CA2294646A1 - Human catalytic telomerase sub-unit and its diagnostic and therapeutic use - Google Patents

Abstract

The invention relates to the nucleotide sequence and the protein sequence derived therefrom, which encodes for the human catalytic telomerase sub-unit.
The invention furthermore relates to methods involving a pharmaceutical, diagnostic or therapeutic use of this gene/protein, principally for treating cancer and ageing.

Description

~2 486-Foreign countries Sto/Kr/vos/W6/ V29.05.1998 .,.
.. FILE,ftl~tM THIS Ai~
T~X~-TRAN;~LATIO~i Catalytic su6unit of human telomerase and its diagnostic and therapeutic use Structure and function of the chromosome ends The genetic material of eukaryotic cells is distributed on Linear chromosomes.
The ends of these hereditary units are termed telomeres, derived from the Greek words telos (end) and meros (part or segment). Most telomeres consist of repeats of short sequences which are mainly constructed from thymine and guanine (Zakian, 1995). The telomere sequences of related organisms are often similar and these sequences are even conserved between species which are more phylogenetically remote. It is a remarkable fact that the telomeres are constructed from the sequence TTAGGG in all the vertebrates which have so far been examined (Meyne et al., 1989).
The telomeres exert a variety of important functions. They prevent the fusion of chromosomes (McClintock, 1941) and consequently the formation of dicentric hereditary units. Chromosomes of this nature, possessing two centromeres, can lead to the development of cancer due to loss of heterozygosity or the duplication or loss of genes.
In addition, telomeres serve the purpose of distinguishing intact hereditary units from damaged hereditary units. Thus, yeast cells ceased dividing when they harboured a chromosome which lacked a telomere (Sandell and Zakian, 1993).
Telomeres cant' out another important task in association with DNA replication in eukaryotic cells. In contrast to the circular genomes of prokaryotes, the Linear chromosomes of eukaryotes cannot be completely replicated by the DNA polymerase complex. RNA
primers are required for initiating DNA replication. After the RNA primers have been eliminated and the Okazaki fragments have been extended and then ligated, the newly synthesized DNA
strand lacks the 5' end because the RNA primer at that point cannot be replaced with DNA.
For this reason, without special protective mechanisms, the chromosomes would shrink with every cell division ("end-replication problem", Harley et al., 1990). The non-coding telomere 2 486-Foreign countries sequences probably represent a buffer zone for preventing the loss of genes (Sandell and Zakian, 1993).
Over and above this, telomeres also play an important role in regulating cell ageing (Olovnikov, 1973). Human somatic cells exhibit a limited capacity to replicate in culture;
after a certain time they become senescent. In this condition, the cells no longer divide even after being stimulated with growth factors; however, they do not die but remain metabolically active (Goldstein, 1990). Various observations provide support for the hypothesis that a cell determines from the length of its telomeres how often it can still divide (Allsopp et al., 1992).
In summary, the telomeres consequently possess central functions in the ageing of cells and in the stabilization of the genetic material and prevention of cancer.
The enzyme telomerase smthesizes the telomeres As described above, organisms possessing Linear chromosomes are only able to replicate their genomes incompletely in the absence of a special protective mechanism.
Most eukaryotes use a special enzyme, i.e. telomerase, to regenerate the telomere sequences.
Telomerase is expressed constitutively in the single-cell organisms which have so far been examined. By contrast, in humans, telomerase activity was only detected in germ cells and tumour cells whereas neighbouring somatic tissue did not contain any telomerase (Kim et al., 1994).
Telomerase in ciliates Like the telomeres, telomerase was identified for the first time in the ciliate Tetrahymena thermophila. Telomerase activity was detected by extending the single-stranded oligonucleotide d(TTGGGG)4 in the presence of dTTP and dGTP (Greider and Blackburn, 1985). In this reaction, the Tetrahymena telomere sequence TTGGGG was added repeatedly to the primer. Even when an oligonucleotide _having the irregular telomere sequence of Saccharomyces cerevisiae, T(G)I_3, was offered as the starting material, the telomerase ,2 486-Foreign countries ....

extended the primer with the telomere sequence of Tetrahymena (Greider and Blackburn, 1985). From these results, it was concluded that the telomerase itself carries the template for the sequence of the telomeres.
Once the existence of an RNA component in the telomerase had initially been demonstrated (Greider and Blackburn, 1987), the gene for the RNA subunit of the telomerase was cloned a short while later (Greider and Blackburn, 1989). This RNA contains a region which is complementary to the Tetrahymena telomere sequence (termed "complementary region"
below). The activity of the telomerase depended on the RNA component, as was demonstrated by digesting the RNA, leading in turn to subsequent loss of activity. If the complementary region of the telomerase RNA was mutated, the corresponding mutations were incorporated in vivo into the Tetrahymena telomeres (Yu et al., 1990).
Telomerase consequently belongs to the class of RNA-dependent DNA polymerases.
The first protein subunits of the Tetrahymena telomerase, i.e. p80 and p95, were identified in 1995 (Collins et al., 1995). The observation that p95 anchors the enzyme to the DNA and p80 binds the RNA component led to the following model: the telomerase RNA anneals by its complementary region to the single-stranded 3' overhang. The 3' overhang is extended by incorporating the corresponding nucleotides in the S'-3' direction. The de novo synthesis of telomeres probably involves an elongation step and a translocation step. Once a telomere sequence has been synthesized, the telomerase presumably moves along the DNA
until it is once again in a position to be able to add a complete telomere sequence. This model does not have to be generally valid since great differences exist between the telomerases of different species with regard to the number of nucleotides which the enzyme adds before it dissociates from the telomere (Drowse et al., 1993).
In addition to this, telomerase subunits from other organisms have also recently been identified. Two protein subunits, i.e. p123 and p43, which do not exhibit any homology with the Tetrahymena telomerase proteins, have been found in the ciliate Euplotes aediculatus.
The telomerase subunit p123 exhibits a basic domain at its N terminus and a domain for a reverse transcriptase (RT) at the C terminus, suggesting this protein has a catalytic function, 486-Foreign countries (Lingner et al., 1997). Furthermore, p123 has been reported to share significant homology with the Saccharomyces cerevisiae protein Est2 which was found by Lundblad (Lingner et al., 1997).
Whereas p80 and p95 have not hitherto been demonstrated to possess any function which is essential for telomerase activity, the potential catalytic telomerase subunits p123/est2p have been unambiguously shown to have a key function: mutation of the active centre of the est2p RT led to significant truncation of the telomeres in yeast cells (Lingner et al., 1997).
Telomerase components from mammalian cells The RNA components of the telomerases of various organisms, inter alia of Saccharomyces cerevisiae, mice and humans (Singer and Gottschling, 1994; Blasco et al., 1996; Feng et al., 1995), have by now been cloned. All the telomerase RNAs known to date comprise a region which is complementary to the telomere sequence of a particular organism.
However, the primary sequence of the human telomerase RNA (hTR) does not display any similarity to the RNA components of the ciliates or of Saccharomyces cerevisiae. On the other hand, regions exist which are conserved between human and murine telomerase RNA (Feng et al., 1995).
The isolation of a human telomerase-associated protein (hTPI) has recently been described (Harnngton et al., 1997). On the basis of its homology with the Tetrahymena telomerase p80 subunit, the corresponding gene was found in an EST data base which is not available to the general public (Harrington et al., 1997). hTPl is composed of 2627 amino acids and, in the N-terminus, exhibits three domains which possess at most 46°lo homology with p80. 16 repeats of the amino acids tryptophan and asparagine, which presumably mediate a protein/protein interaction, were shown to be present, as an additional structural element, in the C-terminal region.
Activation of the telomerase in human tumours . 486-Foreign countries In humans, it was originally only possible to demonstrate telomerase activity in germ line cells and not in normal somatic cells (Hastie et al., 1990; Kim et al., 1994).
After a more sensitive detection method had been developed (Kim et al., 1994) a low level of telomerase activity was also detected in hematopoietic cells (Broccoli et al., 1995;
Counter et al., 1995;
Hiyama et al., 1995). However, these cells nevertheless exhibited a reduction in the telomeres (Vaziri et al., 1994; Counter et al., 1995). It has still not been clarified whether the quantity of enzyme in these cells is insufficient to compensate for the telomere loss or whether the measured telomerase activity stems from a subpopulation, e.g. of incompletely differentiated CD34+38+ precursor cells (Hiyama et al., 1995). In order to clarify this point, it would be necessary to detect the telomerase activity which was present in a single cell.
Interestingly enough, however, significant telomerase activity has been detected in a large number of the tumour tissues which have been tested to date (1734/2031, 85%;
Shay, 1997), whereas no activity has been found in normal somatic tissue (1/196, <1%, Shay, 1997). In addition, a variety of investigations demonstrated that the telomeres continued to shrink in senescent cells which were transformed with viral oncoproteins and that it was only possible to find telomerase in the subpopulation which survived the growth crisis (Counter et al., 1992). The telomeres were also stable in these immortalized cells (Counter et al., 1992).
Similar findings derived from investigations in mice (Blasco et al., 1996) support the assumption that reactivation of the telomerase is a late event in tumorigenesis.
Based on these results, a "telomerase hypothesis" was developed which links the loss of telomere sequences and cell ageing to telomerase activity and the genesis of cancer. In long-lived species such as humans, the shrinking of the telomeres can be regarded as a tumour suppression mechanism. Differentiated cells, which do not contain any telomerase, cease dividing when the telomeres have reached a particular length. If such a cell mutates, a tumour can only develop from it if the cell is able to extend its telomeres.
Otherwise, the cell would continue to lose telomere sequences until its chromosomes became unstable and it finally died. Reactivation of the telomerase is presumably the main mechanism which tumour cells deploy in order to stabilize their telomeres.

486-Foreign countries It follows from these observations and ideas that it should be possible to develop a therapy for tumours based on inhibiting telomerase activity. Conventional cancer therapies using cytostatic agents or short-wave irradiation damage all the dividing cells in the body in addition to damaging the tumour cells. However, since it is only germ line cells which contain significant telomerase activity, apart from tumour cells, telomerase inhibitors would attack the tumour cells more specifically and consequently evoke fewer undesirable side effects. Since telomerase activity has been detected in all the tumour tissues tested to date, it would be possible to employ these therapeutic agents against all types of cancer. The effect of telomerase inhibitors would then set in when the telomers of the cells had shortened to such an extent that the genome had become unstable. Since tumour cells usually exhibit shorter telomeres than do normal somatic cells, it would be cancer cells which would first of all be eliminated by telomerase inhibitors. By contrast, cells possessing long telomeres, such as the germ cells, would not be damaged until a much later stage. Telomerase inhibitors consequently represent an approach which points the way forward for cancer therapy.
However, it will only be possible to provide unambiguous answers to questions regarding the nature and the points of attack of physiological telomerase inhibitors when the protein structures of the enzyme, together with their functions, have also been identified and a deeper understanding of the various telomere-binding proteins has been obtained.
The invention relates to the catalytically active human telomerase subunit (phTC), where appropriate in purified form, to active moieties of the protein, to modulators, in particular agonists of the protein, to substances which imitate the function of the protein and to combinations of these components.
The invention furthermore relates to:
- The nucleic acid sequence which encodes the human protein phTC, specifically:
- the genomic sequence of the hTC gene, the cDNA sequence of the hTC gene, 486-Foreign countries - the DNA sequence of hTC variants - the sequence of the mRNA which is transcribed from the hTC gene, - parts of the abovementioned sequences, including the DNA sequence (SEQ m No. 1) of hTC which is shown in Fig. 1.
S
- The nucleic acid sequences which encode hTC-homologous proteins in other mammals, specifically:
- the genomic sequences of hTC-homologous genes, - the cDNA sequences of hTC-homologous genes, - the sequences of the mRNAs which are transcribed from hTC-homologous genes, - parts of the abovementioned sequences.
- Nucleic acid sequences which, in humans and other mammals, encode proteins which are related to the phTC protein, specifically:
- the genomic sequences of hTC-related genes in humans and other mammals, - the cDNA sequences of hTC-related genes in humans and other mammals, - the sequences of the mRNAs which are transcribed from hTC-related genes in humans and other mammals, - parts of the abovementioned sequences.
- The above-described phTC protein, which is isolated from mammalian cells (c~
Fig. 2 and SEQ m No. 2).
- The phTC protein which is labelled with a detection reagent, with the detection reagent preferably being an enzyme, a radioactively labelled element or a fluorescent chemical.
_ - An antibody which is directed against the phTC protein.

486-Foreign countries _g_ According to a preferred embodiment, this antibody is a polyclonal antibody.
According to another preferred embodiment, this antibody is a monoclonal antibody.
Antibodies of this nature can be produced, for example, by injecting a host, which is substantially immunocompetent, with a quantity of a phTC polypeptide, or a fragment thereof, which is effective for producing the antibody, and by subsequently isolating this antibody.
In addition, an immortalized cell line which produces monoclonal antibodies can be obtained in a manner known per se.
Where appropriate, the antibodies can be labelled with a detection .reagent.
Fragments which possess the desired specific binding properties can also be employed instead of the complete antibody.
Preferred examples of such a detection reagent are enzymes, radioactively labelled elements, fluorescent chemicals or biotin.
Oligonucleotides in purified form which have a sequence which is identical or exactly complementary to a contiguous sequence, of from 10 to 500 nucleotides in length, of the above-described genomic DNA, cDNA or mRNA.
An oligonucleotide of this nature can, in particular, be an oligodeoxy-ribonucleotide or an oligoribonucleotide or a peptide nucleic acid (PNA).
Preference is given to oligonucleotides which inhibit, repress or block the activity of the telomerase when they bind to the hTC mRNA.

~86-Fore~n countries - A DNA sequence, or a degenerate variation of this sequence, which encodes the phTC protein, or a fragment of this protein, where appropriate comprising the DNA
sequence in Figure la, or a DNA sequence which hybridizes with the previously cited DNA sequence under standard hybridization conditions.
- A recombinant DNA molecule which comprises a DNA sequence, or a degenerate variation of this sequence, which encodes phTC or a fragment of phTC, with the latter sequence preferably comprising the DNA sequence in Figure la, or which comprises a DNA sequence which hybridizes with the previously cited DNA sequence under standard hybridization conditions.
In the abovementioned recombinant DNA molecule, the described DNA is preferably linked to an expression control sequence.
Examples of expression control sequences which are particularly preferred are the early or late promoter of the SV40 virus or adenovirus, the lac system, the trp system, the TAC system, the TRC system, the main operator and promoter regions of phage ~., the control regions of the fd coat protein, the 3-phosphoglycerate kinase promoter, the acid phosphatase promoter and the yeast a-mating factor promoter.
- A single-cell host which has been transformed with the above-described recombinant DNA molecule which comprises the DNA sequence, or a degenerate variation of this sequence, which encodes the phTC protein or a part of this protein. In this recombinant DNA molecule, the said DNA sequence is linked to an expression control sequence.
Preferred examples of the single-cell host are: E. coli, Pseudomonas, Bacillus, Streptomyces, yeasts, CHO, R1.1, B-W, L-M, COS 1, COS 7, BSC1, BSC40 and BMT10 cells, plant cells, insect cells and mammalian cells in cell culture.

Le A 32 486-Foreign countries - A recombinant virus which is transformed with one of the previously described DNA
molecules or a derivative or fragment of this molecule.
- A method for inhibiting telomerase activity in human cells, preferably neoplastic cells, in which an exogenous polynucleotide which consists of a transcription unit is transferred into the cells. This transcription unit comprises a polynucleotide sequence of at least 29 consecutive nucleotides, which sequence is substantially identical or substantially complementary to the hTC RNA sequence and is linked to a heterologous transcription-regulating sequence which controls the transcription of the linked polynucleotide in the said cells.
Preferably, the abovementioned heterologous transcription-regulating sequence comprises a promoter which is constitutively active in human cells.
Alternatively, the heterologous transcription-regulating sequence can comprise a promoter which can be induced or repressed in human cells by adding a regulatory substance. Examples of such promoters are inducible and repressible tetracycline-dependent promoters, heat shock promoters and metal ion-dependent promoters.
The abovementioned exogenous polynucleotide can, for example, be a viral genome containing a transcription unit from the human hTC DNA component.
Particularly preferably, the said transcription unit produces antisense RNA
which is substantially complementary to the human hTC RNA component.
Particular preference is also given to the exogenous polynucleotide being able to comprise the sequence in Fig. la.
- A polynucleotide for the genetic therapy of a human disease. This polynucleotide consists of a transcription unit which comprises a polynucleotide sequence of at least 9 consecutive nucleotides, which sequence is substantially identical or substantially Le A 32 486-Foreign countries complementary to the hTC RNA sequence and is linked to a heterologous transcription-regulating sequence which controls the transcription of the linked polynucleotide in said cells.
- A method for detecting telomerase-associated conditions in a patient, which method comprises the following steps:
A. Detecting the phTC protein in body fluids or cell samples in order to obtain a diagnostic value;
B. Comparing the diagnostic value with standard values for the phTC protein in standardized normal cells or body fluids of the same type as the test sample;
C. Detecting diagnostic values which are higher or lower than the standard comparative values and which indicate a telomerase-associated condition, which condition in turn indicates a pathogenic condition.
This method is preferably employed for detecting a neoplastic disease in a patient.
The method then comprises the following steps:
A. Detecting the phTC protein in cell samples in order to obtain a diagnostic value;
B. Comparing the diagnostic value with standard values for the phTC protein in non-neoplastic cells of the same type as the test sample;
C. Diagnostic values which are clearly higher than standard comparative values indicate a neoplastic condition.
- A method for determining the presence of the phTC protein in a cell or cell sample, which method is based on amplifying an hTC polynucleotide, or hybridizing an hTC
polynucleotide, a primer or an hTC-complementary sequence with an hTC
polynucleotide.
- A test kit for detecting phTC in cell samples and body fluids, with it being possible, for example, for labelled, immunochemically-reactive components to be:
polyclonal Le A 32 486-Fore~n countries antibodies against phTC, monoclonal antibodies against phTC, fragments of these antibodies or a mixture of these components.
- A method for preventing and/or treating cell disturbance or destruction and/or malfunction and/or other symptoms in humans, which method is based on administering a therapeutically effective quantity of catalytically active human telomerase, its functional equivalents or its catalytically active fragments.
It is also possible to conceive of using a substance which promotes the production and/or activity of phTC; a substance which can imitate the activity of phTC; a substance which can inhibit the production and/or activity of phTC, or a mixture of these substances. A specific binding partner can also be employed.
The method is preferably employed for preventing or treating ageing or cancer diseases.
Substances which are able to affect the activity of phTC, i.e. inhibit or promote, are here termed modulators. Such modulators can be found, in a manner known per se, by testing their effect on telomerase activity in a telomerase assay. Examples of telomerase assays are given in Example 15.
Modulators of phTC are of interest for treating diseases which are connected with telomerase. The prevention or treatment of ageing processes or of cancer diseases may, in particular, be mentioned in this context.
- An antisense nucleic acid against the hTC mRNA, which nucleic acid comprises a nucleotide sequence which hybridizes with the said mRNA, with the antisense nucleic acid being an RNA or a DNA.
Preferably, the antisense nucleic acid binds to the start codon of the particular mRNA.
_ Le A 32 486-Foreign countries - A recombinant DNA molecule which contains a DNA sequence from which an antisense ribonucleic acid against the hTC mRNA is produced during transcription.
This said antisense ribonucleic acid comprises a nucleic acid sequence which can hybridize to the said hTC mRNA.
A DNA molecule of this nature can be used to prepare a cell line having a reduced expression of phTC by transfecting a phTC-producing cell line with this recombinant DNA molecule.
- A ribozyme which cleaves the hTC mRNA.
This ribozyme is preferably a Tetrahymena-type ribozyme or a hammerhead-type ribozyme.
- A recombinant DNA molecule which contains a DNA sequence whose transcription leads to the production of a ribozyme of this nature.
This recombinant DNA molecule can be used to transfect a phTC-producing cell line.
- A combination which consists of a pair of human hTC polynucleotide PCR
primers, with the primers preferably consisting of sequences which correspond to the sequence of the human hTC mRNA or which are complementary to this sequence.
- A combination which comprises a polynucleotide hybridization probe for the human hTC gene, with the probe preferably comprising at least 29 consecutive nucleotides which correspond to the sequence of the human hTC gene or which are complementary to this sequence.
- Animal models which can be used to investigate telomerase/telomere regulation in vivo. Thus, tumour development and ageing can, for example, be directly investigated using knockout animals or transgenic animals.

Le A 32 486-Foreign countries In the case of proteins or peptides, functional equivalents are those compounds which, while being distinguishable with regard to amino acid sequence, essentially have the same functions.
Known examples of these compounds are isoenzymes or so-called microheterogeneities in proteins.
In the case of the oligonucleic or polynucleic acids, functional equivalents are to be understood as being those compounds which differ in nucleotide sequence but which encode the same protein. The existence of such compounds may be attributed, for example, to the fact that the genetic code is degenerate.
Explanation of the figures:
Fig. l: cDNA sequence of the catalytic subunit of human telomerase (hTC) (SEQ m No. 1).
Fig. 2: Amino acid sequence which is deduced from the hTC DNA sequence depicted in Fig. 1 (SEQ ID No. 2).
The DNA sequence depicted in Fig. 1 can be completely translated from Position 64 to Position 3461 into an amino acid sequence. The amino acid residues are depicted in accordance with their single-letter code.
Fig. 3: Ethidium bromide-stained agarose gel containing AA281296 DNA which has been treated in different ways.
The figure shows an ethidium bromide-stained 0.8% agarose gel. Two different DNA size standards are loaded in lanes 1 and 8, with the DNA fragment lengths 3, 2, 0.5 and 0.4 kb being pointed out. The AA281296 DNA in pT7T3D was digested with a restriction enzyme Eco RI/Not I (lane 3), Pst I (lane 6) and Xho 1 (lane 7).
Undigested AA281296 DNA in pT7T3D was loaded onto lane 2. 1/10 of a PCR

Le A 32 486-Foreign countries . _ -15-mixture (1 minute 94°C, 2 minutes at 60°C, 3 minutes at 72°C) with the hTC
cDNA in pT7T3D and primers 1 (5' GAGTGTGTACGTC-GTCGAGCTGCTCAGGTC 3') and 4 (5' CACCCTCGAGGTGAGACGCTCGGCC 3') [lane 4] and, especially, with primers 6 (5' GCTCGTAGTTGAGCACGCTGAACAGTG 3') and 7 (5' GCCAAGTTCCTGCACTGGCTGATGAG 3') [lane 5] was applied to lanes 4 and 5.
Fig. 4: Detail from a comparison of the protein sequences of the Euplotes p123 (p123) and human (phTC) catalytic telomerase subunits.
The conditions (ktuple, gap penalty and gap length penalty) are listed for the Lipman-Pearson protein comparison, using the Lasergene program software (Dnastar, Inc.), which is depicted in this figure. The amino acid residues are depicted in accordance with their single-letter code. The amino acids which are identical between Euplotes aediculatus p123 and the identified EST+~ are also highlighted using the corresponding letter from the single-letter code. Amino acids which are not identical but whose function is similar or comparable are marked by a:.
Fig. 5: Part of a comparison of the protein sequences of the catalytic telomerase subunits of Euplotes p123 (p123), and yeast (est2p).
The condition (Ktuple, gap penalty and gap length penalty) are listed for the Lipman-Pearson protein comparison using Lasergene program software (Dnastar, Inc.) which is dipicted in this figure. The amino acid residues are shown in accordance with their single letter code. The amino acids which are identical between Euplotes aediculatus p123 and yeast est2p are likewise given prominence by the corresponding letter from the single-letter code. Amino acids which are not identical, but which are similar or comparable in function, are marked with a :.
Fig. 6: Detail from a comparison of the protein sequences of the yeast (est2p) and human (phTC) catalytic telomerase subunits.

Le A 32 486-Foreign countries The conditions (ktuple, gap penalty and gap length penalty) are listed for the Lipman-Pearson protein comparison, using the Lasergene program software (Dnastar, Inc.), which is depicted in this figure. The amino acid residues are depicted in accordance with their single-letter code. The amino acids which are identical between yeast est2p and the identified EST+, are also highlighted using the corresponding letter from the single-letter code. Amino acids which are not identical but whose function is similar or comparable are marked by a :.
Fig. 7: Detail from a comparison of the protein sequences of the Euplotes p123 (p123), yeast (est2p) and human (phTC) catalytic telomerase subunits. The comparison, depicted in Fig. 5, between Euplotes p123 (p123), yeast (est2p) and humans (phTC) was carried out using the Clustal Method subprogram of the Lasergene program software (Dnastar, Inc.) under standard conditions. The amino acid residues are depicted in accordance with their single-letter code. The amino acids which are identical between yeast est2p, Euplotes aediculatus p123 and the identified EST+, are also highlighted using the corresponding letter from the single-letter code. In addition, the regions which are identical between all three proteins are marked by a light grey bar above the protein sequence.
Fig. 8: Generated DNA sequence from Example 6 (RACE round 1) (SEQ m No. 3).
Fig. 9: Generated DNA sequence from Example 6 (RACE round 2) (SEQ >D No. 4).
Fig. 10: Generated DNA sequence from Example 6 (RACE round 3 j (SEQ >D No. 5).
Fig. 11: Generated DNA sequence from Example 8 (RACE round 3) (SEQ >D No. 6).
Fig. 12: Outline of the cloning of the complete hTC cDNA sequence. The positions of the start and stop codons are marked by arrows. The black regions of the rectangles symbolize protein-encoding sequence sections, whereas the pale grey regions symbolize 5'- and 3'- untranslated cDNA regions and/or denote intronsequences.

Le A 32 486-Foreign countries The dark grey blocks in the rectangle for the full-length cDNA either denote the telomerase-specific motif (T) or the seven reverse transcriptase motifs (numbers 1-7).
The DNA fragments which are required for preparing the complete hTC cDNA are likewise depicted as rectangles and are marked in accordance with their origin. All the rectangles are arranged in their positions relative to each other. The origin of the DNA fragment which is denoted by rectangle AA261296 is described in Example 2. The relative position of the 182 by deletion in this fragment (compare Example 2) is shown by a gap in the rectangle. The origin of the DNA fragments which are denoted by the rectangles RACE 1, RACE 2 and RACE 3 is described in Example 6. The origin of the DNA fragment which is denoted by the CSF
fragment rectangle is described in Example 7. The origin of the DNA fragment which is denoted by the lambda 12 rectangle is described in Example 9. The 3' part in the lambda 12 DNA fragment which encodes a cDNA which is not connected to hTC (compare Example 9) is not depicted in this figure. The complete hTC-cDNA
sequence was joined together at the 5' and 3' splice sites using the lambda 12 and CSF DNA fragments shown in this figure (compare Example 7). These splice sites were identified in a variety of fragments (RACE 1, RACE 3, lambda 12 and CSF).
Fig. 13: Detailed sections from a comparison of the protein sequences of the catalytic telomerase subunits of Euplotes and man (hTC).
The figure shows sections from a comparison of the protein sequences of the catalytic telomerase subunits of Euplotes and man (hTC). Attention is drawn to the reverse transcriptase motifs in the boxed-in areas. The figures under the boxes refer to the respective amino acid positions in Fig. 2. The amino acid residues are shown in accordance with their single-letter code. Identical amino acids are printed in bold. In the consensus sequence for the reverse transcriptase (RT
consensus) motif, h denotes a hydrophobic amino acid and p denotes a polar amino acid. If these groups of amino acids are retained in the Euplotes and hTC amino acid sequences, p and/or h is/are then printed in bold. Very highly conserved amino acids are underlaid in grey. In RT3, the boxed-in area is extended in order to cover Le A 32 486-Foreign countries ___ - 18-additional homologous amino acids. The telomerase-specific motif is described in Example 9.
Fig. 14: Generated DNA sequence from Example 11 (3' version) (SEQ >D No. 7).
The region which is not homologous with the DNA sequence depicted in Fig. 1 is made to stand out in bold.
Fig. 15: hTC expression in cancer cell lines and normal human tissue. Fig. A:
Approximately 2 pg of poly-A+ RNA from different human cell lines were immobilized on the Northern blot in accordance with the manufacturer's (Clontech) instruction. Specifically, the RNA originated from a melanoma (G361), a lung carcinoma (A549), an adenocarcinoma of the colon (SW480), from a Raji Burkitt's lymphoma, from a leukaemia cell line (MOLT-4), from a chronic leukaemia cell line (K-562), from a cervical tumour (HeLa) and from the 1 ~ leukaemia cell line HL60. The transcripts marked 4.4 kb, 6 kb and 9.5 kb are specific for hTC (compare Example 10). Fig. B: About 2 pg of poly-A+ RNA from different human tissues were immobilized on the Northern blot in accordance with the manufacturers (Clontech) instructions. Specifically, the RNA was isolated from heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas. An RNA size standard is shown.
Fig. 16: Western blot analysis of the rabbit sera against peptides from the human telomerase amino acid sequence (Example 12). In each case, 20 pl of the bacterial lysates from Example 13 were analysed in a western blot (Ausubel et al., 1987) using the antisera from Example 12. Lysates from bacteria which harbour the pMALEST construct were loaded in lanes 1, 2, 6 and 7. Lysates from bacteria which harbour the pMALAl construct were loaded in lanes 3, 4, 8 and 9. Lysates from bacteria which were not induced with IPTG (isopropyl-beta-thiogalactopyranoside) were loaded in lanes 1, 3, 6 and 8. Lysates from IPTG-induced bacteria were loaded in lanes 2, 4, 7 and 9. A standard size marker (10 kDa protein ladder from Life Technologies, Cat. No. 10064-012) was loaded Le A 32 486-Foreign countries in lane 5. The 50 kDa and 120 kDa bands are marked at the edges of the membranes. The PVDF membrane in Fig. A containing lanes 1 to 4 was incubated with preimmune sera against peptide B (compare Example 12). The PVDF
membrane in Fig. B containing lanes 6 to 9 was incubated with preimmune sera S against peptide C (compare Example 12). The PVDF membrane in Fig. B
containing lanes 1 to 4 was incubated with immune sera against peptide B
(compare Example 12). The PVDF membrane in Fig. B containing lanes 6 to 9 was incubated with immune sera against peptide C (compare Example 12).
Fig. 17: Autoradiogram of 35S-labelled, in vitro-translated protein. The complete in vitro-translated hTC (compare Example 15) was loaded in lane 1. A C-terminally truncated version of phTC was loaded in lane 2. Lane 3 shows a positive control for the in vitro translation which was supplied by the manufacturer (compare Example 15). A protein size standard for estimating protein sizes is marked on the right-hand side.
Fig. l8: Autoradiogram of 32P-labelled products from the TRAP assay (compare Example 15). A TRAP assay mixture without any added enzyme or protein was loaded, as a negative control, in lanes 1 and 2. A TRAP assay mixture containing partially purified human telomerase from HeLa cells was loaded, as a positive control, in lanes 3 and 4. A TRAP assay mixture containing in vitro-translated phTC was loaded, undiluted, in lanes 5 and 6. A TRAP assay mixture containing in vitro-translated phTC, at a 1:4 dilution, was loaded in lanes 7 and 8. A
TRAP
assay mixture containing in vitro-translated phTC, at a dilution of 1:16, was loaded in lanes 9 and 10. A TRAP assay mixture containing in vitro-translated luciferase was loaded, as a negative control, in lanes 11 and 12.
Fig. 19: Autoradiogram of 32P-labelled products from the direct telomerase assay (compare Example 15). A radioactively labelled 10 by marker was loaded in lane 1. A
telomer oligonucleotide ([TTAGGG)3) which was radioactively labelled 5' was loaded in lane 2. Lane 3 is an empty lane. Partially purified human telomerase Le A 32 486-Foreign countries from HeLa cells was used in a direct assay and the synthesis product was loaded, as a positive control, in lane 4. The in vitro-translated phTC from Example 15 was used in a direct assay and the synthesis product was loaded in lane 5.

Le A 32 486-Foreign countries Examples Example 1 It is nowadays accepted that less than 5°l0 of the human genome is in fact transcribed and translated into protein. Even before the genome has been completely sequenced, it is possible to obtain important information about the 60,000-70,000 genes in a human cell by investigating these coding moieties of the genome in a specific manner. The automation of high-throughput DNA sequencing technology in the last 10 to 15 years has made it possible to collect many cDNAs from plasmid cDNA libraries of widely differing origin and sequence the 5' or 3' end in each case. These short DNA sequences, which are typically of from 300 to 400 by in length, are termed expressed sequence tags or ESTs for short and are compiled in various specialized data bases. The EST approach was initially described by Okubo et al.
(1992) and transferred to a larger scale by Adams et al. (1992). At present, approximately 50,000 human cell genes are partially sequenced and documented as EST entries.
By comparing with the DNA and amino acid sequences of known genes, it is possible to identify related, but hitherto unkown, genes in these EST databases (Gerhold and Caskey, 1996). tBLASTn (Altschul et al., 1990) is a search algorithm which has proved particularly useful for this purpose. This algorithm translates every DNA clone in the EST
data base in all six possible reading frames and compares these amino acid sequences with the known protein sequence.
The EST data base at the National Center for Biotechnology Information (NCB
was searched with the recently published protein sequence for the Euplotes aediculatus catalytic telomerase subunit p123 (Lingner et al., 1997). This resulted in a human EST
with the accession number AA281296 being identified which exhibits significant homology with p123 in reading frame +1. This amino acid sequence in reading frame +1 is termed Est,.~ in that which follows.
_ Le A 32 486-Foreign countries The homology between p123 and the Est+, is most conspicuous in two sequence regions which are separated by 30 amino acids. The longer sequence region, which in p123 extends from amino acid 438 to amino acid 484, is 38% identical to the corresponding region Est+~. If similar amino acids are also taken into consideration, the congruence is even 59°l0. The second block of homology extends, in the p123 protein, from amino acid 513 to amino acid 530 and exhibits 44% identity with the corresponding sequence segment in the identified Est~.~. A congruence of 61% is obtained when amino acid residues having similar properties are taken into account.
The P (probability) value is an important parameter for assessing a BLAST
search. P
indicates the probability of also finding a specific segment pair in a BLAST
search using a random sequence and varies numerically between 0 (highly significant result) and 1 (insignificant result). Thus, comparison of the p123 equivalent from yeast (est2p) with the NCBI EST data base, for example, gave a negative result: The EST which was found had a probability of P=1 (Tab. 1). On the other hand, human telomerase-associated protein 1 (hTPI), which was found in an EST data base which is not available to the general public (Harrington et al., 1997), gives a probability of P=0.004.
known gene (species)P identified gene origin of the cDNA
i library est2p (Saccharomyces0.999 Rat EST Kidney cerevisiae p80 (Tetrahymena 0.004 hTPI (Harrington Crypts of the intestinal et al., termophilia) 1997) epithelium p123 (Euplotes 3.5X10'6AA281296 Germinal centres of the aediculatus) tonsils Tab. 1: Comparison of three tBlastn search runs using different known genes.

Le A 32 486-Foreign countries The human EST AA281296 which was identified by the comparison with p123 has a probability of P=3.Sx10~.
These data suggest that the identified EST in all probability encodes a fragment of the catalytic subunit of human telomerase. For this reason, the corresponding gene is abbreviated below to hTC (human Telomerase, catalytic) and the deduced protein is abbreviated to phTC.
Example 2 The EST which was identified by the comparison with p123 was fed into the EST
data base on 2 April 1997 and has not been published in any journal. According to information obtained from the National Center for Biotechnology Information, the cDNA
library which contains this EST clone was prepared as follows:
After the mRNA had been prepared from the germinal centres of the tonsils, a cDNA
synthesis was earned out and the double-stranded cDNA fragments were cloned in an orientated manner, using the Not I and Eco RI restriction enzyme cleavage sites, into the vector pT7T3D-Pac.
The 389 by which had been fed into the EST database were sequenced using the -28m13 rev2 primer supplied by Amersham (DNA sequence, see Fig. 1 Position 1685 to 2073).
Lasergene program software (Dnastar Inc.) was used to translate the DNA
sequence of EST AA281296 in accordance with the human genetic code. The resulting amino acid sequence (Est+i) corresponds to Position 542 to 670 in Fig. 2.
The deduced protein sequence of Est+~ is composed of 129 amino acids, including 27 basic, 11 acidic, 51 hydrophobic and 28 polar amino acid residues.

Le A 32 486-Foreign countries The EST (AA281296) which was identified in Example 1 was obtained commercially from Research Genetics, Inc. (Huntsville) in the form of a plasmid transformed into E. coli and analyse experimentally:
As shown in the ethidium bromide-stained agarose gel depicted in Fig. 3, a fragment from EST AA281296 of approximately 2.2 kb in size is liberated from the vector pT7T3D after subjecting the prepared plasmid DNA to restriction digestion. With the aid of a polymerase chain reaction (PCR), which was carned out in parallel and which made use of specific internal primers, EST AA281296 was inspected: the lengths of the expected PCR
products are 325 and 380 by and are in agreement with the lengths of the fragments which were found experimentally (cf. tracks 4 and 5 in Fig. 3). This therefore demonstrated that the E.coli clone supplied by Research Genetics, Int. (Huntsville) therefore harbours the identified EST as a plasmid.
After the DNA had been prepared, the 2176 by of the insert in total were identified by means of double-strand sequencing. A comparison of the DNA sequences of clone AA281296 and of the CSF fragment (compare Example 7) showed that there was a 182 by deletion (Positions 2352 to 2533, Fig. 1) and that the open reading frame is consequently displaced in this region.
In summary, the DNA sequence of clone AA281296 is composed of the sequence information shown in Fig. 1 (Positions 1685 to 2351 and Positions 2534 to 4042).
Example 3 The tBLASTn comparison only identifies the regions in which there is the greatest agreement between p123 and Est+, (amino acids 438-530, in p123), whereas the intervening amino acids are not taken into account. A Lipman-Pearson protein comparison was carried out in order to be able to draw conclusions about the relatedness of the protein sequences over a larger region (amino acids 437-554, in p123) (see Fig. 4). When this was done, 34% of the amino acids were found to be identical while 59010 of the amino acids were found to be either identical or biochemically similar. This result- demonstrates that the relatedness of these Le A 32 486-Foreign countries proteins also continues outside the regions of homology which were found using the tBLASTn program.
As has recently been reported (Lingner et al., 1997), Euplotes aediculatus p123 and Saccharomyces cerevisiae est2p are homologous to each other. In order to relate the degree of affinity between p123 and est2p to the homology between p123 and Est+, which is described here, the Lipman-Pearson protein comparison was employed to compare the above-described region of p123 (amino acids 437-554) with est2p, too, using identical parameters. This showed that, in this chosen region, p123 and est2p are 21% identical and that 22% of their amino acid residues are either identical or biochemically similar (see Fig.
5). Accordingly, the homology between Est,.~ and Euplotes p123 is significantly higher than between p123 and est2p.
Example 4 The homology of p123 with Est+~ and est2p suggests that all 3 proteins belong to the same protein family. In order to confirm this assumption, est2p was compared with Est+~ under the conditions described in Example 3 (see Fig. 6). This showed that Est+~ is 20%
identical to est2p, that is exhibits a degree of homology which is comparable to that of p123 to est2p.
This comparatively low level of congruence also confirms the finding that no significant EST
was identified in the tBLASTn search using est2p (see Example 1).
Example 5 A computer comparison using p123, est2p and phTC was carned out in order to identify possibly functional domains which are important for the protein family consisting of catalytic telomerase subunits derived from different species (see Fig. 7). In this analysis, two regions which are present in all three proteins are particularly conspicuous (see Fig.

7). At present, no unambiguous function can be assigned to the region which, in p123, corresponds to amino acids 447 to 460 (Fig. 13, telomerase motif). A motif search using the Genetics Computer Le A 32 486-Foreign countries Group (GCG) Wisconsin Sequence Analysis Package and a search in a protein data base (Swissprot, version of 8.6.199?) did not provide any significant insights.
On the other hand, a second region which is homologous between p123, est2p and phTC, corresponding in p123 to amino acids 512-526, exhibits a consensus motif for a reverse transcriptase (RT) (Figs. 7 and 13). Lingner et al., (1997) showed that p123/est2p contain a total of 6 such RT motifs, which are essential for the catalytic function of p123/est2p. As depicted in Figs. 7 and 13, two such RT motifs are also conserved in the sequence of phTC
which has been investigated. These motifs are the RT motifs which are located to the furthest extent N-terminally in p123/est2p (Lingner et al., 1997).
The primary sequences of reverse transcriptases are strongly divergent; only a few amino acids are fully conserved within a separate motif (Pock et al., 1989 and Xiong and Eickbush, 1990). In addition, due to having different distances between the conserved RT
motifs, reverse transcriptases which are encoded by retroviruses or long terminal repeat (LTR) retroposons differ from those reverse transcriptases which are encoded by non-LTR
retroposons or group II introns (Xiong and Eickbush, 1990). Based on the structure of their RT motifs, p123, est2p and phTC are to be assigned to the latter RT group.
Interestingly, in this context, the consensus sequences of the RT motifs in phTC correspond most closely to the postulated RT consensus motif: of eight amino acid residues within the two RT motifs, 6 are present in the case of phTC while only 5 are present in the case of p123 and esp2p (Figs. 7 and 13). It is striking in this context how the hydrophobic amino acids, such as leucine and isoleucine, and the amino acids lysine and arginine, in particular, are in specific positions (Figs. 7 and 13).
In summary, it was hereby possible to demonstrate, at the descriptive level, that the AA281296 clone, identified due to its homology with p123, is a fragment of the catalytic subunit of human telomerase.

Le A 32 486-Foreign countries Example 6 For cloning the 5' end of the hTC-cDNA, three consecutive RACE (rapid amplification of cDNA ends) reactions were carned out in addition to the homology screening described in Example 8. Marathon-Ready cDNA (Clontech) form the human leukaemia cell line K562 or from human testis tissue was employed as the cDNA source. The implementation of the individual RACE rounds, as well as the results obtained, are described below.
In addition to this, the sequence information obtained in the RACE rounds was used in order to amplify the individual fragments from a contiguous cDNA clone by means of PCR.
RACE round 1:
In a final volume of 50 pl, 10 pmol of dNTP-mix were added to 5 ~1 of K562 Marathon-Ready cDNA (from Clontech, Catalogue Number 7441-1), and a PCR reaction was carned out in 1 x Klen Taq PCR reaction buffer and 1 x advantage Klen Taq polymerase mix (from Clontec). 10 pmol of the internal gene-specific primer GSP2 (5' -GCAACTTGCTCCAGACACTTCTTCCGG-3') from the 5' region of the hTC-EST
clone and 10 pmol of the Marathon Adaptor primer AP1 (5'-CCATCCTAATACGACTCACTATAGGGC-3'; from Clontech) were added as primers.
The PCR was carned out in 4 steps. After a one-minute denaturation at 94°C, denaturation was then carned out for 5 cycles of 30 sec at 94°C and the primers were then subsequently annealed for 4 min at 72°C and the DNA chain was extended. There then followed 5 cycles in which the DNA was denatured for 30 sec at 94°C but the subsequent primer extension took place for 4 min at 70°C. Finally, 22 cycles were then carried out in which, after the 30 sec DNA denaturation, the primer annealing and chain extension took place for 4 min at 68°C.
Following this PCR, the PCR product was diluted 1:50. 5 ~.I of this dilution were used in a second "nested" PCR together with 10 pmol of dNTP-mix in 1 x 10 Klen Taq PCR
reaction buffer and 1 x Advantage Klen Tag polymerase mix and also 10 pmol of primer GSP2 and Le A 32 486-Foreign countries pmol of the "nested" Marathon Adaptor primer AP2 (5'-ACTCACTATAGGGCTCGAGCGGC-3 ; from Clontech). The PCR conditions corresponded to the parameters selected in the first PCR. As the only exception, only 16 cycles were chosen, instead of 22 cycles, in the last PCR step.

A DNA fragment of 1153 by in length was obtained as the product of this nested RACE
PCR. This fragment was cloned into the TA cloning vector pCR2.1 from Invitrogen and subjected to complete double-strand sequencing (Fig. 8 and SEQ ID No. 3).
10 Nucleotides 974 to 1153 represent the nucleotide region 1629 to 1808 of the hTC-cDNA
which is depicted in Fig. 1. The nucleotide region extending from by 1 to by 973, which does not exhibit any homology with the hTC-cDNA sequence shown in Fig. 1, represents intron sequences of the hTC gene (data not shown). A 3' splice consensus sequence is located at the exon-intron transition. The presence of intron sequences could be due to using incompletely spliced mRNA as the starting substance for the cDNA synthesis. Genomic DNA
contamination in the cDNA could also be an explanation for intron sequences being found.
RACE round 2:
Based on the sequence data obtained in the first RACE round, a second RACE was carried out using the gene-specific primer GSPS from the 5' region of RACE product 1 (5'-GGCAGTGACCAGGAGGCAACGAGAGG-3') and the AP1 primer. Marathon-Ready cDNA from human testis (from Clontech; Catalogue Number 7414-1) was used as the cDNA
source. The same PCR conditions were selected as in the 1st PCT in RACE round 1. The 1st PCR was also followed, in RACE round 2, by a 2nd "nested" PCR using diluted PCR product as the cDNA source. The gene-specific primer GSP6 from the 5' region of RACE
product 1 (5'-GGCACACTCGGCAGGAAACGCACATGG-3') and the AP2 primer were used as the "nested" PCR primers. The conditions corresponded to parameters for the nested PCR from RACE round 1.
_ Le A 32 486-Foreign countries The PCR product of 412 by in length from the nested PCR of RACE round 2 was cloned into the TA cloning vector pCRII-Topo from Invitrogen and sequence completely (Fig.
9 and SEQ
ID No. 4). The sequence segment from by 267 to by 412 is completely homologous with the 5' region of the product from RACE 1. The region from by 1 to by 266 extends RACE
product 1 at the 5' end. This RACE product 2 is probably, in its entirety, an intron region of the hTC gene (data not shown).
RACE round 3:
A third RACE round led to the identification of hTC-cDNA regions which were located further on in the 5' direction. Using the sequence results from RACE round 2 as a base, a gene-specific primer GSP9 (5'-CCTCCTCTGTTCACTGCTCTGGCC-3') was selected from the 5' region of RACE product 2 and used in a new RACE together with the APl primer and Marathon-Ready cDNA from human testis (from Clontech). The RACE conditions were the same as those used in the 1st PCR in RACES 1 and 2. In the "nested" RACE which followed, and which took place, in accordance with the "nested" RACES in rounds 1 and 2, using the gene-specific primer GSP10 from the 5' region of RACE product 2 (5'-CGTAAGTTTATGCAAACTGGACAGG-3') and AP2, a fragment of 1012 by in length (Fig. 10 and SEQ >D No. 5) was amplified and cloned into the TA cloning vector pCRII--TOPO. Subsequent sequencing showed that the 3' region of this RACE fragment (bp 817 -by 1012) evidently still constitutes an intron sequence of the hTC gene. The region from by 889 to by 1012 is completely homologous with the 5' region of RACE product 2. On the other hand, the 5' region of this fragment, from by 1 to by 816, is identical to the by 814 -bp 1629 region of the hTC-cDNA which is shown in Fig. 1. A potential 5' splice consensus sequence is located at the exon-intron transition.
Examule 7 A PCR was carried out in order to clone a contiguous fragment from the sequence information obtained from RACE 2 and clone AA281296. Marathon-Ready cDNA from human testis (from Clontech; Catalogue Number 7414-1) was used as the cDNA
source. The Le A 32 486-Foreign countries PCR mixture was as described under RACE 1 (compare Example 6) but using the primers CSF (5'-CGAGTGGACACGGTGATCTCTGCC-3') from the 5' region of RACE 2 and primer C3B (5'-GCACACCTTTGGTCACTCCAAATTCC-3') from a 3' region of clone AA281296. The PCR was carried out in 2 steps. After a one-minute denaturation at 94°C, denaturation was then carried out for 36 cycles of 30 sec at 94°C and, after that, the primers were annealed, and the DNA chain was extended, for 4 min at 68°C.
A DNA fragment of 2486 by in length, which is designated the CSF fragment below, was obtained as the product of this PCR. This fragment was cloned into the TA
cloning vector pCRII-TOPO from Invitrogen and subjected to complete double-strand sequencing.
A
comparison of the DNA sequences of the CSF fragment and the AA281296 clone showed that there was an in-frame insertion of 182 by between RT motif 3 and RT motif 4 (Positions 2352 to 2533, Fig. 1). A further comparison of DNA of the CSF fragment with the sequences from the three RACE rounds made it clear that an intron which was already identified in RACE 2 was present at the 3' end of CSF. A 3' splice consensus sequence is located at the exon-intron transition. In summary, the DNA sequence of the CSF fragment is consequently composed of the sequence information shown in Fig. 9 (Position 64 to 278) and the sequence data shown in Fig. 1 (Positions 1636 to 3908).
Example 8 For cloning the 5' end of the hTC-cDNA, a homology screening (Ausubel et al., 1987) was carned out in addition to the RACE protocol described in Example 6. A human erythroleukaemia 5'-stretch plus cDNA library (from Clontech, cat. No.
HL,5016b) from the human leukaemia cell line K562 was used as the cDNA source. Approximately 3 x 106 Pfu of this random and oligo-dT-primed library were plated out and used for screening as described in Ausubel et al. (1987). A radioactively labelled hTC-DNA fragment of 719 by in length (Positions 1685 to 2404, corresponding to Fig. 1) was used as the probe.
Following a rescreening with the same hTC probe, the ~, clone 12 was verified as being positive out of 20 putatively positive ~, clones. Following plaque purification and ~, DNA

Le A 32 486-Foreign countries preparation (Ausubel et al., 1987), the 4 kb insert was recloned into the pBluescript vector and sequenced (Fig. 11 and SEQ 1D No. 6).
A comparison of the ~, clone 12 sequence with the sequences of the RACE clones and the DNA sequence of clone AA281296 showed that this clone, which was identified in the homology screening, encodes a 5' part of the hTC-cDNA and possesses a putative ATG start codon in Position 63 in accordance with Fig. 1. There is no stop codon in the same reading frame 5' of this ATG. Subsequent sequence analyses make it clear that ~, clone 12 probably contains an intron from Positions 1656 to 2004. Very well conserved 5' and 3' splice sites provide support for this hypothesis. The hTC-cDNA-encoding sequence then continues from Position 2005 to Position 2382. The sequence from 2383 to the 3' end of ~, clone 12 exhibits a conspicuous open reading frame in reading frame -4. A bioinformatic analysis of the conesponding DNA sequence showed that, over about 400 bp, this reading frame is identical to a variety of ESTs which have no connection with the hTC cDNA. Consequently, ~, clone 12 is a chimeric clone which essentially consists of the 5' end of the h'fC cDNA and another cDNA clone of unknown function.
A diagrammatic summary showing the relative orientations of the RACE products, and the homology screening, is depicted in Fig.l2. The complete sequence of the hTC
cDNA (Fig. 1) was assembled from ~, clone 12 (Positions 21 to 1655 in accordance with Fig.
11 ), the CSF
PCR product (Positions 1636 to 3908 in accordance with Fig. 1) and EST

(Positions 3909 to 4042, in accordance with Fig. 1).
Example 9 A total of seven motifs for reverse transcriptases (RT motifs) was identified by comparing the phTG protein sequence (Fig. 2 and SEQ 1D NO. 2) with a reverse transcriptase consensus sequence (Poch et al., 1989, Xiong and Eickbush, 1990) (Fig. 13). Within these motifs, some amino acids are highly conserved not only between the RT consensus sequence and phTC but also in comparison with the Euplotes telomeras~ protein. Thus, two aspartic acids (Positions 868 and 869 in Fig. 2) are, for example, completely conserved in RT motif 5 (Fig. 13). RT

Le A 32 486-Foreign countries motif 7, which was deduced from other reverse transcriptases (Pock et al., 1989, Xiong and Eickbush, 1990), was only demonstrated in the human catalytic telomerase subunit and not in the Euplotes protein (Fig. 13).
Structural features which can only be found in the telomerase proteins and not in other reverse transcriptases are also conspicuous. The telomerase motif (Positions 553 and 565 in Fig. 2) is a structure which is specific for this protein family since it does not occur in any previously known protein. A further feature which has only been identified in the catalytic telomerase proteins is the difference between RT motifs 3 and 4, which distance, at 107 amino acids, is markedly greater than in other RTs. These special features indicate that the catalytic subunits of the telomerases from different species probably constitute a separate subgroup of RNA-dependent DNA polymerases.
Example 10 Expression of the telomerase RNA subunit (hTR) does not correlate with telomerase activity but, instead, is observed ubiquitously (Feng et al., 1995). Consequently, the question arises as to whether expression of the catalytic telomerase subunit is associated with telomerase activity.
Northern blot experiments (Ausubel et al., 1987) were carned out in order to analyze the level of hTC expression. The commercially available Northern blots were supplied with a number of RNA preparations from normal human tissue (from Clontech; catalogue No. 7760-1) or with RNA samples from human cancer cell lines (from Clontech;
Catalogue Number 7757-1). A radioactively labelled hTC DNA fragment of 719 by in length (Positions 1685 to 2404, in accordance with Fig. 1) was used as the probe. The membranes were incubated with the probe in accordance with the manufactures s (Clontech) instructions.
Two main RNA transcripts, of about 9.5 kb and 4.4 kb in size, and an additional RNA
transcript of about 6 kb, which transcripts cross-hybridize with the probe, were detected in the eight human cell lines (3 leukaemia cell lines, 3 carcinoma cell lines, one melanoma and one Le A 32 486-Foreign countries lymphoma) tested (Fig.lS, Fig. A). In the comparison, the hTC mRNA was expressed most strongly in the leukaemia cell lines K-562 and HL-60 (Fig. 15, Fig. A). By contrast, it was not possible to detect the hTC transcript in the normal tissues (heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas) which were tested (Fig. 15, Fig. B).
This observation is not surprising since it was not possible to detect any telomerase activity, either, in these tissues (Kim et al., 1994).
These data indicate that the induction of hTC expression plays an important role in activating the telomerase during tumour development.
Examule 11 Several PCR products, whose sizes only differed from each other to a minimal extent, were always obtained when the hTC cDNA fragments from various cDNA libraries (Clontech Marathon Ready cDNA from the human leukaemia cell line K562 and from human testis and also cDNA from the human premyeloid leukaemia cell line HL60) were subjected to PCR
amplification. In order to elucidate the differences between the different hTC-PCR products, a fragment of the hTC cDNA depicted in Fig. 1 extending from by 1783 to by 3901 was amplified using the primers CSA (5'-CCGGAAGAGTGTCTGGAGCAAGTTGC-3') and C3B (5'-GCACACCTTTGGTCACTCCAAATTCC-3'). Marathon-Ready cDNA from K562 leukaemia cells (from Clontech; Catalogue Number 7441-1) was used as the cDNA
source (PCR1 and 2). In a third PCR, a hTC fragment, from by 1695 to by 3463, of the hTC cDNA
in Fig.l was amplified from HL60 cDNA using the primers GSP1 front (5'-GGCTGATGAGTGTGTACGTCGTCGAG-3') and HTRT3A
(5'-GGGTGGCCATCAGTCCAGGATGG-3').
The conditions of the 3 PCR reactions are described below:
In the first PCR, and in a final volume of 50 pl, 10 pmol of dNTP mix were added to 5 pl of K562 Marathon-Ready cDNA, and a PCR reaction was carl-ied out in 1 x Klen Taq PCR
reaction buffer and 1 x Advantage Klen Taq polymerase mix (from Clontech). 10 pmol of Le A 32 486-Foreign countries each of the primers CSA and CSB were added. The PCR was carried out in 3 steps. A
one-minute denaturation at 94°C was followed by 35 PCR cycles in which the DNA was firstly denatured for 30 sec at 94°C and the primers were then annealed, and the DNA chain was extended, for 4 min at 68°C. In conclusion, there followed a chain extension for 10 min at 68°C. The resulting PCR products were cloned into the TA cloning vector pCRII-TOPO
from Invitrogen.
In a second PCR, 10 pmol of each of the primers CSA and C3B, 10 pmol of dNTP
mix and 2 U of Taq DNA polymerise (from Gibco-BRL) were added to 5 p.l of K562 Marathon-Ready cDNA, and a PCR reaction was carned out in 1 x PCR buffer (from Perkin Elmer) in a final volume of 50 pl. The PCR reaction was carried out in 3 steps. The DNA
was firstly denatured for 3 min at 94°C. There then followed 34 cycles in which, consecutively, the DNA was denatured for 45 sec at 94°C, primer annealing then took place for 1 min at 68°C
and, after that, the DNA chain was extended for 3 min at 72°C. In the last PCR step, a 1 S concluding chain extension was carned out for 10 min at 72°C. The resulting PCR products were cloned into the TA cloning vector pCR2.1 from Invitrogen.
For the third PCR, the cDNA synthesis kit from Boehringer Mannheim was first of all used to carry out a cDNA synthesis from 2 pg of DNaseI-treated poly-A RNA from the human premyeloid cell line HL60 in accordance with the manufacturer's instructions.
1 pl of this I3L60 cDNA was then mixed with 10 pmol of each of the primers GSP1 front and and also 10 pmol of dNTP mix, in a final volume of 50 pl, and, after 1.25 pl of DMSO in 1 x Klen Taq PCR reaction buffer and 1 x Advantage Klen Taq polymerise mix (from Clontech) had been added, a PCR reaction was carned out. The PCR reaction proceeded in 3 steps. After a denaturation for 3 min at 94°C, the DNA was initially denatured for 1 min at 94°C and the primers were then annealed, and the DNA chain extended, for 4 min at 68°C, over 37 cycles. The reaction was concluded by a further incubation for 10 min at 68°C. The PCR products were cloned into the TA cloning vector pCR2.1-TOPO.

Le A 32 486-Foreign countries Complete double-strand sequencing of the cloned hTC cDNA fragments from PCRs 1 and 2, and partial sequencing of the hTC cDNA fragments obtained from PCR 3, showed that, in addition to the hTC cDNA depicted in Fig. 1, 4 variants of this cDNA exist in human cells, i.e.:
Variant 1 of human hTC cDNA is distinguished by a deletion of 182 by in length extending from nucleotides 2345 to 2526. This deletion results in the ORF being displaced, with a truncated hTC protein, which lacks RT motifs 4 to 7, being read off.
Variant 2 of human hTC cDNA exhibits a deletion of 36 by in length extending from nucleotides 2184 to 2219. RT motif 3 is lost as a result of this deletion.
However, the reading frame is retained and a protein is produced which selectively lacks RT motif 3.
Variant 3 of human hTC cDNA is a combination of variants 1 and 2. It exhibits both a deletion from by 2184 to 2219 and a deletion from by 2345 to 2526.
Variant 4 of human hTC cDNA is distinguished by the loss of the nucleotide region from by 3219 to by 3842. This missing sequence is replaced by a sequence which is not homologous with hTC. From by 3843 onwards, the sequence is once again completely identical to the hTC sequence depicted in Fig. 1. The sequence of variant 4 is shown in Fig. 14. In accordance with the 5' primer chosen, it begins with by 1783 of the hTC cDNA
shown in Fig. 1. The region which is not homologous is emphasized in bold and, from Position 3219 to Position 3451 (Fig. 14 and SEQ >D No. 7) is, to the extent of 98.7%, in agreement, at the DNA level, with an EST (Accession No. AA299878) from a human uterus tumour.
Example 12 In order to obtain antisera having specificity for the catalytic subunit of human telomerase, the available nucleotide sequence (Fig. 1) was translated into an amino acid sequence (Fig. 2). Using a secondary structure prediction program (PROTEAN, from the DNAStar Le A 32 486-Foreign countries software package, DNASTAR Inc., Madison, WI, USA), two peptides were chosen which, with a certain degree of probability, evoke an immune response. These are the following peptides, which are depicted in the one-letter code for amino acids:
B: C-K-R-V-Q-L-R-E-L-S-E-A-E-V-R-Q - CONH2/Pos. 594 - 608 C: C-Q-E-T-S-P-L-R-D-A-V-V-I-E-Q-S-S-S-L-N-E - CONH2/Pos. 781-800 The cysteines which are underlined are not derived from the telomerase sequence but were additionally added on as linkers for the coupling.
The peptides were coupled to keyhole limpet hemocyanin (KLI-~ using the thiol-reactive coupling reagent m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS). Two rabbits were in each case immunized with these coupled peptides at intervals of from 2 to 4 weeks.
Prior to immunization, 5 ml of blood were withdrawn in order to obtain preimmune sera.
After 4 immunizations, 5 ml of blood were likewise withdrawn for obtaining immune sera.
These sera were tested for reactivity with fusion proteins (Example 13) in a Western blotting experiment (Ausubel et al., 1987).
Example 13 Bacterial expression experiments were carried out in order to be able to analyse the protein of the catalytic telomerase subunit.
The constructs of these experiments are described below:
For the expression construct pMaIEST, the insert in the AA281296 clone mentioned in Example 2 was excised with restriction enzymes Eco RI and Not I and the cleavage sites were filled in using the Klenow fragment (Ausubel et al., 1987); the insert was then cloned into the given reading frame of the maltose-binding protein of the bacterial expression vector pMAL-C2 (from New England Biolabs). Vector pMAL-C2 was digested with restriction Le A 32 486-Foreign countries enzyme Pst I and the protruding single-strand ends were removed with T4 DNA
polymerase (Ausubel et al., 1987).
The expression construct pMalAl contains the nucleotide sequence of Fig.l from Position 1789 to Position 3908. This DNA fragment was amplified from a commercially available K562 Marathon-Ready cDNA library (from Clontech, Catalogue Number 7441-1) by means of PCR using the primers CSA (5'-ACCGGAAGAGTGTCTGGAGCAAGTTG-3') and C3B (5'-GCACACCTTTGGTCACTCCAAATTCC-3'), and cloned into the TA cloning vector pCRII-TOPO from Invitrogen. The PCR conditions were as described in Example 7.
For the expression construct pMalAl, the insert was excised using the restriction enzyme Eco RI and the cleavage sites were filled in using the Klenow fragment (Ausubel et al., 1987); the insert was then cloned into the bacterial expression vector pMAL-C2 (from New England Biolabs) which had been cleaved with the restriction enzyme Xmn I.
These constructs were then used for protein expression in the bacterial strain E. coli DHSa.
The expression conditions were those as described in the instructions provided by New England Biolabs (Catalogue Number 800). The bacterial lysates which were prepared were tested in a Western blotting experiment (Ausubel et al., 1987).
Example 14 The bacterial lysates from Example 13 were analysed in a Western blot (Ausubel et al., 1987) using the antisera from Example 12.
Since the proportion of the fusion represented by the maltose-binding protein is about 43 kDa in size, fusion proteins of about 74 kDa and 106 kDa are expected for the pMaIEST and pMalAl constructs, respectively.
When comparing the preimmune sera with the sera following the first immunization, it becomes evident that specific antibodies were formed against the B and C
epitopes (Fig. 16).
Furthermore, in addition to the expected 74 kDa and 106 kDa proteins, respectively, smaller Le A 32 486-Forei~~n countries protein fragments were also observed which react with the antisera. These smaller products probably originate from premature products.
Only the epitope for serum B is present on the fusion protein from the expression using pMaIEST. By contrast, the epitopes for sera B and C are present on the fusion protein from pMalAl. For this reason, antiserum C does not recognize the pMaIEST expression product and only recognizes the larger protein fragments from the expression experiments using pMalAl. This observation underlines the high degree of specificity of the antisera which were generated.
Example 15 In order to be able to analyse the protein of the catalytic telomerase subunit, the protein component should be reconstituted in vitro together with the RNA component.
The constructs for these experiments are described below:
The RNA component of 504 nt in length (Feng et al., 1995) was amplified from a 293 cell cDNA library using the primers HTR9BAM (5'-CGCGG-ATCCTAATACGACTCACTATAGGGTTGCGGAGGGTGGGCCTG-3') and HTR2BAM
(5'-CGCGGATCCCGGCGAGGGGTGACGGATGC-3). Primer HTR9BAM contains a T7 promoter from nucleotide 10 to 29. In the PCR, 10 pmol of dNTP mix were added, in a final volume of 100 pl, to 3 pl of cDNA from 293 cells, and a PCR reaction was called out in 1 x PCR reaction buffer containing 0.5 pl of Taq polymerase (from Gibco). 10 pmol of each of the primers HTR9BAM and HTR2BAM were added. The PCR was carried out in 3 steps.
A ten-minute denaturation at 94°C was followed by 35 PCR cycles in which the DNA was first of all denatured for one minute at 94°C and, after that, the primers were annealed, and the DNA chain was extended, for 2 min at 62°C. In conclusion, there followed a chain extension for 4 min at 72°C. The resulting PCR products were cloned, after a restriction digestion with Bam HI, into the Bam HI cleavage site of vector pUCl9 in such a way that the Le A 32 486-Foreign countries RNA component is under the control of the T7 promoter. This construct is designated HTR504 in that which follows.
The cDNA fragment of 3411 by in length (Position 60 to Position 3470, Fig. 1) was cloned into the vector PCRII TOPO (from Invitrogen). Detailed information on the cloning is given in Examples 8 and 7, and also in Fig. 12. In this construct, which is designated HTC FL, the T7 promoter is located 5' before the hTC cDNA.
The catalytic telomerase protein component was synthesized in a commercially available transcription/translation system, after adding the hTC FL construct, in accordance with the manufacturer's (Promega; Catalogue Number L4610) instructions. Whether the in vitro translation of the expected 127 kDa product had been successful was checked in an SDS-PAGE (Ausubel et al., 1987) using 35S-labelled cysteine (Fig. 17).
The telomerase RNA component was synthesized using a transcription system in accordance with the manufacturer's (Ambion; Catalogue Number 1344) instructions or using the method described by Pokrovskaya and Gurevich ( 1994).
For the in vitro re-constitution, 0.5 ~g of hTRNA was added to 50 pl of the above-described translation mixture containing the hTC FL construct and the whole was incubated at 37°C for 10 min. The enzymatic activity of 2 p.l of this mixture was investigated using the TRAP assay (N.W. Kim et al., 1994). The measurement of the activity, by the same method, of telomerase which was purified from HeLa cells (Shay et al., 1994) was used as the positive control. As can be seen in Fig. 18, both the reconstituted enzyme and the native enzyme produce the same product pattern, i.e. the nucleotide ladder which is characteristic for telomerase. This result also verifies that a single protein component, together with the RNA, is sufficient for the enzymatic telomerase activity.
In addition to the described TRAP assay, 5 pl of the reconstitution mixture were tested for its activity in a direct telomerase assay (Shay et al., 1994). In this experiment, too, the Le A 32 486-Foreign countries _. -40-characteristic nucleotide ladder verifies the successful reconstitution of recombinant hTC
protein and telomerase RNA component.
In summary, it was hereby possible to demonstrate, at the functional level, that the identified, and completely cloned, hTC-cDNA constitutes the catalytic subunit of human telomerase.

Le A 32 486-Foreign countries . _ -41 -Reference list Adams, M.D., Dubnick, M., Kerlavage, A.R., Moreno, R., Kelley, J-M., Utterback, T.R., Nagle, J.W., Fields, C. and Venter, J.C. (1992). Sequence identification of 2,375 human brain genes. Nature 355: 632-634.
Allsopp, R.C., Vazire, H., Pattersson, C., Goldstein, S., Younglai, E.V., Futcher, A.B., Greider, C.W. and Harley, C.B. (1992). Telomere length predicts replicative capacity of human fibroblasts. Proc. Natl. Acad. Sci.
89, 10114-10118.
Altschul, S.F., Gish, W., Miller, W., Myers, E.W. et a1 (1990). Basic local alignment search tool. J. Mol. Biol.
215, 403-410.
Ausubel, F.M., Brent, R., Kingston, R.E. Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K. (1987).
Current protocols in molecular biology. Greene Publishing Associates and Whiley-Intersciences, New York.
Blasco, M.A., Rizen, M., Greider, C.W. and Hanahan, D. (1996). Differential regulation of telomerase activity and telomerase RNA during multistage tumorigenesis. Nature Genetics 12, 200-204.
Broccoli, D., Young, J.W. and deLange, T. (1995). Telomerase activity in normal and malignant hematopoietic cells. Proc. Natl. Acad. Sci. 92, 9082-9086.
ColGns, K., Kobayashi, R. and Greider, C.W. (1995). Purification of Tetrahymena telomerase and cloning of genes encoding the two protein components of the enzyme. Cell 81, 677-686.
Counter, C.M., Avilion, A.A., LeFeuvre, C.E., Stewart, N.G. Greider, C.W.
Harley, C.B. and Bacchetti S.
(1992). Telomere shortening associated with chromosome instability is arrested in immortal cells which express telomerase activity. EMBO J. 11, 1921-1929.
Counter, C.M., Gupta, J., Harley, C.B., Leber, B. and Bacchetti, S. (1995).
Telomerase activity in normal leukocytes and in hematologic malignancies. Blood 85> 2315-2320.
Feng, J., Funk, W.D., Wang, S: S., Weinrich, S.L., AviGon, A.A., Chiu, C: P., Adams, R.R., Chang, E., Allsopp, R.C., Yu, J., Le, S., West, M.D., Harley, C.B., Andrews, W.H., Greider, C.W. and Villeponteau, B. (1995). The RNA component of human telomerase. Science 269, 1236-1241.
Gerhold, D. and Caskey, T. (1996). It's the genes! EST access to human genome content. BioEssays 18, 973-981.

Le A 32 486-Foreign countries _. -42-Goldstein, S. (1990). Replicative senescence: The human fibroblast comes of age. Science 249, 1129-1133.
Greider, C.W. and Blackburn, E.H. (1985). Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell 43, 405-413.
Greider, C.W. and Blackburn, E.H. (1987). The telomere terminal transferase of Tetrahymena is a ribonucleoprotein enzyme with two kinds of primer specificity. Cell 51, 887-898.
Greider, C.W. and Blackburn, E.H. (1989). A telomeric sequence in the RNA of Tetrahymena telomerase required for telomere repeat synthesis. Nature 337, 331-337.
Harley, C.B., Futcher, A.B. and Greider, C.W. (1990). Telomeres shorten during ageing of human fibroblasts.
Nature 345, 458-460.
Harrington, L., McPhail, T., Mar, V., Zhou, W., Oulton, R., Amgen EST Program, Bass, M.B., Arruda, I.
and Robinson, M.O. (1997). A mammalian telomerase-associated protein. Science 275: 973-977.
Hastie, N.D., Dempster, M., Dunlop, M.G., Thompson, A.M., Green, D.K. and Allshire, R.C. (1990).
Telomere reduction in human colorectal carcinoma and with ageing. Nature 346, 866-868.
Hiyama, K., Hirai, Y., Kyoizumi, S., Akiyama, M., Hiyama, E., Piatyszek, M.A., Shay, J.W., Ishioka, S.
and Yamakido, M. (1995). Activation of telomerase in human lymphocytes and hematopoietic progenitor cells.
J. Immunol. 155, 3711-3715.
Kim, N.W., Piatyszek, M.A., Prowse, K.R., Harley, C.B., West, M.D., Ho, P.L.C., Coviello, G.M., Wright, W.E., Weinrich, S.L. and Shay, J.W. (1994). Specific association of human telomerase activity with immortal cells and cancer. Science 266, 2011-2015.
Lingner, J., Hughes, T.R., Shevchenko, A., Mann, M., Lundblad, V. and Cech T.R. (1997). Reverse transcriptase motifs in the catalytic subunit of telomerase. Science 276: 561-567.
Lundblad, V. and Szostak, J.W. (1989). A mutant with a defect in telomere elongation leads to senescence in yeast. Cell 57, 633-643.
McClintock, B. (1941). The stability of broken ends of chromosomes in Zea mays. Genetics 26, 234-282.

Le A 32 486-Foreign countries - _ -43-Meyne, J., Ratlitlf, R.L. and Moyzis, R.K. (1989). Conservation of the human telomere sequence (TTAGGG)o among vertebrates. Proc. Natl. Acad. Sci. 86, 7049-7053.
Okubo, K. Hori, N., Matoba, R., Niiyama, T., Fukushima, A., Kojima, Y. and Matsubra, K. (1992). Large S scale cDNA sequencing for analysis of quantitative and qualitative aspects of gene expression. Nature Genetics 2: 173-179.
Olovnikov, A.M. (1973). A theory of marginotomy. J. Theor. Biol. 41, 181-190.
Poch, O., Sauvaget, L, Delarue, M. and Tordo, N. (1989). Identification of four conserved motifs among the RNA-dependent polymerase encoding elements. EMBO J. 8: 3867-3874.
Pokrovskaya, LD. and Gurevich, V.V. (1994). In vitro transcription:
Preparative RNA yields in analytical scale reactions. Analytical Biochemistry 220, 420-423.

Prowse, K.R., Avilion, A.A. and Greider, C.W. (1993). Identification of a non-processive telomerase activity from mouse cells. Proc. Natl. Acad. Sci. 90, 1493-1497.
Sandell, L.L. and Zakian, V.A. (1993). Loss of a yeast telomere: Arrest, recovery and chromosome loss. Cell 75, 729-739.
Shampay, J. and Blackburn, E.H. (1988). Generation of telomere-length heterogeneity in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. 85, 534-538.
Shay, J.W., Brasiskyte, D., Ouellette, M., Piatyszek, M.A, Werbin, H., Ying, Y. and Wright, E.W. (1994).
Analysis of telomerase and telomeres. Methods of Molecular Genetics 5, 263-280 Shay, J.W. (1997). Telomerae and Cancer. Ciba Foundation Meeting: Telomeres and Telomerase. London.
Singer, M.S. and Gottschling, D.E. (1994). TLCI: Template RNA Component of Saccharomyces cerevisiae Telomerase. Science 266, 404-409.
Vaziri, H., Dragowska, W., Allsopp, R.C., Thomas, T.E., Harley, C.B. and Landsdorp, P.M. (1994).
Evidence for a mitotic clock in human hematopoietic stem cells: Loss of telomeric DNA with age. Proc. Natl.
Acad. Sci. 91, 9857-9860.

Le A 32 486-Forei~~n countries .. _ _ Xiong, Y. and Eickbush, T.H. (1990). Origin and evolution of retroelements based upon their reverse transcriptase sequences. EMBO J. 9: 3353-3362.
Yu, G: L., Bradley, J.D., Attardi, L.D. and Blackburn, E.H. (1990). In vivo alteration of telomere sequences and senescence caused by mutated Tetrahymena telomerase ItNAs. Nature 344, 126-132.
Zakian, V. A. (1995). Telomeres: Beginning to understand the end. Science 270, 1601-1607.

Le A 32 486-Foreign countries - . -45-SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT:
(A) NAME: Bayer AG
(B) STREET: Bayerwerk (C) CITY: Leverkusen (E) COUNTRY: Germany (F) POSTAL CODE: D-51368 (G) TELEPHONE: 0214-303688 (H) TELEFAX: 0214-303482 (ii) TITLE OF THE INVENTION: Human catalytic telomerase subunit and its diagnostic and therapeutic use (iii) NUMBER OF SEQUENCES: 7 (iv) COMPUTER-READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30B (EPA) (2) INFORMATION FOR SEQ ID N0: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 4042 Basenpaare (B) TYPE: Nucleotide (C) STRANDEDNESS: Einzelstrang (D) TOPOLOGY: Linear (ii) ART DES MOLEK~LS: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(vi) ORIGINAL SOURCE:
(C) INDIVIDUAL/ISOLATE: Human (xi) SEQUENCE
DESCRIPTION:
SEQ ID
NO: 1:

Le A 32 486-Foreign countries AGGAGGACACAGACCCCCGTCGCCTGGTGCAGC'rGCTCCGCCAGCACAGCAGCCCCTGGC1440 Le A 32 486-Foreign countries ._ . _4~_ F~~i~AAAAAAAAAAAAAAAAAAA 4 (2) INFORMATION
FOR
SEQ
ID N0:
2:

(i) SEQUENCE :
CHARACTERISTICS

Le A 32 486-Foreign countries ._ , -48-(A) LENGTH: 1132 amino acids (B) TYPE: Amino acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) ART DES MOLEKSLS: Protein (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(vi) ORIGINAL SOURCE:
(C) INDIVIDUAL/ISOLATE: Human (xi) SEQUENCE DESCRIPTION: SEQ ID N0: 2:
Met Pro Arg Ala Pro Arg Cys Arg Ala Val Arg Ser Leu Leu Arg Ser His Tyr Arg Glu Val Leu Pro Leu Ala Thr Phe Val Arg Arg Leu Gly Pro Gln Gly Trp Arg Leu Val Gln Arg Gly Asp Pro Ala Ala Phe Arg Ala Leu Val Ala Gln Cys Leu Val Cys Val Pro Trp Asp Ala Arg Pro Pro Pro Ala Ala Pro Ser Phe Arg Gln Val Ser Cys Leu Lys Glu Leu Val Ala Arg Val Leu Gln Arg Leu Cys Glu Arg Gly Ala Lys Asn Val Leu Ala Phe Gly Phe Ala Leu Leu Asp Gly Ala Arg Gly Gly Pro Pro Glu Ala Phe Thr Thr Ser Val Arg Ser Tyr Leu Pro Asn Thr Val Thr Asp Ala Leu Arg Gly Ser Gly Ala Trp Gly Leu Leu Leu Arg Arg Val Gly Asp Asp Val Leu Val His Leu Leu Ala Arg Cys Ala Leu Phe Val Leu Val Ala Pro Ser Cys Ala Tyr Gln Val Cys Gly Pro Pro Leu Tyr Gln Leu Gly Ala Ala Thr Gln Ala Arg Pro Pro Pro His Ala Ser Gly Pro Arg Arg Arg Leu Gly Cys Glu Arg Ala Trp Asn His Ser Val Arg Glu Ala Gly Val Pro Leu Gly Leu Pro Ala Pro Gly Ala Arg Arg Arg Gly Gly Ser Ala Ser Arg Ser Leu Pro Leu Pro Lys Arg Pro Arg Arg Le A 32 486-Foreign countries Gly Ala Ala Pro Glu Pro Glu Arg Thr Pro Val Gly Gln Gly Ser Trp Ala His Pro Gly Arg Thr Arg Gly Pro Ser Asp Arg Gly Phe Cys Val Val Ser Pro Ala Arg Pro Ala Glu Glu Ala Thr Ser Leu Glu Gly Ala Leu Ser Gly Thr Arg His Ser His Pro Ser Val Gly Arg Gln His His Ala Gly Pro Pro Ser Thr Ser Arg Pro Pro Arg Pro Trp Asp Thr Pro Cys Pro Pro Val Tyr Ala Glu Thr Lys His Phe Leu Tyr Ser Ser Gly Asp Lys Glu Gln Leu Arg Pro Ser Phe Leu Leu Ser Ser Leu Arg Pro Ser Leu Thr Gly Ala Arg Arg Leu Val Glu Thr Ile Phe Leu Gly Ser Arg Pro Trp Met Pro Gly Thr Pro Arg Arg Leu Pro Arg Leu Pro Gln Arg Tyr Trp Gln Met Arg Pro Leu Phe Leu Glu Leu Leu Gly Asn His Ala Gln Cys Pro Tyr Gly Val Leu Leu Lys Thr His Cys Pro Leu Arg ' 405 410 415 Ala Ala Val Thr Pro Ala Ala Gly Val Cys Ala Arg Glu Lys Pro Gln Gly Ser Val Ala Ala Pro Glu Glu Glu Asp Thr Asp Pro Arg Arg Leu Val Gln Leu Leu Arg Gln His Ser Ser Pro Trp Gln Val Tyr Gly Phe Val Arg Ala Cys Leu Arg Arg Leu Val Pro Pro Gly Leu Trp Gly Ser Arg His Asn Glu Arg Arg Phe Leu Arg Asn Thr Lys Lys Phe Ile Ser Leu Gly Lys His Ala Lys Leu Ser Leu Gln Glu Leu Thr Trp Lys Met Ser Val Arg Asp Cys Ala Trp Leu Arg Arg Ser Pro Gly Val Gly Cys Val Pro Ala Ala Glu His Arg Leu Arg Glu Glu Ile Leu Ala Lys Phe Leu His Trp Leu Met Ser Val Tyr Val Val Glu Leu Leu Arg Ser Phe Phe Tyr Val Thr Glu Thr Thr Phe Gln Lys Asn Arg Leu Phe Phe Tyr Le A 32 486-Foreign countries _ _ -50-Arg Lys Ser Val Trp Ser Lys Leu Gln Ser Ile Gly Ile Arg Gln His Leu Lys Arg Val Gln Leu Arg Glu Leu Ser Glu Ala Glu Val Arg Gln His Arg Glu Ala Arg Pro Ala Leu Leu Thr Ser Arg Leu Arg Phe Ile Pro Lys Pro Asp Gly Leu Arg Pro Ile Val Asn Met Asp Tyr Val Val Gly Ala Arg Thr Phe Arg Arg Glu Lys Arg Ala Glu Arg Leu Thr Ser Arg Val Lys Ala Leu Phe Ser Val Leu Asn Tyr Glu Arg Ala Arg Arg Pro Gly Leu Leu Gly Ala Ser Val Leu Gly Leu Asp Asp Ile His Arg Ala Trp Arg Thr Phe Val Leu Arg Val Arg Ala Gln Asp Pro Pro Pro Glu Leu Tyr Phe Val Lys Val Asp Val Thr Gly Ala Tyr Asp Thr Ile Pro Gln Asp Arg Leu Thr Glu Val Ile Ala Ser Ile Ile Lys Pro Gln 725 730 '735 Asn Thr Tyr Cys Val Arg Arg Tyr Ala Val Val Gln Lys Ala Ala His Gly His Val Arg Lys Ala Phe Lys Ser His Val Ser Thr Leu Thr Asp Leu Gln Pro Tyr Met Arg Gln Phe Val Ala His Leu Gln Glu Thr Ser Pro Leu Arg Asp Ala Val Val Ile Glu Gln Ser Ser Ser Leu Asn Glu Ala Ser Ser Gly Leu Phe Asp Val Phe Leu Arg Phe Met Cys His His Ala Val Arg Ile Arg Gly Lys Ser Tyr Val Gln Cys Gln Gly Ile Pro Gln Gly Ser Ile Leu Ser Thr Leu Leu Cys Ser Leu Cys Tyr Gly Asp Met Glu Asn Lys Leu Phe Ala Gly Ile Arg Arg Asp Gly Leu Leu Leu Arg Leu Val Asp Asp Phe Leu Leu Val Thr Pro His Leu Thr His Ala Lys Thr Phe Leu Arg Thr Leu Val Arg Gly Val Pro Glu Tyr Gly Cys Val Val Asn Leu Arg Lys Thr Val Val Asn Phe Pro Val Glu Asp Glu Le A 32 486-Foreign countries __ -51-Ala Leu Gly Gly Thr Ala Phe Val Gln Met Pro Ala His Gly Leu Phe Pro Trp Cys Gly Leu Leu Leu Asp Thr Arg Thr Leu Glu Val Gln Ser Asp Tyr Ser Ser Tyr Ala Arg Thr Ser Ile Arg Ala Ser Leu Thr Phe Asn Arg Gly Phe Lys Ala Gly Arg Asn Met Arg Arg Lys Leu Phe Gly Val Leu Arg Leu Lys Cys His Ser Leu Phe Leu Asp Leu Gln Val Asn Ser Leu Gln Thr Val Cys Thr Asn Ile Tyr Lys Ile Leu Leu Leu Gln Ala Tyr Arg Phe His Ala Cys Val Leu Gln Leu Pro Phe His Gln Gln Val Trp Lys Asn Pro Thr Phe Phe Leu Arg Val Ile Ser Asp Thr Ala Ser Leu Cys Tyr Ser Ile Leu Lys Ala Lys Asn Ala Gly Met Ser Leu Gly Ala Lys Gly Ala Ala Gly Pro Leu Pro Ser Glu Ala Val Gln Trp Leu C~.~s His Gln Ala Phe Leu Leu Lys Leu Thr Arg His Arg Val Thr Tyr Val Pro Leu Leu Gly Ser Leu Arg Thr Ala Gln Thr G1n Leu Ser Arg Lys Leu Pro Gly Thr Thr Leu Thr Ala Leu Glu Ala Ala Ala Asn Pro Ala Leu Pro Ser Asp Phe Lys Thr Ile Leu Asp (2) INFORMATION FOR SEQ ID N0: 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1153 base pairs (B) TYPE: Nucleotide (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(vi) ORIGINAL SOURCE:
(C) INDIVIDUAL/ISOLATE: Human Le A 32 486-Foreign countries (xi) SEQUENCE DESCRIPTION:
SEQ ID N0: 3:

(2) INFORMATION Q ID N0:
FOR SE 4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 412 base pairs (B) TYPE: Nu cleotide (C) STRANDEDNESS: e Singl (D) TOPOLOGY : Linear (ii) MOLECULE TYPE : cDNA

(iii) HYPOTHETICAL:NO

(iv) ANTISENSE:
NO

(vi) ORIGINAL SOUR CE:

(C) INDIVIDUAL/ISOLATE: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:

Le A 32 486-Foreign countries - . -53-ACGTGGGCAC

GCTCTCCCTC

ACGCGGTTTC

AGCCGGGTTG

CTGCAGAGAC

CTTGTTTCTC

TCTCGTTGCC

(2) INFORMATION FOR SEQ ID NO: 5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1012 base pairs (B) TYPE: Nucleotide (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLCULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(iv) ANTISENSE: NO

(vi) ORIGINAL SOURCE:

(C) INDIVIDUAL/ISOLATE: Human (xi) SEQUENCE
DESCRIPTION:
SEQ ID
N0: 5:

Le A 32 486-Foreign countries (2) INFORMATION
FOR SEQ
ID N0:
6:

(i) S EQUENCE CHARACTERISTICS:

(A) LENGTH: 3972 base pairs (B) TYPE: Nucleotide (C) STRANDEDNESS:
Single (D) TOPOLOGY: Linear (ii) MOLECULE
TYPE:
cDNA

(iii) HYPOTHETICAL:
NO

(iv) ANTISENSE:
NO

(vi) ORIGINAL
SOURCE:

(C) INDIVIDUAL/ISOLATE:Human (xi) SEQUENCE
DESCRIPTION:
SEQ ID
N0: 6:

Le A 32 486-Foreign countries Le A 32 486-Foreign countries (2) INFORMATION
FOR SEQ
ID N0:
7:

(i) SEQUENCE
CHARACTERISTICS:

(A) LENGTH: 2089 base pairs (B) TYPE: Nucleotide (C) STRANDEDNESS: e Singl (D) TOPOLOGY: Linear (ii) MOLECULE
TYPE:
cDNA

(v) FRAGMENT
TYPE:
Linear (vi) ORIGINAL
SOURCE:

(C) INDIVIDUAL/ISOLATE:Human (xi) SEQUENCE DESCRIPTION: SEQ ID N0: 7:

Le A 32 486-Forei~~n countries CCTCaCCCACGCGAAAACCTTCCTCAGGACCCTGGTCCGAGGTGTCCCTGAGTATGGCTG 960 Le A 32 486-Foreign countries

Claims (13)

Claims

1. Catalytically active human telomerase subunit, its functional equivalents, its variants and its catalytically active fragments.

2. Telomerase according to Claim 1, comprising the amino acid sequence depicted in Fig. 1b or its functional equivalents.

3. Nucleic acid sequences encoding compounds according to Claims 1 and 2 and their functional equivalents.

4. Nucleic acid sequences according to Claim 3, comprising the DNA sequence depicted in Fig. 1a or its functional equivalents.

5. Antisense nucleic acids binding to the nucleic acid sequence according to Claim 3 or 4.

6. Antibodies against telomerase according to Claims 1 and 2, where appropriate labelled with one or more labels.

7. Use of nucleic acid sequences according to Claims 3 and 4 for preparing telomerase.

8. Use of antibodies according to Claim 6 for diagnosis.

9. Use of antibodies according to Claim 6 for preparing medicaments.

10. Vector comprising a nucleic acid sequence, in particular DNA, according to Claims 3 and 4.

11. Microorganisms harbouring the vector according to Claim 10.

12. Screening assay for identifying modulators of human telomerase comprising the telomerase according to Claims 1 and 2.

13. Process for preparing the telomerase according to Claims 1 and 2, characterized in that the microorganism according to Claim 11 is cultured and the telomerase is isolated.