CA2426738A1 - Streptococcal genes - Google Patents

Streptococcal genes Download PDF

Info

Publication number
CA2426738A1
CA2426738A1 CA002426738A CA2426738A CA2426738A1 CA 2426738 A1 CA2426738 A1 CA 2426738A1 CA 002426738 A CA002426738 A CA 002426738A CA 2426738 A CA2426738 A CA 2426738A CA 2426738 A1 CA2426738 A1 CA 2426738A1
Authority
CA
Canada
Prior art keywords
leu
glu
ser
ile
lys
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
CA002426738A
Other languages
French (fr)
Inventor
David William Holden
Jeremy Stuart Brown
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ip2ipo Innovations Ltd
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GB0026231A external-priority patent/GB0026231D0/en
Priority claimed from GB0028345A external-priority patent/GB0028345D0/en
Priority claimed from GB0102666A external-priority patent/GB0102666D0/en
Application filed by Individual filed Critical Individual
Publication of CA2426738A1 publication Critical patent/CA2426738A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/315Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/522Bacterial cells; Fungal cells; Protozoal cells avirulent or attenuated
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53DNA (RNA) vaccination
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Peptides derived from S. pneumoniae are identified as virulence determinants and may be useful in the preparation of vaccines for the treatment of infection. The peptides may be used as antigens or in the preparation of attenuated microorganisms for use as live oral vaccines.

Description

STREPTOCOCCAL GENES
Field of the Invention This invention relates to genes and the proteins that they encode, to vaccines containing the proteins or functional fragments of the proteins, and to live attenuated bacterial vaccines lacking any or part of the genes. More particularly, the invention relates to their prophylactic and therapeutic uses and their use in diagnosis.
Background to the Invention High affinity iron uptake mechanisms are essential for the virulence of several Gram-negative pathogens, including pathogenic Neisseria (Schryvers and Stojiljkovic, 1999), Salmonella typhimurium (Janakiraman and Slauch, 2000), Pseudomonas aeruginosa (Takase et al., 2000), Legionella pneumophila (Viswanathan et al., 2000) and Yersinia pestis (Bearden and Perry, 1999). The mechanisms by which Gram-negative pathogens obtain iron from a host have been well described. They include the secretion of low molecular weight iron chelators, called siderophores, which scavenge iron from host iron-binding proteins such as transferrin, and secreted haemophores which acquire iron from haemoglobin and haemin (Wooldridge and Williams, 1993; Wandersman and Stojiljkovic, 2000). Alternatively, proteins containing iron or haem may bind to specific receptors on the bacterial outer membrane (Wooldridge and Williams, 1993; Cornelissen and Sparling, 1994). Independent of the source of the captured iron, transport into the bacterial cytoplasm is usually dependent on cytoplasmic membrane ABC transporters (Fetherston et al., 1999).
Despite the wealth of data on iron uptake by Gram-negative pathogens, little is known about the mechanisms and importance during infection of iron acquisition by Gram-positive pathogens. Of the Gram-positive pathogens, Streptococcus pneumoniae is second only to M. tuberculosis as a cause of mortality worldwide. S. pneumoniae frequently colonises the nasopharynx and invasive infection can develop in a variety of body compartments, including the middle ear, the lung interstitium, the blood, and cerebrospinal fluid. The organism must utilise iron sources in each of these environments, but at present it is poorly understood how S. pneumoniae acquires iron and from which substrate(s). Potential iron sources in the respiratory tract include lactoferrin, transferrin, ferritin (released from dead cells shed from the mucosal epithelium), and possibly small amounts of haemoglobin and its breakdown products {LaForce et al., 1986; Thompson et al., 1989; Schryvers and Stojiljkovic, 1999).
In addition, siderophores produced by other nasopharyngeal commensuals may provide an alternative iron source. S. pneumoniae growth in iron-deficient medium can be complemented by haemin, haemoglobin and ferric sulphate but, in contrast to other pathogens of mucosal surfaces (Schryvers and Stojiljkovic, 1999; Cornelissen and Spading, 1994), not by transferrin and lactoferrin (Tai et al., 1993). Chemical and biological assays suggest S. pneumoniae does not produce siderophores (Tai et al., 1993), but a haemin-binding polypeptide has been isolated and an undefined mutant unable to utilise haemin as an iron source was reduced in virulence (Tai et al., 1993 and 1997). However, the molecular basis for iron uptake by S. pneumoniae has yet to be characterised, and iron transporters have not been proven to be virulence determinants in animal models for a Gram-positive pathogen.
Virulence determinants of Gram-negative bacteria, including iron and magnesium transporters, are frequently encoded in defined areas of chromosomal DNA thought to be acquired by horizontal transmission and termed pathogenicity islands (Pls) (Carniel et al., 1996; Hacker et al., 1997; Blanc-Potard and Groisman, 1997; Janakiraman and Slauch, 2000). Characteristically, Pls have a different GC content to host chromosomal DNA, frequently have tRNA
or insertion sequences at their boundaries, contain genes encoding mobile genetic elements, and are not present in less pathogenic but related strains of bacteria {Hacker et al., 1997). Pls often contain genes encoding virulence functions specific for the host bacteria. For example, SPI-2 of S. typhimurium encodes a type III secretion apparatus which allows the bacteria to multiply within macrophages but is not present in closely related enteric pathogens (Shea et al., 1996). Consequently, acquisition of Pls is probably a major influence in the evolution of distinct Gram-negative pathogens (Hacker et al. 1997; Ochman et al., 2000). In contrast, only a few Pls have been described for Gram-positive pathogens and they rarely have the classical genetic characteristics of Gram-negative Pls (Hacker et al., 1997). Those Pls of Gram-positive pathogens which have similar genetic characteristics to Gram-negative Pls encode toxins and are not required for the in vivo growth of the pathogen (Braun et al., 1997;
Lindsay et al., 1998). S. pneumoniae is naturally transformable and readily integrates partially homologous DNA from other streptococci into its chromosome (Claverys et al., 2000). However, this mechanism of horizontal transfer of DNA is distinct from the acquisition of Pls and no S. pneumoniae Pls have been described.
It is desirable to provide means for prevention and therapy of Gram-positive bacterial infections and S. pneumoniae infections.
Summao-y of the Invention Signature-tagged mutagenesis and genome searches have been used to identify three separate S. pneumoniae iron uptake ABC transporters, called Sit9, Sit2 and Sit3. The sequences of the Sits, Sit2 and Sit3 ABCD genes are shown in the accompanying sequence listing. The Sit2 operon is located in a pathogenicity island required for in vivo growth. Other genes that encode putative virulence determinants were also identified, and are referred to herein as MS1 to 11 and ORF1 to 14.
According to a first aspect of the invention, a peptide is encoded by any of the gene sequences identified herein as SitlA, 8 or C, Sit2B, C or D, Sit3A, B, C or D, ORF1 to 14, and MS1 to 11, or a functional fragment thereof, for therapeutic or diagnostic use.
According to a second aspect, an attenuated microorganism comprises a mutation that disrupts expression of any of the gene sequences identified above and also Sit1 D and Sit2A.
According to a third aspect of the invention, a vaccine composition comprises any of the gene sequences identified above, with an optional pharmaceutically acceptable diluent, carrier or adjuvant.
In a specific embodiment, a vaccine composition comprises a peptide encoded by Sit~D and a peptide encoded by Sit2A, or a functional fragment thereof capable of elliciting an immune response. This combination vaccine ellicits a very good immune response compared to other known peptide vaccines.
According to a fourth aspect of the invention, a peptide of the invention is used in a screening assay for the identification of an antimicrobial drug, or in a diagnostic assay for the detection of a streptococcal microorganism.
Description of the Figures The invention is described with reference to the accompanying figures, wherein:
Figure 1 is a schematic representation of the Sits and Sit2 loci, where clear boxes represent ORFs flanking the Sit loci; black boxes represent putative iron-binding receptors; grey boxes represent putative ATPases; diagonal shading represent putative permeases; and arrows represent site of insertions in mutant strains;
Figure 2 is a schematic representation of PP11, where (A) and (B) show the GC content plot for PP11, with the dashed line representing mean GC
content of S. pneumoniae DNA (38.9%), and (C) shows ORFs flanking and contained within PP11, where ORFs present in a species are marked by a cross and ORFs absent from a species are marked by a minus mark;
Figure 3 is a graphic representation of the growth of sit mutants measured by optical density, where (A) shows growth in THY broth, (B) in Chelex-THY
broth, (C) in Chelex-THY broth + 10 pM FeCl2, (D) in Chelex-THY broth + 10 pM
FeCl3 and (E) in Chelex-THY broth + 10 pM haemoglobin, and where 0 represent the wild-type strain; o a Sit1A- strain; O a Sit2A- strain; ~ a SitlA-lSit2A-strain and where (F) shows the growth of the Sit~A-lSit2A- strain in Chelex-RPMIm with X representing no supplement; represents 10 pM FeCl3; O represents 10 NM
haemoglobin; o represents 25 pM MnS04 and 25 pM ZnS04 supplements;
Figure 4 illustrates the sensitivity to streptonigrin of the Sit' strains;
Figure 5 is a graphic representation of 55FeC13 uptake, where (A)representsthewild-type, SiflA-, Sit2A~, and Sit~A-/Sit2Astrains after 15 minutes, and (B) represents the wild-type and Sit1A-lSit2A strains after 15 and 30 minutes;

Figure 6 is a graphic representation of the survival of groups of 10 mice inoculated with Sif~ mutant strains where (A) represents intranasal (IN) inoculation and (B) represents intraperitoneal (1P) inoculation;
Figure 7 is a graphic representation of the % survival of mice treated with 5 various proteins and infected with S. pneumoniae; and Figure 8 is a graph showing the survival rates for mice which were administered serum from mice immunised with various proteins of the invention, wherein series 1 represents alum only, series 2 is SitlD, series 3 is Sit2A, series 4 is pdb, series 5 is pdb + Sit~D, series 6 is pdb + Sit2A and series 7 is Sit1D +
Sit2A.
~escription of the Invention The peptides (proteins) and genes of the invention were identified as putative virulence determinants using signature tagged mutagenesis (Hensel et al., 1995).
The proteins and genes of the present invention may be suitable candidates forthe production of therapeutically-effective vaccines against Gram-positive bacterial pathogens and S. pneumoniae. The term "therapeutically-effective" is intended to include the prophylactic effect of the vaccines. For example, a recombinant protein may be used, as an antigen for direct administration to an individual. The protein may be isolated directly from a Gram-positive bacterial pathogen or from S. pneumoniae or expressed in any suitable expression system, e.g. Escherishia coli. It is preferably administered with an adjuvant, e.g. alum.
In a preferred embodiment, the vaccine composition comprises a combination of peptides of the invention, e.g. a peptide encoded by Sit1D and a peptide encoded by Sit2A, or a functional fragment thereof capable of elliciting an immune response. This double protein vaccine is shown to offer improved protection compared to the known protective antigen non-toxic pneumolysin (Pdb).
The protein may be a mutant protein in comparison to wild-type protein, a fragment of the protein or a chimeric protein comprising different fragments or proteins, provided an effective immune response is generated. Preferably, protein fragments are at least 20 amino acids in size, more preferably, at least 30 amino acids and most preferably, at least 50 amino acids in size.
An alternative approach is to use a live attenuated Gram-positive bacterium or a live attenuated S. pneumoniae vaccine. This may be produced by deleting or disrupting the expression of a gene of the invention.
Preferably, the S. pneumoniae strain comprises additional virulence gene mutations.
The mutated microorganisms of the invention may be prepared by known techniques, e.g. by deletion mutagenesis or insertional inactivation of a gene of the invention. The gene does not necessarily have to be mutated, provided that the expression of its product is in some way disrupted. For example, a mutation may be made upstream of the gene, or to the gene regulatory systems. The preparation of mutant microorganisms having a deletion mutation are shown in WO-A-96/17951. In one suitable technique, a suicide plasmid comprising a mutated gene and a selective marker is introduced into a microorganism by conjugation. The wild-type gene is replaced with the mutated gene via homologous recombination, and the mutated microorganism is identified using the selective marker.
The attenuated microorganisms may be used as carriers of heterologous antigens or therapeutic proteins/ polynucleotides. For example, a vector expressing an antigen may be inserted into the attenuated strain for delivery to a patient. Conventional techniques may be used to carry out this embodiment.
Suitable heterologous antigens will be apparent to the skilled person, and include any bacterial, viral or fungal antigens and allergens, e.g. tumour associated antigens. For example, suitable viral antigens include: hepatitis A, B and C antigens, herpes simplex virus HSV, human papilloma virus HPV, respiratorysyncytial virus RSV, (human and bovine), rotavirus, norwalk, HIV, and varicella zooster virus (shingles and chickenpox). Suitable bacterial antigens include those from: ETEC, Shigella, Campylobacter, Helicobacfer, Vibrio cholera, EPEC, EAEC, Staphylococcus aureus toxin, Chlamydia, Mycobacterium tuberculosis, Plasmodium falciparum, Malaria and Pseudomonas spp.
The heterologous antigen may be expressed in the host cell utilising a eukaryotic DNA expression cassette, delivered by the mutant. Alternatively, the heterologous antigen may be expressed by the mutant bacterium utilising a prokaryotic expression cassette.
The microorganism may alternatively be used to deliver a therapeutic heterologous peptide or polynucleotide to a host cell. For example, cytokines are suitable therapeutic peptides (proteins), which may be delivered by the microorganisms for the treatment of patients infected with hepatitis. The delivery of a polynucleotide is desirable for gene therapy, for example, anti-sense nucleotides, such as anti-sense RNA, or catalytic RNA, such as ribozymes.
Methods for preparing the microorganisms with the heterologous antigens etc, will be apparent to the skilled person and are disclosed in Pasetti etal., Clin.
Immunol, ~ 999; 92(~ ): 76-89, which is incorporated herein by reference.
The gene that encodes the heterologous product may be provided on a recombinant polynucleotide that contains the regulatory apparatus necessary for the expression of the gene, e.g. promoter, enhancers etc. For example, the prokaryotic or eukaryotic expression cassette may be incorporated in a vector, e.g. a multi-copy plasmid. Alternatively, the heterologous gene may be targeted to a gene endogenous to the microorganism, including the gene to be mutated, so that the heterologous gene becomes incorporated into the genome of the microorganism, and uses the endogenous or cloned regulatory apparatus for its expression.
The protein (or fragments thereof) of the present invention may also be used in the production of monoclonal and polyclonal antibodies for use in passive immunisation.
In a further embodiment of the invention, the protein or corresponding polynucleotide may be used as a target for screening potentially useful drugs, especially antimicrobials. Suitable drugs may be selected for their ability to bind to the protein or DNA to exert their effects. Suitable drugs may be selected for their ability to affect the expression of Gram-positive pathogenicity island genes required for in vivo growth, for example the Sit genes, thereby reducing or altering the ability of the bacterium to survive in vivo or in a particular environment. Assays for screening for suitable drugs and which make use of the protein or polynucleotides of the invention will be apparent to those skilled in the art.
Although the proteins, polynucleotides, attenuated mutants and antibodies raised against the proteins and attenuated mutants are described for use in the diagnosis or treatment of individuals, veterinary uses are also considered to be within the scope of the present invention.
In a further embodiment, promoter sequences associated with the genes identified herein may be used to regulate expression of heterologous genes.
This may be achieved either by incorporating the promoters in a vector system, e.g. a conventional gene expression vector. Alternatively, the heterologous gene may be inserted into the bacterial chromosome such that the promoter regulates expression.
In general, the techniques required to carry out the invention are those known conventionally in the art. Particular guidance is given in Sambrook et al, Molecular Cloning, A Laboratory Manual (1989), and Ausubel et al, Current Protocols in Molecular Biology (1995), John Wiley & Sons Inc.
The present invention relates to pathogenicity islands, containing genes required for the growth of Gram-positive pathogens in vivo. The example is described with reference to S. pneumoniae strain 0100993, however all pathogenic S. pneumoniae strains should have the same genes. Southern analysis and PCR have been utilised to demonstrate that Sit1 and Sit2 homologues are present in all S. pneumoniae capsular types tested, Sit1 probes hybridise to genomic fragments of other Streptococci e.g. S. mitis, S. oralis, S.
sanguis, S. milleri. Vaccines to each of these may be developed in the same way as described for S. pneumoniae.
To formulate the vaccine compositions, the mutant microorganisms may be present in a composition together with any suitable excipient. For example, the compositions may comprise any suitable adjuvant. Alternatively, the microorganisms may be produced to express an adjuvant endogenously.
Suitable formulations will be apparent to the skilled person. The formulations may be developed for any suitable means of administration. Preferred administration is via the oral, mucosal (e.g. nasal) or systemic routes.
Preferably, the peptides that may be useful for the production of vaccines have greater than 40% similarity with the peptides identified herein. More preferably, the peptides have greater than 60% sequence similarity. Most preferably the peptides have greater than 80% sequence similarity, e.g. 95%
similarity. Preferably, the nucleotide sequences that may be useful for the production of vaccines have greater than 40% identity with the nucleotide sequences identified herein. More preferably, the nucleotide sequences have greater than 60% sequence identity. Most preferably the nucleotide sequences have greater than 80% sequence identity, e.g. 95% identity.
"Similarity" and "identity" are known in the art. In the art, identity refers to the relatedness between polynucleotide or polypeptide sequences as determined by comparing the sequences, and particularly identical matches between nucleotides or amino acids in correspondingly identical positions in the sequences being compared. Similarity refers to the relatedness of polypeptide sequences, and takes account not only of identical amino acids in corresponding positions, but also functionally similar amino acids in corresponding positions.
Thus similarity between polypeptide sequences indicates functional similarity, even if there is little apparent identity.
Levels of identity between genes and levels of identity and similarity between proteins can be calculated using known methods. In relation to the present invention, publicly available computer based methods for determining identity and similarity between polypeptide sequences and identity between polynucleotide sequences include but are not limited to those of the GCG
package (Genetics Computer Group, (1991), Program Manual for the GCG
Package, Version 7, April 1991, 575 Science Drive, Madison, Wisconsin, USA
53711 ), BLASTP, BLASTN, and FASTA (Atschul, S.F. et al., J. Molec. Biol. 215:
403-410 (1990)). The BLASTX program is available from NCBI and other sources. The Smith Waterman algorithm may also be used to determine identity.
The parameters for polypeptide sequence comparison include the following:
Algorithm: Needleman and Wunsch (J. Mol Biol. 48: 443-453 (1970)).
Comparison matrix. BLOSSUM62 (Hentikoff and Hentikoff, PNAS 89: 10915-10919 (1992)).

Gap penalty: 12 Gap length penalty; 4 These parameters are the default parameters of the "Gap" program from Genetics Computer Group, Madison WI.
5 The parameters for polynucleotide sequence comparison include the following:
Algorithm: Needleman and Wunsch (J. Mol Biol. 48: 443-453 (1970)).
Comparison matrix: matches = +10, mismatch = 0 Gap penalty: 50 Gap length penalty: 3 to available as the "Gap" program from Genetics Computer Group, Madison WI.
These parameters are the default parameters for nucleic acid comparisons.
Table 1 lists the genes of the present invention and the appropriate SEQ
ID N0.

Table 1 SEQ ID NO. GENE SEQ tD NO. GENE

1 Sit1locus 39 Orf11 2 Sit~A 41 Orfl2 4 Sit~B 43 Orf13 6 Sits C 45 Orf14 8 Sit1D 47 MS1 PP11 locus 49 MS2 11 Sit2A 51 M S 3 10 13 Sit28 53 MS4 Sit2C 55 MS5 17 Sit2D 57 MS6 19 Orf1 59 MS7 21 Orf2 61 MS8 15 23 Orf3 63 MS9 Ort4 65 MS10 27 Ort5 67 MS11 29 Ort6 69 Sit3A

31 Ort7 71 Sit38 20 33 Orf8 73 Sit3C

Orf9 75 Sit3D

37 OrflO

The invention is now further described by the following Example, with 25 reference to the accompanying figures.
Bacterial strains, media and culture conditions A type 3 S. pneumoniae strain, 0100993, isolated from a patient with pneumonia was used for all experiments. S. pneumoniae strains were cultured on Columbia agar supplemented with 5% horse blood, in Todd-Hewitt broth 30 supplemented with 0.5% yeast extract (THY), or using a modified version of RPMi medium at 37°C and 5% COZ. RPMIm was made by adding to the tissue culture medium RPMI (type 1640, Gibco) 0.4% bovine serum albumin factor V (BSA, Sigma), 1 % vitamin solution and 2 mM glutamine. Medium was cation depleted by adding 2% (THY) or 6% (RPMIm) Chelex (Biorad) to broth medium for 8 (THY) or 24 (RPMI) hours under continuous agitation. THY was autoclaved and the Chelex removed by filter sterilisation before use, and Chelexed RPMI was fitter sterilised and used immediately. Chelex-THY and Chelex-RPMIm were supplemented with 100 NM CaCl2 and 2 mM MgS04 before use. When necessary the following supplements were added to medium: chloramphenicol (cm) 4 Ng ml-', erythromycin (ery) 0.4 Ng ml-', 10 to 50 NM FeCl3, 10 to 50 pM FeS04, 1 to 5 Ng ml-' lactoferrin (Sigma), 1 to 5 pg ml-' ferritin (Sigma), 5 to 10 pM human haemoglobin (Sigma), 1 to 10 pM haemin (Sigma), and 400 NM 2,2'-dipyridyl (Sigma), 25 pM MnS04; 25 NM ZnS04. Growth of broth cultures was monitored by measuring optical density at 580 nm using a Multiskan Plus Mkll plate reader (Titertek) and 200 p1 of culture aliquots in 96 well microtitre dishes, or a spectrophotometer and 1 ml cultures in sterile cuvettes. Aliquots of strains grown in THY broth to an ODS8o of 0.35 to 0.6 were stored in 10% glycerol at -70°C. To minimise Fe contamination, stock solutions were made using MiIIiQ treated Water and stored in disposable plastic ware and cultures were incubated in disposable plastic ware. Plasmids were manipulated in E, coli strain DHSa, grown at 37°C
on Luria-Bertani (LB) medium with appropriate selection (Sambrook et al., 1989).
DNA isolation and manipulation Plasmid DNA was isolated from E. coli using Qiagen Plasmid Kits (Qiagen) using the manufacturer's protocols. Standard protocols were used for cloning, transformation, restriction digests, and ligations of plasmid DNA (Sambrook etal., 1989). Nylon membranes for Southern hybridisations were prepared and probed using 32P-dCTP labelled probes made using the RediPrime random primer labelling kit (Amersham International Ltd, Bucks, UK) as previously described (Holden et al., 1989). S. pneumoniae chromosomal DNA was isolated using Wizard genomic DNA isolation kits (Promega).

Computer anal sy is of nucleic acid sequences Preliminary S. pneumoniae sequence data Was obtained from The Institute for Genomic Research website (http;//www.tigr.org) and analysed and manipulated using MacVector (International Biotechnologies, Inc.). BLAST2 searches of available nucleotide and protein databases and of incomplete microbial genomes were performed using the NCBI website (http://www.ncbi.nlm.nih.gov/blast/). Dendrograms were constructed using Multalin (http:l/www.toulouse. inra.frimultalin.html) and TreeView PPC.
Sequence GC content was analysed using Artemis (Genome Research Ltd) and graphs of GC content made with the Window application of the Wisconsin Sequence Analysis Package (Genetics Computer Group).
Construction of mutant strains Plasmids, primers and S. pneumoniaestrains constructed and used for this work are shown in Table 2.
Table 2 NAME DESCRIPTION/SE~UENCE

strains 0100993 serotype III clinical isolate sit1A~ 0100993 containing an insertion duplication in Sit1A~
made with plasmid pPCS:
cm' Sit2A~ 0100993 containing an insertion duplication in Sit2A~
made with plasmid pPC12: cm' sitlAlSit2A-0100993 containing an insertion duplication in SitlA-and in Sit2A~ made with plasmid pPCl2 and pPC25: ery' cm' PPC4 0100993 containing an insertion duplication 265 by downstream of Sit1D made with plasmid pPC4: cm' PPC29 0100993 containing an insertion duplication 234 by downstream of Sit2D made With plasmid pPC29: cm' plasmids pID701 non-replicating shuttle vector for E. coif and S.
pneumoniae derived from pEVP3: amp' cm' pACH74 non-replicating shuttle vector for E. coli and S.
pneumoniae: amp' ery' pPC4 pID701 with Smt3.3/Smt3.4 PCR product ligated into the Xbal Site: amp' cm' pPC5 pID701 with Smt6.1lSmt6.2 PCR product ligated into the Xbal Site (sit1A~
disruption vector): amp' cm' pPC12 PID7-1 with IRP1.1/IRP1.2 PCR product ligated into the Xbal Site (Sit2A~
disruption vector): amp' cm' pPC25 pACH74 with Smt6.3lSmt6.4 PCR product ligated into the Kpnl Site (sit1A-disruption vector): amp' ery' pPC29 pID701 with IRP1,7/IRP1.8 PCR product ligated into the Xbai Site: amp' cm' primers Smt6.1 GCTCTAGACCCACAAGATGCTCTTCG (SEQ ID NO. 77) Smt6.2 CGCTCTAGACGCTTGTCGTTAGCGCCACC (SEQ iD NO. 78) Smt6.3 GGGGTACCCACAAGATGCTCTTCG (SEQ ID NO. 79) Smt6.4 CGGGGTACCGCTTGTCGTTAGCGCCACC (SEQ ID NO. 80) Smt3.3 GCTCTAGAAGCTATCGCCGCCCTTGAG (SEQ ID NO. 81) Smt3.4 CGCTCTAGAGCAACCTGCGGCTAGTTTCC (SEQ ID NO. 82) IRP1.1 GCTCTAGAGTTTTAGATCATGCTTTCGG (SEQ ID NO. 83) IRP1.2 CGCTCTAGATTTGTATGCTGCTACAGGAGC (SEQ ID NO. 84) IRP1.7 GCTCTAGATTGGGTCAAATGGTTGTGG (SEQ ID NO. 85) IRP1.8 CGCTCTAGAACTAGTCGTTGTACTTTC (SEQ ID NO. 86) ORFB.1 CACACCGTAATCAAGATC (SEQ ID NO, 87) ORFB.2 CTGGTCCGTAATATAGTC (SEQ ID NO. 88) ORFD.1 GGTCTATTCGACCACCAG (SEQ ID NO. 89) ORFD.2 CTGGTGACCTGCATCAGC (SEQ ID NO. 90) ORF1.1 CACGAGTATCTACGTC (SEQ ID NO. 91) S. pneumoniae mutant strains were constructed by insertional duplication mutagenesis. Internal portions of the target genes were amplified by PCR using primers designed from the available genomic sequence, and ligated into pID701 (cm resistance, derived from pEVP3, or pACH74 erythromycin resistant. To make a SitlA disruption vector, pPCS, an internal portion of Sit9A from by 320 to was amplified using primers Smt6.1 and Smt6.2, digested with Xbal and ligated into the Xbal Site of pID701. To make a Sit2A disruption vector, pPC12, an internal portion of Sit2A from by 84 to 428 was amplified using primers IRP1.1 and IRP1.2, digested with Xbal and ligated into the Xbal Site of pID701. To make a Sit1A disruption vector, pPC25, for construction of the double mutant an internal portion of Sit1A from by 320 to 711 was amplified using primers Smt6.3 and Smt6.4, digested with Kpnl and ligated into the Kpnl Site of pACH74.
Vectors designed to insert plasmid DNA 265 by downstream of the stop codon of Sit~D (plasmid pPC4) and 234 by downstream of Sit2D (plasmid pPC29) were constructed by ligating PCR products generated by primer pairs Smt3.3/Smt3.4 s and IRP1.7/IRP1.8 respectively into the Xbal Site of pID701. The inserts of the disruption vectors were sequenced to confirm that they contained the predicted genomic sequences for their respective PCR primers.
S. pneumoniae strains were transformed using a modified protocol requiring induction of transformation competence with Competence Stimulating 1o Peptide 1 (CSP1) (Havarstein et al., 1995). 8 ml cultures of S. pneumoniae grown to an OD58~ between 0.012 and 0.020 in THY broth pH 6.8 were collected by centrifugation at 20000 g at 4°C and resuspended in 1 ml THY broth pH 8.0 supplemented with 1 mM CaCl2 and 0.2% BSA. Competence was induced by addition of 400 ng of CSP1 followed by the addition of 10 pg of circular 15 transforming plasmid. The transformation reactions were incubated at 37°C for 3 hours then plated on selective medium and incubated for 24 to 48 hours at 37°C in 5% C02. Individual mutants were made by transformation of the wild-type S. pneumoniae strain with the appropriate plasmid, and the double SitlA-ISit2A- strain was constructed by transformation of the Sit2A- strain with 2 o pPC25. The identity of the mutations carried by mutant strains was confirmed by PCR and Southern hybridisation. All mutations except pPC29 were stable after two 8 hour growth cycles in THY broth without antibiotics (Sit~A~, Sit2A-, and pPC4 100% of 100 colonies resistant to chloramphenicol; SitlA-ISit2A- 100% of 100 colonies resistant to chloramphenicol and 100% to erythromycin; pPC29 65%
of 100 colonies resistant to chloramphenicol).
Stre~toniqrin sensitivity assays For bacterial survival streptonigrin assays, stocks of S. pneumoniae strains grown in Chelex-THY broth and stored at -70°C were defrosted on ice, pelleted by centrifugation at 20000 g at 4°C and resuspended in THY to which 2.5 pg ml-' of streptonigrin (Sigma) was then added. The reactions were incubated at 37°C, and aliquots of the reaction cultures taken at 40 and 60 minutes after adding streptonigrin were diluted and plated. Cfu at each time point were expressed as a percentage of the cfu prior to adding streptonigrin and the results presented as a ratio of the wild-type strain's results. To assess sensitivity to streptonigrin discs, S. pneumoniae strain stocks cultured in Chelex-THY broth were plated on RPMIm plates with or without 50 pM FeCl3 and 400 NM DIP supplementation at s a density of several thousand colonies per plate. Antibiotic discs impregnated with 5 pg streptonigrin were placed onto the plates. After incubation for 20 hours at 37°C in 5% CO2, the width of the zone of growth inhibition surrounding each disc was measured and confidence intervals for three separate results calculated.
SeFe transport assays 55Fe transport assays were modified from previously described protocols (Bearden and Perry, 1999). Stocks of S. pneumoniae strains cultured in THY
broth and stored at -70°C were defrosted on ice and 5 x 10'cells added to 3 mls of RPMIm. After 1 hour incubation at 37°C in 5% C02, sSFeCl3 (NEN) to a final concentration of 0.2 NCi ml-' was added. The reactions were incubated for a l~ further 15 or 30 minutes at 37°C, then filtered through 0.45 pM
nitrocellulose filters (Millipore), washed with 10 ml RPMI, and allowed to dry. To reduce background radioactivity, the nitrocellulose filters were prefiltered with 40 NM
FeCl3 and 55FeC13 medium filtered through 0.2 pM membranes (Sartorius) before use. Reaction filters were placed in 10 ml of Optisafe scintillation fluid (Wallac) 2 o and counted using the 3H settings of a Beckman LS 1801 scintillation counter (Beckman).
In vivo studies using mice models of S. pneumoniae infection Outbred male white mice (strain CD1, Charles Rivers Breeders) weighing from 18 to 22 g were used for all animal experiments except for the Sit1 D and 25 Sit2A immunisation experiment. Inocula consisted of appropriately diluted defrosted stocks of S. pneumoniae strains cultured in THY broth and stored at -70°C. Strains being compared by competitive infection were mixed in proportions calculated to result in each strain contributing 50% of the cells in the inoculum.
For the pneumonia model, mice were anaesthetised by inhalation of halothane 30 (Zeneca) and inoculated intranasally (IN) with 40 u1 of 0.9% saline containing between 5 x 105 to 5 x 106 bacteria. For the systemic model, mice were inoculated by intraperitoneal injection with 100 u1 of 0.9% saline containing 5 x 10' (for survival curves) or 1 x 103 (for competitive infections) bacteria.
Three to five mice were inoculated per competitive infection experiment and sacrificed after 24 hours (1P inoculations) or 48 hours (IN inoculations). Target organs were recovered, homogenised in 0.5 ml 0.9% saline and dilutions plated and incubated s overnight at 37°C in 5% COZ on non-selective and selective medium.
Results for the competitive infections were expressed as competitive indices (CI), defined as the ratio of mutant to wild-type strain recovered from the mice divided by the ratio of mutant to wild type strain in the inoculum (Beuzon et al., 2000). Mice inoculated with a pure inocula of each strain for survival curves were sacrificed 1 o when the mice exhibited the following clinical signs of disease; severely ruffled fur, hunched posture, poor mobility, weight loss, and (for IN inoculation only) coughing and tachypnoea, Cls were compared to 1.0 (the predicted CI if there is no difference in virulence between the two strains tested) using Student's t test, and survival curves were compared using the log rank method.
15 Identification and sepuence analysis of the Sit1 and Sit2 .genetic loci A signature-tagged mutagenesis screen of S. pneumoniae strain in a mouse model of pneumonia identified a strain attenuated in virulence which contains a mutation in a gene (smtA) whose predicted amino acid product has 31 % identity and 53% similarity to CeuC, a component of a Campylobacter coli 2 o iron uptake ABC transporter (Richardson and Park, 1995). Analysis of the surrounding genome sequence (available at the TIGR website for unfinished microbial genomes, http://www.tigr.org) showed that smtA is the second gene of a four gene locus encoding a likely ABC transporter with high degrees of identity to iron uptake ABC transporters (Figure 1 ). This four gene locus was renamed 25 SitlABC and D (streptococcal iron transporter 1). Searches of the S. pneumoniae genome using IRP1, an iron regulated Corynebacterium diptheriae lipoprotein, identified a gene, Sit2A, the predicted amino acid sequence of which has 43% identity and 62% similarity to IRP1 (Lee etal., 1997).
Analysis of the genome sequence showed that Sit2A is the first gene of a second 3 o tour gene locus, Sit2A8C and D, with high degrees of identity to iron uptake ABC
transporters (Figure 1 ). Both the Sit1 and Sit2 loci conform to the reported organisation of loci encoding ABC transporters and contain one gene encoding putative ATPases, one gene encoding putative lipoprotein iron receptors, and two genes encoding putative transmembrane permease proteins (Fig. 1 ). In both loci all four genes are transcribed in the same direction and either have short intergenic sequences (maximum 135 by between Sit1 B and Sit 1 C) or overlapping ORFs suggesting they are single transcriptional units. There is a putative 19 by hairpin loop terminator sequence 72 by downstream of Sit1D. No hairpin loop terminator sequences were identified downstream of Sit2D.
The Sit1 locus is flanked by an ORF whose derived amino acid sequence has 43% identity to UDP galactose epimerase of Lactococcus lacti (terminates 392 by upstream of Sit1A, transcribed in the same direction) and a small ORF
whose derived amino acid sequence has high degrees of similarity to ORFs of unknown function (starts 230 by downstream of Sit~D, transcribed in the opposite direction) (Fig. 1 ). The Sit2 locus is flanked by an ORF whose derived amino acid sequence has 42% identity to a Bacillus subtilis RNA methyltransferase z5 homolog (terminates 1353 by upstream of Sit2A, transcribed in the same direction), and an ORF whose derived amino acid sequence has 25% identity to a Staphylococcus aureus recombinase (starts 1997 by downstream of Sit2D, transcribed in the same orientation) (Fig. 1 ). The degrees of identity and similarity between the derived amino acid sequence of the putative metal-binding receptors 2 0 of Sits, Sit9D, and Sit2, Sit2A, is low at 22% and 53%. Sit~D and Sit2A
have the highest degree of identities to separate groups of iron compound binding lipoproteins. Sit~D and Sit2A both contain motifs matching the consensus sequence for the lipoprotein signal peptide cleavage site (Sutcliffe and Russell, 1995). The derived amino acid sequences of the putative ATPases, Sit~C and 25 Sit2D, contain motifs commonly found in ATP-binding proteins (Linton and Higgins, 1998).
To assess the role of the Sit loci in iron uptake and virulence, strains carrying mutations of SittA and Sit2A were constructed by insertional duplication mutagenesis. Insertions were placed in the first genes of each loci to ensure 3 o complete inactivation of operon function. A third mutant containing insertions in both Sit1A and Sit2A was also constructed. To ensure the mutant phenotypes were not due to polar effects of the insertions on genes downstream of the Sit loci, two further mutants, PPC4 and PPC29, were constructed containing insertions 73 and 100 by downstream of the stop codons of SitlD and Sit2D
respectively (Fig. 1 ).
Growth of Sit' mutants on iron-deficient medium The growth of the Sit' mutant strains were compared with the wild-type strain in an undefined complete medium, THY, and in THY which had been treated with Chelex-100 to remove cations (Fig. 3). There were no discernible differences in growth between all the mutant strains and the wild-type strain in THY. Compared to growth in THY all strains had impaired growth in Chelex-THY, 1o and in this medium the double mutant SitlA-/Sit2A-strain had decreased growth compared to wild type and the single Sit' strains (Fig. 3). The wild-type and single SitlA- and Sit2A' strains' growth defects in chelex-THY were reversed by supplementation with 40 pM ferric or ferrous chloride, partially reversed by supplementation with 10 pM haemoglobin but not by 5 pg ml'' of lactoferrin or m pg ml-' of ferritin. Growth of the double mutant Sit1A'ISit2A- strain in chelex-THY
was restored to levels similar to that of the wild-type strain by the addition of ferric or ferrous chloride, suggesting that this strain's growth defect compared to the wild-type strain in chelex-THY is due to iron depletion. However, supplementing Chelex-THY with 10 pM haemoglobin did not restore growth of the SitlA-ISit2A-2 o strain, indicating that this strain is unable to use haemoglobin as an iron source.
These findings were confirmed by investigating the growth of the Sit' strains in a defined medium with no added iron, RPMIm. Growth of the wild-type strain in Chelex-RPMlmwas delayed and reduced compared to growth in Chelex THY but could be markedly improved by the addition of 5 pM haemoglobin or 2s haemin. Growth of the wild-type strain in Chelex-RPMIm was partially inhibited by ferrous chloride, ferric citrate and ferric chloride, possibly due to competitive inhibition of the available metal ion transporters by free iron resulting in reduced uptake of other cations. The double SitlA'ISit2A- strain was unable to grow in Chelex-RPMIm without supplementing the medium with 10 pM ferric or ferrous 3 o chloride. Supplementation with 5 pm haemoglobin or haemin, or 25 pM Mn and Zn had a minimal effect on growth. These results confirm that the double SitlA' lSit2A' strain is unable to use haemoglobin as an exogenous source of iron when growing in iron restricted medium. Hence, one substrate of the Sit1 and Sit2 loci iron transporters is likely to be haemoglobin and loss of function of either Sit1 or Sit2 can be compensated for by the other iron transporter.
Sit9A- and Sit2A- mutants have decreased sensitivity to stre,otonigrin 5 The bacteriocidal effects of the antibiotic streptonigrin requires intracellular iron (Yeowell and White, 1982). Hence, decreased sensitivity to streptonigrin is evidence of lower intracellular levels of iron and this property has been exploited to identify iron transporter mutations (Braun et al,, 1983; Pope et al., 1996). The streptonigrin sensitivity of the Sit strains were assessed by comparing the 1 o proportional survival of mutant to wild-type strains when incubated with streptonigrin and by measuring the zone of growth inhibition around a streptonigrin disc when plated on RPMIm medium (Fig. 4). Both methods showed that the Sir strains were less sensitive to streptonigrin than the wild-type strain.
Approximately 10-fold more Sit~A' and Sit2A- cells and a 1000-fold more Sit1A-1 s lSit2A cells survived 60 minutes incubation with streptonigrin than wild type cells (Fig. 4), and the zone of growth inhibition surrounding a streptonigrin disc was smaller for the Sit strains than for the wild-type strain. Supplementation with the metal chelator 2,2'-dipyridyl (DIP) accentuated differences in streptonigrin sensitivity between the Sitr strains and the wild-type strain. Strikingly, in the 2 o presence of 400 NM DlP the Sit ~A-lSit2A- double mutant was completely resistant to 5 ug streptonigrin discs. The addition of 25 pM FeCl3, but not 25 NM MnS04, to plates supplemented with DIP restored streptonigrin sensitivity, confirming that the efficacy of streptonigrin is iron-dependent. These results show the Sit cells contain less iron than wild-type bacteria and provide indirect evidence that the Sit 2 5 loci encode iron transporters. The Sit2A- strain was less sensitive to streptonigrin than the SitlA- strain, suggesting it may be the dominant iron transporter of the two. Disrupting both Sit loci has a clear additive effect, resulting in a strain highly resistant to streptonigrin. Mutant strains containing insertions immediately downstream of the Sit loci, pPC4 and pPC29, had streptonigrin sensitivities similar to the wild-type strain, confirming that the loss of streptonigrin sensitivity of the Sit- strains is due to the mutations in the Sit loci. Although pPC29 does not contain a stable mutation, over 50% of the culture tested in the streptonigrin sensitivity experiments remained chloramphenicol resistant. Hence, if pPC29 is less sensitive to streptonigrin then a partial phenotype would have been identified.
~SFeCl3 uptake by Sit mutant strains Direct evidence for a role in iron uptake of the Sit loci was obtained by measuring the uptake of the radioactive isotope 55FeC13 by the mutant and wild-type strains (Fig. 5). After 15 minutes incubation with SSFeCl3 no differences were detected between the wild-type and the single SitlA- and Sit2A- strains.
However, the 55FeCl3level was significantly lower for the SitlA-lSit2A- strain. To show that 1o the lower level of 55FeCl3for the SitlA-lSit2A- strain at 15 minutes was due to a reduced rate of iron uptake, the levels of 55FeC13 for the wild-type and Sit1A
lSit2A- strains were compared after 15 and 30 minutes incubation with SSFeCl3.
Between 15 and 30 minutes the 55FeC13 content of the wild-type strain increased by 280% whereas the 55FeC13 content of the SitlA-lSit2A- strain increased by 160%, confirming that the Sit1 and Sit2 loci function as iron transporters.
Virulence of SitlA- and Sit2A- strains in a mouse model of ,aneumonia and systemic infection The effect on virulence of mutations in either SitlA- or Sit2A- or both genes was investigated in mouse models of pulmonary (intranasal inoculation, IN) and 2 o systemic infection (intraperitoneal inoculation, IP) (Fig. 6). Subtle differences in virulence were assessed using competitive infections of the mutant strains versus the wild-type strain and the ability of the strains to cause fatal disease was assessed using survival curves. The results for the competitive infections are expressed as the ratio of mutant to wild-type colonies recovered from the target organ divided by the ratio of mutant to wild-type strains in the inoculum (the competitive index, CI) (Beuzon et al., 2000).
In competitive infections against the wild-type strain the SitlA- strain was mildly attenuated in pulmonary infection (lungs CI = 0.67, SD 0.07; spleen CI
0.4, SD 0.34), but was not attenuated in the systemic infection model (spleen CI
1.13).
2 o The Sit2A- strain was clearly attenuated in both the pulmonary infection model (lung CI 0.13, SD 0.14; spleen CI 0.14, SD 0.15) and in the systemic infection model (spleen CI 0.32, SD 0.11 ). Hence, the Sit loci seem to have different roles during infection, with Sit2 being of greater importance for both pulmonary and systemic infection. The mutant strain containing an insertion immediately downstream of the Sit1 locus, pPC4, was not reduced in virulence, confirming the reduced virulence of the SitlA' strain was not due to a polar effect. Due to its s relative instability, the mutant strain containing an insertion immediately downstream of the Sit2 locus, pPC29, was not tested in vivo. The double SitlA-lSit2A' strain was considerably reduced in virulence compared to the wild-type strain in both the pulmonary and systemic models of infection. No SitlA'ISit2A-colonies were recovered from the spleen 24 hours after IP inoculation in a mixed Zo inoculum with the wild-type strain, and approximately 103 fewer Sit1A'ISit2A' colonies were recovered from the lungs than wild-type colonies after IN
inoculation (1.3 x 104 v. 6.8 x 10'respectively, n = 3). These results suggest that mutation of both SitlA- and Sit2A- has a synergistic effect on the virulence of S.
pneumoniae. To confirm this finding, the SitlA-ISit2A' strain was compared to the 1 s Sit2A' strain in a pulmonary competitive infection. If the mutations in the Sit1 and Sit2 loci had effects on unconnected virulence functions, the consequences on the CI of the Sit2A- mutation would affect both strains in the inoculum equally.
Hence, the CI for the Sit1A'lSit2A' strain versus the Sit2A' strain would be similar to the CI of a SitlA' strain versus wild-type (CI = 0.67). However, the CI was less 2 o than 0.001 demonstrating that dual mutation of Sit1 and Sit2 has a synergistic effect on S. pneumoniae virulence.
No differences were found in the mortality of mice inoculated with the wild type or the single SitlA- and Sit2A' strains either in pulmonary (inoculum 5 x cfu , 80 to 100% mortality after 5 days) or in systemic infection (inoculum 50 cfu, 2s 100% mortality after48 hours) (Fig. 6). However the double mutant SitlA'ISit2A' strain was highly attenuated in the pulmonary infection model. After a transient illness with mild pilo-erection and decrease in mobility during the first 36 hours post-inoculation, all mice inoculated with the SitlA'lSit2A' strain recovered and survived the duration of the experiment. In contrast, the mortality of mice due to 3 o systemic infection with either single mutant (SitlA' or Sit2A-) strain was 90%.
However the time of death was significantly delayed compared to the wild-type strain (p = 0.002, log rank test).

sit2 is encoded on a ~athogenicit isy land The closest homolog of the ORF immediately downstream of the Sit2locus (ORF 1 ) is a putative recombinase carried by the S. aureus mec mobile genetic element. mec is an 'antibiotic resistance island' which confers methicillin s resistance, and the recombinase may catalyse recombination of mec into S.
aureus chromosomal DNA (Ito et al., 1999). In addition, analysis of the genome sequence showed that the Sit2 locus has a lower GC content than the upstream DNA sequence, with a striking drop in GC content occurring within the C
terminus of the ORF immediately upstream of the Sit2 locus (ORF B). These findings 1 o stimulated investigation for further evidence that Sit2 maybe part of a PI
using the available genome sequence from a serotype 4 S. pneumoniae strain.
The GC content of 250,000 by of S. pneumoniae chromosomal DNA on the contig containing Sits was 38.9%, similar to the estimate calculated by chemical methods (38.5%, Hardie, 1986). Analysis of the GC content of consecutive 800 1 s by segments of 41.6 kb of DNA including the Sit2 locus identified an area of approximately 27,000 by with a mean GC content of 32.6%, nearly 7% lower than the surrounding sequence (p < 0.001, Fig. 2). This area was termed PP11 (Pneumococcal Pathogenicity Island 1 ). The boundaries of PP11 are marked by sharp decreases in GC content (Fig. 2) and were defined to within 50 by by GC
2 o content analysis of 200 by lengths of DNA overlapping by 10 bp. The left-hand boundary lies within the C terminus of the first ORF 5' to the Sit2 loci which encodes a likely RNA methyltransferase (Fig. 2). The right-hand boundary of PP11 lies between an ORF with no close homologs in the databases and a probable transposase (Fig. 2). Visual analysis of the DNA sequence around the 25 PP11 boundaries did not identify inverted or direct repeats. Two areas within PP11 of approximately 4000 and 3200 by length have a GC content approaching that of the S. pneumoniae chromosome (Fig. 2). The putative transposase immediately downstream of the 3' end of PP11 belongs to the insertion sequence family IS605, which includes the IS200 transposons of Gram-negative pathogens 3 0 (Mahillon and Chandler, 1998). 1S605 transposons have been reported in S.
pneumoniae (Oggioni and Claverys, 1999) and are characterised by a low frequency of transposition and hairpin loops 5' to the transposase, but do not contain terminal inverse repeats (1R) (Beuzon and Casadesus, 1997; Mahillon and Chandler, 1998). In keeping with these data we identified a hairpin loop by 5' to the transposase. In addition to being flanked by a transposase, PP11 contains two ORFs associated with mobile genetic elements, the recombinase described above and a relaxase (ORF11 ). In contrast to the Sit2 locus, chromosomal DNA around the Sit1 locus has a mean GC content of 40.1 % with no regions whose GC content significantly varies from the mean for S.
pneumoniae.
In addition to the Sit2 locus within PP11 there are 14 ORFs whose 1 o predicted amino acid products are longer than 100 residues (Fig. 2).
Incomplete genome sequences are available for three non-S. pneumoniae streptococcal species (Streptococcus pyogenes, Streptococcus mutans and Streptococcus eguiy on the world-wide web (http://www.ncbi.nlm.nih.gov/blast/), allowing investigation of the distribution of the ORFs present within and adjacent to 25 amongst streptococci (Fig. 2). The five ORFs flanking PP11 have at least 59%
identity to ORFs from two or more non-S. pneumoniae streptococcal species, whereas 8 of the 14 ORFs within PP11 have no identity to ORFs from non-S.
pneumoniae streptococcal species. The remaining 6 ORFs have similar levels of identity to ORFs from non-streptococcal species and streptococcal species, 2 o varying from 22% to 42%. Furthermore, these ORFs include parts of mobile elements (e.g. ORF1 is a recombinase, ORF10 is a relaxase) or belong to families of proteins which have multiple representatives within a given genome (ORF13 is a likely ATPase and ORF11 is a possible transcription factor). Sit2A
has high degrees of similarity only to ORFs from non-streptococcal species 25 whereas Sit1D has high degrees of identity to an ORF from Streptococcus mutans (35 % identity and 52% similarity over 332 residues).
The results of the BLAST searches suggested that the ORFs flanking PP11 are present in distantly related streptococcal species whereas Sit2 and the ORFs within PP11 are not. The distribution of the Sit loci and the ORFs within and surrounding PP11 within streptococcal species closely related to S. pneumoniae was investigated by Southern analysis using internal fragments of the Sit genes and PP11 ORFs as probes under non-stringent conditions. The SitlD probe hybridised to genomic DNA fragments from S. mitis, S. sanguis, S. oralis and S.
milieri, whereas the Sit2A probe only hybridised to S. pneumoniae DNA. Hence, Sits is widely distributed amongst Streptococcus species closely related to S.
pneumoniae whereas Sit2 is restricted to S. pneumoniae. The presence of the s Sit loci in different S. pneumoniae strains was investigated using PCR with primers specific for internal fragments of Sit~A and Sit2A (Smt6.1/2 and IRP1.1/2). Both genes were present in all S. pneumoniae strains investigated.
The results of Southern analysis of different streptococcal species probed under with internal fragments of ORFs within and adjacent to PP11 are represented in 1o Fig. 2. To summarise, hybridisation signals were obtained from all viridans streptococci for ORF B and D which flank the 5' end of PP11 and the transposase at the 3' end of PP11 respectively. However, ORFs within PP11 usually gave no hybridisation signals except from S. pneumoniae, confirming that PP11 is only present in S. pneumoniae and is not present in the streptococcal species most 1~ closely related to S. pneumoniae.
The experiments disclosed herein also revealed a third iron transport system (Sit3) which contained four gene sequences (SitA, 8, C and D). The gene sequences are identified in the accompanying sequence listing.
Sit~D and Sit2A immunisation experiment 2 o This experiment illustrates the effectiveness of a vaccine comprising a combination of SitlD and Sit2A proteins.
BALBc were mice given 10 ug of protein (expressed in pQE30 expression vectors in E. coli and purified using the His-tag) via IP, on three occasions separated by 7 - 10 days, and then challenged 2 weeks after the last a 5 immunisation with 10,000 S. pneumoniae cells inoculated IP.
Alum was used as a negative control, and the non-toxic pneumolysin variant, termed Pdb, was used as a positive control (known to be protective).
The other proteins were Sit~D, Sit2A, Sit1 D combined with Sit2A, Sit~fD combined with Pdb, and Sit2A combined with Pbd.
3o Essentially, both Sit1D and Sit2A are as protective as Pdb, and the combination of Sit~D and Sit2A is very protective (80% long term survivors compared to 0% in the alum group). Combinations of Pdb and either SitlD or Sit2A had no additional protective benefit over the individual proteins (Fig.
7).
To show that the protective effect is antibody-mediated, the serum from immunised mice was given fP to another group of naive mice, and then these mice were challenged with 3000 bacteria. The results showed a clear benefit for the group receiving the combined Sit~DlSit2A antisera. The clear positive result with the Sit9DlSit2A antisera confirms that the protective effect of immunisation with Sit~D and Sit2A is a serum, i.e. antibody, dependent phenomena (Fig. 8).

References Bearden, S.W., and Perry, R.D. (1999) The Yfe system of Yersinia pestis transports iron and manganese and is required for full virulence of plague.
Mol Microbiol 32: 403-414 Beuzon, C.R., and Casadesus, J. (1997) Conserved structure of IS200 elements in Salmonella typhimurium. Nucleic Acids Res 25: 1355-1361.
Beuzon, C.R., Meresse, S., Unsworth, K.E., Ruiz-Albert, J., Garvis, S., 1o Waterman, S.R., Ryder, T.A., Boucrot, E., and Holden, D.W. (2000) Salmonella typhimurium maintains the integrity of its intracellular vacuole through the action of SifA. EMBO J 19: 3235-3249.
Blanc-Potard, A.B., and Groisman, E.A. (1997) The Salmonella self locus l~ contains a pathogenicity island mediating intramacrophage survival. EMBO J
16:
5376-85.
Blanc-Potard A.B., Solomon, F., and Groisman, E.A. (1997) The SPI-3 pathogenicity island of Salmonella enterica. J Bacteriol 181: 998-1004.
Braun, V., Gross, R., Koster W., and Zimmermann, L. (1983) Plasmid and chromosomal mutants in the iron (III)-aerobactin transport system of Escherichia coli. Use of streptonigrin for selection. Mol Gen Genet 192: 131-139.
Braun et al., 1997 Clostridia (don't have the paper for this one -use medline) Carniel, E., Guilvout, I., and Prentice, M. (1996) Characterization of a large chromosomal "high pathogenicity island" in biotype 1 B Yersinia enterocolitica. J
Bacteriol 178: 6743-6751.

Claverys, J.P., Prudhomme, M., Mortier-Barriere, I., and Martin, B. (2000) Adaptation to the environment: Streptococcus pneumoniae, a paradigm for recombination-mediated genetic plasticity. Mol Microbiol35: 251-259.
Cornelissen, C. N., and Sparling, P.F. (1994) Iron piracy: acquisition of transferrin-bound iron by bacterial pathogens. Mol Microbiol 14: 843-850.
Fetherstone, J.D., Bertolino, V.J., and Perry, R.D. (1999) YbtP and YbtQ: two ABC transporters required for iron uptake in Yersinia pestis. Mol Microbiol 32:
289-299.
Fetherstone, J.D., and Perry, R.D. (1994) The pigmentation locus of Yersinia pestis KiM6+ is flanked by an insertion sequence and includes the structural genes for pesticin sensitivity and HMWP2. Mol Microbiol 13: 697-708.
Hacker, J., Blum-Oehler, G., Muhldorfer, I., and Tschape, H. (1997) Pathogenicity islands of virulent bacteria: structure, function and impact on microbial evolution.
Mol Microbiol 23: 1089-1097.
2o Hardie, J.M. (1986) Genus Streptococcus. In Krieg, N.R., and Holt, J.G.
(ed.) Bergey's Manual of Systematic Bacteriology. Williams & Wilkins, Baltimore, pp.
1043-1071.
Havarstein, L.S., Coomaraswami, G,, and Morrison, D.A. (1995) An unmodified 2 s heptadecapeptide pheromone induces competence for genetic transformation of Streptococcus pneumoniae. Proc Natl Acad Sci USA 92: 11140-11144.
Hensel et al., (1995) Science 269:400-403.
3o Holden, D.W., Kronstad, J.W., and Leong, S.A. (1989) Mutation in a heat-regulated hsp70 of Ustilago maydis. EMBO J 8: 1927-1934.

Ito, L, Katayama, Y., and Hiramatsu, K. (1999) Cloning and nucleotide sequence determination of the entire mec DNA of pre-methicillin-resistant Staphylococcus aureus N315. Antimicrob Agents Chemother 43: 1449-1458.
Janakiraman, A., and Slauch, J.M. (2000) The putative iron transport system SitABCD encoded on SP11 is required for full virulence of Salmonella typhimurium. Mol Microbiol 35: 1146-1155.
LaForce, F.M., Boose, D.S., and Ellison, R.T. (1986) Effect of aerosolised ~ o Escherichia coli and Staphylococcus aureus on iron and iron-binding proteins in lung lavage. J Infect Dis 154: 959-965.
Lee, J.H,, Wang, T., Ault, K., Liu, J., Schmitt, M.P., and Holmes, R.K. (1997) Identification and characterisation of three new promoter/operators from m Corynebacterium diphtheriae that are regulated by the diphtheria toxin repressor (DtxR) and iron, Infect lmmun 65: 4273-4280.
Lindsay, J.A., Ruzin, A., Ross, H.R., Kurepina, N., and Novik, R. (1998) The gene for toxic shock is carried by a family of mobile pathogenicity islands in 2 o Staphylococus aureus. Mol Microbiol 29: 527-543.
Linton, K.J,, and Higgins, C.F. (1998) The Escherichia coliATP-binding cassette (ABC) proteins. Mol Microbiol 28: 5-13.
2s Mahillon, J., and Chandler, M. (1998) Insertion sequences. Microbiol MoI8io1 Rev 62: 725-774.
Ochman, H,, Lawrence, J.G., and Groisman, E.A. (2000) Lateral gene transfer and the nature of bacterial innovation. Nature 405; 299-304.

Oggioni, M.R., and Claverys, J.P. (1999) Repeated extragenic sequences in prokaryotic genomes: a proposal for the origin and dynamics of the RUP element in Streptococcus pneumoniae. Microbiology 145: 2647-2653.
3028-3033.
S
Pope, C.D., O'Connell, W,, and Cianciotto, N.P. (1996) Legionella pneumophila mutants that are defective for iron acquisition and intracellular infection.
Infect immun 64: 629-636.
of Listeria monocytogenes pathogenesis. Infect Immun 60: 1263-1267.
Richardson, P.T., and Park, S.F. (1995) Enterochelin acquisition in Campylobacter coli: characterisation of components of a binding-protein-dependent transport system. Microbiology 141: 3181-3191.
Sambrook, J., Fritsch, E.F,, and Maniatis, T. (1989) Molecular cloning, a laboratory manual, 2nd edition, Cold Spring Harbor Press.
Schryvers, A.B., and Stojiljkovic, I. (1999) Iron acquisition systems in the pathogenic Neisseria. Mol Microbiol 32: 1117-1123.
Shea, J.E., Hensel, M., Gleeson, C., and Holden, D. W. (1996) Identification of a virulence locus encoding a second type III secretion system in Salmonella typhimurium. Proc Natl Acad Sci USA 93: 2593-2597.
2s Sutcliffe, I,, and Russell, R.R.B. (1995) Lipoproteins of Gram-positive bacteria.
J Bacteriol 177: 1123-1128.
Tai, S.S., Lee, C., and Winter, R.E. (1993) Hemin utilization is related to virulence of Streptococcus pneumoniae. Infect Immun 61: 5401-5405.
Tai, S.S., Wang, T. R., and Lee, C. (1997) Characterisation of hemin binding activity of Streptococcus pneumoniae. Infect Immun 65: 1083-1087.

Takase, H., Nitanai, H., Hoshino, K., and Otani, T. (2000) Impact of siderophore production on Pseudomonas aeruginosa infections in immunosuppressed mice.
Infect Immun 68: 1834-1839.
Viswanathan, V. K., Edelstein, P.H., Pope, C.D., and Cianciotto, N.P. (2000) The Legionella pneumophila iraAB locus is required for iron assimilation, intracellular infection, and virulence. Infect Immun 68: 1069-1079.
to Wandersman, C., and Stojiljkovic, I. (2000) Bacterial heme sources: the role of heme, hemoprotein receptors and hemophores. Curr Opin Microbiol 3: 215-220.
Wooldridge, K.G., and Williams, P.H. (1993) Iron uptake mechanisms of pathogenic bacteria. FEMS Microbiol Rev 12: 325-348.
Yeowell, H.N., and White, J.R. (1982) Iron requirement in the bacteriocidal mechanism of streptonigrin. Antimicrob agents Chemother 22: 961-968.

SEQUENCE LISTING
<110> Microscience Limted <120> Streptococcal genes <130> REP06571Wo <140> not yet known <141> 2001-10-26 <150> 0026232.1 <151> 2000-10-26 <150> 00028345.7 <151> 2000-11-21 <150> 0102666.5 <151> 2001-02-02 <150> 601288,118 <151> 2001-05-02 <160> 91 <170> Patentln Ver. 2.1 <210> 1 <211> 5751 <212> DNA
<213> Salmonella pneumoniae <900> 1 cggctacctg cagagataaa ctacctaaca cgagagtaag tagtctgtct gtagtcgtcc 60 agtctgatga tttttacgat acttcgtttt tctgatcata cagttgcctc tcggcatagg 120 tcagaacttt accttgtctg ggtggttccc gttggtcgta gatagattgg atatcgctag 180 gagaatcctt ttgaactgga ggaaagaggg catcgatcaa gctactgaat actttaacta 240 agtcaaatat agtatttttc ttagtagacc taaccctttt ttcataattt ctaatggtgt 300 ttttacttat acctatctta gtacccaatt cttattgagt ccaaccatta ctagtctata 360 ttgttttata gttgattgag tttggaatag tacgctgtag ctgctaaaac atttctagaa 420 attaatttga ctttcctaat agagttgttc atatcttatt tcaatttact atagtacaaa 480 actagaaaag gaaaaaatca tgaccaaaac aattcttgtt acaggtggga ctagctacat 540 tggctcccat accgttaaag ctcttttaaa tgctggctat caggtgcatg tcctcgataa 600 tctctccaca ggaaatcgag cggctgtgga tagtcgtgct agctttaaag aactggatgt 66D
ttatgatgct agcgccttaa aggcttactt agaagaaaat cagattgatg ctgtcctcca 72p ttgtgcaggt gaaattgttg tgagcgaaag tattgaaaat ccaagtaaat acttcactgc 780 ceacgttgct ggtatgaacc aagttctcaa agtcttatct gaagttggca ttcaaaaaat 840 catgttctct tcgactgctt ctctctatgg aaataactgt attgacaagc cggtgactga 900 agataccctg ctcgaccctg tcaaccctta tgcagagaca aaactgatgg gcgaacgaat 960 gatttactgg atggccaatc gctacgactg gaaatatgtt attttccgtt actttaatgt 1020 tgctggggct gaaatggatg cttcaaacgg tctgcgtgtg aaaaatccaa ctcacatcat 1080 tccaaatatc aacaagaccg cattgggaca aaatgatagc ttaaaaatat ttggagatga 1190 ctacgataca cgtgacggtt catgtattcg agattacatt tatgtcttgg accttgcata 1200 ggctcatgtt aaaggaatga actacctatt tcaagaagac agttcttctc aaatctttaa 12&0 cttaggaact aaaaaaggct atactatcaa agaaatcttt aaaactgctg aagaattact 1320 aaattaaaaa atcccacacg agattgttgc tcgacgtgct agtgacccag ccagtgtcct 1380 agcagatgct tcaaaagcta aacaatatct tgattggacg gctagctact ccctcgaaga 1440 tattatttta tcagattaag gtaaaaacat tttagaatag gataacaaag gagaaagtct 1500 tgttgctctc tccttgttgt atttattaaa ttgtcagaaa ttttattgac agattagaaa 1560 aataatgtta catttatatc cgcagatatc tttcgatacc aaatctacat gaaaggacgg 1620 ggtatgaaac tttctcatta tttaattggc ttacttctac tcctagtctt tctctctatt 1680 agcattggga ccagtgattt ttcatgggga aagctatttg atttcgacca gcagacctgg 1740 ctcctctttc aagagtcccg tctcccaaga actatcagta ttctcctgac tgcctctagt 1800 atgagtatgg caggccttct catgcagact attacccaaa atcagtttgc tgcaccgagt 1860 acagttggaa cgactgaagc cgccaaactg ggaatggtgc tgagcctttt tgtctttcca 1920 tcggctagtc tgacccacaa gatgctcttc gcttttgttt catccatcgt attcaccctc 1980 ttcttcctag cctttatgac catttttact gtaaaggaaa ggtggatgtt gcctctgatt 209D
gggatcatct atagcgggat tatcggctca gtcacagaag ttatcgccta tcgtttcaat 2100 ctggttcaga gtatgactgc ctggacccag ggctccttct ccatgattca gacccatcag 21&0 tatgagtggc tcttcttagg cctcatcatc ctgataaccg tttggaaatt atcccaaacc 2220 ttcaccatca tgaatctagg'gaaagaaacc agcgagagtt tggggatttc ctactcccta 2280 cttgaaaaac tggccctctt tctggtggcg ctaacgacaa gcgtcaccat gattaccgtg 234D
ggtggcctac catttctcgg agttatcgtt cccaatcttg ttcgcaagcg ctatggagat 2400 aatctaagtc aaaccaaact catggtcgca ctggttggtg ccaatctagt tctggcttgc 2460 gatatcctat cccgagttct gattaggccc tatgagttgt ctgtcagtct cttgctagga 2520 atcatcggta gtctcgtctt tatcctactt ctctggagag ggggacgaaa agatgcagac 2580 taaaagcaaa cataccaagc tcttctggat tctcattatt cttgccatcg gagcttgtct 2640 tctctacttt tggcccatca ctcacttgtc agcctttgct tggaagttgc gttcccaaaa 2700 gatcatcgtt tatctcttgg tagccatcgc gactgggatt tcgaccatta gttttcaaac 2760 cctgacggaa aatcgcttcc tgacgcctag tattttggga attgaatcct tctacgtcct 2820 actacaaacc ctactactgg tttttgaaag caagtttctt caacttggca aatcccctat 2880 cttagaattc ctagtcttac ttcttgtcca gtccctcttc tttctcgcct tacaaggtta 2990 cttgaagaca ctgatgaagc aagacctggt cttcgtcctg ctgatctgtc tagcgctcag 3000 aagtctcttt cgaaatatca gcaccttcct tcaagtccta atggatccaa acgaatacga 3060 taaactgcaa aatagtcttt ttgcctcctt tcaacatctc aacacttcca tcctagccat 3120 cggttctctg atcatcctcg ctttgacaat ctttttcttt cgaaaagcag tcgttctaga 3180 tgtcttgcac ctgcaaagag aaacggctca gatattggga ctcgatgttg aaaaagaaca 3290 gaaagagctc ctctggggaa tcgtgctttt gacctcaacg gccactgcct tggtaggacc 3300 tatggccttc ttcggcttta tactggccaa cctcacctac ctgattgtca aagactatca 3360 gcacaagtta ctctttatag tggccattct ggttggattt attagcttaa ccttggggca 3420 agccttgatt gaacgagtct ttgcactgga aattcgtatc agtatgatca ttgagagtgt 3480 gggtggcttc ttattcttta tcttactata taggaggtct cgtcagtgaa actggaaaac 3540 attgacaaat ccattcaaaa acaggatatt ttgcaaggca tttcgcttga agtcagtcct 3600 caaaaactga cagcctttat tggtccaaat ggtgctggaa aatcgactct cctctccatc 366D
atgagcaggc taaccaagaa agatcaggga gttctcagta tcaaaggacg tgaaatcgag 3720 agctggaatt cgcaagaact ggcccaagaa ctaaccatcc taaaacagaa aatcaattac 3780 caagccaaat tgactgttga agaactggtc agttttggac gttttcccta cagccgaggt 3840 cgacttagat cagaagactg ggaaaaaatc cgagaaactc tgaactattt agaactgacc 3900 aacttaaaag accgctacat caatagcctg tcaggggggc aactccagcg cgtctttatc 3960 gctatggtac tggcccagga tacggacttt atcttgctgg acgaaccact caacaatctc 4020 gatatcaagc aaagcgtcag catgatgcag attcttcgac gactggtgga ggaactcggc 4080 aagaccatta tcatcgtcct ccacgatatc aacatggcca gtcagtatgc agatgaaatt 4140 gtcgccttca aggacggcca ggtctttagc aagggaagaa ccgatcaaat catgcaggct 4200 gacctgctca gtcaacttta tgagattccc atcacgctag ctgatatcaa tgacaaaaag 4260 atctgtatct atagctagta acataaaagc tcaagttaga gaaccttcag tctcttagtc 4320 aataagatta agagactccc taaatcgtta tcacatttta aaaaggagaa attatgaaaa 4380 catcccttaa actttatttc actgccctag tggccagctt cttgctccta cttggtgcat 4440 gtagtacaaa ctcaagcact agtcagacag agaccagtag ctctgctcca acagaggtaa 4500 ccattaaaag ttcactggac gaggtcaaac tttccaaagt tcctgaaaag attgtgacct 4560 ttgacctcgg cgctgcggat actattcgcg ctttaggatt tgaaaaaaat atcgtcggaa 4620 tgcctacaaa aactgttccg acttatctaa aagacctagt gggaactgtc aaaaatgttg 4680 gttctatgaa agaacctgat ttagaagcta tcgccgccct tgagcctgat ttgattatcg 4740 cttcgccacg tacacaaaaa ttcgtagaca aattcaaaga aatcgcccca accgttctct 4800 tccaagcaag caaggacgac tactggactt ctaccaaggc taatatcgaa tccttagcaa 4860 gtgccttcgg cgaaactggt acacagaaag ccaaggaaga attgaccaag ctagacaaga 4920 gcatccaaga agtcgctact aaaaatgaaa gctctgacaa aaaagccctt gcgatcctcc 4980 ttaatgaagg aaaaatggca gcctttggtg ccaaatctcg tttctctttc ttgtaccaaa 5040 ccttgaaatt caaaccaact gatacaaaat ttgaagactc acgccacgga caagaagtca 5100 gctttgaaag tgtcaaagaa atcaaccctg acatcctctt tgtcatcaac cgtacccttg 5160 ccatcggtgg ggacaactct agcaacgacg gtgtcctaga aaatgccctt atcgctgaaa 522fl cacctgctgc taaaaatggt aagattatcc aactaacacc agacctctgg tatctaagcg 5280 gaggcggact tgaatcaaca aaactcatga ttgaagacat acaaaaagct ttgaaataag 5340 ccacttcaaa ctcaatttaa tactcaatga aaatcaaaga gcaaactagg aaactagccg 5400 caggttgctc aaaacactgt tttgaggttg cagatgaaag ctgacgcggt ttgaagagat 5460 tttcgaagag tataaaattt tgacattcta aaacgcatcc tatcaagttc actcaaacct 5520 gataggatgc gtttttatca ttttgaaatc tatttacccc acctcattcc ccttcttgat 558D
ttcgtttaag ggaaaagcgg tctggaacgg ggtccttacc tgttttcgac cagggatgac 5640 aacgtaaaat ccgagccaag cccatcaata cccccttaaa cccatgtttt tcaatagcct 5700 gaatcatgta gttggaacaa gtcagctcaa agcgacaaga gggtggaaag a 5751 <210> 2 <211> 975 <212> DNA
<213> Salmonella pneumon.iae <220>
<221> cDS
<222> (1)..(975) <400> z atg aaa gga cgg ggt atg aaa ctt tct cat tat tta att ggc tta ctt 48 Met I~ys Gly Arg Gly Met Lys Leu Ser His Tyr Leu I2e fly T~eu Leu WO 02/34773 PCTlGBOI/04749 cta ctc cta gtc ttt ctc tct att agc att ggg acc agt gat ttt tca 96 Zeu Leu Leu Va1 Phe Leu Ser Ile Ser Ile Gly Thr Ser Asp Phe Ser tgg gga aag cta ttt gat ttc gac cag cag acc tgg ctc ctc ttt caa 144 Trp Gly Lys Leu Phe Asp Phe Asp Gln Gln Thr Trp Leu Leu Phe Gln gag tcc cgt ctc cca aga act atc agt att ctc ctg act gcc tct agt 192 Glu Set Arg I~eu Pro Arg Thr Tle Ser Tle Leu Zeu Thr Ala Ser 5er atg agt atg gca ggc ctt ctc atg cag act att acc caa aat cag ttt 240 Met Sex Met Ala Gly Leu Leu Met Gln Thr Ile Thr Gln Asn Gln Phe get gca ccg agt aca gtt gga acg act gaa gcc gcc aaa ctg gga atg 288 Ala Ala Pro Ser Thr Val G1y Thr Thr Glu Ala Ala Lys Leu Gly Met gtg ctg agc ctt ttt gtc ttt cca teg get agt ctg acc cac aag atg 336 Val Leu Ser Leu Phe Val Phe Pro Ser Ala Ser Leu Thr His Zys Met ctc ttc get ttt gtt tca tcc atc gta ttc acc ctc ttc ttc cta gcc 384 I~eu Phe Ala Phe Val Ser Ser Tle Val Phe Thr ~eu Phe Phe Leu Ala ttt atg acc att ttt act gta aag gaa agg tgg atg ttg cct ctg att 432 Phe Met Thr Ile Phe Thr Val Lys Glu Arg Trp Met Leu Pro Zeu I1e ggg atc atc tat agc ggg att atc ggc tca gtc aca gaa gtt atc gcc 480 Gly Ile Ile Tyr Ser Gly Ile Ile Gly Ser Val Thr Glu Val I1e Ala tat cgt ttc aat ctg gtt cag agt atg act gcc tgg acc cag ggc tcc 528 Tyr Arg Phe Asn Zeu Val Gln Ser Met Thr Ala Trp Thr Gln G1y Ser ttc tcc atg att cag acc cat cag tat gag tgg ctc ttc tta ggc ctc 576 Phe Ser Met Tle Gln Thr Hi.s Gln Tyr Glu Trp Leu Phe T~eu Gly T~eu atc atc ctg ata acc gtt tgg aaa tta tcc caa acc ttc acc atc atg 624 Ile Ile Teu Ile Thr Val Trp ~ys Leu Ser Gln Thr Phe Thr 212 Met aat cta ggg aaa gaa acc agc gag agt ttg ggg att tcc tac tcc cta 672 Asn Leu Gly Lys Glu Thr Ser Glu Ser Leu Gly Ile Ser Tyr Ser Leu ctt gaa aaa ctg gcc ctc ttt ctg gtg gcg cta acg aca agc gtc acc 720 Leu Glu Toys Leu A1a Leu Phe Leu Val Ala Leu Thr Thr Ser Val Thr atg att acc gtg ggt ggc cta cca ttt ctc gga gtt atc gtt ccc aat 768 Met Tle Thr Val Gly Gly Leu Pro Phe Leu Gly Val Ile Va1 pro Asn ctt gtt cgc aag cgc tat gga gat aat cta agt caa acc aaa ctc atg 816 Leu Va1 Arg Lys Arg Tyr Gly Asp Asn heu Ser Gln Thr Lys Leu Met gtc gca ctg gtt ggt gcc aat cta gtt ctg get tgc gat atc cta tcc 864 Val A1a I~eu Val Gly Ala Asn Leu Val T~eu Ala Cys Asp Ile heu Ser cga gtt ctg att agg ccc tat gag ttg tct gtc agt ctc ttg cta gga 912 Arg Val Leu Ile Arg Pro Tyr Glu Leu Ser Val Ser heu Leu Leu Gly atc atc ggt agt ctc gtc ttt atc cta ctt ctc tgg aga ggg gga cga 960 Ile Ile Gly Ser Leu Val Phe Ile Ireu Zeu Zeu Trp Arg Gly Gly Arg aaa gat gca gac taa 975 Lys Asp Ala Asp <210> 3 <211> 324 <212> PRT
<213> Salmonella pneumoniae <400> 3 Met Lys Gly Arg G1y Met Lys Leu Sex His Tyr Leu Ile Gly Leu Leu 1. 5 10 15 Leu Zeu Leu Val Phe I,eu Ser Ile Ser Ile Gly Thr Ser Asp Phe Ser Trp Gly Lys Leu Phe Asp Phe Asp Gln Gln Thr Trp ~eu Leu Phe Gln Glu Ser Arg Leu Pro Arg Thr Ile Ser Ile Leu Zeu Thr Ala Ser Ser Met Ser Met Ala Gly Reu Leu Met Gln Thr Tle Thr Gln Asn Gln Phe Ala A1a Pro Ser Thr Val Gly Thr Thr Glu Ala Ala Lys Leu Gly Met s5 90 95 Va1 Leu Ser Leu Phe Val Phe Pro Ser Ala Ser Leu Thr His Lys Met Leu Phe Ala Phe Val Ser Ser Ile Val Phe Thr Leu Phe Phe Leu Ala Phe Met Thr Tle Phe Thr Val Lys Glu Arg Trp Met Leu Pro Leu Ile Gly Ile Tle Tyr Ser Gly Ile Ile Gly Ser Val Thr Glu Val Ile Ala Tyr Arg Phe Asn Leu Va1 G1n Ser Met Thr A1a Trp Thr Gln Gly Ser Phe Ser Met Ile Gln Thr His Gln Tyr Glu Trp Leu Phe Zeu Gly Leu Ile Ile Leu Ile Thr Val Trp Irys Leu Ser G1n Thr Phe Thr I1e Met Asn Leu Gly Lays Glu Thr Ser Glu Ser Leu G1y Ile Ser Tyr Ser Leu Leu Glu Lys Leu Ala Leu Phe Leu Val Ala Leu Thr Thr Ser Val Thr Met Ile Thr Val Gly Gly heu Pro Phe Leu Gly Val Ile Val Pro Asn Leu Val Arg Lys Arg Tyr Gly Asp Asn Leu Ser Gln Thr Lys Leu Met Val Ala Leu Val G1y Ala Asn Z<eu Val Leu Ala Cys Asp I1e Leu Sex Arg Val Zeu Ile Arg Pro Tyr Glu Leu Ser Val Ser Leu Leu Leu Gly Ile zle Gly Ser T~eu Val Phe Ile T~eu heu heu Trp Arg Gly Gly Arg Lys Asp Ala Asp <210>4 <211>954 <212>DNA

<213>Salmonella pneumoniae <220>
<221> CDS
<222> (1)..(954) <400> 4 atg cag act aaa agc aaa cat acc aag ctc ttc tgg att ctc att att 48 Met Gln Thr Toys Ser Lys His Thr Lys Leu Phe Trp Ile Leu Ile Ile ctt gcc atc gga get tgt ctt ctc tac tt.t tgg ccc atc act cac ttg 96 Leu Ala Ile Gly Ala Cys Leu Leu Tyr Phe Trp Pro I1e Thx His Leu tca gcc ttt get tgg aag ttg cgt tcc caa aag atc atc gtt tat ctc 144 Ser Ala Phe Ala Trp Lys Leu Arg Sex Gln Lys Ile Ile Val Tyr Leu ttg gta gcc atc gcg act ggg att tcg acc att agt ttt caa acc ctg 192 Leu Val Ala Ile Ala: Thr Gly Ile Ser Thr Ile Ser Phe Gln Thr I~eu acg gaa aat cgc ttc ctg acg cct agt att ttg gga att gaa tcc ttc 240 Thr Glu Asn Arg Phe T~eu Thr Pro Ser Ile Leu Gly Tle Glu Ser Phe tac gtc cta cta caa acc cta cta ctg gtt ttt gaa agc aag ttt ctt 288 Tyr Val heu Leu Gln Thr Leu I~eu I~eu Val Phe Glu Sex Lys Phe Leu caa ctt ggc aaa tcc cct atc tta gaa ttc cta gtc tta ctt ctt gtc 336 Gln Leu Gly Lys Ser Pro Ile T~eu Glu Phe Lreu Val Ireu Leu Leu Val cag tcc ctc ttc ttt ctc gcc tta caa ggt tac ttg aag aca ctg atg 384 Gln Ser Leu Phe Phe Leu Ala Leu Gln Gly Tyr I~eu Lys Thr F~eu Met aag caa gac ctg gtc ttc gtc ctg ctg atc tgt cta gcg ctc aga agt 432 Zys Gln Asp Leu Val Phe Val Leu Leu Tle Cys heu Ala heu Arg Ser ctc ttt cga aat atc agc acc ttc ctt caa gtc cta atg gat cca aac 480 Leu Phe Arg Asn Zle Ser Thr Phe Leu Gln Val Leu Met Asp Pro Asn gaa tac gat aaa ctg caa aat agt ctt ttt gcc tcc ttt caa cat ctc 528 Glu Tyr Asp Lys Leu Gln Asn Ser Leu Phe A1a Ser Phe Gln His Leu aac act tcc atc cta gcc atc ggt tct ctg atc atc ctc get ttg aca 576 Asn Thr Ser Tle Leu Ala Tle Gly Ser Lieu Ile Ile Leu Ala heu Thr atc ttt ttc ttt cga aaa gca gtc gtt cta gat gtc ttg cac ctg caa 624 Tle Phe Phe Phe Arg Lys Ala Val Val Leu Asp Val T~eu His Leu Gln aga gaa acg get cag ata ttg gga ctc gat gtt gaa aaa gaa cag aaa 672 Arg Glu Thr A1a Gln Ile Leu Gly Leu Asp Val Glu Toys Glu Gln Lys gag ctc ctc tgg gga atc gtg ctt ttg acc tca acg gcc act gcc ttg 720 Glu Leu I~eu Trp Gly Ile Va1 Leu Leu Thr Ser Thr Ala Thr Ala Leu gta gga cct atg gcc ttc ttc ggc ttt ata ctg gcc aac ctc acc tac 768 Val Gly Pro Met Ala Phe Phe Gly Phe Tle heu A1a Asn Leu Thr Tyr ctg att gtc aaa gac tat cag cac aag tta ctc ttt ata gtg gcc att 816 T~eu Tle Val E~ys Asp Tyr Gln His hys Leu Leu Phe T1e Val Ala Tle ctg gtt gga ttt att agc tta acc ttg ggg caa gcc ttg att gaa cga 864 Zeu Val Gly Phe Tle Ser Leu Thr Leu Gly G1n Ala Leu Ile Glu Arg gtc ttt gca ctg gaa att cgt atc agt atg atc att gag agt gtg ggt 912 Val Phe A1a I~eu Glu Tle Arg Tle Ser Met Tle Ile Glu Ser val Gly 290 295 300' ggc ttc tta ttc ttt atc tta cta tat agg agg tct cgt cag 954 Gly Phe Leu Phe Phe Tle ~eu Leu Tyr Arg Arg Ser Arg Gln <210>5 <211>318 <212>PRT

<213>Salmonella pneumoniae <400> 5 Met Gln Thr Lys Ser Lys His Thr hys Leu Phe Trp Ile Leu Ile Ile Leu Ala Tle Gly Ala Cys Leu Leu Tyr Phe Trp Pro Ile Thr His heu Ser Ala Phe Ala Trp Lys Leu Arg Ser Gln Lys Ile Ile Val Tyr Leu Leu Val Ala Ile Ala Thr Gly Ile Ser Thr Ile Ser Phe G1n Thr Leu Thr Glu Asn Arg Phe Leu Thr Pro Ser Ile Leu Gly Ile Glu Ser Phe 65 70 ~ 75 80 Tyr Val Reu 7~eu Gln Thr l,eu Leu Leu Val Phe Glu Ser Lys Phe Leu Gln Iteu Gly Lys Ser Pro I1e Leu Glu Phe Leu Val Zeu Leu Leu Val Gln Ser Leu Phe PhC Leu Ala Leu Gln Gly Tyr T~eu Lys Thr Leu Met Zys Gln Asp Leu Val Phe Val Ireu Leu Ile Cys Leu Ala Leu Arg Ser 13~ 135 140 Leu Phe Arg Asn Ixe Ser Thr Phe l,eu Gln Val Leu Met Asp Pro Asn Glu Tyr Asp Lys Leu Gln Asn Ser Leu Phe Ala Ser Phe Gln His Leu Asn Thr Ser Tle Leu Ala Tle Gly Ser Zeu Tle Tle Leu Ala Leu Thr Tle Phe Phe Phe Arg I,ys Ala Val Val Leu Asp Val Leu His Leu Gln Arg Glu Thr Ala Gln Ile Leu Gly Zeu Asp Val Glu Lys Glu Gln Irys Glu Leu Leu Trp Gly Ile Val Leu Leu Thr Ser Thr Ala Thr Ala Leu Val Gly Pro Met Ala Phe Phe Gly Phe Ile Leu Ala Asn Leu Thr Tyr Leu Ile Val Lys Asp Tyr Gln His Lys Leu Leu Phe Ile Val Ala Ile Leu Val Gly Phe lle Ser Lyeu Thr T~eu Gly Gln Ala Leu Ile Glu Arg Val Phe Ala Leu Glu Ile Arg Ile Ser Met Ile Tle Glu Ser Val Gly Gly Phe Leu Phe Phe Ile Leu Leu Tyr Arg Arg Ser Arg G1n <210> 6 <211> 618 <212> DNA
<213> Salmonella pneumoniae <220>
<221> CDS
<222> (1)..(618) <400> 6 atg agc agg cta acc aag aaa gat cag gga gtt ctc agt atc aaa gga 48 Met Ser Arg Leu Thr Lys hys Asp Gln Gly Val Leu Ser Ile Lys Gly cgt gaa atc gag agc tgg aat tcg caa gaa ctg gcc caa gaa cta acc 96 Arg G1u Ile Glu Ser Trp Asn Ser Gln Glu Leu Ala Gln Glu T~eu Thr atc cta aaa cag aaa atc aat tac caa gcc aaa ttg act gtt gaa gaa 144 Ile Leu Lys Gln Lys Ile Asn Tyr Gln A1a Lys Leu Thr Val Glu Glu ctg gtc agt ttt gga cgt ttt ccc tac agc cga ggt cga ctt aga tca 192 Leu Val Sex Phe Gly Arg Phe Pro Tyr Ser Arg Gly Arg heu Arg Ser gaa gac tgg gaa aaa atc cga gaa act ctg aac tat tta gaa ctg acc 240 Glu Asp Trp Glu Lys Ile Arg Glu Thr Leu Asn Tyr Leu Glu Leu Thr aac tta aaa gac cgc tac atc aat agc ctg tca ggg ggg caa ctc cag 288 ~-1sn heu I~ys Asp Arg Tyr Ile Asn Ser Leu Ser Gly Gly Gln Leu Gln egc gtc ttt ate get atg gta ctg gec cag gat aeg gac ttt atc ttg 336 Arg Val Phe Ile A1a Met Val Leu Ala Gln Asp Thr Asp Phe Ile Leu ctg gac gaa cca ctc aac aat ctc gat atc aag caa agc gtc agc atg 384 Leu Asp Glu Pro Leu Asn Asn I~eu Asp Ile Lys Gln Ser Val Ser Met atg cag att ctt cga cga ctg gtg gag gaa ctc ggc aag acc att atc 432 Met Gln Ile Leu Arg Arg Leu Val Glu Glu Leu Gly Lys Thr Ile Ile atc gtc ctc cac gat atc aac atg gcc agt cag tat gca gat gaa att 480 Ile Val Leu His Asp Ile Asn Met Ala Ser Gln Tyr Ala Asp G1u Ile 1q5 150 155 160 gtc gcc ttc aag gac ggc cag gtc ttt agc aag gga aga acc gat caa 528 Val Ala Phe Toys Asp Gly Gln Val Phe Ser Lys Gly Arg Thr Asp Gln atc atg cag get gac: ctg ctc agt caa ctt tat gag att ccc atc acg 576 Ile Met Gln Ala Asp Leu Leu Ser Gln Leu Tyr Glu Ile Pro Ile Thr cta get gat atc aat gae aaa aag ate tgt atc tat age tag 618 T~eu Ala Asp Ile Asm Asp hys I~ys Ile cys Ile Tyr Ser <210> 7 <z11> 205 <212> PRT
<213> Salmonella pmeumoniae <400> 7 Met Ser Arg Leu Thr Lys Lys Asp Gln Gly Val I~eu Ser Ile Lys Gly Arg Glu Ile Glu Ser Trp Asn Ser Gln Glu Leu Ala Gln Glu Leu Thr Ile Leu Lys Gln Lys Ile Asn Tyr Gln Ala I,ys T~eu Thr Val Glu Glu I~eu Val Ser Phe Gly Arg Phe Pro Tyr Ser Arg G1y Arg Zeu Arg Ser Glu Asp Trp Glu Lys Ile Arg Glu Thr Leu Asn Tyr Leu Glu Leu Thr Asn Leu Lys Asp Arg Tyr Ile Asn Ser Leu Ser Gly Gly Gln Leu Gln Arg Val Phe I1e Ala Met Val Leu Ala G1n Asp Thr Asp Phe Ile Leu Leu Asp Glu Pro Leu Asn Asn Leu Asp Ile Lys Gln Ser Val Ser Met Met Gln Bile I~eu Arg Arg Lieu Val Glu Glu I~eu Gly Lys Thr Ile Ile Ile Val Leu I-Ids Asp Ile Asn Met A1a Ser Gln Tyr Ala Asp Glu Ile Va1 Ala Phe Lys Asp Gly Gln Val Phe Ser Lys Gly Arg Thr Asp Gln Ile Met Gln Ala Asp Leu Leu Ser Gln I~eu Tyr Glu Tle Pro Ile Thr I~eu Ala Asp Tle Asn Asp Lys Toys Ile Cys Ile Tyr Ser <210> 8 <211> 966 <212> DNA
<213> Salmonella pneurnoniae <220>
<221> CDS
<222> (1) .. (966) <400> 8 atg aaa aca tcc ctt aaa ctt tat ttc act gcc cta gtg gcc agc ttc 48 Met Itys Thr Ser Tyeu Txys Y~eu Tyr Phe Thr Ala Leu Val Ala Ser Phe ttg ctc cta ctt ggt gca tgt agt aca aac tca agc act agt cag aca 96 Leu Leu Leu T,eu Gly Ala Cys Ser Thr Asn Ser Ser Thr Ser Gln Thr gag acc agt agc tct get cca aca gag gta acc att aaa agt tca ctg 144 Glu Thr Ser Ser Ser Ala Pro Thr Glu Val Thr Ile hys Ser Ser Leu gac gag gtc aaa ctt tcc aaa gtt cct gaa aag att gtg acc ttt gac 192 Asp Glu Va1 Lys Tyeu Ser hys Val Pro Glu Lays Ile Val Thr Phe Asp ctc ggc get gcg gat act att cgc get tta gga ttt gaa aaa aat atc 240 l,eu Gly Ala Ala Asp Thr Tle Arg Ala Leu Gly Phe G1u Lys Asn lle gtc gga atg cct aca aaa act gtt ccg act tat cta aaa gac cta gtg 288 Val Gly Met Pro Thr Lys Thr Val Pro Thr Tyr Leu Lys Asp Leu Val gga act gtc aaa aat gtt ggt tct atg aaa gaa cct gat tta gaa get 336 Gly Thr Val Zys Asn Val Gly Ser Met Lys Glu Pro Asp Leu Glu Ala atc gcc gcc ctt gag cct gat ttg att atc get tcg cca cgt aca caa 384 Tle Ala Ala T~eu Glu Pro Asp Leu Tle Ile Ala Ser Pro Arg Thr Gln aaa ttc gta gac aaa ttc aaa gaa atc gcc cca acc gtt ctc ttc caa 432 I~ys Phe Val Asp Lys Phe Lys Glu Tle A1a Pro Thr Va1 ~eu Phe Gln gca agc aag gac gac tac tgg act tct acc aag get aat atc gaa tcc 480 Rla Ser Trys Asp Asp Tyr Trp Thr Ser Thr ~ys Ala Asn Tle Glu Ser tta gca agt gcc ttc ggc gaa act ggt aca cag aaa gcc aag gaa gaa 528 Leu Ala Ser Ala Phe Gly Glu Thr Gly Thr Gln hys Ala Lys Glu Glu ttg acc aag cta gac aag agc atc caa gaa gtc get act aaa aat gaa 576 Leu Thr vys Leu Asp Zys Ser Tle Gln Glu Val Ala Thr Trys Asn Glu agc tct gac aaa aaa gcc ctt gcg atc ctc ctt aat gaa gga aaa atg 629 WO 02!34773 PCT/GBO1/04749 Ser Ser Asp Lys Lys Ala Leu Ala lle Leu Leu Asn Glu Gly hys Met gca gcc ttt ggt gcc aaa tct cgt ttc tct ttc ttg tac caa acc ttg 672 Ala Ala Phe Gly Ala Zrys Ser Arg Phe Ser Phe Leu Tyr Gln Thr Leu aaa ttc aaa cca act gat aca aaa ttt gaa gac tca cgc cac gga caa 720 Lys Phe Lys Pro Thr Asp Thr Lys Phe Glu Asp Ser Arg His Gly Gln gaa gtc agc ttt gaa agt gtc aaa gaa atc aac cct gac atc ctc ttt 768 Glu Val Ser Phe Glu Ser'Val Lys Glu Ile Asn Pro Asp lle Leu Phe gtc atc aac cgt acc ctt gcc atc ggt ggg gac aac tct agc aac gac 816 Val Ile Asn Arg Thr Leu Ala Ile Gly Gly Asp Asn Ser Ser Asn Asp ggt gtc cta gaa aat gcc ctt atc get gaa aca cct get get aaa aat 864 Gly Val Leu Glu Asn Ala Leu lle Ala Glu Thx Pro Ala Ala Mys Asn ggt aag att atc caa cta aca cca gac ctc tgg tat cta agc gga ggc 912 Gly Lys Ile Ile Gln ~eu Thr Pro Asp Leu Trp Tyr Leu Sex Gly Gly gga ctt gaa tca aca aaa ctc atg att gaa gac ata caa aaa get ttg 960 Gly Leu Glu Ser Thx Lys Leu Met Ile Glu Asp 21e Gln Lys Ala T~eu aaa taa 966 Lys <210>9 <211>321 <212>PRT

<213>Salmonella pneumoniae <400> 9 Met Lys Thr Sex Leu T,ys Leu Tyr Phe Thr Ala Zeu Val Ala Ser Phe 1 5 1.0 15 lieu Leu heu Leu Gly Ala Cys Ser Thr Asn Ser Ser Thr Ser Gln Thr Glu Thr Ser Sex Ser A1a Pro Thr Glu Val Thr Tle Lys Ser Ser Leu Asp Glu Val Lys Leu Ser Lys Va1 Pro Glu Lys Ile Val Thr Phe Asp heu Gly Ala Ala Asp Thr Ile Arg Ala Leu Gly Phe G1u Lys Asn I1e Val Gly Met Pro Thr Lys Thr Val Pro Thr Tyr I~eu Lys Asp Leu Val Gly Thr Val Lys Asn Val Gly Ser Met Lys Glu Pro Asp Leu Glu A1a Ile Ala Ala heu Glu Pro Asp Leu Ile Ile Ala Ser Pro Arg Thr G1n Lys Phe Val Asp Lys Phe Lys Glu Ile Ala Pro Thr Val Leu Phe Gln Ala Ser Lys Asp Asp Tyr Trp Thr Ser Thr Lys Ala Asn Ile Glu Ser Leu Ala Ser Ala Phe Gly Glu Thr Gly Thr Gln Lys Ala Lys Glu Glu Leu Thr Lys Leu Asp Lys Ser Ile Gln Glu Val Ala Thr Lys Asn Glu Sex Ser Asp Lys Lys Ala Leu Ala Ile Leu Leu Asn Glu Gly Trys Met Ala A1a Phe G1y Ala Toys Ser Arg Phe Ser Phe Leu Tyr Gln Thr Leu Lys Phe Irys Pro Thr Asp Thr Lys Phe Glu Asp Ser Arg His Gly Gln Glu Val Ser Phe Glu Ser Val Lys Glu Ile Asn Pro Asp lle Leu Phe val I1e Asn Arg Thr Leu Ala Ile Gly Gly Asp Asn Ser Ser Asn Asp Gly VaI. Leu Glu Asn Ala Leu Ile Ala Glu Thr Pro Ala Ala Lys Asn Gly Lys Ile Ile Gln Leu Thr Pro Asp Leu Trp Tyr Leu Ser Gly Gly Gly Leu Glu Ser Thr Lys T,eu Met 11e Glu Asp I1e Gln ~ys Ala T~eu Lys <210> 1D
<211> 27540 <212> DNA
<213> Salmonella pneumoniae <400> 10 tgtcgataag cacataagtg ttgaaattga gctggatgag atggatttga caagtgcgga 60 gagcaaagca acatatgctc aaatcaaaga atatgtttgg aataaatttg aattaaaagt 120 ttcgacatta tatattgcac agataaaaaa gaaatgtgga atagaattac gagaacatta 180 caacaagtct aaaaaggata aacaaattat tccacagtgt acacctgaaa aagaagaagc 240 catcatggat gctttgagac acttcaaaat gatttaatag aaaagaatga cagtatatga 300 ctttctgcat ttattacatt cctacttggt ataggaacag ctattattcc tttcttgcaa 360 ggtatcaatt agaaaatagg ctcaatataa agattgatag gatcattttt atatttaaag 420 gagcgttgaa atgattgata aaggcaacaa aaaattttag gataaatttg ctaagttgta 480 tgcctctttt atgaaaaaag ataaagaggt ttatgataaa gtttgtgaat atcttagtcc 540 tcatttgaat aaagatatgg aggtgcttga acttgcttgt tggtttcgtg tcataacagt 600 tatagaggca aatagttatg taaatataag gagttcaaga cttctaccaa agtttaaaac 660 tcaaaaaata aatagttggt gtgctgctta caatatccat tttaataatg gatattgtaa 720 gcagcacacc taatgaattt aaagattctt taaagagtct tattttgtga tgaaaattta 780 atatgtaaat ctcagacgat agaaattaaa aactctatcg tcttttttat actcaaaatt 840 aggaggtaaa aatggtaagg ataagaggtc ccacttaaaa caatttatgg caaaataagg 900 acggaataac acaacaaatt ctctaaaaca aatcactaaa tcaatgtaag attgaatgaa 960 atcaatattt atgctataat taaataaatt taatgaagaa aaaaagaggg atattatggc 1020 acttaactat aaaccattat ggatacagtt agcaaaaaaa ggactaaaga aaacagatgt 1080 aatagctatg gcaggactta caacaaatgt tatggcacaa atgggaaagg ataaaccaat 1140 tacatttaag aatttagaaa gaatatgtaa ggctttatct tgcactccta atgatattat 1200 tagttttgaa gataatttta gtgacgagga atagaaaatg actttaagga cagaagatca 1260 agttagggat tatgcaagag aagtataggc tttaatgaag ttgaagaaaa catcaatcaa 1320 ggtactggtc aaataactac ttttaatcaa ttaggcttca agggatattc aaataagcca 1380 gatggttggt atttacctaa aaatatgaat gatgtagcaa taatccttga aacaaaatca 1440 gaagaaagag atattagcaa acaaattttt attgatgagt taatgaaaaa tatagacata 1500 atttaactaa aaataaaaac tagatccttt tttgaaaaaa ttatattatt aaatttgtaa 156D
ctgtatctat tgacaatgat aattattatc gatacaatag acttgaaata tgtttaagga 1620 gtttttatga aaaacaaatt ttttctaata gctattttag ctatgtgtat agtttttagc 1680 gcttgttctt ctaattctgt taaaaatgaa gaaaatactt ctaaagagca tgcgcctgat 1740 aaaatagttt tagatcatgc tttcggtcaa actatattag ataaaaaacc tgaaagagtt 1800 gcaactattg cttggggaaa tcatgatgta gcattagctt taggaatagt tcctgttgga 1860 ttttcaaaag caaattacgg tgtaagtgct gataaaggag ttttaccatg gacagaagaa 1920 aaaatcaaag aactaaatgg taaagctaac ctatttgacg atttggatgg acttaacttt 1980 gaagcaatat caaattctaa accagatgtt atcttagcag gttattctgg tataactaaa 2040 gaagattatg acactctatc aaaaattgct cctgtagcag catacaaatc taaaccttgg 2100 caaactttat ggagagatat gattaaaatt gattcaaaag ccttaggtat ggaaaaagaa 2160 ggtgatgagt taatcaaaaa tactgaagct cgtatatcca aagaattaga aaaacatcca 2220 gaaatcaaag gaaaaatcaa aggaaaaaaa gtattattta ctatgattaa tgctgcagat 2280 acatcaaaat tctggattta tactagcaaa gatccaagag caaattattt aacagattta 2340 ggtctagttt tccctgaatc attaaaagaa tttgagagtg aagatagttt tgcaaaggaa 2400 atttctgcag aagaagcaaa taagataaat gatgctgatg taatcataac ttatggtgat 2460 gataaaactc ttgaagcttt acaaaaagat cctcttttag gtaaaataaa tgcaattaaa 2520 aatggtgccg ttgctgtaat tccagataat acaccgttag cagcctcatg cactccaaca 2580 ccactttcaa taaactatac tattgaagaa tacctaaatc ttttaggaaa tgcatgcaaa 2640 aatgcgaaat aaaaaacaaa taaacctagg cataattttt ataatctgcc taggtcttct 2700 tattacaata tttttgtcat taaagcttgg aacaaaagaa attaatatca gagatttttt 2760 agcagctttt ggaatgggta atacaaatga tgattttatt aaatcaatta tatataaaag 2820 aatacctaga actatttttg caattttagc aggttctagt cttgccataa gcggtgtatt 2880 gatgcaatca gttactagaa acccaatagc tgatccaggt atactcggta taaacacagg 2940 agcaagtctt agtgtagtaa ttggtctttc ttttttagga atttcatcaa gcataagcca 3000 tataagtttt gcaatcattg gtggcttagt aagtgcaatt tttgtatacg cgattgctgt 3060 aagcggaaaa gcaggcctta cccctataaa acttgcctta tcaggaactt gtgttagtat 3120 ggctttaagc agttttgtaa gttttttaat tttaccgaat aataacgtct tagacaaatt 3180 tagattttgg caaataggta gccttggagc agctacatta tcttctatat ctacactact 3240 accttttata attttaggtc acttgatagc tatatttatt tcatcagatt taaacgcttt 3300 agctatgggt gatgaaatgg ctgttggtct tggagttaat gttaatagga taagatcact 3360 tgcaataatt gcaagtgtgc ttttatgttc aagtattact gcaattggtg gacctattgg 3420 cttcgtaggt cttatagttc ctcacttttg tggcttattt ataagcaaag atatacgcac 3480 aatgaccatt tcttcatctt ttataggtgc agagctcttg cttatatgtg atataatcgg 3540 ccgtatgtta ggtaaaccag gtgaaattga agtagggata attactgcaa taatcggggg 3600 tccagtactt atttatgtaa ctatgaaaaa tagaggggtt aataactaat gcaaaattta 3660 attataggta ttcaaaaaag aaaaaataga ataacactat tttcctcact atttttatta 3720 ataataatca gtctatcatt tttcatttta cttatcggag atgaaagtta ttctttttca 3780 actttgatta aagtcttaaa tagtgaaact gttcctggag ctagtttttc gattatggaa 3840 attagattac caaaattatt agcaggaatt atagctggct ggtcttttgg attggcagga 3900 tttatctttc aaactatgtt aagaaatcct cttgcaagtc ctgatataat cggtgtcaca 3960 agttcttcat ctattgcagc ggtcttttgc atattggtat taaaaacaaa tagtttaact 4020 actggaatta tttcaataac ttgtggacta acatcatctt taatattatt tttactagct 4080 aaaaaagatg gtttttcagc agcaagactg ataatattag gtattggttt tcaagctgtc 4140 acaagagcag gcacctcatt tttattgttg aaagtagcaa gatatgaatt acaagaagtt 4200 atgagatggc tcagtggctc tttatctttt acaaagttag atgacatacc tcttgttcta 4260 atagtaagta ttattgctac tatattagtt ttatttttta ataaaagact agaaattatt 4320 gaacttggtg aagaaatagc aatcggactt ggagcaaatc ccgagctttc aaggcttgtt 4380 ttaatttttt gcgctgtatc tttaactgct ttttctactt caattacagg accaatagct 4440 tgtatatctt ttttagctgg tcccatagcc ttaaatattg gcaagaaaag aagcccaata 4500 ttagctggat tggttggaat tttactagtt ttgttatcag acatattctc tcaaaatatt 4560 ttaccagcta gatatccagt aggtgttgta actggcttgt taggttcacc atacttaata 4620 tacttactaa taaaaatgaa caggaggaat atataatgaa aggtctgtgg tcaaataatc 4680 ttacctgcgg ttatgatgaa aaaataatct tggaaaatat aaatataaaa atacctgaag 4740 aaaaaatatc agttattatt gggtcaaatg gttgtgggaa atcaacactc attaaaacct 48D0 tgtctcgact tataaagcca ttagagggag aagtattgct tgataataaa tcaattaatt 4860 cttataaaga aaaagattta gcaaaacaca tagctatatt acctcaatct ccaataatcc 4920 ctgaatcaat aacagtagct gatcttgtaa gccgtggtcg tttcccctac agaaagcctt 4980 ttaagagtct tggaaaagat gaccttgaaa taataaacag atcaatggtt aaggccaatg 5040 ttgaagatct agcaaataac ctagttgaag aactttctgg gggtcaaagg caaagagtat 5100 ggatagctct agccctagcc caagatacaa gtatcctact tttagatqag ccaactactt 5160 acttggatat ctcatatcaa atagaactat tagacctctt gactgatcta aaccaaaaat 5220 ataagacaac catttgcatg attttgcacg atataaatct aacagcaaga tacgctgatt 5280 acctatttgc aattaaagaa ggtaaacttg ttgcagaggg aaagcctgaa gatatactaa 5340 atgataaact agttaaagat atctttaatc ttgaagcaaa aattatacgt gaccctattt 5400 ccaattcgcc tctaatgatt cctattggca agcaccatgt taactcttaa taattgaata 5460 ttggaattca tttaaaagtc gcaaattttg aactgaccct caaaagttag gccaaaaaac 5520 taactaaagg aggtcagttt tttaatggca aatacagcac agaatttaag ataaaattag 5580 taaaagaata tcatgaatga aaaataggat atagagaata acagcaatat taaaaagatc 5640 aggactgata ataaacaaaa agaaagtaca acgactagtt caaaagctaa aacttcaagt 5700 aaaaagttat tcaagaaaat ctagaaaata ctcatcctac aaaggacagg taggaaaaat 5760 atcagacaac aaaataaaaa gaaatattta ttaccgaaaa aaaggggaaa tcgagttaag 5820 taccaacagg ctcatctatt ccaaaaagat atttactcga tggaaaaact cctagaatta 5880 gtgctacaaa tattgacaat ggtatcttag gttactacga agatatagat gataaaaatt 5940 atagagtttt tgaaaatttt atatctgttt catttttagg agcagtcttt tatcataaat 6000 ataaagcaag cctagatatg aaaattcatt gtttaaaatt aaaaaataaa gaattgaata 6060 aagaagtagc attctattta acttcaatta ttaggcaagc tttaaaaaat actgaatata 6120 aagatcaaat atctagcaca gtattgccag atatcaaaat taaattaccg atagacagta 6180 gaggtactcc agattggaat tacatggaaa gatatagaga tagataaaga gagagaggga 6240 gagatagata aaaagtccac ccccattttt tatggagaat tcaaaaatgt aaggttaagc 6300 aaagaagaat ataaaaatct aaaagaaaaa ttaaactcac acacagatat aatgataaat 6360 aaactatcca gatacatgga aagcagtggt aagacctatc aaaaccacta tgtgacaatc 6420 ttaaaatggt atgaagaaga taaagacaaa ctaagacaga aaggtttaaa taaaaaaatg 6480 aattatgatg taggagaatc tttatagata aaaagaggtg gaaaggcact attaaagact 6540 ttaagtctaa aaaggtatca aagtatgcca gagataaaaa aatataaata tgacacttta 6600 aaggcgatta gaaaattaaa gaaatgctag aagactttta gatgacagtt accaagaggg 6660 tctaattttc actgctattt atgcagtggg aattggacct ttttatataa gcaaattcta 6720 tttcaaaatt ggttaccaag aaagacttct tttcactgtt aagtataaga gggtaattta 6780 tagaattttg ttacatcaag ataaatattt tctgatggtc aaattttaaa aagattaata 6840 actctcgata aattttgaac cttaacaatt gaatagacca agacaagacg ttaattattt 6900 ttggagcgta ataacctatc cgtcaagatc tttcggctga ataattcggc aaaaaaagtt 6960 ctgctaagca aaaagaaagt gagcgataag taagagtttg aatataggga gggataccct 7D20 atccgctatg aagaaaatga gggtaatgat acttctaagg ttgaagccgg ctcatccgga 7080 atagaggcgg aagtgagatt cctatgttgc taatccaaag cacttgtcaa tgtcaaaaaa 7140 cttaattaaa caaataatta ttagatataa aactttagag gaggtatata ttggacaatg 7200 actggaatgg attggctgat ttaatagcaa atctgattgc aaaatatgct ggtgctttag 7260 atttagataa tctacccgat ccaacgccag caaaaaatca agagatgaaa aatagttttg 7320 acatggcaaa aacacaaatt gagacggact aataaaagtg ttataatata cttgaaatga 7380 tagtccaaac ttaaattaaa aaaattatat atgatataga aaaattatat tgaggttaat 7440 actatgtcaa aagaaaaaat aaaagtatac ctctatacac gagtatctac gtcaatacag 7500 atagaggggt attcgttaga ggcacaaaaa tcacgaatga aagcttttgc tatttacaac 7560 gattatgaaa ttgttggaga gtatgaagat gccgggaagt ctgacaagtc tattgaaggt 7620 agaatacagt tcaatcgaat gatggaagat ataaaatctg gaaaagatgg agtatctttt 7680 gttcttgtgt ttaagttatc aagatttgca agaaatgccg ctgatgttct ttctacactt 7740 catataatgc aggattatgg agttaatctt atctgcgttg aagatggcat tgattcatct 7800 aaagatgctg ggaaactaat gatttctgtt ttatcagctg tggctgaaat agaaagagaa 7860 aacatcagta ttcaaacaat ggaaggtcgc attcaaaaag caggggaagg aaaatggaat 7920 ggtggctttg ctccgtatgg atataaactt gaagacggca agctgtttat aaatgaggaa 7980 gaggcagttg caataagaac gattttcgac cagtatgtaa atactacgat aggagccaat 8040 gggatatcta aatacttaga gaatcatgga attagaaaaa tcccaagaca gaatggtaag 8100 aatcctttgt ttgatgcagg tcttataaga aagatattaa agaatcctgt atataatggg 8160 aaaatagcat ttggaagaag aactttagaa aaagttcatg gtacaagaaa tgaatataag 8220 caggttgaac aagatgaata tctaatatct gaagggatac atgaagctat agtttccgat 8280 gaagtttggc aagctgctca ggttaagcta aaatctcaag caaagaaata tgagcatgtg 8340 aataaaggaa aagatacacg cacacacttg ctttctggaa ttgtaaaatg cccgatatgt 8400 ggagtgggaa tgtttgggaa caagtgtatc aagaaaaaga aagatggcac aaagtataaa 8460 gatttttatt actatggttg taaccatagg cagatgataa gaggtaataa gtgtacattc 8520 agtaagcaaa ttagagaaga attgttagat gatgctgttg cagaggtgat tgtcaagata 8580 gtaagtaatc cgaaatttgc ttctatgatg caagaaaaaa tcaacatgaa ggtggatacc 8640 tctgaaatag aaaaagaaat agataattac caaaaggaat tgagaaagag tcattctaca 8700 aagtttaagc taattgagga aatagataat ttagatgttg aagataagca ttataagaga 876D
aggaaacagg atttagatga tagactatat cgtatgtatg acaaactaga tgaattagaa 8820 tcatcactaa ttgatgcgaa agcaaagaaa cagactattg aagctgaaaa gcttacagga 8880 gataacatat ataaggttct gatctatttt gataagctct ataaagtcat gaatgatgta 8940 gagcgtaggc agttaatttc agctttgatt tctgaaattc aagtttatga agaaaaacaa 9000 tctaacggac aatggctaaa atccattact tttaagctac caattataga agaaaatctc 9060 aacataggtt tggacaatga tgaacaagtt gaatgtgtaa gtttattaga gaaacgtagt 9120 taatcctcaa aaggttcccc gaaccttttg agtcccactg acgcatcacg ctgaggcggt 9180 atcactgctt gtacgagttg aagcatcagc aaagtaaaag tagatgttca gccaatgcga 9240 cgaggtgaga ccgaaggtcg ataaggtgtg ttctgggtat aagactcgta aagtaagtag 9300 gaaatatgat gagatgatac agagagcctg aattggtcag gtgacgtgct tatttacatt 9360 agcctgataa tg~aaatgga gagattatcg atggttatat tggaattgta ccaaaatgat 9420 tattctaaag atttagtagc atttgattcc atagaagatg ggaaagcctt tgtagctcaa 9480 atcccgggat acactctgga aacagaagat ggttttgaag tggagtattt taatcctaaa 9540 aacataccgg attatatgga aattattttt aacggaaata ttgttccttt atctaaattt 9600 atgttcgatc ctgaggaaaa tgtaaacatt atttggaaag agatttcaaa tttatccctc 9660 aaaaatgata gagtgatcga aggatattca aaaattgatg catatgtcgt taacaaccat 9720 gaagttaaag cctatgtcga aacaagagaa acgaactatc gtaaagcaaa agacttctta 9780 gaaagccgcg gatatgaaat cgacagaagc tttttcggaa gtgaagacgg tgaagcgatt 9840 ctttacagaa aaaaagggat cgaagtttgg catttcttgt gtcacttaga cccaatgttt 990D
gtagagattg aagatgtaga aggatatgtt aaagaagaag ttggagagat tcaatagtca 9960 accaaagttc cttgtgagta tatacctttg ctagtaaaag agtcaaaacg ttataacgaa 10020 gggggggaag aaaacccttg agtgtaagtc tttttcttgt ttagagggaa agtattagag 10080 tagccgctca taatttatac tagatttgat aactgatttg agacagattt tatttctata 10140 aatattgtga aaatttttta ataccaaaga tttaaagtta ctgtgttaaa aatcctctcc 10200 acttttaaac taatgtatta taaaagccag ttgacactag tgttacacct gtgatagaat 10260 taacttgagg tgatgaaaat ggcaaccgat aaaaatagaa taatgattag cttggatgat 10320 aaaaatctag agaaacttga aaatttagta gaagatgcta gagatagaag gggaatgcga 10380 ctaacaaagt cccaggttat tgaattactc ctaaataccg ttgattattt cgatgatatt 10440 atgggggcta tttactcaaa aaaataagag caaaattgct attatttttt acaaattggt 10500 gtaacactag tgatatagga gtgatgaaat ggttgtttat attagacaaa gtaaattacc 10560 aagtgaggtt tcaattaata aatacaatgc tcaagtaggt gcctacttac aaggagaaga 1D620 agttatttta tatcaatctt tttctgaaat aaaagagtta acaagtgaag atatagttgt 10680 agattatata atggagacta gagcattact aaaaatgatg ggcttaaacg ttccggttca 10740 tgactatcct attgagctta aagagtttta tggtcgaaag atttatgctg gtattttagg 10800 agagattgtg aatatacctg ataattgggg aaaatttatt aagcctaaag ctggttcaaa 10860 agtctttact ggaagagttg ttaatggaac ccatgattta ataggtattg gtctaccttt 10920 cgactatcct atatggatta gtgaggttgt agaattcata gctgaatggc gttgttttgt 10980 gttagatggt cgcgtattag atgttcgacc ctatacaggt gattatcatg cacaatttga 11040 tgcaagtgta attgatgaag cgatatcatg ttggaaagat gcgccaatag cttatggact 11100 agatatcggt gttactcgcg atggcagaac acttgttgtt gaagtaaatg atggttatgc 11160 attgggaaat tatggcctat ctcctttaaa atcaatcaat tttcatagag ctaggtggaa 11220 agaaatggta aaaccctatt ttgaaaaaaa tgaaattttt aaaatccaac aggatgttat 11280 tttctaaaat aaatatggta gataaccaat ataaaaagca tcaaaatgaa caaggaggaa 11340 tctgatgctt ggagcaatta ttggagatat tgtcggttct gtttacgaat ggaacaatat 11400 caaaacaaag gactttcctt tatttcggaa ggactgcttt tttacagatg acacggttat 11460 gacctgtgct gttgcagaag caattatgaa tggtggacaa aaagatgact tcattgacgc 11520 gatgaagaaa tatggcagaa tgtatccgaa tgctgattac ggtgctcggt ttaatgcatg 11580 gctaaacagc gataaccgtg agccttataa tagctttggg aatggatcag ctatgcgtat 11640 ttctccatgt gcttggatca tggactgtgg tttttatgcg aaaactggta tatggccatc 11700 atctagagga cttacgagtc tttctgcaga ggtaactcat aatcatccag aaggtgtcaa 11760 aggcgctatg gctacagctg atgctatctt tctatgtcgt ttttactttg gtggttattg 11820 tagagagtac gagcaatcaa ttaacgacaa tcctacagag tgtaaaagac gaattaagga 11880 ttatatagaa aaagaatacg attacaatct atctcaaact ttagatgaaa tccgtcctaa 11940 ctatcgtttt aacgaaacat gtcaggaaac tgtccctcaa gccattatcg cctttcttga 12000 aagtagagac ttcgaagatg cgataagaaa~ tgccatctca cttggtggcg acagtgatac 12060 tctcgcagca atcacttgta gcatagcaga ggcagcttac ggtattcctg attggatcaa 12120 ggataaggcc tattcttact tggatgaacc cttaaaggat gtagttaggc gatgggaaaa 12180 tagaataaaa gcgtattaat ctccagtacg tcagatttct cttttctgta ttttcattgt 12240 ataataggat tacatttact tgcatacgac gaaatgtaaa catttctgtt taaaattaag 12300 gataaaatca atgaaaaaag caatggtaat tatcaaccct acttctggtg gcgagaaggc 12360 tttggattac aaagaaaagc tggagaataa agcaaaagaa tactttgaat atgttgaaac 12420 caaaattacc gaaaaagcgc tggatgcaac acattttgct gaagaagctt ctcgtgagca 12480 gtatgatgca gtggttgtgt ttggtggaga tggaactgtc aatgaagtca tttcaggtat 12540 tgatgagaga gactacattc ctaagttagg gattatccca ggcggtacgg gtaacctcat 12600 tacaaaactt ttggaaatca atcaagacat cgatggcgca attgacgaac tggattttga 12660 tttaaccaat aagattgata tcggtaaagc aaatgacaac tattttggtt atatctttag 12720 tatcggttct ctgcctgagg cgattcacaa tgttgaaata gaggacaaaa caaaattcgg 12780 tattttaacc tatgctgtaa ataccatgaa gtctgtcatg acagatcagg tctttaacat 12840 taaggttgag acagaaaatg gaaattatgt tggtgaagct agccatgttt tggtcctttt 12900 gacaaattac ttcgctgata agaaaatctt tgaagaaaac aaggacggct atgccaacat 12960 tttgattctg aaagatgcct ctatattctc caaattatcc gtcattcctg atttattaaa 13020 aggggatgtt gtcgcaaatg ataatatcga gtatatcaaa gcgcgtaata ttaaaatctc 13080 ttcagatagt gaattggagt cagatgttga cggagataaa tcagataacc tacctgtaga 13140 aatcaaagtc ctagctcagc gagtagaagt attttcaaaa ccgaaagagg attagtatat 13200 agagaaagcc ttttttaagg ctttttgtat actttaaaag atagttcctt taacaacgga 13260 cattccttgc aaatagtttt acaaaaatag tatactggat tcattgagtt tgaaaacgtt 13320 tgcgtaaaat ttgaatgaat actttaggag acaaattgat ggaattgagt gctatttacc 13380 ataggcctga gtcggagtat gactatcttt ataaggataa gaaactccat attcgaattc 13440 gaactaagaa aggggacatt gaaagcatca acttgcacta tggggaccct tttatcttta 13500 tggaggagtt ttatcaggat acaaaagaaa tggtcaagat aacttctggt accttatttg 13560 accattggca ggttgaagtg tcagttgact ttgcacgtat ccagtatctc tttgagctca 13620 gagatacaga aggtcaaaat attttgtatg gcgataaagg gtgtgtggaa aattctctag 13680 aaaatcttca tgcaattggg aatggattta agttgcctta gcttcatgag attgatgcct 13740 gcaaggttcc tgactgggtt tcaaatacgg tatggtatca gatatttcct gaaagatttg 13800 ccaatggcaa tgctctatta aacccagaag ggactttaga ctgggattca tctgtcacac 13860 ctaagagcga tgatttcttt ggtggtgatt tacaggggat tattgatcat atgaattact 13920 tgcaagactt gggtattact ggactatatc tttgtcccat ctttgaatct acaagcaatc 13980 acaagtacaa tacgacagat tactttgaaa ttgaccgtca ttttggagac aaggagacct 14040 ttcgggaact ggtggatcaa gcgcatcatc gtggcatgaa agtcatgctg gatgcggtat 14100 ttaatcatat tggttcgcaa tctcttcaat ggaaaaatgt cgtcaaaaat ggtgaacagt 14160 ctgcttataa ggattggttc catattcaac aattcccagt gacaactgaa aagctagtta 14220 ataagagaga cttaccctat catgtttttg gtttcgagga ctatatgcct aagctaaata 14280 cagccaatcc agaggtcaag aattatcttt taaaggttgc gacttattgg attgaagagt 14340 ttaatatcga tgcttggcgt ttggatgtgg ctaatgagat tgaccatcag ttctggaagg 14400 attttcgtaa ggcagtttta gctaaaaatc ctgatcttta tatcctagga gaagtctggc 14460 atacatctca gccttggcta aatggagatg agttccatgc cgtcatgaat tatcctttat 14520 ctgatagtat caaggactat ttcttacgag gaattaagaa gacagaccag ttcatcgatg 14580 aaatcaatgg agagtctatg tattacaagc agcagatttc agaggtcatg tttaatctct 14640 tggattcaca tgatacagag cgaatcctgt ggacggccaa tgaagatgtt caactggtta 14700 aatcagcctt agcctttctc tttttacaaa aaggaacacc gtgcatttat tacggaaccg 14760 agctagcctt gactggagga ccagatccag attgtcgtcg ttgtatgcct tgggaacgtg 14$20 tatcaagtga caatgatatg ctgaacttta tgaagaggct gattaaaatt cggaaatacg 14880 cgtcagtaat catttcgcat ggcaagtata gccttcaaga aatcaactct gatctagtag 14940 ctctggaatg gaaatacgaa ggacggatcc tcaaagcaat attcaaccaa tcaacagaag 15000 attatctttt agagaaagaa gcagtagcac tagcaagcaa ttgccaagaa ttggataatc 15060 agcttgtcat ctctccagat ggatttatga ttttctaaaa actagttgat gaagattatg 15120 gtacatttca taccttatat agtataataa ggctagttac taaacttgta aaggagaact 15180 taaatgaatt gtagaggaca tgaaacaaga caaagaattg ttagagattt tgaagttcag 15240 cctaaagcac atattaagct gttagcaaat caacaaaaac atagtgatgc aggagcaact 15300 attgaagatg aatattatgt atttatcgct gagagtaaaa ttgatggcaa gaaggaagtt 15360 attcagtgtt gcatgggtgc ggcaagggat tttttagaac taattaatca caaagggcta 15420 cctcttttta atccgcttgt aggtgattct catgtaaata atagacaaga atatgacaat 15480 acagggagtg gaaatttata acctgaaaag tggaatgaaa ctgcaaagca gctttataat 15540 gctataatgt ggttgattat tttatggaat gctaagccgg atacaccttt atttaatttt 15600 aaagacgaag taattaagta taaaacatat gagccttttg aaagcagtat aaaaagagta 15660 aatactacta taaagaatgg tagtaaaggg aaaactctga ctgagatgat taatggctac 15720 agagcggata acgatattag agatgaaatt tgtaacttta atattctgaa aaataaaatt 15780 cgtgatatga aaaaccaaca aggaaataca atggaatctt acttttagtt attgttgaat 15840 tttgggtatt ctataaaata tcctaattga gatttaaata gtagactata caatatagtt 1.5900 aaaatatcag taaaaacaac actttattga ggtattggat acgctttgct aatagcctaa 15960 taatcacatg tggagtgttg ctacaacgaa aaaggtgata atccttgatt tcaagctatt 16020 ttataagcat tttgtctttg tagataaagg caattttgac aataaaaatc ctaaaaggtg 16080 aatcgttata gatgtatttg tagatatcgt ttgcgcatcg aaaaaattaa tacaagaata 16140 aatatttata gctctttagg tgacttttat agaagtaaag tttaggatag aaaaacaaga 16200 aataacgcac catttttggt gcgttatgct tttttatgct ataatggatt tataaaaata 16260 aaggagtttg ctatgattgg aaagaacata aaatccttgc gtaaaacaca tgacttaaca 16320 caactcgaat ttgcacggat tgtaggtatt tcacgaaata gtctgagtcg ttatgaaaat 16380 ggaacgagtt cagtctctac cgaattaata gacatcattt gtcagaagtt taatgtatct 16440 tatgtcgata ttgtaggaga agataaaatg ctcaatcctg ttgaagatta tgaattgact 16500 ttaaaaattg aaattgtgaa agaaagaggt gctaatctat tatctcgact ctatcgttat 16560 caagatagtc agggaattag cattgatgat gagtctaatc cttggatttt aatgagtgat 16620 gatctatctg atttgattca tacgaatatc tatctagtag aaacttttga tgaaatagag 16680 agatatagtg gctatttgga tggaattgaa cgtatgttag agatatctga aaaacggatg 16740 gtggcctaat ggaaatccaa gattatactg atagtgaatt caaacatgct ttagcaagga 16800 atcttcgttc actgacaaga ggaaaaaagt ccagtaagca acctatagcg attttacttg 16860 gagggcaaag tggtgccggt aagactacaa ttcatcgtat taaacagaaa gaatttcaag 16920 gaaatattgt tatcatagat ggtgatagtt ttcgttctca gcatccacac tatttagaac 16980 tgcagcaaga atatggcaaa gacagtgtag aatataccaa agattttgca ggaaaaatgg 17040 tagagtcttt agtaacaaaa ttgagtagtt tgagatacaa tcttttgata gagggaactt 17100 tacgaacagt tgatgttcca aagaaaacag cacaactctt gaaaaataag ggatatgaag 17160 tacaattggc cttaattgcg acaaagcctg aattgtcgta tctaagtact cttatccgtt 17220 atgaagaact gtacattatc aatccaaatc aagcacgcgc aactccaaaa gaacatcatg 17280 atttcattgt aaatcatcta gttgataaca cacgaaaatt ggaagaacta gctatctttg 17340 aaagaattca aatttaccaa cgagatagaa gttgtgtata tgattcaaaa gaaaatacaa 17400 cttcagcagc agatgttctt caagagttac tctttgggga gtggagtcag gtagagaagg 17460 agatgttgca ggtgggggaa aagagactta atgaattact tgaaaaataa acaattgata 17520 tttttaggag aatagaaatg agagggttta ataacaagat aaagtctgtt tatcaagaac 17580 taacaaattc caaagagaaa ttcggtagct ttcacaagac tttaattcat ttgcatacac 17640 ctgtttctta tgattacaag ctattttcta attggactgc aacgaaatat agaaaaatta 17700 ctgaagatga actatatgat atattttttg aaaataagaa aataaaagtt gataagacaa 17760 ttttttttag taattttgat aaggttgttt tttctagttc aaaagaatat attagttttc 17820 ttatgttagc agaggcaatc ataaaaaatg gaatagaaat agttgtagta actgatcata 17880 atactaccaa aggtattaaa aagttacaaa tggcagtctc aatcataatg aaaaattatc 17940 cgatttatga tatacatcct catattttac atggagtaga aattagtgca gcagataaat 18000 tgcatattgt atgtatatat gattatgaac aagaatcatg ggttaatcaa tggttaagtg 18060 aaaatattat aagtgagaaa gatggaagtt atcaacattc actgactata atgaaggatt 18120 tcaataatca aaaaatagtt aactatattg ctcatttcaa tagttatgac attttgaaaa 18180 aaggttctca cttatcaggt gcatataaac gaaaaatttt ttctaaagaa aatacacgat 18240 tttggagttt aatattaact cgaaagaatc ttcgcaacaa cttgatattc tctataaaga 18300 agttggtgta ttaagtttgg gacaaaaagt tgtagccatg cttgattttt tattagcata 18360 tagtgattat tctaaagact tcagaccatt gattattgat cagcctgaag acaatctaga 18420 caatcgttat atttacaggc atttagttca gcagtttaga gatgtgaaag ctcaacgtca 18480 aattatttta gcaacacata atgctacaat tgtaacaaat tctatgacag atcaagttgt 18540 tattatggag tcagatggag ttaacggatg gattgaatca cagggatatg ttagtgaaaa 18600 atatataaaa aatcatatca tcaatcaatt agagggagga aaagattcct tcaagcataa 18660 aatgtctata tatgagacgg ctttatcaga gtagagtcag aaaaagtagg ttagaaattt 18720 agcctacttt tttctttgtc cgacaggcat agtgtacatc tgaggtccaa gtcctctgtg 18780 gatatttgct gcagatgaaa ccaatagcga ctcctaagcc tgaatatcgt gaggtagggg 18840 ggataggaag gaattagcga aatcaaggtt ctacaaacag aatcgtgact tgaagccata 18900 tatagcggat gaggaactct aaaatccaaa taggtgtcgt aacctatata cgtaaattac 18960 gagagtaaac taggaaagat gtacggctta ttccgtgagc gtttaggacg tagtacaacg 19020 aatcatggga gtcagctgaa cacatagtat tgaagaaatt tctgtaatgg aaatggagcg 19080 aagaagtgaa caattaaatg aatacctctc taattaaatt tgtcaattct aattcctggt 19140 atgaaaagac agtgacctga aaatgtaaac gatgggagct gatcataaat ataggacggt 19200 acatgcagtg gtgttagaga ttagtcctta cttgatttgt gataacttcc ccaaatttct 29260 tctgctatac ttttctcaac ttttaaaaat ccaactaaga attttacctg ggggtttggg 19320 ggcggagcac taagttatct tatcgttagc tgtcaaaact ggtaggtttt gataggctgg 19380 cgatatgatt tttgggatat tgtggacaca atatctgagc tcgcaaagcc ttacaagaat 19440 gaaaatcagt tgttggaaaa gtgtactgac attgtatggt agctcacatt gtcagtacaa 19500 gtattttgga aaggaagtag cagtatgaaa cgagatgtgc gtgatattcg gaaacaattt 19560 cgtttaacag aagcagaaga aaagcaaatt ctagctttga tgagagagcg gggagagact 19620 aatttctctg attttcttcg taaaagttta ctttcctctg atttacaaaa acagatggag 19680 acatggtttg ccctctggca atcccaaaaa ctagaacaaa tcagtcgtga cgttcatgaa 19740 gttttaatct tggcacagtc agaacgtcaa gtcacccaag agcatgtatc tattctctta 19800 acgtgcgtgc aggaattgat tcaagaggtt gcaaacacca tacccctcag taaagaattt 19860 cgtgagaagt acatgaggta agcacatgga acatcgttac cgaaccaatc tcaagaaagt 19920 gtttttgtct gatagtgagt tgaaccaact aaatataaat atcgatcaaa gtggttgtaa 19980 atccttttct gaatatgcga gacgaactct actcgatcct ggtatgaatt ttatcacgat 20040 tgacacaaac ggttaccaag atttagtgtt tgagttaaag aggattggca ataatatcaa 20100 ccagattgct cgaagtgtta atcaatctca gttaatttct ggtgaagaat tgcaggagtt 20160 gaaaaaagga attggtgaat tgataaaaga agttgataag gaatttaatc tgcaagcgca 20220 gaagctaaag gagttccatg gtcatcacta aacactttgc cattcacgga aagagttacc 20280 gcagaaagct tatcaagtac attctcaatc ctgagaaaac caataatctt gccttggtgt 20340 cggactatgg catgaagaat tttctggact ttcctagcta tgaggaaatg gtgcagatgt 20400 atcatgaaaa tttcatcagc aacgatacgc tttacgattt tcgccacgac aggatggaag 20460 aaaatcaacg aaaaatacac gctcaccaca tcattcagtc tttctcgcca gaggatcata 20520 tcactcctga acaaatcaat cggataggtt atgagactgt gaaggaatta actggtggca 20580 aatttcgttt tatcgttgcg acccatgttg ataaagacca cctgcacaat cacatcatta 20640 tcaattcagt agatagcaat tctgacaaaa agctcaagtg ggactacaag gtggagcgaa 20700 atcttcgcat gatttctgac cgtttttcta aaatcgcagg tgctaaaatc attgagaacc 20760 gctattctca ccagcggtat gaagtctatc gtaagactaa tcacaagtat gaactcaagc 20820 agcgactcta ttttttgatg gaacattcta gggactttga ggatttcaaa aagaatgctc 20880 cgctactaca tgtggagatg gatttccgtc acaagcatgc cacctttttt attacggact 20940 caactatgaa acaggtggtg cgtggcaagc aactcaatcg caagcagcct tacacagaag 21000 aattttttaa gaactacttt gccaaaagag aaatagaaag tctcatggaa tttttattgc 21060 tgaaagttga gaatatggat gatttacttc agaaagcaaa actttttgga ctaactatca 21.120 atcctaaaca aaagcatgtt tcttttcaat ttgcaggagt ggaggtaaag gagacagagc 21180 tagaccagaa aaatctttat gatgtagagt ttttccaaga ttattttaaa aatagaaaag 21240 attggcaagc tccagaaact gaggatttcg ttcaacttta tcaagaagaa aagttatcca 21300 aagaaaaaga acttccaagc gatgagaagt tctgggagtc ctatcaagag ttcaagagta 21360 acagagatgc cgttcatgaa tttgaggtgg agttgtcact caatcaaatt gaaaaagtag 21420 tggatgatgg aatttacgtc aaggtcaagt ttggtattcg tcaggaggga cttatctttg 21480 tgccgaacat gcagcttgat atggaagagg ataaggtgaa ggttttcatc agggaaacca 21540 gctcctacta tgtctaccac aaagacgctg ccgagaaaaa ttgttatatg aaaggtcgaa 21600 ccttaattag acagttcagc tatgaaaatc aaaccattcc attacgcaga aaagcgacag 21660 tcgatatgat taaagagaag attgcggaag tggatgcttt gattgaactg gaagtagaaa 21720 atcaatctta tgtcacgatt aaagatgagt tagtgcatga actagcagcg tctgaattga 21780 gaatcaatga gttgcaagaa cgaatgtcaa ccttgaatca agtagcagaa tatctactgg 21840 cttcagttga aagtaagcaa gaaatgaaat taaatctttc aaaactgaat ataactgaga 21900 atatcagtgc taatattgtt gagaaaaaat tgaagagcct ggggaatcaa ctggaattgg 21960 aaaggggcag gtatgaaaag atggtagtca ggctagataa atttataaat cgcttaaata 22020 caggactttc aaaaggagat gggatagatt ttcaaaaata ggaatctagc caataattat 22080 atacaatgtg tatcttttgt aaaatatatt tgaaatttag atttaatcat gttacaatta 22140 acattgaaat caaatagaaa aggaagatgc aaacgtgggt acactattag caacaagatt 22200 aaaaaataga cgaaaagaat taaaaatgtc tcagcgagaa ttagctgagg gtatctgtaa 22260 acaggggcaa attagtcgat tagagagtgg agagttcacc cctggagcgg attttttaca 22320 tgcccttgct aagaaattaa aagttagtat ggactacttt tttgatgagc aggttgtaga 22380 ggaagtcaat gagttatcag agtttaagaa gttagcacag acatttatca caaatcgtaa 22440 ttatgaatct ttaaaatata tatatgaatt ggaaaatgta aaagcccatc gcttatctct 22500 agcagataaa ttttacatgg aatggataaa gtctcttata gatttttatt tttatggaca 22560 gaaagaagag gcaattacac gattagagaa tatgctacct cagttaaatg tatctgattt 22620 gaactacctt caagtttcaa acactctatt caatttttat tatgatattg aagatttaga 22680 acgttttaat gagattagag acaagctaga gcatcaagtg aatcagctta atttaaacac 22740 aattgaagag ttagaactat caattaagtt caattataac gtttgtcgat acctatggtt 22800 acagaaaaat attgaagaag ctattacgaa aatcacagct acgataaagc aatgtaagga 22860 gtacaggaca acttatctat tagctgattt gtatttattg atgggaagtg taagtgaaaa 22920 tttttcttct aaaagttcag taaaagaata ttttgagact gctcattttc tctacaaact 22980 tgaggaaaac atgtcaatgg ctttgaaagt cgaacattat tttgcagata taacagaata 23040 aggaatacgg tgttctagtg agcatcgttt tttaaatcta atttgaatac aaaaaagtat 23100 taaataaaaa aaaataaaaa aagattataa aaatacttga caagctaatt ttgaagtgat 23160 aaaataaatg caagaaaacg aaaggagagg tatatgagaa gtttgtttag gaaaattgtt 23220 gctttgttag tcataggatt aatcctatta gggactgctg gaggaactca agttcataag 23280 atggctagag ggattgatcc aggtcctgcg aatggtattt atagatagga gattatagtc 23340 acttaaaaat caaaaaatta taaaattttt gttttactta aatagatatt ttatgatggg 23400 cgaagttttt ataactagtt cctataagta cagaaaccta ttttaattta ctaatttcaa 2346D
aacaattttt tgagatatat gtaattaaat ctaaattaag ctttaaaaaa ttatttttag 23520 caatttgatt ttgaaagtgt catgcagcaa tatgaaagcg tagaatagag gtgtttccaa 23580 tgtacaagta agttttgatt ccaaataaag taatagaaaa ggagctatat aatgagtagt 23640 caaatgaaag ctttcttgaa tgaacttcaa ggaaatatgg aagttgttgg agaatttttt 23700 gataatcctg aaaaggtaat tagaaaattt ggaattgtcg gaagagagaa ggaagcattg 23760 ctaatccgtg acttaaatga tatggatgat tatgctcttt caattcaaaa tagcgttgca 23820 tcgccttctg gggcacatag tagcacttgc cattttgtta gacaagattt acaatccgca 2388D
taattgttaa tatataaaac ataaaatttc aattttcaat tagggataat agaattcctt 23940 actatgatat agaaagtgaa ttaattagga aatcttagtc agaggtttct gattaattca 24000 ttttttatat attaagagtg atgtgaaatg ttcaaattgt gagactactc tcggattgtt 24060 gtatagaaat ttaaaatttt attgtgagct ttttaaggaa gagtggccga tatgaaaaat 24120 aaatacgatg ttaaaagaat tattccggat gaattatcag aatcactaga tatttttcta 24180 aaaaattatt ctgaaactgg attgtcagat tataatactt atctctttta tggttttatc 24240 ttgaagtcct ataaattgcc tcgagaaaat agatatagca taaaattatt ggtgaaggaa 24300 ttacaaaata gaggactgaa agttacattg attatcaaca tttattatca cgctttaaat 24360 tgtttggctt taaatgatgg tctaaaaatt tatggagaag atttcttaat atgaattacg 24420 aaaagtattt aaactatttg gactatgaaa ctgaaataga agacgcatac cataatttat 24480 tattagaata taaaattagt gataatttta gtgatgaaca ttggttatat aatttgccgt 24590 ctaatatcac ccaatctaag ggatttaaaa tacacctgag cgcttcaata ttaaatgcta 24600 atttggttgc taaaaaattc tttgatttta tattttctag agagaagaag ataaatttca 24660 aaattttggt tagcattaaa gaactttctt tgcaaaatac agggcttaat ggttattcac 24720 aagtcgggaa attcattaca atttatccaa aagataataa agagtttcaa cgtttgttac 2478D
acaaattaga aatattgtat aaaggtgtaa agggtgtaaa cataccatca gatttcagat 24840 ttcaacttag cgaggttgta tattacagat atggggagtt cgtaaaagat agcactttca 24900 aggataaaag agataagaaa atcccttcaa atgtgaatgt tccaataagg gattactata 24960 ttccaagata taacactatt cctgatcaat atattatttt ggaagtgatt tctaaaaatg 25020 ccaaaggtgg agtttataaa gtatttaata ctcaaaagcg agtttattct ttattaaaag 25080 aagctagtga tttatcgttg gttgatttta caaatagaga ttctgtgaat cgtttaataa 25190 atgaaagaga aatattagta gaattggaaa aggaggaatt tactccaaaa gtttttaacg 25200 atttttacat aaagaattcg tattttgtgg aatttgagtt tattattgca gataaattaa 25260 gcgagtataa tatggttagt ggctcgtatg attggttttt aacattaatt gattatatgg 25320 agataataaa ctccaaatat aatctttcct atagagattt atcatttaat aatatactta 25380 ttgataatag aaataatatt tatattatag actttgagca tgccctaagg aaagaaactc 25440 aaattgaaga aaaaaagttg cctctatttg gaactccagg gttttatgaa accaacttaa 25500 atttattgaa taatcaacca gaggatatta tgggattggt tttgttatta tattggagtc 25560 agaatttaga tgattttaac gtcttttcaa aaatgagttt tttagaagcg atggagtatg 25620 caatgaattt taattcgcgt cgcttagaca cacttgataa atcagattgg ctttatgata 25680 tttataaaaa agcgttcaat tataaatatg atactttttc tgaattaaaa aaagatttta 25740 tagaggtatt aaaataaagg taggggtgtt atgaattgtt tcttgaaaat gaataatgta 25800 agtgttcgtt atgatgacgt aatagcttta aaagatataa ctttacaaat aaataaggga 25860 gatttcattg gcttattagg ttcaaatggt gcaggtaaat ctacgttaat taattctatt 25920 gtaggttttc aagagattta tttaggagaa atagagtatt gtgataaaga tttgatagtt 25980 agttctcaac cttttgctca tttaggcttt actcctcaaa ccacagtaat tgatttttat 26040 actactgtga aggacaatgt aatattgggg ctgaaccttg ctggaaagtt tgggaaaaat 26100 gctgagaagt tgtgtcaaat agccttagaa attgt~tgggt tagctgataa aaaaaataat 26160 ttggtagaaa cattgtcagg tggacaactg caacgcgtcc agattgctag agcaatagct 26220 cataatccag atttttatat tttagatgaa cctaccgttg gtttagatac tgaatctgcc 26280 gaaaaatttt taatgtattt aaaagataag agtttggaag gaaaaactat tatcatatct 26340 tcacatgaca taaatctact cgaaaagttt tgtaaaaaaa tacttttttt acaaaatggc 26400 tccatatcat tttttggtga tatgcgtgac tttgtagata attcaactat caaattaaat 26460 ttttcaatgc agaatagaat ttctagatat caaattgaat ttttagaaaa ttttagattt 26520 aaagttcaca tcgaagataa tgatagtttt acaatagaag tccctataga agaaaagatc 26580 ttagatgtta tcaatgaggt aggaaaagca tgtgaaatta aaaacttttc aacaagtaaa 26640 ttaaccttac aagaaagtta tttgcaaaga ataggaggag aaaaatgaag gctgatcaat 26700 taaggcacaa atcggactta ggtttaagag gtctagcgat tattgctaaa aatgagatta 26760 ttgctttttt tagaagtaaa ggtttaatta tttctcagtt'tctacaacca atcttatatg 26820 ttgtttttat aataatagga ttaaattctt cgataaagaa cattcagttt aatgatataa 26880 aaacctctta tgcagaatat acaatcattg gtgttatagc tttattgata atcgggcaga 26940 tgactcaagt tatttatagg gtgacaatag ataaaaaata tgggctactt gctcttaagt 27000 tatgcagtgg agttcgtcct ttatattata ttttagggat gagtatctat tctatattag 27060 ggttgatagt tcaagaaatt attatatata taattacgtt agcgtttgag ataaatatcg 27120 caatggatag atttttttat acagttttgt tatctattgt tgttttatta ttttgggact 27180 cccttgcaat tttacttaca atgtttatca atgattacag aagacgtgat attgtaatac 27240 gttttgtact aacaccgctt ggttttacag ctcctgtttt ctacttaata gattctgctc 27300 ctagtattgt gagatggatt ggtcagttaa atcccttaac ttatcaatta actattttga 27360 gaaactttta ttttaaaaat tcaacaactt tggaattagt tttcttattg ttaacatcat 27420 tacttgtcct tatatctgta tcttttatta taccaaagat aaaattgata ctgatagaaa 27480 gataaaagtt gggtcatcca acttttttgt tgtctcccga aaaccactag ctatgctagt 27540 <210> 11 <211> 1026 <212> flNA
<213> Sa~.monella pneumon~ae <220>
<221> CDS
<222> (1)..(1026) <400> 11 atg aaa aac aaa ttt ttt cta ata get att tta get atg tgt ata gtt 48 Met Lys Asn Lys Phe Phe heu Ile Ala Ile Leu Ala Met Cys Ile Val ttt agc get tgt tct tct aat tct gtt aaa aat gaa gaa aat act tct 96 Phe Ser Ala Cys Ser Ser Asn Ser Val Lys Asn Glu Glu Asn Thr Sex aaa gag cat gcg cct gat aaa ata gtt tta gat cat get ttc ggt caa 144 Lys Glu His Ala Pro Asp Irys Ile Val Leu Asp His Ala Phe Gly Gln act ata tta gat aaa aaa cct gaa aga gtt gca act att get tgg gga 192 Thr Ile Leu Asp Irys Lys Pro Glu Arg Val Ala Thr Ile Ala Trp Gly aat cat gat gta gca tta get tta gga ata gtt cct gtt gga ttt tca 240 Asn His Asp Val Ala Leu Ala Leu G1y Ile Val Pro Val Gly Phe Ser aaa gca aat tac ggt gta agt get gat aaa gga gtt tta cca tgg aca 288 I~ys Ala Asn Tyr Gly Val Ser Ala Asp Lys Gly Val Leu Pro Trp Thr gaa gaa aaa atc aaa gaa cta aat ggt aaa get aac cta ttt gac gat 336 Glu G1u Lys Ile Zys Glu Leu Asn Gly Lys Ala Asn I,eu Phe Asp Asp ttg gat gga ctt aac ttt gaa gca ata tca aat tct aaa cca gat gtt 384 Leu Asp G1y Leu Asn Phe Glu Ala Lle Ser Asn sex I~ys Pro Asp val atc tta gca ggt tat tct ggt ata act aaa gaa gat tat gac act cta 932 Ile Leu Ala Gly Tyr Ser Gly Ile Thr Lys G1u Asp Tyr Asp Thr Leu tca aaa att get cct gta gca gca tac aaa tct aaa cct tgg caa act 480 Ser ~ys Ile A1a Pro val Ala Ala Tyr hys Ser Lys Pro Trp Gln Thr tta tgg aga gat atg att aaa att gat tca aaa gCC tta ggt atg gaa 528 Leu Trp Arg Asp Met Ile Lys Ile Asp Sex I~ys Ala ~eu Gly Met Glu aaa gaa ggt gat gag tta atc aaa aat act gaa get cgt ata tcc aaa 576 Lys Glu Gly Asp Glu Leu Ile Lys Asn Thr Glu Ala Arg Ile Ser Lys gaa tta gaa aaa cat cca gaa atc aaa gga aaa atc aaa gga aaa aaa 624 Glu Leu Glu Lys I3is Pro Glu Ile Lys G1y Lys Ile Lys Gly Lys Lys 1g5 200 205 gta tta ttt act atg att aat get gca gat aca tca aaa ttc tgg att 672 Val Leu Phe Thr Met Ile Asn Ala Ala Asp Thr Ser Lys Phe Trp Ile tat act agc aaa gat cca aga gca aat tat tta aca gat tta ggt cta 720 Tyr Thr Ser Lys Asp Pro Arg Ala Asn Tyr Leu Thr Asp Leu Gly Leu gtt ttc 'cct gaa tca tta aaa gaa ttt gag agt gaa gat agt ttt gca 768 Val Phe Pro Glu Ser Leu Lys Glu Phe Glu Ser G1u Asp Ser Phe Ala aag gaa att tct gca gaa gaa gca aat aag ata aat gat get gat gta 816 Lys Glu Ile Ser Ala Glu Glu A1a Asn Lys Ile Asn Asp Ala Asp Val atc ata act tat ggt gat gat aaa act ctt gaa get tta caa aaa gat 864 Ile I1e Thr Tyr Gly Asp Asp Lys Thr Leu G1u Ala Leu Gln Lys Asp cct ctt tta ggt aaa ata aat gca att aaa aat ggt gcc gtt get gta 912 pro Leu Leu Gly Lys Ile Asn Ala Ile Lys Asn G1y Ala Val Ala Val att cca gat aat aca ccg tta gca gcc tca tgc act cca aca cca ctt 960 I1e Pro Asp Asn Thr Pro Leu Ala Ala Ser Cys Thr Pro Thr Pro Leu tca ata aac tat act att gaa gaa tac cta aat ctt tta gga aat gca 1008 Ser Ile Asn Tyr Thr Ile Glu Glu Tyr Leu Asn Leu Leu Gly Asn Ala tgc aaa aat gcg aaa taa 2026 Cys Lys Asn Ala Lys <210> 12 <211> 341 <212> PRT
<213> Salmonella pneumoniae <400> 12 Met Lys Asn Lys Phe Phe Leu Ile Ala Ile Zeu Ala Met Cys Tle Val Phe Ser Ala Cys Ser Ser Asn Sex Val I~ys Asn Glu Glu Asn Thr Ser Lys Glu His Ala Pro Asp Lys Ile Val Leu Asp His Ala Phe Gly Gln Thr Ile Leu Asp Lys Lys Pro Glu Arg Val Ala Thx Ile Ala Trp Gly Asn His Asp Val Ala Leu Ala Leu Gly Ile Va1 Pro Val Gly Phe Ser 65 70 75. 80 Lys Ala Asn Tyr Gly Val Ser Ala Asp Lys Gly Val Leu Pro Trp Thr Glu Glu Lys Ile Lys Glu ~eu Asn Gly Lys Ala Asn Leu Phe Asp Asp Leu Asp Gly Leu Asn Phe Glu Ala Tle Sex Asn Sex Lrys Pxo Asp Val T1e F~eu Ala Gly Tyr Ser Gly Ile Thr Lys G1u Asp Tyr Asp Thr Leu Ser Toys Ile Ala Pro Val Ala Ala Tyr Zys Ser Lys Pro Trp Gln Thr Leu Trp Arg Asp Met Ile Lys Ile Asp Sex Toys A1a Zeu Gly Met Glu Lys Glu Gly Asp Glu Leu Ile Toys Asn Thr Glu Ala Arg Tle Sex Lys Glu Leu Glu Lys His Pro Glu Ile Lys Gly hys Ile hys Gly Lys Toys Val Lieu Phe Thx Met Ile Asn Ala Ala Asp Thr Ser Lys Phe Trp Ile Tyx Thr Ser Zys Asp Pxo Axg A1a Asn Tyr Leu Thr Asp Leu Gly Leu Val Phe Pro Glu Ser Zeu Lys Glu Phe Glu Ser Glu Asp Ser Phe Ala Lys Glu Ile Ser Ala Glu Glu Ala Asn Lys Ile Asn Asp Ala Asp Val Ile I1e Thr Tyr Gly Asp Asp Lys Thr Leu Glu Ala Leu Gln Lys Asp Pro Leu Leu Gly Lys Ile Asn A1a Ile Lys Asn Gly Ala Val Ala Val Ile Pro Asp Asn Thr Pra Leu A1a Ala Ser Cys Thr Pro Thr Pro Leu Ser Ile Asn Tyr Thr Ile Glu Glu Tyr T,eu Asn Leu Leu Gly Asn Ala Cys Lys Asn Ala ~ys <210> 13 <211> 1020 <212> DNA
<213> Salmonella pneumoniae <220>
<221> CDS
<222> (1)..(1020) <400> 13 atg cat gca aaa atg cga aat aaa aaa caa ata aac cta ggc ata att 48 Met His Ala I~ys Met Arg Asn Lys I~ys Gln Ile Asn I~eu Gly Ile Ile ttt ata atc tgc cta ggt ctt ctt att aca ata ttt ttg tca tta aag 96 Phe Ile Ile Cys Leu Gly Leu heu Ile Thr Ile Phe Leu Ser Leu Lys ctt gga aca aaa gaa att aat atc aga gat ttt tta gca get ttt gga 149 Leu Gly Thr Lys Glu Ile Asn Ile Arg Asp Phe Leu Ala Ala Phe Gly atg ggt aat aca aat gat gat ttt att aaa tca att ata tat aaa aga 192 Met Gly Asn Thr Asn Asp Asp Phe Tle hys Ser Ile Ile Tyr Lys Arg ata cct aga act att ttt gca att tta gca ggt tct agt ctt gcc ata 240 I1e Pro Arg Thr Ile Phe Ala Ile Leu Ala Gly Ser Ser heu Ala Tle ~5 70 75 80 agc ggt gta ttg atg caa tea gtt act aga aac cca ata get gat cca 288 Ser Gly Val Leu Met Gln Ser Val Thr Arg Asn Pro Tle Ala Asp Pro ggt ata ctc ggt ata aac aca gga gca agt ctt agt gta gta att ggt 336 Gly Tle Leu Gly Ile Asn Thr Gly Ala Ser I~eu Ser Val Val Ile Gly ctt tct ttt tta gga att tca tca agc ata agc cat ata agt ttt gca 384 I,eu Ser Phe Leu Gly Ile Ser Ser Ser Ile Ser His Ile Ser Phe Ala ate att ggt gge tta gta agt gca att ttt gta tac gcg att get gta 432 Ile Ile Gly Gly Leu Val Ser Ala Tle Phe Val Tyr Ala Ile Ala Val agc gga aaa gca ggc ctt acc cct ata aaa ctt gcc tta tca gga act 480 Ser Gly Lys Ala Gly Leu Thr Pro Ile Lys Leu Ala Leu Ser Gly Thr tgt gtt agt atg get tta age agt ttt gta agt ttt tta att tta ecg 528 Cys Val Ser Met Ala Leu Ser Ser Phe Val Ser Phe Leu Ile Leu Pro aat aat aac gtc tta gac aaa ttt aga ttt tgg caa ata ggt agc ctt 576 Asn Asn Asn Val Leu Asp Trys Phe Arg Phe Trp Gln Ile Gly Ser I,eu gga gca get aca tta tet tet ata tct aca cta cta ect ttt ata att 624 Gly Ala Ala Thr Leu Ser Ser Ile Sex Thr Leu I~eu Pro Phe Tle Tle tta ggt cac ttg ata get ata ttt att tca tca gat tta aac get tta 672 Leu Gly His Leu Ile Ala Ile Phe Ile Ser Ser Asp Leu Asn Ala Leu get atg ggt gat gaa atg get gtt ggt ett gga gtt aat gtt aat agg 720 Ala Met Gly Asp Glu Met Ala Val Gly heu Gly Val Asn Val Asn Arg ata aga tca ctt gca ata att gca agt gtg ctt tta tgt tca agt att 768 Ile Arg Sex Leu Ala Tle Ile Ala Ser Val Leu Zeu Cys Ser Sex Ile act gca att ggt gga cct att ggc ttc gta ggt ctt ata gtt cct cac 816 Thr Ala Ile Gly G1y Fro Ile Gly Phe Val Gly Leu 21e Val Pro His ttt tgt ggc tta ttt ata agc aaa gat ata cgc aca atg acc att tct 864 Phe Cys Gly Leu Phe I1e Ser Lys Asp Ile Axg Thx Met Thr Ile Ser tca tct ttt ata ggt gca gag ctc ttg ctt ata tgt gat ata atc ggc 912 Ser Ser Phe Ile Gly Ala Glu Leu Leu Ileu Ile Cys Asp Ile Ile Gly cgt atg tta ggt aaa cca ggt gaa att gaa gta ggg ata att act gca 960 Arg Met Leu Gly hys Pro Gly Glu Ile Glu Val Gly Ile zle Thr Ala ata atc ggg ggt cca gta ctt att tat gta act atg aaa aat aga ggg 1008 Ile Tle Gly Gly Pxo Val Leu Ile Tyr Val Thr Met Lys Asn Arg Gly gtt aat aac taa 1020 Val Asn Asn <21D> 14 <21~.> 339 <212> PRT
<213> Salmonella pneumoniae <400> 14 Met His Ala Lys Met Arg Asn Lys hys Gln Ile Asn T~eu Gly Tle Ile Phe Ile 21e Cys Leu Gly Leu heu Ile Thr Ile Phe Leu Ser T~eu Lys T~eu Gly Thr Lys Glu Ile Asn Ile Arg Asp Phe Leu Ala Ala Phe Gly Met Gly Asn Thr Asn Asp Asp Phe Ile Lys Ser Ile Tle Tyr Lys Arg Tle Pro Arg Thr Ile Phe Ala Ile Taeu A1a Gly Ser Ser Zeu Ala Ile ~5 7D 75 80 Ser Gly Val Leu Met Gln Ser Val Thr Arg Asn Pro Tle Ala Asp Pro Gly Tle Leu Gly T1e Asn Thr Gly Ala Ser I~eu Ser Val Val Tle Gly Leu Ser Phe Leu Gly Ile Ser Ser Ser Tle Ser H~.s Tle Ser Phe Ala Tle Tle Gly Gly Leu val Ser Ala Tle Phe Val Tyr A1a Tle Ala Val Ser Gly Toys Ala Gly Le,u Thr Pro Tle Lys Leu A1a Leu Ser Gly Thr Cys Va1 Ser Met Ala Leu Ser Ser Phe Val Ser Phe Leu Tle Leu Pro 165 170 1.75 Asn Asn Asn Va1 Treu Asp Lys Phe Arg Phe Trp Gln Tle Gly Ser Leu Gly Ala Ala Thr Leu Ser Ser Tle Ser Thr Leu Leu Pro Phe Ile Tle Leu Gly His Leu Tle Ala Ile Phe Ile Ser Ser Asp Zeu Asn Ala Leu Ala Met Gly Asp Glu Met Ala Val Gly Leu Gly Val Asn Val Asn Arg Tle Arg Ser T~eu A1a Ile Ile Ala Ser Val Leu Leu Cys Ser Ser Tle Thr Ala T1e Gly Gly Pro Ile Gly Phe Val Gly Leu Tle Val Pro His Phe Cys Gly Leu Phe Tle Ser hys Asp T1e Arg Thr Met Thr Tle Ser Ser Sex Phe Tle Gly Ala Glu Leu Leu heu Tle Cys Asp Tle Tle Gly Arg Met T~eu Gly Lys Pro Gly Glu file G1u Val Gly Tle Tle Thr Ala Tle Tle Gly Gly Pro val Leu Tle Tyr Val Thr Met Lys Asn Arg Gly Val Asn Asn <210> 15 <211> 1008 <212> DNA
<213> Salmonella pneumoniae <220>
<221> CDS
<222> (1)..(2008) <400> 15 atg caa aat tta att ata ggt att caa aaa aga aaa aat aga ata aca 48 Met Gln Asn Z<eu Ile Ile Gly Ile Gln Lys Arg Lys Asn Arg I1e Thr cta ttt tcc tca cta ttt tta tta ata ata atc agt cta tca ttt ttc 96 I,eu Phe Ser Ser Leu Phe Leu T,eu Ile Ile Ile Ser Leu Ser Phe Phe att tta ctt atc gga gat gaa agt tat tct ttt tca act ttg att aaa 144 Ile Leu Leu Ile Gly Asp Glu Ser Tyr ser Phe Ser Thr Leu T1e Itys gtc tta aat agt gaa act gtt cct gga get agt ttt tcg att atg gaa 192 Va1 Leu Asn Ser Glu Thr Val Pro Gly Ala Ser Phe Ser Ile Met Glu att aga tta cca aaa tta tta gca gga att ata get ggc tgg tct ttt 240 Ile Arg Leu Pro hys Leu Leu Ala Gly Tle Ile Ala Gly Trp Ser Phe gga ttg gca gga ttt atc ttt caa act atg tta aga aat cct ctt gca 288 Gly Leu Ala Gly Phe Ile Phe Gln Thr Met Leu Arg Asn Pro Leu Ala agt cct gat ata atc ggt gtc aca agt tct tca tct att gca gcg gtc 336 Ser Pro Asp Ile Ile Gly Val Thr Ser Ser Ser Ser Ile Ala Ala Val 100 1.05 110 ttt tgc ata ttg gta tta aaa aca aat agt tta act act gga att att 384 Phe Cys Ile Leu Val Tleu hys Thr Asn Ser Leu Thr Thr G2.y Ile Ile tca ata act tgt gga cta aca tca tct tta ata tta ttt tta cta get 432 Ser Ile Thr Cys Gly Leu Thr Ser Ser Leu I1e Ileu Phe Leu Leu Ala aaa aaa gat ggt ttt tca gca gca aga ctg ata ata tta ggt att ggt 480 Lys Lys Asp Gly Phe Ser Ala Ala Arg Leu Ile Tle Leu Gly lle Gly ttt caa get gtc aca aga gca ggc acc tca ttt tta ttg ttg aaa gta 528 Phe Gln Ala Va1 Thr Arg Ala Gly Thr Ser Phe Lieu Leu I,eu Lys Val gca aga tat gaa tta caa gaa gtt atg aga tgg ctc agt ggc tct tta 576 Ala Arg Tyr Glu Leu Gln Glu Val Met Arg Trp zeu Ser Gly Ser Leu tct ttt aca aag tta gat gac ata cct ctt gtt cta ata gta agt att 624 Ser Phe Thr Lys Leu Asp Asp Tle Pro Leu Val T~eu Ile Val Ser I1e att get act ata tta gtt tta ttt ttt aat aaa aga cta gaa att att 672 zle Ala Thr I1e Leu Val T~eu Phe Phe Asn I,ys Arg Leu Glu Ile I1e gaa ctt ggt gaa gaa ata gca atc gga ctt gga gca aat ccc gag ctt 720 Glu I,eu Gly Glu Glu Ile Ala Ile Gly Leu Gly Ala Asn Pro Glu Leu tca agg ctt gtt tta att ttt tgc get gta tct tta act get ttt tct 768 5er Arg Leu Val I~eu T1e Phe Cys A1a Val Ser Leu Thr Ala Phe Ser act tca att aca gga cca ata get tgt ata tct ttt tta get ggt ccc 816 Thr Ser Ile Thr G1y Pro Ile A1a Cys Ile Ser Phe Leu Ala Gly Pro ata gcc tta aat att ggc aag aaa aga agc cca ata tta get gga ttg 864 Ile Ala Leu Asn Tle Gly Lys Lys Arg Ser Pro Ile heu Ala Gly Leu gtt gga att tta cta gtt ttg tta tca gac ata ttc tct caa aat att 912 Val Gly I1e veu F~eu Val T~eu heu Ser Asp Ile Phe Ser Gln Asn Ile tta cca get aga tat cca gta ggt gtt gta act ggc ttg tta ggt tca 960 Leu Pro Ala Arg Tyr Fro Val Gly Va1 Val Thr Gly Leu Leu Gly Ser 3p5 310 315 320 cca tac tta ata tac tta cta ata aaa atg aac agg agg aat ata taa 1008 Pro Tyr Leu Ile Tyr Leu Leu Ile Lys Met Asn Arg Arg Asn Ile <210> 16 <211> 335 <212> PRT
<213> Salmonella pneumoniae <400> 16 Met Gln Asn Leu Ile 21e Gly Ile Gln Lys Arg Lys Asn Arg Ile Thr Leu Phe Ser Ser Leu Phe Leu Leu Ile I1e Ile 5er Leu Ser Phe Phe Ile Leu Leu Ile Gly Asp Glu Ser Tyr Ser Phe Ser Thr Leu Ile Lys Val Leu Asn Ser Glu Thr Val Pro Gly Ala Ser Phe Ser Ile Met Glu Ile Arg Leu Pra Lys Leu Leu Ala Gly Tle Tle Ala Gly Trp Ser Phe ~5 70 75 $o Gly Leu Ala Gly Phe Ile Phe Gln Thr Met Leu Arg Asn Pro Leu Ala Ser Pro Asp Ile Ile Gly Val Thr Ser Ser Ser Ser Ile A1a Ala Val Phe Cys Ile Leu Va1 Leu Lys Thr Asn Ser Leu Thr Thr G1y Ile Ile Ser Ile Thr Cys Gly Leu Thr Ser Ser Leu Ile Leu Phe Leu Leu Ala Lys Lys Asp Gly Phe Ser Ala Ala Arg Leu Ile Ile Leu G1y Ile Gly Phe G1n Ala Val Thr Arg Ala Gly Thr Ser Phe Leu Leu Leu Lys Val Ala Arg Tyr Glu Leu Gln Glu Val Met Arg Trp Leu Ser Gly Ser Leu Ser Phe Thr Lys Leu Asp Asp Tle Pro Leu Val Leu Ile Val Ser Ile 195 zoa 205 Tle Ala Thr Tle Leu Val Zeu Phe Phe Asn Lys Arg Leu Glu Tle Ile Glu Leu Gly Glu Glu Ile Ala zle Gly Leu Gly Ala Asn Pro Glu Leu Ser Arg Leu Val Leu Ile Phe Cys Ala Val Ser ~eu Thr Ala Phe Ser Thr Sex Ile Thr Gly Pro Lle Ala Cys Tle Ser Phe Lieu Ala Gly Pxo Ile Ala Leu Asn Ile Gly Lys Zys Arg Ser Pro Tle Lieu Ala Gly Zeu Val Gly Ile Leu Leu Val Leu Leu Ser Asp Ile Phe Ser Gln Asn Tle Leu Pro Ala Arg Tyr Pro Val Gly Va1 Val Thr Gly Leu Leu Gly Ser Pra Tyr Leu Ile Tyr Leu Leu Ile Lys Met Asn Arg Axg Asn Tle <210> 17 <211> 795 <212> DNA
<213> Salmonella pneumoniae <220>
<221> CDS
<222> (1)..(795) <400> 17 atg aaa ggt ctg tgg tca aat aat ctt acc tgc ggt tat gat gaa aaa 48 Met hys Gly Leu Trp S2r Asn Asn Zeu Thr Cys Gly Tyr Rsp Glu Lys ata atc ttg gaa aat ata aat ata aaa ata cct gaa gaa aaa ata tca 96 T1e Ile heu Glu Asn Ile Asn Ile I~ys T1e Pxo Glu Glu I~ys Tle Ser gtt att att ggg tca aat ggt tgt ggg aaa tca aca ctc att aaa acc 144 Val Ile Tle Gly Sex Asn Gly Cys Gly L~ys Ser Thr T~eu I1e Toys Thr ttg tct cga ctt ata aag cca tta gag gga gaa gta ttg ctt gat aat 192 Leu Ser Arg Leu Ile Lys Pro Leu Glu Gly Glu Val Leu Leu Asp Asn aaa tca att aat tct tat aaa gaa aaa gat tta gca aaa cac ata get 240 Lys Ser Ile Asn Ser Tyr Lys Glu Lys Asp ueu Ala Lys I3is Ile Ala ata tta cct caa tct cca ata atc cct gaa tca ata aca gta get gat 288 Ile Leu Pro Gln Ser Pro Ile Ile Pro Glu Ser Ile Thr Val Ala Asp ctt gta agc cgt ggt cgt ttc ccc tac aga aag cct ttt aag agt ctt 336 Leu Val Ser Arg Gly Arg Phe Pro Tyr Arg Lys Pro Phe Lys Ser I~eu gga aaa gat gac ctt gaa ata ata aac aga tca atg gtt aag gcc aat 384 G1y Lys Asp Asp Leu Glu Ile T1e Asn Arg Ser Met Val hys Ala Asn gtt gaa gat cta gca aat aac cta gtt gaa gaa ctt tct ggg ggt caa 432 Val Glu Asp Leu Ala Asn Asn Leu Val Glu Glu I~eu Ser Gly Gly Gln agg caa aga gta tgg ata get cta gcc cta gcc caa gat aca agt atc 480 Arg Gln Arg Val Trp Ile Ala Leu A1a Leu Ala Gln Asp Thr Ser Ile cta ctt tta gat gag cca act act tac ttg gat atc tca tat caa ata 528 Leu Leu Leu Asp Glu Pro Thr Thr Tyr Leu Asp Ile Sex Tyr Gln Ile gaa cta tta gac ctc ttg act gat cta aac caa aaa tat aag aca acc 576 G1u Leu Leu Asp Leu Leu Thr Asp Leu Asn Gln I,ys Tyr Lys Thr Thr att tgc atg att ttg cac gat ata aat cta aca gca aga tac get gat 624 Ile Cys Met Tle Leu His Asp Tle Asn Leu Thr Ala Arg Tyr Ala Asp tac cta ttt gca att aaa gaa ggt aaa ctt gtt gca gag gga aag cct 672 Tyr Leu Phe Ala Ile Lys Glu Gly I~ys Leu Val Ala Glu G1y Lys Pro gaa gat ata cta aat gat aaa cta gtt aaa gat atc ttt aat ctt gaa 720 Glu Asp Tle I3eu Asn Asp Lys Leu Val Lys Asp Tle Phe Asn I,eu Glu gca aaa att ata cgt gac cct att tcc aat tcg cct cta atg att cct 768 Ala Lrys Ile Ile Arg Asp Pro Tle Ser Asn Ser Pro Leu Met Ile Pro att ggc aag cac cat gtt aac tct taa 795 Ile Gly Lys His His Val Asn Ser <210> 18 <211> 264 <212> PRT
<213> Salmonella pneumon~.ae <400> 18 Met Lys Gly T~eu Trp Ser Asn Asn Leu Thr Cys Gly Tyr Asp Glu Lys Ile Ile Leu Glu Asn Ile Asn Ile Lys Ile Pro Glu G1u Lys Ile Ser Val Ile Ile Gly Ser Asn Gly Cys Gly .Lys Ser Thx Leu Ile Lys Thr heu Ser Arg Leu Ile Toys Pro Leu Glu Gly Glu Va1 Leu Leu Asp Asn Lys Ser T1e Asn Ser Tyr Lys Glu Irys Asp Leu Ala Lys His Ile Ala 65 70 75 8p Ile Leu Pro Gln Sex Pro Ile Ile Pro Glu Sex Ile Thr Val Ala Asp Leu Val Sex Arg Gly Arg Phe Pro Tyr Arg Lys Pro Phe Lys Ser Leu Gly Lys Asp Asp Leu Glu Tle Ile Asn Arg Sex Met Val Lys Ala Asn 115 x20 125 Val Glu Asp Leu Ala Asn Asn L2u Val Glu Glu Leu Ser Gly Gly Gln 130 135 1q0 Arg Gln Arg Va1 Trp Ile Ala Leu Ala veu Ala Gln Asp Thr Ser I1e Leu Leu Leu Asp Glu Pro Thr Thr Tyr heu Asp Ile ,Sex Tyr Gln Ile 3$

Glu Leu Leu Asp Leu heu Thr Asp Leu Asn Gln Lys Tyr Lys Thr Thr Ile Cys Met Ile Leu His Asp Ile Asn Leu Thr Ala Arg Tyr Ala Asp Tyr Leu Phe Ala Ile Lys Glu Gly Lys Leu Val Ala Glu Gly Lys Pro Glu Asp Ile Leu Asn Asp Lys Leu Val hys Asp Ile Phe Asn Leu Glu Ala Lys Ile Ile Arg Asp Pro Ile Ser Asn Ser Pro Leu Met Ile Pro I1e Gly Lys His His Val Asn Ser <210> 19 <211> 1680 <212> DNA
<213> Salmonella pneumoniae <220>
<221> CDS
<222> (1)..(1680) <400> 19 atg tca aaa gaa aaa ata aaa gta tac ctc tat aca cga gta tct acg 48 Met Ser Lys Glu Lys Ile Lys Val Tyr Leu Tyr Thr Arg Val Ser Thr tca ata cag ata gag ggg tat tcg tta gag gca caa aaa tca cga atg 96 Ser Ile Gln Ile Glu Gly Tyr Ser Leu Glu Ala Gln Lys Ser Arg Met aaa get ttt get att tac aac gat tat gaa att gtt gga gag tat gaa 244 Lys Ala Phe Ala Ile Tyr Asn Asp Tyr Glu Ile Val Gly Glu Tyr Glu gat gcc ggg aag tct gac aag tct att gaa ggt aga ata cag ttc aat 192 Asp Ala Gly Lys Ser Asp Lys Ser Tle Glu Gly Arg Ile Gln Phe Asn cga atg atg gaa gat ata aaa tct gga aaa gat gga gta tct ttt gtt 240 Arg Met Met Glu Asp lle Lys Ser Gly Lys Asp Gly val Ser Phe Val ctt gtg ttt aag tta tca aga ttt gca aga aat gee get gat gtt ett 288 Leu Val Phe Lys Leu Ser Arg Phe Ala Arg Asn Ala Ala Asp Val Reu tct aca ctt cat ata atg cag gat tat gga gtt aat ctt atc tgc gtt 336 Ser Thr T~eu His Ile Met Gln Asp Tyr G2y Val Asn Leu Ile Cys Val gaa gat ggc att gat tca tct aaa gat get ggg aaa cta atg att tct 384 Glu Asp Gly Ile Asp Ser Ser Irys Asp Ala Gly Lys Leu Met Ile Ser gtt tta tca get gtg get gaa ata gaa aga gaa aac atc agt att caa 432 Val Leu Ser Ala Val Ala Glu Ile Glu Arg Glu Asn Ile Ser I1e Gln aca atg gaa ggt cgc att caa aaa gca ggg gaa gga aaa tgg aat ggt 480 Thr Met Glu Gly Arg Ile Gln Lys Ala Gly Glu Gly Lys Trp Asn Gly ggc ttt get ccg tat gga tat aaa ctt gaa gac ggc aag ctg ttt ata 528 Gly Phe Ala Pro Tyr Gly Tyr T.tys Leu Glu Asp Gly I~ys Leu Phe Ile 1&5 17D 175 aat gag gaa gag gca gtt gca ata aga acg att ttc gac cag tat gta 576 Asn Glu Glu Glu Ala Val Ala T1e Arg Thr Ile Phe Asp Gln Tyr Val aat act acg ata gga gcc aat ggg ata tct aaa tac tta gag aat cat 624 Asn Thr Thr Ile Gly Ala Asn Gly Ile Ser Lys Tyr Leu Glu Asn His gga att aga aaa atc cca aga cag aat ggt aag aat cct ttg ttt gat 672 Gly Ile Arg Lys Lle Pro Arg Gln Asn Gly Lys Asn Pro Leu Phe Asp gca ggt ctt ata aga aag ata tta aag aat cct gta tat aat ggg aaa 720 Ala Gly Leu Ile Arg Lys 21e Leu Toys Asn Pro Val Tyr Asn Gly Lys ata gca ttt gga aga aga act tta gaa aaa gtt cat ggt aca aga aat 768 Ile Ala Phe Gly Axg Arg Thr Leu Glu Zys Val His Gly Thr Arg Asn gaa tat aag cag gtt gaa caa gat gaa tat cta ata tct gaa ggg afa 816 Glu Tyr Lys Gln Val Glu Gln Asp Glu Tyr I~eu Ile Ser Glu Gly Ile cat gaa get ata gtt tcc gat gaa gtt tgg caa get get cag gtt aag 864 His Glu Ala Ile Val Ser Asp Glu Val Trp Gln Ala Ala Gln Val Lys cta aaa tct caa gca aag aaa tat gag cat gtg aat aaa gga aaa gat 912 Z,eu Zys Ser G1n Ala Lys I~ys Tyr Glu His val Asn Lys Gly Lys Asp aca cgc aca cac ttg ctt tct gga att gta aaa tgc ccg ata tgt gga 960 Thr Arg Thr His Leu I~eu Ser Gly Ile Val ~ys Cys Pro Ile Cys Gly 305 31.0 315 320 gtg gga atg ttt ggg aac aag tgt atc aag aaa aag aaa gat ggc aca 1008 Val Gly Met Phe Gly Asn Lys Cys Ile Lys Lys Lys Lys Asp Gly Thr aag tat aaa gat ttt tat tac tat ggt tgt aac cat agg cag atg ata 1056 Lys Tyr Lys Asp Phe Tyr Tyr Tyr Gly Cys Asn His Arg Gln Met Ile aga ggt aat aag tgt aca ttc agt aag caa att aga gaa gaa ttg tta 1104 Arg Gly Asn Lys Cys Thr Phe Ser Lys Gln Ile Arg Glu Glu zeu I~eu gat gat get gtt gca gag gtg att gtc aag ata gta agt aat ccg aaa 1152 Asp Asp Ala Val Ala Glu Val Tle Val T,ys Ile Val Ser Asn Pro Lys ttt get tct atg atg caa gaa aaa atc aac atg aag gtg gat acc tct 1200 Phe Ala Ser Met Met Gln Glu Lys Ile Asn Met Lys Val Asp Thr Ser gaa ata gaa aaa gaa ata gat aat tac caa aag gaa ttg aga aag agt 1298 Glu Ile Glu Toys Glu Ile Asp Asn Tyr G1n Lys Glu T~eu Arg Lys Ser cat tct aca aag ttt aag cta att gag gaa ata gat aat tta gat gtt 1296 His Ser Thr I~ys Phe Lys Leu Tle Glu Glu Ile Asp Asn Leu Asp Val 920 425 43p gaa gat aag cat tat aag aga agg aaa cag gat tta gat gat aga cta 1344 G1u Asp Lys His Tyr Lys Arg Arg Lays Gln Asp heu Asp Asp Arg Leu tat cgt atg tat gac aaa cta gat gaa tta gaa tca tca cta att gat 1392 Tyr Arg Met Tyr Asp Lys Leu Asp Glu heu Glu Ser Ser Leu Ile Asp geg aaa gca aag aaa cag act att gaa get gaa aag ctt aca gga gat 1440 Ala Irys Ala I~ys Lys Gln Thr Ile G1u Ala Glu Lys T~eu Thr G1y Asp aac ata tat aag gtt ctg atc tat ttt gat aag ctc tat aaa gtc atg 1488 Asn Ile Tyr Lys Val Leu Ile Tyr Phe Asp hys Leu Tyr Lys Val Met aat gat gta gag cgt agg cag tta att tca get ttg att tct gaa att 1536 Asn Asp Val Glu Arg Arg Gln Leu Ile Ser Ala Leu Ile Ser Glu I1e caa gtt tat gaa gaa aaa caa tct aac gga caa tgg cta aaa tcc att 1584 Gln Val Tyr Glu Glu Tlys Gln Ser Asn Gly Gln Trp Leu Lys Ser Ile act ttt aag cta cca att ata gaa gaa aat ctc aac ata ggt ttg gac 1632 Thr Phe Lys heu Pro Ile I1e Glu Glu Asn Leu Asn I1e Gly Leu Asp aat gat gaa caa gtt gaa tgt gta agt tta tta gag aaa cgt agt taa 1680 Asn Asp Glu Gln Val Glu Cys Va1 Ser heu T,eu Glu Irys Arg Ser <210> 20 <211> 559 <212> PRT
<213> Salmonella pneumoniae <400> 20 Met Ser Lys Glu Lys I1e Lys Val Tyr Leu Tyr Thr Arg Val Ser Thr Ser Ile Gln Ile G1u Gly Tyr ser Leu Glu Ala Gln Lys Ser Arg Met .Lys Ala Phe Ala Ile Tyr Asn Asp Tyr Glu Ile Val Gly Glu Tyr Glu Asp Ala Gly Toys Ser Asp F~ys Ser Ile Glu Gly Arg Ile Gln Phe Asn Arg Met Met Glu Asp Ile Irys Ser G1y Lys Asp Gly Val Ser Phe Val ~5 70 75 80 Leu Val Phe Lys Leu Ser Arg Phe Ala Arg Asn Ala Ala Asp Val Leu Ser Thr Leu His Ile Met Gln Asp Tyr Gly Val Asn heu I1e Cys Val G1u Asp Gly Ile Asp Ser Ser Lys Asp Ala Gly Lys Leu Met Ile Ser Val Leu Ser Ala Val Ala Glu Ile Glu Arg Glu Asn Ile Ser Tle Gln Thr Met Glu Gly Arg Ile Gln hys Ala Gly Glu Gly Lys Trp Asn Gly Gly Phe A1a Pro Tyr Gly Tyr Irys Leu Glu Asp Gly Lys Leu Phe Ile Asn Glu Glu Glu Ala Va1 A1a Ile Arg Thr Ile Phe Asp Gln Tyr Val Asn Thr Thr Ile Gly Ala Asn Gly Ile Ser T,ys Tyr Leu Glu Asn His Gly Ile Arg Lys Ile Pro Arg Gln Asn G1y Lys Asn Pro Leu Phe Asp Ala G1y Leu Ile Arg Lys Ile Leu Lys Asn Pro Val Tyr Asn Gly Lys Tle Ala Phe Gly Arg Arg Thr Leu Glu Lys Va1 His Gly Thr Arg Asn Glu Tyr Lys Gln Val Glu Gln Asp Glu Tyr Lieu Ile Ser Glu Gly Ile His Glu Ala Ile Val Ser Asp Glu Val Trp Gln Ala Ala Gln Val Lys I~eu Lys Ser G1n Ala hys Toys Tyr Glu His Val Asn Lys Gly Lys Asp Thr Arg Thr His Leu Leu Ser Gly Ile Val Lys Cys Pro I1e Cys Gly Val Gly Met Phe Gly Asn Lys Cys Ile I~ys Lys L~ys hys Asp Gly Thr Lys Tyr Lys Asp Phe Tyr Tyr Tyr Gly Cys Asn His Arg Gln Met Ile Arg Gly Asn Toys Cys Thr Phe Ser Toys Gln Ile Arg G1u Glu Leu Leu Asp Asp Ala Val Ala Glu Val Ile Val ~ys Ile Val Ser Asn Pro Lys Phe Ala Ser Met Met Gln Glu Lys T1e Asn Met Lys Val Asp Thr Ser Glu Ile Glu Lys Glu Ile Asp Asn Tyr Gln Lys Glu Leu Arg Lys Ser His Ser Thr Lys Phe Lys Leu Ile Glu Glu Ile Asp Asn Leu Asp Val Glu Asp I~ys His Tyr Lys Arg Arg Lys Gln Asp Leu Asp Asp Arg Leu Tyr Arg Met Tyr Asp Lys Leu Asp Glu Leu Glu Sex Ser Leu I2e Asp Ala Lys Ala trys Lys G1n Thr Ile Glu Ala Glu Lys Leu Thr Gly Asp Asn Ile Tyr I~ys Val Leu Ile Tyr Phe Asp Irys Leu Tyr~Lys Val Met Asn Asp Val Glu Arg Arg Gln Leu Ile Ser Ala Leu Ile Ser Glu Ile Gln Val Tyr Glu Glu Lys Gln Ser Asn Gly Gln Trp Leu T.rys Ser Ile Thr Phe Irys heu Pro Ile Ile Glu Glu Asn ~eu Asn I1e Gly Leu Asp Asn Asp Glu Gln Val G1u Cys Val Sex Leu E~eu Glu I~ys Arg Ser <210> 21 <211> 588 <212> DNA

<213> Salmonella pneumoniae <22D>
<221> CDS
<222> (1)..(588) <400> 21 atg aaa atg gag aga tta tcg atg gtt ata ttg gaa ttg tac caa aat 48 Met Lys Met Glu Arg Leu Ser Met Val Ile Zeu Glu Leu Tyr Gln Asn gat tat tct aaa gat tta gta gca ttt gat tcc ata gaa gat ggg aaa 96 Asp Tyr Ser I~ys Asp Leu Val Ala Phe Asp Ser Ile Glu Asp Gly Lys gee ttt gta get caa ate ecg gga tac act etg gaa aca gaa gat ggt 144 A1a Phe Val Ala Gln Ile Pro G1y Tyr Thr Leu Glu Thr Glu Asp Gly ttt gaa gtg gag tat ttt aat cct aaa aac ata ccg gat tat atg gaa 192 Phe Glu Val Glu Tyr Phe Asn Pro Lys Asn Ile Pro Asp Tyr Met Glu att att ttt aac gga aat att gtt cct tta tct aaa ttt atg ttc gat 240 Tle Ile Phe Asn Gly Asn Ile Val Pro Zeu Sex Toys Phe Met Phe Asp cct gag gaa aat gta aac att att tgg aaa gag att tca aat tta tcc 288 Pro Glu Glu Asn Val Asn Ile Tle Trp Lys Glu Ile Ser Asn Leu Ser ctc aaa aat gat aga gtg atc gaa gga tat tca aaa att gat gca tat 336 Leu Lys Asn Asp Arg Val Tle Glu Gly Tyr Ser Lys Ile Asp Ala Tyr lOD 105 210 gtc gtt aac aac cat gaa gtt aaa gcc tat gtc gaa aca aga gaa acg 384 Val Val Asn Asn His Glu Val Lys Ala Tyr Val Glu Thr Arg Glu Thr aac tat cgt aaa gca aaa gac ttc tta gaa agc cgc gga tat gaa atc 432 Asn Tyr Arg Lys Ala Lys Asp Phe Leu Glu Ser Arg G1y Tyr Glu Ile gac aga agc ttt ttc gga agt gaa gac ggt gaa gcg att ctt tac aga 48p Asp Arg Ser Phe Phe Gly Ser Glu Asp Gly Glu Ala Tle Leu Tyr Arg aaa aaa ggg atc gaa gtt tgg cat ttc ttg tgt cac tta gac cca atg 528 Lys Toys Gly Tle Glu Val Trp His Phe Leu Cys His Leu Asp Pro Met ttt gta gag att gaa gat gta gaa gga tat gtt aaa gaa gaa gtt gga 576 Phe Val Glu Ile Glu Asp Val Glu Gly Tyr Val Lys Glu Glu Val Gly gag att caa tag 588 Glu Tle Gln <210> 22 <211> 195 <212> PRT
<213> Salmonella pneumoniae <400> 22 Met Toys Met Glu Arg I~eu Ser Met Val Tle Leu Glu Leu Tyr Gln Asn Asp Tyr Ser Lys Asp T~eu Val A1a Phe Asp Ser Tle Glu Asp Gly Lys Ala Phe Val A1a Gln Tle Pro G1y Tyr Thr Leu Glu Thr Glu Asp Gly Phe Glu Val Glu Tyr Phe Asn Pro Lys Asn Tle Pro Asp Tyr Met Glu Ile Ile Phe Asn Gly Asn Ile Val Pro Leu Ser Lys Phe Met Phe Asp Pro Glu Glu Asn Val Asn Ile Ile Trp T,ys Glu Ile Ser Asn Leu Ser Leu Lys Asn Asp Arg Val Tle Glu Gly Tyr Ser Lys Ile Asp Ala Tyr 100 105 lla Val Va1 Asn Asn His Glu Val Irys Ala Tyr Val Glu Thr Arg Glu Thr Asn Tyr Arg Lys Ala Lys Asp Phe lieu Glu Ser Arg Gly Tyr G1u Tle Asp Arg Ser Phe Phe Gly Ser Glu Asp Gly G1u Ala I1e Taeu Tyr Arg Lys Lys Gly Ile Glu Val Trp His Phe Leu Cys His Leu Asp Pro Met Phe Val Glu Ile Glu Asp Val Glu G1y Tyr val ~ys Glu Glu Val Gly Glu Ile Gln <210> 23 <211> 759 <212> DNA
<213> Salmonella pneumoniae <220>
<221> CDS
<222> (1)..(759) <400> 23 atg gtt gtt tat att aga caa agt aaa tta cca agt gag gtt tca att 48 Met Val Val Tyr Ile Arg Gln Sex Lys Leu Pro Ser Glu Val Ser Ile aat aaa tac aat get caa gta ggt gec tac tta caa gga gaa gaa gtt 96 Asn Lys Tyr Asn Ala Gln Val Gly Ala Tyr Leu Gln Gly Glu Glu Val att tta tat caa tct ttt tct gaa ata aaa gag tta aca agt gaa gat 144 Ile Leu Tyr Gln Ser Phe Ser Glu Ile Lys Glu Leu Thr Ser Glu Asp ata gtt gta gat tat ata atg gag act aga gca tta cta aaa atg atg 192 I1e Val Va1 Asp Tyr Ile Met Glu Thr Arg Ala T~eu Zeu Lys Met Met ggc tta aac gtt ccg gtt cat gac tat cct att gag ctt aaa gag ttt 240 Gly Leu Asn Val Pro Val His Asp Tyr Pro Ile Glu heu Irys Glu Phe tat ggt cga aag att tat get ggt att tta gga gag att gtg aat ata 288 Tyr Gly Arg Lys Ile Tyr Ala Gly Ile Leu Gly Glu Ile Val Asn Ile 85 90' 95 ect gat aat tgg gga aaa ttt att aag ect aaa get ggt tca aaa gte 336 Fro Asp Asn Trp Gly Lys Phe Ile Lys Pro Lys Ala Gly Ser hys Val ttt act gga aga gtt gtt aat gga acc cat gat tta ata ggt att ggt 384 Phe Thr Gly Arg Val Val Asn Gly Thr His Asp heu Tle Gly Ile Gly cta cct ttc gac tat cct ata tgg att agt gag gtt gta gaa ttc ata 432 Leu Pro Phe Asp Tyr Pro Ile Trp Ile Ser Glu Val Val Glu Phe Ile get gaa tgg cgt tgt ttt gtg tta gat ggt cge gta tta gat gtt ega 480 Ala Glu Trp Arg Cys Phe Val T~eu Asp G1y Arg Val Zeu Asp Val Arg ccc tat aca ggt gat tat cat gca caa ttt gat gca agt gta att gat 528 Pro Tyr Thr Gly Asp Tyr His Ala Gln Phe Asp Ala Ser Val Tle Asp gaa gcg ata tca tgt tgg aaa gat gcg cca ata get tat gga cta gat 576 Glu Ala 11e Ser Cys Trp Lys Asp Ala Pro Ile Ala Tyr Gly Leu Asp atc ggt gtt act cgc gat ggc aga aca ctt gtt gtt gaa gta aat gat 624 Tle Gly Val Thr Arg Asp Gly Arg Thr ~eu Val val Glu Val Asn Asp 1g5 200 205 ggt tat gca ttg gga aat tat ggc cta tct cct tta aaa tca atc aat 672 Gly Tyr Ala Leu G1y Asn Tyr Gly Leu Ser Pro Leu Lys Ser Ile Asn ttt cat aga get agg tgg aaa gaa atg gta aaa ccc tat ttt gaa aaa 720 Phe His Arg Ala Arg Trp Ilys Glu Met Val Lys Pro Tyr Phe G1u Lys aat gaa att ttt aaa atc caa cag gat gtt att ttc taa 759 Asn Glu 11e Phe Lys 11e Gln Gln Asp Val Ile Phe <210> 24 <211> 252 <212> PRT
<213> Salmonella pneumonxae <400> 24 Met Val Val Tyr xle Arg Gln Ser hys ~eu Pro Ser Glu val Ser Ile Asn Lys Tyr Asn Ala Gln Val Gly Ala Tyr Leu Gln Gly Glu Glu val Ile Leu Tyr Gln Ser Phe Ser Glu Ile I~ys Glu Leu Thr Ser Glu Asp Ile val Val Asp Tyr Ile Met Glu Thr Arg Ala Leu Leu Lys Met Met Gly Zeu Asn Val Pro Val His Asp Tyr Pro I1e Glu Zeu Lys Glu Phe Tyr Gly Arg Lys Ile Tyr Ala Gly Ile Leu Gly Glu Tle Val Asn Ile Pro Asp Asn Trp Gly I~ys Phe Ile I~ys Pro Lys Ala Gly Ser Lys Val 100 1.05 110 Phe Thr Gly Arg Val Val Asn Gly Thr His Asp Zeu Ile Gly Ile Gly Leu Pro Phe Asp Tyr Pro Ile Trp Ile Ser Glu Val Val Glu Phe Ile Ala Glu Trp Arg Cys Phe Val Leu Asp Gly Arg Val T~eu Asp Val Arg Pro Tyr Thr Gly Asp Tyr His Ala Gln Phe Asp A1a Ser Val Ile Asp Glu A1a Ile Ser Cys Trp Lys Asp Ala Pro Ile Ala Tyr Gly Leu Asp Ile Gly Val Thr Arg Asp Gly Arg Thr I~eu Val val Glu Val Asn Asp Gly Tyr Ala Zeu Gly Asn Tyr Gly Leu Ser Pro Leu Lys Ser Ile Asn Phe Ha.s Arg Ala Arg Trp Lys Glu Met Val Lys Pro Tyr Phe Glu Lys Asn G1u Ile Phe Lys Ile Gln G1n Asp Val 21e Phe <210> 25 <211> 855 <212> DNA
<213> Salmonella pneumoniae <220>
<221> CDS
<222> (1)..(855) <400> 25 atg ctt gga gca att att gga gat att gtc ggt tct gtt tac gaa tgg 48 Met Leu Gly A1a Tle Ile Gly Asp Ile Val Gly 5er Val Tyx Glu Txp aac aat atc aaa aca aag gac ttt cct tta ttt cgg aag gac tgc ttt 96 Asn Asn Ile Lys Thr Lys Asp Phe Pro Leu Phe Arg lays Asp Cys Phe ttt aca gat gac acg gtt atg ace tgt get gtt gca gaa gca att atg 144 Phe Thr Asp Asp Thr Val Met Thr Cys Ala Val Ala Glu Ala Ile Met aat ggt gga caa aaa gat gac ttc att gac gcg atg aag aaa tat ggc 192 Asn Gly Gly Gln Lys Asp Asp Phe Ile Asp Ala Met Toys ~ys Tyr Gly aga atg tat ccg aat get gat tac ggt get cgg ttt aat gca tgg cta 240 Arg Met Tyr Pro Asn Ala Asp Tyr Gly Ala Arg Phe Asn Ala Trp Leu aac agc gat aac egt gag ect tat aat agc ttt ggg aat gga tca get 288 Asn Ser Asp Asn Arg Glu Pro Tyr Asn Ser Phe Gly Asn Gly Ser Ala atg egt att tct cca tgt get tgg atc atg gac tgt ggt ttt tat gcg 336 Met Arg Ile Ser Pro Cys Ala Trp lle Met Asp Cys Gly Phe Tyr Ala aaa act ggt ata tgg cca tca tct aga gga ctt acg agt ctt tct gca 384 Lys Thx Gly lle Trp Pro Ser Ser Arg Gly Leu Thr Sex Leu Ser Ala gag gta act cat aat cat cca gaa ggt gtc aaa ggc get atg get aca 432 Glu Val Thr His Asn His Pro Glu Gly Val Lys Gly Ala Met Ala Thr get gat get atc ttt eta tgt egt ttt tac ttt ggt ggt tat tgt aga 480 Ala Asp A1a Tle Phe F~eu Cys Arg Phe Tyr Phe Gly Gly Tyr Cys Axg gag tac gag caa tca att aac gac aat cct aca gag tgt aaa aga cga 528 Glu Tyr Glu G1n Ser Ile Asn Asp Asn Pro Thr Glu Cys Lys Arg Arg att aag qat tat ata gaa aaa gaa tac gat tac aat cta tct caa act 576 Tle Lys Asp Tyr zle Glu hys Glu Tyr Asp Tyr Asn I~eu Ser Gln Thr tta gat gaa atc cgt cct aac tat cgt ttt aac gaa aca tgt cag gaa 629 Leu Asp Glu Ile Arg Pro Asn Tyr Arg Phe Asn Glu Thr Cys Gln Glu act gtc cct caa gcc att atc gcc ttt ctt gaa agt aga gac ttc gaa 672 Thr Val Pro Gln Ala 21e Ile Ala Phe ~eu Glu Ser Arg Asp Phe Glu gat gcg ata aga aat gcc atc tca ctt ggt ggc gac agt gat act ctc 720 Asp Ala Ile Arg Asn Ala Ile Ser Leu Gly Gly Asp Ser Asp Thr Leu gca gca atc act tgt agc ata gca gag gca get tac ggt att cct gat 768 Ala Ala Ile Thr Cys Ser Ile Ala Glu Ala Ala Tyr Gly Ile Pro Asp tgg atc aag gat aag gcc tat tct tac ttg gat gaa ccc tta aag gat 816 Trp Ile Lys Asp Lys Ala Tyr Ser Tyr Leu Asp Glu Pro Leu Toys Asp gta gtt agg cga tgg gaa aat aga ata aaa gcg tat taa 855 vat Val Arg Arg Trp Glu Asn Arg 11e Zys A1a Tyr <210> 26 <211> 284 <212> PRT
<213> Salmonella pneumona.ae <400~ 26 Met Leu Gly Ala 11e Tle G1y Asp Ile val Gly Ser veal Tyr Glu Trp Asn Asn Ile Lys Thr Lys Asp Phe Pro Leu Phe Arg ~ys Asp Cys Phe 20 25 3p Phe Thr Asp Asp Thr Val Met Thr Cys Ala Val Ala Glu Ala Ile Met 35 40 q5 Asn Gly Gly Gln Lys Asp Asp Phe Tle Asp Ala Met Lys Lys Tyr Gly Arg Met Tyr Pro Asn Ala Asp Tyr Gly Ala Arg Phe Asn Ala Trp Leu Asn Ser Asp Asn Arg Glu Pro Tyr Asn Ser Phe Gly Asn Gly Ser Ala Met Arg Tle Ser Pro Cys Ala Trp Ile Met Asp Cys Gly Phe Tyr Ala Lys Thr Gly Tle Trp Pro Ser Ser Arg Gly Leu Thr Ser Leu Sex Ala Glu Val Thr His Asn His Pro Glu Gly Val Lys G1y Ala Met Ala Thr Ala Asp Ala Ile Phe Leu Cys Arg Phe Tyr Phe Gly Gly Tyr Cys Axg Glu Tyr Glu Gln Ser Ile Asn Asp Asn Pro Thr Glu Cys Toys Arg Arg z~5 170 175 xle Lys Asp Tyr T1e Glu Lys Glu Tyr Asp Tyr Asn Leu Ser G1n Thr Leu Asp Glu ale Arg Pro Asn Tyr Arg Phe Asn Glu Thr Cys Gln Glu Thr Val Pro Gln Ala Ile Ile Ala Phe Leu Glu Ser Arg Asp Phe Glu Asp Ala Ile Arg Asn Ala Ile Ser Zeu Gly Gly Asp Ser Asp Thr heu Ala Ala d1e Thr Cys Sex lle Ala Glu Ala Ala Tyr Gly T1@ Pro Asp Trp lle L~ys Asp 1<ys Ala Tyr Sex Tyr peu Asp Glu Pro Z<eu Toys Asp Val val Arg Arg Trp Glu Asn Arg Ile I~ys Ala Tyr z75 28a <210> 27 <211> 936 <212> DMA
<213> Salmonella pneumomae <220>
<221> CDS
<222> (1) . . (936;
<400> 27 ttg cat acg acg aaa tgt aaa cat ttc tgt tta aaa tta agg ata aaa 48 Leu His Thr Thr Lys Cys Lys His Phe Cys Leu Lys Leu Arg Tle Lys tca atg aaa aaa gca atg gta att atc aac cct act tct ggt ggc gag 96 Ser Met Lys Lys Ala Met Val Ile Tle Asn Pro Thr Ser Gly Gly Glu aag get ttg gat tac aaa gaa aag ctg gag aat aaa gca aaa gaa tac 144 Lys Ala Leu Asp Tyr Lys Glu Lys Leu Glu Asn Lys Ala Lys Glu Tyr ttt gaa tat gtt gaa acc aaa att acc gaa aaa gcg ctg gat gca aca 192 Phe Glu Tyr Val Glu Thr Lys Tle Thr Glu hys Ala Leu Asp Ala Thr cat ttt get gaa gaa get tct cgt gag cag tat gat gca gtg gtt gtg 240 His Phe Ala Glu Glu Ala Ser Arg Glu Gln Tyr Asp Ala Val Val Val ttt ggt gga gat gga act gtc aat gaa gtc att tca ggt att gat gag 288 Phe Gly Gly Asp Gly Thr Val Asn Glu Va1 Tle Ser Gly Tle Asp Glu aga gac tac att cct aag tta ggg att atc cca ggc ggt acg ggt aac 336 Arg Asp Tyr Ile Pro Lys Leu Gly Ile Tle Pro Gly Gly Thr Gly Asn 100 7.05 11 0 ctc att aca aaa ctt ttg gaa atc aat caa gac atc gat ggc gca att 389 Leu Tle Thr Lys T,eu Leu Glu Tle Asn Gln Asp Tle Asp Gly Ala Ile 115 ~.2 0 12 5 gac gaa ctg gat ttt gat tta acc aat aag att gat atc ggt aaa gca 432 Asp Glu k~eu Asp Phe Asp Leu The Asn Lys 21e Asp Tle Gly Lys Ala aat gac aac tat ttt ggt tat atc ttt agt atc ggt tct ctg cct gag 980 Asn Asp Asn Tyr Phe Gly Tyr Tle Phe Ser Tle Gly Ser Lau Pro Glu gcg att cac aat gtt gaa ata gag gac aaa aca aaa ttc ggt att tta 528 Ala I1e His Asn Val Glu Ile Glu Asp Zys Thr Lys Phe Gly Ile I~eu acc tat get gta aat acc atg aag tct gtc atg aca gat cag gtc ttt 576 Thr Tyr Ala Val Asn Thr Met Lys Ser Val Met Thr Asp Gln Val Phe aac att aag gtt gag aca gaa aat gga aat tat gtt ggt gaa get agc 629 Asn Ile Lys Val Glu Thr Glu Asn Gly Asn Tyr Val Gly Glu Ala Ser cat gtt ttg gtc ctt ttg aca aat tac ttc get gat aag aaa atc ttt 672 His Val Leu Val Leu Leu Thr Asn Tyr Phe Ala Asp Lys Lys Ile Phe gaa gaa aac aag gac ggc tat gcc aac att ttg att ctg aaa gat gcc 720 Glu Glu Asn Lys Asp Gly Tyr A1a Asn Ile Leu zle Leu Lys Asp Ala tct ata ttc tcc aaa tta tcc gtc att cct gat tta tta aaa ggg gat 768 Ser I1e Phe Ser Lys ~eu Ser Val Tle Pro Asp Leu Leu Lys Gly Asp gtt gtc gca aat gat aat atc gag tat atc aaa gcg cgt aat att aaa 816 Val Val Ala Asn Asp Asn Ile G1u Tyr Ile Lys Ala Arg Asn Ile Lys atc tct tca gat agt gaa ttg gag tca gat gtt gac gga gat aaa tca 864 Ile Ser Sex Asp Ser Glu Leu Glu Ser Asp Val Asp Gly Asp Lys Ser gat aac cta cct gta gaa atc aaa gtc cta get cag cga gta gaa gta 912 Asp Asn Leu Pro Val Glu Ile Toys Val heu Ala Gln Arg Val Glu Val ttt tca aaa ccg aaa gag gat tag 936 Phe Ser Lys Pro Tlys Glu Asp 305 31p <210> 28 <211> 311 <212> PRT
<213> Salmonella pneumoniae <400> 28 I~eu His Thr Thr Lys Cys Lys His Phe Cys Leu Lys Leu Arg Ile Lys Ser Met Lys I~ys Ala Met Val Ile Ile Asn Pro Thr Ser Gly Gly Glu Irys Ala F~eu Asp Tyr Lys Glu Lys Leu Glu Asn Lys Ala Lys Glu Tyr Phe Glu Tyr Val Glu Thr Lys Ile Thr Glu Irys Ala Leu Asp Ala Thr His Phe Ala Glu Glu Ala Ser Arg Glu Gln Tyr Asp Ala Val Val Val Phe Gly Gly Asp Gly Thr Val Asn Glu Val Tle Ser Gly Ile Asp Glu Arg Asp Tyr Ile Pro Lys Leu Gly Il~.e Tle Pro Gly Gly Thr Gly Asn Leu I1e Thr Lys Leu T~eu Glu Tle Asn Gln Asp Ile Asp Gly Ala Ile Asp Glu Leu Asp Phe Asp T~eu Thr Asn Lys Ile Asp Ile Gly Lys A1a Asn Asp Asn Tyr Phe Gly Tyr Ile Phe Ser Ile Gly Ser Leu Pro Glu Ala Ile His Asn Val Glu Ile G1u Asp Lys Thr Lys Phe Gly Tle Leu Thr Tyr Ala Val Asn Thr Met Lys Ser Val Met Thr Asp Gln Val Phe Asn Ile I~ys Val Glu Thr Glu Asn Gly Asn Tyr Val Gly Glu Ala Ser His Val Leu Val Leu Leu Thr Asn Tyr Phe Ala Asp Lys Lys Ile Phe Glu Glu Asn Lys Asp Gly Tyr Ala Asn Ile Leu Ile Leu Lys Asp Ala 225 230' 235 290 Ser Tle Phe Ser Toys Zeu Ser Val I1e Pro Asp L2u Leu ~ys Gly Asp Val Va1 Ala Asn Asp Asn Tle Glu Tyr Ile I~ys Ala Arg Asn Tle Lys Tle Ser Ser Asp Ser Glu i~eu Glu Ser Asp Val Asp Gly Asp Lys Ser Asp Asn heu Pro Val Glu Ile Lys Val Leu Ala Gln Arg Val Glu Val Phe Ser Lys Pro Lys Glu Asp <220> 29 <211> 1188 <212> DNA
<213> Salmonella pneurnoniae <220>
<221> CDS
<222> (11..(1188) <400> 29 atg aat tac ttg caa gac ttg ggt att act gga cta tat ctt tgt ccc 48 Met Asn Tyr Leu Gln Asp Zteu G1y Ile Thr Gly Leu Tyr I~eu Cys Pro atc ttt gaa tct aca agc aat cac aag tac aat acg aca gat tac ttt 96 Tle Phe Glu Ser Thr Ser Asn Hi.s Lys Tyr Asn Thr Thr Asp Tyr Phe gaa att gac cgt cat ttt gga gac aag gag acc ttt cgg gaa ctg gtg 144 Glu Tle Asp Arg His Phe Gly Asp Lys Glu Thr Phe Arg Glu Leu Val gat caa gcg cat cat cgt ggc atg aaa gtc atg ctg gat gcg gta ttt 192 Asp Gln Ala His His Arg Gly Met Lys Val Met lieu Asp Ala Val Phe aat cat att ggt tcg caa tct ctt caa tgg aaa aat gtc gtc aaa aat 240 Asn His Ile Gly Ser Gln Ser Leu Gln Trp hys Asn Val Val Lys Asn ggt gaa cag tct get tat aag gat tgg ttc cat att caa caa ttc cca 288 Gly Glu Gln Ser Ala Tyr hys Asp Trp Phe H~.s Tle Gln Gln Phe Pro gtg aca act gaa aag cta gtt aat aag aga gac tta ccc tat cat gtt 336 Val Thr Thr Glu Lys ~eu Val Asn Lys Arg Asp Leu Pro Tyr His Val ttt ggt ttc gag gac tat atg cct aag cta aat aca gcc aat cca gag 384 Phe Gly Phe Glu Asp Tyr Met Pro Zys Leu Asn Thr Ala Asn Pro Glu 11.5 120 125 gtc aag aat tat ctt tta aag gtt gcg act tat tgg att gaa gag ttt 432 Val Lys Asn Tyr Leu Leu hys Val Ala Thr Tyr Trp Ile Glu Glu Phe aat atc gat get tgg cgt ttg gat gtg get aat gag att gac cat cag 480 Asn Ile Asp Ala Trp Arg Leu Asp Val Ala Asn Glu Ile Asp His Gln ttc tgg aag gat ttt cgt aag gca gtt tta get aaa aat cct gat ctt 528 Phe Trp I~ys Asp Phe Arg Lys Ala Val Leu Ala Lys Asn Pro Asp Zeu 1.65 170 175 tat atc cta gga gaa gtc tgg cat aca tct cag cct tgg cta aat gga 576 Tyr Ile zeu Gly Glu Val Trp His Thr Ser Gln Fro Trp Leu Asn Gly gat gag ttc cat gcc gtc atg aat tat cct tta tct gat agt atc aag 624 Asp Glu Phe His Ala Va1 Met Asn Tyr Pro Leu Ser Asp 5er Ile Zys gac tat ttc tta cga gga att aag aag aca gac cag ttc atc gat gaa 672 Asp Tyr Phe E~eu Arg Gly Ile Lys Lys Thr Asp Gln Phe Ile Asp Glu atc aat gga gag tct atg tat tac aag cag cag att tca gag gtc atg 720 Ile Asn Gly Glu Ser Met Tyr Tyr Lys Gln Gln Tle Ser Glu val Met ttt aat ctc ttg gat tca cat gat aca gag cga atc ctg tgg acg gcc 768 Phe Asn Leu T~eu Asp Ser His Asp Thr Glu Axg Tle l,eu Trp Thr Ala aat gaa gat gtt caa ctg gtt aaa tca gcc tta gcc ttt ctc ttt tta 816 Asn Glu Asp Val Gln Leu Val ~ys Ser Ala T~2u Ala Fhe Leu Fhe Leu caa aaa gga aca ccg tgc att tat tac gga acc gag cta gcc ttg act 864 Gln Lys G1y Thr Pro Cys Ile Tyr Tyr Gly Thr Glu veu Ala Leu Thr gga gga cca gat cca gat tgt cgt cgt tgt atg cct tgg gaa cgt gta 912 Gly Gly Pro Asp Pro Asp Cys Arg Arg Cys Met Pro Trp Glu Arg Val tca agt gac aat gat atg ctg aac ttt atg aag agg ctg att aaa att 960 Ser Ser Asp Asn Asp Met Leu Asn Phe Met Lys Arg Leu Tle Lys Tle cgg aaa tac gcg tca gta atc att tcg cat ggc aag tat agc ctt caa 1008 Arg Lys Tyr Ala Ser Val lle Ile Ser His Gly Lys Tyr Ser Leu Gln gaa atc aac tct gat cta gta get ctg gaa tgg aaa tac gaa gga cgg 1056 Glu Ile Asn Ser Asp Leu Val Ala T~eu G1u Trp Toys Tyr Glu Gly Arg atc ctc aaa gca ata ttc aac caa tca aca gaa gat tat ctt tta gag 1104 Ile Leu Lys Ala Ile Phe Asn Gln Ser Thr Glu Asp Tyr Leu Leu Glu aaa gaa gca gta gca cta gca agc aat tgc caa gaa ttg gat aat cag 1152 Trys Glu Ala Val Ala Leu Ala Ser Asn Cys Gln Glu Leu Asp Asn Gln ctt gtc atc tct cca gat gga ttt atg att ttc taa 1188 Leu Val Ile Ser Pro Asp Gly Phe Met Ile Phe <210> 30 <212> 395 <212> PRT
<213> Salmonella pneumoniae <400> 30 Met Asn Tyr Leu Gln Asp Leu Gly Tle Thr Gly Leu Tyr Leu Cys Pro 1 5 10 1.5 Ile Phe Glu Ser Thr Ser Asn His Lys Tyr Asn Thr Thr Asp Tyr Phe Glu Tle Asp Arg His Phe Gly Asp I,ys Glu Tnr Phe Arg Glu 1~2u vat Asp Gln Ala H~.s His Arg Gly Met I~ys Val Met Leu Asp Ala Val Phe Asn His Ile Gly Ser Gln Ser Leu Gln Trp Lys Asn Val Val Txys Asn Gly Glu Gln Ser Ala Tyr Lys Asp Trp Phe His Ile Gln Gln Phe Pro Val Thr Thr Glu Lys Leu Val Asn Lys Arg Asp Leu Pro Tyr His Va1 Phe Gly Phe Glu Asp Tyr Met Pro Irys Zeu Asn Thr Ala Asn Pro Glu Val Lys Asn Tyr Leu Leu Lys Val A1a Thr Tyr Trp Ile Glu Glu Phe Asn Ile Asp Ala Trp Arg Leu Asp Val Ala Asn Glu Ile Asp His Gln Phe Trp Lys Asp Phe Arg Toys Ala Val Z,eu Ala Lys Asn Pro Asp Leu Tyr Ile Leu Gly G1u Val Trp His Thr Ser Gln Pro Trp Leu Asn Gly Asp Glu Phe His A1a Val Met Asn Tyr Pro Leu Ser Asp Ser Ile Zys Asp Tyr Phe Leu Arg Gly Ile hys Lys Thr Asp Gln Phe Ile Asp Glu Ile Asn Gly Glu Ser Met Tyr Tyr Lys Gln Gln Ile Ser Glu val Met Phe Asn Leu Leu A~:~ Ser His Asp Thr Glu Arg Ile heu Trp Thr Ala 2ei_> 25D 255 Asn Glu Asp Val Gln Leu Val Lys Ser Ala Leu Ala Phe Leu Phe Leu Gln Lys Gly Thr Pro Gys Ile Tyr Tyr Gly Thr Glu Leu Ala Leu Thr Gly Gly Pro Asp Pro Asp Cys Arg Arg Cys Met Pro Trp Glu Arg Val Ser Ser Asp Asn Asp Met Leu Asn Phe Met Lys Arg l,eu Ile Tlys Ile Arg Lys Tyr Ala Ser Val Ile Ile Ser His Gly Lys Tyr Ser Leu Gln Glu Ile Asn Ser Asp Leu vat Ala Leu Glu Trp Lys Tyr Glu Gly Arg Ile Imu Lys Ala Tle Phe Asn Gln Ser Thr Glu Asp Tyr ~eu Zeu Glu hys Glu Ala Val Ala Leu Rla Ser Asn Cys Gln Glu Leu Asp Asn Gln Leu Val Tle Ser Pro Asp Gly Phe Met Ile Phe <210> 31 <211> 318 <212> DNA
<213> Salmonella pneurnoniae <220>
<221> CDS
<222> (1) . . (318) <400> 31 atg aat tgt aga gga cat gaa aca aga caa aga att gtt aga gat ttt 48 Met Asn Cys Arg Gly His Glu Thr Arg G1n Arg T1e val Arg Asp Phe gaa gtt cag cct aaa gca cat att aag ctg tta gca aat caa caa aaa 96 Glu Val Gln Pro Lys Ala His zle Zys Leu Leu Ala Asn Gln Gln Lys cat agt gat gca gga gca act att gaa gat gaa tat tat gta ttt atc 149 His Ser Asp Ala Gly Ala Thr Tle Glu Asp Glu Tyr Tyr Val Phe Tle get gag agt aaa att gat ggc aag aag gaa gtt att cag tgt tgc atg 192 Ala Glu Ser Lys Tle Asp Gly hys Lys Glu Val lle Gln Cys Cys Met 50 55 6~
ggt gcg gca agg gat ttt tta gaa cta att aat cac aaa ggg cta cct 240 Gly Ala Ala Arg Asp Phe ~eu Glu ~eu Ile Asn His Lys Gly Leu Pro 65 7p 75 80 ctt ttt aat ccg ctt gta ggt gat tct cat gta aat aat aga caa gaa 288 F~eu Phe Asn ~'ro T.~eu Val Gly Asp Ser H~.s Val Asn Rsn Arg Gln Glu 85 90 ~5 tat gac aat aca ggg agt gga aat tta taa 31g Tyr Asp Asn Thr Gly Ser Gly Asn Leu <210> 32 <21l> 1 05 <212> PRT
<213> SalmonelJ.a pneumoniae <400> 32 Met Asn Cys Arg Gly His Glu Thr Arg Gln Arg Ile Val Arg Asp Phe Glu Val Gln Pro Lys Ala His Ile Toys heu Leu Ala Asn Gln Gln Zys His Ser Asp Ala Gly Ala Thr I1e Glu Asp G1u Tyr Tyr Val Phe Ile Ala Glu Ser Lys Ile Asp Gly hys Zys Glu Val Ile Gln Cys Cys Met 50 55 gp Gly Ala Ala Arg Asp Phe Leu Glu Leu Ile Asn His Lys Gly I~eu Pro Leu Phe Asn Pro Leu Val Gly Asp Ser His Val Asn Asn Arg Gln G1u Tyr Asp Asn Thr G:~y Ser Gly Asn Leu <210> 33 <211> 762 <212> DNA
<213> Salmonella ~m eumoniae <220>
<221> CDS
<222> f1)-.f762) <~00> 33 atg gaa atc caa gat tat act gat agt gaa ttc aaa cat get tta gca 48 Met Glu Ile Gln Asp Tyr Thr Asp Ser Glu Phe Lys H~.s Ala Leu Ala agg aat ctt cgt tca ctg aca aga gga aaa aag tcc agt aag caa cct 96 Arg Asn Leu Arg Ser Leu Thx Arg Gly hys Lys Sex ser Lrys G2n Pro ata gcg att ttg ctt gga ggg caa agt ggt gcc ggt aag act aca att 144 Ile Ala Ile Leu Ireu Gly Gly Gln Sex Gly Ala Gly hys Thr Thr Ile cat cgt att aaa cag aaa gaa ttt caa gga aat att gtt atc ata gat 192 His Arg I1e Lys Gln Lys Glu Phe Gln Gly Asn Ile Val Ile Ile Asp ggt gat agt ttt cgt tct cag cat cca cac tat tta gaa ctg cag caa 240 Gly Asp Sex Phe Arg Ser Gln His Pro His Tyr Leu Glu Leu G1n Gln gaa tat ggc aaa gac agt gta gaa tat acc aaa gat ttt gca gga aaa 2S8 Glu Tyr Gly Tlys Asp Ser Val Glu Tyr Thr hys Asp Phe Ala Gly Zys atg gta gag tct tta gta aca aaa ttg agt agt ttg aga tac aat ctt 336 Met Val Glu Ser Leu Val Thr Lys Leu Ser Sex Leu Arg Tyr Asn ?~eu ttg ata gag gga act tta cga aca gtt gat gtt cca aag aaa aca gca 384 Leu Ile Glu Gly Thr Leu Arg Thr Val Asp Val Pro Lys Lys Thr A1a 115 12 0 1.2 5 caa ctc ttg aaa aat, aag gga tat gaa gta caa ttg gcc tta att gcg 432 Gln T~eu Tseu T,ys Asn Lys Gly Tyr G1u Val Gln Leu Ala Leu Ile Ala aca aag cct gaa tt tcg tat cta agt act ctt atc cgt tat gaa gaa 480 Thr Lys Pxo Glu Le-., Ser Tyr L,eu Ser Thr Lieu Ile Arg Tyr Glu Glu 145 150 15S 1.60 ctg tac att atc aat cca aat caa gca cgc gca act cca aaa gaa cat 528 Leu Tyr Ile Ile ASkE Pro Asn Gln Ala Arg A1a Thr Pxo Lays Glu His x.65 1.70 175 cat gat ttc att gta aat cat cta gtt gat aac aca cga aaa ttg gaa 576 His Asp Phe Ile Val Asn His Lteu Val Asp Asn Thr Arg Lrys Leu Glu 180 185 x.90 gaa cta get atc ttt gaa aga att caa att tac caa cga gat aga agt 624 Glu heu Ala Ile Phe Glu Axg I1e Gln Ile Tyr Gln Arg Asp Arg Ser tgt gta tat gat tca aaa gaa aat aca act tca gca gca gat gtt ctt 672 Cys Val Tyr Asp Sex Lys Glu Asn Thr Thr Ser Ala A1a Asp Val Leu caa gag tta ctc ttt ggg gag tgg agt cag gta gag aag gag atg ttg 720 Gln Glu Leu Leu Phe Gly Glu Trp Ser G1n Val Glu Lys Glu Met Leu cag gtg ggg gaa aag aga ctt aat gaa tta ctt gaa aaa taa 762 Gln Val Gly Glu Zys Arg heu Asn Glu ~eu Leu Glu I~ys <210>39 <211>253 <212>PRT

<213>Salmonella pneumoniae <400> 34 Met Glu Ile Gln Asp Tyr Thr Asp Ser Glu Phe Lys His A1a Leu A1a ~ 1 5 10 15 Arg Asn Leu Arg Ser heu Thr Arg Gly hys Lys Ser Ser Lys Gln Pro Ile Ala Ile Leu Leu Gly G1y Gln Ser Gly Ala Gly Lys Thr Thr I1e His Arg Ile Lys Gln T~ys Glu Phe G1n Gly Asn Ile val Ile Ile Asp Gly Asp Ser Phe Arg Ser Gln H~.s Pro His Tyr Leu Glu Leu Gln Gln Glu Tyr Gly Lys Asp Ser Val Glu Tyr Thr Lys Asp Phe Ala Gly Lys Met Val Glu Ser Leu Val Thr Lys Leu Ser Ser Leu Arg Tyx Asn Leu Leu Ile Glu Gly Thr Leu Arg Thr Val Asp Val Pro Lys I,ys Thr A1a 11.5 120 1.25 Gln Leu Lieu Lys Asn Lys Gly Tyr Glu Val G1n Leu Ala Leu Ile Ala 130 1S5 1q0 Thr Lys Pro G1u Leu Ser Tyr Zeu Ser Thr Leu Tle Arg Tyr Glu Glu ~eu Tyr Ile Ile Asn Pro Asn Gln Ala Arg A1a Thr Pro Lys Glu His His Asp Phe Ile Val Asn His Leu Val Asp Asn Thr Arg Lys Leu Glu Glu Leu Ala Ile Phe Glu Arg the Gln Ile Tyr Gln Arg Asp Arg Ser Cys Val Tyr Asp Ser Lys Glu Asn Thr Thr Sex Ala Ala Asp Val Leu G1n Glu Leu Leu Phe Gly Glu Trp Ser Gln Val Glu hys Glu Met Leu Gln Val Gly Glu Lys Arg I~eu Asn Glu Leu Zeu Glu Lys <210>35 <211>777 <212>DNA

<213>Salmonella pneumoniae <220>
<221> CDS
<222> (1) . . (777) <400> 35 atg aga ggg ttt aah aac aag ata aag tct gtt tat caa gaa cta aca 48 Met Arg Gly Phe Asn Asn Lys Ile ~ys Ser Val Tyr Gln Glu Leu Thr 1 s la 15 aat tcc aaa gag aak~ ttc ggt agc ttt cac aag act tta att cat ttg 96 Asn Ser Lys Glu Lys Phe Gly Ser Phe His Zys Thr Leu Ile His Leu cat aca cct gtt tct tat gat tac aag cta ttt tct aat tgg act gca 144 His Thr Pro Val Ser Tyr Asp Tyr Lys Leu Phe Ser Asn Trp Thr Ala acg aaa tat aga aaa att act gaa gat gaa cta tat gat ata ttt ttt 192 Thr Lys Tyr Arg Zys Tle Thr Glu Asp Glu Treu Tyr Asp Ile Phe Phe gaa aat aag aaa ata aaa gtt gat aag aca att ttt ttt agt aat ttt 240 Glu Asn Lys Tlys Tle Lys Val Asp ~ys Thr Tle Phe Phe Ser Asn Phe gat aag gtt gtt ttt tct agt tca aaa gaa tat att agt ttt ctt atg 288 Asp Lys Val Val Phe Ser Ser Ser hys Glu Tyr Ile Ser Phe Zeu Met tta gca gag gca atc ata aaa aat gga ata gaa ata gtt gta gta act 336 Leu Ala Glu A1a Tle Tle Toys Asn Gly Tle Glu Tle Val Va1 Val Thr gat cat aat act acc aaa ggt att aaa aag tta caa atg gca gtc tca 384 Asp His Asn Thr Thr Lys G1y Tle Lys Lys Leu Gln Met Ala Val Ser atc ata atg aaa aat tat ccg att tat gat ata cat cct cat att tta 432 Tle Tle Met Lys Asn Tyr Pro Ile Tyr Asp Tle His Pro His Tle Leu cat gga gta gaa att agt gca gca gat aaa ttg cat att gta tgt ata 480 His Gly Val Glu Ile 5er Ala Ala Asp ~ys Leu His Tle val Cys Tle tat gat tat gaa caa gaa tca tgg gtt aat caa tgg tta agt gaa aat 528 Tyr Asp Tyr Glu Gln Glu Ser Trp Val Asn Gln Trp heu 5er Glu Asn att ata agt gag aaa gat gga agt tat caa cat tca ctg act ata atg 576 Tle Ile Ser Glu Lys Asp Gly Ser Tyr Gln His Ser Leu Thr Tle Met aag gat tte aat aat caa aaa ata gtt aac tat att get cat ttc aat 624 Lys Asp Phe Asn Asn Gln ~ys Tle Val Asn Tyr I1e Ala His Phe Asn agt tat gac att ttg aaa aaa ggt tct cac tta tca ggt gca tat aaa 672 Ser Tyr Asp 21e Zeu Lys Lys Gly Ser His heu Ser G1y Ala Tyr hays cga aaa att ttt tct aaa gaa aat aca cga ttt tgg agt tta ata tta 720 Arg keys Tle Phe Ser Frys Glu Asn Thr Arg Phe Trp Ser T~eu Tle Leu 225 230' 235 240 act cga aag aat ctt cgc aac aac ttg ata ttc tct ata aag aag ttg 768 Thr Arg I~ys Asn Leu Arg Asn Asn Leu Tle Phe Ser Tle Irys Lys Zeu gtg tat taa 777 Val Tyr <210> 36 <211> 258 <212> PRT
<213> Salmonella pneumoniae <400> 36 Met Arg Gly Phe Asn Asn Lys Ile Irys Ser Val Tyx Gln Glu Leu Thr Asn Ser Lys G1u Lys Phe Gly Ser Phe His Lys Thr Leu Ile His Leu His Thr Pro Val Ser Tyr Asp Tyr Lys Leu Phe Ser Asn Trp Thr Ala Thr Zys Tyr Arg Lys Ile Thr Glu Asp Glu I~eu Tyr Asp Tle Phe Phe Glu Asn Lys Lys Ile Lys Val Asp Lys Thr Ile phe Phe Ser Asn Phe Asp Toys Val Val Phe Ser Sex Ser lays Glu Tyr Ile Ser Phe Leu Met I~eu Ala Glu Ala I1e Ile Lys Asn Gly Ile Glu Ile Val Val Val Thr Asp His Asn Thr Thr Z<ys Gly Ile Lys ~ys ~eu Gln Met Ala Val Sex Ile Ile Met Lys Asn Tyr Pro Ile Tyr Asp Ile His Pro His Ile heu His G1y Val Glu Ile Ser Ala Ala Asp Lys Leu His 21e Val Cys Ile 1g5 150 155 160 Tyr Asp Tyr Glu Gln G1u ser Trp Val Asn G1n Trp Zeu Ser Glu Asn Ile Ile Ser Glu Lys Asp Gly Ser Tyr Gln His Ser Leu Thr Ile Met Lys Asp Phe Asn Asn Gln Zys I1e Val Asn Tyr I12 Ala His Phe Asn 195 zoo 205 Ser Tyr Asp Tle Leu Lys Lys Gly Ser His Leu Ser Gly Ala Tyr Lys Arg Lys Tle Phe Ser Lys Glu Asn Thr Arg Phe Trp Ser Leu Tle Leu Thr Arg Lys Asn Leu Arg Asn Asn Leu Tle Phe Ser Tle Lys Lys Leu Val Tyr <210> 37 <211> 1824 <212> DNA
<213> Salmonella pneumoniae <220>
<221> CDS
<222> (1)..(1824) <400> 37 atg gtc atc act aaa cac ttt gcc att cac gga aag agt tac cgc aga 48 Met Val Tle Thr Lys His Phe Ala Tle His Gly Lys Ser Tyr Arg Arg aag ctt atc aag tac att ctc aat cct gag aaa acc aat aat ctt gcc 96 Lys Leu Tle Lys Tyr Tle Leu Asn Pro Glu Lys Thr Asn Asn Leu Ala ttg gtg tcg gac tat ggc atg aag aat ttt ctg gac ttt cct agc tat 199 Leu Val Ser Asp Tyr G1y Met Lys Asn Phe Leu Asp Phe Pro Ser Tyr gag gaa atg gtg cag atg tat cat gaa aat ttc atc agc aac gat acg 192 Glu Glu Met Val Gln Met Tyr His Glu Asn Phe Tle Ser Asn Asp Thr ctt tac gat ttt cgc cac gac agg atg gaa gaa aat caa cga aaa ata 240 Leu Tyr Asp Phe Arg H~.s Asp Arg Met Glu Glu Asn G1n Arg Lys Tle 70 75 g0 cac get cac cac ate att cag tct ttc tcg eca gag gat cat atc act 288 H~.s Ala Hls His Tle Tle G1n Ser Phe Ser Pro Glu Asp H~.s Tle Thr cct gaa caa atc aat cgg ata ggt tat gag act gtg aag gaa tta act 336 Pro Glu Gln Tle Asn Arg Ile G1y Tyr Glu Thr val Irys Glu Leu Thr ggt ggc aaa ttt cgt ttt atc gtt gcg acc cat gtt gat aaa gac cac 384 Gly Gly Lys Phe Arg Phe Tle Val Ala Thr His Val Asp Lys Asp His ctg cac aat cac atc att atc aat tca gta gat agc aat tct gac aaa 432 heu His Asn His Ile Tle Ile Asn Ser Val Asp Ser Asn Ser Asp hys aag ctc aag tgg gac tac aag gtg gag cga aat ctt cgc atg att tct 480 Lys Leu Lys Trp Asp Tyr hys Val Glu Arg Asn Leu Arg Met Ile Ser gac cgt ttt tct aaa atc gca ggt get aaa atc att gag aac cgc tat 528 Asp Arg Phe Ser Lys Ile Ala Gly Ala Lys Ile Ile Glu Asn Arg Tyr tct cac cag cgg tat gaa gtc tat cgt aag act aat cac aag tat gaa 576 Ser His Gln Arg Tyr G1u Val Tyr Arg Lys Thr Asn His Irys Tyr Glu ctc aag cag cga ctc tat ttt ttg atg gaa cat tct agg gac ttt gag 624 Leu z,ys Gln Arg Leu Tyr Phe Leu Met Glu His Ser Arg Asp phe Glu 1g5 2D0 205 gat ttc aaa aag aat get ccg cta cta cat gtg gag atg gat ttc cgt 672 Asp Phe Lys Lys Asn Ala Pro Leu Leu His Val Glu Met Asp Phe Arg cac aag cat gcc acc ttt ttt att acg gac tca act atg aaa cag gtg 720 His Lys His Ala Thr Phe Phe Ile Thr Asp Ser Thr Met Lrys Gln Val gtg cgt ggc aag caa ctc aat cgc aag cag cct tac aca gaa gaa ttt 768 Val Arg Gly Lys Gln Leu Asn Arg Lys Gln Pro Tyr Thr Glu Glu Phe ttt aag aac tac ttt gcc aaa aga gaa ata gaa agt ctc atg gaa ttt 816 Phe Zlys Asn Tyr Phe Ala hys Arg Glu Ile Glu Ser I~eu Met Glu Phe tta ttg ctg aaa gtt gag aat atg gat gat tta ctt cag aaa gca aaa 864 I,eu Leu T~eu hys Val Glu Asn Met Asp Asp Zeu .Leu Gln Lys Ala Lys ctt ttt gga cta act atc aat cct aaa caa aag cat gtt tct ttt caa 912 Leu Phe Gly F~eu Thr Fle Asn Pro f~ys Gln Lys His Va2 Ser Fhe Gln ttt gca gga gtg gag gta aag gag aca gag cta gac cag aaa aat ctt 960 Phe Ala Gly Val G1u Val Lys Glu Thr Glu Leu Asp G1n Lys Asn Leu tat gat gta gag ttt ttc caa gat tat ttt aaa aat aga aaa gat tgg 1008 Tyr Asp Val Glu Phe Phe Gln Asp Tyr Phe Lys Asn Arg Lys Asp Trp caa get eca gaa act gag gat tte gtt eaa ett tat caa gaa gaa aag 1056 Gln Ala Pro Glu Thr Glu Asp Phe Val Gln Leu Tyr Gln Glu Glu Lys tta tcc aaa gaa aaa gaa ctt cca agc gat gag aag ttc tgg gag tcc 1104 Leu Ser Lys Glu Lrys Glu Leu Pro Ser Asp Glu I3ys Phe Trp Glu Ser tat caa gag ttc aag agt aac aga gat gcc gtt cat gaa ttt gag gtg 1152 Tyr Gln Glu Phe Lys Ser Asn Arg Asp Ala Val His Glu Phe Glu Va1 gag ttg tca ctc aat caa att gaa aaa gta gtg gat gat gga att tac 1200 Glu Leu Ser Leu Asn Gln Ile Glu Lys Val Val Asp Asp Gly Ile Tyr gtc aag gtc aag ttt ggt att cgt cag gag gga ctt atc ttt gtg ccg 1248 Val Lys Val Lys Phe Gly Ile Arg Gln Glu Gly heu Ile Phe Val Pro aac atg cag ctt gat atg gaa gag gat aag gtg aag gtt ttc atc agg 1296 Asn Met Gln Leu Asp Met Glu Glu Asp Lys Val Lys Val Phe z1e Arg gaa acc agc tcc tac tat gtc tac cac aaa gae get gcc gag aaa aat 2344 Glu Thr Ser Ser Tyr Tyr Val Tyr His Zys Asp Ala Ala Glu Lys Asn tgt tat atg aaa ggt cga acc tta att aga cag ttc agc tat gaa aat 1392 cys Tyr Met Lys Gly Arg Thr Leu 21e Arg Gln Phe Ser Tyr Glu Asn caa acc att cca tta cgc aga aaa gcg aca gtc gat atg att aaa gag 144'0 Gln Thr Ile Pro Leu Arg Arg ~ys Ala Thr val Asp Met 11e Lys Glu aag att gcg gaa gtg gat get ttg att gaa ctg gaa gta gaa aat caa 1488 Lys Ile Ala Glu Val Asp Ala Leu Ile Glu Leu Glu Val Glu Asn Gln tct tat gtc acg att aaa gat gag tta gtg cat gaa cta gca gcg tct 1536 Ser Tyr Val Thr Ile Lys Asp Glu Leu Val His Glu Leu Ala Ala Ser gaa ttg aga atc aat gag ttg caa gaa cga atg tca acc ttg aat caa 1584 Glu Leu Arg Ile Asn Glu Leu Gln Glu Arg Met Ser Thr Leu Asn Gln gta gca gaa tat cta ctg get tca gtt gaa agt aag caa gaa atg aaa 1632 Va1 Ala Glu Tyr Leu L2u Ala Ser Val Glu Ser Lys Gln Glu Met Lys tta aat ett tca aaa ctg aat ata act gag aat atc agt get aat att 2680 Leu Asn Leu Ser Lys Leu Asn Ile Thr Glu Asn Ile Ser Ala Asn Ile gtt gag aaa aaa ttg aag agc ctg ggg aat caa ctg gaa ttg gaa agg 1728 Val Glu Lys Lys Leu Lys Ser Leu Gly Asn G1n Leu Glu Leu G1u Arg ggc agg tat gaa aag atg gta gtc agg cta gat aaa ttt ata aat cgc 2776 Gly Arg Tyr Glu Lys Met Val val Arg Leu Asp Lys Phe I1e Asn Arg tta aat aca gga ctt tca aaa gga gat ggg ata gat ttt caa aaa tag 1824 Leu Asn Thr Gly Leu Ser Lys Gly Asp Gly Ile Asp Phe Gln Lys <210> 38 <211> 607 <212> PRT
<213> Salmonella pneumoniae <400> 38 Met Val Ile Thr Lys H~.s Phe Ala lle His Gly Lys Ser Tyr Arg Arg Lys Leu Ile Lys Tyr Ile Leu Asn Fro Glu Lys Thr Asn Asn Leu Ala Leu Val Ser Asp Tyr Gly Met Lys Asn Fhe Leu Asp phe Pro Ser Tyr 35 40 q5 Glu Glu Met Val Gln Met Tyr His Glu Asn Phe Ile Ser Asn Asp Thr Leu Tyr Asp Phe Arg His Asp Arg Met Glu Glu Asn Gln Arg Lys Ile 65 70 75 $0 His Ala His His Ile Ile Gln Ser Phe Ser Pro G1u Asp His Ile Thr $5 90 95 Pro Glu Gln Ile Asn Arg Ile Gly Tyr Glu Thr Va1 Lys Glu Leu Thr Gly Gly Lys Phe Arg Phe Ile Val Ala Thr His Val Asp Lys Asp His Leu His Asn His Ile I1e 11e Rsn Ser Val Asp Ser Asn Ser Asp Lys Lys Leu Lys Trp Asp Tyr Lys Val Glu Rrg Asn Leu Arg Met Ile Ser Asp Arg Phe Ser Lys I1e Ala Gly Ala Lys Ile Ile Glu Asn Arg Tyr Ser His Gln Arg Tyr Glu Val Tyr Arg Lys Thr Rsn His Lys Tyr Glu 1$0 1$5 190 Leu Lys Gln Arg Leu Tyr Phe Leu Met G1u His Ser Arg Asp Phe G1u Asp Phe Lys Lys Asn Rla Pro Leu Leu His Val Glu Met Asp Phe Arg His Lys His Ala Thr Phe Phe Ile Thr Asp Ser Thr Met Lys Gln Val Val Arg Gly Lys Gln Leu Asn Arg Lys Gln Pro Tyr Thr Glu Glu Phe Phe Lys Asn Tyr Phe Ala Lys Arg Glu Ile Glu Ser Leu Met Glu Phe Leu Leu Leu Lys Val Glu Asn Met Asp Asp Leu Leu Gln hys Ala Lys 275 2$0 2$5 Leu Phe Gly Leu Thr 21e Asn Pro Lys Gln Lys His Val Ser Phe Gln Phe Ala Gly Val Glu val Lys Glu Thr Glu Leu Asp Gln I~ys Asn Leu Tyr Asp Val Glu Phe Phe Gln Asp Tyr Phe Lys Asn Arg Zys Asp Trp Gln Ala Pro Glu Thr Glu Asp Phe Val Gln Leu Tyr Gln Glu Glu Lys Leu Ser Lys Glu I~ys Glu Leu Pro Ser Asp Glu Lys Phe Trp Glu Ser Tyr Gln Glu Phe Lys Ser Asn Arg Asp Ala Val His Glu Phe Glu Val Glu Leu Ser Leu Asn Gln Ile Glu Lys Va1 Val Asp Asp Gly Ile Tyr Val Lys Va1 Lys Phe Gly Ile Arg Gln Glu Gly Leu Ile Phe Val Pro Asn Met Gln Leu Asp Met Glu Glu Asp Lys Val Lys Val Phe Ile Arg Glu Thr Ser Ser Tyr Tyr Val Tyr His Zys Asp Ala Ala Glu Lys Asn Cys Tyr Met I~ys Gly Arg Thr Leu Ile Arg G1n Phe Ser Tyr Glu Asn G1n Thr Ile Pro Leu Arg Arg I~ys Ala Thr Val Asp Met Ile Lys G1u Zys Ile Ala Glu Val Asp Ala Leu Ile Glu Lieu Glu Val Glu Asn Gln Ser Tyr Val Thr Tle Lys Asp Glu Leu Val His G1u Leu Ala Ala Sex Glu Zeu Arg Ile Asn Glu Leu Gln Glu Arg Met Ser Thr Leu Asn Gln Val A1a Glu Tyr Leu Leu Ala Ser Val Glu Ser ~ys Gln Glu Met Lys 530 535 540' Leu Asn Leu Ser Lys Leu Asn Tle Thr Glu Asn Ile Ser Ala Asn 21e Val Glu Lys Lys Leu Lys Ser Leu Gly Asn Gln Leu Glu Leu Glu Arg Gly Arg Tyr Glu Lys Met Val Val Arg Leu Asp Lys Phe Tle Asn Arg L,eu Asn Thr Gly Leu Ser ~ys Gly Asp Gly Tle Asp Phe Gln Lys <210> 39 <211> 867 <212> DNA
<213> Salmonella pneumoniae <220>
<221> CDS
<222> (1)..(867) <900> 39 gtg ggt aca cta tta gca aca aga tta aaa aat aga cga aaa gaa tta 48 Val Gly Thr Leu Leu A1a Thr Arg Leu Lys Asn Arg Arg Zys Glu Leu aaa atg tct cag cga gaa tta get gag ggt atc tgt aaa cag ggg caa 96 Lys Met Ser Gln Arg Glu I~eu A1a Glu Gly Ile Cys Lys Gln Gly Gln att agt cga tta gag agt gga gag ttc acc cct gga gcg gat ttt tta 144 Ile Ser Arg T~eu Glu Ser Gly Glu Phe Thr Pro Gly Ala Asp Phe heu cat gcc ett get aag aaa tta aaa gtt agt atg gac tac ttt ttt gat 192 H1s A1a I~eu A1a Lrys Zys Leu Lys Val Ser Met Asp Tyr Phe Phe Asp gag cag gtt gta gag gaa gtc aat gag tta tca gag ttt aag aag tta 240 Glu Gln Val Val Glu Glu Val Asn G1u ~eu Ser Glu Phe Toys Lys Leu 65 70 75 8a gca cag aca ttt atc aca aat cgt aat tat gaa tct tta aaa tat ata 288 A1a Gln Thr Phe Ile Thr Asn Arg Asn Tyr Glu Ser Leu Lys Tyr Tle tat gaa ttg gaa aat gta aaa gcc cat cgc tta tct cta gca gat aaa 336 Tyr Glu ~eu Glu Asn Val T.~ys Ala His Arg Leu Ser Leu Ala Asp Lys ttt tac atg gaa tgg ata aag tct ctt ata gat ttt tat ttt tat gga 384 Phe Tyr Met Glu Trp Ile Lys Sex Leu Ile Asp Phe Tyr Phe Tyr G1y cag aaa gaa gag gca att aca cga tta gag aat atg cta cct cag tta 432 Gln Lys Glu Glu Ala Ile Thr Arg Leu Glu Asn Met Leu Pro Gln Leu aat gta tct gat ttg aac tac ctt caa gtt tca aac act cta ttc aat 480 Asn Val Ser Asp Leu Asn Tyr Leu Gln Val Ser Asn Thr Leu Phe Asn ttt tat tat gat att gaa gat tta gaa cgt ttt aat gag att aga gac 528 Phe Tyr Tyr Asp Ile Glu Asp Leu Glu Arg Phe Asn Glu Ile Arg Asp aag cta gag cat caa gtg aat cag ctt aat tta aac aca att gaa gag 576 f~ys Leu Glu His Gln Va1 Asn Gln Leu Asn Leu Asn Thr Ile Glu Glu tta gaa cta tca att aag ttc aat tat aac gtt tgt cga tac cta tgg 624 Leu Glu Zeu Ser Ile Lys Phe Asn Tyr Asn Val Cys Arg Tyr Leu Trp tta cag aaa aat att gaa gaa get att acg aaa atc aca get acg ata 672 Leu Gln I~ys Asn Ile Glu Glu Ala Ile Thr Lys Ile Thr Ala Thr Ile aag caa tgt aag gag tac agg aca act tat cta tta get gat ttg tat 720 Lys Gln Cys Lys Glu Tyr Arg Thr Thr Tyr Leu Leu Ala Asp T~eu Tyr tta ttg atg gga agt gta agt gaa aat ttt tct tct aaa agt tca gta 768 Leu Leu Met Gly Ser Val Ser Glu Asn Phe Ser Ser Lys Ser Ser Val 245 25p 255 aaa gaa tat ttt gag act get cat ttt ctc tac aaa ctt gag gaa aac 816 lays Glu Tyr Phe Glu Thr Ala His Phe Leu Tyr Trys Zeu Glu Glu Asn atg tca atg get ttg aaa gtc gaa cat tat ttt gca gat ata aca gaa 864 Met Ser Met Ala Leu Lys Val Glu His Tyr Phe A1a Asp Ile Thr Glu taa 867 <210>90 <211>2$$

<212>PRT

<213>Salmonella pneumoniae <400> 40 Val Gly Thr Leu Zeu Ala Thr Arg ~eu Lys Asn Arg Arg L,ys Glu Leu Irys Met Ser Gln Arg Glu Leu Ala Glu Gly Ile Cys Lys Gln Gly Gln Tle Ser Arg Leu Glu Ser Gly Glu Phe Thr Pro Gly Ala Asp Phe heu His A1a Leu Ala Lys Lys heu Lys Val Ser Met Asp Tyr Phe Phe Asp Glu Gln Val Val Glu G1u Val Asn Glu Tieu Ser G1u Phe Lys Toys Leu 65 70 75 $0 Ala Gln Thr Phe Ile Thr Asn Arg Asn Tyr Glu Ser Leu Lys Tyr Ile $5 90 95 Tyr Glu Leu Glu Asn Val Zys Ala His Arg Leu Ser Leu Ala Asp Lys Phe Tyr Met Glu Trp Ile Lys Ser Leu Ile Asp Phe Tyr Phe Tyr Gly Gln Zys Glu Glu Ala Ile Thr Tlrg Leu G1u Asn Met Lieu Pro Gln Leu Asn Val Ser Asp Leu Asn Tyr TAeu Gln Val Ser Asn Thr Leu Phe Asn 145 1.50 155 160 Phe Tyr Tyr Asp Ile Glu Asp I~eu Glu Rrg Phe Asn Glu Ile Arg Asp hys Leu G1u His Gln Val Asn Gln Leu Asn Leu Asn Thr Ile Glu Glu 1$0 1$5 190 l,eu G1u Leu Ser Ile Lys Phe Asn Tyr Asn Val Cys Arg Tyr Leu Trp k.,eu G1n lays Asn Ile G1u Glu Ala Ile Thr Lys Ile Thr Ala Thr Ile Lys Gln Cys Lys Glu Tyr Arg Thr Thr Tyr Leu Leu Ala Asp Leu Tyr 225 23p 235 240 Leu Leu Met Gly Ser Val Ser Glu Asn Phe Ser Ser Lys Ser Ser Val Lys Glu Tyr Phe Glu Thr Ala His Phe heu Tyr Lys Zeu G1u Glu Asn Met Ser Met Ala Leu Lys Val Glu His Tyr Phe A1a Asp Ile Thr Glu <210>41 <211>1347 <212>DNA

<213>Salmonella pneumoniae <220>
<221> CDS
<222> (2)..(1347) <400> 41 atg aat tac gaa aag tat tta aac tat ttg gac tat gaa act gaa ata 48 Met Asn Tyr Glu Lys Tyr Leu Asn Tyr Leu Asp Tyr Glu Thr Glu Tle gaa gac gca tac cat aat tta tta tta gaa tat aaa att agt gat aat 96 G1u Asp Ala Tyr His Asn Treu heu Leu Glu Tyr Lys I1e Ser Asp Asn ttt agt gat gaa cat tgg tta tat aat ttg ccg tct aat atc acc caa 144 Phe Ser Asp Glu His Trp Leu Tyr Asn Leu Pro Ser Asn Ile Thr Gln tct aag gga ttt aaa ata cac ctg agc get tca ata tta aat get aat 192 Ser Lays Gly Phe Lys Ile His T~eu Ser Ala Ser Ile Leu Asn Ala Asn ttg gtt get aaa aaa tte ttt gat ttt ata ttt tct aga gag aag aag 240 Iaeu Val Ala F~ys ~ys Phe Phe Asp Phe Tle Phe Ser Arg Glu Lys Lcys ~5 70 75 80 ata aat ttc aaa att ttg gtt agc att aaa gaa ctt tct ttg caa aat 288 Ile Asn Phe Lys Ile Leu Val 5er Ile Irys Glu T,eu Ser T~eu Gln Asn aca ggg ctt aat ggt tat tca caa gtc ggg aaa ttc att aca att tat 336 Thr Gly Leu Asn Gly Tyr Ser Gln Val Gly I~ys Phe Ile Thr Ile Tyr cca aaa gat aat aaa gag ttt caa cgt ttg tta cac aaa tta gaa ata 384 Pro hys Asp Asn Lys Glu Phe Gln Arg Zeu Leu His Lys heu Glu Ile ttg tat aaa ggt gta aag ggt gta aac ata cca tca gat ttc aga ttt 432 Leu Tyr Lys Gly Val Lys Gly Va1 Asn Ile Pro Ser Rsp Phe Arg Phe caa ctt agc gag gtt gta tat tac aga tat ggg gag ttc gta aaa gat 480 G1n Leu Ser Glu Val Val Tyr Tyr Arg Tyr Gly Glu Phe Val Toys Asp 1q5 150 155 160 agc act ttc aag gat aaa aga gat aag aaa atc cct tca aat gtg aat 528 Sex Thr Phe Lys Asp F~ys Arg Asp hys hys Ile Pro Ser Asn Val Asn gtt cca ata agg gat tac tat att cca aga tat aac act att cct gat 576 Val Pro Ile Arg Asp Tyr Tyr Ile Pro Arg Tyx Asn Thr Ile Pro Asp caa tat att att ttg gaa gtg att tct aaa aat gcc aaa ggt gga gtt 624 Gln Tyr Ile Ile Leu Glu Val Ile Ser Lys Asn Ala Lys Gly Gly Val tat aaa gta ttt aat act caa aag cga gtt tat tct tta tta aaa gaa 672 Tyr Lys Val Phe Asn Thr Gln hys Arg Val Tyr Sex Leu heu Lys Glu get agt gat tta tcg ttg gtt gat ttt aca aat aga gat tct gtg aat 720 Ala Sex Asp Leu Ser Leu Val Asp Phe Thr Asn Arg Asp Ser Val Asn cgt tta ata aat gaa aga gaa ata tta gta gaa ttg gaa aag gag gaa 768 Arg T~eu Ile Asn Glu Arg Glu Tle Leu Val Glu Leu Glu Lys Glu Glu ttt act cca aaa gtt ttt aac gat ttt tac ata aag aat tcg tat ttt 816 Phe Thr Pro Lys Val Phe Asn Asp Phe Tyr Tle Lys Asn Ser Tyr Phe gtg gaa ttt gag ttt att att gca gat aaa tta agc gag tat aat atg 864 Val Glu Phe Glu Phe Ile Ile Ala Asp Lys Leu Ser Glu Tyr Asn Met gtt agt ggc tcg tat gat tgg ttt tta aca tta att gat tat atg gag 912 Val Ser Gly Ser Tyr Asp Trp Phe I,eu 'Fhr eau Ile Asp Tyr Met Glu ata ata aac tcc aaa tat aat ctt tcc tat aga gat tta tca ttt aat 960 Ile Ile Asn Ser hys Tyr Asn Leu Ser Tyr Arg Asp ~eu Ser Phe Asn 305 310 31.5 320 aat ata ctt att gat aat aga aat aat att tat att ata gac ttt gag 1008 Asn Ile Leu Ile Asp Asn Arg Asn Asn Ile Tyr Ile Ile Asp Phe Glu cat gcc cta agg aaa gaa act caa att gaa gaa aaa aag ttg cct cta 1056 His Ala Leu Arg Lys Glu Thr Gln Ile G1u G1u Irys hys heu Pro Leu ttt gga act cca ggg ttt tat gaa acc aac tta aat tta ttg aat aat 1209 Phe Gly Thr Pro Gl.y Phe Tyr Glu Thr Asn Leu Asn Leu Zeu Asn Asn caa cca gag gat att atg gga ttg gtt ttg tta tta tat tgg agt cag 1152 Gln Pro Glu Asp Ile Met Gly Leu Val ~eu Leu Fleu Tyr Trp Ser Gln aat tta gat gat ttt aac gtc ttt tca aaa atg agt ttt tta gaa gcg 1200 Asn Leu Asp Asp Phe Asn Val Phe Ser hys Met her Phe Leu Glu Ala atg gag tat gca atg aat ttt aat tcg cgt cgc tta gac aca ctt gat 1298 Met G1u Tyr A1a Met Asn Phe Asn Ser Arg Arg Leu Asp Thr Leu Asp aaa tca gat tgg ctt tat gat att tat aaa aaa gcg ttc aat tat aaa 1296 ~ys Ser Asp Trp Leu Tyr Asp Ile Tyr l,ys Toys A1a Phe Asn Tyr ~ys tat gat act ttt tct gaa tta aaa aaa gat ttt ata gag gta tta aaa 2399 Tyr Asp Thr Phe Ser Glu ~eu ~rys Lys Asp Phe Ile Glu Val Leu .~ys 435 990 c~~5 taa 1347 <210> 92 <21.1~ 998 <212> PRT
<213> Salmonella pneumoniae <400> 42 Met Asn Tyr Glu Lys Tyr Leu Asn Tyr Leu Asp Tyr Glu Thr Glu Ile Glu Asp Ala Tyr His Asn Leu Leu T,eu G1u Tyr Lys Ile Ser Asp Asn Phe Ser Asp Glu His Trp Leu Tyr Asn Leu Pro Ser Asn Ile Thr Gln Ser Lys Gly Phe Lys Ile His Leu Ser Ala Ser Ile T,eu Asn Ala Asn Leu Val Ala Trays Lys Phe Phe Asp Phe Ile Phe Ser Arg Glu Lys Lys Ile Asn Phe Lys Ile T~eu Val Ser Ile T,ys Glu Leu Ser Leu Gln Asn Thr Gly heu Asn Gly Tyr Ser Gln Val Gly L,ys Phe Ile Thr Ile Tyr Pro Lys Asp Asn Lys Glu Phe Gln Arg heu Leu His Tlys T~eu Glu Ile Tleu Tyr Lys G1y Val Lys Gly Val Asn Ile Pro Ser Asp Phe Arg Phe 130 13S 1~0 Gln Leu Ser Glu Val Val Tyr Tyr Arg Tyr Gly Glu Phe Val Toys Asp 1q5 150 155 160 Ser Thr Phe Lys Asp T,ys Arg Asp Lys Lys Ile Pro Ser Asn Val Asn 165 17~ 175 Val Pro Ile Arg Asp Tyr Tyr Ile Pro Arg Tyx Asn Thr Ile Pro Asp Gln Tyr Tle Tle Zeu Glu Val Ile Ser Tlys Asn Ala Lys Gly Gly Val Tyr Lys Val Phe Asn Thr Gln Lys Arg Val Tyr Ser Leu Leu TJys Glu Ala Ser Asp Leu Ser heu Val Asp Phe Thr Asn Arg Asp Ser Val Asn Arg Zeu Tle Asn Glu Arg Glu Tle Tleu Val Glu heu Glu Lys Glu Glu Phe Thr Pro Lys Val Phe Asn Asp Phe Tyr Ile Toys Asn Ser Tyr Phe Val Glu Phe Glu Phe Tle Tlc Ala Asp Lys Leu Ser Glu Tyr Asn Met Val Ser Gly Ser Tyr Asp Trp Phe Leu Thr Leu Ile Asp Tyx Met Glu Ile Ile Asn Ser hys Tyr Asn Leu Ser Tyr Arg Asp Leu Ser Phe Asn Asn Ile Zeu Tle Asp Asn Axg Asn Asn Tle Tyr Ile T1e Asp Phe Glu His Ala veu Arg Lys Glu Thr Gln Ile Glu Glu hys Lys ~eu Pro Leu Phe Gly Thr Pro Gly Phe Tyr Glu Thr Asn Lieu Asn Leu T~eu Asn Asn Gln Pro Glu Asp Ile Met Gly 5~eu Val heu heu heu Tyr Trp Ser Gln Asn Leu Asp Asp Phe Asn Val Phe Ser hys Met Ser Phe heu Glu Ala Met Glu Tyr Ala Met Asn Phe Asn Ser Arg Arg T~eu Asp Thr Leu Asp Lys Ser Asp Trp Leu Tyr Asp Tle Tyr Lys hys Ala Phe Asn Tyr T~ys Tyr Asp Thr Phe Ser Glu Leu Lys Lys Asp Phe Ile Glu Val Leu Toys <2~.0> 93 <211> 918 <212> DNA
<213> Salmonella pneumoniae <220>

<221> CDS
<222> (1)..(918) <400> 93 atg aat tgt ttc ttg aaa atg aat aat gta agt gtt cgt tat gat gac 48 Met Asn Cys Phe Leu Lys Met Asn Asn Val Ser Va1 Axg Tyr Asp Asp gta ata get tta aaa gat ata act tta caa ata aat aag gga gat tte 96 Val Ile Ala Leu Lys Asp Ile Thr heu Gln Ile Asn Lys Gly Asp Phe att ggc tta tta ggt tca aat ggt gca ggt aaa tct acg tta att aat 144 Ile Gly Leu Leu Gly Sex Asn Gly Ala Gly Lys Sex Thr 2~eu Ile Asn tct att gta ggt ttt caa gag att tat tta gga gaa ata gag tat tgt 192 Ser Ile Val Gly Phe Gln Glu Ile Tyr Leu Gly Glu Ile Glu Tyr Cys 5p 55 60 gat aaa gat ttg ata gtt agt tct caa cct ttt get cat tta ggc ttt 240 Asp Trys Asp Leu T1e Val Ser Sex Gln Pro Phe Ala His I~eu G1y Phe &5 70 75 80 act cct caa acc aca gta att gat ttt tat act act gtg aag gac aat 288 Thr Pro Gln Thr Thr Val I1e Asp Phe Tyr Thr Thr Val hys Asp Asn gta ata ttg ggg ctg aac ett get gga aag ttt ggg aaa aat get gag 336 Val Ile heu Gly Lieu Asn Leu Ala Gly Lys Phe Gly Lys Asn A2a Glu aag ttg tgt caa ata gcc tta gaa att gtt ggg tta get gat aaa aaa 384 I~ys Leu Cys Gln Ile Ala Leu Glu Ile Val G1y Leu A1a Asp Lys Lys aat aat ttg gta gaa aca ttg tca ggt gga caa ctg caa cgc gtc cag 432 Asn Asn Leu val Glu Thr Leu Ser Gly Gly Gln heu Gln Arg Val Gln 1.30 135 140 att get aga gca ata get cat aat eca gat ttt tat att tta gat gaa 480 Ile Ala Arg Ala Ile Ala His Asn Pro Asp Phe Tyr Ile Leu Asp Glu cct acc gtt ggt tta gat act gaa tct gcc gaa aaa ttt tta atg tat 528 Pro Thx vat Gly Ileu Asp Thr Glu Ser A1a Glu Lys Phe lieu Met Tyr tta aaa gat aag agt ttg gaa gga aaa act att atc ata tct tca cat 576 Leu Lys Asp Lys Ser Leu Glu Gly I~ys Thr Ile Tle Tle Ser Ser His gac ata aat cta ctc gaa aag ttt tgt aaa aaa ata ctt ttt tta caa 624 Asp Ile Asn Leu I~eu Glu Lys Phe Cys Lys I,ys Ile Leu Phe Leu G1n aat ggc tcc ata tca ttt ttt ggt gat atg cgt gac ttt gta gat aat 672 Asn G1y Ser Ile Ser Phe Phe Gly Asp Met Arg Asp Phe Val Asp Asn tca act atc aaa tta aat ttt tca atg cag aat aga att tct aga tat 720 Ser Thr Tle Lys Leu Asn Phe Ser Met Gln Asn Arg Tle Ser Arg Tyr caa att gaa ttt tta gaa aat ttt aga ttt aaa gtt cac atc gaa gat 768 Gln Tle Glu Phe Leu Glu Asn Phe Arg Phe Lys Val His Ile Glu Asp aat gat agt ttt aca ata gaa gtc cct ata gaa gaa aag atc tta gat 816 Asn Asp Ser Phe Thr Ile Glu Val Pro Ile Glu Glu Lys Ile Leu Asp gtt atc aat gag gta gga aaa gca tgt gaa att aaa aac ttt tca aca 864 Val I1e Asn Glu Va1 Gly I~ys Ala Cys Glu Ile Lys Asn Phe Ser Thr agt aaa tta acc tta caa gaa agt tat ttg caa aga ata gga gga gaa 912 Ser Lys Leu Thr Leu Gln Glu Ser Tyr Leu Gln Arg Tle Gly Gly Glu aaa tga 918 Lys <210>44 <211>305 <212>PRT

<213>Salmonella pneumoniae <900> 44 Met Asn Cys Phe Leu Lys Met Asn Asn Val Ser Val Arg Tyr Asp Asg Val Il.e Ala Leu Lys Asp Tle Thr ~eu Gln Ile Asn Lys Gly Asp Phe Tle Gly E~eu Leu G1y Ser Asn Gly Ala G1y ~ys Ser Thr Leu Ile Asn Ser Tle Val Gly Phe Gln Glu Tle Tyr Leu Gly Glu Ile Glu Tyr Cys Asp Lys Asp Leu Ile Val Sex Sex' Gln Pro Phe Ala His Zeu Gly Phe Thr Pro Gln Thr Thr Val Tle Asp Phe Tyr Thr Thr Val Lys Asp Asn Val Tle Leu Gly Leu Asn Leu Ala Gly Lys Phe Gly Lys Asn Ala Glu lays I~eu Cys Gln Tle A1a F~eu Glu Ile Val Gly Leu Ala Asp Lys hys Asn Asn heu Va1 Glu Thr Leu Ser Gly Gly Gln Leu G1n Arg Val Gln Ile Ala Arg Ala Tle Ala His Asn Pro Asp Phe Tyr Ile Leu Asp Glu Fro Thr Val Gly I~eu Asp Thx Glu Ser Ala Glu Lys Phe Leu Met Tyr Leu Lys Asp Trays Ser Leu Glu Gly Lys Thr Tle Ile Ile Ser Sex His Asp T1e Asn Leu Leu Glu Lys Phe Cys Lys Lys Ile Leu Phe Leu Gln Asn Gly Ser Ile Ser Phe Phe Gly Asp Met Arg Asp Phe Val Asp Asn 27.0 215 220 Ser Thx Ile I~ys Leu Asn Phe Ser Met Gln Asn Arg Tle Ser Axg Tyx Gln Ile Glu Phe Leu Glu Asn Phe Arg Phe Lys Val His Tle Glu Asp 245 25p 255 Asn Asp Ser Phe Thr Tle G1u Val Pro Ile Glu Glu ~ys Tle Leu Asp Val Ile Asn Glu Val Gly Toys Ala Cys Glu Ile Zys Asn Phe Sex Thr Ser Lys Leu Thr Leu Gln Glu Ser Tyr Leu Gln Arg Tle Gly Gly Glu Lys <210> 45 <211> 801 <212> DNA
<213> Salmonella pneumoniae <220>
<221> CDS
<222> (1)..(801) <400> 45 atg aag get gat caa tta agg cac aaa tcg gac tta ggt tta aga ggt 48 Met Ixys Ala Asp Gln Leu Arg Hi.s Lys Ser Asp Leu Gly Leu Arg Gly cta gcg att att get aaa aat gag att att get ttt ttt aga agt aaa 96 Leu Ala Tle Tle Ala Lys Asn Glu Ile Tle Ala Phe Phe Arg Ser Lys ggt tta att att tct cag ttt cta caa cca atc tta tat gtt gtt ttt 244 Gly Leu Tle Ile Ser Gln Phe Leu Gln Pro Tle Leu Tyr Val Val Phe ata ata ata gga tta aat tct tcg ata aag aac att cag ttt aat gat 192 Ile Ile Ile Gly Leu Asn Sex Ser Ile Lys Asn Ile Gln Phe Asn Asp ata aaa acc tct tat gca gaa tat aca atc att ggt gtt ata get tta 240 I1e Lys Thr Ser Tyr Ala Glu Tyr Thr Tle Ile Gly Val Tle Ala Leu ttg ata atc ggg cag atg act caa gtt att tat agg gtg aca ata gat 288 Tteu Ile Tle G1y Gln Met Thr Gln Val Tle Tyr Arg Val Thr T1e Asp aaa aaa tat ggg cta ctt get ctt aag tta tgc agt gga gtt cgt cct 336 Lys Lys Tyr Gly Lieu Leu Ala Leu Lys Leu Cys Ser Gly Val Arg Pro 100 105 110' tta tat tat att tta ggg atg agt atc tat tct ata tta ggg ttg ata 384 Leu Tyr Tyr Ile Leu Gly Met Ser Ile Tyr Ser I1e Leu G1y T~eu Ile gtt caa gaa att att ata tat ata att acg tta gcg ttt gag ata aat 432 Val Gln Glu Tle Ile Ile Tyr Ile Ile Thr Leu Ala Phe G1u Tle Asn atc gca atg gat aga ttt ttt tat aca gtt ttg tta tct att gtt gtt X180 Ile Ala Met Asp Arg Phe Phe Tyr Thr Val Leu heu Ser Ile Val Val tta tta ttt tgg gac tcc ctt gca att tta ctt aca atg ttt atc aat 528 Leu T~eu Phe Trp Asp Ser I~eu A1a Ile Leu Treu Thr Met Phe Ile Asn 165 7.70 175 gat tac aga aga cgt gat att gta ata cgt ttt gta cta aca ccg ctt 576 Asp Tyr Arg Arg Arg Asp Tle Val I1e Arg Phe Val Leu Thr Pro Leu 180 185 1.90 ggt ttt aca get ect gtt ttc tac tta ata gat tct get ect agt att 624 Gly Phe Thr Ala Pro Val Phe Tyr Leu Ile Asp Ser Ala Pro Ser Ile gtg aga tgg att ggt cag tta aat ccc tta act tat caa tta act att 672 Val Arg Trp Ile Gly Gln Leu Asn Pro T~au Thr Tyr Gln Leu Thr Tle ttg aga aac ttt tat ttt aaa aat tca aca act ttg gaa tta gtt ttc 720 ~eu Arg Asn Phe Tyr Phe Lys Asn Ser Thr Thr Leu Glu Leu Val Phe tta ttg tta aca tca tta ctt gtc ctt ata tct gta tct ttt att ata 768 Leu Leu Zeu Thr Ser Leu Leu Val Leu Tle Ser Val Ser Phe Ile Tle cca aag ata aaa ttg ata ctg ata gaa aga taa 801 Pro Lys 11e Lys F~eu Ile Zeu Ile Glu Arg <210>46 <211>266 <212>PRT

<213>Salmonella pneumoniae <900> 46 Met 1-~ys A1a Asp Gln k~eu Arg His ~Lys Ser Asp lieu Gly T.keu Arg Gly Leu Ala Ile Ile Ala I~ys Asn Glu Ile Ile Ala Phe Phe Arg S2r ~ys Gly Leu Ile Ile ser Gln Phe Leu Gln Pro Ile Leu Tyr Val Val Phe Ile Tle Ile G1y Leu Asn Ser Ser Tle Lys Asn Ile Gln Phe Asn Asp Ile Lys Thr Ser Tyr Ala Glu Tyr Thr Ile Ile Gly val Ile Ala I~eu Leu Ile Ile Gly G1n Met Thr Gln Val Ile Tyr Arg Val Thr Ile Asp Lys Lys Tyr Gly Leu Leu Ala Leu Lys Leu Cys Ser Gly Val Arg Pro heu Tyr Tyr Ile Leu Gly Met Sex Ile Tyr Ser Ile Leu Gly Leu Ile 17.5 120 125 Val Gln Glu Ile Ile Ile Tyr Ile Ile Thr Leu Ala Phe Glu Ile Asn Ile A1a Met Asp Arg Phe Phe Tyr Thr Val Leu heu Ser Ile Val Val Leu Leu Phe Trp Asp Ser I~eu Ala Ile heu Iteu Thr Met Phe Ile Asn Asp Tyr Arg Arg Arg Asp Ile Val Ile Arg Phe Val Leu Thr Pro Leu Gly Phe Thr Ala Pro Val Phe Tyr Leu Ile Asp Ser Ala Pro Ser Ile Val Arg Trp Ile Gly Gln lieu Asn Pro Leu Thr Tyr Gln Leu Thr Ile 21.0 215 220 Zeu Arg Asn Phe Tyr Phe Lys Asn Ser Thx Thr Leu Glu Leu Val Phe 225 230 2S5 24'0 heu heu Leu Thr Sex ~eu Leu Va1 Zeu Ile Ser Val Ser Phe Ile Tle Pro Lys Ile Lys Leu Ile T~eu Ile Glu Arg <210>47 <211>210 <212>DNA

<213>Salmonella pneumoniae <220>
<221> CDS
<222> (1) . . (210) <400> 47 atg aaa att cat tgt tta aaa tta aaa aat aaa gaa ttg aat aaa gaa 48 Met Lys I1e His Cys Leu Irys Leu Lys Asn Lys Glu Leu Asn Lys Glu gta gca ttc tat tta act tca att att agg caa get tta aaa aat act 96 Val Ala Phe Tyr ~eu Thr Ser Ile Ile Arg Gln Ala heu I~ys Asn Thr gaa tat aaa gat caa ata tct agc aca gta ttg cca gat atc aaa att 144 Glu Tyr Lys Asp Gln Ile Ser Sex Thr vat Leu Pro Asp Ile Lys Ile aaa tta ccg ata gac agt aga ggt act cca gat tgg aat tac atg gaa 192 Lys Leu Pro Ile Asp Ser Arg Gly Thr Pro Asp Trp Asn Tyr Met G1u aga tat aga gat aga taa 210 Arg Tyr Arg Asp Arg <210>48 <211>69 <212>PRT

<213>Salmonella pneumoniae <400> 48 Met Lys Ile His Cys Leu Lys Zeu Zys Asn Lys Glu Zleu Asn Lys Glu Val Ala Phe Tyr Leu Thr Sex Ile Ile Arg Gln Ala Leu hys Asn Thr Glu Tyr Lys Asp Gln Ile Ser Ser Thr Val Leu Pro Asp Tle Toys Ile Lys Leu Rro Ile Asp Ser Arg G1y Thr Pro Asp Trp Asn Tyr Met Glu Arg Tyr Arg Asp Arg <210> 99 <211> 156 <212> DNA
<213> Salmonella pneumon~ae <220>
<221> CDS
<222> (1)..(156) <900> 49 atg ata aat aaa cta tcc aga tac atg gaa agc agt ggt aag acc tat 48 Met Ile Asn Lys Leu Ser Arg Tyr Met Glu Ser Ser Gly Lys Thr Tyr caa aac cac tat gtg aca atc tta aaa tgg tat gaa gaa gat aaa gac 96 Gln Asn His Tyr Val Thr Ile Leu Lys Trp Tyr Glu Glu Asp Lys Asp aaa cta aga cag aaa ggt tta aat aaa aaa atg aat tat gat gta gga 149 Lys Leu Arg Gln Irys Gly Leu Asn Lys Lys Met Asn Tyr Asp Val Gly gaa tct tta tag 156 G1u Sex I~eu <210>50 <2~.~!51 >

<212>PRT

<213>Salmonella pneumoniae <400> 50 Met Tle Asn F~ys Leu Ser Arg Tyr Met Glu Ser Ser Gly hys Thr Tyr 1 5 10 1.5 Gln Asn His Tyr Val Thr Il.e Leu Lys Trp Tyr Glu Glu Asp Lys Asp 20 25 30.

Lys Leu Arg Gln Lys Gly Leu Asn Lys Lys Met Asn Tyr Asp Val Gly Clu Ser Leu <210> S1 <211> 195 <212> DNA
<213> Salmonella pneumoniae <220>
<221> CDS
<222> (1)..(195) <400> 51 atg aaa atg gca acc gat aaa aat aga ata atg att agc ttg gat gat 48 Met Lys Met Ala Thr Asp Lys Asn Arg Tle Met Ile Ser Leu Asp Asp aaa aat cta gag aaa ctt gaa aat tta gta gaa gat get aga gat aga 96 Lys Asn Leu Glu Lys heu Glu Asn Leu Val Glu Asp Ala Arg Asp Arg agg gga atg cga cta aca aag tcc cag gtt att gaa tta ctc cta aat 7.44 Arg C1y Met Arg Leu Thr hys Ser Gln Val Tle Glu Leu Leu Leu Asn acc gtt gat tat ttc gat gat att atg ggg get att tac tca aaa aaa 192 Thr Val Asp Tyr Phe Asp Asp Ile Met Gly Ala Ile Tyr Ser Z,ys Lys taa 195 <210> 52 <211> 64 <212> PRT
<213> Salmonella pneumonzae <400> 52 Met Zys Met A1a Thr Asp Lys Asn Arg Tle Met Zle Sex Zeu Asp Asp hys Asn Zeu Glu Lys Leu Glu Asn Leu Val Glu Asp Ala Arg Asp Arg Arg Gly Met Rrg Leu Thr Lys Ser G1n Ua1 Ile Glu Leu Leu Leu Asn Thr Val Asp Tyr Phe Asp Asp Tle Met Gly Ala Ile Tyr Ser Lys Lys <210>53 <211>387 <212>DNA

<213>Salmonella pneumoniae <220>
<221> cDS
<222> (1)..(387) <400> 53 atg aat act tta gga gac aaa ttg atg gaa ttg agt get att tac cat 48 Met Asn Thr Leu Gly Asp Lys Leu Met G1u Leu Ser Ala Ile Tyr His agg cct gag tcg gag tat gac tat ctt tat aag gat aag aaa ctc cat 96 Arg Pro Glu Ser Glu Tyr Asp Tyr heu Tyr Lys Asp Lys Lys Leu His att cga att cga act aag aaa ggg gac att gaa agc atc aac ttg cac 144 21e Arg Ile Arg Thr Lys Lys Gly Asp Ile Glu Ser Ile Asn Leu His tat ggg gac cct ttt atc ttt atg gag gag ttt tat cag gat aca aaa 192 Tyr Gly Asp Pro Phe 21e Phe Met Glu Glu Phe Tyr Gln Asp Thr hys gaa atg gtc aag ata act tct ggt acc tta ttt gac cat tgg cag gtt 290 G1u Met Val Lys Ile Thr Ser Gly Thr Leu Phe Asp His Trp Gln Val gaa gtg tca gtt gac ttt gca cgt atc cag tat ctc ttt gag ctc aga 288 Gl.u val Ser Val Asp phe Ala Arg Ile Gln Tyr Leu Phe Glu L~eu Arg gat aca gaa ggt caa aat att ttg tat ggc gat aaa ggg tgt gtg gaa 336 Asp Thr Glu Gly Gln Asn 21e 5~eu Tyr Gly Asp Lys Gly cys val Glu aat tct cta gaa aat ctt cat gca att ggg aat gga ttt aag ttg cct 384 Asn Ser Leu Glu Asn Leu His Ala Ile Gly Asn Gly Phe Lys Leu Pro tag 387 <210> 59 <211> 128 <212> PRT
<213> Salmonella pneumoniae <400> 54 Met Asn Thr Leu G1y Asp Lys Zeu Met G1u Leu Ser Ala Ile Tyr His Arg Pro Glu Ser Glu Tyr Asp Tyr Leu Tyr Lys Asp Lys Lys Leu His Ile Arg Ile Arg Thr Lys Lys Gly Asp I1e Glu Ser Ile Asn Leu His Tyr Gly Asp Pro Phe Ile Phe Met Glu Glu Phe Tyr Gln Asp Thr Lys G1u Met Val Lys Ile Thr Ser Gly Thr Leu Phe Asp His Trp Gln Val Glu Val Ser Val Asp Phe Ala Arg Ile Gln Tyr heu Phe Glu Leu Arg Asp Thr Glu Gly Gln Asn Ile Leu Tyr Gly Asp Lys Gly cys Val Glu Asn Ser Zeu Glu Asn Leu His Ala Ile Gly Asn Gly Phe Lys Leu Pro <210>55 <211>282 <212>~I~TA

<213>Salmonella pneumon~.ae <22D>
<421> cL/i.7 <222> (1)..(282) <400> 55 atg tgg ttg att att tta tgg aat get aag ccg gat aca cct tta ttt 98 Met Trp Leu Ile Ile Leu Trp Asn Ala Lys Pro Asp Thr Pro Leu Fhe aat ttt aaa gac gaa gta att aag tat aaa aca tat gag cct ttt gaa 96 Asn Phe Lys Asp Glu Val Ile Lys Tyr Lys Thr Tyr Glu Pro Phe Glu agc agt ata aaa aga gta aat act act ata aag aat ggt agt aaa ggg 194 Ser Ser Ile Lys Arg Val Asn Thr Thr Ile hys Asn Gly Ser Lys Gly aaa act ctg act gag atg att aat ggc tac aga gcg gat aac gat att 192 Lys Thr Leu Thr Glu Met Ile Asn Gly Tyr Arg Ala Asp Asn Asp Ile aga gat gaa att tgt aac ttt aat att ctg aaa aat aaa att cgt gat 240 Arg Asp Glu Ile Cys Asn Phe Asn Ile Leu Lys Asn hys I1e Arg F.sp atg aaa aac caa caa gga aat aca atg gaa tct tac ttt tag 282 Met Lys Asn Gln Gln Gly Asn Thr Met Glu Ser Tyr Phe <210> 56 <212> 93 <212> PRT
<213> Salmonella pneumoniae <900> 56 Met Trp I~eu Ile Ile Leu Trp Asn A1a Lys Pro Asp Thr Pro Leu Phe Asn Phe Zys Asp Glu Val Ile hys Tyr hys Thr Tyr Glu Fro Phe Glu Ser Ser Ile Lys Arg Val Asn Thr Thr Ile Lys Asn G1y Ser Lys Gly Lys Thr ~eu Thr Glu Met Ile Asn Gly Tyr Arg Ala Asp Asn Asp Tle Arg Asp Glu Ile Cys Asn Phe Asn Tle Leu Lys Asn Lys Ile Arg Asp Met Lys Asn Gln Gln Gly Asn Thr Met Glu Ser Tyr Phe <210> 57 <211> 534 <212> DNA
<213> Salmonella pneumoni.ae <220>
<221> CDS
<222> (1)..(534) <400> 57 ttg gtg cgt tat get ttt tta tge tat aat gga ttt ata aaa ata aag 48 Leu Val Arg Tyr Ala Phe ~eu Cys Tyr Asn Gly Phe Tle Lys Tle Lys gag ttt get atg att gga aag aac ata aaa tce ttg cgt aaa aca cat 96 Glu Phe Ala Met Ile Gly Lys Asn Ile Lys Ser Zeu Arg Lys Thr His gac tta aca caa ctc gaa ttt gca cgg att gta ggt att tca cga aat 144 Asp Leu Thr Gln heu Glu Phe Ala Arg Tle Val Gly Tle Ser Arg Asn agt ctg agt cgt tat gaa aat gga acg agt tca gtc tct acc gaa tta 192 Ser Leu Ser Arg Tyr Glu Asn Gly Thr Ser Ser Val Ser Thr Glu Leu ata gac atc att tgt cag aag ttt aat gta tct tat gtc gat att gta 240 Ile Asp T1e Tle Cys Gln Lys Phe Asn Va1 Ser Tyr Val Asp Tle Val gga gaa gat aaa atg ctc aat cct gtt gaa gat tat gaa ttg act tta 288 Gly Glu Asp Lys Met T~eu Asn Pro Val Glu Asp Tyr Glu Leu Thr Leu aaa att gaa att gtg aaa gaa aga ggt get aat eta tta tct cga ctc 336 T,ys Tle Glu Tle Val Lys G1u Arg G1y Ala Asn T~eu Leu Ser Arg Leu tat cgt tat caa gat agt cag gga att agc att gat gat gag tct aat 389 Tyr Arg Tyr Gln Asp Ser Gln Gly Tle Ser Tle Asp Asp Glu Ser Asn cct tgg att tta atg agt gat gat cta tct gat ttg att cat acg aat 432 Pro Trp Ile Leu Met Ser Asp Asp Leu Ser Asp Zeu Ile His Thr Asn atc tat cta gta gaa act ttt gat gaa ata gag aga tat agt ggc tat 480 Ile Tyr Leu val Glu Thr Phe Asp Glu Tle Glu Arg Tyr Ser Gly Tyr ttg gat gga att gaa cgt atg tta gag ata tct gaa aaa cgg atg gtg 528 Leu Asp Gly Ile Glu Arg Met Leu Glu Ile Ser G1u Lys Arg Met Val gcc taa 534 Ala <210> 58 <211> 177 <212> PRT
<213> Salmonella pneumoniae <400> 58 Leu Va1 Arg Tyr Ala Phe Leu Cys Tyr Asn G1y Phe Ile ~ys Tle Lys Glu Phe A1a Met Ile Gly Lys Asn Ile Lys Ser Leu Arg Lys Thr His Asp Leu Thr Gln Leu Glu Phe Ala Axg Ile Val Gly Tle Ser Arg Asn Ser Leu Ser Arg Tyr G1u Asn Gly Thr Ser Ser Val Ser Thr Glu Leu Tle Asp Ile Tle Cys Gln Lys Phe Asn Val Ser Tyr Val Asp Ile Val Gly Glu Asp Lys Met Leu Asn Pro Val Glu Asp Tyr Glu I~eu Thr Leu Lys Ile G1u Ile Val Lys Glu Arg Gly Ala Asn Leu T~eu Ser Axg Leu 10'0 105 110 Tyr Axg Tyr Gln Asp Ser Gln Gly Ile Ser Ile Asp Asp Glu Ser Asn Pro Trp Tle Leu Met Ser Asp Asp Leu Ser Asp Leu Ile H~.s Thr Asn 21e Tyr Leu Val Glu Thr Phe Asp Glu Tle Glu Arg Tyr Ser Gly Tyr Leu Asp Gly Ile Glu Arg Met Leu Glu Ile Ser Glu Lys Arg Met Val Ala <210> 59 <211> 378 <212> DNA
<213> Salmonella pneumoniae <220>
<221> cDS
<222> (1)..(378) <400> 59 ttg gga caa aaa gtt gta gcc atg ctt gat ttt tta tta gca tat agt 48 Leu Gly Gln Toys Val val Ala Met Leu Asp the Zeu T,~eu Ala Tyr ser gat tat tct aaa gac ttc aga cca ttg att att gat cag cct gaa gac 96 Asp Tyr Ser Lys Asp Phe Arg Pro T~eu Ile I1e Asp Gln Pro Glu Asp aat cta gac aat cgt tat att tac agg cat tta gtt cag cag ttt aga 144 Asn Leu Asp Asn Arg Tyr Lle Tyr Arg His Leu Val Gln Gln Phe Arg gat gtg aaa get caa cgt caa att att tta gca aca cat aat get aca 192 Asp Val Lys Ala Gln Arg Gln IIe Ile Zeu Ala Thr His Asn Ala Thr att gta aca aat tct atg aca gat caa gtt gtt att atg gag tca gat 290 Ile Val Thr Asn Ser Met Thr Asp Gln Val val Ile Met Glu Ser Asp gga gtt aac gga tgg att gaa tca cag gga tat gtt agt gaa aaa tat 288 Gly Val Asn Gly Trp Ile Glu Ser G1n Gly Tyr val Ser Glu Lys Tyr ata aaa aat cat atc atc aat caa tta gag gga gga aaa gat tcc ttc 336 Ile Zys Asn H2s Tle Ile Asn G1n ~eu Glu Gly Gly ~ys Asp Ser Phe aag cat aaa atg tct ata tat gag acg get tta tea gag tag 378 Lys His I~ys Met Ser Ile Tyr Glu Thr Ala Leu Ser Glu <210> 60 <211> 125 <212> PRT
<213> Salmonella pneumoniae <400> 60 Leu Gly Gln Lys Val Val Ala Met lieu Asp Phe Leu Leu Ala Tyr Ser 1 5 10 7.5 Asp Tyr Ser Lys Asp Phe Arg Pro I~eu Tle Tle Asp Gln Pro Glu Asp Asn Leu Asp Asn Arg Tyr I1e Tyr Arg His Leu Val Gln Gln Phe Arg Asp Val Lys Ala Gln Arg Gln Tle Ile 7,eu Ala Thr His Asn Ala Thr Tle Val Thr Asn Sex Met Thr Asp Gln Val Val Ile Met Glu Ser Asp Gly Val Asn Gly Trp Tle Glu Ser Gln Gly Tyr Val Ser Glu Lys Tyr Tle Toys Asn His Ile Tle Asn Gln Leu Glu Gly Gly Lys Asp Ser Phe 100 1.05 110 JJys His T,ys Met Ser T1e Tyr Glu Thr Ala Leu Ser Glu <210> 61 <211> 393 <212> DNA
<213> Salmonella pneumoniae <220>
<221> cDS
<222> (1)..(393) <400> 61.

ttg tca gta caa gta ttt tgg aaa gga agt agc agt atg aaa cga gat 48 T~eu Ser Val Gln Val Phe Txp Lys Gly Ser Sex Ser Met Lys Arg Asp gtg cgt gat att cgg aaa caa ttt cgt tta aca gaa gca gaa gaa aag 96 val Arg Asp Tle Arg Lys Gln Phe Arg Zaeu Thr Glu Ala Glu Glu Lys caa att cta get ttg atg aga gag cgg gga gag act aat tte tct gat 144 Gln T2e Leu Ala Zeu Met Axg Glu Arg Gly Glu Thr Asn Phe Ser Asp ttt ctt cgt aaa agt tta ctt tcc tct gat tta caa aaa cag atg gag 192 Phe Treu Arg Lys Ser Leu Leu Ser Ser Asp Leu Gln Lys Gln Met Glu aca tgg ttt gcc ctc tgg caa tcc caa aaa cta gaa caa atc agt cgt 240 Thr Trp Phe Ala Zeu Txp Gln Ser Gln I~ys Leu Glu Gln Tle Ser Arg gac gtt cat gaa gtt tta atc ttg gca cag tca gaa cgt caa gtc acc 288 Asp Val His Glu Val Leu Tle T~eu Ala Gln Ser Glu Arg Gln Val Thr caa gag cat gta tct att ctc tta acg tgc gtg cag gaa ttg att caa 336 Gln Glu His Val Ser Tle Leu Leu Thr Cys Val G1n Glu Leu Tle Gln gag gtt gca aac acc ata ccc ctc agt aaa gaa ttt cgt gag aag tac 384 Glu Val Ala Asn Thr Tle Pro Leu Ser Toys Glu Phe Arg Glu Lys Tyr atg agg taa 393 Met Arg <210> 62 <221> 130 <212> PRT
<213> Salmonella pneumoniae <400> 62 Leu Ser val Gln Va1 Phe Trp Lys Gly Ser Ser Sex Met Lys Axg Asp Val Arg Asp Tle Arg Lays Gln Phe Arg Z,eu Thr G1a Ala Glu Glu Lys Gln Lle Leu Ala Z,eu Met Arg Glu Arg Gly Glu Thr Asn Phe ser Asp Phe Leu Arg T,ys Ser heu heu Ser Ser Asp Leu Gln Irys Gln Met Glu Thr Trp Phe Ala Leu Trp Gln Ser Gln Lys T,eu Glu Gln T1e Ser Arg Asp Val His Glu Val Leu Tle F~eu Ala Gln Ser Glu Arg Gln Val Thr Gln Glu His Val Ser Tle Leu Leu Thr Cys Val Gln Glu Leu Tle Gln Glu Val Ala Asn Thr Ile Pro Leu Ser Lys Glu Phe Arg Glu Lys Tyr Met Arg <210>63 <211>366 <212>DNA

<213>Salmonella pneumoniae <220>
<221> CDS
<222> (11..(366) <400> 63 atg gaa cat cgt tac cga acc aat ctc aag aaa gtg ttt ttg tct gat 48 Met Glu His Arg Tyr Arg Thr Asn Z,eu Lys Lys Val Phe Leu Ser Asp agt gag ttg aac caa cta aat ata aat atc gat caa agt ggt tgt aaa 96 Ser Glu Leu Asn Gln T~eu Asn Tle Asn Ile Asp Gln Ser Gly Cys Tjys tcc ttt tct gaa tat gcg aga cga act cta ctc gat cct ggt atg aat 144 Ser Phe Ser Glu Tyr Ala Arg Arg Thr Leu heu Asp Pro Gly Met Asn ttt atc acg att gac aca aac ggt tac caa gat tta gtg ttt gag tta 192 Phe Tle Thr T1e Asp Thr Asn Gly Tyr Gln Asp Leu Val Phe Glu Leu aag agg att ggc aat aat atc aac cag att get cga agt gtt aat caa 240 Lys Arg Ile Gly Asn Asn Ile Asn Gln Ile Ala Arg Ser Val Asn Gln tct cag tta att tct ggt gaa gaa ttg cag gag ttg aaa aaa gga att 288 Ser Gln I~eu Ile Ser Gly Glu Glu Leu G1n Glu Leu Lys Zys Gly Ile ggt gaa ttg ata aaa gaa gtt gat aag gaa ttt aat ctg caa gcg cag 336 Gly Glu Leu I1e F~ys Glu Val Asp Lys Glu Phe T~sn Leu Gln Ala Gln aag cta aag gag ttc cat ggt cat cac taa 366 Zys Leu Lys Glu Phe His Gly His His <210>64 <211>121 <212>PRT

<213>Salmonella pneumoni.ae <400> 64 Met Glu His Arg Tyr Arg Thr Asn Leu Toys Lys Val Phe E~eu Ser Asp Ser Glu Leu Asn Gln Zeu Asn Ile Asn Ile Asp Gln Ser Gly Cys Lys Ser Phe Ser Glu Tyr Ala ~lrg Arg Thr Leu Leu Asp Pro Gly Met Asn Phe Ile Thr Ile Asp Thr Asn Gly Tyr Gln Asp Ireu val Phe Glu Leu Lys Arg Ile Gly Asn Asn Ile Asn Gln Ile Ala Arg Ser Val Asn Gln Ser Gln Leu Ile Ser Gly Glu Glu Leu Gln Glu Zeu F~-ys Toys Gly Ile Gly Glu ~eu Ile ~ys G1u Va1 Asp Lys Glu Phe Asn ~eu Gln Ala Gln ~,ys Leu Lys Glu Phe Hzs Gly His H~.s <210>65 <211>252 <212>DNA

<213>Salmonella pneumoniae <220>
<221> CDS
<222> (1)..(252) <400> 65 atg agt agt caa atg aaa get ttc ttg aat gaa ctt eaa gga aat atg 48 Met Ser Ser Gln Met Lys Ala Phe Leu Asn Glu T~eu Gln Gly Asn Met gaa gtt gtt gga gaa ttt ttt gat aat cct gaa aag gta att aga aaa 96 Glu Val Val Gly Glu Phe Phe Asp Asn Pro Glu I~ys Val Tle Arg Lys ttt gga att gtc gga aga gag aag gaa gca ttg cta atc cgt gac tta 144 Phe Gly Ile Val Gly Arg Glu Toys G1u Ala Leu Leu Ile Arg Asp Leu aat gat atg gat gat tat get ctt tca att caa aat agc gtt gca tcg 192 Asn Asp Met Asp Asp Tyr Ala Leu Ser Ile Gln Asn Ser Val Ala Ser cct tct ggg gca cat agt agc act tgc cat ttt gtt aga caa gat tta 240 Pro Ser Gly Ala His Sex Ser Thr Cys His Phe Val Arg Gln Asp Leu caa tcc gca taa 252 Gln Ser Ala <210> 66 <211> 83 <212> PRT
<213> Salmonella pneumoniae <400> 66 Met Ser Ser Gln Met Lys Ala Phe Leu Asn Glu Leu Gln Gly Asn Met Glu Val Val G1y Glu Phe Phe Asp Asn Pxa Glu Lys Va1 Ile Arg I~ys 20 25 3p Phe Gly Lle vat Gly Arg Glu F~ys Glu Ala Leu Zeu Ile Arg Asp Zeu Asn Asp Met Asp Asp Tyr Ala Leu Ser Tle Gln Asn Ser Va1 Ala Ser Pro Sex Gly Ala His Ser Sex Thr Cys His Phe Val Arg Gln Asp Leu Gln Sex Ala <210> 67 <211> 303 <212> DNA
<213> Salmonella pneumoniae <220>
<221> CDS
<222> (1)..(303) <400> 67 atg aaa aat aaa tac gat gtt aaa aga att att ccg gat gaa tta tca 98 Met Lays Asn Lys Tyr Asp Val Lys Arg T1e Ile Pro Asp Glu Leu Ser gaa tca cta gat att ttt cta aaa aat tat tct gaa act gga ttg tca 96 Glu Sex Leu Asp Ile Phe Leu Lys Asn Tyr Ser Glu Thr Gly Leu Ser gat tat aat act tat ctc ttt tat ggt ttt atc ttg aag tcc tat aaa 194 Asp Tyr Asn Thr Tyr Leu Phe Tyr Gly Phe 11e Leu Lys Ser Tyr Lys ttg cct cga gaa aat aga tat agc ata aaa tta ttg gtg aag gaa tta 192 Leu Pro Arg Glu Asn Arg Tyr Ser 21e Lays Leu Leu Val Lys Glu Leu caa aat aga gga ctg aaa gtt aca ttg att atc aac att tat tat cac 290 Gln Asn Arg Gly heu Zys Val Thr Leu Ile Tle Asn Lle Tyr Tyr His 65 70 75 $0 get tta aat tgt ttg get tta aat gat ggt cta aaa att tat gga gaa 28g Ala Leu Asn Cys Leu Ala Leu Asn Asp G1y Leu Lys Lle Tyr Gly Glu gat ttc tta ata tga 303 Asp phe Leu Ile <210>68 <211>100 <212>PRT

<213>salmonella pneumaniae <400> 68 Met Lys Asn Lys Tyr Asp Val Lys Arg Tle Ile Pro Asp Glu Leu Ser Glu Ser heu Asp Ile Phe T~eu hys Asn Tyr Ser Glu Thr Gly L,eu Ser Asp Tyr Asn Thr Tyr Leu Phe Tyr Gly Phe Ile Leu Lys Ser Tyr ~ys Leu Pro Arg Glu Asn Arg Tyr Ser Tle Lys Leu Zeu Val Lys Glu Leu Gln Asn Arg Gly heu Toys Val Thr Leu Tle Ile Asn Tle Tyr Tyr His Ala Leu Asn Cys Zeu Ala Leu Asn Asp G1y Leu Lys Tle Tyr Gly Glu Asp Phe Leu Tle <210> 69 <211> 1017 <212> DNA
<213> Salmonella pneurr~oniae <220>
<221> CDS
<222> (1)..1017) <900> 69 atg aaa aag aaa tgg atg tat tat get get tgt tct tct aat gaa tct 48 Met Lys Toys F~ys Trp Met Tyr Tyr Ala Ala Cys Ser Ser Asn Glu Ser gcc gat gac agt tca tct gat aaa gga gac ggc ggt tcg cta gtc gtt 96 Ala Asp Asp Ser ser Ser Asp Lys Gly Asp Gly Gly Ser heu Val Val tat tca cca aac tca gag ggc tta att gga gca act att cct gcc ttt 194 Tyr Ser Pro Asn Sex Glu Gly Leu Ile Gly Ala Thr Ile Pro Ala Phe gaa gaa aaa tat ggt atc aaa gta gaa ctg att caa get ggt act gga 192 Glu Glu I~ys Tyr Gly Ile Lys Val Glu Leu Tle Gln Ala Gly Thr Gly gaa ctt ttc aaa aaa cta gag tca gaa aaa gaa gtt cct gta get gat 240 Glu heu Phe Lys Lys Leu G1u Ser Glu Lys Glu Val Pro Val A1a Asp gtt atc ttt ggt ggt tct tat aca caa tat act acc cac gga gaa ctc 288 Val Ile Phe Gly Gly Ser Tyr Thr Gln Tyr Thr Thr His Gly Glu Leu ttt gaa aac tat act tca aaa gaa aat gat aat gtt atc aaa gaa tat 336 Phe Glu Asn Tyr Thr Ser I~ys Glu Asn Asp Asn Val Ile Lys Glu Tyr caa aac aca act ggc tac tct act cct tat aca cta gat ggt agt gtt 384 Gln Asn Thr Thr Gly Tyr Ser Thr Pro Tyr Thr Leu Asp Gly Ser Val tta atc gtc aac cct gat tta act aaa ggc atg aac atc gaa gga tat 432 I,eu Ile Val Asn Pro Asp Leu Thr Lys Gly Met Asn Ile Glu Gly Tyr aac gat ctt ttc aaa cct gaa cta aaa gga aaa atc gca act get gac 480 Asn Asp Leu Phe Lys Pro Glu Leu Lys Gly Lys Ile Ala Thr Ala Asp cca gca aac tct tct agc gcc ttt get caa tta aca aat atg cta caa 528 Pro Ala Asn Ser Ser Ser Ala Phe Ala Gln Leu Thr Asn Met Leu Gln get caa ggt ggt tac aaa gat gat aag get tgg tct tat gta aaa gat 576 Ala Gln G1y Gly Tyr Zys Asp Asp Lys Ala Trp Ser Tyr val Lys Asp ctt ttc aca ctt att gat ggt aaa atc ggt tca agt tca tct agt gtc 624 Leu Phe Thr Leu Ile Asp Gly I~ys Tle Gly Ser Ser Ser Ser Ser Val tat aaa gta gtc get gat gga gaa atg get gtt ggt ctc tct tat gaa 672 Tyr Lys Val Val Ala Asp Gly Glu Met Ala Val Gly I~eu Sex Tyr Glu gat cca gca gtt aaa ctc tta aat gac gga get aac att aag gta gtc 720 Asp Pro Ala Val Lys Leu Leu Asn Asp Gly Ala Asn Ile Lys Val Val tat cca aaa gaa gga acc gtc ttc cta cct get agt get get atc gtt 768 Tyr Pro Lys Glu Gly Thr Val Phe Leu Pro Ala Sex Ala Ala Ile Val aaa aaa tct aaa aat atg gaa aat gcc aag aaa ttt atc gat ttt att 816 Trys Lys Ser Lys Asn Met Glu Asn Ala Lys Lys Phe I1e Asp Phe Tle atc tct caa gaa gta caa gat aca ctt ggt aca acc act act aac cgt 864 Tle Ser G1n Glu Val Gln Asp Thr Leu Gly Thr Thr Thr Thr Asn Arg cct gtt cgt aaa aat get aaa aca agc gaa aac atg aaa cca att gac 912 Pro Val Arg Lys Asn Ala Lys Thr Ser G1u Asn Met Lys Pro Ile Asp aaa atc aaa aca ctc act gaa gat tat gat tat gtc atc aag aat aaa 960 ?~ys Ile Lys Thx Leu Thr Glu Asp Tyr Asp Tyr Val Ile Lys Asn Lys tca gat atc gtt aag aaa tac aac gaa gtc ttt aca gat atc caa tct 1008 Ser Asp Tle Val I~ys Lys Tyr Asn Glu Val Phe Thr Asp Ile Gln Sex aaa cag taa 1017 Lys Gln <210>70 <211>338 <212>PRT

<213>Salmonella pneumoniae <900> 70 Met Lys ~ys Lys Trp Met Tyr Tyr A1a Ala Cys Sex Ser Asn Glu Ser Ala Asp Asp Ser Ser Ser Asp Tlys Gly Asp Gly Gly Ser I~eu Val Val Tyr Ser Pro Asn Ser Glu Gly Leu Ile Gly Ala Thr Ile Pro Ala Phe Glu Glu hys Tyr Gly Tle Lys Val Glu T~eu Ile Gln Ala Gly Thr Gly Glu Leu Phe Lys I~ys Leu Glu Ser Glu Ays Glu Val Pro Val Ala Asp 65 7fl 75 80 Val Ile Phe Gly Gly Ser Tyr Thr G2n Tyr Thr Thr His Gly G2u Leu Phe Glu Asn Tyr Thr Ser hys Glu Asn Asp Asn Val Ile Zlys G1u Tyr Gln Asn Thr Thr Gly Tyr Ser Thr Pxo Tyr Thr Leu Asp Gly Sex Val Leu Ile Val Asn Pro Asp Leu Thr Toys Gly Met Asn Ile Glu Gly Tyr Asn Asp Leu Phe hys Pro Glu Leu Lys Gly Zrys Ile A1a Thr Ala Asp Pro Ala Asn Ser Ser Sex Ala Phe Ala Gln Leu Thr Asn Met heu Gln 165 170 a.75 Ala Gln Gly Gly Tyx Lys Asp Asp Lys Ala Trp Ser Tyr Val Lys Asp Leu Phe Thr Zeu Ile Asp Gly Lys Ile Gly Ser Ser Ser Ser Ser Val Tyr Lys Val Val Ala Asp Gly Glu Met Ala Val Gly Z,eu Ser Tyr Glu Asp Pro Ala Val F~ys ~eu Leu Asn Asp Gly Ala Asn Tle F~ys Val Val Tyr Pro Lys Glu Gly Thr Val Phe Leu Pro Ala Ser Ala Ala Ile Val 245 25fl 255 Lys Toys Ser Zys Asn Met Glu Asn .~11a Irys Itys Phe Ile Asp Phe Ile Ile Ser Gln Glu Val Gln Asp Thr Leu Gly Thr Thr Thr Thr Asn Arg Pro Val Arg hys Asn Ala Lys Thr Ser Glu Asn Met Lys Pro 21e Asp Lys Tle Tyys Thr Leu Thr Glu Asp Tyr Asp Tyr Val Ile Lys Asn Lys Ser Asp Ile Val Tlys hys Tyr Asn Glu Val Phe Thr Asp zle Gln Ser Lys Gln <210>71 <211>1092 <212>DNA

G2~.3>Salmonella pneumoniae <220>
<221> CDS
<222> (1)..(1092) <400> 71 atg agt gag atc aaa att att aac gcc aaa aaa atc tac cac gat gtc 48 Met Ser Glu Ile vys Ile Ile Asn Ala vys hys I1e Tyr His Asp Val cct gtt att gag aat ttg aac att aca att cca aaa gga agt ctc ttt 96 Pro Val Tle G1u Asn Leu Asn Ile Thr 21e Pro Lys Gly 5er Zeu Phe acc ctt ctt gga get tca gga tgt ggg aaa acg ace ctt ett cgt atg 144 Thr Leu heu Gly Ala Ser Gly Cys Gly I~ys Thr Thr Zeu heu Arg Met att gca ggt ttc aac agt atc gaa ggt gga gaa ttt tac ttc gat gat 192 Tle Ala Gly Phe Asn Ser Tle G1u Gly Gly Glu Phe Tyr Phe Asp Asp aca aaa atc aat aat atg gaa ccc agc aaa cgc aat atc ggg atg gtt 240 Thr Lys 11e Asn Asn Met Glu Pro Ser Ifys Arg Asn Tle Gly Met Val ~5 70 75 80 ttc caa aac tac get att ttc cca cat ttg act gtc cga gac aac gtt 288 Phe Gln Asn Tyr Ala 11e Phe Pro His Leu Thr Val Arg Asp Asn Val get ttt ggt ctt atg caa aag aag gtt eca aaa gaa gaa ttg att eaa 336 Ala Phe Gly I~eu Met Gln Lys I~ys Val Pxo Lys Glu Glu Leu Ile G1n 1.00 105 110 cag acc aac aag tat ctt gaa ctc atg caa att get caa tat gcg gat 384 Gln Thr Asn Lys Tyr Leu Glu Leu Met Gln Tle Ala Gln Tyr Ala Asp cga aag ccc gat aaa ctc agt ggt gga caa caa caa cgt gtc acc ttg 432 Arg Lys Pro Asp Lys Leu ser Gly Gly Gln Gln Gln Arg Val Thr Leu gca tgc gcc tta gcg gtt aat cca agt gtt ctc ctc atg gac gag cca 480 Ala Cys A1a I~eu Ala Val Asn Pro Ser Val Leu Leu Met Asp Glu Pro ctt agt aat ctg gag gcc aaa ctt cgc ttg gat atg cgt caa gcc atc 528 Leu Ser Asn Leu Glu Ala Zys Leu Arg Leu Asp Met Arg Gln Ala Ile cga gaa atc caa cac gaa ctg gga att aca act gtt tat gta acc cac 576 Arg Glu Ile Gln His Glu Leu Gly Ile Thr Thr Val Tyr Val Thr His gac caa gaa gaa gcc atg get att tca gac caa att get gtt atg aaa 624 Asp Gln Glu Glu Ala Met Ala Ile Ser Asp Gln Ile Ala Val Met Lys gat ggg gtg atc caa caa atc ggc gca cca aaa gaa ctc tat cat aaa 672 Asp Gly Val Ile Gln Gln Tle Gly Ala Pro Lys G1u Leu fiyr His Lys cca get aat gag ttt gtg gca acc ttt atc gga cgc aca aat att atc 720 Pro Ala Asn Glu Phe Val Ala Thr Phe Ile Gly Arg Thr Asn I1e Ile cct gcc aat ctt gaa aaa cgg agc gac ggc get tat atc gtc ttt tca 768 Pro Ala Asn Leu Glu Lys Arg Ser Asp Gly Ala Tyr Tle Val Phe Ser gat ggc tat gcc ctt cga atg cca get ctt gat cag gtt gag gag caa 816 Asp Gl.y Tyr Ala Leu Arg Met Pro Ala Leu Asp Gln Val Glu Glu Gln get att cat gta agc att cgt ccc gaa gag ttt atc aaa gat gaa tct 864 Ala zle His Val Ser Ile Arg Pro Glu Glu Phe Ile Lys Asp Glu Ser gga gat att gaa gga act att aga gat agc gtc tat ctt gga cta aat 912 Gly Asp Tle Glu Gly Thx Tle Arg Asp Ser Val Tyr Leu Gly Leu Asn acg gat tat ttc att gag aca ggt ttt gcc tca aaa att caa gtt agt 960 Thr Asp Tyr Phe Tle Glu Thr Gly Phe Ala Sex hys Tle Gln Val Ser 305 31.0 315 320 gaa gaa tca act ttt gaa gaa gat cta caa aaa ggc aat cgt att cgt 1008 Glu Glu Sex Thr Phe Glu Glu Asp Leu Gln Lys Gly Asn Arg Tle Arg cta cga atc aat acg caa aaa tta aac atc ttt tct gca gat ggt tcc 1056 Leu Arg Tle Asn Thr Gln Lys Leu Asn Tle Phe Ser Ala Asp Gly Ser caa aac ctg ata aaa gga gtc aac cat gga acg taa 1092 Gln Asn Leu Tle Lys Gly Va2 Asn His Gly Thr <210> 72 <211> 363 <212> PRT
<213> Salmonella pneumoniae <400> 72 Met Ser Glu T1e Lye Ile Zle Asn Ala Lys Lys Tle Tyr His Asp Val Pro Val T1e G1u Asn Leu Asn T1e Thr Tle Pro Lys Gly Ser Leu Phe Thr Leu Leu Gly Ala Sex Gly Cys Gly Lys Thr Thx Leu Leu Arg Met Tle Ala Gly Phe Asn Ser Tle Glu G,ly Gly Glu Phe Tyr Phe Asp Asp Thr Lys file Asn Asn Met Glu Pro Ser Lys Arg Asn Tle Gly Met Val Phe Gln Asn Tyx Ala Tle Phe Pro His Leu Thr Val Arg Asp Asn Val Ala Phe Gly Leu Met Gln Lys Lys Va1 Pro Lys Glu Glu Leu Tle Gln Gln Thr Asn Lys Tyr Leu Glu Leu Met Gln Tle A1a Gln Tyr Ala Asp Arg Zys Pro Asp Lys T~eu Ser Gly Gly Gln Gln Gln Arg Val Thr Leu Ala Cys Ala heu Ala Val Asn Pro Ser Val Leu Leu Met Asp Glu Pro Leu Ser Asn Leu Glu Ala Lrys Leu Arg Leu Asp Met Arg Gln Ala Tle Arg Glu Ile Gln His G1u Leu Gly Ile Thr Thr Val Tyr Val Thr His Asp Gln Glu Glu Ala Met A1a Tle Ser Asp Gln Ile Ala Va1 Met Lys Asp G1y Val Ile Gln Gln Ile Gly Ala Pro Lys Glu Leu Tyr His I'ys Pro Ala Asn Glu Phe Val Ala Thr Phe lle Gly Arg Thr Asn Ile Ile Pro Ala Asn Leu Glu Zys Arg Ser Asp Gly Ala Tyr Ile Val Phe Ser Asp Gly Tyr Ala Leu Arg Met Pro Ala Leu Asp Gln Val G1u Glu G1n Ala Tle His Val Ser Ile Arg Pro G1u Glu Phe Ile Lys Asp Glu ser Gly Asp I1e G1u Gly Thr Ile Arg Asp 5er Val Tyr I~eu Gly I~eu Asn Thr Asp Tyr Phe Tle Glu Thr Gly Phe Ala Ser Lys Ile Gln val Sex Glu Glu Ser Thr Phe Glu Glu Asp Leu Gln Lys Gly Asn Arg Tle Arg Leu Arg Tle Asn Thr Gln Lys Leu Asn Ile Phe Ser Ala Asp Gly Ser Gln Asn Leu Ile Lys Gly Val Asn His Gly Thr <210> 73 <211> 423 <212> DNA
<213> Salmonella pneumoniae <220>
<221> CDS
<222> (1)..(423) <400> 73 atg gaa cgt aaa aaa cta aat att tgg aca gtt tcc tct ttc ttc ctc 48 Met Glu Arg Lys Lys Leu Asn Ile Trp Thr Val Ser Ser Phe Phe Leu ttt ctt acc tat cct atc ttt ctc gtt tat cct atc gtt acc gtg ctc 96 Phe Leu Thr Tyr Pro Ile Phe ~eu Val Tyr Pro Ile Val Thr Val Leu aag caa gca ett ata cat gaa gga eaa tte tca cta get aat ttt gtc 144 Lys Gln Ala heu I1e His G1u Gly Gln Phe Ser Leu Ala Asn Phe Val act ttc ttt agt aaa gcc tac tac tct gag aca cta gtc aac agt ttc 192 Thr Phe Phe Ser Lys Ala Tyr Tyr Ser Glu Thr I~eu Val Asn Ser Phe aag gtt tce att acc get act atc act tce tta gtt gta gga acc eta 290 Lys Va,1 Ser Tle Thr A1a Thr Tle Thr Ser Leu Val Va1 Gly Thr Leu tta get tat ete tte tct atg tat gac ttc aag ggg aag aaa ttt cta 288 Leu Ala Tyr T~eu Phe Ser Met Tyr Asp Phe Lys Gly Toys I~ys Phe Leu caa ata ttg att atc att get tec atg tca get cct ttc gta gga gcc 336 Gln Ile Zeu Ile Ile Ile Ala Ser Met Ser Ala Pro Phe Val Gly Ala tac tcc tgg gtt ctc ttg cta gga cga aat gag gtc atc act aaa ttt 384 Tyr Ser Trp Val Leu T~eu Leu Gly Arg Asn Glu Val Ile Thr Ilys Phe ttg aca aat gcc ctt tat ctt cca get atc gat att tat 423 Leu Thr Asn Ala T~eu Tyr Leu Pro Ala I2e Asp Ile Tyr <210>79 <211>141 <212>PRT

<213>Salmonella pneumoniae <400> 74 Met Glu Arg Lys Lys Leu Asn Ile Trp Thr Val Ser Ser Phe Phe heu Phe Leu Thr Tyr Pro Ile Phe Leu Val Tyr Pro Ile Val Thr Val Leu Lys Gln Ala Leu Ile His Glu Gly Gln Phe Ser Leu Ala Asn Phe Val Thr Phe Phe Ser Lys Ala Tyr Tyr Ser Glu Thr Leu Val Asn Ser Phe Lys Val Ser Tle Thr Ala Thr Ile Thr Ser Leu Val Val Gly Thr Leu Leu Ala Tyr Leu Phe Ser Met Tyr Asp Phe Lys G1y Lys Zys Phe Leu Gln Ile Leu Ile Ile Ile Ala Ser Met Ser Ala Pro Phe Val Gly Ala Tyr Ser Trp Val Leu F~eu Leu Gly Arg Asn Glu Val I1e Thr Lys Phe Leu Thr Asn Ala Leu Tyr Leu Pro Ala Ile Asp Ile Tyr 130 135 1.~0 <210> 75 <211> 824 <212> DNA
<213> Salmonella pneumoniae <22O>
<221> CDS
<222> (1)..(822) <9D0> 75 atg aga gca ttc tca gac ttt gga acg cct atg ttg att ggc gaa ggg 48 Met Arg Ala Phe Ser Asp Phe Gly Thr Pro Met Leu Ile Gly G1u Gly tat cgg act ttc cct gtc ctg att tat acc caa ttt att agc gag gtt 96 Tyr Arg Thr Phe Pro Val Leu Ile Tyr Thr Gln Phe Ile Ser Glu Val gga gga aat tct get ttt gca att atg gcg att ate att gec ttg gca 144 Gly Gly Asn Ser Ala Phe Ala Ile Met Ala I1e Ile Ile Ala I~eu Ala att ttc ctt atc caa aaa cac att gca aac cgc tac agt ttc agc atg 192 Ile Phe Leu Ile Gln Lys His Ile Ala Asn Arg Tyr Ser Phe Ser Met 5p 55 60 aat ctg ctc cat cca att gag cct aaa aaa act aca aaa gga aaa atg 240 Asn Leu Leu His Pro Ile Glu Pro Lys Toys Thr Thr Lys Gly Lys Met get gcc att tat gca aca gtc tac gga att atc ttt atc tct gtt tta 288 A1a Ala Ile Tyr Ala Thr Val Tyr Gly Ile Ile Phe Ile Ser Val Leu cct caa atc tac tta att tat acc tct ttc cta aaa aca tca gtt atg 336 Pro Gln Ile Tyr Leu Ile Tyr Thr Ser Phe Leu Lys Thr Ser Val Met gta tct gtt aaa ggt tat tct cca aac agt tac aag gta get ttc cat 384 Va1 Ser Val Lys Gly Tyr Sex Pro Asn Ser Tyr Lys Val A1a Phe His egt atg gga tct get att tte aat aec att cgt ate ect ttg att gcc 432 Arg Met Gly Ser Ala Ile Phe Asn Thr I1e Arg I1e Pro Leu I1e Ala tta gtt cta gtt gtt cta ttt gcg aca ttt atc tcc tac cta gcc gtt 480 heu Val Leu Val Val T~eu Phe Ala Thr Phe I1e Ser Tyr Zeu A1a Val aga aaa cgg aat ttg ttt aca aac tta att gac agc ctc agt atg gta 528 Arg Lys Arg Asn Lieu Phe Thr Asn Leu Ile Asp Ser Leu Ser Met val cct tat att gta cca gga acc gtt cta ggg att gcc ttc att tct tcc 576 Pro Tyr Ile Val Pro Gly Thr Val Tleu Gly Ile Ala Phe Ile Ser Ser ttc aat act ggt cta ttt gga agt gga ttt ctt atg att aca ggg act 624 Phe Asn Thr Gly heu Phe Gly Ser Gly Phe T.~eu Met Ile Thr Gly Thr get ttc atc ttg att atg tct cta tct gcc aga aga tta cct tat act 672 Ala Phe Ile Leu Ile Met Ser Leu Ser Ala Arg Arg Leu Pro Tyr Thr att cgc tca tct gtt get agc tta caa caa ata gca cca agt att gaa 720 Ile Arg 5er Ser Val Ala Ser Leu Gln Gln Tle Ala Pro Ser Ile Glu gaa get get gaa agc tta gga agt agt cgt ctc aat acc ttt get aag 768 Glu Ala Ala Glu Ser Leu Gly Ser Ser Arg heu Asn Thr Phe Ala Lys att aca act cca atg atg cta tct ggt atc att tct gga gcc atc tta 816 Tle Thr Thr Pro Met Met Leu Ser Gly Ile Ile Ser Gly Ala Ile ~eu 260 265 27p tct tga gt 824 Ser <210>76 <211>273 <212>PRT

<213>Salmonella pneumoniae <400> 76 Met Arg Ala Phe Ser Asp Phe Gly Thr Pro Met Leu Ile G1y Glu G2y Tyr Arg Thr Phe Pro Val Leu Tle Tyr Thr Gln Phe Tle Ser Glu Val Gly Gly Asn Ser Ala Phe Ala Ile Met Ala Ile Ile Ile Ala T3eu Ala Ile Phe Leu Ile Gln Lys His Ile Ala Asn Arg Tyr Ser Phe Ser Met Asn Tleu Zeu His Pro Ile Glu Pro Lys hys Thr Thr Lys Gly Zys Met Ala Ala Tle Tyr Ala Thr Val Tyr Gly Ile I1e Phe Ile Ser Val Leu Pro Gln Ile Tyr 7,eu Ile Tyr Thr Ser Phe ~eu Zys Thr Ser Val Met Val sex Val Lys Gly Tyr Ser Pxo Asn ser Tyr T~ys Val Ala Phe His Arg Met Gly Ser Ala Ile Phe Asn Thr Ile Arg Tle Pro heu Tle Ala Leu Val Leu Va1 Val Leu Phe Ala Thr Phe Ile Ser Tyr T~eu Ala Val 1~5 1S0 155 160 Arg Lys Arg Asn Leu Phe Thr Asn Leu Zle Asp Ser Leu Ser Met Val Pro Tyr Ile Val Pro Gly Thr Val Leu Gly Tle Ala Phe I1e Ser Sex Phe Asn Thr Gly Leu Phe Gly Ser Gly Phe l,eu Met Ile Thx Gly Thr Ala Phe 11e Zeu Tle Met Ser Leu Ser Ala Arg Arg Zeu Pro Tyr Thr Ile Arg Ser Ser Val Ala Ser heu Gln Gln Ile Ala Pro Ser Tle Glu Glu Ala Ala Glu Ser Leu Gly Ser Ser Axg Leu Asn Thr Phe Ala Lys Ile Thr Thr Pro Met Met Leu Ser Gly Ile Ile Ser Gly Ala I1e T~eu Ser <210>77 <211>26 <212>DNA

<213>Salmonella pneumoniae <400> 77 gctctagacc cacaagatgc tcttcg 26 <210> 78 <211> 29 <212> DNA
<213> Salmonella pneumoniae <400> 78 cgctctagac gcttgtcgtt agcgccacc 29 <210> 79 <211> 24 <212> DNA
<213> Salmonella pneumoniae <400> 79 ggggtaccca caagatgctc ttcg 2~
<210>80 <211>28 <212>DNA

<213>Salmonella pneumoniae <400> 80 cggggtaccg cttgtcgtta gcgccacc 28 <210>81 <211>27 <212>DNA

<213>Salmonella pneumoniae <400> 81 gctctagaag ctatcgccgc ccttgag 27 <210>82 <211>29 <212>DNA

<213>Salmonella pneumoniae <900> 82 cgctctagag caacctgcgg ctagtttcc 2q <210> 83 <211> 28 <212> DNA
<213> Salmonella pneumoni.ae <400> 83 gctctagagt tttagatcat gctttcgg 28 <210> 89 <211> 30 <212> DNA
<213> Salmonella pneumoniae <900> 89 cgctctagat ttgtatgctg ctacaggagc 30 <210>85 <211>27 <212>DNA

<213>Salmonella pneumoniae <400> 8S
gctctagatt gggtcaaatg gttgtgg 27 <210>86 <211>27 <212>DNA

<213>Salmonella pneumoniae <400> 86 cgctctagaa ctagtcgttg tactttc 27 <210>87 <211>18 <212>DNA

<213>Salmonella pneumoniae <400> 87 cacaccgtaa tcaagatc 18 <210> 88 <211> 18 <212> DNA
<213> Salmonella pneumoniae <900> 88 ctggtccgta atatagtc 18 <210> 89 <211> 18 <212> DNA
<213> Salmonella pneumoniae <400> 89 ggtctattcg accaccag 18 <210> 90 <211> 18 <212> DNA
<213> Salmonella pneumoniae <900> 90 ctggtgacct gcatcagc 18 <210>91 <211>16 <212>DNA

<213>Salmonella pneumoniae <~100> 91 cacgagtatc tacgtc 16

Claims (24)

1. A peptide encoded by any of the gene sequences identified herein as Sit1 A, B, C, Sit2 B, C or D, Sit3 A, B, D or D, ORF 1 to 14, and MS 1 to 11, or a functional fragment thereof, for therapeutic or diagnostic use.
2. A peptide encoded within the pneumococcal pathogenicity island 1, identified herein as PP~1.
3. A peptide according to claim 2, for therapeutic or diagnostic use.
4. A polynucleotide encoding a peptide according to any of claims 1 to 3, for therapeutic or diagnostic use.
5. A polynucleotide according to claim 4, having at least 40 nucleotides.
6. A polynucleotide according to claim 5, having at least 80 nucleotides.
7. An attenuated microorganism comprising a mutation that disrupts expression of any of the gene sequences identified herein as Sit1 A, B, C or D, Sit2 A, B, C or D, Sit3 A, B, C or D, ORF 1 to 14, and MS 1 to 11.
8. A microorganism according to claim 7, wherein the gene is any of the Sit1, Sit2 or Sit3 genes.
9. A microorganism according to claim 7 or claim 8, wherein the mutation is a deletion mutation.
10. A microorganism according to any of claims 7 to 9, comprising a further attenuating mutation in a second gene.
11. A microorganism according to claim 10, wherein the further mutation is an auxotrophic mutation.
12. A microorganism according to any of claims 7 to 11, genetically modified to express a heterologous antigen.
13. A construct comprising a promoter naturally associated with a gene according to claim 1, and a heterologous gene.
14. A vaccine comprising a microorganism according to any of claims 7 to 11.
15. A vaccine comprising a peptide according to claim 1, or a polynucleotide according to claim 4.
16. A vaccine comprising at least two peptides according to claim 1.
17. A vaccine comprising a peptide encoded by Sit1 D and a peptide encoded by Sit2A, or a functional fragment thereof capable of elliciting an immune response.
18. Use of a product according to any of claims 1 to 12, in a screening assay for the identification of an antimicrobial drug.
19. Use of a product according to any of claims 1 to 12, in a diagnostic assay for the detection of a streptococcal microorganism.
20. Use of a peptide encoded by the Sit2A gene or SitlD gene, in a screening assay for the identification of an antimicrobial drug.
21. Use of a peptide encoded by the Sit2A gene or Sit1 D gene, in a diagnostic assay for the detection of a streptococcal microorganism.
22, Use of a product according to any of claims 1 to 12, for the manufacture of a medicament for the treatment or prevention of a condition associated with infection by S. pneumoniae or other Gram-positive bacteria.
23. Use according to claim 22, wherein the treatment is veterinary treatment.
24, An antibody, raised against any of the products of claims 1 to 6.
CA002426738A 2000-10-26 2001-10-26 Streptococcal genes Abandoned CA2426738A1 (en)

Applications Claiming Priority (9)

Application Number Priority Date Filing Date Title
GB0026231.1 2000-10-26
GB0026231A GB0026231D0 (en) 2000-10-26 2000-10-26 Streptococcal genes
GB0028345.7 2000-11-21
GB0028345A GB0028345D0 (en) 2000-11-21 2000-11-21 Streptococcal genes
GB0102666A GB0102666D0 (en) 2001-02-02 2001-02-02 Streptococcal Genes
GB0102666.5 2001-02-02
US28811801P 2001-05-02 2001-05-02
US60/288,118 2001-05-02
PCT/GB2001/004749 WO2002034773A2 (en) 2000-10-26 2001-10-26 Streptococcal genes

Publications (1)

Publication Number Publication Date
CA2426738A1 true CA2426738A1 (en) 2002-05-02

Family

ID=27447899

Family Applications (1)

Application Number Title Priority Date Filing Date
CA002426738A Abandoned CA2426738A1 (en) 2000-10-26 2001-10-26 Streptococcal genes

Country Status (4)

Country Link
EP (1) EP1330473A2 (en)
AU (1) AU2001295795A1 (en)
CA (1) CA2426738A1 (en)
WO (1) WO2002034773A2 (en)

Families Citing this family (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0208499D0 (en) * 2002-04-12 2002-05-22 Microscience Ltd Streptococcal genes
EP1670505B1 (en) 2003-09-18 2012-11-14 GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES Dna promoters and anthrax vaccines
US8729013B2 (en) 2004-08-26 2014-05-20 The University Of Western Ontario Methods of inhibiting staphylobactin-mediated iron uptake in S. aureus
GB0714963D0 (en) 2007-08-01 2007-09-12 Novartis Ag Compositions comprising antigens
MY150481A (en) 2008-03-03 2014-01-30 Irm Llc Compounds and compositions as tlr activity modulators
BRPI1008561A2 (en) * 2009-02-20 2018-07-24 Australian Poultry Crc Pty Ltd live attenuated vaccines
US9517263B2 (en) 2009-06-10 2016-12-13 Glaxosmithkline Biologicals Sa Benzonaphthyridine-containing vaccines
ES2443952T3 (en) 2009-09-02 2014-02-21 Novartis Ag Immunogenic compositions that include modulators of TLR activity
TWI445708B (en) 2009-09-02 2014-07-21 Irm Llc Compounds and compositions as tlr activity modulators
WO2011057148A1 (en) 2009-11-05 2011-05-12 Irm Llc Compounds and compositions as tlr-7 activity modulators
SG181712A1 (en) 2009-12-15 2012-07-30 Novartis Ag Homogeneous suspension of immunopotentiating compounds and uses thereof
CA2792938C (en) 2010-03-23 2018-07-31 Irm Llc Compounds (cystein based lipopeptides) and compositions as tlr2 agonists used for treating infections, inflammations, respiratory diseases etc.
US20150132339A1 (en) 2012-03-07 2015-05-14 Novartis Ag Adjuvanted formulations of streptococcus pneumoniae antigens
CN105188747A (en) 2013-02-01 2015-12-23 葛兰素史密斯克莱生物公司 Intradermal delivery of immunological compositions comprising TOLL-like receptor agonists
EP3371320A4 (en) 2015-11-04 2018-12-05 The Translational Genomics Research Institute Systems and methods of diagnosing and characterizing infections
BR112020016314A2 (en) 2018-02-12 2020-12-15 Inimmune Corporation PHARMACEUTICALLY ACCEPTABLE COMPOUNDS OR SALTS, PHARMACEUTICAL COMPOSITION, KIT, AND, METHODS FOR ELICITATING, INTENSIFYING OR MODIFYING AN IMMUNOLOGICAL RESPONSE, TO TREAT, PREVENT OR REDUCE THE SUSCETIBILITY TO CANCER, TO REDUCE, UNDERSTAND TREAT, PREVENT OR REDUCE SUSCEPTIBILITY TO AN ALLERGY, TO TREAT, PREVENT OR REDUCE SUSCETIBILITY TO AUTOIMMUNE AFFECTION, TO TREAT, PREVENT OR REDUCE SUSCETIBILITY IN A SUBJECT TO BACTERIAL INFECTION, ALTERNATE, VENEER, NAVAL, NAVARI TREAT, PREVENT OR REDUCE SUSCEPTIBILITY TO AUTOIMMUNITY, ALLERGY, ISCHEMIA OR SEPSIS REPERFUSION, TO TREAT, PREVENT OR REDUCE THE GRAVITY OF EPILETIC ATTACKS AND TO TREAT, PREVENT OR REDUCE THE MACANTIC HERITAGE OF HERITAGE,
CA3198876A1 (en) 2020-11-04 2022-05-12 Eligo Bioscience Cutibacterium acnes recombinant phages, method of production and uses thereof
GB2600962A (en) * 2020-11-12 2022-05-18 Ucl Business Plc Live attenuated strain of Streptococcus pneumoniae and pharmaceutical compositions comprising a live attenuated strain of S. pneumoniae

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5434065A (en) * 1993-05-06 1995-07-18 President And Fellows Of Harvard College In vivo selection of microbial virulence genes
US6346392B1 (en) * 1996-11-27 2002-02-12 Smithkline Beecham Corporation Polynucleotides encoding a novel glutamine transport ATP-binding protein
EP0956289A4 (en) * 1996-08-16 2004-10-13 Smithkline Beecham Corp Novel prokaryotic polynucleotides, polypeptides and their uses
DE69737125T3 (en) * 1996-10-31 2015-02-26 Human Genome Sciences, Inc. Streptococcus pneumoniae antigens and vaccines

Also Published As

Publication number Publication date
WO2002034773A3 (en) 2003-03-13
AU2001295795A1 (en) 2002-05-06
WO2002034773A2 (en) 2002-05-02
EP1330473A2 (en) 2003-07-30

Similar Documents

Publication Publication Date Title
KR100760221B1 (en) Chlamydia trachomatis genomic sequence and polypeptides, fragments thereof and uses thereof, in particular for the diagnosis, prevention and treatment of infection
KR100886095B1 (en) Novel Streptococcus pneumoniae open reading frames encoding polypeptide antigens and a composition comprising the same
AU745787B2 (en) Enterococcus faecalis polynucleotides and polypeptides
RU2725726C2 (en) Bacteriophages, phage peptides and methods of using them
CA2426738A1 (en) Streptococcal genes
US20120171236A1 (en) Immunization against chlamydia pneumoniae
AU6909098A (en) Streptococcus pneumoniae polynucleotides and sequences
WO1997043303A1 (en) Novel compounds
TWI328035B (en) Anti-bacterial vaccine compositions
KR20150056540A (en) Clostridium difficile polypeptides as vaccine
NZ532297A (en) Virulence genes, proteins, and their use in treating conditions associated with infection by Neisseria or gram-negative bacteria
US20030072769A1 (en) Virulence genes, proteins, and their use
US20090280141A1 (en) Streptococcal Genes
CN101293922A (en) Streptococcus pneumoniae proteins and nucleic acid molecules
AU777190B2 (en) Streptococcus pneumoniae polynucleotides and sequences
CZ388697A3 (en) Sequence of nucleic acids and amino acids relating to heliobacter pylori for diagnosis and therapy
AU3796099A (en) Assays using nucleic acid and amino acid sequences relating to helicobacter pylori
AU1546202A (en) Enterococcus faecalis polynucleotides and polypeptides
AU3795699A (en) Nucleic acid and amino acid sequences relating to helicobacter pylori for therapeutics

Legal Events

Date Code Title Description
EEER Examination request
FZDE Discontinued