WO1995004756A1 - Complement inhibitor proteins of non-human primates - Google Patents

Abstract

Non-human primate complement inhibitor proteins and cDNA sequences encoding the proteins are disclosed. The proteins are characterized by a cysteine backbone structure defined by the formula: Cys-X2-Cys-X6-9-Cys-X5-Cys-X6-Cys-X12-Cys-X5-Cys-X17-Cys-X0-Cys-X4-Cys, wherein Xn indicates a peptide of length n. The proteins and cDNA sequences are useful for protecting cells from damage by primate complement as depicted in the figure.

Description

COMPLEMENT INHIBITOR PROTEINS OF NON-HUMAN PRIMATES

FIELD OF THE INVENTION

The present invention relates to complement inhibitor proteins (CIPs) of non-human primates that have substantial human complement regulatory activity. BACKGROUND OF THE INVENTION I. The Complement System

The complement system is a complex interaction of plasma proteins and membrane cofactors that act in a multistep, multiprotein cascade sequence in conjunction with other immunological systems of the body to defend against intrusion of foreign cells and viruses. Complement proteins represent up to about 10% of the globulins in the serum of humans and other vertebrates. The complement system works through a number of different mechanisms to carry out its defensive functions. One important aspect of complement function is the lysis of target cells by direct action of a set of complement proteins known as the "terminal complement components", which, when assembled, form the membrane attack complex, or "MAC". See Esser, 1991; and Bhakdi, et al. , 1991. The actions of the MAC are hereinafter referred to as "complement attack".

There are two main routes by which complement attack is initiated -- the classical pathway and the alternative pathway -- as well as other, less prevalent means of turning on complement attack. The two main routes share many components. While they differ in their early steps, all known pathways involved in initiating complement attack converge and share the same terminal complement components.

The classical complement pathway is typically initiated by antibody recognition of and binding to an antigenic site on a target cell. The alternative pathway is usually antibody independent. Both pathways converge at the point where complement component C3 is cleaved by an active protease (which is different in each pathway) to yield C3a and C3b. Other factors can initiate either pathway later in the sequence of events and induce various aspects of complement function, including the formation of the MAC.

C3a is an anaphylotoxin that can induce degranulation of mast cells, resulting in the release of histamine and other mediators of inflammation. C3b binds to bacterial and other cells and tags them for removal from the circulation. C3b in this role is known as an opsonin. C3b can also form a complex with other components unique to each pathway to form classical or alternative C5 convertase, which cleaves C5 into C5a and C5b. Amongst the other means by which complement attack can be initiated, proteolytic enzymes with relatively broad target protein specificities, including plasmin, elastase, and cathepsin G, can cleave C5 so as to mimic the action of C5 convertase and produce active C5b. This route of complement attack initiation is not susceptible to the actions of complement inhibitors which act earlier in the chain of complement attack activation, e.g. inhibitors of C3 convertase.

C5a is another anaphylotoxin. C5b combines with C6, C7, and C8 to form the C5b-8 complex at the surface of the target cell. Upon binding of C9, the MAC (C5b-9 complex) is formed.

Complement damages target cells by compromising the integrity of the cell membrane. When sufficient numbers of MACs insert into the cell membrane, the openings they create result in rapid lysis of the cell. Lower, non-lytic concentrations of MACs can produce other effects. Membrane insertion of small numbers of C5b-9 complexes into endothelial cells and platelets can stimulate specific physiologic responses. As a result of complement attack, whether by low or high concentrations of MACs, cells leak (release) molecules that are normally sequestered by the cell membrane in undamaged cells. Control of the complement system is necessary in order to prevent destruction of autologous cells. Since at least 1900 it has been known that complement mediated cytolysis is not efficient when the complement and the target cells are from the same species (Bordet, 1900.). Over the years, studies of the susceptibility of cells to complement mediated lysis have confirmed that cells are readily lysed by complement from various heterologous sources, while they are generally resistant to lysis by complement derived from the same species. See Shin, et al., 1986; Houle, et al. , 1984, Lachmann, et al., 1973; and Hansch, et al., 1981. This phenomenon is referred to in the art as "homologous species restriction of complement mediated lysis". The mechanism by which this restriction takes place has been at least in part revealed by a series of experiments in which complement inhibitor proteins have been identified that serve to protect cells from homologous complement mediated damage. See Zalman, et al., 1986; Schonermark, et al., 1986; Nose, et al., 1990; and Sugita, et al., 1988. II. Complement Associated Pathologies And Complement Inhibitor Proteins

Complement action has been implicated in the etiology and/or clinical progression of a variety of diseases based on human studies and studies employing animal models of human diseases. In certain cases, pathogenic complement action is initiated by the classical pathway. In other disorders, such initiation occurs via the alternative pathway. In some cases, both pathways and/or other means of initiation of complement action may contribute to the development of complement mediated pathology. As a result of the involvement of complement in these pathologies, extensive, on-going efforts are being made to develop effective complement inhibitor proteins as therapeutic agents.

Briefly, some of the clinical areas in which the complement system has been found to play a role are as follows:

Transplantation: Intrinsic activation of complement attack via the alternative pathway during storage of donor organs is responsible for various problems associated with organ transplantation in that endothelial cells can be stimulated and/or lysed by the C5b-9 membrane attack complex (Brasile, et al. 1985) . Storage associated ex vivo complement attack leads to reduced vascular viability and reduced vascular integrity in subsequently transplanted organs, decreasing the likelihood of a successful transplant outcome. Ten percent of allogeneic solid donor organs in HLA-identical matches are rejected by in vivo complement mediated mechanisms effecting a phenomenon referred to as hyperacute rejection (Brasile, et al. 1987) . In 78% of the cases of rejection under these conditions, activation of complement attack is mediated by antibodies directed against molecules on the surfaces of vascular endothelial cells (Brasile, et al., 1985).

In the xenogeneic setting, as when non-human organs are transplanted into human patients, activation of complement attack by antibodies directed against molecules on the surfaces of endothelial cells lining the vessels of the donor organ accounts for the nearly universal occurrence of hyperacute rejection (Dalmasso, et al., 1992). Recently, a report on a relatively successful baboon-to-human liver transplant has been published (Starzl, et al., 1993). In this particular case, the xenogeneic donor organ failed to exhibit signs of hyperacute rejection. The low levels of anti-baboon antibodies likely to be present in human blood make hyperacute responses unlikely. However, in accordance with the present invention, it is believed that complement inhibitors present in the baboon tissues also played a role in maintaining the integrity of the organ. Unfortunately, ethical questions, availability, and other problems render baboons (and other primates) less than ideal as sources of organs for routine use in xenotransplantation.

As recognized in the art, animal models are useful in the development of technologies allowing safe and effective xenotransplantation of organs into human patients. Accordingly, complement inhibitor proteins effective against the complement of non-human animals will be of substantial utility in developing such models. These proteins will have even greater utility if they have a relatively broad spectrum of cross-species activity and therefore provide effective complement inhibition both in the animal model and in xenotransplantation into human patients.

Platelet Storage Lesion And Platelet-Associated Disease: Stimulation and lysis of platelets can result from MAC assembly on the platelet surface (Sims, et al., 1989; and Morgan, 1992) . Such assembly during storage of partially purified platelets, either in the form of platelet-rich plasma or after washing, may be mediated by alternative pathway mechanisms. Complement has thus been suggested as a cause contributing to the development of the platelet storage lesion, which can reduce the clinical efficacy of platelets administered after storage (Zimmerman, et al., 1976). In the body, the destruction of platelets by complement attack, via the classical pathway initiated by autoimmune anti-platelet antibodies, can result in thrombocytopenia, which is frequently refractory to current forms of therapy. A role for complement inhibitor proteins in preserving platelets is suggested by studies in which antibodies blocking the activity of the complement inhibitor protein CD59 were shown to potentiate platelet stimulation and to accelerate platelet lysis. See Sims, et al., 1989; and Morgan, 1992.

Autoimmune Disorders: Antibody stimulated complement mediated inflammation plays important roles in classical autoimmune disorders such as Goodpasture's syndrome and systemic lupus erythematosus. Immune complexes formed as a consequence of these illnesses often cause glomerulonephritis, a pathological condition which can destroy the kidneys and necessitate dialysis or kidney transplantation.

Other pathologic conditions that may involve the complement arm of the immune system, and thus may be broadly considered as autoimmune in nature, are discussed below.

Central Nervous System Disorders: Recent reports have demonstrated that activated components of the complement system are markedly increased in patients with a variety of central nervous system disorders.

Substantial increases in the concentration of C5b-9 membrane attack complexes were found in the cerebrospinal fluid of patients with Guillain-Barre syndrome and multiple sclerosis, and in patients with central nervous system involvement of primary Sjogren's syndrome and systemic lupus erythematosus (Sanders, et al., 1986; and Sanders, et al., 1987).

In other studies, activated components of the classical pathway and C5b-9 membrane attack complexes were observed only rarely in immunohistochemical studies of tissue from disease free individuals, but at substantially increased levels in brain tissue from patients with Alzheimer's dementia, Pick's disease, Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis, progressive supranuclear palsy, and Shy-Drager syndrome (McGeer, et al., 1989; Eikelenboom, et al., 1989; and Yamada, et al. , 1990). Activation of complement attack is also implicated as a factor contributing to the morbidity and mortality associated with cerebrovascular accidents.

These findings suggest that complement may play a significant role in the generation of central nervous system disease, and imply that complement components may contribute to the degeneration of brain tissue, and the subsequent morbidity and mortality, associated with some central nervous system disorders.

Infections. Burns, and Lung Damage: Activation of complement attack of host tissues has been observed in animal models following bacterial infection (Bergh, et al., 1991). Activation of complement attack has also been reported in animals after burns and following endotoxin administration, in which cases depletion of complement reduces the severity of the observed pathology (Rabinovici, et al., 1992; and Hill, et al., 1992) .

Activation of complement attack is also apparent in human patients with adult (acute) respiratory distress syndrome (ARDS; Hammerschmidt, et al., 1980; Zilow, et al., 1990; and Zilow, et al., 1992). Further evidence for complement involvement in some types of lung pathology comes from studies in which depletion of complement was reported to have beneficial effects in animal models of lung injury (Gelfand, et al., 1982; Till, et al., 1986; Mulligan, et al. 1992; and Rabinovici, et al., 1992).

Ischemia: Complement deposition, including deposition of MACs, has been demonstrated in human myocardium and animal myocardium after myocardial infarction and ischemia/reperfusion (Pinckard, et al. 1980; Rossen, et al. , 1985; Schafer, et al. , 1986; and Weisman, et al., 1990). Further, systemic complement activation occurs after myocardial infarction in humans due to an antibody independent mechanism (Pinckard, et al., 1975). Additional evidence supporting a role for complement in post-ischemic pathology comes from experiments in which it has been shown that depletion of complement reduces the extent of myocardial infarction in animal models during ischemia/reperfusion and following coronary occlusion without reperfusion (Maroko, et al., 1978; Crawford, et al., 1988; and Weisman, et al., 1990).

Activation of complement attack has been reported to occur in animals following intestinal ischemia/reperfusion; moreover, depletion of complement reduces the disease severity in this model system (Gelfand, et al., 1982). Activation of complement attack likely contributes to the morbidity and mortality associated with other ischemia/reperfusion conditions, including pulmonary embolism, cerebrovascular accidents, and unstable angina.

Paroxysmal Nocturnal Hemoglobinuria: A complement mediated disease that may involve both the classical and alternative pathways of initiation of complement attack, and which exemplifies the biological importance of complement inhibitor proteins in regulating autologous or homologous complement activity, is the hematologic disorder known as paroxysmal nocturnal hemoglobinuria (PNH) .

One phenotypic characteristic of individuals suffering from PNH is erythrocyte susceptibility to autologous complement mediated cell lysis, resulting in episodes of hemolytic anemia. Complement inhibitor proteins are absent from the membranes of the most hemolytically sensitive erythrocytes found in patients with this disease. In most cases, the PNH phenotype is due to a metabolic defect blocking the synthesis of the glycosyl-phosphatidylinositol (GPI) anchor that is normally attached to certain newly synthesized polypeptides, including several complement inhibitor proteins (e.g., CD59 and CD55) , and serves to bind such proteins to the cell membrane. The resulting lack of these complement inhibitor proteins is known to allow the complement mediated hemolysis that characterizes PNH (see Venneker, et al., 1992).

The red blood cells of PNH patients have been categorized based on differential susceptibility to complement mediated lysis. Type I erythrocytes are essentially normal. Type II erythrocytes exhibit moderately increased sensitivity to homologous complement mediated erythrocyte lysis (Holguin et al. , 1989a) . Type III erythrocytes are associated with severe complement mediated hemolytic anemia (Medof et al., 1987) .

It has been shown in vitro that homologous complement mediated lysis of type III erythrocytes can be blocked by adsorption into the erythrocyte plasma membrane of purified CD59, a complement inhibitor protein that is often found to be present at reduced levels in the erythrocytes of PNH sufferers (Holguin et al. 1989b; and Okada et al., 1990). As discussed in more detail below, CD59 acts to block at least one of the final steps of MAC assembly and is thus classified as a terminal complement inhibitor.

A single, atypical, clinical case of PNH has been described where PNH symptoms did not result from the metabolic defect described above, but were apparently due to the complete absence from the cell surface of CD59 alone. Normal levels were observed of the GPI anchored complement inhibitor protein CD55, also known as decay accelerating factor (or DAF) , which is not a terminal complement inhibitor but acts on C3 convertase (Yamashina, et al., 1990). Conversely, an aberrant blood cell trait known as the Inab phenotype represents an inherited CD55 deficiency in the presence of normal levels of CD59. Individuals with the Inab phenotype display no clinical symptoms of hemolytic anemia (Telen, et al., 1989; and Merry, et al. 1989), and isolated erythrocytes with the Inab phenotype resist homologous complement mediated lysis in vitro (Holguin et al. 1992) . The red blood cells of the atypical PNH patient, on the other hand, were vulnerable to homologous complement attack.

The PNH and Inab clinical disorders illustrate the important role of terminal complement inhibitors, particularly CD59, in preventing homologous complement mediated cell lysis and thus maintaining cellular integrity in vivo. III. CD59

As described above, CD59 is a complement inhibitor molecule involved in protecting cells from autologous complement mediated lysis. Biochemically, CD59 is a glycoprotein and is found associated with the membranes of various human cells including erythrocytes, lymphocytes, and vascular endothelial cells. It has an apparent molecular mass of 18-21 kilodaltons (kD) and is tethered to the outside of the cell by a glycophospholipid moiety that anchors it in the cell membrane. See, for example, Sims, et al. , U.S. Patent No. 5,135,916.

CD59 appears to function by competing with C9 for binding to C8 in the C5b-8 complex, thereby decreasing the formation of the C5b-9 complex (Rollins, et al. , 1990) . CD59 thus acts to reduce both cell stimulation and cell lysis by MACs (Rollins, et al., 1990; Rollins, et al., 1991; Stefanova, et al., 1989; Sugita, et al., 1988; Davies, et al., 1989; Holguin, et al., 1989a; Okada, et al., 1989a; Meri, et al., 1990; Whitlow, et al., 1990; and Harada, et al., 1990). This activity of CD59 is for the most part species-selective, most efficiently blocking the formation of MACs only under conditions where C8 and C9 are derived from homologous (i.e., human) serum (Venneker, et al., 1992). This species restriction accounts for the different actions of CD59 in restricting cell lysis by homologous complement but not restricting cell lysis by complement from most heterologous sources and may, at least in part, account for the phenomenon of homologous species restriction of complement mediated lysis.

The assimilation of purified CD59 into the plasma membrane of non-human erythrocytes (which appear to be protected from homologous complement lysis by the action of their own cell surface complement inhibitor proteins) and oligodendrocytes (which are not protected from homologous lysis by cell surface proteins, but are protected in vivo by the blood brain barrier) has shown that CD59 can protect these cells from lysis mediated by human complement. (Rollins, et al., 1990; Rollins, et al., 1991; Stefanova, et al., 1989; Meri, et al., 1990; Whitlow, et al., 1990; Okada, et al., 1989b; and Wing, et al. , 1992) . cDNAs encoding CD59 have been cloned and the structure of the CD59 gene has been characterized (Davies, et al., 1989; Okada, et al., 1989b; Philbrick, et al., 1990; Sawada, et al., 1989; and Tone, et al., 1992) . Transfected non-human mammalian cells expressing the cloned CD59 cDNA, and thereby producing the CD59 protein, have been shown to gain resistance to complement mediated cell lysis (Zhao, et al., 1991; and Walsh, et al. , 1991) .

CD59 has been reported to be structurally related to the murine Ly-6 antigens (Philbrick, et al., 1990; and Petranka, et al., 1992). The genes encoding these antigens are members of the Ly-6 multigene family, and include Ly-6A.2, Ly-6B.2, Ly-6C.l, Ly6C2, and Ly-6E.l. The gene encoding the murine thymocyte B Cell antigen ThB is also a member of this family (Shevach, et al. 1989; and Gumley, et al., 1992).

A distinguishing feature of the amino acid sequences of the proteins of the Ly-6 family is the arrangement of their cysteine residues. Cysteine residues of many proteins form a structural element referred to in the art as a "cysteine backbone." In those proteins in which they occur, cysteine backbones play essential roles in determining the three dimensional folding, tertiary structure, and ultimate function of the protein molecule.

The proteins of the Ly-6 multigene family and several other proteins share a particular cysteine backbone structure referred to herein as the "Ly-6 motif". For example, the human urokinase plasminogen activator receptor (uPAR; Roldan, et al., 1990) and several squid glycoproteins of unknown function (Sgp2; Williams, et al., 1988) contain the Ly-6 motif.

Subsets of proteins having the Ly-6 motif can be identified by the presence of conserved amino acid residues immediately adjacent to the cysteine residues. Such conservation of specific amino acids within a subset of proteins can be associated with specific aspects of the folding, tertiary structure, and ultimate function of the proteins. These conserved patterns are most readily perceived by aligning the sequences of the proteins so that the cysteine residues are in register.

As discussed fully below, the novel complement inhibitor molecules disclosed herein have a cysteine backbone structure which defines a specific subset of the general Ly-6 motif.

IV. Other Complement Inhibitors

Attempts have been made to find other proteins having terminal complement inhibitor activity of the type exhibited by CD59. Work has been reported in which non-human complement regulatory proteins from rat and sheep, having at least some similarity to CD59, have been identified. Even though some N-terminal amino acid sequence data were obtained by sequencing of these proteins, neither isolation nor characterization of the genes encoding these proteins has been reported. See Hughes, et al., 1992; and Van Den Berg, et al., 1993. While it is possible to align the limited N-terminal sequences reported for these rat and sheep proteins with the N-terminus of CD59, and while the proteins show apparent terminal complement inhibitor activity, it remains unclear to what extent these proteins are in fact structurally related to CD59.

Nucleic acid hybridization studies of CD59 cDNA probes with genomic DNAs of rodents and ruminants, specifically rats, mice, and cows, have been reported not to yield consistently hybridizing bands. See Philbrick, et al., 1990; and Akami, et al., 1993. (See also Example 8 below with regard to lack of hybridization with guinea pig genomic DNA.) The lack of hybridizing bands when rat, mouse, and cow genomic DNAs were probed with CD59 cDNA in these studies makes it seem likely that rodent and ruminant genomes do not contain genes that share substantial nucleic acid sequence similarity to CD59. Southern blots of genomic DNAs of a number of species, namely, human, African Green Monkey, Rhesus Monkey, rat, mouse, dog, cow, rabbit, chicken, and yeast, have been probed with DNA fragments comprising CD59 gene sequences (Philbrick, et al., 1990; and Akami, et al., 1993). Only human, African Green Monkey, and Rhesus Monkey genomic DNAs were reported to yield consistently hybridizing bands in these studies. Philbrick, et al. also reported that Northern blot analysis of African Green Monkey COS cell RNA showed bands suggesting hybridization of monkey RNAs to the CD59 probe.

None of these experiments further characterized the nature of the nucleic acid molecules that hybridized to 5 the CD59 probes or the function of any proteins that might be encoded by these nucleic acid molecules. With regard to the present invention, the experiments did not show that African Green monkeys and Rhesus monkeys produce nucleic acid molecules which code for proteins 0 having terminal complement inhibitor activity.

As known in the art, detection of a hybridizing band in a Northern or Southern blot does not establish the existence of a nucleic acid sequence encoding a protein related to a protein encoded by the probe

15 sequence. Hybridization stringency in experiments using probes from heterologous organisms is usually lowered to allow detection of non-identical sequences. Consequently, spurious hybridization signals can more readily occur as a result of fortuitous sequence

20. similarity to the nucleic acid sequence of the probe.

Adding to the questions raised by the uncertainties inherent in the interpretation of the results of these hybridization studies, Philbrick et al. acknowledge that the anti-CD59 monoclonal antibody MEM- 3 only bound to

25 African Green Monkey COS cells genetically engineered to express human CD59 cDNA in the sense orientation. (Philbrick, et al., 1990 at page 89.) See also Example 5 below, where it is demonstrated that monoclonal antibodies to CD59 do not cross react with proteins on COS cells. This lack of reactivity casts further doubts as to whether or not the bands seen in the nucleic acid hybridization studies were due to the presence of sequences encoding complement inhibitor proteins.

In addition to the work involving eukaryotic systems, a gene having a sequence resembling that of CD59 has been discovered in the herpesvirus saimiri genome. See commonly assigned, copending PCT application Serial No. PCT/US 93/00672, filed January 12, 1993, the relevant portions of which are incorporated herein by reference, and Albrecht, et al., 1992. The protein produced by this gene is referred to herein as HVS-15.

In addition to the terminal complement inhibitor, CD59, several inhibitors of C3 and/or C5 convertase activities are known, including CD46, CD55, CR1, CR2, and C4bp (see Farries, et al., 1991; and Lachmann, 1991) . As opposed to CD59, these other inhibitors work upstream of the membrane attack complex and do not interrupt all complement activation pathways. They thus do not have the general inhibitory activity of a terminal complement inhibitor as is desirable for a therapeutic agent. SUMMARY OF THE INVENTION

In view of the foregoing, it is an object of this invention to provide novel proteins that can be used in controlling the complement system of humans and other animals. It is a further object of the invention to provide DNA sequences and associated genetic engineering constructs for producing such proteins either in vitro or in vivo.

To achieve the foregoing and other objects, the present invention, in accordance with certain of its aspects, provides cDNA sequences encoding non-human primate complement inhibitor proteins that are functionally and structurally related to the human CD59 protein. The invention also provides the protein products encoded by those sequences, including the mature protein products produced by post-translational modifications occurring in eukaryotic cells (see below) . As such, the invention establishes for the first time the shared features of nucleic acid and amino acid sequences of complement inhibitors that are capable of blocking the formation (and hence the lytic activity) of the human MAC, and, more specifically, of complement inhibitors from non-human primates. In particular, the invention provides a number of amino acid sequence homologies that define the molecules of the invention. Specifically, alignment of the amino acid sequences disclosed herein for non-human primate CIPs (SEQ.l through SEQ.5) with the sequences of several proteins containing the Ly-6 motif has demonstrated that these non-human primate molecules define a subset of proteins containing the Ly-6 motif. Members of the subset are distinctly characterized by the spacing between the cysteine residues making up the motif and by the presence of specific amino acids immediately adjacent to certain of these cysteine residues.

Specifically, the non-human primate molecules of the invention include or encode polypeptides comprising a cysteine backbone with a Ly-6 motif characterized by the formula:

Cys-X„-Cys-X_g_ _Q-Cys-X_ς-Cys-X,-Cys-X.--

Cys-X₅-Cys-X₁₇-Cys-X_Q-Cys-X₄-Cys.

Analysis of the amino acid residues immediately adjacent to the cysteines of the above formula demonstrated that the non-human primate molecules disclosed herein include or encode amino acid sequences conforming to the following formula:

Cys-X₂-Cys-Pro-X₅__Q-Cys-X₄-Asn- Cys-X₅-(Thr or Ser) -Cys-X - (Gin or Arg) -

Cys-X₄-(Asn or Asp) -Cys-X₁₇-Cys-X₀-Cys-X₄-Cys. In both formulas, the X in X indicates a peptide containing any combination of amino acids, the n in X represents the length in amino acid residues of the peptide, and each X at any position can be the same as or different from any other X of the same length in any other position.

As shown in Example 6 below, the non-human primate CIPs of SEQ.l and SEQ.2 are attached to cell membranes by means of a glycosyl-phosphatidylinositol (GPI) linkage. As understood in the art, the addition of such a GPI moiety to a nascent protein coincides with a proteolytic processing step that removes a number of amino acid residues from the C-terminus of the polypeptide. In accordance with the invention, it is believed that all non-human primate CIPs may be processed in this manner.

Accordingly, the mature non-human primate CIPs of the invention may not include all of the amino acids encoded by the full length nucleic acid molecules of the invention. Specifically, they may not include some or all of the amino acid residues downstream of the cysteine backbone, e.g., the amino acids downstream of cysteine 69 of SEQ.l, SEQ.2, SEQ.4, and SEQ.5, and downstream of cysteine 72 of SEQ.3. In addition to the foregoing, the non-human primate molecules of the invention preferably comprise sequences that include or encode one or more of the amino acid sequences defined by the following formulas:

Leu-Gin-Cys-Tyr- (Asn or Ser) -Cys-Pro-; or

-Asn-Cys- (Ser or Thr) -Ser- (Asn or Gly) - (Leu or Phe) -Asp- (Ser or Thr) -Cys-Leu- Ile-Ala- (Arg or Lys) -Ala-Gly-; or

-Leu- (Glu or Lys) -Asn-Gly-Gly-Thr- (Ser or Thr) - Leu-Ser- (Glu or Lys) -Lys-Thr- (lie or Val)- (Leu or Val) -Leu-Leu-Val- (Thr or lie) - (Leu or Pro) - (Leu or Phe) -Leu- (Ala or Val) -Ala-Ala-Trp- (Cys or Ser) - (Arg or Leu) -His-Pro.

The amino acid sequence defined by the last of these three formulas (hereinafter the "third formula") lies at the C-terminus of the polypeptide. As discussed above, post-translational processing to attach a GPI linkage coincides with proteolytic removal of a portion of the C-terminus of the polypeptide encoded by the full length nucleic acid molecule. Accordingly, all or a portion of the sequence defined by the third formula may not appear in the mature molecule. However, the mature molecule will still be defined by this formula in the sense that the mature molecule is a derivative of a polypeptide containing the sequence of the formula.

The removal of all or part of the C-terminus in connection with attachment of a GPI linkage to a polypeptide can produce a molecule having functional activity. Accordingly, in accordance with the invention, functional non-human primate CIPs can be produced directly by expression of a nucleic acid molecule which comprises one of the full length nucleic acid molecules of the invention mutated so that the mutated nucleic acid molecule directs the synthesis of a protein which lacks at least a portion of the carboxy-terminal peptide sequence encoded by the full length nucleic acid molecule. (As used herein, the term "mutated" includes any and all alterations of the sequence of a nucleic acid molecule, including, without limitation, truncation or deletion of a portion of the molecule.)

In addition to the foregoing, in accordance with the invention, a further commonality of the non-human primate CIPs of the invention has been discovered within the amino acid sequences upstream of the mature, functional proteins. This commonality appears in the leader sequence of the nascent protein which becomes the mature protein and can be described by the following formula:

Met-Gly-Ile-Gln-Gly-Gly-Ser-Val-Leu-Phe- Gly-Leu-Leu-Leu- (Ala or lie or Val) -Leu- Ala-Val-Phe-Cys-His-Ser-Gly- (Asn or His) -Ser.

Since this commonality does not appear in the mature functional molecule, nucleic acids comprising the sequence encoding the mature CIP, without the naturally associated leader sequence, are sufficient to generate the complement inhibitor proteins of the invention. In particular, the desired CIP can be produced by growing a recombinant host containing a nucleic acid molecule encoding the mature protein, where the nucleic acid molecule has been obtained by mutating a nucleic acid molecule encoding the full length precursor polypeptide so that the protein is synthesized without the amino-terminal leader peptide.

In accordance with others of its aspects, the invention provides nucleic acid probes and/or primers (derived from the 5' and 3' UTRs of CD59 and BabCIP) having the following sequences:

5' GGAAGAGGATCCTGGGCGCCGCAGG 3' , 5' CCCAACAGGATCCATTTGGAAAATATCAAGCC 3' , 5' GAAGGGATCCCGGGCGCCGCCAGGTTCTGTGGACAATCAC 3' , 5' GGGAGAAGCTCTCCTGGTGTTGAC 3', or having sequences complementary to these sequences. These probes and/or primers provide means for isolating and purifying nucleic acid sequences encoding the non-human primate CIPs of the invention. As discussed below in connection with the preferred embodiments of the invention, the nucleic acid molecules and proteins of the invention can be used in variety of applications. In particular, these nucleic acid molecules and proteins may be used as components of therapeutic agents for the prevention and/or treatment of complement mediated pathologies.

The claims of this application describe the nucleic acid molecules of the invention as being "substantially free" of nucleic acid molecules not containing the sequences of the invention. This expression is intended to mean that the nucleic acid molecules of the invention have only minor levels of contaminating nucleic acid molecules, e.g., the levels of contamination which typically exist after a cloning and vector isolation procedure which are generally on the order of less than about 5% by weight.

The accompanying drawings, which are incorporated in and constitute part of the specification, illustrate certain aspects of the preferred embodiments of the invention and, together with the description, serve to explain certain principles of the invention. It is to be understood, of course, that both the drawings and the description are explanatory only and are not restrictive of the invention. BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows aligned amino acid sequences of Baboon, African Green Monkey, Squirrel Monkey, Owl Monkey, and Marmoset CIPs (referred to hereinafter as BabCIP, AgmCIP, SqmCIP, OwmCIP, and MarCIP, respectively) . The conserved sequences among these proteins discussed above are boxed.

Figure 2 shows aligned amino acid sequences of

CD59, BabCIP, AgmCIP, SqmCIP, OwmCIP, MarCIP, HVS-15,

ThB, Ly6C.l, uPAR, and Sgp2. The cysteine residues making up the Ly-6 motif (cysteine backbone) of each protein are underlined.

Figure 3 shows FACS analysis of Balb/3T3 transfectants, namely, Neo in Figures 3A and 3B, CD59 in Figures 3C and 3D, BabCIP in Figures 3E and 3F, and AgmCIP in Figures 3G and 3H. Two independent clones for each of the transfected experimental DNAs are shown.

FACS analyses were performed using the mAb MEM-43

(Figures 3B, 3D, 3F, and 3H) and anti-CD59 polyclonal serum (Figures 3A, 3C, 3E, and 3G) as primary antibodies, and commercial fluorescent secondary (2°) antibodies. Control curves obtained with cells incubated in the presence of the (2°) antibody alone are indicated in each panel. The letter-number designations represent independent clones (e.g., CD59 Al, CD59 A3, BabCIP Al, BabCIP A5, etc.). Mean log fluorescence intensity is indicated on the abscissa and the relative cell number is indicated on the ordinate. Data are from a single experiment, representative of n>3.

Figure 4 shows the removal of cell surface CD59 by phosphatidylinositol-phospholipase C. The figure shows FACS analysis of Balb/3T3 transfectants, namely, Neo in Figure 4A, CD59 in Figure 4B, BabCIP in Figure 4C, and AgmCIP in Figure 4D. PI-PLC digestion and mock digests were performed on a single clone for each CIP. Indirect immunofluorescence labelling was then performed using the anti-CD59 polyclonal anti-serum as primary antibody and commercial fluorescent secondary (2°) antibodies, and labelled cells were analyzed by FACS. Control curves obtained with cells incubated in the presence of the 2° antibody alone are indicated in each panel. The

(+) and (-) indicate curves obtained with PI-PLC and mock treated cells, respectively. Mean log fluorescence intensity is indicated on the abscissa and the relative cell number is indicated on the ordinate. Data are from a single experiment, representative of two so performed. - 30/1 -

Figure 5 shows the protection of transfected

Balb/3T3 cells from human, rabbit and rat serum complement. Balb/3T3 cells expressing non-human primate CIPs were assayed for their ability to resist serum complement mediated lysis. The assays were

^■ 31 -

performed with whole serum from human, rat, and rabbit, (upper row of graphs) , as well as with human C8 depleted serum supplemented with EDTA treated sera as indicated (lower row of graphs) . The Balb/3T3 transfectants included in the dye release assays are indicate in each panel: CD59-A3 (Hu A3, solid circles), BabCIP-Al(Bab Al, solid triangles) , AgmCIP-Bl (Mk Bl, solid squares) , Neo control (Neo, open circles) . The percent concentration of serum used is indicated on the abscissa and the percent of dye release is indicated on the ordinate. Each panel represents a single experiment, representative of n>3 so performed. Human C8 depleted serum was obtained from Quidel Corporation, San Diego, CA. Figure 6 shows dye release assay results demonstrating the protection of transfected Balb/3T3 cells expressing SqmCIP from 20% human C8 depleted serum supplemented with the indicated amounts of a mixture of equal parts of purified human C8 and C9. The Balb/3T3 transfectants included in the dye release assays are indicated as follows: SqmCIP (solid triangles), CD59 (solid squares) , and Neo control (solid circles) . The amounts, in micrograms per milliliter final concentration, of the mixture of human C8 and C9 added are indicated on the abscissa and the percent of dye ^■ 32 -

release is indicated on the ordinate. Human C8 depleted serum, as well as purified C8 and C9, were obtained from Quidel Corporation, San Diego, CA.

Figure 7 shows a comparison of the human complement regulatory activity of CD59 compared to the activities of BabCIP, AgmCIP, and SqmCIP. The data for this figure were derived from Figures 5 and 6, and represent data for 10% human serum (BabCIP and AgmCIP) or 20% human C8 depleted serum plus lOμg/ml of a mixture of equal parts of human C8 and C9 (Quidel Corporation, San Diego, California) . The control data for CD59 were essentially the same using either source of human complement activity, but the bar represents data obtained using 10% human serum as shown in Figure 5. DESCRIPTION OF THE PREFERRED EMBODIMENTS

Probes/Primers: By discovering and isolating nucleic acid molecules comprising sequences encoding Baboon, African Green Monkey, Squirrel Monkey, Owl Monkey, and Marmoset CIPs, and by analyzing the sequences of these nucleic acid molecules and the amino acid sequences they encode, certain sequence homologies that define the molecules of the invention and are disclosed in Example 4, below, have been determined. The presence of any of these discovered sequence homologies defines the non-human primate CIPs of the - 33 -

invention, and allows the identification and isolation of nucleic acids encoding such non-human primate CIPs by, for example, probe/primer methods known in the art. The probes/primers used in such procedures preferably include contiguous sequences from any of the nucleic acid sequences of SEQ.l through SEQ.5. Preferably, the contiguous nucleic acid sequences correspond to a conserved amino acid domain of the protein sequences of SEQ.l through SEQ.5. These conserved amino acid domains are shown boxed in Figure 1.

When used in a PCR procedure (see below) , the sequences should include at least 16 bases (Sambrook et al., 1989). Longer probes or primers having, for example, 21, 24, 25, 32, 39, 45, or 87 bases, which correspond to the lengths of the probes/primers disclosed above and of nucleic acid sequences encoding the conserved amino acid sequences of Figure 1, can be used in the practice of the invention if desired. In some cases, primers having less than 16 bases may be effective.

The probes and primers of the invention, and variants of these probes/primers with equivalent hybridization/priming properties, make possible the isolation and purification of the cDNAs and/or genes ^■ 34 -

encoding non-human primate CIPs by means of various methods known in the art. Such methods include PCR. amplification of cDNA or genomic DNA preparations obtained from non-human primates, and hybridization screening of libraries of recombinant bacteriophages, plasmids, cosmids, or the like, containing non-human primate nucleic acid sequences.

Expression Vectors/Host Organisms: The present invention provides recombinant expression vectors which include synthetic, genomic, and/or cDNA-derived DNA fragments encoding CIPs from non-human primates. Nucleic acid molecules comprising the sequence coding for any non-human primate CIP can be inserted into an appropriate expression vector, i.e., a vector that contains the necessary elements for the transcription and translation of the inserted protein-encoding sequence, and then used to produce the CIP. The necessary transcriptional and translational signals can also be supplied by the native genes and/or their flanking regions.

A variety of host vector systems may be utilized to express the protein-coding sequence. These include, but are not limited to, mammalian cell systems infected with a virus such as vaccinia virus, adenovirus, a retrovirus, etc.; mammalian cell systems transfected - 35 -

with plasmids; insect cell systems infected with a virus such as baculovirus; microorganisms such as yeast containing yeast expression vectors, or bacteria transformed with bacteriophage DNA, plasmid DNA, cosmid DNA, or the like.

Useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids including those comprising genetic elements of the well-known cloning vector pBR322 (American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland 20852, United States of America; ATCC Accession No. 37017). These pBR322 "backbone sections," or functionally equivalent sequences, are combined with an appropriate promoter and the structural gene to be expressed.

Preferred bacterial expression vectors include, but are not limited to, vector pSE420 (Invitrogen Corporation, San Diego, California) . This vector harbors the trc promoter, the lacO operon, an anti-terminator sequence, . the glO ribosome binding sequence, a translation terminator sequence, the laclq repressor, the ColEl origin of replication, and the ampicillin resistance gene. ^■ 36 -

Promoters commonly used in recombinant microbial expression vectors include, but are not limited to, the lactose promoter system (Chang, et al., 1978), the tryptophan (trp) promoter (Goeddel, et al., 1980) and the tac promoter, or a fusion between the tac and trp promoters referred to as the trc promoter (Maniatis, et al., 1982) .

Recombinant non-human primate CIPs may also be expressed in fungal hosts, preferably yeast of the genus Saccharomyces such as S. cerevisiae. Fungi of other genera such as Aspergillus. Pichia or Kluyveromyces may also be employed. Fungal vectors will generally contain an origin of replication from the 2 μm yeast plasmid or another autonomously replicating sequence (ARS) , a promoter, DNA encoding the non-human primate CIP, sequences directing polyadenylation and transcription termination, and a selectable marker gene. Preferably, fungal vectors will include an origin of replication and selectable markers permitting transformation of both E_-_ coli and fungi.

Suitable promoter systems in fungi include the promoters for metallothionein, 3-phosphoglycerate kinase, or other glycolytic enzymes such as enolase, hexokinase, pyruvate kinase, and glucokinase, as well as the glucose-repressible alcohol dehydrogenase promoter 37 -

(ADH2) , the constitutive promoter from the alcohol dehydrogenase gene, ADHI, and others. See, for example,. Schena, et al. 1991. Secretion signals, such as those directing the secretion of yeast alpha-factor or yeast invertase, can be incorporated into the fungal vector to promote secretion of the non-human primate CIP into the fungal growth medium. See Moir, et al., 1991.

Preferred fungal expression vectors can be constructed using DNA sequences from pBR322 for selection and replication in bacteria, and fungal DNA sequences, including the ADHI promoter and the alcohol dehydrogenase ADHI termination sequence, as found in vector pAAH5 (Ammerer, 1983) .

Various mammalian or insect cell culture systems can be employed to express recombinant non-human primate CIPs. Suitable baculovirus systems for production of heterologous proteins in insect cells are reviewed by Luckow, et al., 1988. Examples of suitable mammalian host cell lines include the COS cell of monkey kidney origin, mouse C127 mammary epithelial cells, mouse

Balb/3T3 cells, mouse M0P8 cells, Chinese hamster ovary cells (CHO) , HeLa, myeloma, and baby hamster kidney

(BHK) cells. Mammalian expression vectors may comprise non-transcribed elements such as an origin of replication, a suitable promoter and an enhancer linked • 38 -

to the non-human primate sequence to be expressed, and other 5' or 3' flanking sequences such as ribosome binding sites, polyadenylation sequences, splice donor and acceptor sites, and transcriptional termination sequences.

The transcriptional and translational control sequences in mammalian expression vector systems to be used in transforming vertebrate cells may be provided by viral sources. For example, commonly used promoters and enhancers are derived from Polyoma virus, Adenovirus, Simian Virus 40 (SV40) , and human cytomegalovirus (CMV) , including the cytomegalovirus immediate-early gene 1 promoter and enhancer.

A particularly preferred eukaryotic vector for the expression of BabCIP, AgmCIP, OwmCIP, MarCIP or SqmCIP is pcDNAI/Amp (Invitrogen Corporation, San Diego, California) as described below in the examples. The pcDNAI/Amp expression vector contains the human cytomegalovirus immediate-early gene I promoter and enhancer elements, the Simian Virus 40 (SV40) consensus intron donor and acceptor splice sequences, and the SV40 consensus polyadenylation signal. This vector also contains an SV40 origin of replication that allows for episomal amplification in cells (e.g., COS cells, MOP8 cells, etc.) transformed with SV40 large T antigen, and - 39 -

an origin of replication and an ampicillin resistance gene for propagation and selection in bacterial hosts.

Purification: Purified non-human primate CIPs are prepared by culturing suitable host/vector systems to express the recombinant translation products of the DNA compositions of the invention, which are then purified from the culture media, cell extracts, or the like, of the host system, e.g., the bacteria, insect cells, fungal, or mammalian cells. Growth of cells (e.g., fermentation of fungi) that express a non-human primate protein as a secreted product greatly simplifies purification.

In general terms, the purification is performed using a suitable set of concentration and fractionation (e.g., chromatography) steps known in the art. For recombinant non-human primate CIPs requiring correct disulfide bond formation for full biological activity, denaturation of the purified protein followed by chemical-mediated refolding under reducing conditions can be carried out to promote proper disulfide interactions.

Non-human primate CIPs purified from blood or blood products of the non-human primate, or from tissues or bodily fluids of transgenic animals engineered to produce the CIPs of the invention, are also within the ^■ 40 -

scope of the invention, as are non-human primate CIPs that are produced in part or entirely by chemical synthesis.

The purified non-human primate CIPs of the invention, however prepared, will in general be characterized by the presence of some impurities. These impurities may include proteins or other molecules in amounts and of a character which depend on the production and purification processes used. These components will ordinarily be of viral, prokaryotic, eukaryotic, or synthetic origin, and preferably are present in innocuous contaminant quantities, on the order of less than about 1% by weight. Recombinant cell culture is particularly preferred in this regard since it enables the production of non-human primate CIPs free of other proteins that may normally be associated with the protein as it is found in nature.

Administration/Compositions: The non-human primate CIPs of the invention can be used in therapeutic compositions to treat a variety of diseases involving the complement arm of the immune system (see above) . For these applications, purified non-human primate CIP can be administered to a patient, e.g., a human, in a variety of ways. Thus, for example, non-human primate complement inhibitor proteins can be given by bolus - 41 -

injection, continuous infusion, sustained release from implants, or other suitable techniques.

Typically, a therapeutic agent will be administered in the form of a composition comprising purified non-human primate CIP in conjunction with physiologically acceptable carriers or diluents. Such carriers will be nontoxic to recipients at the effective dosages and concentrations employed. Ordinarily, the preparation of such compositions entails combining the non-human primate CIP with buffers, antioxidants such as ascorbic acid, low molecular weight polypeptides, proteins, amino acids, carbohydrates including glucose, glutathione, sucrose or dextrins, chelating agents (such as EDTA), detergents (such as SDS, NP-40, or LDAO), and other stabilizers and excipients. Neutral buffered saline or saline containing dissolved serum albumin are exemplary diluents. Preferably, the product is formulated as a lyophilizate using appropriate excipient solutions (e.g., buffered sucrose) as diluents. The amount and frequency of administration will depend, of course, on such factors as the nature and severity of the illness being treated, the desired response, the condition of the patient, and so forth.

The molecules of the present invention can be used to generate engineered transgenic animals (e.g., mouse, - 42 -

rat, rabbit, pig, cow, goat, sheep, etc.) that have been made to express functional non-human primate CIPs on the surfaces of their cells (e.g., endothelial cells). These transgenic animals are useful as model systems for testing the xenotransplantation of their engineered tissues or organs. The expression of functional non-human primate CIPs on the surfaces of endothelial cells and/or other cell types in the organs of transgenic animals can provide enhanced protection to these animal organs from hyperacute complement mediated rejection following xenotransplantation. Along these same lines, the molecules of the invention can be used to engineer cultured cells (e.g., endothelial cells) of various species which can then be transplanted. The use of non-human primate CIP encoding cDNAs to produce a pharmaceutical product or to engineer cells and/or transgenic animals in some cases can provide greater protection from human complement mediated damage than the use of the human CD59 gene and its products in the same systems. As shown in Example 7 below, this enhanced protection is achieved by AgmCIP expressed in mouse cells in vitro.

The enhanced protection from complement attack conferred by at least some of the non-human primate CIPs of the invention may also prove useful in gene therapy ^■ 43 '

systems, where the expression of the CIP can be directed, for example, to the surface of nascent red blood cells, as a treatment for the prevention of pathologic complement attack in, for example, certain autoimmune hemolytic anemias.

In light of the expanded phylogenetic scope of the protection from complement attack afforded by AgmCIP, which protects cells from both human and rat serum in vitro (in contrast to CD59 or BabCIP, which are inactive against rat serum, see Example 7, below) , protection of engineered cells and organs from complement attack in multiple animal model systems by this molecule is expected. The concomitant activity of the molecule against human complement provides the advantage that the same molecule can be used in model system studies and in human therapy.

Representative Modifications: Although specific embodiments of the invention are described and illustrated herein, it is to be understood that modifications can be made without departing from the invention's spirit and scope.

For example, the primary amino acid structures of the CIPs of the invention may be modified by creating amino acid substitutions or nucleic acid mutations. At least some complement regulatory activity should remain -44 -

after such modifications. Similarly, nucleic acid mutations which do not change the amino acid sequences, e.g., third nucleotide changes in degenerate codons, are included within the scope of the invention. Also included are sequences comprising changes that are found as naturally occurring allelic variants of the non-human primate CIP genes.

Other modifications include forming derivatives of the non-human primate protein to include covalent or aggregated conjugates of the protein or its fragments with other proteins or polypeptides, such as by synthesis of recombinant proteins with N-terminal or C- erminal fusions to the non-human primate protein. For example, the conjugated peptide may be a signal (or leader) polypeptide sequence at the N-terminal region of the protein which co-translationally or post-translationally directs transfer of the protein from its site of synthesis to its site of function-or to a location which facilitates isolation and purification. Other protein fusions can comprise peptides added to facilitate identification and/or affinity purification of the CIP. For example, a fusion protein containing the FLAG octapeptide

(Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) , fused by oligonucleotide-primed PCR to the non-human primate CIP, - 45 -

may be constructed and expressed. The FLAG peptide is highly antigenic and provides a defined epitope for easy identification of the non-human primate protein. Also, the epitope binds reversibly to a commercially available monoclonal antibody enabling ready purification of the expressed non-human primate CIP containing fusion protein. This sequence is also specifically cleaved by bovine mucosal enterokinase at the residue immediately following the Asp-Lys pairing, a property that can be used to readily separate the CIP portion of the fusion protein from the FLAG peptide.

The present invention also includes CIPs with or without associated native patterns of glycosylation. For example, expressing proteins recombinantly in bacteria such as E. coli provides non-glycosylated molecules, while expressing CIPs in fungal, insect, or mammalian cells can provide glycosylated molecules.

Deposits: Plasmids containing regions corresponding to SEQ.l through SEQ.5 have been deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland, 20852, United States of America, in E. coli strain Top 10F' and have been assigned the ATCC designations 69299, 69298, 69343, 69344, and 69345, respectively. These deposits were made under the Budapest Treaty on the International - 46 -

Recognition of the Deposit of Micro-organisms for the Purposes of Patent Procedure (1977) .

Without intending to limit it in any manner, the present invention will be more fully described by the following examples.

Example 1 Cloning and Sequence Analysis of Baboon CIP (BabCIP) The cDNA encoding the baboon CIP was isolated from a lambda ZapII baboon spleen cDNA library (Stratagene Cloning Systems, La Jolla, California) . Approximately g 1.5x10 phage plaques were screened by DNA hybridization to nitrocellulose filter plaque lifts. The plaque lift filters were hybri .di.zed to a 32P-labeled CD59 full c length cDNA probe (Philbrick, et al., 1990; 2x10 cpm/ml of hybridization buffer) in 0.5M sodium phosphate pH6.8 + 7% SDS + 1% BSA + ImM EDTA at 50°C. Washes were performed as follows: once in 2X SSC + 0.1% SDS at room temperature for 15 minutes; twice in 2X SSC + 0.1% SDS at 50°C for 15 minutes each; once in IX SSC at 65°C for 10 minutes; once in 0.2X SSC at 65°C for 10 minutes.

Eight primary putative positive clones were isolated and rescreened. Two phage clones that hybridized to the CD59 cDNA probe upon rescreening, bab2A.l and bab2B.l, were isolated. Each of these clones was replated and reprobed, this process being ^■ 47 -

repeated until pure clones were obtained. The pure phage clones were subjected to phagemid isolation procedures, to produce plasmids containing the hybridizing phage insert sequences and to thus allow the isolation of plasmid DNA inserts.

The plasmid derivatives of the bab2A.l and bab2B.l clones both contained 763 base pair inserts. Sequence analysis showed that these clones contain a 5' untranslated region (UTR) of 133 nucleotides, a coding region of 384 nucleotides, (the "BabCIP encoding fragment"), and a 3'UTR of 242 nucleotides. The coding region corresponds in length to CD59, with an encoded polypeptide of 128 amino acids. Its homology with other CIPs is discussed below in Example 4. The sequence derived from these clones is set forth in SEQ.l.

The BabCIP encoding fragment was subsequently subcloned into plasmid vector pcDNAI/Amp utilizing the BamHI restriction sites located in the BabCIP 5' and 3' UTRs. The resultant plasmid construct was used to generate stable Balb/3T3 cell lines (see Examples 5 and 7 below) . - 48 -

Example 2 Cloning and Sequence Analysis of African Green Monkey CIP (AgmCIP) The cDNA fragment encoding the African Green Monkey CIP was isolated by polymerase chain reaction (PCR) amplification using first strand cDNA prepared from the African Green Monkey COS-l cell line as a template and 2 oligonucleotide primers with the sequences:

5' GGAAGAGGATCCTGGGCGCCGCAGG 3' ("5' UTR oligo") and

5' CCCAACAGGATCCATTTGGAAAATATCAAGCC 3' ("3' UTR oligo") .

Cytoplasmic RNA was prepared from approximately g 5x10 COS-l cells (ATCC catalog number CRL 1650; grown in DMEM + 10% FCS) . First strand cDNA was synthesized from 4μg of RNA in a final volume of lOOμl using the following reaction conditions: lOmM Tris-HCl pH8.3; 50mM KC1; 1.5mM MgCl,; 800ng oligo(dT) (Promega Corporation, Madison, Wisconsin); lOmM DTT; 0.25mM dNTPs (dG, dC, dA, dT) ; 40U RNasin (Promega Corporation, Madison, Wisconsin) ; and 20U Avian Myeloblastosis Virus reverse transcriptase (Seikagaku of America, Inc. Rockville, Maryland) at 42°C.

The PCR reactions were performed following cDNA synthesis using 8μl of first strand cDNA reaction mix in - 49 -

a final volume of lOOμl using the primers described above, containing the following reaction components: lOmM Tris-HCl pH8.3; 50mM KC1; 3.5mM MgCl₂; 750μM dNTPs; 0.25μM 5' UTR oligo; 0.25μM 3' UTR oligo; and 5U AmpliTaq (Perkin-Elmer Corporation, Norwalk, Connecticut) . These primers contain BamHI restriction sites (underlined in the primer sequences above) that are found in the native CD59 and BabCIP sequences, and were used to facilitate subcloning of the PCR fragment. The PCR conditions were as follows: 95°C 1 minute, 52°C 1 minute, 72°C 1 minute, for a total of 40 cycles.

The PCR reaction produced a single DNA fragment of approximately 520 nucleotides that was digested with BamHI and subcloned into the plasmid pBS (Stratagene Cloning Systems, La Jolla, California) . The nucleotide sequence was determined by sequence analysis of independent clones generated by several separate PCR reactions. These analyses showed that the clones contained a 5' UTR of 17 nucleotides, a coding region of 378 nucleotides (hereinafter the "AgmCIP encoding fragment"), and a 3'UTR of 97 nucleotides. The length of the coding region (378 nucleotides) and the encoded polypeptide (126 amino acids) were respectively 6 bases and 2 amino acids shorter than BabCIP. The homology of AgmCIP with other CIPs is discussed below in Example 4. • 50-

The sequence derived from these clones is set forth in SEQ.2.

The AgmCIP encoding fragment was subcloned into pcDNAI/Amp and the resulting constructs were used for generating stable Balb/3T3 transfectants (see Examples 5 and 7 below) .

Example 3 Cloning and Sequence Analysis of Squirrel Monkey CIP (SqmCIP) . Owl Monkey CIP (OwmCIP) . and Marmoset CIP (MarCIP) cDNAs encoding Squirrel Monkey, Owl Monkey, and Marmoset CIPs were cloned from first strand cDNAs of cell lines obtained from the ATCC (cell lines CCL 194, CRL 1556, and CRL 6297, respectively) using PCR methods. The same pair of primers was used to clone all three cDNAs. They were:

5' GAAGGGATCCCGGGCGCCGCCAGGTTCTGTGGACAATCAC 3' and

5' GGGAGAAGCTCTCCTGGTGTTGAC 3' . Conditions for first strand cDNA synthesis and PCR reactions were similar to those described above for the African Green Monkey. Cloning of SqmCIP was achieved through PCR amplification of reverse transcribed cDNA using the oligonucleotides described above, which were constructed from regions flanking the start and stop ^■ 51 -

codons of the baboon CIP sequence. Total RNA was isolated from squirrel monkey lung cells (ATCC catalog number CCL 194) using the acid guanidinium technique (Chomczynski, et al., 1987). 5μg of total RNA were heated at 65°C for 3 minutes and cooled on ice before reverse transcribing for 1 h at 37°C in a 100 μl reaction containing the following: lOmM Tris-HCl (pH 8.3), 50mM KCl, 1.5mM MgCl₂, lOmM DTT, 0.25mM each dNTP, 0.5μg oligo (dT) ., and 20U of Avian Myeloblastosis Virus reverse transcriptase (Seikagaku of America, Inc. Rockville, Maryland) . 5μl of the cDNA pool were used as a template in a lOOμl PCR reaction (50mM KCl, lOmM Tris-HCl, pH9.0, 1.5mM MgCl_2# 0.1% gelatin, w/v, 1.0% Triton X-100, 200μM each dNTP, 2.5U of Tag DNA polymerase (Perkin-Elmer Corporation, Norwalk, Connecticut) using 25pM of each primer. Thermacycler conditions were as follows: 95°C, 1 minute; 42°C, 1 minute; 72°C 1 minute, for a total of 30 cycles, with a 10 minute extension at 72°C at the end of the 30 cycles. The PCR fragment was cloned into the pCRII vector of the

T/A cloning kit using the manufacturer's protocol

(Invitrogen Corporation, San Diego, California) .

Sequencing of the double-stranded DNA template was carried out by the chain-termination method. Since multiple rounds of PCR amplification are known to result ^■ 52 -

in an occasional base error, the squirrel monkey CIP sequence was verified by sequencing two additional isolates generated from separate PCR reactions. Similar procedures were followed for OwmCIP and MarCIP. These analyses provided the SqmCIP, OwmCIP, and MarCIP sequences set forth below in SEQ.3, SEQ.4, and SEQ.5, respectively. SqmCIP was found to have a coding region of 393 bases, corresponding to a polypeptide of 131 amino acids. This was nine bases (3 amino acids) longer than BabCIP. Both OwmCIP and MarCIP had coding regions of 384 bases corresponding to polypeptides of 128 amino acids, i.e., the same length as BabCIP.

Coding sequence fragments were subcloned into the pcDNA3 vector (Invitrogen Corporation, San Diego, California) and the resulting SqmCIP and OwmCIP constructs were used for generating stable Balb/3T3 transfectants (see Examples 5 and 7 below) .

Example 4 Sequence Comparisons of CIPs The nucleotide and encoded amino acid sequences of the CIPs of Examples 1-3, above, were compared to each other to identify heretofore unknown commonalities of non-human primate CIPs. As shown in Figure 1, alignment of the encoded amino acid sequences revealed a series of conserved features of these molecules. - 53 -

The encoded 25 amino acid leader peptide sequences are all highly conserved, with substitutions only being found at positions -2 and -11. The sequence of the leader peptide shared by these CIPs is described by the formula:

Met-Gly-Ile-Gln-Gly-Gly-Ser-Val-Leu-Phe- Gly-Leu-Leu-Leu- (Ala or lie or Val) -Leu- Ala-Val-Phe-Cys-His-Ser-Gly- (Asn or His) -Ser. The first 7 amino acid residues of the mature proteins are also highly conserved, with substitutions only being found at position +5. The common sequence for these 7 amino acids can be described by the formula: Leu-Gin-Cys-Tyr- (Asn or Ser) -Cys-Pro- . A 15 amino acid string, starting with an Asn residue at position +18 (+21 in the SqmCIP) that constitutes a predicted glycosylation site, is characteristic of the non-human primate CIPs. The common sequence for these 15 amino acids can be described by the formula: -Asn-Cys- (Ser or Thr) -Ser- (Asn or Gly) - (Leu or Phe) -Asp- (Ser or Thr) -Cys-Leu- Ile-Ala- (Arg or Lys) -Ala-Gly-; The 29 C-terminal amino acid residues also show strong sequence conservation in the non-human primate ^■ 54 -

CIPs. The sequence shared in this case can be described by the formula:

-Leu- (Glu or Lys) -Asn-Gly-Gly-Thr- (Ser or Thr) - Leu-Ser- (Glu or Lys) -Lys-Thr- (lie or Val) - (Leu or Val) -Leu-Leu-Val- (Thr or lie) - (Leu or Pro) - (Leu or Phe) -Leu- (Ala or Val) -Ala-Ala-Trp- (Cys or Ser) - (Arg or Leu) -His-Pro.

Figure 2 compares the amino acid sequences of the non-human primate CIPs of the invention with CD59, HVS-15, ThB, Ly6C.l, uPAR, and Sgp2 (see Background of the Invention, supra) . As can be seen in this figure, the non-human primate CIPs of the invention 1) have a cysteine backbone comprising a Ly-6 motif and 2) constitute a specific subset of molecules having such a motif.

The degree of divergence between each of BabCIP, AgmCIP, SqmCIP, OwmCIP, MarCIP, and CD59 have been calculated based upon nucleotide and encoded amino acid sequences of their coding regions. BabCIP, AgmCIP, SqmCIP, OwmCIP, and MarCIP each exhibit approximately 92%, 92%, 82%, 85%, and 85% nucleotide sequence identity to CD59, and 84%, 82%, 59%, 67% and 67% encoded amino acid sequence identity to CD59, respectively. BabCIP has approximately 97%, 81%, 84%, and 84% nucleotide sequence identity, and 95% 58%, 63% and 62% encoded ^■ 55 -

amino acid sequence identity to AgmCIP, SqmCIP, OwmCIP, and MarCIP, respectively. AgmCIP has approximately 80%, 82%, and 83% nucleotide sequence identity and 57%, 58%, and 62% encoded amino acid sequence identity to SqmCIP, OwmCIP, and MarCIP, respectively. SqmCIP has approximately 89% and 89% nucleotide sequence identity, and 77% and 75% encoded amino acid sequence identity to OwmCIP and MarCIP, respectively. Finally, OwmCIP has approximately 93% nucleotide sequence identity and 82% encoded amino acid sequence identity to MarCIP.

Some interesting features of the non-human primate CIPs, with respect to divergence, include the higher degree of divergence in the functional coding region of the molecule than in the leader and hydrophobic tail portions of the molecule. This observation holds true for the comparison of CD59 to BabCIP and AgmCIP, e.g., the maximum leader sequence divergence = 4% (CD59 vs. AgmCIP; CD59 vs. BabCIP = 0%) and the divergence in the hydrophobic tail region = 7.5% and 15% (CD59 vs. AgmCIP; CD59 vs. BabCIP, respectively) . However, the divergence in the coding region of the mature peptide is 26% for CD59 vs. AgmCIP and 21% for the comparison of CD59 to BabCIP. The most notable changes occur between cysteine residues at positions +39 and +63, where the extent of divergence is 39% (9/23 residues) . Two distinct amino • 56 -

acid changes result in charge changes in the AgmCIP mature protein, namely a D to N change at position +12 and a K to E change at position +66. These changes result in a change in the predicted pi of the protein from a pi of 5.2 for CD59 to a pi of 4.3 for AgmCIP. These differences, and possibly the two amino acid deletion near the putative GPI anchor, appear to structurally modify the protein conformation, thereby causing a decrease in cross-reactivity of the CD59 antibodies to AgmCIP. This has been observed both on cell surface expressed proteins (see Figure 3, MEM-43 AgmCIP panel) as well as on western blots prepared from whole cell lysates. These amino acid differences may result in functional modification of the protein resulting in enhanced complement inhibitory activity even against heterologous species complement.

Example 5 Expression of BabCIP. AgmCIP. and SqmCIP by Mammalian Cells The cDNAs encoding BabCIP, AgmCIP, and SqmCIP were subcloned into the mammalian expression vectors, pcDNAI/Amp or pcDNA3 (Invitrogen Corporation, San Diego, California) , as described above. CD59 cDNA (Philbrick et al., 1990) was directionally subcloned into pcDNAI/Amp (Invitrogen Corporation, San Diego, ^■ 57 -

California) utilizing the BamHI and EcoRI restriction sites contained in the 5' untranslated region and in the polylinker of pUC19, respectively. Sequence analysis was performed to confirm the orientation and sequence integrity of the clones. Stable transfectants of all four molecules were obtained in the murine fibroblast cell line, Balb/3T3 (ATCC catalog number CCL 163; grown in DMEM + 10% FCS) , by calcium phosphate transfection. Co-transfection of the plasmid SV2Neo, which directs the expression of the bacterial neomycin phosphotransferase gene, permitted selection in media containing 500μg/ml of the neomycin analog G418 (Life Technologies, Inc. Gathersburg, Maryland) for constructions in pcDNAI/AMP. The pcDNA3 vector carries the neomycin gene, and does not require co-transfection of SV2Neo to permit selection with G418.

20μg of the SqmCIP construct was linearized with Pvul followed by phenol/chloroform extraction and ethanol precipitation (note that constructions using pcDNAI/AMP were co-precipitated with the selection vector SV2Neo) . To the dried DNA pellets 50μl of 0.IX TE (l M Tris, pH 8.0, 0.ImM EDTA), 400μl of H₂0 and 50μl of 2.5M CaCl- were added. This solution was added dropwise to 500μl of 2X HeBS (Ausubel, et al. , 1991) with gentle agitation followed by a 30 minute incubation - 58 -

at room temperature. The DNA solution was added to Balb/3T3 cells at 50% confluency previously washed with PBS. The cells were incubated at 37°C for 24 h, washed 2X with PBS and incubated an additional 48 h with fresh media before splitting into selection media (DME/High Modified/ RH Biosciences, Lexena, Kansas; with ImM sodium pyruvate, 2mM L-glutamine and 500μg/ml G418) . 10 days following selection, isolated colonies were transferred to 48 well plates for expansion. The BabCIP and AgmCIP constructs were treated similarly.

G418 resistant colonies of transfected Balb/3T3 cells were isolated and screened for the presence of cell surface expressed CIP by indirect immunofluorescence, using monoclonal and polyclonal antibody preparations. Human CD59 polyclonal antiserum #223 was provided by Dr. Peter Sims (Blood Research Institute, Milwaukee, Wisconsin) . The CD59 mAb, MEM-43, was purchased from Biodesign International,

Kennebunkport, Maine. Cell surface indirect ς immunofluorescence was typically performed on 1x10 cells with 50μg/ml of the primary polyclonal antibody or

20μg/ml of monoclonal antisera in 1XPBS + 2% FBS. Goat anti-rabbit IgG (polyclonal sera) or goat anti-mouse

(monoclonal sera) IgG FITC conjugated antisera were used as secondary antibodies (Zymed Laboratories, South San • 59 -

Francisco, California) . Fluorescence was measured using a FACSort instrument (Becton-Dickinson Immunocytometry Systems, San Jose, California) .

Figure 3 illustrates cell surface expression profiles of positive clones of the Baboon and African Green Monkey CIP molecules, as well as a human CD59 transfectant as a positive control and an SV2Neo alone transfectant as a negative control. The polyclonal antisera raised against purified human CD59 cross reacted with both the Baboon and African Green Monkey CIP molecules (Figure 3, polyclonal panels) .

In addition, BabCIP cross-reacted to a slight but detectable degree with the monoclonal antibody MEM-43 (Figure 3, MEM-43 panels). The AgmCIP did not react with the monoclonal antibody.

Balb/3T3 cells transfected with the SqmCIP expression vector did not react with either the polyclonal or monoclonal antibodies. Nevertheless, SqmCIP was being expressed by these transfected cells as demonstrated by their resistance to complement attack, as shown below in Example 7.

These results indicate that: 1) the BabCIP and AgmCIP share at least some common epitopes that are recognized by the anti-CD59 polyclonal antisera; 2) all of these CIPs have diverged significantly from CD59 as 60 -

evidenced by the monoclonal antibody experiments; 3) AgmCIP is structurally more divergent from CD59 than BabCIP, based on the loss of any detectable MEM-43 epitope; and 4) SqmCIP is the most divergent in view of its lack of reactivity with all of the anti-CD59 antibodies. These experimental results are consistent with the degree of divergence from CD59 of the amino acid sequences of BabCIP, AgmCIP, and SqmCIP shown in Figure 2. These divergences are also discussed above in Example 4.

Example 6 Phosphatidylinositol-Phospholipase C Analysis of BabCIP and AgmCIP Expressed in Mammalian Cells A structural feature of CD59 is the anchoring of the protein to the cell surface membrane through a glycosyl-phosphatidylinositol (GPI) linkage.

To test for the presence of such a GPI anchor in the non-human primate CIPs of the invention, phosphatidylinositol-phospholipase C (PI-PLC, Boehringer-Mannheim Corporation, Biomedical Products Division, Indianapolis, Indiana) digestion was performed on Balb/3T3 cells expressing AgmCIP and BabCIP (and CD59 as a control) . PI-PLC digestion of cell surface GPI proteins was performed as follows: 1X10 cells were incubated in 1XPBS + 1% BSA + lOmM EDTA + 80mU PI-PLC at • 61 -

37°C for 30 minutes. The cells were washed in IXPBS + 1% FCS, pelleted and resuspended in IXPBS + 2% FCS and subsequently analyzed by indirect immunofluorescence as described above for Example 5. The results of this experiment are presented in Figure 4.

Mock treated cells retained CIP on the cell surface, whereas, in all cases, PI-PLC treatment resulted in the loss of cell surface CIPs as indicated by reduced fluorescence intensity upon indirect immunofluorescence analysis with polyclonal anti-CD59 antisera. An anti-MHC class I monoclonal antibody preparation, HB159, (ATCC Catalog No. HB159) , was used as a control to show that PI-PLC treatment did not alter the detection of a cell surface protein anchored by an integral transmembrane domain that would not be expected to be altered by the PI-PLC treatment.

Example 7 Functional Analysis of BabCIP. AgmCIP. and SqmCIP The functional activity of recombinant non-human primate CIP molecules expressed in transfected Balb/3T3 cells was assessed by a dye release assay that consists of measuring the efflux of molecules sequestered in the cytoplasm, specifically the cytoplasmic indicator dye, calcein AM (Molecular Probes, Inc., Eugene, Oregon). 62 -

Transfected cells expressing one of Baboon, African Green Monkey, or Squirrel Monkey CIPs, as well as the. parent expression vectors without CIP encoding inserts (as controls) were grown to confluence in 96-well plates.

Cells were washed twice with 200 μl of Hank's balanced salts solution containing 10 μg/ml bovine serum albumin (HBSS/BSA) . Calcein AM was added (lOμM final concentration) and the plates were incubated at 37°C for 30 minutes to allow the dye to be internalized by the cells and converted by cellular esterases into a polar fluorescent derivative that is retained inside undamaged cells. The wells were then washed twice with HBSS/BSA to remove dye remaining outside the cells. The cells were then incubated with anti-Balb/3T3 IgG (2 mg/ml in HBSS/BSA) , which served as an activator of the classical complement pathway. After 30 minutes at 23°C, unbound IgG was washed away. The cells were then incubated at 37°C for 30 minutes in the presence of whole serum or in the presence of C8 deficient serum, washed once with HBSS/BSA, and then incubated in EDTA treated whole serum (or purified C8 and C9) at 37°C for 30 minutes, to allow complement attack to occur. The experiments using C8 deficient serum and EDTA treated whole serum as a source of C8 and C9, as well as those using C8 deficient serum 63 -

and purified C8 and C9, were conducted because they provide additional insight into the functional activity of a CIP. The medium bathing the cells was then transferred to a clean 96-well plate for fluorescence measurement.

Under the conditions of this assay, the fluorescent polar derivative of calcein AM is only released into the medium bathing the test cells if the integrity of the cell membranes is compromised. Therefore, the fluorescence of the calcein AM derivative released into the medium bathing the test cells provides an indirect but accurate measure of the level of complement-mediated damage sustained by the cells. Total cell-associated dye was determined from 1% SDS lysates of the cells remaining in the 96-well culture plates as a control to normalize baseline intracellular dye levels. Fluorescence was measured using a Millipore Cytofluor 2350 fluorescence plate reader (490nm excitation, 530nm emission) . Specific dye release was calculated as a percent of total, correcting for non-specific dye release and • background fluorescence measured on identically matched controls without the addition of serum.

The results of these dye release assays are shown in Figures 5 and 6. As shown therein, Baboon, African ^■ 64 -

Green Monkey, and Squirrel Monkey CIPs each exhibit substantial human complement regulatory activity. Results presented in Figure 5 (left hand panels) further demonstrate that AgmCIP provided more protection against human complement than even the human CIP, CD59, in this experimental system. Results of additional dye release experiments are presented in Figure 5 (center panels) that show that AgmCIP was also effective in providing protection against complement attack mediated by rat serum as well as by MACs containing human C5b-7 (from 20% human C8 depleted serum) and rat C8 and C9 (from EDTA treated rat serum) . Further experiments (Figure 5, right hand panels) demonstrated protection against rabbit serum, and against MACs containing human C5b-7 (from 20% human C8 depleted serum) and rabbit C8 and C9 (from EDTA treated rabbit serum) by CD59, BabCIP, and AgmCIP.

Figure 7 shows a comparison of the human complement regulatory activity of CD59 compared to the activities of BabCIP, AgmCIP, and SqmCIP. The data for this figure were derived from Figures 5 and 6, and represent data for 10% human serum (BabCIP and AgmCIP) or 20% human C8 depleted serum plus lOμg/ml of a mixture of equal parts of human C8 and C9 (Quidel Corporation, San Diego, California) . The control data for CD59 were essentially - 65 -

the same using these levels of either source of human complement activity, but the bar represents data, obtained using 10% human serum as shown in Figure 5.

Example 8 Southern Blot Hybridization Analysis of Genomic DNAs

Human, baboon, rabbit, and guinea pig genomic DNAs (lOμg each) were separately digested with BamHI and electrophoresed on 1% agarose gels in IX TBE, transferred to nitrocellulose, and hybridized to a ³²P-labeled full length CD59 cDNA probe (Philbrick, et g al., 1990; 2x10 cpm/ml of hybridization buffer) in 0.5M sodium phosphate pH6.8 + 7% SDS + 1% BSA + ImM EDTA at

50°C. Washes were performed as follows: once with 2X

SSC + 0.1% SDS at room temperature for 15 minutes; twice with 2X SSC + 0.1% SDS at 50°C, each for 15 minutes; once with IX SSC at 65°C for 10 minutes; and once with 0.2X SSC at 65°C for 10 minutes. The filter was then mounted and exposed to Kodak XAR5 X-ray film with double intensifying screens for 160 hours. The stringency of these selective hybridization and wash conditions was selected by calculating a theoretical T of 92°C using the equation (Sambrook, et al., 1989) :

Tm = 81.5 +

( [Na⁺] ) + 0.41(%G+C) - 650/L 66 -

where the Na⁺ concentration in 0.2X SSC = 320mM; %G+C = 50; and L = 425bp probe length. The minimal homology of hybridizing bands can be calculated by assuming 1% of mismatch for every 1°C by which the hybridization temperature is below the T . Under the conditions used, this results in a theoretical minimal homology of 73% (92°C - 65°C = 27% mismatch) . Only bands indicating hybridization to human, rabbit, and baboon genomic sequences were detected in these experiments. Although preferred and other embodiments of the invention have been described herein, other embodiments may be perceived and practiced by those skilled in the art without departing from the scope of the invention. The following claims are intended to cover the specific embodiments set forth herein as well as such modifications, variations, and equivalents.

Further Deposit Information: The deposits referred to above having ATCC accession numbers 69299 and 69298 were made on May 7, 1993, and those having ATCC accession numbers 69343, 69344, and 69345 were made on June 30, 1993. As discussed above, these plasmids were deposited in Escherichia coli strain TOP10F' and confer ampicillin resistance upon these bacteria. Strain TOP10F' has the following geneotype: F'{tet'} zπcrA Δ ( rr-hsdRMS -mcrBC) φ80ΔlacΔM15 ΔlacX74 deoR recAl araD139 A {ara, leu) 7697 galU galK \^~ rpsL endAl nupG . • 67 -

References

Akami, et al. , 1993. Transplant. Proc. 25:394-395 Albrecht, et al., 1992. J. Virology 66:5047-5058.

Ammerer, 1983. Methods Enzymol. 101:192.

Ausubel, et al., 1991. Current Protocols in Molecular Biology, Volume 1, Wiley Interscience, John Wiley and Sons.

Bergh, et al., 1991. Acta Anaesthesiol. Scand. 35:267-274

Bhakdi, et al. , 1991. Immunol. Today. 12: 318-321.

Bordet, et al. , 1900. Ann. Institut. Pasteur 14:257.

Brasile, et al., 1985. Transplantation. 40:672-675.

Brasile, et al., 1987. Trans. Proceed. 19:894-895. Chang, et al., 1978. Nature 275:615.

Cho czynski, et al., 1987. Analytical Biochem. 162:156-159. Crawford, et al., 1988. Circulation 78:1449-1458.

Dalmasso, et al., 1992. Am. J. Pathol. 140:1157-1166. Davies, et al. , 1989. J. Exp. Med. 170: 637-654.

Eikelenboom, et al., 1989. Virchow's Archiv. B. Cell. Pathol. 56:259-262. Esser. 1991. Immunol. Today. 12: 316-318.

Farries, et al., 1991. Immunol. Today. 12: 295-300.

Gelfand, et al., 1982. J. Clin. Invest. 70:1170-1176.

Goeddel, et al. , 1980. Nucl. Acids Res. 8:4057. - 68 -

Gu ley, et al. , 1992. J. Immunol. 149:2615-2618.

Hammerschmidt, et al., 1980. Lancet 1:947-949. Hansch, G.M. , et al., 1981. Proc. Natl. Acad. Sci. USA 78:5118.

Harada, et al., 1990. J. Immunol. 144: 1823-1828. Hill, et al., 1992. J. Immunol. 149:1723-1728.

Holguin, et al., 1989a. J. Clin. Invest. 84: 7-17.

Holguin, et al., 1989b. J. Clin. Invest. 84: 1387-1394.

Holguin, et al., 1992. J. Immunol.. 148: 498-502.

Houle, J.J., et al., 1984. J. Immunol. 133:1444-1452

Hughes, T.R., et al. 1992. Biochem. J. 284:169-176

Lachmann. 1991. Immunol Today. 12: 312-315.

Lachmann, et al., 1973. Immunology 24:135-145

Luckow, et al., 1988. Bio/Technology 6:47. Maniatis, et al., 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

Maroko, et al., 1978. J. Clin. Invest. 61:661-670. McGeer, et al., 1989. Neurosci. Lttrs. 107:341-346, Medof, et al., 1987. J. Clin. Invest. 80: 165-174. Meri, et al., 1990. Immunology. 70: 1-9.

Merry, et al., 1989. Br. J. Hematol. 73: 248-253. Moir, et al., 1991. Meth. Enzymol. 194: 491-507. Morgan, 1992 Biochem. J. 282:409-413. Mulligan, et al., 1992. J. Immunol. 148:1479-1485. ^■ 69 -

Nose, et al., 1990. Immunology. 70: 145-149.

Okada, et al., 1989a. Biochem. Biophys. Res. Commun. 162: 1553-1559.

Okada, et al., 1989b. J. Immunol. 143: 2262-2266.

Okada, et al., 1990. Clin. Exp. Immunol. 80: 109-113.

Petranka, et al., 1992. Proc. Natl. Acad. Sci. USA. 89: 7876-7879.

Philbrick, et al., 1990. Eur. J. Immunol. 20: 87-92.

Pinckard, et al., 1975. J. Clin. Invest. 56:740-750. Pinckard, et al., 1980. J. Clin. Invest. 66:1050-1056.

Rabinovici, et al., 1992. J. Immunol. 149:1744-1750.

Roldan, et al., 1990. EMBO J. 9:467-474.

Rollins, et al., 1990. J. Immunol. 144: 3478-3483. Rollins, et al., 1991. J. Immunol. 146: 2345-2351.

Rossen, et al., 1985. Circ. Res. 57:119-130.

Sambrook, et al., 1989. Molecular cloning: a laboratory manual. Second Edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

Sanders, et al., 1986. J. Immunol. 136:4456-4459. Sanders, et al., 1987. J. Immunol. 138:2095-2099.

Sawada, et al., 1989. DNA and Cell. Biol. 9: 213-220. Schafer, et al., 1986. J. Immunol. 137:1945-1949.

Schena, et al., 1991. Meth. Enzymol. 194: 389-398.

Schonermark, et al., 1986. J. Immunol. 136:1772. 70 -

Shevach, et al., 1989. Immunol. Today. 10:195-200 Shin, et al., 1986. J. Immunol. 136:1777 Sims, et al., 1989. J. Biol. Chem. 264:19228-19235. Starzl, et al. , 1993. Lancet 341: 65-71. Stefanova, et al., 1989. Mol. Immunol. 26: 153-161, Sugita, et al., 1988. J. Biochem. 104: 633-637. Telen, et al., 1989. Blood. 74: 437-441. Till, et al., 1986. Federation Proc. 45:13-18.

Tone, et al., 1992. J. Mol. Biol. 227: 971-976.

Van Den Berg, C.W., et al. 1993. Immunology 78:349-357.

Venneker, et al. , 1992. Exp. Clin. Immunogenet. , 9:33-47. Walsh, et al., 1991. Eur. J. Immunol. 21: 847-850.

Weisman, et al., 1990. Science, 249:146.

Whitlow, et al., 1990. Cell Immunol. 126:176-184.

Williams, et al., 1988. Immunogenetics 27:265-272.

Wing, et al., 1992. Immunology 76: 140-145. Yamada, et al., 1990. Neurosci. Lttrs. 112:161-166.

Yamashina, et al., 1990. N. Engl. J. Med. 323: 1184-1189. Zalman, et al., 1986. Proc. Natl. Acad. Sci. USA. 83:6975-6979.

Zhao, et al., 1991. J. Biol. Chem. 266: 13418-13422.

Zilow, et al., 1990. Clin. Exp. Immunol. 79:151-157.

Zilow, et al., 1992. Crit. Care Med. 20: 468-473. •71-

Zimmerman, et al., 1976. J. Clin. Invest. 57:203-211.

-72-

SEOUENCE LISTING (1) GENERAL INFORMATION:

(i) APPLICANT: Fodor, William L.

Rollins, Scott Rother, Russell Squinto, Stephen P.

(ii) TITLE OF INVENTION: Complement Inhibitor Proteins of Non-human Primates

(iii) NUMBER OF SEQUENCES: 13

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Maurice M. Klee

(B) STREET: 1951 Burr Street

(C) CITY: Fairfield

(D) STATE: Connecticut

(E) COUNTRY: USA

(F) ZIP: 06430

(V) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: 3.5 inch, 1400 Kb storage

(B) COMPUTER: Apple Macintosh

(C) OPERATING SYSTEM: Macintosh System 7.1

(D) SOFTWARE: Microsoft Word 5.1

(vi: 1 CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA

(A) APPLICATION NUMBER: 08/105,735 (B) FILING DATE: August 11, 1993 -73 -

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Klee, Maurice M.

(B) REGISTRATION NUMBER: 30,399

(C) REFERENCE/DOCKET NUMBER: ALX-114PCT (ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: (203) 255 1400

(B) TELEFAX: (203) 254 1101

-74-

(2) INFORMATION FOR SEQ ID NO:1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 763 base pairs

(B) TYPE: Nucleic Acid

(C) STRANDEDNESS: Double

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: cDNA to mRNA

(iii) HYPOTHETICAL: No

(iv) ANTI-SENSE: No

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Papio hamadrvas

(vii) IMMEDIATE SOURCE:

(A) LIBRARY: Baboon Spleen Lambda ZAPII cDNA

Library, Catalog # 936103, Stratagene Cloning Systems, La Jolla, California

-75 -

(xi ) SEQUENCE DESCRIPTION : SEQ ID NO : l :

GGTTATGTGC CCACACTTGC CTAGGCTGTG AATAGTTAGT ACCTCTGATT 50

ACTTAGTTAA ATATGCTTCT AGATGAGAAG TAGCGAAAGG CTGGAAGGGA 100

TCCCGGGCGC CGCCAGGTTC TGTGGACAAT CACA ATG GGA 140

Met Gly -25

ATC CAA GGA GGG TCT GTC CTG TTC GGG CTG CTG CTT GTC CTG GCT 185 lie Gin Gly Gly Ser Val Leu Phe Gly Leu Leu Leu Val Leu Ala -20 -15 -10

GTC TTC TGC CAT TCA GGT CAT AGC CTG CAG TGC TAC AAC TGT CCT 230 Val Phe Cys His Ser Gly His Ser Leu Gin Cys Tyr Asn Cys Pro -5 +1 5

AAC CCA ACT ACT GAC TGC AAA ACA GCC ATC AAT TGT TCA TCT GGT 275 Asn Pro Thr Thr Asp Cys Lys Thr Ala lie Asn Cys Ser Ser Gly 10 15 20

TTT GAT ACG TGT CTC ATT GCC AGA GCT GGG TTA CAA GTA TAT AAC 320 Phe Asp Thr Cys Leu lie Ala Arg Ala Gly Leu Gin Val Tyr Asn 25 30 35

CAG TGT TGG AAG TTT GCG AAT TGC AAT TTC AAT GAC ATT TCA ACC 365 Gin Cys Trp Lys Phe Ala Asn Cys Asn Phe Asn Asp lie Ser Thr 40 45 50

CTC TTG AAG GAA AGC GAG CTA CAG TAC TTC TGC TGC AAG AAG GAC 410 Leu Leu Lys Glu Ser Glu Leu Gin Tyr Phe Cys Cys Lys Lys Asp 55 60 65

CTG TGT AAC TTT AAC GAA CAG CTT GAA AAT GGT GGG ACA TCC TTA 455 Leu Cys Asn Phe Asn Glu Gin Leu Glu Asn Gly Gly Thr Ser Leu 70 75 80

TCA GAG AAA ACA GTT GTT CTG CTG GTG ACC CTA CTT CTG GCA GCA 500 Ser Glu Lys Thr Val Val Leu Leu Val Thr Leu Leu Leu Ala Ala 85 90 95

GCC TGG TGC CTT CAT CCC TAAGTCAACA CCAGGAGAGC TTCTCCCATA 548 Ala Trp Cys Leu His Pro 100

CTCCCCGTTC CTGCGTAGTC CCCTTTCCCT CGTGCNGATT CTAAAGGCTT 598

ATATTTTCCA ACCGGATCCT GTTGGGAAAG AATAAAATTG ACTTGAGCAA 648

CCTGGCTAAG ATAGAGGGGC TCTGGAAGAC TTCGAAGACC AGTCCTGTTT 698 -76-

GCAGGGAAGC CCCACTTGAA GGAAGAAGTT TAAGAGTGAA GTAGGTGTGA 748 CTTGAGCTAG ATTGG 763

-77-

(2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 469 base pairs

(B) TYPE: Nucleic Acid

(C) STRANDEDNESS: Double

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: cDNA to mRNA

(iii) HYPOTHETICAL: No

(iv) ANTI-SENSE: No

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Cercopithecus aethiops (H) CELL LINE: COS-l (ATCC CRL 1650)

-78-

(xi ) SEQUENCE DESCRIPTION : SEQ ID NO : 2

TTCTGTGGAC AATCACA ATG GGA ATC 26

Met Gly He -25

CAA GGA GGG TCT GTC CTG TTC GGG CTG CTG CTT GCC CTG GCT GTC 71 Gin Gly Gly Ser Val Leu Phe Gly Leu Leu Leu Ala Leu Ala Val -20 -15 -10

TTC TGC CAT TCA GGT CAT AGC CTG CAA TGC TAC AAC TGT CCT AAC 116 Phe Cys His Ser Gly His Ser Leu Gin Cys Tyr Asn Cys Pro Asn -5 +1 5

CCA ACT ACT AAC TGC AAA ACA GCC ATC AAT TGT TCA TCT GGT TTT 161 Pro Thr Thr Asn Cys Lys Thr Ala He Asn Cys Ser Ser Gly Phe 10 15 20

(

GAT ACG TGT CTC ATT GCC AGA GCT GGG TTA CAA GTA TAT AAC CAG 206 Asp Thr Cys Leu He Ala Arg Ala Gly Leu Gin Val Tyr Asn Gin 25 30 35

TGT TGG AAG TTT GCG AAT TGC AAT TTC AAT GAC ATT TCA ACC CTC 251 Cys Trp Lys Phe Ala Asn Cys Asn Phe Asn Asp He Ser Thr Leu 40 45 50

TTG AAG GAA AGC GAG CTA CAG TAC TTC TGC TGC AAG GAG GAC CTG 296 Leu Lys Glu Ser Glu Leu Gin Tyr Phe Cys Cys Lys Glu Asp Leu 55 60 65

TGT AAC GAA CAG CTT GAA AAT GGT GGG ACA TCC TTA TCA GAG AAA 341 Cys Asn Glu Gin Leu Glu Asn Gly Gly Thr Ser Leu Ser Glu Lys 70 75 80

ACA GTT CTT CTG CTG GTG ACC CCA CTT CTG GCA GCA GCC TGG TGC 386 Thr Val Leu Leu Leu Val Thr Pro Leu Leu Ala Ala Ala Trp Cys 85 90 95

CTT CAT CCC TAAGTCAACA CCAGGAGAGC TTCTCCCATA CTCCCCGTTC 435 Leu His Pro 100

CTGCGTAGTC CCCTTTCCCC GGCCGCATTC TAAA 469 -79 -

[2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 396 base pairs

(B) TYPE: Nucleic Acid

(C) STRANDEDNESS: Double

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: cDNA to mRNA

(iii) HYPOTHETICAL: No

(iv) ANTI-SENSE: No

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Saimiri sciureus

(H) CELL LINE: DPSO 114/74 (ATCC CCL 194)

-80-

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3 :

ATG GGA ATC CAA GGA GGG TCT GTC CTG TTT GGG CTG CTG CTC GTC 45 Met Gly He Gin Gly Gly Ser Val Leu Phe Gly Leu Leu Leu Val -25 -20 -15

CTG GCT GTC TTC TGC CAT TCA GGT AAT AGC CTG CAA TGC TAC AGC 90 Leu Ala Val Phe Cys His Ser Gly Asn Ser Leu Gin Cys Tyr Ser -10 -5 +1 5

TGT CCT CTC CCA ACC ATG GAG TCC ATG GAG TGC ACT GCG TCC ACC 135 Cys Pro Leu Pro Thr Met Glu Ser Met Glu Cys Thr Ala Ser Thr

10 15 20

AAC TGT ACA TCT AAT CTT GAT TCG TGT CTC ATT GCC AAA GCC GGG 180 Asn Cys Thr Ser Asn Leu Asp Ser Cys Leu He Ala Lys Ala Gly

25 30 35

TCA GGA GTA TAT TAC CGG TGT TGG AAG TTT GAC GAT TGC AGT TTC 225 Ser Gly Val Tyr Tyr Arg Cys Trp Lys Phe Asp Asp Cys Ser Phe

40 45 50

AAA CGC ATC TCA AAC CAA TTG TCG GAA ACT CAG TTA AAG TAT CAC 270 Lys Arg He Ser Asn Gin Leu Ser Glu Thr Gin Leu Lys Tyr His

55 60 65

TGC TGC AAG AAG AAC CTG TGT AAT GTT AAG GAA GTG CTT GAA AAT 315 Cys Cys Lys Lys Asn Leu Cys Asn Val Lys Glu Val Leu Glu Asn

70 75 80

GGT GGG ACA ACC TTA TCA AAG AAA ACA ATT CTT CTG CTG GTG ACC 360 Gly Gly Thr Thr Leu Ser Lys Lys Thr He Leu Leu Leu Val Thr

85 90 95

CCG TTT CTG GCA GCA GCC TGG AGC CGT CAT CCC TAA 396

Pro Phe Leu Ala Ala Ala Trp Ser Arg His Pro 100

-81-

(2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 387 base pairs

(B) TYPE: Nucleic Acid

(C) STRANDEDNESS: Double

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: cDNA to mRNA

(iii) HYPOTHETICAL: No

(iv) ANT -SENSE: No

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Aotus trivirσatus (H) CELL LINE: OMK (ATCC CRL 1556)

^■ 82 -

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

ATG GGA ATT CAA GGA GGG TCT GTC CTG TTT GGG CTG CTG CTC GTC 45 Met Gly He Gin Gly Gly Ser Val Leu Phe Gly Leu Leu Leu Val -25 -20 -15

CTG GCT GTC TTC TGC CAT TCA GGT AAT AGC CTG CAG TGC TAC AGC 90 Leu Ala Val Phe Cys His Ser Gly Asn Ser Leu Gin Cys Tyr Ser -10 -5 +1 5

TGT CCT TAC CCA ACC ACT CAG TGC ACT ATG ACC ACC AAC TGT ACA 135 Cys Pro Tyr Pro Thr Thr Gin Cys Thr Met Thr Thr Asn Cys Thr

10 15 20

TCT AAT CTT GAT TCG TGT CTC ATT GCC AAA GCC GGG TCA CGA GTA 180 Ser Asn Leu Asp Ser Cys Leu He Ala Lys Ala Gly Ser Arg Val

25 30 35

TAT TAC CGG TGT TGG AAG TTT GAG GAT TGC ACT TTC AGC CGC GTT 225 Tyr Tyr Arg Cys Trp Lys Phe Glu Asp Cys Thr Phe Ser Arg Val

40 45 50

TCA AAC CAA TTG TCT GAA AAT GAG TTA AAG TAT TAC TGC TGC AAG 270 Ser Asn Gin Leu Ser Glu Asn Glu Leu Lys Tyr Tyr Cys Cys Lys

55 60 65

AAG AAC CTG TGT AAC TTT AAT GAA GCG CTT AAA AAT GGT GGG ACA 315 Lys Asn Leu Cys Asn Phe Asn Glu Ala Leu Lys Asn Gly Gly Thr

70 75 80

ACC TTA TCA AAG AAA ACA GTC CTC CTG CTG GTG ATC CCA TTT CTG 360 Thr Leu Ser Lys Lys Thr Val Leu Leu Leu Val He Pro Phe Leu

85 90 95

GTA GCA GCC TGG AGC CTT CAT CCC TAA 387

Val Ala Ala Trp Ser Leu His Pro 100

-83 -

(2) INFORMATION FOR SEQ ID NO:5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 387 base pairs

(B) TYPE: Nucleic Acid

(C) STRANDEDNESS: Double

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: cDNA to mRNA

(iii) HYPOTHETICAL: No

(iv) ANTI-SENSE: No

( i) ORIGINAL SOURCE:

(A) ORGANISM: Saσuinus niσricollis (H) CELL LINE: 1283.Lu (ATCC CRL 6297]

-84-

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5

ATG GGA ATC CAA GGA GGG TCT GTC CTG TTT GGG CTG CTG CTC ATC 45 Met Gly He Gin Gly Gly Ser Val Leu Phe Gly Leu Leu Leu He -25 -20 -15

CTG GCT GTC TTC TGC CAT TCA GGT CAT AGC CTG CAG TGC TAC AGC 90 Leu Ala Val Phe Cys His Ser Gly His Ser Leu Gin Cys Tyr Ser -10 -5 +1 5

TGT CCT TAC TCA ACC GCT CGG TGC ACT ACG ACC ACC AAC TGT ACA 135 Cys Pro Tyr Ser Thr Ala Arg Cys Thr Thr Thr Thr Asn Cys Thr

10 15 20

TCT AAT CTT GAT TCA TGT CTC ATT GCC AAA GCC GGG TTA CGA GTA 180 Ser Asn Leu Asp Ser Cys Leu He Ala Lys Ala Gly Leu Arg Val

25 30 35

TAT TAC CGG TGT TGG AAG TTT GAG GAT TGC ACT TTC AGA CAA CTT 225 Tyr Tyr Arg Cys Trp Lys Phe Glu Asp Cys Thr Phe Arg Gin Leu

40 45 50

TCA AAC CAA TTG TCG GAA AAT GAG TTA AAG TAT CAC TGC TGC AGG 270 Ser Asn Gin Leu Ser Glu Asn Glu Leu Lys Tyr His Cys Cys Arg

55 60 65

GAG AAC CTG TGT AAC TTT AAC GGA ATA CTT GAA AAT GGT GGG ACA 315 Glu Asn Leu Cys Asn Phe Asn Gly He Leu Glu Asn Gly Gly Thr

70 75 80

ACC TTA TCA AAG AAA ACA GTT CTT CTG CTG GTG ACC CCT TTT CTG 360 Thr Leu Ser Lys Lys Thr Val Leu Leu Leu Val Thr Pro Phe Leu

85 90 95

GCA GCA GCC TGG AGC CTT CAT CCC TAA 387

Ala Ala Ala Trp Ser Leu His Pro 100

-85 -

(2) INFORMATION FOR SEQ ID NO:6:^' (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 bases

(B) TYPE: Nucleic Acid

(C) STRANDEDNESS: Single

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: cDNA to mRNA

(A) DESCRIPTION: Probe/Primer

(iii) HYPOTHETICAL: No

(iv) ANTI-SENSE: No

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Homo sapiens

(x) PUBLICATION INFORMATION:

(A) AUTHORS: Philbrick, .M.

Palfree, R.G.E Maher, S.E. Bridgett, M.M. Sirlin S. Bothwell, A.L.M.

(B) TITLE: The CD59 antigen is a structural homologue of murine Ly-6 antigens but lacks interferon inducibility.

(C) JOURNAL: European Journal of Immunology

(D) VOLUME: 20

(F) PAGES: 87-92

(G) DATE: JAN-1990 -86-

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:

GGAAGAGGAT CCTGGGCGCC GCAGG 25

-87-

(2) INFORMATION FOR SEQ ID NO:7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 bases

(B) TYPE: Nucleic Acid

(C) STRANDEDNESS: Single

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: cDNA to mRNA

(A) DESCRIPTION: Probe/Primer, reverse complement of SEQ ID NO 6

(iii) HYPOTHETICAL: No

(iv) ANTI-SENSE: Yes

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Homo sapiens

(x) PUBLICATION INFORMATION:

(A) AUTHORS: Philbrick, .M.

Palfree, R.G.E Maher, S.E. Bridgett, M.M. Sirlin S. Both ell, A.L.M.

(B) TITLE: The CD59 antigen is a structural homologue of murine Ly-6 antigens but lacks interferon inducibility.

(C) JOURNAL: European Journal of Immunology

(D) VOLUME: 20

(F) PAGES: 87-92

(G) DATE: JAN-1990 -88-

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

CCTGCGGCGC CCAGGATCCT CTTCC 25

-89 -

(2) INFORMATION FOR SEQ ID NO:8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 32 bases

(B) TYPE: Nucleic Acid

(C) STRANDEDNESS: Single

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: cDNA to mRNA

(A) DESCRIPTION: Probe/Primer

(iii) HYPOTHETICAL: No

(iv) ANTI-SENSE: Yes

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Homo sapiens

(x) PUBLICATION INFORMATION:

(A) AUTHORS: Philbrick, .M.

Palfree, R.G.E Maher, S.E. Bridgett, M.M. Sirlin S. Bothwell, A.L.M.

(B) TITLE: The CD59 antigen is a structural homologue of murine Ly-6 antigens but lacks interferon inducibility.

(C) JOURNAL: European Journal of Immunology

(D) VOLUME: 20

(F) PAGES: 87-92

(G) DATE: JAN-1990 -90-

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:

CCCAACAGGA TCCATTTGGA AAATATCAAG CC 32

-91-

(2) INFORMATION FOR SEQ ID NO: 9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 32 bases

(B) TYPE: Nucleic Acid

(C) STRANDEDNESS: Single

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: cDNA to mRNA

(A) DESCRIPTION: Probe/Primer, reverse complement of SEQ ID NO 8

(iii) HYPOTHETICAL: No

(iv) ANTI-SENSE: No

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Homo sapiens

(x) PUBLICATION INFORMATION:

(A) AUTHORS: Philbrick, .M.

Palfree, R.G.E Maher, S.E. Bridgett, M.M. Sirlin S. Bothwell, A.L.M.

(B) TITLE: The CD59 antigen is a structural homologue of murine Ly-6 antigens but lacks interferon inducibility.

(C) JOURNAL: European Journal of Immunology

(D) VOLUME: 20

(F) PAGES: 87-92

(G) DATE: JAN-1990 -92-

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9 :

GGCTTGATAT TTTCCAAATG GATCCTGTTG GG 32

•93 -

(2) INFORMATION FOR SEQ ID NO 10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 40 bases

(B) TYPE: Nucleic Acid

(C) STRANDEDNESS: Single

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: cDNA to mRNA

(A) DESCRIPTION: Probe/Primer

(iii) HYPOTHETICAL: No

(iv) ANTI-SENSE: No

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Papio hamadrvas

(vii) IMMEDIATE SOURCE:

(A) LIBRARY: Baboon Spleen Lambda ZAPII cDNA

Library, Catalog # 936103, Stratagene Cloning Systems, La Jolla, California

-94-

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10

GAAGGGATCC CGGGCGCCGC CAGGTTCTGT GGACAATCAC 40

-95-

(2) INFORMATION FOR SEQ ID NO:11:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 40 base pairs

(B) TYPE: Nucleic Acid

(C) STRANDEDNESS: Single

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: cDNA to mRNA

(A) DESCRIPTION: Probe/Primer, reverse complement of SEQ ID NO 9

(iii) HYPOTHETICAL: No

(iv) ANTI-SENSE: Yes

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Paoio hamadrvas

(vii) IMMEDIATE SOURCE:

(A) LIBRARY: Baboon Spleen Lambda ZAPII cDNA

Library, Catalog # 936103, Stratagene Cloning Systems, La Jolla, California

-96-

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:11:

GTGATTGTCC ACAGAACCTG GCGGCGCCCG GGATCCCTTC 40

-97 -

(2) INFORMATION FOR SEQ ID NO:12:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 base pairs

(B) TYPE: Nucleic Acid

(C) STRANDEDNESS: Single

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: cDNA to mRNA

(A) DESCRIPTION: Probe/Primer

(iii) HYPOTHETICAL: No

(iv) ANTI-SENSE:, Yes

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Papio hamadrvas

(vii) IMMEDIATE SOURCE:

(A) LIBRARY: Baboon Spleen Lambda ZAPII cDNA

Library, Catalog # 936103, Stratagene Cloning Systems, La Jolla, California

^■98 -

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12

GGGAGAAGCT CTCCTGGTGT TGAC 24

-99 -

(2) INFORMATION FOR SEQ ID NO:13:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 base pairs

(B) TYPE: Nucleic Acid

(C) STRANDEDNESS: Single

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: CDNA to mRNA

(A) DESCRIPTION: Probe/Primer, reverse complement of SEQ ID NO 12

(iii) HYPOTHETICAL: No

(iv) ANTI-SENSE: No

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Papio hamadrvas

(vii) IMMEDIATE SOURCE:

(A) LIBRARY: Baboon Spleen Lambda ZAPII cDNA

Library, Catalog # 936103, Stratagene Cloning Systems, La Jolla, California

-100 -

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13

GTCAACACCA GGAGAGCTTC TCCC 24

Claims

- 101 -hat is claimed is:

1. A nucleic acid molecule comprising:

(a) a sequence encoding a non-human primate complement inhibitor protein having a cysteine backbone structure defined by the formula:

Cys-X₂-Cys-X_{6 9}-Cys-X₅-Cys-X₆-Cys-X₁₂-

Cys-X₅-Cys-X₁₇-Cys-X₀-Cys-X₄-Cys, wherein the X in X indicates a peptide containing any combination of amino acids, the n in X represents the length in amino acid residues of the peptide, and each X at any position can be the same as or different from any other X of the same length in any other position; or

(b) a sequence complementary to (a) ; or

(c) both (a) and (b) ; said molecule being substantially free of nucleic acid molecules not containing (a) , (b) , or (c) .

2. A nucleic acid molecule comprising:

(a) a sequence encoding a non-human primate complement inhibitor protein having a cysteine backbone structure defined by the formula:

Cys-X₂-Cys-Pro-X₅__-Cys-X.-Asn- Cys-X₅- (Thr or Ser) -Cys-X^- (Gin or Arg) - Cys-X.- (Asn or Asp) -Cys-X._-Cys-X_-Cys-X.-Cys, wherein the X in X indicates a peptide containing any combination of amino acids, the n in X represents the - 102 -

length in amino acid residues of the peptide, and each X at any position can be the same as or different from any other X of the same length in any other position; or

(b) a sequence complementary to (a) ; or

(c) both (a) and (b) ; said molecule being substantially free of nucleic acid molecules not containing (a) , (b) , or (c) .

3. A nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: nucleotide 210 through nucleotide 416 of SEQ.l; nucleotide 93 through nucleotide 299 of SEQ.2; nucleotide 76 through nucleotide 291 of SEQ.3, nucleotide 76 through nucleotide 282 of SEQ.4; and nucleotide 76 through nucleotide 282 of SEQ.5; wherein T can also be U in these sequences.

4. The nucleic acid molecule of Claim 3 wherein the nucleotide sequence is nucleotide 93 through nucleotide 299 of SEQ.2.

5. A nucleic acid molecule comprising:

(a) a sequence encoding a non-human primate complement inhibitor protein wherein said sequence includes a region that encodes the amino acid sequence defined by the formula:

Leu-Gln-Cys-Tyr- (Asn or Ser) -Cys-Pro- ; - 103 -

or

(b) a nucleic acid sequence complementary to (a) ; or

(c) both (a) and (b) ; said molecule being substantially free of nucleic acid molecules not containing (a) , (b) , or (c) .

6. A nucleic acid molecule comprising: (a) a sequence encoding a non-human primate complement inhibitor protein wherein said sequence includes a region that encodes the amino acid sequence defined by the formula:

-Asn-Cys- (Ser or Thr) -Ser- (Asn or Gly) - (Leu or Phe) -Asp- (Ser or Thr) -Cys-Leu- lie-Ala- (Arg or Lys) -Ala-Gly- ; or

(b) a nucleic acid sequence complementary to (a) ; or

(c) both (a) and (b) ; said molecule being substantially free of nucleic acid molecules not containing (a) , (b) , or (c) .

7. A nucleic acid molecule comprising:

(a) a sequence encoding a non-human primate complement inhibitor protein wherein said sequence includes a region that encodes the amino acid sequence defined by the formula: - 104 -

-Leu- (Glu or Lys) -Asn-Gly-Gly-Thr- (Ser or Thr) - Leu-Ser- (Glu or Lys) -Lys-Thr- (lie or Val) - (Leu or Val) -Leu-Leu-Val- (Thr or lie) - (Leu or Pro) (Leu or Phe) -Leu- (Ala or Val) -Ala-Ala-Trp- (Cys or Ser) - (Arg or Leu) -His-Pro; or

(b) a nucleic acid sequence complementary to (a) ; or

(c) both (a) and (b) ; said molecule being substantially free of nucleic acid molecules not containing (a) , (b) , or (c) .

8. A nucleic acid molecule comprising:

(a) a sequence encoding a non-human primate complement inhibitor protein (CIP) comprising the amino acid sequence of a mature non-human primate CIP, said mature CIP derived in vivo from a precursor polypeptide containing a carboxy-terminal peptide sequence, at least a portion of which is not present in the mature CIP, said carboxy-terminal peptide sequence comprising an amino acid sequence defined by the formula:

-Leu- (Glu or Lys) -Asn-Gly-Gly-Thr- (Ser or Thr) - Leu-Ser- (Glu or Lys) -Lys-Thr- (lie or Val) -

(Leu or Val) -Leu-Leu-Val- (Thr or lie) - (Leu or Pro) -

(Leu or Phe) -Leu- (Ala or Val) -Ala-Ala-Trp-

(Cys or Ser) - (Arg or Leu) -His-Pro; - 105 -

or

(b) a nucleic acid sequence complementary to (a) ; or

(c) both (a) and (b) ; said molecule being substantially free of nucleic acid molecules not containing (a) , (b) , or (c) .

9. A nucleic acid molecule comprising: (a) a sequence encoding a non-human primate complement inhibitor protein (CIP) comprising the amino acid sequence of a mature non-human primate CIP, said mature CIP derived in vivo from a precursor polypeptide containing an amino-terminal leader peptide, not present in the mature CIP, said leader peptide comprising an amino acid sequence defined by the formula: et-Gly-Ile-Gln-Gly-Gly-Ser-Val-Leu-Phe- Gly-Leu-Leu-Leu- (Ala or lie or Val) -Leu- Ala-Val-Phe-Cys-His-Ser-Gly- (Asn or His) -Ser; or

(b) a nucleic acid sequence complementary to (a) - or

(c) both (a) and (b) ; said molecule being substantially free of nucleic acid molecules not containing (a) , (b) , or (c) .

10. A nucleic acid vector comprising the nucleic acid molecule of Claim 1, 2, 5, 6, 7, 8, or 9. - 106 -

11. A nucleic acid vector comprising the nucleic acid molecule of Claim 1, 2, 5, 6, 7, 8, or 9 operatively linked to a second nucleic acid molecule so that the non-human primate complement inhibitor protein is expressed in a host transformed with the vector.

12. A recombinant host containing the vector of Claim 11.

13. A purified non-human primate complement inhibitor protein having a cysteine backbone structure defined by the formula:

Cys-X₂-Cys-X₆__g-Cys-X₅-Cys-X₆-Cys-X₁₂-

Cys-X₅-Cys-X₁₇-Cys-X₀-Cys-X₄-Cys, wherein the X in X indicates a peptide containing any combination of amino acids, the n in X represents the length in amino acid residues of the peptide, and each X at any position can be the same as or different from any other X of the same length in any other position.

14. The purified non-human primate complement inhibitor protein of Claim 13 wherein the cysteine backbone structure is associated with specific amino acid residues immediately adjacent to the cysteine residues in said backbone structure in accordance with the formula:

Cys-X₂-Cys-Pro-X_{5 8}-Cys-X₄-Asn-

Cys-X-- (Thr or Ser) -Cys-X. - (Gin or Arg)- - 107 -

Cys -X - (Asn or Asp) - Cys-X₁₇ - Cys -X₀ - Cys -X - Cys .

15. A purified non-human primate complement inhibitor protein comprising the amino acid sequence defined by the formula:

Leu-Gin-Cys-Tyr- (Asn or Ser) -Cys-Pro- .

16. A purified non-human primate complement inhibitor protein comprising the amino acid sequence defined by the formula:

-Asn-Cys- (Ser or Thr) -Ser- (Asn or Gly) - (Leu or Phe) -Asp- (Ser or Thr) -Cys-Leu- Ile-Ala- (Arg or Lys) -Ala-Gly- .

17. A purified non-human primate complement inhibitor protein comprising the amino acid sequence defined by the formula:

-Leu- (Glu or Lys) -Asn-Gly-Gly-Thr- (Ser or Thr) - Leu-Ser- (Glu or Lys) -Lys-Thr- (lie or Val) - (Leu or Val) -Leu-Leu-Val- (Thr or lie) - (Leu or Pro) - (Leu or Phe) -Leu- (Ala or Val) -Ala-Ala-Trp- (Cys or Ser) - (Arg or Leu) -His-Pro.

18. A purified non-human primate complement inhibitor protein (CIP) comprising the amino acid sequence of a mature non-human primate CIP, said mature CIP derived in vivo from a precursor polypeptide containing a carboxy-terminal peptide sequence, at least a portion of which is not present in the mature CIP, - 108 -

said carboxy-terminal peptide sequence comprising an amino acid sequence defined by the formula:

-Leu- (Glu or Lys) -Asn-Gly-Gly-Thr- (Ser or Thr) - Leu-Ser- (Glu or Lys) -Lys-Thr- (lie or Val) -

(Leu or Val) -Leu-Leu-Val- (Thr or lie) - (Leu or Pro) -

(Leu or Phe) -Leu- (Ala or Val) -Ala-Ala-Trp-

(Cys or Ser) - (Arg or Leu) -His-Pro.

19. The purified non-human primate complement inhibitor protein of Claim 18 wherein the purified protein is produced by growing a recombinant host containing a nucleic acid molecule encoding said protein, said nucleic acid molecule being the nucleic acid molecule encoding the full length precursor polypeptide, mutated so that the protein is produced without at least a portion of said carboxy-terminal peptide sequence.

20. A purified non-human primate complement inhibitor protein (CIP) comprising the amino acid sequence of a mature non-human primate CIP, said mature CIP derived in vivo from a precursor polypeptide containing an amino-terminal leader peptide, not present in the mature CIP, said leader peptide comprising an amino acid sequence defined by the formula:

Met-Gly-Ile-Gln-Gly-Gly-Ser-Val-Leu-Phe- Gly-Leu-Leu-Leu- (Ala or lie or Val) -Leu- Ala-Val-Phe-Cys-His-Ser-Gly- (Asn or His) -Ser. - 109 -

21. The purified non-human primate complement inhibitor protein of Claim 20 wherein the purified protein is produced by growing a recombinant host containing a nucleic acid molecule encoding said protein, said nucleic acid molecule being the nucleic acid molecule encoding the full length precursor polypeptide, mutated so that the protein is produced without said amino-terminal leader peptide.

22. A purified protein comprising an amino acid sequence selected from the group consisting of: amino acid +1 through amino acid 69 of SEQ.l; amino acid +1 through amino acid 69 of SEQ.2; amino acid +1 through amino acid 72 of SEQ.3, amino acid +1 through amino acid 69 of SEQ.4; and amino acid +1 through amino acid 69 of SEQ.5.

23. The purified protein of Claim 22 wherein the amino acid sequence is amino acid +1 through amino acid 69 of SEQ.2.

24. A method for producing a non-human primate complement inhibitor protein comprising growing a recombinant host containing the nucleic acid molecule of Claim 1, 2, 5, 6, 7, 8, or 9 such that the nucleic acid molecule is expressed by the host, and isolating the -110-

expressed non-human primate complement inhibitor protein.

25. The product of the method of Claim 24.

26. A nucleic acid molecule comprising a nucleotide sequence selected from the following group:

(a) 5' GGAAGAGGATCCTGGGCGCCGCAGG 3' ;

(b) 5' CCTGCGGCGCCCAGGATCCTCTTCC 3' ;

(C) 5' CCCAACAGGATCCATTTGGAAAATATCAAGCC 3';

(d) 5' GGCTTGATATTTTCCAAATGGATCCTGTTGGG 3' ;

(e) 5' GAAGGGATCCCGGGCGCCGCCAGGTTCTGTGGACAATCAC 3';

(f) 5' GTGATTGTCCACAGAACCTGGCGGCGCCCGGGATCCCTTC 3' ;

(g) 5' GGGAGAAGCTCTCCTGGTGTTGAC 3'; or (h) 5' GTCAACACCAGGAGAGCTTCTCCC 3'; said molecule being substantially free of nucleic acid molecules not containing (a) , (b) , (c) , (d) , (e) , (f) , (g) or (h) .