CA2311282A1

CA2311282A1 - Yac vectors

Info

Publication number: CA2311282A1
Application number: CA002311282A
Authority: CA
Inventors: Sanbing Shen; Andreas Schedl; Anthony John Harmar
Original assignee: Individual
Current assignee: Medical Research Council
Priority date: 1997-11-28
Filing date: 1998-11-27
Publication date: 1999-06-10
Also published as: GB9826126D0; GB2331752B; JP2001525168A; GB2331752A9; AU1342399A; HK1019765A1; WO1999028449A3; WO1999028449A2; AU751811B2; EP1034257A2; GB2331752A

Abstract

YAC vectors are described which may be used individually or in combination to prepare a YAC. A first YAC vector comprises a nucleotide sequence wherein the nucleotide sequence comprises the sequence presented as SEQ ID No.1 or SEQ ID No.4 or a variant, homologue or derivative thereof.

Description

The present invention relates to vectors, in particular .vectors that are suitable for use as s or with or in the preparation of a yeast artificial chromosome.
A yeast artificial chromosome - otherwise known as a YAC - comprises the structural components of a yeast chromosome into which it is possible to clone very large pieces of DNA. By way of example, it is generally possible to clone into a YAC stretches of DNA that are up to about 1000kb long - which are much larger than when compared with the stretches of DNA that can be cloned into other cloning vectors such as plasmids (typically up to 20kb stretches of DNA), bacteriophage ~, (typically up to 25kb stretches of DNA), cosmids (typically up to 45kb stretches of DNA) and the P1 vector (typically up to 100kb stretches of DNA) (see Lodish et al 1995 Molecular Cell Biology 3rd 15 Edition, Pub. Scientific American Books, page 233).
YACs were initially proposed by Burke et al (Burke, D.T., G.F. Carte and M.V.
Olson (1987) Cloning of large segments of exogenous DNA into yeast by means of artificial chromosome vectors. Science 236: 806-812). General introductory teachings on YACs 2o have been presented by T.A. Brown 1995 (Gene Cloning, An Introduction, 3rd Edition, page 325, Pub. Chapman & Hall, pages 139-142).
Typically, a YAC contains the following essential functional elements: a centromere, two telomeres and one or more origins of replication. The centromere is required to 2s correctly distribute the chromosome to daughter cells during cell division;
the telomeres are required to ensure correct replication; and the replication origins) is (are) present to ensure initiation of DNA replication. The origins of replication are sometimes referred to as ARS elements.

YACs are typically prepared from YAC vectors. These vectors are typically circular.
When they are needed to be used to prepare the YAC they are then linearised -such as by use of specific restriction enzymes.
s To date, a number of YAC vectors have been proposed in the literature.
Examples of such vectors are pYAC2 and pYAC4 which are discussed in US-A-4889806. Other YAC vectors are disclosed in WO-A-95/03400. Other YAC vectors include pYAC3 and pYACS.
o YAC vectors - such as pYAC3, pYAC4 and pYACS - are essentially a pBR322 plasmid into which a number of yeast genes have been inserted. These genes include a yeast centromere region (called CENT, two telomere regions (called TEL), and two selectable marker genes (called URA3 and TRPI). The TEL sequences do not correspond to the full genomic telomere sequences. Nevertheless these partial sequences still function as ~s telomeric sequences. One replication origin (called ori, such as ARSI) is positioned intermediate CEN4 and TRPl. When used for cloning, the YAC vectors are cut with BarnHI and a second restriction enzyme (SmaI for pYAC3, EcoRI for pYAC4 and NotI
for pYACS) to produce two vector arms. The fragments are then ligated with a nucleotide sequence of interest (which for ease of reference shall be called "NOI") which 2o has been digested with corresponding restriction enzymes.
The resultant linear structure (which is not drawn to scale) is presented as Figure 17.
This resultant linear structure - which is a YAC - comprises in the correct orientation the essential functional features of a chromosome.
YACs have been - and are still being - used to map the human genome. In this case, the NOI is a gene or fragment thereof whose full sequence (or even function) may not have been determined. In these studies, YACs are used to create genomic libraries which are then screened. By way of example, the physical map of the human Y chromosome and 3o the long arm of chromosome 21 have been determined through analysis of long segments of human DNA cloned into YACs by inter alia sequence tagged sites. This work is summarised in Lodish et al 1995 (ibid, page 285).

However, the use of YACs is by no means limited to mapping of the human genome.
For example, the use of YACs has led to the preparation of physical maps of the Drosophila X chromosome containing the shibire (ship locus (Bliek and Meyerowitz 1991 Nature 351 441). YACs have also been proposed to map plant genomes such as s the Arabidopsis genome.
In addition to their usage in genome mapping, YACs have now another important use.
In this regard, it has been recently found that under certain conditions YACs can be introduced into mammalian cells (such as murine cells), whereupon they can behave 1o functionally the same as (or very similar to) endogenous chromosomes. In this regard, it is possible to deliver - such as by use of cell fusion techniques, microinjection techniques or transfection techniques - YACs containing large fragments of human DNA
(i.e. the NOI) into the mouse germline. This was initially achieved with a 670kb YAC
containing a human X-chromosome fragment (Jacobovitis et al 1993 Nature 362 pages ~s 255-258). By way of further example, WO-A-94/23049 reports on a YAC
containing the gene coding for ~i-amyloid precursor protein.
Hence, YACs now enable workers to analyse an or the in vivo functional behaviour of a NOI, such as a human NOI. For these studies, prior knowledge of the sequence and/or 2o function of the NOI need not be necessary.
A review of these in vivo functional studies has been presented by Jacobovitis (Current Biology 1994 vol 4 No 8 pages 761-763), who states:
25 "The ability to replace mouse genes with their human equivalents using yeast artifccial chromosome technology provides a powerful new technique for studying the regulation and function of human genes" .

Other reviews and details on these studies and techniques have been presented by Larin and Lehrach (Genet. Res. Camb 1990 56 pp 203-208), Schedl et al (Nucleic Acids Research vol 20 No. 20 pages 3073-3077), and Montoliu et al (Reprod. Fert.
Dev. 1994 6 577-584).
YACs may even be used to study the functional behaviour of mutant genes. In this regard, WO-A-95/14769 reports on a method of producing a mouse that expresses human mutant protein sequences that utilises the "pop-in/pop-out" method in combination with YAC technology to insert mutations into YACs and thereby derive io stem cells capable of being used in the development of transgenic mice.
This particular method comprises obtaining a gene contained within a YAC, introducing a predetermined mutant human DNA sequence (which is the NOI) into the YAC by homologous recombination, utilising transgenics to insert the mutant gene into embryonic stem cells, and injecting the stem cells into blastocysts to derive a transgenic i5 mouse that expresses the mutant protein sequences. The "pop-in/pop-out"
method is described by Rothstein ( 1991 Methods In Enzymology vol 194, Guide To Yeast Genetics and also in Molecular Biology. Eds. Gutherie at al, San Diego: Academic Press.
Pages 281-301) and McCormick et al (TCM Vol 6 No. 1 1996 pages 16-24).
20 According to Schedl et al (reference 28): the transfer of YAC DNA into mammalian cells came into focus of interest soon after the first report of yeast artificial chromosomes. In a successfully transgenic cell the genes contained on the YAC
are embedded in an almost natural chromosomal context, which should ensure regulation of expression comparable to their endogenous counterparts. Therefore, such a method 25 should allow a more rapid identification of genes by complementation analysis as well as detailed studies of function of genes and their regulation in vivo. Schedl et al (ibic~
describe a method for the isolation of purified and concentrated YAC DNA as well as protocols for microinjection into somatic cells in culture and fertilized mouse oocytes.
3o Despite the fact that YACs have many important applications, there are nevertheless problems associated with their production and their usage.

WO 99/28449 . PCT/CB98/03558-For example, the low efficiency with which transgenic animals are produced using YAC
DNA ( 1-5 Rb ) compared to DNA from conventional vectors (approximately 10 °b ) is probably caused by the low concentration of YAC DNA available for injection.
Assuming that 2 pl of 540kb YAC at a concentration of 1 ng/~1 is injected into a 5 pronucleus, a fertilised egg receives only 1 molecule of YAC DNA.
Amplification of YACs in yeast should provide a possible method for the isolation of more concentrated YAC DNA which should lead to more successful generation of YAC transgenic animals (i.e. a transgenic mammal that comprises a YAC). However, to date, there has not been a totally acceptable solution to this problem.
to For example, Smith et al proposed use of the YAC vector pCGS990 (Smith et al Mammalian Genome 1993 4 pages 141-147). Even though that YAC vector goes some way to overcoming this problem, it nevertheless comprises the TK gene (i.e.
the herpes simplex virus thymidine kinase gene) as a selectable marker. This is problematic as ~5 expression of this gene can cause male sterility in transgenic animals.
Alternatively, or in addition, with current techniques it is not currently possible to readily monitor the in vivo expression pattern of a NOI that has been introduced into an organism - such as a mouse. Current techniques - such as in situ hydridisation, 2o Polymerase Chain Reaction (PCR) and Northern Blotting - are laborious to carry out.
In addition, and by way of further example, .none of the earlier reported studies has reported on the co-expression of a NOI and a reporter gene in a YAC.
z5 Thus there are problems associated with the known vectors for preparing YACs.
The present invention seeks to improve upon the existing techniques associated with the preparation of and usage of YACs.
3o In this regard, the present invention seeks to provide two types of vectors that can be used on their own or in combination with each other and thereby overcome at least one of the above-mentioned problems.

WO 99/28449 PCT/GB98/03558' According to a first aspect of the present invention there is provided one or more of the following embodiments, which for ease have been presented as numbered paragraphs:
1. A YAC vector comprising an IRES.
2. A YAC vector comprising a reporter gene wherein the expression product of the reporter gene is capable of producing a visually detectable signal.
3. A YAC vector comprising a reporter gene wherein the expression product of the to reporter gene is capable of producing an immunologically detectable signal.
4. A YAC vector comprising an IRES and a reporter gene wherein the expression product of the reporter gene is capable of producing a visually detectable signal.
5. A YAC vector comprising an IRES and a reporter gene wherein the expression product of the reporter gene is capable of producing an immunologically detectable signal.
6. pYNl.

7. pYN2.

8. pYIV3.

9. pYIV4.

10. A YAC prepared by the vector (such as the insertion thereof) according to any one of the above-mentioned embodiments.

11. Use of an IRES to modify a YAC vector or a YAC.

WO 99128449 PCT/CB98/03558' According to a second aspect of the present invention there is provided one or more of the following embodiments, which for ease have been presented as numbered paragraphs:
s 1. A YAC vector comprising a nucleotide sequence wherein the nucleotide sequence comprises the sequence presented as SEQ ID No.l or SEQ ID No. 4 a variant, homologue or derivative thereof.
2. A vector capable of modifying a YAC or a YAC vector wherein the vector to comprises a nucleotide sequence wherein the nucleotide sequence comprises the sequence presented as SEQ ID No.l or SEQ ID No. 4 or a variant, homologue or derivative thereof.
3. pYAM4.
is 4. A YAC prepared by the vector according to any one of the above-mentioned embodiments.
5. Use of a nucleotide sequence comprising the sequence presented SEQ ID No.l or 2o SEQ ID No. 4 or a variant, homologue or derivative thereof in a vector to prepare a YAC vector or a YAC.
6. Use of a nucleotide sequence comprising the sequence presented SEQ ID No.l or SEQ ID No. 4 or a variant, homologue or derivative thereof in a vector to increase the 2s expression efficiency of one or more NOIs within a YAC vector or a YAC.
For convenience, the vector of the first aspect of the present invention is sometimes referred to herein as being an insertion vector; whereas the vector of the second aspect of the present invention is sometimes referred to herein as being an amplification vector.

WO 99/28449 _ PCT/GB98/03558 However, the term "vector" as used herein in the general sense means the vector of the first aspect of the present invention andlor the vector of the second aspect of the present invention.
s According to a third aspect of the present invention there is provided the combination of at least any one of the embodiments of the first aspect of the present invention and at least any one of the embodiments of the second aspect of the present invention.
With the third aspect of the present invention - namely the combination of the vector of to the first aspect of the present invention and the vector of the second aspect of the present invention - the term "combination" means that the resultant YAC or transgenic/transformed cell, organ or organism is prepared by use of both the vector of the first aspect of the present invention and the vector of the second aspect of the present invention.
is The third aspect of the present invention is not limited to preparative techniques wherein both the vector of the first aspect of the present invention and the vector of the second aspect of the present invention have to be used at the same time when preparing the YAC, let alone the transformed/transgenic cell, organ or organism. In this regard, it is 2o sometimes advantageous for the vector of the first aspect of the present invention to be used at a different stage than the vector of the second aspect of the present invention during the preparation of the YAC, or even the transformed/transgenic cell, organ or organism.
2s According to a further aspect of the present invention there is provided a YAC vector or a YAC comprising a selection gene, wherein that selection gene is specifically removable from the YAC vector or the YAC.
Other aspects of the present invention include:
A YAC transgenic mammal co-expressing an NOI and a reporter gene wherein the expression pattern of the NOI can be determined by measuring a detectable signal (such as a visually or an immunologically detectable signal) produced by the expression product of the reporter gene.
A YAC transgenic mammal expressing a reporter gene under the control of a s regulatory sequence from a human NOI.
Use of a YAC transgenic mammal to test for potential pharmaceutical and/or veterinary agents.
1o An assay method for identifying an agent that can affect the expression pattern of an NOI or the EP ("expression product") activity thereof, the assay method comprising ~5 administering an agent to a YAC transgenic mammal according to the present invention;
determining whether the agent modulates (such as affects the expression pattern or activity) the NOI or the EP by means of the detectable signal.
An assay method according to the present invention wherein the assay is to screen for agents useful in the treatment of disturbances in any one of: circadian function, sleep disorders, eating disorders, pre-menstural syndrome, autoimmune disorders, birth defects in women and/or sexual dysfunction.
An agent identified by the method according to the present invention.
A process comprising the steps of:
(a) performing the assay according to the present invention;

(b) identifying one or more agents that affect the expression pattern of the NOI or the EP activity thereof;
(c) preparing a quantity of those one or more identified agents.
5 A process comprising the steps of:
(a) performing the assay according to the present invention;
(b) identifying one or more agents that affect the expression pattern of the NOI or the to EP activity thereof;
(c) preparing a pharmaceutical composition comprising one or more identified agents.
A process comprising the steps of:
(a) performing the assay according to the present invention;
(b) identifying one or more agents that affect the expression pattern of the NOI or the 2o EP activity thereof;
(c) modifiying one or more identified agents to cause a different effect on the expression pattern of the NOI or the EP activity thereof.
2s Use of a YAC according to the present invention or any one of the vectors according to the present invention to screen for agents capable of affecting the expression pattern of an NOI or the EP activity thereof in a transgenic mammal.
Use of an agent in the preparation of a pharmaceutical composition for the 3o treatment of a disorder or condition associated with the expression pattern of an NOI or the EP activity thereof, the agent having an effect on the expression pattern of the NOI

WO 99128449 . PCT/GB98/03558-or the EP activity thereof when assayed in vitro by the assay according to the present invention.
Use of an agent identified by an assay according to the present invention in the s manufacture of a medicament which affects the expression pattern of an NOI
or the EP
activity thereof.
Use of an agent identified by an assay according to the present invention in the manufacture of a medicament which affects the expression pattern of an NOI or the EP
1o activity thereof.
In accordance with the present invention, at least part of the assay can be carried out in living tissue.
15 A preferred - but non-limiting - example of an NOI is the human. serotonin transporter (SERT), preferably the the human serotonin transporter (SERT) presented as SEQ
ID
No. 2 or a variant, homologue or derivative thereof.
The terms "variant", "homologue", or "derivative" in relation to this aspect of the present 2o invention include any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) nucleic acid from or to the sequence providing the resultant expression product of the nucleotide sequence has the same activity as the expression product of SEQ ID No. 2, preferably having at least the same level of activity of the expression product of SEQ LD. No. 2. In particular, the term "homologue" covers 2s identity with respect to structure and/or function providing the resultant nucleotide sequence has promoter activity. With respect to sequence identity (i.e.
similarity), preferably there is at least 75 % , more preferably at least 85 % , more preferably at least 90% sequence identity. More preferably there is at least 95%, more preferably at least 98%, sequence identity. These terms also encompass allelic variations of the sequences.

Another preferred - but non-limiting - example of an NOI is the VIP2 receptor (VIPR2).
The VIP2 receptor is referred to interchangeably throughout the text as the receptor, VIPR2 or VPAC2R (Harmar et al 1998 Pharmacological Reviews 50: 265-270). Preferably, the VIPR2 is the VIP2 receptor (VIPR2) presented as SEQ ID
No. 3 s or a variant, homologue or derivative thereof.
The terms "variant", "homologue", or "derivative" in relation to this as~ct of the present invention include any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) nucleic acid from or to the sequence providing the to resultant expression product of the nucleotide sequence has the same activity as the expression product of SEQ ID No. 3, preferably having at least the same level of activity of the expression product of SEQ LD. No. 3. In particular, the term "homologue" covers identity with respect to structure and/or function providing the resultant nucleotide sequence has promoter activity. With respect to sequence identity (i.e., similarity), 15 preferably there is at least 75 l , more preferably at least 85 ~ , more preferably at least 90 l sequence identity. More preferably there is at least 95 ~ , more preferably at least 98°6, sequence identity. These terms also encompass allelic variations of the sequences.
The present invention also encompasses modified YACs comprising these aspects of the 2o present invention, transformed cells comprising these aspects of the present invention, transgenic organisms comprising these aspects of the present invention, processes for making all of these aspects, and methods of expressing all of these aspects.
The term "affects" includes any one or more of: treats, prevents, suppresses, alleviates, 25 restores, modulates, influences or to otherwise alter an existing state.
The term "agent" includes any entity (such as one or more chemical compounds, including peptide sequunces and variants/homologues/derivatives/fragments thereof) which is capable of affecting the expression pattern of the NOI or the EP
activity 3o thereof. It also includes mimics and equivalents and mutants thereof. It also includes agonists and antagonists and antibodies. Non-limiting antibodies include:
polyclonal, WO 99/28449 PCT/GB98/03558~

monoclonal, chimeric, single chain, Fab fragments, fragments produced by a Fab expression library and humanised monoclonal antibodies.
The term "expression product" or "EP" means the expressed protein per se but also includes fusion proteins comprising all or part of same. The EP may be the same as the naturally occuring form or is a variant, homologue, fragment or derivative thereof.
The term "disturbances in circadian function" means disorders which may lead to impaird physical and mental well-being that can occur through extremes in work patterns 1o such as shift work, in normal ageing, when travelling through time zones (jet lag), and in dementia.
There are a number of advantages associated with the present invention.
is For example, with the use of the amplification vector it is possible to obtain high copy numbers of YACs.
For example, with the use of the insertion vector it is possible to readily monitor the in vivo expression pattern of a NOI.
Also, with the use of the insertion vector, it is possible to express - such as over-express - a NOI and a reporter gene contained within or as a YAC.
It provides a means for producing YAC transgenic animals and the analysis of these animals in terms of expression, regulation and function of NOIs present in YAC
DNA.
It facilitates the determination of sites/regions where an NOI is expressed and the identification of agents which may affect the expression pattern of the NOI or the EP
activity thereof.
Other advantages associated with the present invention will be apparent from the following text.

With the present invention, the vector may comprise at least one NOI.
With the present invention, the term NOI (i.e. nucleotide sequence of interest) includes any suitable nucleotide sequence, which need not necessarily be a complete naturally s occuring DNA sequence. Thus, the DNA sequence can be, for example, a synthetic DNA sequence, a recombinant DNA sequence (i.e. prepared by use of recombinant DNA techniques), a cDNA sequence or a partial genomic DNA sequence, including combinations thereof. The DNA sequence need not be a coding region. If it is a coding region, it need not be an entire coding region. In addition, the DNA sequence can be in to a sense orientation or in an anti-sense orientation. Preferably, it is in a sense orientation. Preferably, the DNA is or comprises cDNA.
The vectors of the present invention may be used to prepare a modified YAC or a modified YAC vector. The modified YAC or the modified YAC vector can be used, for 1 s example, for expression and/or regulation and/or functional studies of the NOI. In addition, the vectors of the present invention can be used to prepare modified YACs or modified YAC vectors that can be used for expression and/or regulation and/or functional studies of the NOI in combination with other entities, such as other NOIs, compounds or compositions. In addition, the modified YAC or modified YAC
vector 2o can be used to test potential pharmaceutical agents (including veterinary agents).
Here the term "modified YAC or modified YAC vector" means a modified YAC or modified YAC vector having a modified genetic structure. With the present invention, the YAC or YAC vector has a modified genetic structure since part or all of the vector 2s according to the present invention has been incorporated into the YAC or YAC vector.
The vectors of the present invention may be used to prepare transformed cells that can be used, for example, for functional studies of the NOI. In addition, the vectors of the present invention can be used to prepare transformed cells that can be used for functional 3o studies of the NOI in combination with other entities, such as other NOIs, compounds or compositions. In addition, the transformed cells can be used to test potential pharmaceutical agents (including veterinary agents).

WO 99/28449 _ PCT/GB98/03558-The vectors of the present invention may be used to prepare transformed cells that comprise mutated genes - such as by use of the pop-in/pop-out technique (mentioned above).
s Here the term "transformed cell" means a cell having a modified genetic structure. With the present invention, the cell has a modified genetic structure since a vector according to the present invention has been introduced into the cell.
The term "cell" includes any suitable organism. In a preferred embodiment, the cell is a to mammalian cell. In a highly preferred embodiment, the cell is a murine cell.
The cell can be an isolated cell or a collection of cells. The cell or cells may even be part of a tissue or organ or an organism (including an animal).

15 The cell can be transformed in vivo or in vitro, or combinations thereof.
Typically, the cell will be transformed by any one of the following methods:
transfection, microinjection, electroporation or microprojectile bombardment, including combinations thereof.
Preferably, the cell will be transformed by, or by at least, transfection.
For some applications, the transformed cells may be prepared by use of the modified YAC according to the present invention.
The vectors of the present invention can also be used to prepare transgenic organisms that can be used for functional studies of the NOI. In addition, the vectors of the present invention can be used to prepare transgenic organisms that can be used, for example, for functional studies of the NOI in combination with other entities, such as other NOIs, 3o compounds or compositions. In addition, the transgenic organisms can be used to test potential pharmaceutical agents (including veterinary agents).

Here the term "transgenic organism" means an organism comprising a modified genetic structure. With the present invention, the organism has a modified genetic structure since a vector according to the present invention has been introduced into the organism.
The term "organism" includes any suitable organism. In a preferred embodiment, the organism is a mammal. In a highly preferred embodiment, the organism is a mouse.
For some applications, the transgenic organisms may be prepared by use of the transformed cells of the present invention.
to In a preferred embodiment, the insertion vector of the present invention is itself a YAC
vector.
For some applications, it may be advantageous that the amplification vector of the Is present invention is itself a YAC vector.
With the present invention, the vector of the present invention may additionally comprise one or more selection genes to enable the vector and any resultant entity comprising the same or made from the same (such as a modified YAC vector, a YAC or a specific yeast 2o strain comprising any one of the same) to be selectively grown and/or screened. These selection genes can be chosen from suitable selection genes that are available. Examples of suitable selection genes include LYS2 (see Barnes and Thorner 1986, Mol and Cell Biol 6: pp 2828-2838), LEU2 (see Beach and Nurse 1981 Nature vol 290 pp 140-142), and ADE2 (see Stotz and Linder 1990 Gene 95 pp 91-98).
In a preferred aspect any one or more of the selection gene is specifically removable from the vector, the modified YAC vector and the modified YAC according to the present invention. In this regard, the term "specifically removable" means being able to remove the one or more selection gene without disrupting any other region in the vector, 3o the modified YAC vector and the modified YAC according to the present invention. For example, the selection gene may be flanked by unique restriction sites.
Alternatively, the selection gene may be flanked by a LoxP element which is removable by use of Cre WO 99/28449 , PCT/GB98/03558-recombinase. Teachings on the use of the LoxP element and Cre recombinase have been published by Deursen et al (1995 PNAS Vol 93 pages 7376-7380), Kuhn et al (1995 Science Vol 269 pages 1427-1429) and Araki et al (1995 PNAS Vol 92 pages 160-164).
By way of example, the selection gene flanked by the LoxP element may therefore be removed prior to or after formation of the transgenic animal stem cell.
Removal of the selection gene is highly desirable as it means that the transgenic organism is not expressing the selection gene and so there can be no affect of that gene on the organism or even on the expression of the NOI being studied. In addition, removal of the selection gene means that the NOI is nearer to any 3' regulatory regions that may be io present on the YAC.
With the present invention, the YAC vector may additionally comprise one or more NOIs. The NOI need not be of known function and/or structure. Preferably, the NOI is of human origin.
is In accordance with one aspect of the present invention, the YAC vector comprises an internal ribosomal entry site (i.e. an IRES).
A review on IRES is presented by Mountford and Smith (TIG May 1995 vol 11 No.

2o pages 179 - 184). A suitable IRES has also been disclosed by Mountford et al (Mountford et al 1994 PNAS 91 pages 4303-4307).
IRES sequences are also mentioned in WO-A-93/03143, WO-A-97/14809, WO-A-94/24301, WO-A-95/32298, and WO-A-96/27676. These references do not disclose or 25 suggest the use of an IRES unit in preparing or being a part of a YAC.
According to WO-A-97/14809, IRES sequences act on improving translation efficiency of RNAs in contrast to a promoter's effect on the transcription of DNAs. A
number of different IRES sequences are known including those from encephalomyocarditis virus 30 (EMCV) (Ghattas, LR., et al., Mol. Cell. Biol., 11:5848-5859 (1991); BiP
protein [Macejak and Sarnow, Nature 353:91 (1991)]; the Antennapedia gene of drosphilia (exons d and e) [Oh, et al., Genes & Development, 6:1643-1653 (1992)] as well as those in polio virus [Pelletier and Sonenberg, Nature 334: 320-325 ( 1988); see also Mountford and Smith, TIG 11, 179-184 (1985)].
According to WO-A-97/ 14809, IRES sequences are typically found in the 5' non-coding region of genes. In addition to those in the literature they can be found empirically by looking for genetic sequences that affect expression and then determining whether that sequence affects the DNA (i.e. acts as a promoter or enhancer) or only the RNA
(acts as an IRES sequence).
to Thus the present invention is not intended to be limited to a specific IRES
sequence.
Instead, the sequence to be used can be any sequence that is capable of acting as an IRES
sequence - i.e. it is capable of improving translation efficiency of an RNA.
A preferred IRES sequence is that presented as SEQ ID No. 1 or a variant, homologue, 1 s derivative or fragment thereof.
The terms "variant", "homologue", "derivative" or "fragment" in relation to this aspect of the present invention include any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) nucleic acid from or to the sequence providing 2o the resultant nucleotide sequence has IRES activity, preferably having at least the same activity of the IRES shown as SEQ LD. No. 1. In particular, the term "homologue"
covers identity with respect to structure and/or function providing the resultant nucleotide sequence has promoter activity. With respect to sequence identity (i.e.
similarity), preferably there is at least 75 ~ , more preferably at least 85 ~ , more preferably at least 2s 90 ~ sequence identity. More preferably there is at least 95 ~ , more preferably at least 98°x, sequence identity. These terms also encompass allelic variations of the sequences.
Another preferred IRES sequence is that presented as SEQ ID No. 4 or a variant, homologue, derivative or fragment thereof.
The terms "variant", "homologue", "derivative" or "fragment" in relation to this aspect of the present invention include any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) nucleic acid from or to the sequence providing the resultant nucleotide sequence has IRFF,S activity, preferably having at least the same activity of the IRES shown as SEQ LD. No. 4. In particular, the term "homologue"
covers identity with respect to structure and/or function providing the resultant nucleotide s sequence has promoter activity. With respect to sequence identity (i.e.
similarity), preferably there is at least 75 % , more preferably at least 85 k , more preferably at least 90 ~O sequence identity. More preferably there is at least 95 % , more preferably at least 98 % , sequence identity. These terms also encompass allelic variations of the sequences.
to Sequence identity with respect to any of SEQ ID 1-4 can be determined by a simple "eyeball" comparison (i.e. a strict comparison) of any one or more of the sequences with another sequence to see if that other sequence has, for example, at least 75 %
sequence identity to the sequence(s).
15 Relative sequence identity can also be determined by commercially available computer programs that can calculate ~ identity between two or more sequences using any suitable algorithm for determining identity, using for example default parameters. A
typical example of such a computer program is CLUSTAL. Advantageously, the BLAST
algorithm is employed, with parameters set to default values. The BLAST
algorithm is 2o described in detail at http://www.ncbi.nih.gov/BLAST/blast help.html, which is incorporated herein by reference. The search parameters are defined as follows, can be advantageously set to the defined default parameters.
Advantageously, "substantial identity" when assessed by BLAST equates to sequences 25 which match with an EXPECT value of at least about 7, preferably at least about 9 and most preferably 10 or more. The default threshold for EXPECT in BLAST
searching is usually 10.
BLAST (Basic Local Alignment Search Tool) is the heuristic search algorithm employed 3o by the programs blastp, blastn, blastx, tblastn, and tblastx; these programs ascribe significance to their findings using the statistical methods of Karlin and Altschul (see http://www.ncbi.nih.gov/BLAST/blast help.html) with a few enhancements. The WO 99/28449 _ PCT/GB9$/03558-BLAST programs were tailored for sequence similarity searching, for example to identify homologues to a query sequence. For a discussion of basic issues in similarity searching of sequence databases, see Altschul et al (1994) Nature Genetics 6:119-129.
5 The five BLAST programs available at http://www.ncbi.nlm.nih.gov perform the following tasks:
blastp - compares an amino acid query sequence against a protein sequence database.
o blasts - compares a nucleotide query sequence against a nucleotide sequence database blastx - compares the six-frame conceptual translation products of a nucleotide query sequence (both strands) against a protein sequence database.
~5 tblastn - compares a protein query sequence against a nucleotide sequence database dynamically translated in all six reading frames (both strands).
tblastx - compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database.
BLAST uses the following search parameters:
HISTOGRAM - Display a histogram of scores for each search; default is yes.
(See parameter H in the BLAST Manual).
DESCRIPTIONS - Restricts the number of short descriptions of matching sequences reported to the number specified; default limit is 100 descriptions. (See parameter V in the manual page).
3o EXPECT - The statistical significance threshold for reporting matches against database sequences; the default value is 10, such that 10 matches are expected to be found merely by chance, according to the stochastic model of Karlin and Altschul (1990). If the WO 99/28449 PCT/GB98/03558' statistical significance ascribed to a match is greater than the EXPECT
threshold, the match will not be reported. Lower EXPECT thresholds are more stringent, leading to fewer chance matches being reported. Fractional values are acceptable. (See parameter E
in the BLAST Manual).
CUTOFF - Cutoff score for reporting high-scoring segment pairs. The default value is calculated from the EXPECT value (see above). HSPs are reported for a database sequence only if the statistical significance ascribed to them is at least as high as would be ascribed to a lone HSP having a score equal to the CUTOFF value. Higher CUTOFF
to values are more stringent, leading to fewer chance matches being reported.
(See parameter S in the BLAST Manual). Typically, significance thresholds can be more intuitively managed using EXPECT.
ALIGNMENTS - Restricts database sequences to the number specified for which high-scoring segment pairs (HSPs) are reported; the default limit is 50. If more database sequences than this happen to satisfy the statistical significance threshold for reporting (see EXPECT and CUTOFF below), only the matches ascribed the greatest statistical significance are reported. (See parameter B in the BLAST Manual).
2o MATRIX - Specify an alternate scoring matrix for BLASTP, BLASTX, TBLASTN
and TBLASTX. The default matrix is BLOSUM62 (Henikoff & Henikoff, 1992). The valid alternative choices include: PAM40, PAM120, PAM250 and IDENTITY. No alternate scoring matrices are available for BLASTN; specifying the MATRIX directive in BLASTN requests returns an error response.
STRAND - Restrict a TBLASTN search to just the top or bottom strand of the database sequences; or restrict a BLASTN, BLASTX or TBLASTX search to just reading frames on the top or bottom strand of the query sequence.
3o FILTER - Mask off segments of the query sequence that have low compositional complexity, as determined by the SEG program of Wootton & Federhen (1993) Computers and Chemistry 17:149-163, or segments consisting of short-periodicity internal repeats, as determined by the XNU program of Claverie & States (1993) Computers and Chemistry 17:191-201, or, for BLASTN, by the DUST program of Tatusov and Lipman (see http://www.ncbi.nlm.nih.gov). Filtering can eliminate statistically significant but biologically uninteresting reports from the blast output (e.g., s hits against common acidic-, basic- or proline-rich regions), leaving the more biologically interesting regions of the query sequence available for specific matching against database sequences.
Low complexity sequence found by a filter program is substituted using the letter "N" in o nucleotide sequence (e.g., "NNNNNNNNNNNNN") and the letter "X" in protein sequences (e.g., "XXXXXXXXX").
Filtering is only applied to the query sequence (or its translation products), not to database sequences. Default filtering is DUST for BLASTN, SEG for other programs.
It is not unusual for nothing at all to be masked by SEG, XNU, or both, when applied to sequences in SWISS-PROT, so filtering should not be expected to always yield an effect.
Furthermore, in some cases, sequences are masked in their entirety, indicating that the statistical significance of any matches reported against the unfiltered query sequence 2o should be suspect.
NCBI-gi - Causes NCBI gi identifiers to be shown in the output, in addition to the accession and/or locus name.
Most preferably, sequence comparisons are conducted using the simple BLAST
search algorithm provided at http://www.ncbi.nlm.nih.gov/BLAST.
Other computer program methods to determine identify and similarity between the two sequences include but are not limited to the GCG program package (Devereux et al 1984 Nucleic Acids Research 12: 387) and FASTA (Atschul et al 1990 J Molec Biol 403-410).

WO 99/28449 _ PCT/GB98/03558-In some aspects of the present invention, no gap penalties are used when determining sequence identity.
The present invention also encompasses nucleotide sequences that are complementary to the sequences presented herein, or any fragment or derivative thereof. If the sequence is complementary to a fragment thereof then that sequence can be used as a probe to identify similar promoter sequences in other organisms etc.
The present invention also encompasses nucleotide sequences that are capable of o hybridising to the sequences presented herein, or any fragment or derivative thereof.
Hybridization means a "process by which a strand of nucleic acid joins with a complementary strand through base pairing" (Coombs J (1994) Dictionary of Biotechnology, Stockton Press, New York NY) as well as the process of amplification as carried out in polymerase chain reaction technologies as described in Dieffenbach CW
and GS Dveksler (1995, PCR Primer, a Laboratory Manual, Cold Spring Harbor Press, Plainview NY).
Also included within the scope of the present invention are nucleotide sequences that are 2o capable of hybridizing to the nucleotide sequences presented herein under conditions of intermediate to maximal stringency. Hybridization conditions are based on the melting temperature (Tin) of the nucleic acid binding complex, as taught in Berger and Kimmel {1987, Guide to Molecular Cloning Techniques, Methods in Enzymology, Vol 152, Academic Press, San Diego CA), and confer a defined "stringency" as explained below.
Maximum stringency typically occurs at about Tm-5°C (5°C below the Tm of the probe); high stringency at about 5°C to 10°C below Tm;
intermediate stringency at about 10°C to 20°C below Tm; and low stringency at about 20°C
to 25°C below Tm. As will be understood by those of skill in the art, a maximum stringency hybridization can be 3o used to identify or detect identical nucleotide sequences while an intermediate (or low) stringency hybridization can be used to identify or detect similar or related nucleotide sequences.

In a preferred aspect, the present invention covers nucleotide sequences that can hybridise to the nucleotide sequences of the present invention under stringent conditions (e.g. 65 °C
and O.IxSSC).
The present invention also encompasses nucleotide sequences that are capable of hybridising to the sequences that are complementary to the sequences presented herein, or any fragment or derivative thereof. Likewise, the present invention encompasses nucleotide sequences that are complementary to sequences that are capable of hybridising to the sequence of the present invention. These types of nucleotide sequences are examples of variant nucleotide sequences. In this respect, the term "variant"
encompasses sequences that are complementary to sequences that are capable of hydridising to the nucleotide sequences presented herein. Preferably, however, the term "variant"
encompasses sequences that are complementary to sequences that are capable of hydridising under stringent conditions (eg. 65°C and 0. IxSSC { IxSSC = 0.15 M NaCI, 0.015 Na3 citrate pH
7.0}) to the nucleotide sequences presented herein.
Insertion of the IRES into a YAC by use of the insertion vector of the present invention -and thus forming a modified YAC - enables the modified YAC to express, in particular over-express, at least two nucleotide sequences. Of these two nucleotide sequences one 2o may be a NOI, such as a NOI of human origin. The other of those nucleotide sequences may be another NOI. Alternatively, and in a preferred aspect, the other nucleotide sequence is a reporter gene according to the present invention.
The present invention also encompasses a vector or a YAC obtained therefrom comprising more than one IRES. In this embodiment, the vector or the YAC
obtained therefrom preferably comprises more than NOI.
In a preferred aspect of the first aspect of the present invention, the YAC
vector comprises a reporter gene whose expression product is capable of producing a visually 3o detectable signal. Examples of such reporter genes include: LacZ (see Mansour et al 1990 PNAS vol 87 pp 7688-7692), green fluorescent protein (see Chiocchetti et al 1997 Biochim Biophys Acta 1352: pp 193-202; and Chalfie et al 1994 Science vol 263 pp 802-805), chloroamphenicol acetyl transferase (see Gorman et al 1982 Mol Cell Biol 2(9) pp 1044-1051; and Frebourg and Brison 1988 Gene vol 65 pp 315-318), or luciferase (see de Wet et al 1987 Mol Cell Biol 7(2) pp 725-737; and Rodriguez et al 1988 PNAS
vol 85 pp 1667-1671).

In another preferred embodiment of the first aspect of the present invention, the YAC
vector comprises a reporter gene whose expression product is capable of producing, or being detected by an agent capable of providing, an immunologically detectable signal.
o In a preferred aspect, the reporter gene when fused to the NOI leads to the production of a fusion protein that can be detected by commercially available antibodies, such as a haemagglutinin tag (see Pati 1992 Gene 15; 114(2): 285-288), a c-myc tag (see Emrich et al 1993 Biocem Biophys Res Commun 197(1): 214-220), or the FLAG epitope (Ford et al 1991 Protein Expr Purif Apr; 2(2):95-107).
By using a reporter gene according to the present invention it is possible to readily observe the functionality of NOIs contained within YAC libraries, such as YAC
human DNA libraries.
2o For example, if the NOI in the YAC has an expression regulatory role (such as a promoter) then expression of the reporter gene according to the present invention by a transgenic organism according to the present invention enables workers to readily determine in or at which sites or regions that expression regulatory element is active. In addition, workers will be able to readily test agents etc. that may affect the expression ability or pattern of that regulatory element.
By way of further example, if the NOI in the YAC has a functional role other than an expression regulatory role then by use of the insertion vector according to the invention workers can fuse (either directly or indirectly such as by means of one or more spacing 3o nucleotide sequences) the NOI to the reporter gene according to the present invention.
Thus, if the NOI is fused to the reporter gene according to the present invention and is present in a transgenic organism according to the present invention, then workers can readily determine which sites or regions that NOI is expressed. In addition, workers will be able to readily test agents etc. that may affect the expression pattern of that NOI.
A further advantage is that by being able to readily monitor the expression pattern or level of the NOI enables workers to determine the phenotype.
One aspect of the present invention concerns the use of SEQ ID No. l or SEQ ID
No. 4 or a variant, homologue or derivative thereof. Here, the term "variant, homologue or derivative thereof" includes any addition, substitution or deletion of one or more nucleic acids providing the resultant entity can still function as an IRES.

For a preferred aspect of the present invention it is envisaged that any variant, homologue or derivative of the IRES sequence comprises at least 100 by of SEQ ID No.l or SEQ ID
No. 4. Preferably, any variant, homologue or derivative comprises at least 200 by of SEQ
ID No.l or SEQ ID No. 4. Preferably, any variant, homologue or derivative comprises at s least 300 by SEQ ID No.l or SEQ ID No. 4. Preferably, any variant, homologue or derivative comprises at least 400 by of SEQ ID No.l or SEQ ID No. 4.
Preferably, any variant, homologue or derivative comprises at least S00 by of SEQ ID No.l or SEQ ID
No. 4. Preferably there is at least 809 sequence identity, preferably at least 85°Xo sequence identity, preferably at least 90 % sequence identity, preferably at least 95 ~
2o sequence identity, more preferably there is at least 98l sequence identity with the sequence shown as SEQ ID No. l or SEQ ID No. 4.
Preferably, the nucleotide sequence is the sequence presented as SEQ ID No.l or SEQ
ID No. 4.
As indicated, the YAC vector of the present invention comprises the nucleotide sequence presented as SEQ ID No.l or SEQ ID No. 4 or a variant, homologue or derivative thereof. Here the nucleotide sequence increases the expression efficiency of one or more NOIs within a YAC vector or a YAC.

The YAC vector may additionally comprise one or more marker genes. These genes can be chosen from suitable marker genes that are available. An example of a suitable marker gene is PGK Hyg (see Nara et al 1993 Curr Genet 23(2}: pp 134-140).
The nucleotide sequence of the present invention can be used to modify a YAC
or a YAC vector, such as pYAC 1, pYAC2, pYAC3 or pYAC4 etc.
The present invention also encompasses combinations of the above-mentioned aspects.
The following samples were deposited by the MRC Brain Metabolism Unit, Royal Edinburgh Hospital, Morningside Park, Edinburgh, EH 10 5HF in accordance with the Budapest Treaty at the recognised depositary The National Collections of Industrial and Marine Bacteria Limited (NCIMB) at 23 St. Machar Drive, Aberdeen, Scotland, United Kingdom, AB2 1RY on 24 November 1997 JM 109 pYIV 1 - deposit number NCIMB 40907 JM109 pYIV2 - deposit number NCIMB 40908 JM109 pYIV3 - deposit number NCIMB 40909 JM109 pYIV4 - deposit number NCIMB 40910 2o JM109 pYAM4 - deposit number NCIMB 40906 The present invention will now be described only by way of example, in which reference shall be made to the following Figures:
2s Figure 1 which is a diagrammatic representation of pYIVl;
Figure 2 which is a diagrammatic representation of pYIV2;
Figure 3 which is a diagrammatic representation of pYIV3;
Figure 4 which is a diagrammatic representation of pYIV4;

Figure 5 which is a photographic image;
Figure 6 which is a diagrammatic representation of pYAM4;
Figure 7 which is a picture of a gel;
Figure 8 which is a photographic image;
Figure 9 which is a photographic image;
Figure 10 which presents a nucleotide sequence;
Figure 11 which is a picture of a gel;
Figure 12 which is a PCR map of the integrated SERT 35D8/D6 YAC DNA;
Figure 13 which is a PCR map of the integrated VIPR2 HSC7E526/V 12 YAC DNA;
Figure 14 which is a photographic image;
Figure 15 which is a photographic image;
Figure 16 which is a graphical representation of ~i-Gal enzyme activity determined using a chemiluminescent reporter assay system; and Figure 17 which is a schematic diagram.
In slightly more detail:
Figure 7 shows implication of YAC DNA by pYAM4. The endogenous chromosomal DNA
from S. cerevisiae is shown in lane 3 and sizes in kb at the left. All other lanes were loaded with DNA plugs form Lys+ YAC clones and cultured in medium with galactose but lacking lysine after retrofitting with pYAM4. The migration position of YAC DNA in each clone is indicated with an arrow. Levels of amplification of the YAC DNA are based on comparison of ethidium RECTIFIED SHEET (RULE 91) WO 99IZ8449 _ PCT/GB98/03558' bromide staining of YAC DNA to that of endogeous chromosomes of similar size.
Lane 1, 350 kb, 8-fold, lane 2, 630 kb, 3-fold, lane 4, 615 kb, 3-fold, lane 5, 500 kb, 4-fold, lane 6, 200 kb, 5-fold, lane 7, 200 kb, 6-fold; lane 8, 230 kb, 2-fold; lane 9, 150 kb, 3-fold, lane 10/11/12, 230 kb, 5-fold.
Figure 10 shows the IRES sequence which is derived from Encephalomycocarditis virus. The sequence has been genetically modified at the 3' end to introduce a Hindlll restriction site.
Figure 14 shows the immunohistochemical staining of the LacZ reporter gene in the t 0 suprachiasmatic nuclei of transgenic mice expressing a YAC containing the human VPAC2R
gene. The single cell resolution obtainable with the immunohistochemical approach is worthy of note.
Figure 15 illustrates the histochemical staining of (3-galactosidase activity in transgenic mice containing the YAC HSC7E526/V 12.
Figures 15a and 15b show staining patterns for (3-galactosidase activity in a coronal slice from the brain of a transgenic mouse for whom mouse A108.2 was the father. In (a) the stained suprachiasmatic nuclei are indicated with arrowheads, in (b) an enlarged view is shown. Figure 15c shows staining in the pancreas from the same transgenic mouse (tg) and in a wild type (wt) littermate.

Figure 16 illustrates the tissue distribution of (3-galactosidase activity in transgenic mice containing the YAC HSC7E526/V 12.
~galactosidase (LacZ) activity was determined in tissue extracts from control mice and two independent lines expressing the hVPAC2R-HA-IacZ transgene. Enzyme activity was determined using a chemiluminescent reporter assay system (Galacto-Light Plus, Tropix).
ND indicates tissues in which no (3-galactosidase activity was detected.
For ease of reference, some parts of the following text has been split according to the vector of the first aspect of the present invention or according to the vector of the second aspect of the present invention.
RECTIFIED SHEET (RULE 9~

WO 99/28449 _ PCT/GB98/03558' INSERTION VECTOR
5 Construction of YAC Insertion vectors For genetic manipulation of YAC DNA, we have generated a series of modification cassettes which can be inserted into any YAC DNA:
1o pYIVi A cassette containing a lacZ reporter gene flanked by IRES and the LEU2 selective marker. The vector can be used for YACs which have been introduced into a Leu yeast strain. The details of the construction procedure were as follows:
~s A 3.5 kb cassette containing the lacZ gene and polyadenylation sequences was isolated from pMRl3-lac~PA (23) by SaII (complete) and EcoRI (partial) digestion and inserted into the EcoRI-SaII sites of pBluescript SK-, generating pSK-IacZ PA. The IRES
was introduced into pSK-IacZ PA by replacing the 1. l kb XbaI (in the polylinker)-EcoRV (in 2o the lacZ sequence) fragment with a 1.7 kb XbaI-EcoRV fragment (IRES-5'-lacZ) from pIRES-bgeo (24), resulting in pIRES-lacZ-PA. A 2.2 kb XhoI-SaII fragment containing the LEU2 gene was isolated from pDB248 (25) and inserted into the compatible SaII site in pIRES-IacZ PA in the same orientation as the IacZ gene, resulting a plasmid (pYIVl) containing the IRES-lac~PA-LEU2 cassette in pBluescript SK- (Fig. 1). Five unique 25 restriction sites flank the cassette (SacII, NotI and XbaI between the T3 primer and the IRES, SaII and XhoI sites between LEU2 gene and the T7 primer) which allow insertion of genomic DNA on both sides of the cassette.
3o pYIV2 is similar to pYIV 1 except that the LEU2 gene is replaced by the ADE2 gene so that the plasmid can be directly introduced into the conventional yeast strain (AB 1380) used for the construction of most YAC libraries. A 2.5 kb BglII fragment containing the ADE2 gene was isolated from pASZ 11, filled in and inserted into the filled in HindIII
site of pBluescript SK- in an orientation such that the T7 promoter is adjacent to the 5' end of the ADE2 gene (pSK-ADE2). The IRES-lacZ-PA cassette was released from pIRES-IacZ PA by SaII digestion, filled in and then cut with NotI. The fragment was inserted into the EcoRI (filled in) and Notl sites of pSK-ADE2, resulting a plasmid (pYIV2) containing and IRES-lacZ ADE2 cassette (Fig.4). Four unique sites (SacII, NotI, SaII and XhoI) are available for cloning.
pYN3 to For many genes, there is no antibody available to detect the encoded protein.
We introduced a haemaggluttinin (HA) epitope tag into pYIV2 so that a commercially available antibody can be used to localise the distribution of the protein product of a YAC transgene within cells. The HA tag was introduced as follows:
The translation stop colon of the human VIP2 receptor cloned in the vector pcDNA3 was converted into an XhoI site by PCR-based mutagenesis. A linker encoding the HA
epitope tag flanked by Xhol-XbaI sites 5'-TC GAG TAC CCA TAC GAT GTT CCA GAT TAC GCC TCC CTC TAG-3' 3'-ATG GGT ATG CTA CAA GGT CTA ATG CGG AGG GAG ATC AGA TC-5' was cloned into the XhoI-XbaI sites at the end of the VIPZ receptor. The VIP2 receptor-HA fragment was released from the pcDNA3 vector by BamHI and XbaI (filled-in) digestion and cloned into pBluescript SK- (in which the XhoI site was removed by filling in) at the BamHI-EcoRV sites generating pSK-VIP2R-HA.
The IRES-lacZ ADE2 cassette was isolated from pYIV2 with NotI (filled in) and Salt 3o restriction enzymes and inserted into the HindIII (filled in) and SaII
sites of pSK-VIP2R-HA, yielding a plasmid containing VIP2R-HA-IRES-IacZ ADE2. The HA-IRES-lacZ-ADE2 cassette was isolated by XhoI-SaII digestion and inserted into pGEMIIZ at the XhoI-SaII sites, resulting in pYIV3 (Fig.3). In pYIV3, the HA-IRES-lacZ-ADE2 cassette is flanked by NotI and XhoI restriction sites at the 5' side and by SaII and SfiI
sites at the 3' side, facilitating the cloning of genomic fragments of interest for YAC
manipulation.
pYIV4 pYIV4 is similar to pYIV3 except that the orientation of the ADE2 gene is opposite to 1o that in pYIV3 and two loxP elements, in same orientation, were introduced, one at the BgIII site between the IacZ and PA, and another following the ADE2 gene.
The loxP sequence from pBG was cloned into pBluescript SK- at EcoRI and SaII
sites (pSK-IoxP). The ADE2 gene was excised from pSK ADE2 by EcoRI and CIaI (filled in) digestion and cloned into pSK-loxP at the EcoRI and SmaI sites (pSK-IoxP
ADE2). The EcoRI-SaII loxP fragment from pSK-IoxP was isolated, blunt ended with Klenow and inserted into the BgIII (filled in) site between the lacZ and poly A sequences of pSK-IRES-lacZ PA generating pSK-IRES-lacZ IoxP-PA. The IRES-lacZ loxP-PA cassette was isolated by NotI and SaII (filled in) and cloned into pSK-loxP-ADE2 at the NotI and 2o BamHl (filled in) sites, yielding a construct pYIV4 (Fig.4). The pYIV4 vector permits deletion of the SV40 PA and ADE2 gene in the YAC transgenic animals using Cre recombinase so that a transgene and IacZ reporter gene can be followed by its own 3'-untranslated region.
Yeast DNA preparation Yeast DNA was isolated with the combined methods of Schedl et al. (26) and Bellis et al. (27). Clones were inoculated into 15 ml of medium (Ura-/Lys-) with 2 % of galactose instead of glucose as the carbon source. When cells had grown to late log phase after 2-4 days, plugs were taken and subjected to novozyme digestion for 4-6 hours as described by Schedl et al. (28). Then, plugs were washed in 50 mM EDTA (2 x 30 min) and digested with proteinase K (2mg/ml) in a buffer containing 0.5 M NaCI, 0.125 M
Tris pH 8.0, 0.25 M Na2EDTA, 1 ~O Lithium sulphate, and 0.5 M ~-mercaptoethanol at 55°C overnight. Plugs then were washed with TE and stored at 4°C
in 0.5 M EDTA.
Pulsed field gel electrophoresis DNA plugs were washed in TE (3 x 30min), loaded on a 1 °6 agarose gel and sealed with 1 % agarose in 0.5 x TBE buffer. Gels were run in 0.5 x TBE buffer at 6V/cm for 24 1o hours at 14°C with 60 sec. switch time. After running, gels were stained with ethidium bromide and photographed.
AMPLIFICATION VECTOR
Construction of pYAM4 pYAM4 was constructed using pYAC4, pBluescript SK- and pBG. pBG is a modification of pCGS990 in which the SaII site has been converted to a NotI
site and a PGK-Hyg-loxP cassette has been introduced between the LYS2 and TK genes in 2o pCGS990.
pBG was constructed as follows: The unique SaII site in pCGS990 was converted into NotI with the XhoI-NotI-XhoI linker 5'-TCGAGCGGCCGC-3' 3'-CGCCGGCGAGCT-5' 3o resulting in pCGS990N. A 2044 by PstI fragment containing the chloramphenicol resistance gene (cm) flanked by two loxP sites was excised from pUC91ox2cm, blunt ended with T4 DNA poiymerase and ligated to the filled-in SphI site of pHA58 which WO 99/28449 PCf/GB98/03555 contains a Hygromycin B resistance gene flanked by the mouse Pgkl (phosphoglycerate kinase 1) promoter and polyadenylation signal. The resulting plasmid (pHA581ox2cm.1) was digested with BgIII, a 3.5 kb BgIII fragment harbouring a IoxP-cm-loxP-Hyg cassette was isolated, filled in with Klenow and inserted into the EcoRI site (filled in) between the TK and LYS2 genes in pCGS990N, obtaining pCGS990N-Hyglox2cm. The chloramphenicol resistance gene was removed from pCGS990N-Hyglox2cm with purified Cre recombinase. DNA was purified, transformed into E. Coli XL-1 Blue and chloramphenicol sensitive colonies were selected, leading to the production of pBG.
to A 572 by (SmaI-CIaI) fragment between the cloning site and CEN4 in pYAC4 was cloned into SmaI-CIaI sites of pBluescript SK- vector. The fragment was excised with CIaI and NotI and inserted into the CIaI-NotI sites of pBG, resulting in pYAM3.
A 705 by XhoI-BamHI fragment of the telomere (TEL) from pYAC4 was blunt ended ~5 with Klenow and inserted into the filled in SacI-SacII sites of pBluescript SK- vector.
The orientation of the TEL in the resulting plasmid (pSK-TEL) was confirmed by sequencing with T7 and reverse primers. pSK-TEL was digested with NotI-SaII
restriction enzymes and replaced the corresponding region (pBR322-TEL-TK LoxP) in pYAM3, leading to the generation of pYAM4 (Fig. 6 ).
Transformation pYAM4 was linearised with NotI. Yeast were inoculated into 10 ml SD medium lacking uracil and tryptophan. When yeast had grown to 2 x 107 cells/ml, they were harvested and washed with 5 ml of LTE (O.1M LiOAc, lOmM Tris pH7.5, and 1 mMNa2EDTA).
After resuspension in 100 ~l of LTE, cells were incubated at 30°C for one hour with regular inversion. One ~.g of linearised pYAM4 and 5 ~,1 of carrier DNA
(salmon sperm DNA,10 mg/ml) were added to the cells and mixed. After incubation at 30°C for 30 minutes, 0.7 ml of PEG/LTE (40 k PEG 3,300 in LTE) was mixed with the cells and 3o incubated at 30°C for 30 minutes. Then cells were heat-shocked at 42°C for 5 minutes.
Cells were spun down for 2 min at 500 x g and washed twice with TE. After resuspension in 400 ~cl TE, cells were plated out on SD medium lacking uracil and lysine. Plates were kept at 30°C for 3-5 days. Single colonies were picked and plated onto dishes lacking lysine or tryptophan. Clones which could not grow on the medium lacking tryptophan were selected for further analysis.
s Yeast DNA preparation Yeast DNA was isolated with the combined methods of Schedl et al. (26) and Bellis et al. (27). Clones were inoculated into 15 ml of medium (Ura-/Lys-) with 29b of o galactose instead of glucose as the carbon source. When cells had grown to late log phase after 2-4 days, plugs were taken and subjected to novozyme digestion for hours as described by Schedl et al. (28). Then, plugs were washed in 50 mM
EDTA (2 x 30 min) and digested with proteinase K (2mg/ml) in a buffer containing 0.5 M
NaCI, 0.125 M Tris pH 8.0, 0.25 M Na2EDTA, 1 °b Lithium sulphate, and 0.5 M ~-~5 mercaptoethanol at 55°C overnight. Plugs then were washed with TE
and stored at 4°C
in 0.5 M EDTA.
Pulsed field gel electrophoresis 2o DNA plugs were washed in TE (3 x 30min), loaded on a 1 % agarose gel and sealed with 1 °~fo agarose in 0.5 x TBE buffer. Gels were run in 0.5 x TBE buffer at 6V/cm for 24 hours at 14°C with 60 sec. switch time. After running, gels were stained with ethidium bromide and photographed.

Combination of the pYlV3 and pYAM4 for YAC transgenic study The vector pYIV3 was used to introduce the haemagglutinin (HA) tag and IacZ
reporter 3o gene into two YAC clones,35D8 (SOOkb) and HSC7E526 (630kb), which contain the human serotonin transporter (SERT) and VIP2 receptor (VIPR2) genes respectively. In order to integrate the lacZ reporter gene into each of the YAC clones by homologous recombination, genomic DNA sequences (at least a few hundred bp) flanking the stop colon of each gene were introduced on either side of the HA-IRES-IacZ-Ade2 sequences of the pYIV3 vector.
Construction of the pLacZVIPR2+ vector The XhoI site in the polylinker of pBluescript SK- was removed by digesting the vector with XhoI and filling in the recessed 3' termini with Klenow fragment of E.
coli DNA
polymerise I, generating pSKX. A BamHI-XbaI fragment containing the human to cDNA with the HA tag at the C-terminus of the coding sequence (see McDonald et al 1997 Biochem Soc 25:442S) was subcloned from the pcDNA3 vector into pSKX at the EcoRV site in an orientation such that the 5' end of the cDNA was adjacent to the T3 primer in the pSKX vector, generating pSK-VIPR2-HA. A NotI-PstI fragment of pSK-VIPR2-HA containing VIPR2 cDNA sequences was then replaced with a 1.2 kb NotI-t5 PstI fragment of VIPR2 genomic DNA (PstI cuts in the last coding exon of the human VIPR2 gene), generating pVHA. The IRES-IacZ PA-Ade2 cassette was excised from pYIV2 as a SaII - NotI (blunt ended) fragment and inserted into the SaII-HindIII (blunt ended) sites of pVHA, resulting in pVHAIZA.
2o By PCR using primers 32366 (5'-CAA ACG GAG ACC TCG GTC CTC GAG CCC CAC-3') and 32496 (5'-CGG GTA CCA AAA TGG TGG GTT GTT CTG TAA-3') XhoI and KpnI restriction sites were introduced at ends of a 1.6 kb fragment of genomic DNA 3' of the stop colon of the human VIPR2 gene. The fragment was subcloned into 3o the XhoI and KpnI sites of the pSK- vector, generating p3'VIPR2.

The NotI-SaII fragment of pVHAIZA which contains VIPR2-HA-IRES-lacZ-PA-Ade2 was ligated into NotI-XhoI digested p3'VIPR2, generating a final construct, pLacZVIPR2+. For efficient homologous recombination in yeast, genomic DNA
sequences at least a few hundred by in length must flank the stop codon of the target s gene either side of the HA-IRES-IacZ-Ade2 sequences of pYIV3. In pLacZVIPR2+
there is 1.3 kb of VIPR2 genomic sequence upstream and 1.6 kb of VIPR2 genomic sequence downstream of the HA-IRES-lacZ-Ade2 cassette.
Construction of the pLacZSERT'' vector 1o The XhoI site in the polylinker of pBluescriptSK' was removed by digesting the vector with XhoI and filling in the recessed 3' termini with Klenow fragment of E.
coli DNA
polymerase, generating pSKX. A BamHI-XbaI fragment containing the human VIPR2 cDNA with the HA tag at the C-terminus of the coding sequence was subcloned from the 1 s pcDNA3 vector into pSKX at the EcoRV site, in an orientation that the 5' end of the cDNA is adjacent to the T3 primer in the pSKX vector, generating pSK-VIPR2-HA.
A
kb human genomic DNA fragment contaning intron 13 and exon 14 of the SERT gene was cloned into NotI-XhoI sites of pBluescriptSK- using PCR primers 20 32365 (5'ACT GCA TAG CGG CCG SAT CTT TCA TTT GCA TCC CC 3') and 32853 (5' TGT GCT CGA SAG CAT TCA AGC GGA TGT 3') generating pInl3. To introduce the HA tag into the C-terminus of the SERT gene product, the 5 kb SERT intron 13 sequence (NotI-XhoI fragment) was used to replace the NotI-XhoI fragment in pSK-VIPR2-HA, generating pInl3-HA. The intron 13 sequence and the HA tag were isolated as a SacII - CIaI (blunt ended) fragment and inserted into 3o SacII and (blunt ended) NotI sites of pYIV2, generating pInl3-HA-IZA. The sequences downstream of the stop codon in exon 14 of the SERT gene were isolated by PCR
of human genomic DNA using primers 32358 (5' CTC sZ~ AGG AAA AAG GCT TCT 3' ) and 32359 (5' TAB ~T,A, ~C TGT TCT CTC CTA CGC AGT TT 3' ) and cloned into the XhoI-KpnI sites of pBluescriptSK- generating p3'SERT.
Finally, the intronl3-HA-IRES-IacZ Ade2 fragment was isolated by NotI and SaII digestion of pInl3-HA-IZA and inserted into the NotI and XhoI sites of p3'SERT, resulting in to pLacZSERT+
Introduction of the Insertion Constructs into the YAC DNA
The pLacZVIPR2+ and pLacZSERT+ constructs were linearised with NotI and introduced into the YAC clones HSC7E526 and 35D8 respectively: The transformants which incorporated HA-lacZ Ade2 sequences into YAC DNA by homolgous recombination were selected by growing on plates lacking uracil, tryptophan and adenine. The integration of the HA-IRES-lacZ Ade2 sequence into the YAC DNA
was confirmed by Southern hybridization with an Ade2 probe.
Amplification of Modified YAC DNA
YAC subclones which incorporated the HA-IacZ Ade2 cassette were transformed with NotI linearised pYAM4. Recombinants were isolated on selective medium lacking uracil, adenine and lysine and replica plated on plates lacking uracil, adenine and tryptophan.
Successful replacement of the YAC left arm (containing TRPl gene) by pYAM4 would result in yeast capable of growth on medium lacking uracil, adenine and lysine but not on the counter selection medium lacking tryptophan.
3o Tryptophan sensitive clones were cultured in selective medium (Ura /Ade /Lys~ with galactose as carbon source instead of glucose. In such medium, the GAL1 promoter adjacent to the CEN4 in the pYAM4 vector will be induced. Activation of transcription from the GAL1 promoter interferes with the function of the CEN4 leading to non-segregation of the YAC DNA and a consequent increase the YAC DNA copy number per cell.
TR_ANSFOR1~FD CELLS/TR_ANSOENIC ORGANISMS
A YAC according to the present invention may be transfered into mammalian cells by appropriately adapting the teachings of Schedl et al (reference 28). By the term "adapting" we mean following the teachings but using the vectors of the present 1o invention where appropriate. It is to be understood that other techniques may be used to transfer a YAC according to the present invention in mammalian cells and these other techniques are well documented in the art (e.g. for example see WO-A-95/14769 and/or Gietz et al 1995 Yeast vol 11 No. 4, pp 355-360).
According to Schedl et al (ibis, possibly the most straight forward approach to generate transgenic cell lines is the transfer of YACs by sphaeroblast fusion (this is a technique disclosed in the previous chapter of Reference 28). This method, however, normally leads to integration of the entire yeast genome in addition to the YAC, which might obscure the results of some experiments. In contrast, direct microinjection of DNA into 2o the nucleus of a recipient cell allows purification of a YAC prior to the transfer.
Some teachings of Schedl et al (ibic~ are as follows:
Materials 1. SE: 1M Sorbitol, 20mM EDTA (pH8.0).
2. TENPA: IOmM Tn's-HCI (pH 7.5), ImM EDTA (pH8.0), 100mM NaCI, 30pM
spermine, 70~M spermidine.
3. IB: IOmM Tris-HCI (pH7.5), O.ImM EDTA (pH8.0), 100mM NaCI, 30~M
spermine, 70~M spermidine.

4. LIDS: 1 l lithium-dodecyl-sulphate, 100mM EDTA (pH8.0).
5. Zymolyase, ICN Biomedicals Inc., Costa Mesa, CA, USA.
s 6. Nusieve low melting point (LMP) agarose, FMC, Rockland, ME, USA.
7. Seaplaque low melting point (LMP) agarose, FMC, Rockland, ME, USA.
8. Automatic Injection System, Zeiss, Germany.
to 9. Femptotips, Eppendorf, 10. Insert moulds (plug formers), Pharmacia, Uppsala, Sweden.
1s 11. CHEF-DR 11, pulsed-field-gel-electrophoresis (PFGE) system, BIO-RAD
Laboratories, Richmond, CA, USA.
12. ~3-mercaptoethanol (14M stock).
20 {Note: Heavy metal ions present in buffers even in traces will lead to degradation of the YAC DNA during the agarase treatment. Make sure to use water of highest quality for the preparation of buffers.}
Methods Preparation of high density agarose plugs for preparative Pulsed Field Gel Electrophoresis (PFGE) 1. Inoculate 500 ml of of SD medium (-URA) with your yeast clone and grow the 3o culture to late log phase.

2. Prepare a solution of 1 °~ Seaplaque LMP agarose in SE buffer containing l4mM
(3-mercaptoethanol and keep at 45°C until use.
3. Spin down cells at 4000 rpm for Smin (Sorvall RT6000). and resuspend the pellet in SOmI SE. Transfer the cell suspension into a SOmI Falcon tube.
4. Seal the bottom of Pharmacia plug formers (insert moulds) with strips of tape and place them on ice.
l0 5. Wash cells twice with SE (4000 rpm, Smin.).
6. After the last washing step, discard the supernatant, and carefully remove all liquid by cleaning the inside of the tube with a paper towel. The cell pellet should be about 1 to 1. Sml.
7. Add 200 pl of SE buffer. With a cut off tip try to resuspend the pellet.
The suspension will be very thick and difficult to pipet.
8. Transfer O.SmI aliquots of the cell suspension into 2m1 Eppendorf tubes and keep 2o at 37°C.
9. Just before use dissolve lOmg Zymolyase in 2.Sml of the LMP agarose solution.
{Note: Zymolyase does not completely dissolve at this concentration. Weigh in the required amount and work with a protein suspension. }
10. Transfer O.SmI of this solution to the yeast cell suspension and mix thoroughly the agarose with the cells by pipetting up and down using a blue cut off tip.
{Note: Only a completely homogenous mixture will yield in high quality plugs with even distribution of DNA. }

Keep the solution at 45°C at all times to avoid setting of the agarose.
11. Using a cut off yellow tip pipet 80p1 aliquots of the mixture into plug formers kept on ice. Leave for 10 min to allow the agarose to set.
12. Transfer the plugs into SE buffer containing l4mM ~i-mercaptoethanol and lmg/ml Zymolyase. Incubate at 37°C for 4 to 6h.
13. Replace the buffer with LIDS buffer using at least O.Smllplug and incubate at to 37°C with gentle rocking. After 1 h refresh the LIDS buffer and continue incubation overnight.
14. Wash plugs extensively in TE pH8.0 until no more bubbles can be seen.
Store plugs in O.SM EDTA at 4°C until use.
{Note: DNA plugs prepared this way can be stored without degradation for at least one year.
Isolation of intact YAC DNA for microinjection 1. Cast a gel using 0.25xTAE, 1 % agarose using a comb of which you have sealed several teeth of the comb with tape to obtain a preparative lane of approximately Scm.
{Note: To ensure straight bands it is recommended to run the preparative lane in the center of the gel. Bands of preparative lanes bigger than 5cm, may show "smiling"
effects, which leads to imprecise excision of the DNA and, hence, a lower yield/ final concentration. }
If the DNA will be concentrated by a second gel run standard agarose can be used.
3o Otherwise use an LMP agarose.

2. Wash the high density plugs for 4x15min in TE pH8 with gentle shaking on a rocking platform.
3. Load the plugs next to one another into the preparative lane.
{Note: Best results are achieved using rectangular plugs (such as produced in Pharmacia plug formers), which can be loaded next to one another without intervening spaces. Use 90m1 of the 1 % gel for a small BioRad casting chamber (l4cm x 12.7cm). The plugs should occupy the entire height of the gel. Therefore, when casting the gel, make sure to that the comb is touching the bottom of the casting chamber. Make sure that the casting chamber as well as the PFGE-chamber are absolutely leveled to avoid any loss of DNA
during the gel run. }
Then seal the slot with 1 % LMP agarose (0.25xTAE).
4. Run the PFGE in a cooled buffer (O.ZSxTAE) using conditions optimized to separate the YAC from the endogenous chromosomes.
{Note: Best separation results from endogenous chromosomes are achieved using a 2o single pulse time instead of a time ramp for the entire run. It is worth while to test out several conditions before starting the isolation procedure}.
5. After the gel run cut off marker lanes on either side including about 0.5cm of the preparative lane and stain them in 0.25xTAE buffer containing O.S~g/ml ethidium bromide. Mark the position of the YAC band under UV light using a sterile scalpel blade.
6. Reassemble the gel and excise the part of the preparative lane coresponding to the YAC-DNA. Cut also slices above and below the YAC DNA to serve as marker lanes 3o for the second gel run.

7. Position the gel slices on a minigel tray with the YAC slice in the middle and cast a 4 ~O LMP agarose (Nusieve, FMC) gel 0.25xTAE around them.
8. Run the gel at a 90° angle to the PFGE run for approximately 6-8h at 4V/cm in 0.25xTAE (circulating buffer). The running time depends on the size of the gel slice as well as on the agarose used for the PFGE run.
9. Cut off and stain the two marker lanes to localize the DNA.
o {Note: If the DNA has not yet completely run into the Nusieve LMP gel continue the electrophoresis. Since it is impossible to digest normal agarose with the enzyme agarase, it is important to excise only LMP material. }
10. Excise the concentrated DNA from the corresponding position of the YAC DNA
is lane.
11. Equilibrate the gel slice on a rocking platform in 20m1 of TENPA buffer for at least l.Sh.
20 12. Transfer the gel slice into a l.Sml Eppendorf tube and remove all additional buffer using a fine tipped pipette.
13. Melt the agarose for 3min at 68°C, centrifuge for lOs to bring down all of the molten agarose and incubate for an additional Smin at 68°C.
14. Transfer the tube to 42°C for Smin. Add 2U of agarase (New Englands BioLabs) per 0.1 ml of molten gel slice.
{Note: Do not add agarase directly from the -20°C freezer, which can lead to setting of 3o part of the LMP agarose. Load the enzyme into the tip and allow to warm up for a few secoonds by placing into the molten agarose. Carefully release the enzyme while stiring slowly with the tip. Mixing can be achieved by releasing air bubbles into the solution}.

Incubate for further 3h at 42°C.
15. Dialyse the resulting DNA solution for 2h on a floating dialysis membrane (Millipore, pore size O.OSpm) against microinjection buffer (lOmM Tris:HCI, pH7.5, 5 O.ImM EDTA, 100mM NaCI, 30pM spermine, 70p,M spermidine).
16. To determine the DNA concentration, check 2p1 on a thin 0. 8 Rb agarose gel with very small slots, using ~, DNA of known concentration as a standard.
to {Note: It is useful to prepare a 2ng/pl stock solution of DNA. Loading of 2, 5, 10 and 20ng of this standard should allow a relatively accurate determination of the YAC DNA
concentration}
17. The integrity of the DNA can be checked running 20p.1 of the preparation on a 15 PFGE gel (use a comb with small slots).
Iq~ection into cultured cells The Zeiss Automatic Injection System (AIS) can be used for rapid injection of large 2o numbers of cells growing on cell culture dishes. A digital camera attached to a microsope transmits an image to the computer screen. An interactive computer program is then used to position the pipette above a "reference cell" and to mark the tip of the needle on the screen. This position is stored by the computer and serves as a reference point for the rest of the injections. Nuclei of other cells visible on the screen can now be 25 marked by clicking on them with a computer mouse and injections are performed automatically by the computer. The amount of DNA injected can be regulated by the injection time as well as the pressure set at the Eppendorf injection system.
High pressures result in higher efflux of the DNA containing solution. The pressure to be set depends on the viscosity of the DNA solution and the size of the needle opening and, 3o therefore, has to be adjusted individually in each experiment. The pressure in a standard experiment will vary between 20 and 150 hectopascal. Almost confluent dishes are best to inject. A too low cell density allows only a few cells to be injected per frame, whereas cells on confluent plates do not grow in one plane making it impossible to inject all cells into the nuclei. The efficiency of microinjection will depend greatly on the cell type. Best results are achieved using cells with big and easily visible nuclei.
1. Grow cells on a Scm dish to 80 % confluency in the medium required by the cell type.
2. Immediately before injection cover the cells with Sml of fresh medium and top layer the dish with Sml of liquid paraffin. Liquid paraffin is preferably used to prevent ~o contamination of the cells as well as evaporation of the medium during injections.
3: Switch on computer, microscope, monitor, Eppendorf microinjector and pump and place the culture dish on the stage.
~5 4. Choose the command STAGE from the main menue to select a region of the dish which is almost confluent but in which the cells are still growing in one plane. The stage can be moved by clicking (always use the top/yellow button) onto the crossed double arrows. The direction of the arrow indicates the direction in which the stage will move. The distance from the center of the cross determines the speed with which the 2o stage moves.
5. Return to the main menu and select MARK/INJECT. A new menu will appear which allows to choose from the following options:
25 STORE DATA: Allows to generate a file in which the positions of the injected cells will be stored. To use this option the bottom of the dish has to be marked to give the machine left and right hand references (scratch crosses at either side). Find the marks after the plate has been place on the stage and click cursor on the appropriate box to record the references. If you generate a file you must enter an operator and a sample 30 name.

WO 99/28449 . PCT/GB98/03558 APPEND: Allows you to go back to a previous file to find the cells which have been microinjected.
NO FILE: This option does not record the cells that are injected and is sufficient for most applications.
6. Select the number of frames you want to inject by filling in numbers lower than for X and Y values. A frame is the window visible on the screen and, therefore, represents the field in which cells can be marked and injected at a time. Each frame has to specific X and Y coordinates. The computer moves along the x-axis first. An array of 5 x 10 frames will allow you to inject more than 1000 cells depending on the confluency of the plate.
7. Click on DATA OK.
8. Load l.Sp,1 of DNA solution into an Eppendorf microloader and insert it into an Eppendorf Femptotip placing it at the very bottom of the tip. Slowly release the DNA
solution trying to avoid the introduction of air bubbles, which can block the needle.
9. Twist the tip carefully to remove it from its cover and load the needle by screwing it into the injection needle holder at the microscope.
10. Choose the option adjust from the menu. Use the mouse to lower the needle by clicking onto the arrow in the center of the screen. The distance from the center determines the speed of the movement. Start with high speed and slow down when you approach the surface of the dish. Once the needle touches the medium find it in low power magnification and use the micrometer screws on the pipette holder to center the needle in the frame. Change the lens to higher magnification. Focus on a plane intermediate between the cells and the needle and bring the needle down into focus.
3o Repeat this procedure until the tip of the needle is pressing down on a cell. This will result in a small halo surrounding the needle tip as you press down on the cell.

11. The following options are available to adjust the position of the needle STEP DOWN: Lowers the needle in the smallest possible increment.
s MARK TIP: Allows to set the reference point for the computer software. To adjust click on the very tip of the injection needle.
INJECTION TIME: Determines the time the needle remains within the cell and is, therefore, one parameter for the volume delivered to the nucleus. This time has to be 1o varied depending on the pressure, tip size etc. A time of 0.2s is a good value to start with.
MOVE STAGE: Allows to move the stage directed with the mouse.
15 RESTART: Takes you back to the main menu and you can reset any of the parameters.
HOME: Takes the needle back to the original position.
POSITION OK: Click on this when you are ready to start injecting.
12. To perform the injections click on MARK NEXT. This will allow to direct the computer to the nuclei of cells to be injected. Click on MARK and subsequently onto the nuclei. To start the injections click on INJECT. The computer will perform the injections into the marked cells. Successfully injected cells can be identified by a temporary dramatic swelling of the nucleus. If no change of cells can be observed after a number of injections check the following possibilities:
The injection needle is blocked: Use the high pressure button (P3) at the injection machine to release DNA. If this does not help the needle has to be replaced.
~ The computer is injecting in the wrong plane: Stop the injections by pressing the yellow button and try lowering or lifting the needle in single step increments. Be careful not to break the needle on the surface of the dish by lowering it too much.

Too low pressure: Increase the pressure for P1. Be aware that too high pressure will result in bursting of the cells.
Press the mouse button at any time during irjections to adjust the needle height or remark the tip of the needle to inject the whole frame again press RESTART.
Alternatively you can carry on with CONTINUE.
13. To finish the injections press RESTART, MARKJINJECT, HOME, EXIT.
1o Pronuclear injections into fertilised mouse oocytes The procedure of generating transgenic mice includes isolation of fertilized oocytes from superovulated females, microinjection of DNA into pronuclei and the transfer of injected oocytes into pseudopregnant foster mothers. A detailed description of these steps can be t5 found in for example Hogan, Murphy and Carter (1993 Transgenesis in the mouse in "Transgenesis Techniques", Methods in Molecular Biology vol. 18 Ed. Murphy and Carter, pp 109-176. Humana Press, Totowa, New Jersey) and reference 28 (subsequent chapter) - the contents of each of which are incorporated herein by reference).
2o Preparation of DNA constructs for injection normally involves a filtration step in which the DNA is passed through a membrane with 0.2pm pore size. This step is recommended to avoid blocking of the injection needle by ~ dust particles in the DNA
solution. YAC DNA preparations should not be subjected to filtration, because of shearing forces occuring during this step. We have found that blockage of the needle is 25 a relatively infrequent event if the agarose digestion was successful. In some cases it might be preferable to centrifuge the DNA for 5min (12000rpm Eppendorf centrifuge) to remove undigested gel pieces. However, since small particles of agarose can trap DNA
we would strongly recommend to determine the DNA concentration after the centrifugation step.
Some DNA preparations are very sticky, which is probably due to incomplete agarose digestion. In these cases a higher proportion of injected oocytes will be found to lyse and the injection needle has to be exchanged more frequently. Prepare a new batch of DNA for the next injection day and take care to digest all agarose. Even more than with normal constructs, try to avoid touching the pronuclei during injections. Once touched they will stick to the needle and being pulled out. If that happens replace the 5 microinjection pipet immediately. The percentage of lysed oocytes should not be markedly higher, when compared with normal constructs. Injected oocytes can be either transfered on the same day to the oviduct of pseudopregnant foster mothers or incubated overnight at 37°C in M16 buffer. Normal survival rates (20 to 30°x) of transfered embryos even at DNA concentrations as high as lOng/p.l should be obtained.
Transgenic animals can be identified by PCR or Southern blot analysis with DNA
isolated from tail tips. With 250kb constructs about 10 to 20% of the offspring should have YAC DNA incorporated. Once a transgenic line has been established it is important to confirm the integrity of the integrated construct. This can be achieved by 15 conventional PFGE mapping with several probes scattered over the YAC, which, however, requires a detailed knowledge of the restriction map of the construct.
Alternatively, the RecA approach can be used to release the entire YAC from the mouse genome.
20 ~$~~
INSERTION VECTOR
General 2s The analysis in transgenic animals of genes expressed in YACs can be greatly facilitated by the use of a reporter gene for the accurate and sensitive detection of cellular sites of transcription. We have constructed a series of YAC modification vectors (pYIVi, pYIV2, pYIV3 and pYIV4) which can be inserted into YACs after the translation initiation or stop colon. The common feature of all of these vectors is that they contain 3o a lacZ reporter gene downstream of a viral internal ribosome entry site (IRES), together with selective markers. In transgenic animals expressing these constructs, the IacZ
reporter gene will be expressed in the same pattern as the transgene so that the expression, regulation and function of the transgene can be analysed using simple histochemical staining procedures. This approach may provide a more complete picture of the pattern of expression of the transgene than standard procedures such as in situ hybridisation. The pYIV 1 vector can be used for YACs which have been introduced into a Leu- yeast strain, while pYIV2, pYIV3, and pYIV4 can be directly introduced into the yeast strain (AB1380) which was used for construction of most YAC
libraries.
One of the vectors (pYIV3) permits the HA epitope tag sequence (from influenza hemagglutinin) to be fused to the carboxyl terminus of the expression product of the gene of interest, so that the protein product of the transgene can be detected using the to commercially available 12CA5 monoclonal antibody. pYIV4 contains loxP
elements flanking the SV40 polyadenylation signal and the ADE2 gene. In transgenic animals generated using pYIV4, the polyA sequence and the ADE2 gene sequences can be deleted using Cre recombinase so that the transgene and lacZ reporter gene are flanked by the authentic 3'-untranslated region of the transgene. A comparison between animals is containing the SV40 polyadenylation signal and the ADE2 gene with those in which these sequences have been removed will reveal the function of the 3' sequence of the transgene.
Expression of the IRES-lacZ from pYlVl in YAC transgenic mice We have examined the expression of the lacZ reporter gene in transgenic mice expressing a YAC clone modified using the pYIV 1 insertion vector. Insulin-like growth factor II (IGF2) cDNA was introduced 3' of the Wilm's tumor (wtl) gene promoter (isolated from a 480 kb human YAC clone). Then the promoter and cDNA were 2s inserted at the NotI-XbaI sites 5' of the IRES-lacZ LEU2 cassette in the pYIVl vector.
The first intron of the wtl gene was cloned 3' of the LEU2 gene. The construct was introduced to the 480 kb YAC by homologous recombination. After amplification, the modified YAC DNA was isolated and micro-injected into fertilised eggs. Eight lines of transgenic mice were produced, 5 of which expressed the lacZ reporter gene.
All 3o expressing lines produced an X-Gal (it is understood that the terms X-Gal, ~-Gal and LacZ are synonymous) staining pattern (Fig.S) identical to that of the human gene from which the promoter was derived. These data demonstrated that the IRES-IacZ
reporter gene is functional in the YAC insertion vectors.
AMPLIFICATION VECTOR
The improved homologous recombination efjlciency of pYAM4 To assess the homologous recombination efficiency of pYAM4, the plasmid was linearised with NotI and introduced into a variety of YAC clones from the ICI, ICRF and to chromosome-7-specific YAC libraries. Recombinants were isolated on selective medium lacking uracil and lysine and replica plated on plates lacking uracil and tryptophan.
Successful replacement of the left arm (containing TRPl gene) by pYAM4 would result in yeast capable of growth on medium lacking uracil and lysine but not on the counter selection medium lacking tryptophan.
Of a total of 1266 Lys + clones analysed, 167 clones could not grow on medium lacking tryptophan (Table 1). That is, the homologous recombination leading to the loss of the TRP1 gene occurred in 167 clones. The retrofitting efficiency of pYAM4 overall is 13.3% which is much higher than pCGS990 and pCGS966 (0.5-2.5°x) (11, 12).
Table I. Retrofitting efficiency of pYAM4 in a variety of YAC clones from different YAC libraries YAC clone Insert Size Ura-/Lys- Ura-/Trp- (not growing) ICI YAC Clones 1 (16FC9) 51 4 2. (27FE5) 320 55 3 3. (30FH70 350 105 33 4. (3HG4) 300 46 2 5. (36AH3) 300 77 16 6. ( 12GG6) 300 141 31 Subtotal 475 89 ( 18 .7 k ) ICRF YAC clones 1. (49A9) 340 37 3 2. (35D8) 500 103 8 3. (132C6) 630 133 19 Subtotal 274 30 ( 10.9 ~ ) Chromosomal YAC clones HSC7E526 550 107 8 (7.5 ~) E145A7 200 129 11 (8.59b) ywss922 350 57 8 ywss 1545 420 59 8 ~ 5 ywss2056 400 15 2 ywss3844 300 151 11 Subtotal 282 29 ( 10. 3 rb ) 2o Total 1266 167 ( 13 .3 9b ) The increased efficiency of retrofitting is probably due to the introduction of a 572 by CIaI-SmaI fragment from pYAC4 adjacent to the CEN4. When the SmaI-CIaI
fragment of pYAM4 was deleted by NotI-CIaI digestion, or pYAM4 was linearised with CIaI, the 25 frequency of tryptophan sensitive clones was not significantly different from that obtained with pCGS990.
Amplification of YAC DNA by pYAM4 3o Tryptophan sensitive clones were cultured in selective medium (Ura-/Lys-) with galactose as carbon source instead of glucose. In such medium, the GAL1 promoter adjacent to the CEN4 in the pYAM4 vector will be induced. Activation of transcription from the GAL1 promoter should interfere with the CEN4 leading to non-segregation of the YAC DNA therefore increase the YAC DNA copy number per cell.
As shown in Fig 7, depending on the size and nature of the insert, human YAC
DNA
was amplified 3 to 5 fold. Although the amplification is not as high as that achieved with pCGS990, it helps to isolate more concentrated YAC DNA for transgenics.

Introduction of an additional conditional promoter such as ADH2 adjacent to the CEN4, or of an additional selection gene, might improve the amplification further.
We have introduced the bacterial hygromycin B resistance gene under the control of the mouse Pgkl promoter into pYAM4. After retrofitting with pYAM4, isolated YAC
DNA can be introduced into mammalian cells such as embryonic stem (ES) cells, which is an alternative approach to microinjection of YAC DNA for making YAC
transgenic animals (29).
1o If a genomic fragment (which is present in a YAC) is cloned into the CIaI-NotI site of pYAM4, the truncation of a large YAC and amplification of the shortened YAC
DNA
can be achieved in a single step.
COMBINATION OF INSERTION VECTOR AND AMPLIFICATION VECTOR
The results are presented in Figures 8 and 9. In this regard, Figures 8 and 9 are photographs of gels.
The amplification of the YAC DNA can be seen from Fig 8 and 9. In this regard:
Lane 1 is un-amplified YAC DNA as present in original 35D8 YAC clone, lane 2 is un-amplified YAC DNA in another YAC clone (132C6) containing the SERT gene, and lane 3 is amplified YAC DNA in 35D8/D6 subclone. The blot was hybridized with genomic probes downstream (Fig.B) and upstream (Fig.9) of the SERT gene.
AMPLIFICATION AND PURIFICATION OF YAC DNA
The integration of the amplification vector pYAM4 into YAC clones 35D8 and HSC7E526 greatly increased the yields of YAC DNA obtained. These results are presented in Figure 11. In this regard, Figure 11 is a photograph of a gel prepared by a 3o Southern blot and hybridised with a 32P-labelled pBR322 probe to detect YAC
sequences. In each lane, the hybridising band corresponding to YAC DNA is arrowed Lane 1 is DNA from yeast containing YAC clone 35D8; Lane 2 is DNA from yeast containing YAC clone 35D8/D6, in which the YAC has been modified by integration of the amplification vector pYAM4 and the insertion vector pYIV3; Lane 3 is the isolated YAC DNA from clone 35D8/D6 prior to microinjection. Lane 4 is DNA from yeast s containing YAC clone HSC7E526/V 12, in which the YAC HSC7E526 has been modified by integration of the amplification vector pYAM4 and the insertion vector pYIV3. Lane 5 is the isolated YAC DNA from clone HSC7E526/V 12 prior to microinjection.
i o GENERATION OF YAC TRANSGENIC MICE
Modified YAC DNA was excised from a 1 % pulse-field agarose gel in 0.25 x TAE
buffer and concentrated into 4 % low melting point agarose. The gel slice containing YAC DNA was equilibrated with microinjection buffer (TE pH 7.0 with 0.1 M
NaCI) t s and digested with gelase. YAC DNA was dialysed against the microinjection buffer for 2 hours before injection into fertilised oocytes.
Two hundred and ninety-eight fertilised oocytes were injected with 35D8/D6 YAC
DNA
and 364 with HSC7E526/V 12. After transfer of injected oocytes into oviducts of 2o pseudopregnant female mice, a total of 190 mice (28.7 % ) were born of which 26 (13.70 carried YAC DNA as determined by PCR as shown below:
Table II. Survival rate of trausfered oocytes and YAC transgenic mice YAC ConstructSize (kb)NEIT Born Died Transgenic Total 662 190 7 26 (28.70 (13.7X0 2s N.E.LT: Number of oocytes injected and transferred WO 99/28449 _ PCT/GB98/03558-PCR determination of the size of the integrated construct The size of the integrated YAC 35D8/D6 and YAC HSC7E526/V I2 constructs in each transgenic founder animal were determined using two pairs of PCR primers (A
and H:
s Table III) to detect the two YAC vector arms and a series of PCR primer pairs spanning the SERT (B to G: Table III) and VIPR2 (I to L: Table III) genes respectively.
Table III. Primer Pairs Used For PCR
PrimerForward Primers (5' - Reverse Primers (5' -Pair 3') 3') I 53525 CCACATACAGACTGATGAATC53526 AGCTGGAATTGGAACTCAGC.

SUBSTITUTE SHEET (RULE 26) WO 99/28449 _ PCT/GB98/03558-The results are presented in Figures 12 and 13. In this regard, Figure 12 shows the size of the integrated YAC DNA in transgenic founder animals carrying 35D8/D6 YAC
DNA. Figure 13 shows the size of integrated YAC DNA in transgenic founder animals carrying HSC7E526/V 12 YAC DNA. For each founder animal, the probable extent of s the transgene is indicated as a shaded bar, with pale circles indicating presence of markers, as determined by PCR. The location of these markers is indicated in the schematic diagram of the 35D8/D6 YAC construct (Figure 12) and HSC7E526/V 12 YAC (Figure 13) construct which are drawn above the markers.
1o Three independent transgenic founder mice carrying the intact YAC 35D8/D6 (A102.3, A102.5, A105, Figure 12) and six carrying the intact YAC HSC7E526/V12 (A108, A108.1, A108.2, A108.3, A108.5, A110: Figure 13) were identified. Thus, a beneficial number of mice born in this study carried intact YAC DNA.
1 s GERM LINE TRANSMISSION
An important feature of pYAM4 is that it does not necessarily have to contain a thymidine kinase (TK) gene which may cause male infertility. In the absence of the TK
gene, we found that YAC transgenes were transmitted into the next generation from both 2o male and female founders as determined by primer pair A, which is derived from the hygromycin resistance gene within pYAM4. Thus, preferably, the TK gene is not present in the vector of the present invention.
Immunocytochemistry for beta -galactosidase Animals were perfused transcardially with 4% paraformaldehyde in O.1M PBS.
Brains were postfixed overnight in the same solution, then transferred into PBS next day and kept in that solution until cutting. Brains were infiltrated with 30% sucrose overnight, then 25p,m thick sections were cut on a cryostat. Sections were collected in multiwell plates 3o containing PBS and then processed for immunocytochemistry. Sections were treated with 0.1% Triton X-100 and 0.02% H202 solution for 30 min, then rinsed two times for 5 min with PBS. This was followed by a blocking step with 2% solution of normal donkey serum, for another half an hour. Sections were incubated in anti beta-galactosidase primary antibody (5'Prime3'Prime, Inc., diluted at 1:20000) for 48 hours. Biotinylated donkey anti rabbit IgG (from Jackson, diluted at 1:1000, for 60 min.), ABC Elite Kit (from Vector, diluted at 1:1000, for 60 min.) and NiDAB as chromogen were used to visualise the immunoreactive areas.
LacZ staining of adult transgenic mice expressing the YAC construct Mice were anaesthetised with a lethal dose of sodium pentobarbitone and briefly perfused through the heart with 0.9 °~ sodium chloride solution to remove blood followed by a longer perfusion of the ice-cold fixative solution (4% paraformaldehyde in O.1M
sodium phospahate buffer, pH 7.4). After perfusion with approximately 150-200 ml of the fixative solution, the brains and internal organs were removed rapidly and postfixed in the same fixative for 2-4 hours at 4°C. Subsequently 2-5 mm coronal slices of the brain were cut and the brain and other organs were washed twice at room temperature in a detergent wash solution consisting of 2 mM Magnesium Chloride, O.OI k Sodium Deoxycholate, and 0.02 % NP40 in phosphate-buffered saline (PBS); pH 7.4.
After washing all tisues were transferred to a solution containing lmg/ml X-Gal in SmM
2o potassium ferrocyanide, SmM potassium ferricyanide, 2mM Magnesium chloride, 0.019 Sodium deoxycholate, and 0.02 % NP40 in PBS, pH 7.4 and incubated overnight at 30°C. After staining, tissues were washed in PBS and cleared in 40% and 80 k glycerol (v/v) in PBS and photographed.
2s The distribution of (3-galactosidase activity in transgenic mice was consistent with the published distribution of VIPR2 mRNA (Cagampang et al., 1998; Inagaki et al., 1994;
Sheward et al., 1995; Usdin et al., 1994) and of binding sites for the selective VIP2 receptor agonist Ro25-1553(Vertongen et al., 1997). In particular, high levels of expression of ~i-galactosidase were detected:
(i) In the suprachiasmatic nucleus {Figure 15a, 15b), where VIP and/or PACAP, acting through the VIP2 receptor, may play a role in the control of circadian rhythms.
There is circadian variation of VIP immunoreactivity (Takahashi et al., 1989), prepro VIP mRNA (Albers et al., 1990; Glazer and Gozes, 1994; Gozes et al., 1989) and of VIP2 receptor mItNA (Cagampang et al., 1998) in the SCN and VIP (Piggies er al., s 1995), VIP antagonists (Gozes et al., 1995) and VIP antisense oligodeoxynucleotides (Scarbrough et al., 1996) have been shown to disrupt circadian function.
(ii) In the pancreas (Figure Sc), where VIP and PACAP stimulate insulin release by interaction with the VIP2 receptor on the beta cell (Straub and Sharp, 1996).
Chemiluminescent assay for ~i-galactosidase in mouse tissues using the Tropix Galacto-Light Plus kit.
Tissues from mice were dissected, frozen on dry ice and stored at -70oC. They were t5 thawed and homogenised immediately in 100-400,1 of cold lysis buffer (as supplied in the kit, with 0.2mM PMSF and S~,g/ml leupeptin added just before use). After homogenisation, samples were centrifuged at 12000g for 10 min at 4°C.
An aliquot of the supernatant was stored at -70°C for measurement of protein concentration and the rest was incubated at 48°C for 60 minutes to inactivate the endogenous (3-galactosidase.
2o After centrifugation for 5 min at room temperature 201 of each sample were used in the assay. 200~c1 of Galacto-Light reaction buffer was added, inbubated for 60 min at room temperature and then 300~c1 of Accelerator was added and the sample counted in a TD
20/20 luminometer (for 20 sec after 5 sec delay). Protein concentrations were determined using the Bio- Rad assay and activity was expressed as light units/min/mg of 2s protein.

WO 99/28449 PC'f/GB98/03558-INSERTION VECTOR
5 Almost all YAC transgenic animals described to date have been made with unmodified YAC DNA.
Expression of the transgenes in these animals can only be assessed by in situ hybridisation, Northern blotting, PCR and/or immunohistochemistry.
Introduction of a reporter gene into the YAC DNA would simplify procedures for the detection of transgene expression.
We have constructed a series of YAC modification vectors (pYIVI, pYIV2, pYIV3 and pYIV4) which can be inserted into YACs after the translation initiation or stop codon.
t 5 The vectors contain a lacZ reporter gene downstream of a viral internal ribosome entry site (IRES), so that a simple histochemical staining procedure can be used to examine the tissue distribution and regulation of the transgene. This approach provides a more complete picture of the pattern of expression of the transgene than standard procedures such as in situ hybridisation. One of the vectors (pYIV3 ) permits the HA
epitope tag 2o sequence (from influenza hemagglutinin) to be fused to the carboxyl terminus of the gene product of interest, so that the protein product of the transgene can be detected using the commercially available 12CA5 monoclonal antibody. pYIV4 contains IoxP elements flanking the SV40 polyadenylation signal and the ADE2 gene. In transgenic animals generated using pYIV4, polyA and ADE2 sequences can be deleted using Cre 2s recombinase so that the transgene and IacZ reporter gene are flanked by the authentic 3'-untranslated region of the transgene.
In summation therefore, transgenic technology has played an important role in the understanding of gene function and regulation in vivo, and in creating animal models of 3o human genetic diseases. The development of yeast artiftcial chromosome (YAC) technology has permitted the cloning of DNA segments thousands of kilobases in size between two YAC vector arms, facilitating transfer of a whole gene and most (if not all) of the elements required for its faithful regulation into transgenic animals.
The analysis in transgenic animals of genes expressed in YACs can be greatly facilitated by the use of a reporter gene in accordance with the present invention for the accurate and sensitive detection of cellular sites of transcription.
AMPLIFICATION VECTOR
to Importance of YAC technology and YAC transgenesis The development of the yeast artificial chromosome (YAC) technology has permitted the cloning of DNA segments thousands of kilobases in size between two YAC vector arms.
YACs can be used to clone the complete sequences of large genes or gene complexes that exceed the size limit for cloning in conventional bacterial cloning vectors such as plasmids (10 kb), bacteriophage (15 kb), and cosmids (50 kb). Cloning of such large DNA fragments is essential for physical genome mapping (1) and to isolate large genes relevant to human genetic disease (2, 3). Although bacterial artificial chromosome (BAC) (4) and P1 artificial chromosome vectors (5) have a large cloning capacity (up to 200 kb), it is relatively difficult to perform genetic manipulation in these vectors. The high efficiency of homologous recombination in yeast permits genetic manipulations of genes cloned in YAC vectors to be performed easily.
Transgenic technology has played an important role in the understanding of gene function and regulation in vivo, and in creating animal models of human genetic diseases.
It is well recognised that transgenes containing genomic DNA with introns and essential regulatory sequences are expressed more appropriately in vivo than cDNA based constructs (6-10). The use of YAC constructs to produce transgenic animals facilitates the presence and transfer of most (if not all) elements required for the faithful regulation of a gene and may avoid position effects related to the integration site, which may lead to low levels and, in some cases, aberrant patterns of gene expression in transgenic WO 99/28449 PCT/GB98/03558' animals. However, the efficiency with which transgenic animals are produced using YAC DNA ( 1-5 % ) is lower than that using conventional vectors (approx. 10 qb ) Importance of YAC amplification YAC vectors (for example pYAC4) contain a yeast centromere, two telomeres, and two selective markers (TRPI and URA3). After incorporation of YAC DNA, yeast can grow in medium lacking the uracil and tryptophan. Under these conditions of selection, YAC
clones are replicated along with the endogenous host chromosomes; only one copy of to YAC DNA is produced per cell. Using standard protocols, YAC DNA at a concentration of 1 ~,g/ml can be isolated. However, there is a substantial increase in copy number if the YAC centromere is inactivated by induced transcription from a GALL
or ADH2 promoter. This increase is thought to reflect the segregation bias of the YAC
for the mother cells and loss of the daughter cells without the YAC from the population under selection.
The low e~ciency with which transgenic animals are produced using YAC DNA (1-5°6) compared to DNA from conventional vectors (approx. 10°k) is probably caused by the low concentration of YAC DNA available for injection. Also, conventional YACs are 2o replicated in yeast at one copy per cell.
Therefore, assuming that 2 pl of S00 kb YAC at a concentration of 1 nghl is injected into a pronucleus, a fertilised egg would only receive 1 molecule of YAC DNA.
Amplification of YACs in yeast therefore provides a possible method for the isolation of 2s more concentrated YAC DNA which should lead to more successful generation of YAC
transgenic animals.
Advantages and disadvantages of the existing YAC amplification vectors pCGS966 and pCGS990 To date two vectors which can be used to amplify YAC DNA have been reported:
pCGS966 (11) and pCGS990 (12). Both vectors include a conditional centromere and a heterologous (herpes simplex virus) thymidine kinase (TK) gene. YAC DNA of less than 600 kb is amplified efficiently (3 to 11 copies/cell). pCGS966 has been used recently to construct a number of new YAC libraries (13-15). However, when using this vector for the modification (retrofitting) of existing YACs, replacement of the left arm occurs with s very low frequency (0.5-2.5q6) (12). Most importantly, the expression of the TK gene in the testes of transgenic mice interferes with spermatogenesis and causes male infertility (16-22). This complication makes these vectors unsuitable for transgenic studies.
Features of the novel YAC amplification vector pYAM4.
We have constructed a YAC amplification vector which has a number of advantages:
1) it amplifies YAC DNA 3 to 5 fold.
~ 5 2) unlike existing vectors, it does not contain the herpes simplex virus thymidine kinase (TK) gene, which causes male infertility in transgenic mice.
3) it has much higher homologous recombination efficiency ( 13 °~ ) than existing YAC amplification vectors.
4) it contains a selectable marker (hygromycin B resistance) which facilitates the transfer of YAC DNA into embryonic stem cells and other cell lines.
5) it can be used for targeted deletion of sequences cloned in YAC vectors.
6) Fusion of a NOI (such as the SERT gene) to a reporter gene (such as Lack facilitates the determination of the sites/regions where the NOI is expressed and the testing of agents which may affect the expression pattern of the NOI.
">) Transgenic mice overexpressing the human VIPR2 gene together with the ~-galactosidase reporter gene will facilitate the development of agents capable of influencing the activity of the VIP2 receptor in man. Two classes of agent might be identified: (i) agents regulating the expression of the human VIP2 receptor, which could be identified by their ability to influence ji-galactosidase activity in transgenic mice and (ii) agonists and antagonists of the human VIP2 receptor, for which the transgenic mice in which the human VIPR2 gene is expressed will provide an animal model.
Optimally, s YAC transgenic animals, such as VIP2 receptor null ("knock out") mice, could be bred with a view to generating "humanised" animals in which the VIP2 receptor displays identical pharmacology to that seen in man.
By way of example, agents, acting in the suprachiasmatic nucleus, which are capable of influencing the activity of the VIP2 receptor, may prove useful in the treatment of the disturbances in circadian function. Such disturbances, which may lead to impaired physical and mental well-being, can occur through: (i) extremes in work patterns (shift work); (ii) travelling through many time zones (jet lag); (iii) in normal ageing; and (iv) in dementia. Such agents may also prove useful in the treatment of sleep disorders, t5 seasonal affective disorder (SAD), eating disorders and pre-menstrual syndrome.
By way of further example, agents, acting in the pancreas, which are capable of regulating the expression of the human VIP2 receptor or agents acting as agonists and antagonists of the receptor may be useful in the treatment of diabetes.
In summation introduction of the IacZ reporter gene by using pYIVs, together with amplification of YAC DNA by using pYAM4 should greatly facilitate production of YAC transgenic animals and analysis of these animals in terms of expression, regulation and function of genes present in YAC DNA.
In these studies we present the construction of a series of YAC modification vectors (such as pYIV 1, pYIV2, pYIV3 and pYIV4) that contain a reporter gene (such as the lacZ reporter gene) to facilitate the study of the tissue distribution and regulation of YAC

transgenes. These vectors are likely to find widespread application in transgenic research.
In these studies we also present the construction of a YAC amplification vector (such as 5 pYAM4) which has a number of advantages over previous vectors and is suitable for the amplification of YAC DNA for the creation of transgenic mice.
In these studies we also present the combined use of the above-mentioned modification vectors (such as pYIVI, pYIV2, pYIV3 and pYIV4) and the above-mentioned YAC
to amplification vector (such as pYAM4). The combined use of these vectors is likely to find widespread application in transgenic research.
For example, the vectors of the present invention - in particular the insertion vectors of the present invention - may be used to prepare other artificial chromosomes (i.e.
t5 artificial chromosomes other than YACs), which may in turn be used to prepare transgenic organisms (including animals). In this alternative embodiment, the above mentioned statements of invention and description are still applicable but wherein the term YAC represents any suitable artificial chromosome, preferably a yeast artificial chromosome.
All publications mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described methods and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology or related fields are intended to be within the scope of the following claims.

1 Cohen, D., I. Chumakov and J. Weissenbach (1993) Nature 366, 698-701.
2 Nobile, C., F. Galvagni, J. Marchi, R. Roberts and I. Vitiello (1995) Genomics 28, 97-100.
3 Couch, F.J., L.H. Castilla, J.Z. Xu, K.J. Abel, P. Welcsh, S.E. King, L.H.
Wong, P.P. Ho, S. Merajver, L.C. Brody, G.Y. Yin, S.T. Hayes, L.M. Gieser, 1o W.L. Flejter, T.W. Glover, L.S. Friedman, E.D. Lynch, J.E. Meza, M.E. King, D.J. Law, L. Deaven, A.M. Bowcock, F.S. Collies, B.L. Weber and S.C.
Chandrasekharappa ( 1995) Genomics 25, 264-273.
4 Shizuya, H., B. Birren, U.J. Kim, V. Mancino, T. Slepak, Y. Tachiiri and M.
~5 Simon (1992) Proc. Natl. Acad. Sci. USA 89, 8794-8797.
5 Shepherd, N.S., B.D. Pfrogner, J.N. Coulby, S.L. Ackerman, G. Vaidyanathan, R.H. Sauer, T.C. Balkenhol and N. Sternberg (1994) Proceedings Of the National Academy Of Sciences Of the United States Of America 91, 2629-2633.
6 Gordon, J.W. (1993) Meth. Enzymol. 225, 747-771.
7 Brinster, R.L., J.M. Allen, R.R. Behringer, R.E. Gelinas and R.D. Palmiter ( 1988) Proc. Natl. Acad. Sci. USA 85, 836-840.
8 Choi, T., M. Huang, C. Gorman and R. Jaenisch (1991) Mol. Cell. Biol. 11, 3070-3074.
9 Jaenisch, R. (1988) Science 240, 1468-1474.
10 Lamb, B.T. and J.D. Gearhart (1995) Curr. Opin. Genet. Develop. 5, 342-358.

11 Smith, D.R., A.P. Snyth and D.T. Moir (1990) Proc. Natl. Acad. Sci. USA 87, 8242-8246.
12 Smith, D.R., A.P. Smyth, W.M. Strauss and D.T. Moir (1993) Mamm.
Genome 4, 141-147.
13 Toye, A.A., L. Schalkwyk, H. Lehrach and N. Bumstead (1997) Mamm.
Genome 8, 274-276.
l0 14 Leeb, T., G. Rettenberger, H.B. Hameister, G. and B. Brenig (1995) Mamm.
Genome 6, 37-41.
Cai, L., L.C. Schalkwyk, A. Schoeberlein-Stehli, R.Y. Zee, A. Smith, T. Haaf, M. Georges, H. Lehrach and K. Lindpaintner (1997) Genomics 39, 385-392.
16 Al-Shawi, R., J. Burke, H. Wallace, C. Jones, S. Harrison, D. Buxton, S.
Matey, A. Chandley and J.O. Bishop (1991) Mol. Cell. Biol. 11, 4207-4216.
17 Al-Shawi, R., J. Burke, C.T. Jones, J.P. Simons and J.O. Bishop (1988) Mol.
2o Cell. Biol. 8, 4821-4828.
18 Braun, R.E., D. Lo, C.A. Pinkert, G. Widera, R.A. Flavell, R.D. Palmiter and R.L. Brinster (1990) Biol. Reprod. 43, 684-693.
2s 19 Dzierzak, E., B. Daly, P. Fraser, L. Larsson and A. Muller (1993) Int.
Immunol. 5, 975-984.
Heyman, R.A., E. Borrelli, J. Lesley, D. Anderson, D.D. Richman, S.M. Baird, R. Hyman and R.M. Evans (1989) Proc. Natl. Acad. Sci. USA 86, 2698-2702.

21 Iwakura, Y., M. Asano, Y. Nishimune and Y. Kawade (1988) EMBO J. 7, 3757-3762.

22 Neznanov, N., LS. Thorey, G. Cecena and R.G. Oshima (1993) Mol. Cell.
Biol. 13, 2214-2223.

23 Shen, S., F.A. Kruyt, J. den Hertog, P.T. van den Saag and W. Kruijer (1991) DNA Sequence 2, 111-119.

24 Mountford, P., B. Zevnik, A. Duwel, J. Nichols, M. Li, C. Dani, M.
Robertson, I. Chambers and A. Smith (1994) Proceedings Of the National Academy Of Sciences Of the United States Of America 91, 4303-4307.
io 25 Beach, D. and P. Nurse (1981) Nature 290, 140-142.

26 Schedl, A., L. Montoliu, G. Kelsey and G. Schutz (1993) Nature 362, 258-261.
~5 27 Bellis, M., M. Pages and G. Roizes (1987) Nucl. Acids Res. 15, 6749-6749.
28 Schedl, A., B. Grimes and L. Montoliu (1995) In: Yeast artificial chromosomes (YAC) protocols eds. D. Markie. Methods in Molecular Biology 54, 293-306 (Humans Press, Totowa, NJ).
29 Peterson, K.R., C.H. Clegg, Q.L. Li and G. Stamatoyannopoulos (1997) Trends Genet. 13, 61-66.
30. Alters, H. E., Stops, E. G., Zoeller, R. T., Kauer, J. S., King, J. C., Fink, J. S., Mobtaker, H., and Wolfe, H. (1990). Brain Res Mol Brain Res 7: 85-9.
31. Cagampang, F. R. A., Sheward, W. J., Harman, A. J., Piggins, H. D., and Coen, C. W. (1998). Molecular Brain Research 54: 108-112.
32. Glazer, R., and Gozes, I. (1994). Brain Res 644: 164-7.

33. Gozes, L, Lilting, G., Glazer, R., Ticker, A., Ashkenazi, I. E., Davidson, A., Rubinraut, S., Fridkin, M., and Brenneman, D. E. (1995). J Pharmacol Exp Ther 273: 161-7.
34. Gozes, L, Shani, Y., Liu, B., and Burbach, J. P. H. (1989). Neuroscience Research Communications 5: 83-86.
35. Inagaki, N., Yoshida, H., Mizuta, M., Mizuno, N., Fujii, Y., Gonoi, T., Miyazaki, J., and Seino, S. (1994). Proc Natl Acad Sci U S A 91: 2679-83.
36. Piggies, H. D., Antle, M. C., and Rusak, B. (1995). Neuropeptides phase shift the mammalian circadian pacemaker. J Neurosci 15: 5612-22.
37. Scarbrough, K., Harney, J. P., Rosewell, K. L., and Wise, P. M. (1996). Am J
Physiol 274: 8283-8.
38. Sheward, W. J., Lutz, E. M., and Harmar, A. J. (1995). Neuroscience 67:

18.
39. Straub, S. G., and Sharp, G. W. (1996). J Biol Chem 271: 1660-8.
~s 40. Takahashi, Y., Okamura, H., Yanaihara, N., Hamada, S., Fujita, S., and Ibata, Y.
(1989). Brain Res 497: 374-7.
41. Usdin, T. B., Bonner, T. L, and Mezey, E. (1994). Endocrinology 135: 2662-80.
42. Vertongen, P., Schiffcnann, S. N., Gourlet, P., and Robberecht, P. (1997).
Peptides18:1547-1554.

SEQ ID. NO. 1 TCAGGCACCG

GGATGCTGTA

CCATTCCGAC

ATTTCTATGC

GTGGATCAAT

361 TCCCT'TTAGT ATAAATTTCACTCTGAACCA TCTTGGAAGG ACCGGTAATT
ATTTCAAATC

CAATTAAATA

GGAATTCCGT

SEQ ID. NO. 2 20LOCUS SERT.DOC 2889 BP DS-DNA ENTERED 11/24/98 CON~HENT 1 - 85 axon 1A

86 - 182 axon 1B (some splice variants do not include this axon) 25 183 - 648 axon 2 649 - 783 axon 3 784 - 1003 axon 4 1004 - 1142 axon 5 1143 - 1277 axon 6 30 1278 - 1381 axon 7 1382 - 1509 axon 8 1510 - 1622 axon 9 1623 - 1754 axon 10 1755 - 1854 axon 11 35 1855 - 1955 axon 12 1956 - 2123 axon 13 2124 - 2889 axon 14 180 - 2198 open reading frame encoding SERT

ORIGIN -CAGCCCGGGA

CTTGCCCTCT

GAAGAACAAA

CCACAAATCC

TTACTAACCA

GAAGATGGAG

GACAAAGTGG

GGAGATGACA

CAAGGGGAAC

GCTGTGGACC

GCATTCCTCC

GAGCTCGCAC

4o SEQ ID. NO. 3 LOCUS hVIP2.DOC 3944BP DS-DNA ENTERED 11/23/98 COUNT

45 C0I4~IENT1 - 238 axon1 239 - 338 axon2 339 - 446 axon3 447 - 544 axon4 545 - 642 axon5 50 643 - 784 axon6 785 - 935 axon7 936 - 996 axon8 997 - 1066axon9 1067 - axon10 55 1159 - axon11 1289 - axon12 1331 - axon13 188 - 1504openreading frame encoding VIP2 receptor ORIGIN -CGCGCTCCAG
CTGCCGGGAC
GGAGGGGGCG
GCCCCCGCGC
TCGGGGCGCT

AAACAAAATG

TCTGGGACAA

GCCCAAAAGT

GTGACGGATG

AGGATGAGAG

GTGTCTCTCT

ACTGCACCAG

CAGTGCTGGT

AGCCATCCTC

CCAACTTCTT

TCCCCCCTAG

GCATCGGTGC

ACGACCACAG

ATTTTGTCCT

TCGGCGGCAA

CGCTGTTCGG

ACCAGATACT

ACTGTTTCCT

CGACCCCGTC

CGGAGGGCGC

CCTCGGTCAT

CTTCTGCGGG

GGTCAGCGCG

GAGTCGTGTT

TGTTTCAGCC

TCTGTCGCCC

GGGTTCACGC

ACGCCTGGCT

GGTCTCGATC

GGCGTGAGCC

GCAGTTGTGT

GGCGGCCTCC

CAGGGCCCCC

CTTGGGGCGC

GCCTCCCCAC

AGGGGACCTC

AGGTCACCTG

GCCAGGCCTG

AACCGGAAAC

CATATAAAAC

CTCCTTCAGG

TGGCTGCAGA

CCCACAGCGC

GGGACTCAGT

TCCTGTGCAT

CTGTGCCGGG

AAAACCCATA

CAGTGTCCAG

ACGCCGGCCA

CGAGGTTGGT

GGGGGCCGCA

CCCAGGAAAG

CAGGTTCAGT

AGCCTTGCCC

AGGAAACAAA

GCTGTGACCC

AGGCACTGGT

TCAGGGGACA

CTCCTGGTAG

CAGTGGTCAA

TGGCGGGAAT

SEQ ID NO. 4 GAATTCCGCC CCTCTCCCTC CCCCCCCCCT AACGTTACTG GCCGAAGCCG
CTTGGAATAA GGCCGGTGTG CGTTTGTCTA TATGTTATTT TCCACCATAT
TGCCGTCTTT TGGCAATGTG AGGGCCCGGA AACCTGGCCC TGTCTTCTTG
ACGAGCATTC CTAGGGGTCT TTCCCCTCTC GCCAAAGGAA TGCAAGGTCT
GTTGAATGTC GTGAAGGAAG CAGTTCCTCT GGAAGCTTCT TGAAGACAAA
CAACGTCTGT AGCGACCCTT TGCAGGCAGC GGAACCCCCC ACCTGGCGAC
AGGTGCCTCT GCGGCCAAAA GCCACGTGTA TAAGATACAC CTGCAAAGGC
GGCACAACCC CAGTGCCACG TTGTGAGTTG GATAGTTGTG GAAAGAGTCA
AATGGCTCTC CTCAAGCGTA TTCAACAAGG GGCTGAAGGA TGCCCAGAAG
GTACCCCATT GTATGGGATC TGATCTGGGG CCTCGGTGCA CATGCTTTAC
ATGTGTTTAG TCGAGGTTAA AAAACGTCTA GGCCCCCCGA ACCACGGGGA
CGTGGTTTTC CTTTGAAAAA CACGATGATA AGCTTGCCAC AACCATG
IS
(this sequence is also presented as Figure 10).

WO 99/28449 _ ~4 PCT/GB98/03558' .apphcanrs or agcnc's tile p/3330.W0 CTH I In~utonat appltcatn reference number 1 tYDtC~TtOi~S REL.~TtvC TO ~ DEPOSITED dItCROORC.~NISrt (PCT Rule I3bts) .~. The indications made below relate to the microuraanism referred to in the description on page ~7 . line 15 B. IDE.VTIFtC~1T10N OF DEPOSIT
Further deposiu are identified on an additional sheet o iVame of dcpusitarv, institution The National Collections of Industrial and Marine Bacteria Limited (NCIMti) .lddrcss of depository institution /including postal colt and tonetrv, ) .

23 St Machar Drive Aberdeen United Kingdom O;ue of deposit Accession Number 24 November 1997 NCI1~ 40907 C. A00(TIOVAL INDIC.1T101VS
/lsaw blank ijnot applieab(t) This information is continued on an additional sheet In respect of those designations in which a European patent is sought, and any other designated state having equivalent legislation, a sample of the deposited microorganism will only be made available either until the publication of the mention of the grant of the patent or after twenty years from the date of filino _ if the application has been refused or withdrawn or is deemed to be withdrawn, only by the issue of such a sample to an expert nominated by the person requestin the sample. (Rule 28(a) EPC) D. DESICYATED STATES FOR WNICEI
l, IDIC.ITIOiYS dRE MADE Iijths irtditattons ors not jot all designated States/

E. SEPARATE FURIVISEItYC OF
IYDICAT10NS Iltaw blcnk ijnot applicable) The indications listed below will be submitted co the Incerctstionsl Burau lacer (Specij trtJtt ~Clldal nantft OjfJlt IIIGfKaQOItf Gg. :Iceariaut ' ~
.Vumoer ojOtpa~stt For receiving Office use only For Intemaaonal Bureau use only his sheet was received with the international application a This sheet wu received by the lntemuional Bureau on:
2 7 NOVEir~BFR 1998 Authorized oiFcerP. J. ~~~ p3~/~9S Au~orixed officer Form PCTIRO/13~t (July 1992) WO 99/28449 ~5 PCT/GB98/03558 .aooncart ; ur :4:nt i :;.: ; tntr..suwnat acancauun ':re:_~.ta,urnee: P3330.W0 CTH i I,YD(C.~TIOt~S REL.aTI~C TO .a DEPOSITED :vItCROORCa~IS~t (PCT Rule uors) a. Tac mdtuttons mate oc:ow rctate :u the mtc: aur~antxm ret:~ to m the uexenpnon on page 27 n"~ 16 B. IDE~T1FTC.aTtO~ OF DEPOSIT
Funhcr deaostu are ttJenuried on art ardtuonat she~: Q

~amc of ccoustt_ . msnwnon The vational C~Llections of tndustrial and Marine Bacteria Limited (NCIMB) ~ .addtxsf of ceeostta. i mfntnuon rtnciudrrtq ppsrat cacs ana courtrrvl I 23 St Machar Drive abe:Ceen a82 1PY

United Kingoom I
_ Dilte ul CepOftt ,umoe:

24 November 1997 NCIMB 40908 C. ADDITIOnrtL WDIC.1TIOIVS
!leave oiwric t/rtnr aoplreablei This iniormsuon is tronetnued on an seditiunaJ she.: a tn respect of those designations in which can patent is sought, and any other designated state havinc equivalent legislation, a samol_ of the deoasited microorganism will only be mace available either until the puolication of the mention of the grant of the oat_nt cr after twenty years from the dat_ of filino if the application nas been refused or withdrawn or is deemeo to be withdrawn, only by the LSSUe o. sucn a sample t(1 all OttnOe~ nmwin~raA
h". rne ser:..

the samo:e. ;Rule 29(a) E?r) . ___ ~ 0. OESiC.WTED ST.aTES FOR WHICH I~DIC.~TiO~S .aRE rt.lDE /i/:hr rnoaortons ars rtor jor all c'str;narrdStortsr i E. SEPaR.~TE Ft;R.YISHIYC OF IVDIC.aTIOYS IJeave oienK:jnor eoaueeoiu t ne mcte..t.ons as,ea ae:ow wul oe suomtetec to :ae Into :atsonal e3ureau rate: rzec:rp:ne;er~r,ct~o~rne utc»:»o~se;.. ;accsstton i i ~ Boer ~j Cexnr 7 I
v I
I
=or rece: vtng Ofie: use onto =or inte-suonu e3ureau uss onr~
:us stsr_: ~was rr.::vea ~~run the :nte~auonu aoaueuton (~ ,'ii: snc:: ~~as :::e:v:a av :ne tats.-..a::onu 3u :au oe:
2 7 t~~0y~i;~~=:~ seog .autnort: : ar'ic:: Autnort::a ori:a:
P~TR~c~ s.IZ.gs Font)?C;'~ROIt3.t(July 19921 WO 99/28449 ~6 PCT/GB98/03558-~pouc_.::.:.~ . -:, :... P . 0 CTH ::n~:::unu::puca:un ::c~:::e:-.ra-:- !3330 w IVOICaTt0:~5 REL.aTtaG TO.a OEPOStTEO ,~ItCROORG~~IS~t (PCT Rule l Jors) A. T'.:e tnwue:ons rts ce:ov eesate :u ;nc nsrc:out~:atsn re:..--.-_, :u m the uaenpnvn on osqe 27 . true 17 Il. IDE~TIFtC.aTiO,Y OF OEPOStT
FutAe: :rostu u: :ee.-.ut:e:
on as actauonat saes: Q

~atete at ee:usst_; .nsuwuon The v3tional Collections aP
tnduscciai and Marine 6actecia Limited (vCIMB) i .a,atsns of ar_csvt:r! rnstttuuon rrncawrrrq power toes :na eowunr E 23 St 'lacnar D: ive ~bO:C!.~
I

i Uniteo K:ngcom I

Oats ut c~os,c A~asron W met:

24 November 1997 NCIMB x0909 C. a001T(O~ al. iVOiC.aTtO'tS
Itcsa oitrea r/rrr sooltcsa(a This utiorituton a cant:aa~
on :.s :euruunat stir..

In cesoect cf those designations in which a Eurooesn patent is sought. and any other cesicnated sate navino eavivalent legislation, a satpole oP the oeoosited micc:crranism will only oe maCe available either until the puolicaticn of the men d=n c the grant c,' the oatenc ~_~ after raenty years P:nm cne date aP filing if t-e ape::=aticn has teen refuseo c: .rithdrawn o: is Ce!meo :: be withdrawn.

~ on!y ~v c~. issue cP suGt a samole :~ an exoec= ~ominacea ~y cne person reouestinc :ht s3npi=. ~~ule 2~ti) :fir!

D. DESIG'.1TEI) S;.iTES FOR WtitCH IOICATTOsYS ARE 51.10E Iil:J,c rreweanons sn nor jor all etsr~areeSrortsr I
j E. SEP.aR.aT='L:RYISItt,tG OF I~DiCAT10~5 Ite_~e owni rr nor a=aue::ia , ins mea~::ans :a:e: :c:ow W rrr oe suomtstsc ~ :.~te snc -:::gnu 3ureau :z:»
:»earr ~e;rrsr~ r~crr of u~ ~==w~i t.;.. :;cxsmn o,~r ai Ct_-es:: ';
I
I
i .
T--- ~ .. ...s~.mns ptT . as omy =or ln:er.:n:::..~.: =::.-:=a v:: :nr~ --_.:.s mre: ~..as :-s:v:c ~rrrtn use :a:-_.-.sauona~ r : oi: snr.: ~cu .-:~~s=
:v we :.~.::.-..~.... :: 3z::~ :e:
sccne_.on 21 MOYEi~;~:~ 1°98 .a~i~.or::a .7:~~::
j~ 3.~Z.(~g - ~ auusonxM agree:
~oApP'"dOriiaiirlv t99Z1 WO 99/28449 ~~ PtV'T/GB98103558-j aooi~c_::: or :: .-.:s :::. p/3330.W0 CTH , m~:.u:unu:coucsi:
u~
.~=rs.-.ee .~.un::
:
tVDtC.~TtOVS REL.aTt'IC TO .> DEPOSITED vttCROORC:1~1S,~1 1PCT Rate l3irtst a. T~c tnu:uc:cnx ."z:: ae:ow rc:ace w u:c m,v:.-our:an:m r::'-_.~.:p :u m ine i:escapaun I an pace 27 I,ne 18 I B. IOE~TtFfC.>TtOS OF DEPOSIT F::.hr. a::osiu ar: :ccan~ an s.~s ,ua:utonst sar: O
~~aia: ui ce:usu_ : :nsatutson I
The vatio~ai C~11=ctions of Industrial and htacine 8actecia limited (NCtMB) I .~'swi:::Sf Ot aQOSit3.~! ,n3ittuGOn rytaci:r;~ aOt:Ct :DCl :rttt COU,Itn~1 23 St ~lacnac n: ine ~be:~san ~ :_=v Uniced K:nCCOfi1 O:W of aWOx,t Act:sxxton ~umoe:
24 November 1997 NCI14B 40910 C. a00fTtOn~L I~OIC.>TtOVS Ih=yr oin,rs tj ~r,r aao(ie=dltl T.Sis inionat:on i::ant:nu:d ort an sG~itiunal she:
In c~soect ~f those designations in which a Eucaoean patent a sougnt, and any ot!"ec cesi~nated state havino eauivalent legislation, a samoie of the deposited micc:cccanis~ will only be mace availabl~_ either until the ouolication oP the menc:cn o° t!~e grant of the patent c: after twenty years fccm cne date of filing ', :,' the accl:=atlCn nas bean ;.fused c: .ritndcawn oc a deemed =c be Withdrawn, only cv c-.e issue e. suc.~. a sample to an expec= ~ominaced by :ne person reouestin~
the sarao:=. rule ?3;4) ~?~) ~ D. OESICN.1TED ST.>TES FOR WHICH IsDIC.IT(OrS aRE V1AOE /i/:irs vwaeesaans an nor r'or all dtti;nettd Srattst I
I
i E. SEP.>R.>TE FCR.YISHi:iC OF t~D(C.aT10n5llr:rt picnic y'not got=cn.-.at I
~'. ae mc:c~:ons n: ac :e:ow w,H oe sucm,r:: :o :ae iias.~..at:onai ~uresu ia:~ :.-tr:r~:re;ersr~ r.~lrt oru~ m= ass r.;.. :ac:miort I
'. yt~tr ~f ~t?G. t ~, i i .
I
/ =:r :e::rnn; Ofr:c-. .use on,Y =ar ir.::.~..a::onu 3caai: a. on: ~ -~~i y( ; :~.a tats: was r:::r,:a .rttn ;ne :na.-.:a::onat s::uearton (~ ', ii:
tote: ~>rss r::: v~ :~~ .-s l:::e-a::una 3u: =a :r:
Z ~ novE~,~3a Isss .auG.or:::: a:T::-.7 7 Autaor:x:: at::c::
Form?'T.,"ZOlti~(luy t99=) _ 78 ~ooucs:c s or .ys.-r s ;h' p/3330.W0 CTH I m~wuau aooucauun ~:rcrsic: nunce.~
tvOtC~TtOnS REL.aTtvG TO .~ DEPOStTED W tCROORG~:ilSV1 (PCT Rule 136ts1 T:~e mmuaons ramie 6e:ow reeste w ;ne mtcrourg:msm re.'e-'eri w m cne >iesenpuun on oagc 27 . line 19 B. IOE~TIFIC.aTtON OF pEPOSIT
furtha oeposus are idenutied on aer addiuonal slt~ o ,Vame of tiepuatt_.~i ulsututton The wational Collections of Industrial and Marine Bacteria Limited (NCIMB) .adrtrsss of dr_ostta:y msucuuon hnc:udmq posrce case enu eoanrryl t 23 St Macnar Orive Aberan I .a8? ,,y United Kingdom I

Oate w scposu Accas;on W moo 24 Novealber 1997 NCIhB 40906 C. ADOITtON~L I;IOlCATIOiYS
Ilrave olnnir ynrx ooplteablri This inlortaarroo is cnounurl an an muitriuoal sheer Q

In respect oP those designations in which a European patent a sought, and any other desicnated state havin4 eauivalent legislation, a sample of the deposited microorganism will only be made available either until the publication of the mention of the grant of the patent or after twenty years from the date of filing if the application has been refused or withdrawn ar is deemed to be withdrawn, only by the issue of sucn a sample to an exoerc nominates by the person ceouestinq j the samoie. ;Rule ?9(0) EPC
-l) 0. OESIGrJITED STATES FOR WHICH
IrDiC.lTtOi'15 .1RE VIADE h/:Hr tnatectrons are not Ior all disesnertd Stottsl I

E. SEPARATE FURNISfitYC OF I~D(CAT10V5 Ilscve otcnit /nor tmoucaoli) I Tile me;cstsons;:s.e. oetow wed oe suomtaee to :ae lnr:~rartonst Bureau are: ticecgiuayerircenemrsw~u~e:c~:onrs.3..
v rs:eron a unrosr of Ccaaea ') ,~,/ ?u recmmns Otlic: use omY .-.-'or Inte~.:auocu 3uresu use onr~
~'va me-_: was rr_aveo ~.nrn me :nre:rauona; aoouescton C ; oi: sne:: wu :::::v:. :v ~.-o ;-r..-..s::onm 3ur:;u an:
2 7 HOVEtr;BER 1998 .author:; = ot':c::
.~uteonus ottic::
n 3.2.9 Fanu P="..:ZOII 3a (July 199'.1

Claims

1. A transgenic organism comprising a YAC vector wherein the YAC vector comprises a centromere, two telomeres, one or more origins of replication and an IRES.

2. A transgenic organism according to claim 1 wherein the YAC vector comprises a reporter gene wherein the expression product of the reporter gene is capable of producing a visually detectable signal.

3. A transgenic organism according to claim 1 wherein the YAC vector comprises a reporter gene wherein the expression product of the reporter gene is capable of producing an immunologically detectable signal.

4. A transgenic organism according to claims 1-3 wherein the YAC vector further comprises a selection gene, wherein that selection gene is specifically removable from the YAC vector.

5. A transgenic organism according to any one of the preceding claims wherein the IRES comprises a nucleotide sequence presented as SEQ ID No.1 or SEQ ID
No.
4 or a variant, homologue or derivative thereof.

6. A vector capable of modifying a YAC vector as defined in any one of the preceding claims wherein the vector is selected from the group consisting of pYIV1(NCIMB 40907). pYIV2(NCIMB 40908); pYIV3(NCIMB 40909); and pYIV4(NCIMB 40910).

7. A vector capably of modifying a YAC vector as defined in any one of the preceding claims wherein the vector is a pYAM4 vector (NCIMB 40906).

8. A transgenic organism comprising a YAC wherein the YAC is prepared by any one or more of the YAC vectors as defined in any one of claims 1-4 or a vector as defined in claim 6 or claim 7 or any combination thereof.

9. Use of a YAC vector as defined in any one of claims 1-4 or claim 6 or claim 7 to prepare a YAC transgenic organism.

10. Use of a YAC transgenic organism as defined in claim 9 to screen for agents capable of affecting the expression pattern of an NOI or the EP activity thereof of a YAC transgenic organism.

11. A YAC transgenic organism according to claim 10 wherein the YAC
transgenic organism co-expresses an NOI and a reporter gene wherein the expression pattern of the NOI can be determined by measuring a detectable signal (such as a visually or an immunologically detectable signal) produced by the expression product of the reporter gene.

12. A YAC transgenic organism according to claim 11 wherein the expression of the reporter gene is under the control of a regulatory sequence from a human NOI.

13. An assay method for identifying an agent that can affect the expression pattern of an NOI or the EP activity thereof in a YAC transgenic organism;

the assay method comprising administering an agent to a YAC transgenic organism as defined in claim 9 or claim 10 or claim 11;

determining whether the agent modulates (such as affects the expression pattern) of the NOI or the EP activity by means of the detectable signal.

14. An assay method according to claim 13 wherein the assay is to screen for agents useful in the treatment of disturbances in any one of: circadian function, sleep disorders, eating disorders, pre-menstrual syndrome, autoimmune disorders, birth defects in women and/or sexual dysfunction.

15. An agent identified by the method of claim 13.

16. A process comprising the steps of:

(a) performing the assay according to claim 13 or claim 14;

(b) identifying one or more agents that affect the expression pattern of the NOI or the EP activity thereof;

(c) preparing a quantity of those one or more identified agents.

17. A process comprising the steps of:

(a) performing the assay according to claim 13 or claim 14;

(b) identifying one or more agents that affect the expression pattern of the NOI or the EP activity thereof;

(c) preparing a pharmaceutical composition comprising one or more identified agents.

18. A process comprising the steps of:

(a) performing the assay according to claim 13 or 14;

(b) identifying one or more agents that affect the expression pattern of the NOI or the EP activity thereof;

(c) modifying one or more identified agents to cause a different effect on the expression pattern of the NOI or the EP activity thereof.

19. Use of an agent identified by an assay according to claim 13 or claim 14 in the manufacture of a medicament which affects the expression pattern of an NOI
or the EP activity thereof.

20. Use of an agent in the preparation of a pharmaceutical composition for the treatment of a disorder or condition associated with the expression pattern of an NOI
or the EP activity thereof, the agent having an effect on the expression pattern of the NOI or the EP activity thereof when assayed in vitro by the assay method according to claim 13 or 14.

21. Use of a nucleotide sequence comprising the sequence presented SEQ ID
No.1 or SEQ ID No. 4 or a variant, homologue or derivative thereof in a vector according to claim 6 to modify a YAC vector or a YAC in a transgenic organism.

22. Use of a nucleotide sequence comprising the sequence presented as SEQ ID
No.1 or SEQ ID No. 4 or a variant, homologue or derivative thereof in a modified YAC vector as defined in claim 6 to monitor the expression of one or more NOIs within YAC vector or a YAC in a transgenic organism.