CA2381316A1 - Homogentisate-dioxygenase - Google Patents

Abstract

The invention relates to a new type of expression cassettes which, under genetic control, contain regulating nucleic acid sequences a) nucleic acid sequence coding for 4-hydrophenylpyruvate dioxygenase (HPPD) or for one of its functional equiva-lents; and/or b) at least one nucleic acid sequence (anti-HGD), which can inhibit the homogentisate-dioxygenase (HGD) activity. The invention also relates to vectors which are suitable for the production of plants having an increased tocopherol content, to transgenic plants produced therewith, and to a method for the production of transgenic plants having an increased tocopherol content.

Description

081.7 /00010 CA 02381316 2002-02-07 Homogentisate-dioxygenase The present invention relates to novel genetic constructs such as expression cassettes and vectors for generating plants with an elevated tocopherol content, to transgenic plants generated thus, and to methods for the generation of transgenic plants with an elevated tocopherol content.
The generation of plants with an elevated sugar, enzyme and amino acid content has hitherto been an important objective in plant molecular genetics. The development of plants with an elevated vitamin content, such as, for example, with an elevated tocopherol (vitamin E) content, is, however, also of economic interest.
The naturally occurring eight compounds with vitamin E activity are derivatives of 6-chromanol (Ullmann's Encyclopedia of Industrial Chemistry, Vol. A 27 (1996), VCH Verlagsgesellschaft, Chapter 4., 478-488, Vitamin E). The first group (la-d) encompasses the tocopherols (I), while the second group (2a-d) encompasses the tocotrienols (II):

(I) i 4 ~u' ~/ 8 la, a.-tocopherol: R1 = RZ = R3 = CH3 1b, (3-tocopherol: R1 = R3 = CH3 , R2 = H
lc, y-tocopherol: R1 = H, R2 = R3 = CH3 1d, b-tocopherol: R1 = RZ = H, R3 = CH3 \ ~ / / /
R~ ~ 3~ 7~ 11~

(II) 2a, a.-tocopherol: R1 = R2 = R3 = CH3 2b, (3-tocopherol: R1 = R3 = CH3 , RZ = H
2c. y-tocopherol: R1 = H, R2 = R3 = CH3 2d, 8-tocopherol: R1 = Rz = H, R3 = CH3 where R1, R2 and R3 are as defined above.
At present, alpha-tocopherol is of great economic importance.
The development of crop plants with an elevated tocopherol content by means of tissue culture or seed mutagenesis and natural selection is set a limit. On the one hand, it must be possible for the tocopherol content to be recorded as early as during the tissue culture stages and, on the other hand, only those plants can be manipulated via tissue culture techniques which can be successfully regenerated from cell cultures into whole plants. Moreover, crop plants can show undesirable properties after mutagenesis and selection, and the former have to be eliminated by in some cases repeated backcrosses. Also, increasing the tocopherol content by means of crosses would be limited to plants of the same species.
This is why the genetic engineering approach of isolating the essential biosynthesis genes which encode tocopherol synthesis performance and introducing them into crop plants in a directed fashion is superior to the traditional plant breeding method.
Knowledge of the biosynthesis pathways and its regulation, and identification of genes which affect biosynthesis performance, are prerequisites for this method.
The tocopherol synthesis pathway in plants is shown schematically in the appended Figure 1. As yet, no useful approach exists in the prior art which allows the tocopherol biosynthesis in plants to be elevated in a targeted fashion.
Short description of the invention:
It is an object of the present invention to provide means with the aid of which an improved tocopherol biosynthesis can be achieved.
We have found that this object is achieved by providing genetic constructs with the aid of which the biosynthesis of homogentisate, a tocopherol precursor, and thus the formation of tocopherol, can be increased. Simultaneously, it is possible in accordance with the invention to prevent the undesired homogentisate efflux to maleyl acetoacetate, thus improving tocopherol synthesis further.

A first subject of the invention therefore relates to an expression cassette comprising a) the coding nucleic acid sequence for 4-hydroxyphenylpyruvate dioxygenase (HPPD) or for a functional equivalent thereof, thus increasing the homogentisate biosynthesis rate upon expression; and/or b) at least one nucleic acid sequence (anti-HGD) which is capable of inhibiting the homogentisate dioxygenase (HGD) activity under the genetic control of regulatory nucleic acid sequences.
"Inhibition" is to be interpreted broadly in the present context and encompasses the partial or essentially complete prevention or blocking of the HGD enzyme activity in the plant or the plant organ or tissue which has been transformed with an anti-HGD
construct according to the invention, this prevention or blocking being based on different mechanisms in cell biology. Inhibition for the purposes of the invention also encompasses a quantitative reduction of active HGD in the plant down to an essentially complete absence (i.e. lack of detectability of HGD enzyme activity or lack of immunological detectability of HGD) of HGD
protein.
According to the invention several strategies for decreasing or inhibiting of the HGD activity are comprised. A person skilled in the art will recognize that a variety of different methods are available in order to affect the HGD gene expression in a desirable manner.
A preferred strategy according to the invention comprises the use of a nucleic acid sequence (anti-HGD) which can be transcribed into an antisense nucleic acid sequence which is capable of inhibiting the homogentisate dioxygenase (HGD) activity, for example by inhibiting the expression of endogenous HGD.
Further methods of inhibiting the HGD expression comprise the overexpression of homologous HGD nucleic acid sequences leading to cosuppression (Jorgensen et al. (1996): "Chalcone synthase cosuppression phenotypes in petunia flowers: Comparison of sense vs. antisense constructs and single copy vs. complex T-DNA
sequences.", Plant Mol. Biol. 31 (5): 957-973.), induction of specific RNA degradation by a plant with the help of a viral expression system (amplicon) (Angell, S. M., Baulcombe, D. C.
(1999): "Technical advance: Potato virus x amplicon mediated silencing of nuclear genes." Plant J. 20 (3): 357-362.), 0$17 0001,0 CA 02381316 2002-02-07 insertion of nonsense mutations into the endogene by means of introduction of RNA/DNA oligo nucleotides into the plant (Zhu et al. (2000): "Engineering herbicide resistant maize using chimeric RNA/DNA oligonucleotides." Nat. Biotechnol. 18 (5): 555-558.) or 5 generating knockout mutants, e. g. with the help of T-DNA
mutagenesis (Koncz et al. (1992): "T-DNA insertional mutagenesis in Arabidopsis." Plant Mol. Biol. 20 (5): 963-976.) or homolgous recombination (Hohn, B.; Puchta, H. (1999): "Gene therapy in plants." Proc. Natl. Acad. Sci. USA 96: 8321-8323.).
The above mentioned documents and the methods for the regulation of gene expression in plants described therein are herewith incorporated by reference.
The anti-HGD sequence in the sense of the present invention is thus particularly selected among:
a) antisense nucleic acid sequences;
b) nucleic acid sequences coding for homologous HGD and leading to cosuppression;
c) viral nucleic acid sequences and expression constructs affecting HGD-RNA degradation;
d) nonsense mutations of nucleic acid sequences coding for endogenous HGD;
e) nucleic acid sequences coding for knockout mutants;
f) nucleic acid sequences suitable for homologous recombination;
wherein the expression of each of these sequences can effect an "inhibition" of the HGD activity in the sense of the present invention. A combined use of such sequences is also possible.
The coding HPPD sequence is according to the invention preferably linked functionally to the coding sequence of a plant-organelle-specific transit peptide. The transit peptide preferably has specificity for the seeds or the plastids such as, for example, the chloroplasts, chromoplasts and/or leukoplasts, of the plant. The transit peptide directs the expressed HPPD
activity to the desired target within the plant and, once this is achieved, is eliminated from the HPPD protein moiety, preferably proteolytically. In the expression construct according to the invention, the coding transit peptide sequence is preferably located 5'-upstream from the coding HPPD sequence.
In a further preferred embodiment, the coding HPPD sequence and the anti-HGD sequence are in each case under the genetic control of a plant-specific promoter.

Expression cassettes which are especially preferred in accordance with the invention encompass a coding HPPD nucleic acid sequence which encodes a protein containing an amino acid sequence in accordance with SEQ ID N0:15 or a functional equivalent thereof, 5 or which encompasses a nucleic acid sequence from the nucleotide in position 8 to the nucleotide in position 1153 inclusive, in accordance with SEQ ID N0:14 or a functional equivalent thereof.
In a preferred embodiment the anti-HGD nucleic acid sequence can contain the coding nucleic acid sequence of homogentisate dioxygenase or a functional fragment thereof, inserted in antisense orientation. A preferred embodiment of the expression cassettes according to the invention encompasses an HGD sequence motif in accordance with SEQ ID N0:1 in antisense orientation.
This leads to the increased transcription of nucleic acid sequences in the transgenic plant which are complementary to the endogenous coding HGD sequence or a portion thereof and which hybridize herewith at DNA or RNA level.
The invention further relates to recombinant vectors encompassing at least one expression cassette in accordance with the above definition. Examples of vectors according to the invention encompass at least one expression construct of the following type:
5'-plant-specific promoter/HPPD or anti-HGD/terminator-3'. The coding HPPD sequence may also be replaced by a coding sequence for a fusion protein of transit peptide and HPPD.
Preferred examples encompass monomeric vectors comprising one of the following expression constructs:
a) 5'-35S-promoter/anti-HGD/OCS-terminator-3';
b1) 5'-legumin-B-promoter/HPPD/NOS-terminator-3';
b2) 5'-legumin-B-promoter/transit peptide-HPPD/NOS-terminator-3'.
The constructs a) and b) require the plant to be co-transformed with both vectors, i.e. with a) and b1) or b2).
Preferred examples also encompass binary vectors comprising the following constructs:
c1) 5'-35S-promoter/anti-HGD/OCS-terminator/legumin-B-promoter/HPPD/NOS-terminator-3'; and c2) 5'-35S-promoter/anti-HGD/OCS-terminator/legumin-B-promoter/transit peptide-HPPD/NOS-terminator-3'.

Construct c1) or c2) allows the simultaneous transformation of the plant with HPPD and anti-HGD.
The invention furthermore relates to microorganisms comprising at least one recombinant vector according to the invention.
Preferred organisms are those which are capable of infecting plants and thus of transferring the constructs according to the invention.
Preferred microorganisms are those from the genus Agrobacterium, in particular the species Agrobacterium tumefaciens.
The invention furthermore relates to the use of a vector or microorganism according to the invention for the transformation of plants, plant cells, plant tissues or plant organs, in particular with the purpose of making them capable of an improved tocopherol synthesis.
The invention furthermore relates to a transgenic plant, transformed with at least one vector or microorganism according to the invention, and to transgenic cells, tissue, organs or transgenic propagation material of such plants.
The transgenic plants according to the invention are in particular selected from amongst crop plants such as cereals, maize, soybeans, rice, cotton, sugar beet, canola, sunflowers, flax, potatoes, tobacco, tomatoes, oilseed rape, alfalfa, salad species such as cress, and the various tree, nut and grapevine species.
The invention furthermore relates to a method for generating transgenic plants with improved tocopherol production, which comprises transforming plants which are capable of producing tocopherol, or plant cells, plant tissue or plant organs or protoplasts thereof, with at least one vector according to the invention or at least one microorganism according to the invention, culturing the transformed cells, tissue, plant organs or protoplasts in a growth medium and, if appropriate, regenerating plants from the culture.
The invention furthermore relates to the use of an expression cassette, a vector, a microorganism or a transgenic plant in accordance with the above definition for obtaining plant metabolites, in particular tocopherols.

Finally, the invention relates to a process for the preparation of tocopherols, which comprises isolating in a known manner the desired tocopherol from a culture of a plant which has been transformed in accordance with the invention.
Detailed description of the invention:
The transformation according to the invention of plants with an HPPD-encoding construct leads to the overexpression of this protein and thus to an increased homogentisate formation. The simultaneous transformation with anti-HGD, in particular the antisense-HGD construct, avoids an undesired efflux of this metabolite to maleyl acetoacetate. Thus, an increased homogentisate quantity is available in the transgenic plant for the formation of tocopherols via the intermediates methyl-6-phytylquinol and 2,3-dimethylphytylquinol (cf. Figure 1).
A nucleotide or nucleic acid sequence is to be understood as meaning in accordance with the invention for example a genomic or a complementary DNA sequence or an RNA sequence or semi- or fully synthetic analogs thereof.
The HPPD or anti-HGD nucleotide sequences of the constructs according to the invention can be produced synthetically or obtained naturally or comprise a mixture of synthetic and natural DNA components, or else be composed of various heterologous HGD
or HPPD gene segments of various organisms. The anti-HGD sequence can be derived from one or more exons and/or introns, in particular exons of the HGD gene.
For example, synthetic nucleotide sequences can be generated which have codons which are preferred by the plants to be transformed. These codons which are preferred by plants can be determined for the plant in the customary manner with the aid of the codon usage. When preparing an expression cassette, various DNA fragments can be manipulated in such a way that the result is a nucleotide sequence with the correct direction of reading and a correct reading frame. To connect the nucleic acid fragments to each other, adapters or linkers may be attached to the fragments.
Functional equivalents of the HPPD gene are those sequences which still encode a protein with the desired functions in accordance with the invention, i.e. an enzyme with homogentisate-forming activity, despite a deviating nucleotide sequence.

Functional equivalents of anti-HGD encompass those nucleotide sequences which prevent the HGD enzyme function in the transgenic plant to a sufficient degree. This can be effected for example by hindering or preventing HGD processing, the transport of HGD or its mRNA, inhibition of ribosome attachment, inhibition of RNA
splicing, induction of an RNA-degrading enzyme and/or inhibition of translation elongation or translation termination.
Functional equivalents generally encompass naturally occuring l0.variants of the sequences described herein and also artificial nucleotide sequences, for example artificial nucleotide sequences obtained by chemical synthesis which are adapted to the codon usage of a plant.
Functional equivalents are also to be understood as meaning, in particular, natural or artificial mutations of an originally isolated sequence which encodes HGD or HPPD which continue to show the desired function. Mutations encompass substitutions, additions, deletions, exchanges or insertions of one or more nucleotide residues. Thus, the present invention also , encompasses, for example, those nucleotide sequences which are obtained by modifying the HGD or HPPD nucleotide sequence. The purpose of such a modification may be, for example, the further limitation of the encoding sequence contained therein or else, for example, the insertion of further restriction enzyme cleavage sites.
Functional equivalents are also those variants whose function is attenuated or increased compared with the starting gene or gene fragment, that is to say for example those HPPD genes which encode an HPPD variant with a lower or higher enzymatic activity than that of the original gene.
Also suitable are artificial nucleic acid sequences as long as they mediate the desired characteristic, for example an elevated tocopherol content in the plant, by overexpression of the HPPD
gene or expression of an anti-HGD sequence in crop plants, as described above. Such artificial nucleotide sequences can be identified, for example, by back translation of proteins with HGD
or HPPD activity which have been constructed by means of molecular modeling, or else by in vitro selection. Especially suitable are coding nucleotide sequences which have been obtained by back translating a polypeptide sequence in accordance with the host-plant-specific codon usage. An expert skilled in the art of plant genetic methods will readily be able to identify the specific codon usage by computer evaluations of other known genes of the plant to be transformed. To circumvent undesired regulatory mechanisms of the plant, it is possible, for example, to back translate DNA fragments starting from the amino acid sequence of a bacterial HPPD and taking into consideration the plant codon usage, and thus generate the complete exogenous HPPD
sequence which is optimized for use in the plant. This expresses an HPPD enzyme which is not, or only insufficiently, accessible to regulation by the plant, thus fully allowing enzyme activity to be overexpressed.
Further suitable equivalent nucleic acid sequences which must be mentioned are sequences which encode fusion proteins, for example an HPPD polypeptide or a functionally equivalent portion of these being a constituent of the fusion protein. The second portion of the fusion protein may be, for example, another enzymatically active polypeptide, or an antigenic polypeptide sequence with the aid of which detection of HPPD expression is possible (for example myc-tag or his-tag). However, it is preferably a regulatory protein sequence such as, for example, a signal or transit peptide which leads the HPPD protein to the desired site of action.
An elevated tocopherol content in the plant is to be understood as meaning for the purposes of the present invention the artificially acquired capability of an increased biosynthetic performance regarding at least one compound from the group of the tocopherols and tocotrienols as defined above in the plant in comparison with the non-genetically-modified plant for the duration of at least one plant generation.
The tocopherol biosynthesis site is generally the leaf tissue but also the seed, so that leaf-specific and/or seed-specific expression in particular of the HPPD gene and/or, if appropriate, anti-HGD are meaningful. However, it is obvious that tocopherol biosynthesis need not be limited to the seed but may also take place in a tissue-specific fashion in all the other remaining parts of the plant.
Constitutive expression of the exogenous gene is also advantageous. On the other hand, inducible expression may also be desirable.
The regulatory nucleic acid sequences contained in the expression cassettes according to the invention govern the expression of the coding sequences (such as HPPD sequence, if appropriate fused to a transit peptide sequence) and the anti-HGD sequence.
Preferably, the constructs according to the invention comprise a promoter 5'-upstream from the coding sequence in question and a l terminator sequence 3'-downstream, and, if appropriate, other customary regulatory elements, in each case operatively linked with the coding sequence. Operative linkage is to be understood as meaning the sequential arrangement of promoter, encoding sequence, terminator and, if appropriate, further regulatory elements in such a way that each of the regulatory elements can fulfill its function as intended when the encoding sequence or the antisense sequence is expressed. Examples of operatively linkable sequences are other targeting sequences (which differ from the transit-peptide-encoding sequences) for guaranteeing subcellular localization in the apoplast, in the vacuole, in plastids, in the mitochondrion, in the endoplasmatic reticulum (ER), in the nucleus, in elaioplasts or in other compartments;
and translation enhancers such as the tobacco mosaic virus 5'-leader sequence (Gallie et al., Nucl. Acids Res. 15 (1987), 8693 -8711), and the like.
Suitable polyadenylation signals are plant polyadenylation signals, preferably those which essentially correspond to Agrobacterium tumefaciens T-DNA polyadenylation signals, in particular those of gene 3 of the T-DNA (octopine synthase) of the Ti plasmid pTiACHS (Gielen et al., EMBO J. 3 (1984), 835 et seq.) or functional equivalents thereof. Examples of especially suitable terminator sequences are the OCS (octopine synthase) terminator and the NOS (nopaline synthase) terminator.
A suitable promoter of the expression cassettes is, in principle, any promoter which is capable of governing the expression of genes, in particular foreign genes, in plants. In particular, a plant promoter or a promoter derived from a plant virus is preferably used. Particularly preferred is the cauliflower mosaic virus CaMV 35S promoter (Franck et al., Cell 21 (1980), 285 - 294). As is known, this promoter contains various recognition sequences for transcriptional effectors which in their totality lead to permanent and constitutive expression of the introduced gene (Benfey et al., EMBO J. 8 (1989), 2195-2202).
Another example of a suitable promoter is the legumin B promoter (accession No. X03677).
The expression cassette may also comprise a chemically inducible promoter which allows expression of the exogenous gene in the plant to be governed at a particular point in time. Such promoters, for example the PRP1 promoter (Ward et al., Plant.
Mol. Biol. 22 (1993), 361-366), a salicylic-acid-inducible promoter (WO 95/19443), a benzenesulfonamide-inducible promoter (EP-A-0388186), a tetracyclin-inducible promoter (Gatz et al., (1992) Plant J. 2, 397-404), an abscisic-acid-inducible promoter (EP-A 335528) or an ethanol- or cyclohexanone-inducible promoter (WO 93/21334), may also be used.
Furthermore, particularly preferred promoters are those which ensure expression in tissues or plant organs in which the biosynthesis of tocopherol or its precursors takes place.
Promoters which ensure leaf-specific expression must be mentioned in particular. Promoters which must be mentioned are the potato cytosolic FBPase or the potato ST-LSI promoter (Stockhaus et al., EMBO J. 8 (1989), 2445 - 245). Examples of seed-specific promoters are the phaseolin promoter (US 5504200), the USP
promoter (Baumlein, H. et al., Mol. Gen. Genet. (1991) 225 (3), 459 - 467) or the LEB4 promoter (Fiedler, U. et al., Biotechnology (NY) (1995), 13 (10) 1090) together with the LEB4 signal peptide.
An expression cassette is generated by fusing a suitable promoter to a suitable anti-HDG or HPPD nucleotide sequence, if appropriate a sequence encoding a transit peptide, which is preferably arranged between the promoter and the HPPD sequence, and a terminator or polyadenylation signal. To this end, customary recombination and cloning techniques are used as they are described, for example, by T. Maniatis, E.F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and by T.J. Silhavy, M.L. Berman and L.W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
(1984) and by Ausubel, F.M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987).
As already mentioned other expression cassettes which can be used are those whose DNA sequence encodes an HPPD fusion protein, part of the fusion protein being a transit peptide which governs translocation of the polypeptide. Examples are chloroplast-specific transit peptides which are cleaved off enzymatically from the HPPD residue after translocation of the HPPD gene into the chloroplasts.
Particular mention must be made of the transit peptide derived from plastid transketolase (TK) or from a functional equivalent of this transit peptide (for example the transit peptide of the RubisCO small subunit or of ferredoxin: NADP oxidoreductase).
The promoter and terminator regions may expediently be provided, in the direction of transcription, with a linker or polylinker containing one or more restriction sites for insertion of this sequence. As a rule, the linker has 1 to 10, in most cases 1 to 8, preferably 2 to 6, restriction sites. In general, the linker within the regulatory regions has a size less than 100 bp, frequently less than 60 bp, but at least 5 bp.
The promoter, terminator and the other regulatory elements may be native (homologous) or else foreign (heterologous) to the host plant.
Genetic manipulations which provide suitable restriction cleavage sites or which eliminate the excess DNA or restriction cleavage sites may also be employed for the purposes of the invention.
Techniques known per se, such as, in-vitro mutagenesis, primer repair, restriction or ligation may be used in cases where insertions, deletions or substitutions such as, for example, transitions and transversions, are suitable. Complementary ends of the fragments may be provided for ligation by manipulations such as, for example, restriction, chewing back or filling in overhangs for blunt ends.
The expression cassettes according to the invention are preferably inserted into suitable transformation vectors.
Suitable vectors are described, inter alia, in "Methods in Plant Molecular Biology and Biotechnology" (CRC Press), Chapter 6/7, pp. 71 - 119 (1993).
They are preferably cloned into a vector such as, for example, pBinl9, pBinAR, pPZP200 or pPTV, which is suitable for transforming Agrobacterium tumefaciens. Agrobacteria transformed with such a vector can then be used in a known manner for transforming plants, in particular crop plants, such as, for example, tobacco plants, for example by bathing wounded leaves or leaf sections in an agrobacterial suspension and subsequently growing them in suitable media. The transformation of plants by agrobacteria is known, inter alia, from F.F. White, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Vol. 1, Engineering and Utilization, edited by S.D. Kung and R. Wu, Academic Press, 1993, pp. 15 - 38.
Transgenic plants can be regenerated in a known manner from the transformed cells of the wounded leaves or leaf sections.
The transfer of foreign genes into the genome of a plant is termed transformation. It exploits the above-described methods of transforming and regenerating plants from plant tissues or plant cells for transient or stable transformation. Suitable methods are protoplast transformation by polyethylene-glycol-induced DNA

uptake, the biolistic method using the gene gun, the so-called particle bombardment method, electroporation, incubation of dry embryos in DNA-containing solution, microinjection and agrobacterium-mediated gene transfer. The abovementioned methods are described, for example, in B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, edited by S.D. Kung and R. Wu, Academic Press (1993), 128 - 143, and in Potrykus, Annu. Rev. Plant Physiol.
Plant Molec. Biol. 42 (1991), 205 - 225). The construct to be expressed is preferably cloned into a vector which is suitable for the transformation of Agrobacterium tumefaciens, for example pBinl9 (Bevan et al., Nucl. Acids Res. 12 (1984), 8711).
Agrobacteria transformed with an expression cassette can equally be used in a known manner for transforming plants, in particular crop plants such as cereals, maize, oats, soybeans, rice, cotton, sugar beet, canola, sunflowers, flax, hemp, potatoes, tobacco, tomatoes, oilseed rape, alfalfa, lettuce and the various tree, nut and grapevine. species, for example by bathing wounded leaves or leaf sections in an agrobacterial suspension and subsequently growing them in suitable media.
The invention also relates to transgenic plants transformed with an expression cassette according to the invention and to transgenic cells, tissue, organs and propagation material of such plants. Especially preferred in this context are transgenic crop plants such as, for example, barley, wheat, rye, maize, oats, soybeans, rice, cotton, sugar beet, canola, sunflowers, flax, hemp, potatoes, tobacco, tomatoes, oilseed rape, alfalfa, lettuce and the various tree, nut and grapevine species. Plants for the purposes of the invention are monocotyledonous and dicotyledonous plants or algae.
The invention is now illustrated in greater detail in the use examples which follow, taking into consideration the appended figures:
Figure 1 shows a schematic representation of the tocopherol biosynthesis pathway in plants; PP represents pyrophosphate; if homogentisate is reacted with geranylgeranyl-PP (not shown) in the plant, the corresponding tocotrienols are formed in a similar fashion;
Figure 2 shows a binary transformation vector which expresses HPPDop in the seeds of transformed plants and simultaneously suppresses the expression of the endogenous HGD: A = 35S-promoter; B = HGD in antisense orientation; C = OCS terminator; D = legumin B promoter;
E = FNR transit peptide; F = HPPDop; G = NOS terminator;

5 Figure 3 shows construction schemes of the HPPD-encoding plasmids pUCI9HPPDop and pCRScriptHPPDop;
Figure 4 shows construction schemes of the antiHGD-encoding plasmids pBinARHGDanti and pCRScriptHGDanti; and Figure 5 shows construction schemes of the transformation vectors pPTVHGDanti and pPZP200HPPD.
General methods:
a) General cloning methods The cloning steps carried out for the purposes of the present invention, such as, for example, restriction cleavages, agarose gel electrophoresis, purification of DNA fragments, transfer of nucleic acids to nitrocellulose and nylon membranes, linkage of DNA fragments, transformation of E. coli cells, growing bacteria, multiplying phages and sequence analysis of recombinant DNA, were carried out as described by Sambrook et al. (1989) Cold Spring Harbor Laboratory Press; TSBN 0-87969-309-6.
b) Sequence analysis of recombinant DNA
The recombinant DNA molecules were sequenced with a Licor laser fluorescence DNA sequencer (available from MWG Biotech, Ebersbach) by the method of Sanger (Sanger et al., Proc. Natl.
Acad. Sci. USA 74 (1977), 5463 - 5467).
Example 1: Cloning a hydroxyphenylpyruvate dioxygenase (HPPD) with a DNA sequence optimized for expression in Brassica napus The amino acid sequence of the hydroxyphenylpyruvate dioxygenase (HPPD) from Streptomyces avermitilis (accession No. U11864) was back-translated into a DNA sequence taking into consideration the codon usage in Brassica napus (oilseed rape). The codon usage was determined by means of the database http://www.dna.affrc.go.jp/
-nakamura/index.html. The deduced sequence (SEQ ID N0:14) was synthesized by ligating overlapping oligonucleotides, followed by PCR amplification (Rouwendal, GJA; et al, (1997) PMB 33:
989-999), while attaching SalI cleavage sites. The correctness of the sequence of the synthetic gene was checked by sequencing. The synthetic gene was inserted into the vector pBluescript II SK+
(Stratagene).
Example 2: Cloning a Brassica napus homogentisate dioxygenase 5 (HGD) a) Isolation of total RNA from Brassica napus flowers Open flowers were harvested from Brassica napus var. Westar and 10 frozen in liquid nitrogen. The material was subsequently reduced to a powder in a mortar and taken up in Z6 buffer (8M guanidinium hydrochloride, 20 mM MES, 20 mM EDTA, brought to pH 7.0 with NaOH; treated with 400 ~.1 mercaptoethanol/100 ml buffer immediately prior to use). The suspension was then transferred 15 into reaction vessels and extracted by shaking with one volume of phenol/chloroform/isoamyl alcohol 25:24:1. After centrifugation for 10 minutes at 15,000 rotations, the supernatant was transferred into a fresh reaction vessel and the RNA was precipitated with 1/20 volume 1N acetic acid and 0.7 volume ethanol (absolute). After recentrifugation, the pellet was first washed with 3M sodium acetate solution and, after a further centrifugation, with 70~ ethanol. The pellet was subsequently dissolved in DEPC (diethylpyrocarbonate) water, and the RNA
concentration was determined photometrically.
b) Preparation of cDNA from total RNA from Brassica napus flowers First, 20 ~,g of total RNA were treated with 3.3 ~,1 of 3M sodium acetate solution, 2 ~,1 of 1M magnesium sulfate solution and made up to an end volume of 10 ~,1 with DEPC water. To this, 1 ~.1 of RNase-free DNase (Boehringer Mannheim) was added, and the mixture was incubated for 45 minutes at 37 degrees. After the enzyme had been removed by extraction by shaking with phenol/chloroform/isoamyl alcohol, the RNA was precipitated with ethanol and the pellet was taken up in 100 ~ul of DEPC water.
2.5 ~,g of RNA from this solution were transcribed into cDNA using a cDNA kit (Gibco BRL) following the manufacturer's instructions.
c) PCR amplification of a subfragment of the Brassica napes HGD
A comparison of the DNA sequences of the known homogentisate dioxygenases (HGD) from Arabidopsis thaliana (accession No.
U80668), Homo sapiens (accession No. U63008) and Mus musculus (accession No. U58988) allowed oligonucleotides to be deduced, for a PCR, which had an Sall cleavage site added at the 5' terminus and an Asp718 restriction cleavage site at the 3' terminus. The oligonucleotide at the 5' terminus encompasses the sequence:
GTCGACGGNCCNATNGGNGCNAANGG (SEQ ID N0:2), starting with base 661 of the Arabidopsis gene. The oligonucleotide at the 3' terminus encompasses the sequence:
GGTACCTCRAACATRAANGCCATNGTNCC (SEQ ID N0:3), starting with base 1223 of the Arabidopsis gene, where N is in each case inosine and R represents the incorporation of A or G
into the oligonucleotide.
The PCR reaction was carried out with TAKARA Taq polymerase following the manufacturer's instructions. The template used was 0.3 ~g of the cDNA. The PCR program was:
1 cycle: 94 degrees 1 min 5 cycles: 94 degrees 4 sec 50 degrees 30 sec 72 degrees 1 min 5 cycles: 94 degrees 4 sec 48 degrees 30 sec 72 degrees 1 min 25 cycles: 94 degrees 4 sec 46 degrees 30 sec 72 degrees 1 min 1 cycle: 72 degrees 30 min The fragment was purified by means of NucleoSpin Extract (Machery and Nagel) and cloned into the vector pGEMT (Promega) following the manufacturer's instructions.
The correctness of the fragment was checked by sequencing.
Example 3: Generation of a plant transformation construct for overexpressing HPPD with optimized DNA sequence (HPPDop) and elimination of HGD
To generate plants which express HPPDop in seeds and in which the expression of the endogenous HGD is suppressed by means of antisense technology, a binary vector was constructed which contains both gene sequences (Figure 2, construct VI).

a) Generation of an HPPDop expression cassette To this end, the components of the cassette for expressing the HPPDop, composed of the legumin B promoter (accession No.
5 X03677), the transit peptide of the spinach ferredoxin:NADP+
oxidoreductase (FNR; Jansen, T, et al (1988) Current Genetics 13, 517-522) and the NOS terminator (contained in pBI101 accession No. U12668) were first provided with the necessary restriction cleavage sites by means of PCR.
The legumin promoter was amplified by means of PCR from the plasmid plePOCS (Baumlein, H, et a1.(1986) Plant J. 24, 233-239) with the upstream oligonucleotide:
GAATTCGATCTGTCGTCTCAAACTC (SEQ ID NO: 4) and the downstream oligonucleotide:
GGTACCGTGATAGTAAACAACTAATG (SEQ ID NO: 5) and cloned into the vector PCR-Script (Stratagene) following the manufacturer's instructions.
The transit peptide was amplified from the plasmid pSK-FNR
(Andrea Babette Regierer "Molekulargenetische Ansatze zur Veranderung der Phosphat-Nutzungseffizienz von hoheren Pflanzen"
[Approaches in molecular genetics for altering the phosphate utilization efficacy of higher plants], P+H Wissenschaftlicher Verlag, Berlin 1998 ISBN: 3-9805474-9-3) by means of PCR using the 5' oligonucleotide:
ATGGTACCTTTTTTGCATAAACTTATCTTCATAG (SEQ ID NO: 6) and the 3' oligonucleotide:
ATGTCGACCCGGGATCCAGGGCCCTGATGGGTCCCATTTTCCC (SEQ ID NO: 7).
The NOS terminator was amplified from the plasmid pBI101 (Jefferson, R.A., et al (1987) EMBO J. 6 (13), 3901-3907) by means of PCR using the 5' oligonucleotide:
GTCGACGAATTTCCCCGAATCGTTC: (SEQ ID NO: 8) and the 3' oligonucleotide AAGCTTCCGATCTAGTAACATAGA (SEQ ID N0: 9).

The amplicon was cloned in each case into the vector pCR-Script (Stratagene) following the manufacturer's instructions.
For the expression cassette, the NOS terminator was first recloned as an SalI/HindIII fragment into a suitably cut pUCl9 vector (Yanisch-Perron, C., et al (1985) Gene 33, 103-119). The transit peptide was subsequently introduced into this plasmid as an Asp718/Sall fragment. The legumin promoter was then cloned in as an EcoRI/Asp718 fragment. The gene HPPDop was introduced into this construct as an SalI fragment (Figure 3, construct III).
The finished cassette in pUCl9 was used as template for a PCR, for which purpose the oligonucleotide:
AAGCTTGATCTGTCGTCTCAAACTC (SEQ ID NO: 10) was used for the legumin promoter and the oligonucleotide:
AAGCTTCCGATCTAGTAACATAGA (SEQ ID NO: 11) for the NOS terminator. The amplicon was cloned into pCR-Script and named pCR-ScriptHPPDop (Figure 3, construct IV).
b) Construction of an antiHGD expression cassette To eliminate HGD using the antisense technique, the gene fragment was cloned as an SalI/Asp718 fragment into the vector pBinAR
(Hofgen, R. and Willmitzer, L., (1990) Plant Sci. 66: 221-230) in which the 35S promoter and the OCS terminator are present (Figure 4, construct I). The construct acted as template for a PCR
reaction with the oligonucleotide:
ATTCTAGACATGGAGTCAAAGATTCAAATAGA (SEQ ID NO: 12), specifically for the 35S promoter sequence, and the oligonucleotide:
ATTCTAGAGGACAATCAGTAAATTGAACGGAG (SEQ ID NO: 13).
specifically for the OCS terminator sequence The amplicon was cloned into the vector PCR-Script (Stratagene) and named HGDanti (Figure 3, construct II).

., c) Construction of the binary vector To construct a binary vector for the transformation of oilseed rape, the construct HGDanti from pCRScriptHGDanti was first cloned into the vector pPTV (Becker, D., (1992) PMB 20, 1195-1197) as an Xbal fragment (Figure 5, construct V). The construct LegHPPDop from pCRScriptHPPDop was inserted into this plasmid as an HindIII fragment. This plasmid was termed pPTVHPPD/HGDanti (Figure 2, construct VI).
Example 4: Construction of cotransformation constructs for overexpressing HPPDop and eliminating HGD in Brassica napes plants To cotransform plants with HPPDop and antiHGD, the construct legumin B promoter/transit peptide/HPPDop/NOS was excised from the vector pCRScriptHPPDop (Figure 3, construct IV) as an HindIII
fragment and inserted into the suitably cut vector pPZP200 (Hajdukiewicz, P., et al., (1994) PMB 25(6): 989-94) (Figure 5, construct VII). This plasmid was used later for cotransforming plants together with the vector pPTVHGDanti (Figure 5, construct V) of Example 3 c).
Example 5: Generation of transgenic Brassica napes plants The generation of transgenic oilseed rape plants approximately followed a protocol by Bade, ,T. B. and Damm, B. (in Gene Transfer to Plants, Potrykus, I. and Spangenberg, G., Hrsg., Springer Lab Manual, Springer Verlag, 1995, 30-38), which also indicates the composition of the media and buffers used.
The transformation was carried out with the Agrobacterium tumefaciens strain EHA105 ( Li, X.Q., et al., PMB (1992) 20, 1037). Either the abovementioned plasmid pPTVHPPDopHGDanti (Figure 2) or cultures of agrobacteria with the plasmids pPTVHGDanti and pPZP200HPPDop (Figure 5), which cultures had been mixed after growing, were used for the transformation.
Seeds of Brassica napes var. westar were surface-sterilized with 70o ethanol (v/v), washed in water for 10 minutes at 55°C, incubated for 20 minutes in a to strength hypochlorite solution (25o v/v Teepol, 0.1~ v/v Tween 20) and washed six times for 20 minutes with sterile water. The seeds were dried for three days on filter paper and 10-15 seeds were germinated in a glass flask containing 15 ml of germination medium. The roots and apices were removed from several seedlings (approximate size 10 cm) and the remaining hypocotyls were cut into sections approximately 6 mm in length. The approximately 600 explants thus obtained were washed for 30 minutes in 50 ml of basal medium and transferred into a 300-ml flask. After 100 ml of callus induction medium had been added, the cultures were incubated for 24 hours 5 at 100 rpm.
Overnight cultures of the Agrobacterium strains were set up at 29~C in Luria broth medium supplemented with kanamycin (20 mg/1), of which 2 ml were incubated for 4 hours at 29~C in 50 ml of Luria 10 broth medium without kanamycin until an OD6oo of 0.4-0.5 had been reached. After the culture had been pelleted for 25 minutes at 2000 rpm, the cell pellet was resuspended in 25 ml of basal .medium. The bacterial concentration in the solution was brought to an OD6oo of 0.3 by adding more basal medium. For the 15 cotransformation, equal portions of the solution of both strains were mixed.
The callus induction medium was removed from the oilseed rape explants by means of sterile pipettes, 50 ml of Agrobacterium 20 solution were added, everything was mixed carefully and the mixture was incubated for 20 minutes. The Agrobacterium suspension was removed, the oilseed rape explants were washed for 1 minute with 50 ml of callus induction medium, and 100 ml of callus induction medium were subsequently added. Cocultivation was carried out for 24 hours on an orbital shaker at 100 rpm.
Cocultivation was stopped by removal of the callus induction medium, and the explants were washed twice for 1 minute in each case with 25 ml and twice for 60 minutes with in each case 100 ml of wash medium at 100 rpm. The wash medium together with the explants were transferred into 15-cm Petri dishes and the medium was removed using sterile pipettes.
For the regeneration, in each case 20-30 explants were transferred into 90-mm Petri dishes containing 25 ml of shoot induction medium supplemented with phosphinotricin. The Petri dishes were sealed with 2 layers of Leukopor and incubated at 25°C
and 2000 lux at photoperiods of 16 hours light/8 hours darkness.
Every 12 days, the calli which developed were transferred to fresh Petri dishes with shoot induction medium. All further steps for the regeneration of entire plants were carried out as described by Bade, J.B and Damm, B. (in: Gene Transfer to Plants, Potrykus, I. and Spangenberg, G., Hrsg., Springer Lab Manual, Springer Verlag, 1995, 30-38).

SEQUENCE LISTING
<110> BASF Aktiengesellschaft <120> Homogentisat-Dioxygenase <130> M/40226 <140> 19937957.2 <141> 1999-08-11 <160> 15 <170> PatentIn Ver. 2.1 <210> 1 <211> 575 <212> DNA
<213> Brassica napus <220>
<221> misc_feature <222> (1). (6) <223> /function= "Restriktionsschnittstelle <220>
<221> misc_feature <222> (570)..(575) <223> /function = "Restriktionsschnittstelle"
<400> 1 gtcgacgggc cgatgggggc gaagggtctt gctgcaccaa gagattttct tgcaccaacg 60 gcatggtttg aggaagggct acggcctgac tacactattg ttcagaagtt tggcggtgaa 120 ctctttactg ctaaacaaga tttctctccg ttcaatgtgg ttgcctggca tggcaattac 180 gtgccttata agtatgacct gcacaagttc tgtccataca acactgtcct tgtagaccat 240 ggagatccat ctgtaaatac agttctgaca gcaccaacgg ataaacctgg tgtggccttg 300 cttgattttg tcatattccc tcctcgttgg ttggttgctg agcatacctt tcgacctcct 360 tactaccatc gtaactgcat gagtgaattt atgggcctaa tctatggtgc ttacgaggcc 420 aaagctgatg gatttctacc tggtggcgca agtcttcaca gttgtatgac acctcatggt 480 ccagatacaa ccacatacga ggcgacgatt gctcgtgtaa atgcaatggc tccttataag 540 ctcacaggca ccatggcctt catgtttgag gtacc 575 <210> 2 <211> 26 <212> DNA
<213> Kiinstliche Sequenz <220>
<223> Beschreibung der kiinstlichen Sequenz: /desc =
"Oligonukleotid"
<220>
<221> misc_feature <222> (9) <223> /mod base = i ' . 22 <220>
<221> misc_feature <222> (12) <223> /mod base = i <220>
<221> misc_feature <222> (15) <223> /mod base = i <220>
<221> misc_feature <222> (18) <223> /mod base = i <220>
<221> misc_feature <222> (21) <223> /mod base = i <220>
<221> misc_feature <222> (24) <223> /mod base = i <400> 2 gtcgacggnc cnatnggngc naangg 26 <210> 3 <211> 29 <212> DNA
<213> Kiinstliche Sequenz <220>
<223> Beschreibung der kiinstlichen Sequenz: /desc =
"Oligonukleotid"
<220>
<221> misc_feature <222> (18) <223> /mod base = i <220>
<221> misc_feature <222> (24) <223> /mod base = i <220>
<221> misc_feature <222> (27) <223> /mod base = i <400> 3 ggtacctcra acatraangc catngtncc 29 '. 23 <210> 4 <211> 25 <212> DNA
<213> Kiinstliche Sequenz <220>
<223> Beschreibung der kiinstlichen Sequenz: /desc =
"Oligonukleotid"
<400> 4 gaattcgatc tgtcgtctca aactc 25 <210> 5 <211> 26 <212> DNA
<213> Kiinstliche Sequenz <220>
<223> Beschreibung der kiinstlichen Sequenz: /desc =
"Oligonukleotid"
<400> 5 ggtaccgtga tagtaaacaa ctaatg 26 <210> 6 <211> 34 <212> DNA
<213> Kiinstliche Sequenz <220>
<223> Beschreibung der kiinstlichen Sequenz: /desc =
"Oligonukleotid"
<400> 6 atggtacctt ttttgcataa acttatcttc stag 34 <210> 7 <211> 43 <212> DNA
<213> Kiznstliche Sequenz <220>
<223> Beschreibung der kiinstlichen Sequenz: /desc =
"Oligonukleotid"
<400> 7 atgtcgaccc gggatccagg gccctgatgg gtcccatttt ccc 43 <210> 8 <211> 25 '. 24 <212> DNA
<213> Kiinstliche Sequenz <220>
<223> Beschreibung der kiinstlichen Sequenz: /desc =
Oligonukleotid"
<400> 8 gtcgacgaat ttccccgaat cgttc 25 <210> 9 <211> 24 <212> DNA
<213> Kiinstliche Sequenz <220>
<223>~Beschreibung der kiinstlichen Sequenz: /desc =
"Oligonukleotid"
<400> 9 aagcttccga tctagtaaca taga 24 <210> 10 <211> 25 <212> DNA
<213> Kiinstliche Sequenz <220>
<223> Beschreibung der kiinstlichen Sequenz: /desc =
"Oligonukleotid"
<400> 10 aagcttgatc tgtcgtctca aactc 25 <210> 11 <211> 24 <212> DNA
<213> Kiinstliche Sequenz <220>
<223> Beschreibung der kiinstlichen Sequenz: /desc =
"Oligonukleotid"
<400> 11 aagcttccga tctagtaaca taga 24 <210> 12 <211> 32 <212> DNA
<213> Kiinstliche Sequenz <220>

<223> Beschreibung der kiinstlichen Sequenz: /desc =
"Oligonukleotid"
<400> 12 attctagaca tggagtcaaa gattcaaata ga 32 <210> 13 <211> 32 <212> DNA
<213> Kiinstliche Sequenz <220>
<223> Beschreibung der kiinstlichen Sequenz: /desc =
"Oligonukleotid"
<400> 13 attctagagg acaatcagta aattgaacgg ag 32 <210> 14 <211> 1159 <212> DNA
<213> Kiinstliche Sequenz <220>
<223> Beschreibung der kiinstlichen Sequenz: /desc =
"DNA"
<220>
<221> misc_feature <222> (I)..(6) <223> /function = "Restriktionsschnittstelle"
<220>
<221> CDS
<222> (8)..(1153) <220>
<221> misc_feature <222> (1154)..(1159) <223> /function = "Restriktionsschnittstelle"
<400> 14 gtcgact atg act caa act act cat cat act cca gat act get aga caa 49 Met Thr Gln Thr Thr His His Thr Pro Asp Thr Ala Arg Gln get gat cct ttt cca gtt aag gga atg gat get gtt gtt ttc get gtt 97 Ala Asp Pro Phe Pro Val Lys Gly Met Asp Ala Val Val Phe Ala Val gga aac get aag caa get get cat tac tac tct act get ttc gga atg 145 Gly Asn Ala Lys Gln Ala Ala His Tyr Tyr Ser Thr Ala Phe Gly Met ' . 26 caa ctt gtt get tac tct gga cca gaa aac gga tct aga gaa act get 193 Gln Leu Val Ala Tyr Ser Gly Pro Glu Asn Gly Ser Arg Glu Thr Ala tct tac gtt ctt act aac gga tct get aga ttc gtt ctt act tct gtt 241 Ser Tyr Val Leu Thr Asn Gly Ser Ala Arg Phe Val Leu Thr Ser Val att aag cca get acc cca tgg gga cat ttc ctt get gat cac gtt get 289 Ile Lys Pro Ala Thr Pro Trp Gly His Phe Leu Ala Asp His Val Ala gaa cac gga gat gga gtt gtt gat ctt get att gaa gtt cca gat get 337 Glu His Gly Asp Gly Val Val Asp Leu Ala Ile Glu Val Pro Asp Ala aga get get cat get tac get att gaa cat gga get aga tct gtt get 385 Arg Ala Ala His Ala Tyr Ala Ile Glu His Gly Ala Arg Ser Val Ala gaa cca tac gaa ctt aag gat gaa cat gga act gtt gtt ctt get get 433 Glu Pro Tyr Glu Leu Lys Asp Glu His Gly Thr Val Val Leu Ala Ala att get act tac gga aag act aga cat act ctt gtt gat aga act gga 481 Ile Ala Thr Tyr Gly Lys Thr Arg His Thr Leu Val Asp Arg Thr Gly tac gat gga cca tac ctt cca gga tac gtt get get get cca att gtt 529 Tyr Asp Gly Pro Tyr Leu Pro Gly Tyr Val Ala Ala Ala Pro Ile Val gaa cca cca get cat aga acc ttc caa get att gac cat tgt gtt ggt 577 Glu Pro Pro Ala His Arg Thr Phe Gln Ala Ile Asp His Cys Val Gly aac gtt gaa ctc gga aga atg aac gaa tgg gtt gga ttc tac aac aag 625 Asn Val Glu Leu Gly Arg Met Asn Glu Trp Val Gly Phe Tyr Asn Lys gtt atg gga ttc act aac atg aag gaa ttc gtt gga gat gat att get 673 Val Met Gly Phe Thr Asn Met Lys Glu Phe Val Gly Asp Asp Ile Ala act gag tac tct get ctt atg tct aag gtt gtt get gat gga act ctt 721 Thr Glu Tyr Ser Ala Leu Met Ser Lys Val Val Ala Asp Gly Thr Leu aag gtt aaa ttc cca att aat gaa cca get ctt get aag aag aag tct 769 Lys Val Lys Phe Pro Ile Asn Glu Pro Ala Leu Ala Lys Lys Lys Ser cag att gat gaa tac ctt gag ttc tac gga gga get gga gtt caa cat 817 Gln Ile Asp Glu Tyr Leu Glu Phe Tyr Gly Gly Ala Gly Val Gln His att get ctt aac act gga gat atc gtg gaa act gtt aga act atg aga 865 Ile Ala Leu Asn Thr Gly Asp Ile Val Glu Thr Val Arg Thr Met Arg get gca gga gtt caa ttc ctt gat act cca gat tct tac tac gat act 913 Ala Ala Gly Val Gln Phe Leu Asp Thr Pro Asp Ser Tyr Tyr Asp Thr ctt ggt gaa tgg gtt gga gat act aga gtt cca gtt gat act ctt aga 961 Leu Gly Glu Trp Val Gly Asp Thr Arg Val Pro Val Asp Thr Leu Arg gaa ctt aag att ctt get gat aga gat gaa gat gga tac ctt ctt caa 1009 Glu Leu Lys Ile Leu Ala Asp Arg Asp Glu Asp Gly Tyr Leu Leu Gln atc ttc act aag cca gtt caa gat aga cca act gtg ttc ttc gaa atc 1057 Ile Phe Thr Lys Pro Val Gln Asp Arg Pro Thr Val Phe Phe Glu Ile att gaa aga cat gga tct atg gga ttc gga aag ggt aac ttc aag get 1105 Ile Glu Arg His Gly Ser Met Gly Phe Gly Lys Gly Asn Phe Lys Ala ctt ttc gaa get att gaa aga gaa caa gag aag aga gga aac ctt tag 1153 Leu Phe Glu Ala Ile Glu Arg Glu Gln Glu Lys Arg Gly Asn Leu gtcgac 1159 <210> 15 <211> 381 <212> PRT
<213> Kiinstliche Sequenz <223> Beschreibung der kiinstlichen Sequenz: /desc =
"DNA"
<400> 15 Met Thr Gln Thr Thr His His Thr Pro Asp Thr Ala Arg Gln Ala Asp Pro Phe Pro Val Lys Gly Met Asp Ala Val Val Phe Ala Val Gly Asn Ala Lys Gln Ala Ala His Tyr Tyr Ser Thr Ala Phe Gly Met Gln Leu Val Ala Tyr Ser Gly Pro Glu Asn Gly Ser Arg Glu Thr Ala Ser Tyr Val Leu Thr Asn Gly Ser Ala Arg Phe Val Leu Thr Ser Val Ile Lys Pro Ala Thr Pro Trp Gly His Phe Leu Ala Asp His Val Ala Glu His Gly Asp Gly Val Val Asp Leu Ala Ile Glu Val Pro Asp Ala Arg Ala Ala His Ala Tyr Ala Ile Glu His Gly Ala Arg Ser Val Ala Glu Pro Tyr Glu Leu Lys Asp Glu His Gly Thr Val Val Leu Ala Ala Ile Ala Thr Tyr Gly Lys Thr Arg His Thr Leu Val Asp Arg Thr Gly Tyr Asp Gly Pro Tyr Leu Pro Gly Tyr Val Ala Ala Ala Pro Ile Val Glu Pro Pro Ala His Arg Thr Phe Gln Ala Ile Asp His Cys Val Gly Asn Val Glu Leu Gly Arg Met Asn Glu Trp Val Gly Phe Tyr Asn Lys Val Met Gly Phe Thr Asn Met Lys Glu Phe Val Gly Asp Asp Ile Ala Thr Glu Tyr Ser Ala Leu Met Ser Lys Val Val Ala Asp Gly Thr Leu Lys Val Lys Phe Pro Ile Asn Glu Pro Ala Leu Ala Lys Lys Lys Ser Gln Ile Asp Glu Tyr Leu Glu Phe Tyr Gly Gly Ala Gly Val Gln His Ile Ala Leu Asn Thr Gly Asp Ile Val Glu Thr Val Arg Thr Met Arg Ala Ala Gly Val Gln Phe Leu Asp Thr Pro Asp Ser Tyr Tyr Asp Thr Leu Gly Glu Trp Val Gly Asp Thr Arg Val Pro Val Asp Thr Leu Arg Glu Leu Lys Ile Leu Ala Asp Arg Asp Glu Asp Gly Tyr Leu Leu Gln Ile Phe Thr Lys Pro Val Gln Asp Arg Pro Thr Val Phe Phe Glu Ile Ile Glu Arg His Gly Ser Met Gly Phe Gly Lys Gly Asn Phe Lys Ala Leu Phe Glu Ala Ile Glu Arg Glu Gln Glu Lys Arg Gly Asn Leu

Claims (18)

We claim:

1. An expression cassette comprising a) the coding nucleic acid sequence for 4-hydroxyphenylpyruvate dioxygenase (HPPD) or for a functional equivalent thereof; and/or b) at least one nucleic acid sequence (anti-HGD) which is capable of inhibiting the homogentisate dioxygenase (HGD) activity under the genetic control of regulatory nucleic acid sequences.

2. An expression cassette as claimed in claim 1, wherein the anti-HGD sequence is transcribable into an antisense nucleic acid sequence which is capable of inhibiting the HGD
activity.

3. An expression cassette as claimed in claim 1 or 2, wherein the coding HPPD sequence is linked functionally to the coding sequence of a plant-organelle-specific transit peptide.

4. An expression cassette as claimed in any of the preceding claims, wherein the coding HPPD sequence and the anti-HGD
sequence are in each case under the genetic control of a plant-specific promoter.

5. An expression cassette as claimed in any of the preceding claims, wherein the coding HPPD nucleic acid sequence encodes a protein containing an amino acid sequence in accordance with SEQ ID NO:15 or a functional equivalent thereof or encompasses a nucleic acid sequence from residue 8 to residue 1153 in accordance with SEQ ID NO:14 or a functional equivalent thereof.

6. An expression cassette as claimed in any of the preceding claims, which encompasses an HGD sequence motif in accordance with SEQ ID NO:1 in antisense orientation.

7. A recombinant vector encompassing at least one expression cassette as claimed in any of claims 1 to 6.

8. A vector as claimed in claim 7 encompassing at least one expression construct of the type:
5'-plant-specific-promoter/HPPD or anti-HGD/terminator-3', where the individual elements are functionally linked to each other and where HPPD optionally encodes a fusion protein encompassing a transit peptide which can be eliminated and a polypeptide with HPPD activity.

9. A vector as claimed in claim 8 encompassing one of the following expression constructs:
a) 35S promoter/anti-HGD/OCS terminator b) legumin B promoter/HPPD/NOS terminator c) 35S promoter/anti-HGD/OCS terminator/legumin B
promoter/HPPD/NOS terminator

10. A microorganism comprising a recombinant vector as claimed in any of claims 7 to 9.

11. A microorganism as claimed in claim 10 from the genus Agrobacterium and in particular the species Agrobacterium tumefaciens.

12. The use of a vector as claimed in any of claims 7 to 9 or of a microorganism as claimed in claim 10 or 11 for the transformation of plants, plant cells, plant tissue or plant organs.

13. The use as claimed in claim 12, wherein the plants, plant cells, plant tissue or plant organs are made capable of an improved tocopherol synthesis.

14. A transgenic plant, transformed with a vector as claimed in any of claims 7 to 9 or with a microorganism as claimed in claim 10 or 11, or transgenic cells, tissue, organs or transgenic propagation material thereof.

15. A transgenic plant as claimed in claim 14 selected from amongst crop plants such as cereals, maize, soybeans, rice, cotton, sugar beet, canola, sunflowers, flax, potatoes, tobacco, tomatoes, oilseed rape, alfalfa, salad species such as cress, and the various tree, nut and grapevine species.

16. A method for generating transgenic plants as claimed in claim 14 or 15, wherein plant cells, tissue or organs or protoplasts are transformed with a vector as claimed in any of claims 7 to 9 or with a microorganism as claimed in claim 10 or 11, the transformed cells, tissue, plant organs or protoplasts are cultured in a growth medium, and, if appropriate, plants are regenerated from the culture.

17. The use of an expression cassette as claimed in any of claims 1 to 6, a vector as claimed in any of claims 7 to 9, a microorganism as claimed in claim 10 or 11 or a transgenic plant as claimed in claim 14 or 15 for obtaining plant metabolites, in particular tocopherols.

18. A process for the preparation of tocopherols, which comprises isolating the tocopherol from a culture of a transformed plant as claimed in claim 14 or 15.