CA2293363A1 - Secreted proteins and polynucleotides encoding them - Google Patents

Abstract

Polynucleotides and the proteins encoded thereby are disclosed.

Description

SECRETED PROTEINS AND POLYNUCLEOTIDES ENCODING THEM
This application is a continuation-in-part of application Ser. No. 60/XXX,XXX
(converted to a provisional application from non-provisional application Ser.
No.
08/873,218), filed June 11, 1997, which is incorporated by reference herein.
FIELD OF THE INVENTION
The present invention provides novel polynucleotides and proteins encoded by such polynucleotides, along with therapeutic, diagnostic and research utilities for these polynucleotides and proteins.
BACKGROUND OF THE INVENTION
Technology aimed at the discovery of protein factors (including e.g., cytokines, such as lymphokines, interferons, CSFs and interleukins) has matured rapidly over the past decade. The now routine hybridization cloning and expression cloning techniques clone novel polynucleotides "directly" in the sense that they rely on information directly related to the discovered protein (i.e., partial DNA/amino acid sequence of the protein 2 0 in the case of hybridization cloning; activity of the protein in the case of expression cloning). More recent "indirect" cloning techniques such as signal sequence cloning, which isolates DNA sequences based on the presence of a now well-recognized secretory leader sequence motif, as well as various PCR-based or low stringency hybridization cloning techniques, have advanced the state of the art by making available large numbers of DNA/amino acid sequences for proteins that are known to have biological activity by virtue of their secreted nature in the case of leader sequence cloning, or by virtue of the cell or tissue source in the case of PCR-based techniques. It is to these proteins and the polynucleotides encoding them that the present invention is directed.
;i 0 SUMMARY OF THE INVENTION
In one embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:1;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:1 from nucleotide 12 to nucleotide 800;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:l from nucleotide 78 to nucleotide 800;
(d) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:1 from nucleotide 1 to nucleotide 547;
(e) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone bh389_I1 deposited under accession number ATCC 98451;
(f) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone bh389_11 deposited under accession number ATCC 98451;
(g) a polynucleotide comprising the nucleotide sequence of a mature protein coding sequence of clone bh389_11 deposited under accession number ATCC 98451;
2 0 (h) a polynucleotide encoding a mature protein encoded by the cDNA
insert of clone bh389_11 deposited under accession number ATCC 98451;
(i) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:2;
(j) a polynucleotide encoding a protein comprising a fragment of the 2 5 amino acid sequence of SEQ ID N0:2 having biological activity, the fragment comprising eight consecutive amino acids of SEQ ID N0:2;
(k) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(h) above;
(1) a polynucleotide which encodes a species homologue of the protein 3 0 of (i) or (j) above ; and (m) a polynucleotide that hybridizes under stringent conditions to any one of the polynucleotides specified in (a)-(j).
Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID
NO:1 from nucleotide 12 to nucleotide 800; the nucleotide sequence of SEQ ID
N0:1 from nucleotide 78 to nucleotide 800; the nucleotide sequence of SEQ ID NO:1 from nucleotide 1 to nucleotide 547; the nucleotide sequence of the full-length protein coding sequence of clone bh389_11 deposited under accession number ATCC 98451; or the nucleotide sequence of a mature protein coding sequence of clone bh389_11 deposited under accession number ATCC 98451. In other preferred embodiments, the polynucleotide encodes the full-length or a mature protein encoded by the cDNA insert of clone bh389_l l deposited under accession number ATCC 98451. In yet other preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:2 from amino acid 1 to amino acid 178. In further preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:2 having biological activity, the fragment preferably comprising eight (more preferably twenty, most preferably thirty) consecutive amino acids of SEQ ID N0:2, or a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:2 having biological activity, the fragment comprising the amino acid sequence from amino acid 126 to amino acid 135 of SEQ ID N0:2.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID NO:1.
In other embodiments, the present invention provides a composition comprising 2 0 a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID N0:2;
(b) the amino acid sequence of SEQ ID N0:2 from amino acid 1 to amino acid 178;
2 5 (c) fragments of the amino acid sequence of SEQ ID N0:2 comprising eight consecutive amino acids of SEQ ID N0:2; and (d) the amino acid sequence encoded by the cDNA insert of clone bh389_11 deposited under accession number ATCC 98451;
the protein being substantially free from other mammalian proteins. Preferably such 3 0 protein comprises the amino acid sequence of SEQ ID N0:2 or the amino acid sequence of SEQ ID N0:2 from amino acid 1 to amino acid 178. In further preferred embodiments, the present invention provides a protein comprising a fragment of the amino acid sequence of SEQ ID N0:2 having biological activity, the fragment preferably comprising eight (more preferably twenty, most preferably thirty) consecutive amino acids of SEQ ID

N0:2, or a protein comprising a fragment of the amino acid sequence of SEQ ID
N0:2having biological activity, the fragment comprising the amino acid sequence from amino acid 126 to amino acid 135 of SEQ ID N0:2.
In one embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:3;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:3 from nucleotide 100 to nucleotide 882;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:3 from nucleotide 635 to nucleotide 867;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone bk112_15 deposited under accession number ATCC 98451;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone bk112_15 deposited under accession number ATCC 98451;
(f) a polynucleotide comprising the nucleotide sequence of a mature protein coding sequence of clone bk112_15 deposited under accession number ATCC 98451;
2 0 (g) a polynucleotide encoding a mature protein encoded by the cDNA
insert of clone bk112_15 deposited under accession number ATCC 98451;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:4;
(i) a polynucleotide encoding a protein comprising a fragment of the 2 5 amino acid sequence of SEQ ID N0:4 having biological activity, the fragment comprising eight consecutive amino acids of SEQ ID N0:4;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein 3 0 of {h) or (i) above ; and (1) a polynucleotide that hybridizes under stringent conditions to any one of the polynucleotides specified in (a)-(i).
Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID
N0:3 from nucleotide 100 to nucleotide 882; the nucleotide sequence of SEQ ID
N0:3 from nucleotide 635 to nucleotide 867; the nucleotide sequence of the full-length protein coding sequence of clone bk112_15 deposited under accession number ATCC 98451;
or _ the nucleotide sequence of a mature protein coding sequence of clone bk112_15 deposited under accession number ATCC 98451. In other preferred embodiments, the polynucleotide encodes the full-length or a mature protein encoded by the cDNA
insert of clone bk112_15 deposited under accession number ATCC 98451. In yet other preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:4 from amino acid 200 to amino acid 256. In further preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID
N0:4 having biological activity, the fragment preferably comprising eight (more preferably twenty, most preferably thirty) consecutive amino acids of SEQ ID N0:4, or a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:4 having biological activity, the fragment comprising the amino acid sequence from amino acid 125 to amino acid 134 of SEQ ID N0:4.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:3.
In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group 2 0 consisting of:
(a) the amino acid sequence of SEQ ID N0:4;
(b) the amino acid sequence of SEQ ID N0:4 from amino acid 200 to amino acid 256;
(c) fragments of the amino acid sequence of SEQ ID N0:4 comprising 2 5 eight consecutive amino acids of SEQ ID N0:4; and (d) the amino acid sequence encoded by the cDNA insert of clone bk112_15 deposited under accession number ATCC 98451;
the protein being substantially free from other mammalian proteins. Preferably such - protein comprises the amino acid sequence of SEQ ID N0:4 or the amino acid sequence 3 0 of SEQ ID N0:4 from amino acid 200 to amino acid 256. In further preferred embodiments, the present invention provides a protein comprising a fragment of the amino acid sequence of SEQ ID N0:4 having biological activity, the fragment preferably comprising eight (more preferably twenty, most preferably thirty) consecutive amino acids of SEQ ID N0:4, or a protein comprising a fragment of the amino acid sequence of SEQ ID N0:4having biological activity, the fragment comprising the amino acid sequence from amino acid 125 to amino acid 134 of SEQ ID N0:4.
In one embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:5;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:5 from nucleotide 245 to nucleotide 520;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:5 from nucleotide 181 to nucleotide 527;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone bk200_13 deposited under accession number ATCC 98451;
{e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone bk200_13 deposited under accession number ATCC 98451;
(f) a polynucleotide comprising the nucleotide sequence of a mature protein coding sequence of clone bk200_13 deposited under accession number ATCC 98451;
(g) a polynucleotide encoding a mature protein encoded by the cDNA
2 0 insert of clone bk200_13 deposited under accession number ATCC 98451;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:6;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:6 having biological activity, the fragment 2 5 comprising eight consecutive amino acids of SEQ ID N0:6;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and 3 0 (1) a polynucleotide that hybridizes under stringent conditions to any one of the polynucleotides specified in (a)-(i).
Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID
N0:5 from nucleotide 245 to nucleotide 520; the nucleotide sequence of SEQ ID
N0:5 from nucleotide 181 to nucleotide 527; the nucleotide sequence of the full-length protein coding sequence of clone bk200_13 deposited under accession number ATCC 98451;
or the nucleotide sequence of a mature protein coding sequence of clone bk200_13 deposited under accession number ATCC 98451. In other preferred embodiments, the polynucleotide encodes the full-length or a mature protein encoded by the cDNA
insert of clone bk200_13 deposited under accession number ATCC 98451. In further preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:6 having biological activity, the fragment preferably comprising eight (more preferably twenty, most preferably thirty) consecutive amino acids of SEQ ID N0:6, or a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:6 having biological activity, the fragment comprising the amino acid sequence from amino acid 41 to amino acid 50 of SEQ ID N0:6.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:5.
In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a} the amino acid sequence of SEQ ID N0:6;
(b) fragments of the amino acid sequence of SEQ ID N0:6 comprising 2 0 eight consecutive amino acids of SEQ ID N0:6; and (c) the amino acid sequence encoded by the cDNA insert of clone bk200 I3 deposited under accession number ATCC 98451;
the protein being substantially free from other mammalian proteins. Preferably such protein comprises the amino acid sequence of SEQ ID N0:6. In further preferred 2 5 embodiments, the present invention provides a protein comprising a fragment of the amino acid sequence of SEQ ID N0:6 having biological activity, the fragment preferably comprising eight (more preferably twenty, most preferably thirty) consecutive amino acids of SEQ ID N0:6, or a protein comprising a fragment of the amino acid sequence of SEQ ID N0:6 having biological activity, the fragment comprising the amino acid sequence 3 0 from amino acid 41 to amino acid 50 of SEQ ID N0:6.
In one embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:7;

(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:7 from nucleotide 365 to nucleotide 784;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:7 from nucleotide 518 to nucleotide 784;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone di386_3 deposited under accession number ATCC 98451;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone di386_3 deposited under accession number ATCC 98451;
(f) a polynucleotide comprising the nucleotide sequence of a mature protein coding sequence of clone di386_3 deposited under accession number ATCC 98451;
{g) a polynucleotide encoding a mature protein encoded by the cDNA
insert of clone di386_3 deposited under accession number ATCC 98451;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:8;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:8 having biological activity, the fragment comprising eight consecutive amino acids of SEQ ID N0:8;
2 0 (j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and {l) a polynucleotide that hybridizes under stringent conditions to any 2 5 one of the polynucleotides specified in (a)-(i).
Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID
N0:7 from nucleotide 365 to nucleotide 784; the nucleotide sequence of SEQ ID
N0:7 from nucleotide 518 to nucleotide 784; the nucleotide sequence of the full-length protein coding sequence of clone di386 3 deposited under accession number ATCC 98451; or the 3 0 nucleotide sequence of a mature protein coding sequence of clone di386_3 deposited under accession number ATCC 98451. In other preferred embodiments, the polynucleotide encodes the full-length or a mature protein encoded by the cDNA
insert of clone di386_3 deposited under accession number ATCC 98451. In yet other preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:8 from amino acid 1 to amino acid 140.
In further preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID
N0:8 having biological activity, the fragment preferably comprising eight (more preferably twenty, most preferably thirty) consecutive amino acids of SEQ ID N0:8, or a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:8 having biological activity, the fragment comprising the amino acid sequence from amino acid 65 to amino acid 74 of SEQ ID N0:8.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:7 or SEQ ID N0:9.
In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID N0:8;
(b) the amino acid sequence of SEQ ID N0:8 from amino acid 1 to amino acid 140;
(c) fragments of the amino acid sequence of SEQ ID N0:8 comprising eight consecutive amino acids of SEQ ID N0:8; and (d) the amino acid sequence encoded by the cDNA insert of clone 2 0 di386_3 deposited under accession number ATCC 98451;
the protein being substantially free from other mammalian proteins. Preferably such protein comprises the amino acid sequence of SEQ ID N0:8 or the amino acid sequence of SEQ ID N0:8 from amino acid 1 to amino acid 140. In further preferred embodiments, the present invention provides a protein comprising a fragment of the amino acid 2 5 sequence of SEQ ID N0:8 having biological activity, the fragment preferably comprising eight (more preferably twenty, most preferably thirty) consecutive amino acids of SEQ ID
N0:8, or a protein comprising a fragment of the amino acid sequence of SEQ ID
N0:8having biological activity, the fragment comprising the amino acid sequence from amino acid 65 to amino acid 74 of SEQ ID N0:8.
3 0 In one embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:10;

(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:10 from nucleotide 191 to nucleotide 781;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:10 from nucleotide 56 to nucleotide 492;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone em397_2 deposited under accession number ATCC 98451;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone em397_2 deposited under accession number ATCC 98451;
(f) a polynucleotide comprising the nucleotide sequence of a mature protein coding sequence of clone em397_2 deposited under accession number ATCC 98451;
(g) a polynucleotide encoding a mature protein encoded by the cDNA
insert of clone em397_2 deposited under accession number ATCC 98451;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:11;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:11 having biological activity, the fragment comprising eight consecutive amino acids of SEQ ID N0:11;
2 0 (j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (1) a polynucleotide that hybridizes under stringent conditions to any 2 5 one of the polynucleotides specified in (a)-(i).
Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID
N0:10 from nucleotide 191 to nucleotide 781; the nucleotide sequence of SEQ ID
NO:10 from nucleotide 56 to nucleotide 492; the nucleotide sequence of the full-length protein coding sequence of clone em397_2 deposited under accession number ATCC 98451;
or the 3 0 nucleotide sequence of a mature protein coding sequence of clone em397_2 deposited under accession number ATCC 98451. In other preferred embodiments, the polynucleotide encodes the full-length or a mature protein encoded by the cDNA
insert of clone em397_2 deposited under accession number ATCC 98451. In yet other preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:11 from amino acid 1 to amino acid 101. In further preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID
N0:11 having biological activity, the fragment preferably comprising eight (more preferably twenty, most preferably thirty) consecutive amino acids of SEQ ID N0:11, or a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:11 having biological activity, the fragment comprising the amino acid sequence from amino acid 93 to amino acid 102 of SEQ ID N0:11.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID NO:10.
In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:11;
(b) the amino acid sequence of SEQ ID N0:11 from amino acid 1 to amino acid 101;
(c) fragments of the amino acid sequence of SEQ ID NO:11 comprising eight consecutive amino acids of SEQ ID NO:11; and (d) the amino acid sequence encoded by the cDNA insert of clone 2 0 em397 2 deposited under accession number ATCC 98451;
the protein being substantially free from other mammalian proteins. Preferably such protein comprises the amino acid sequence of SEQ ID N0:11 or the amino acid sequence of SEQ ID NO:11 from amino acid 1 to amino acid 101. In further preferred embodiments, the present invention provides a protein comprising a fragment of the amino acid 2 5 sequence of SEQ ID NO:11 having biological activity, the fragment preferably comprising eight (more preferably twenty, most preferably thirty) consecutive amino acids of SEQ ID
N0:11, or a protein comprising a fragment of the amino acid sequence of SEQ ID
NO:l lhaving biological activity, the fragment comprising the amino acid sequence from amino acid 93 to amino acid 102 of SEQ ID NO:11.
3 0 In one embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:12;

(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:12 from nucleotide 65 to nucleotide 1636;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:12 from nucleotide 482 to nucleotide 1636;
(d) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:12 from nucleotide 487 to nucleotide 1006;
(e) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone fh170 7 deposited under accession number ATCC 98451;
(f) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone fh170_7 deposited under accession number ATCC 98451;
(g) a polynucleotide comprising the nucleotide sequence of a mature protein coding sequence of clone fh170_7 deposited under accession number ATCC 98451;
(h) a polynucleotide encoding a mature protein encoded by the cDNA
insert of clone fh170 7 deposited under accession number ATCC 98451;
(i) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:13;
(j) a polynucleotide encoding a protein comprising a fragment of the 2 0 amino acid sequence of SEQ ID N0:13 having biological activity, the fragment comprising eight consecutive amino acids of SEQ ID N0:13;
(k) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(h) above;
(1) a polynucleotide which encodes a species homologue of the protein 2 5 of (i) or (j) above ; and (m) a polynucleotide that hybridizes under stringent conditions to any one of the polynucleotides specified in (a)-(j).
Preferably, such polynucleoHde comprises the nucleotide sequence of SEQ ID
N0:12 from nucleotide 65 to nucleotide 1636; the nucleotide sequence of SEQ ID
N0:12 3 0 from nucleotide 482 to nucleotide 1636; the nucleotide sequence of SEQ ID
N0:12 from nucleotide 487 to nucleotide 1006; the nucleotide sequence of the full-length protein coding sequence of clone fh170 7 deposited under accession number ATCC 98451;
or the nucleotide sequence of a mature protein coding sequence of clone fh170 7 deposited under accession number ATCC 98451. In other preferred embodiments, the polynucleotide encodes the full-length or a mature protein encoded by the cDNA
insert of clone fh170 7 deposited under accession number ATCC 98451. In yet other preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:13 from amino acid 142 to amino acid 314. 1n further preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID
N0:13 having biological activity, the fragment preferably comprising eight (more preferably twenty, most preferably thirty) consecutive amino acids of SEQ ID N0:13, or a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:13 having biological activity, the fragment comprising the amino acid sequence from amino acid 257 to amino acid 266 of SEQ ID N0:13.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:12.
In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID N0:13;
(b) the amino acid sequence of SEQ ID N0:13 from amino acid 142 to amino acid 314;
2 0 (c) fragments of the amino acid sequence of SEQ ID NO:I3 comprising eight consecutive amino acids of SEQ ID N0:13; and (d) the amino acid sequence encoded by the cDNA insert of clone fh170 7 deposited under accession number ATCC 98451;
the protein being substantially free from other mammalian proteins. Preferably such 2 5 protein comprises the amino acid sequence of SEQ ID N0:13 or the amino acid sequence of SEQ ID N0:13 from amino acid 142 to amino acid 314. In further preferred embodiments, the present invention provides a protein comprising a fragment of the amino acid sequence of SEQ ID N0:13 having biological activity, the fragment preferably comprising eight (more preferably twenty, most preferably thirty) consecutive amino 3 0 acids of SEQ ID N0:13, or a protein comprising a fragment of the amino acid sequence of SEQ ID N0:13having biological activity, the fragment comprising the amino acid sequence from amino acid 257 to amino acid 266 of SEQ ID NO:I3.
In one embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:

(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:15;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:15 from nucleotide 41 to nucleotide 550;
(c) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone fn53_4 deposited under accession number ATCC 98451;
(d) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone fn53_4 deposited under accession number ATCC 98451;
(e) a polynucleotide comprising the nucleotide sequence of a mature protein coding sequence of clone fn53_4 deposited under accession number ATCC
98451;
(f) a polynucleotide encoding a mature protein encoded by the cDNA
insert of clone fn53_4 deposited under accession number ATCC 98451;
{g) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:16;
(h) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:16 having biological activity, the fragment comprising eight consecutive amino acids of SEQ ID N0:16;
2 0 (i) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(f) above;
(j) a polynucleotide which encodes a species homologue of the protein of (g) or (h) above ; and (k) a polynucleotide that hybridizes under stringent conditions to any 2 5 one of the polynucleotides specified in (a)-(h}.
Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID
N0:15 from nucleotide 41 to nucleotide 550; the nucleotide sequence of the full-length protein coding sequence of clone fn53 4 deposited under accession number ATCC
98451;
or the nucleotide sequence of a mature protein coding sequence of clone fn53 4 deposited 3 0 under accession number ATCC 98451. In other preferred embodiments, the polynucleotide encodes the full-length or a mature protein encoded by the cDNA
insert of clone fn53_4 deposited under accession number ATCC 98451. In yet other preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:16 from amino acid 40 to amino acid 170. In further preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID
N0:16 having biological activity, the fragment preferably comprising eight (more preferably twenty, most preferably thirty) consecutive amino acids of SEQ ID N0:16, or a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:16 having biological activity, the fragment comprising the amino acid sequence from amino acid 80 to amino acid 89 of SEQ ID N0:16.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:15, SEQ ID N0:14 or SEQ ID N0:17 .
In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID N0:16;
(b) the amino acid sequence of SEQ ID N0:16 from amino acid 40 to amino acid 170;
(c) fragments of the amino acid sequence of SEQ ID N0:16 comprising eight consecutive amino acids of SEQ ID N0:16; and (d) the amino acid sequence encoded by the cDNA insert of clone fn53_4 deposited under accession number ATCC 98451;
2 0 the protein being substantially free from other mammalian proteins.
Preferably such protein comprises the amino acid sequence of SEQ ID N0:16 or the amino acid sequence of SEQ ID N0:16 from amino acid 40 to amino acid 170. In further preferred embodiments, the present invention provides a protein comprising a fragment of the amino acid sequence of SEQ ID N0:16 having biological activity, the fragment preferably 2 5 comprising eight (more preferably twenty, most preferably thirty) consecutive amino acids of SEQ ID N0:16, or a protein comprising a fragment of the amino acid sequence of SEQ ID N0:16 having biological activity, the fragment comprising the amino acid sequence from amino acid 80 to amino acid 89 of SEQ ID N0:16.
In one embodiment, the present invention provides a composition comprising an 3 0 isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:18;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:18 from nucleotide 84 to nucleotide 404;

(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:18 from nucleotide 78 to nucleotide 493;
{d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone fq505_4 deposited under accession number ATCC 98451;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone fq505 4 deposited under accession number ATCC 98451;
(f) a polynucleotide comprising the nucleotide sequence of a mature protein coding sequence of clone fq505 4 deposited under accession number ATCC 98451;
(g) a polynucleotide encoding a mature protein encoded by the cDNA
insert of clone fq505 4 deposited under accession number ATCC 98451;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:19;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:19 having biological activity, the fragment comprising eight consecutive amino acids of SEQ ID N0:19;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
2 0 (k) a polynucleotide which encodes a species homologue of the protein of (h) or {i) above ; and (1) a polynucleotide that hybridizes under stringent conditions to any one of the polynucleotides specified in {a)-(i).
Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID
2 5 N0:18 from nucleotide 84 to nucleotide 404; the nucleotide sequence of SEQ
ID N0:18 from nucleotide 78 to nucleotide 493; the nucleotide sequence of the full-length protein coding sequence of clone fq505 4 deposited under accession number ATCC 98451;
or the nucleotide sequence of a mature protein coding sequence of clone fq505 4 deposited under accession number ATCC 98451. In other preferred embodiments, the 3 0 polynucleotide encodes the full-length or a mature protein encoded by the cDNA insert of clone fq505 4 deposited under accession number ATCC 98451. In yet other preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:19 from amino acid 23 to amino acid 107. In further preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID
N0:19 having biological activity, the fragment preferably comprising eight (more preferably twenty, most preferably thirty) consecutive amino acids of SEQ ID N0:19, or a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:19 having biological activity, the fragment comprising the amino acid sequence from amino acid 48 to amino acid 57 of SEQ ID N0:19.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:18.
In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID N0:19;
(b) the amino acid sequence of SEQ ID N0:19 from amino acid 23 to amino acid 107;
(c) fragments of the amino acid sequence of SEQ ID N0:19 comprising eight consecutive amino acids of SEQ ID N0:19; and (d) the amino acid sequence encoded by the cDNA insert of clone fq505 4 deposited under accession number ATCC 98451;
the protein being substantially free from other mammalian proteins. Preferably such 2 0 protein comprises the amino acid sequence of SEQ ID N0:19 or the amino acid sequence of SEQ ID N0:19 from amino acid 23 to amino acid 107. In further preferred embodiments, the present invention provides a protein comprising a fragment of the amino acid sequence of SEQ ID N0:19 having biological activity, the fragment preferably comprising eight (more preferably twenty, most preferably thirty) consecutive amino 2 5 acids of SEQ ID N0:19, or a protein comprising a fragment of the amino acid sequence of SEQ ID N0:19having biological activity, the fragment comprising the amino acid sequence from amino acid 48 to amino acid 57 of SEQ ID N0:19.
In one embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
3 0 (a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:20;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:20 from nucleotide 1439 to nucleotide 1744;

(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:20 from nucleotide 1241 to nucleotide 1754;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone fwl3_9 deposited under accession number ATCC 98451;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone fwl3_9 deposited under accession number ATCC 98451;
(f) a polynucleotide comprising the nucleotide sequence of a mature protein coding sequence of clone fwl3_9 deposited under accession number ATCC 98451;
(g) a polynucleotide encoding a mature protein encoded by the cDNA
insert of clone fwl3_9 deposited under accession number ATCC 98451;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:21;
1 S (i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:21 having biological activity, the fragment comprising eight consecutive amino acids of SEQ ID N0:21;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a}-(g) above;
2 0 (k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (1) a polynucleotide that hybridizes under stringent conditions to any one of the polynucleotides specified in (a}-(i).
Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID
2 5 N0:20 from nucleotide 1439 to nucleotide 1744; the nucleotide sequence of SEQ ID N0:20 from nucleotide 1241 to nucleotide 1754; the nucleotide sequence of the full-length protein coding sequence of clone fwl3 9 deposited under accession number ATCC 98451;
or the nucleotide sequence of a mature protein coding sequence of clone fwl3_9 deposited under accession number ATCC 98451. In other preferred embodiments, the polynucleotide 3 0 encodes the full-length or a mature protein encoded by the cDNA insert of clone fwl3_9 deposited under accession number ATCC 98451. In yet other preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:21 from amino acid 1 to amino acid 57. In further preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:21 having biological activity, the fragment preferably comprising eight (more preferably twenty, most preferably thirty) consecutive amino acids of SEQ ID N0:21, or a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:21 having biological activity, the fragment comprising the amino acid sequence from amino acid 46 to amino acid 55 of SEQ ID N0:21.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:20.
In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID N0:21;
(b) the amino acid sequence of SEQ ID N0:21 from amino acid 1 to amino acid 57;
(c) fragments of the amino acid sequence of SEQ ID N0:21 comprising eight consecutive amino acids of SEQ ID N0:21; and (d) the amino acid sequence encoded by the cDNA insert of clone fwl3_9 deposited under accession number ATCC 98451;
the protein being substantially free from other mammalian proteins. Preferably such 2 0 protein comprises the amino acid sequence of SEQ ID N0:21 or the amino acid sequence of SEQ ID N0:21 from amino acid 1 to amino acid 57. In further preferred embodiments, the present invention provides a protein comprising a fragment of the amino acid sequence of SEQ ID N0:21 having biological activity, the fragment preferably comprising eight (more preferably twenty, most preferably thirty) consecutive amino acids of SEQ ID
2 5 N0:21, or a protein comprising a fragment of the amino acid sequence of SEQ ID
N0:21having biological activity, the fragment comprising the amino acid sequence from amino acid 46 to amino acid 55 of SEQ ID N0:21.
In one embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
3 0 (a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:22;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:22 from nucleotide 47 to nucleotide 919;

(c} a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:22 from nucleotide 124 to nucleotide 452;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone gg619_2 deposited under accession number ATCC 98451;
{e} a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone gg619_2 deposited under accession number ATCC 98451;
(f) a polynucleotide comprising the nucleotide sequence of a mature protein coding sequence of clone gg619_2 deposited under accession number ATCC 98451;
(g) a polynucleotide encoding a mature protein encoded by the cDNA
insert of clone gg619 2 deposited under accession number ATCC 98451;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:23;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:23 having biological activity, the fragment comprising eight consecutive amino acids of SEQ ID N0:23;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
2 0 (k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (1) a polynucleotide that hybridizes under stringent conditions to any one of the polynucleotides specified in (a)-{i).
Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID
2 5 N0:22 from nucleotide 47 to nucleotide 919; the nucleotide sequence of SEQ
ID N0:22 from nucleotide 124 to nucleotide 452; the nucleotide sequence of the full-length protein coding sequence of clone gg619_2 deposited under accession number ATCC 98451;
or the nucleotide sequence of a mature protein coding sequence of clone gg619_2 deposited under accession number ATCC 98451. In other preferred embodiments, the 3 0 polynucleotide encodes the full-length or a mature protein encoded by the cDNA insert of clone gg619_2 deposited under accession number ATCC 98451. In yet other preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:23 from amino acid 27 to amino acid 135. In further preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID
N0:23 having biological activity, the fragment preferably comprising eight (more preferably twenty, most preferably thirty) consecutive amino acids of SEQ ID N0:23, or a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:23 having biological activity, the fragment comprising the amino acid sequence from amino acid 140 to amino acid 149 of SEQ ID N0:23.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:22.
In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID N0:23;
(b) the amino acid sequence of SEQ ID N0:23 from amino acid 27 to amino acid 135;
(c) fragments of the amino acid sequence of SEQ ID N0:23 comprising eight consecutive amino acids of SEQ ID N0:23; and (d) the amino acid sequence encoded by the cDNA insert of clone gg619_2 deposited under accession number ATCC 98451;
the protein being substantially free from other mammalian proteins. Preferably such 2 0 protein comprises the amino acid sequence of SEQ ID N0:23 or the amino acid sequence of SEQ ID N0:23 from amino acid 27 to amino acid 135. In further preferred embodiments, the present invention provides a protein comprising a fragment of the amino acid sequence of SEQ ID N0:23 having biological activity, the fragment preferably comprising eight (more preferably twenty, most preferably thirty) consecutive amino 2 5 acids of SEQ ID N0:23, or a protein comprising a fragment of the amino acid sequence of SEQ ID N0:23having biological activity, the fragment comprising the amino acid sequence from amino acid 140 to amino acid 149 of SEQ ID N0:23.
In certain preferred embodiments, the polynucleotide is operably linked to an expression control sequence. The invention also provides a host cell, including bacterial, 3 0 yeast, insect and mammalian cells, transformed with such polynucleotide compositions.
Also provided by the present invention are organisms that have enhanced, reduced, or modified expression of the genes) corresponding to the polynucleotide sequences disclosed herein.
Processes are also provided for producing a protein, which comprise:

(a) growing a culture of the host cell transformed with such polynucleotide compositions in a suitable culture medium; and (b) purifying the protein from the culture.
The protein produced according to such methods is also provided by the present invention.
Protein compositions of the present invention may further comprise a pharmaceutically acceptable carrier. Compositions comprising an antibody which specifically reacts with such protein are also provided by the present invention.
Methods are also provided for preventing, treating or ameliorating a medical condition which comprises administering to a mammalian subject a therapeutically effective amount of a composition comprising a protein of the present invention and a pharmaceutically acceptable carrier.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures lA and 1B are schematic representations of the pED6 and pNOTs vectors, respectively, used for deposit of clones disclosed herein.
DETAILED DESCRIPTION
ISOLATED PROTEINS AND POLYNUCLEOTIDES
2 0 Nucleotide and amino acid sequences, as presently determined, are reported below for each clone and protein disclosed in the present application. The nucleotide sequence of each clone can readily be determined by sequencing of the deposited clone in accordance with known methods. The predicted amino acid sequence (both full-length and mature forms) can then be determined from such nucleotide sequence. The amino 2 5 acid sequence of the protein encoded by a particular clone can also be determined by expression of the clone in a suitable host cell, collecting the protein and determining its sequence. For each disclosed protein applicants have identified what they have determined to be the reading frame best identifiable with sequence information available at the time of filing.
3 0 As used herein a "secreted" protein is one which, when expressed in a suitable host cell, is transported across or through a membrane, including transport as a result of signal sequences in its amino acid sequence. "Secreted" proteins include without limitation proteins secreted wholly (e.g., soluble proteins) or partially (e.g. , receptors) from the cell in which they are expressed. "Secreted" proteins also include without limitation proteins which are transported across the membrane of the endoplasmic reticulum.
Clone "bh389 11"
A polynucleotide of the present invention has been identified as clone "bh389_11 ".
bh389_11 was isolated from a human adult thyroid cDNA library using methods which are selective for cDNAs encoding secreted proteins (see U.S. Pat. No.
5,536,637), or was identified as encoding a secreted or transmembrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. bh389_11 is a full-length clone, including the entire coding sequence of a secreted protein (also referred to herein as "bh389_11 protein").
The nucleotide sequence of bh389_l l as presently determined is reported in SEQ
ID NO:1. What applicants presently believe to be the proper reading frame and the predicted amino acid sequence of the bh389_l l protein corresponding to the foregoing nucleotide sequence is reported in SEQ ID N0:2. Amino acids 10 to 22 of SEQ ID
N0:2 are a predicted leader/signal sequence, with the predicted mature amino acid sequence beginning at amino acid 23, or are a transmembrane domain. The TopPredII
computer program predicts a potential transmembrane domain within the bh389_11 protein sequence centered around amino acid 68 of SEQ ID N0:2.
2 0 Another potential bh389_11 reading frame and predicted amino acid sequence is encoded by basepairs 757 to 1833 of SEQ ID NO:1 and is reported in SEQ ID
N0:34. A
frameshift in the nucleotide sequence of SEQ ID NO:1 between about nucleotide 754 to about nucleotide 803 could join the reading frames of SEQ ID N0:1 and SEQ ID
N0:34.
The TopPredII computer program predicts a potential transmembrane domain within the 2 5 amino acid sequence of SEQ ID N0:34, centered around amino acid 357 of SEQ
ID N0:34.
The EcoRI/NotI restriction fragment obtainable from the deposit containing clone bh389_11 should be approximately 1700 bp.
The nucleotide sequence disclosed herein for bh389_11 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and 3 0 FASTA search protocols. bh389_11 demonstrated at least some similarity with sequences identified as AA307880 (ESTI78733 Colon carcinoma (HCC) cell line Homo Sapiens cDNA 5' end), AA442426 (zv70f06.r1 Soares total fetus Nb2HF8 9w Homo sapiens cDNA
clone 759011 5'), H70103 (yr92f04.r1 Homo Sapiens cDNA clone 212767 5'), (yg37f12.r1 Homo Sapiens cDNA clone 34771 5'), and W46238 (zc30e10.s1 Soares senescent fibroblasts NbHSF Homo sapiens cDNA clone 323850 3'). Based upon sequence similarity, bh389_11 proteins and each similar protein or peptide may share at least some activity.
Clone "bk112 15"
A polynucleotide of the present invention has been identified as clone "bk112_15".
bkI 12_15 was isolated from a human adult retina cDNA library using methods which are selective for cDNAs encoding secreted proteins (see U.S. Pat. No. 5,536,637), or was identified as encoding a secreted or transmembrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. bk112_15 is a full-length clone, including the entire coding sequence of a secreted protein (also referred to herein as "bk112_15 protein") The nucleotide sequence of bk112_15 as presently determined is reported in SEQ
ID N0:3. What applicants presently believe to be the proper reading frame and the predicted amino acid sequence of the bk112_15 protein corresponding to the foregoing nucleotide sequence is reported in SEQ ID N0:4.
The EcoRI/NotI restriction fragment obtainable from the deposit containing clone bk112_15 should be approximately 1300 bp.
2 0 The nucleotide sequence disclosed herein for bk112_15 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and FASTA search protocols. bk112_15 demonstrated at least some similarity with sequences identified as AA307119 (EST178031 Colon carcinoma (HCC) cell line Homo sapiens cDNA 5' end}, AA318352 (EST20422 Retina II Homo Sapiens cDNA 5' end similar to 2 5 similar to C. elegans hypothetical protein, cosmid ZK688.2), L20941 (Human ferritin heavy chain mRNA, complete cds), M97164 (Human ferritin heavy chain mRNA, complete cds), N25339 (yxS5d08.s1 Homo sapiens cDNA clone 265647 3'), N31453 (yx55d08.r1 Homo Sapiens cDNA clone 265647 5'), and N33227 (yy07d02.s1 Homo Sapiens cDNA clone 270531 3' similar to gb:L20941 FERRITIN HEAVY CHAIN
3 0 (HUMAN)). The predicted amino acid sequence disclosed herein for bk112_15 was searched against the GenPept and GeneSeq amino acid sequence databases using the BLASTX search protocol. The predicted bk112_15 protein demonstrated at least some similarity to sequences identified as 268335 (C29F4.2 [Caenorhabditis elegans]). 8ased upon sequence similarity, bk112_l5 proteins and each similar protein or peptide may share at least some activity.
Clone "bk200 13"
A polynucleotide of the present invention has been identified as clone "bk200_13".
bk200_13 was isolated from a human adult retina cDNA library using methods which are selective for cDNAs encoding secreted proteins (see U.S. Pat. No. 5,536,637), or was identified as encoding a secreted or transmembrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. bk200_13 is a full-length clone, including the entire coding sequence of a secreted protein (also referred to herein as "bk200_l3 protein").
The nucleotide sequence of bk200_13 as presently determined is reported in SEQ
ID N0:5. What applicants presently believe to be the proper reading frame and the predicted amino acid sequence of the bk200_13 protein corresponding to the foregoing nucleotide sequence is reported in SEQ ID N0:6.
The EcoRI/Notl restriction fragment obtainable from the deposit containing clone bk200_13 should be approximately 1000 bp.
The nucleotide sequence disclosed herein for bk200_13 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and 2 0 FASTA search protocols. bk200_13 demonstrated at least some similarity with sequences identified as AA098915 zk84f06.s 1 Soares pregnant uterus NbHPU Homo sapiens cDNA
clone 489539 3'), AA150367 z107b06.r1 Soares pregnant uterus NbHPU Homo sapiens cDNA clone 491603 5')> AA235904 (zs40h05.r1 Soares NhHMPu S 1 Homo Sapiens cDNA clone 687705 5'), N32487 (yx79g10.r1 Homo sapiens cDNA clone 268002 5'), and T47862 (yb17g03.r1 Homo sapiens cDNA clone 71476 5'). Based upon sequence similarity, bk200 13 proteins and each similar protein or peptide may share at least some activity. The nucleotide sequence of bk200_13 may contain CAAAAA repeat-like elements.
3 0 Clone "di386 3"
A polynucleotide of the present invention has been identified as clone "di386_3".
di386_3 was isolated from a human adult testes cDNA library using methods which are selective for cDNAs encoding secreted proteins (see U.S. Pat. No. 5,536,637), or was identified as encoding a secreted or transmembrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. di386_3 is a full-length clone, including the entire coding sequence of a secreted protein (also referred to herein as "di386_3 protein").
The nucleotide sequence of the 5' portion of di386_3 as presently determined is reported in SEQ ID N0:7. What applicants presently believe is the proper reading frame for the coding region is indicated in SEQ ID N0:8. The predicted amino acid sequence of the di386_3 protein corresponding to the foregoing nucleotide sequence is reported in SEQ ID N0:8. Amino acids 39 to 51 are a predicted leader/signal sequence, with the predicted mature amino acid sequence beginning at amino acid 52, or are a transmembrane domain. Amino acids 17 to 29 OF SEQ ID N0:8 are also a possible leader/signal sequence, with the predicted mature amino acid sequence beginning at amino acid 30, or are a transmembrane domain. Additional nucleotide sequence from the 3' portion of di386_3, including the polyA tail, is reported in SEQ ID N0:9.
The EcoRI/NotI restriction fragment obtainable from the deposit containing clone di386_3 should be approximately 2000 bp.
The nucleotide sequence disclosed herein for di386_3 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and FASTA search protocols. di386_3 demonstrated no similarity with any known sequences 2 0 in those databases.
Clone "em397 2"
A polynucleodde of the present invention has been identified as clone "em397_2".
em397_2 was isolated from a human fetal kidney cDNA library using methods which are 2 5 selective for cDNAs encoding secreted proteins (see U.S. Pat. No.
5,536,637), or was identified as encoding a secreted or transmembrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. em397_2 is a full-length clone, including the entire coding sequence of a secreted protein (also referred to herein as "em397_2 protein") 3 0 The nucleotide sequence of em397_2 as presently determined is reported in SEQ
ID N0:10. What applicants presently believe to be the proper reading frame and the predicted amino acid sequence of the em397_2 protein corresponding to the foregoing nucleotide sequence is reported in SEQ ID NO:11.

The EcoRI/NotI restriction fragment obtainable from the deposit containing clone em397_2 should be approximately 1250 bp.
The nucleotide sequence disclosed herein for em397_2 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and FASTA search protocols. em397 2 demonstrated at least some similarity with sequences identified as AA092876 (m0851.seq.F Fetal heart, Lambda ZAP Express Homo Sapiens eDNA 5'), AA180952 (zp41b06.r1 Stratagene muscle 937209 Homo sapiens cDNA
clone 611987 5'), AA463323 (zx7lfOl.r1 Soares total fetus Nb2HF8 9w Homo sapiens), (ys74fOl.r1 Homo Sapiens cDNA clone 220537 5'), W56381 (zc57a01.r1 Soares parathyroid tumor NbHPA Homo sapiens cDNA clone 326376 5'), W88527 (zh73g02.s1 Soares fetal liver spleen 1NFLS S 1 Homo sapiens cDNA clone 417746 3'), and (H.sapiens CpG island DNA genomic Msel fragment, clone 13d12, reverse read cpg13d12.rtlc). Based upon sequence similarity, em397_2 proteins and each similar protein or peptide may share at least some activity.
Clone "fh170 7"
A polynucleotide of the present invention has been identified as clone "fh170_7".
fh170_7 was isolated from a human fetal brain cDNA library using methods which are selective for cDNAs encoding secreted proteins (see U.S. Pat. No. 5,536,637), or was 2 0 identified as encoding a secreted or transmembrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. fh170 7 is a full-length clone, including the entire coding sequence of a secreted protein (also referred to herein as "fh170 7 protein").
The nucleotide sequence of fh170 7 as presently determined is reported in SEQ
ID
2 5 N0:12. What applicants presently believe to be the proper reading frame and the predicted amino acid sequence of the fh170 7 protein corresponding to the foregoing nucleotide sequence is reported in SEQ ID N0:13. Amino acids 127 to 139 are a predicted leader/signal sequence, with the predicted mature amino acid sequence beginning at amino acid 140, or are a transmembrane domain.
3 0 The EcoRI/NotI restriction fragment obtainable from the deposit containing clone fh170_7 should be approximately 2200 bp.
The nucleotide sequence disclosed herein for fh170_7 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and FASTA search protocols. fh170_7 demonstrated at least some similarity with sequences identified as AA112479 (zn69a02.s1 Stratagene HeLacell s3 937216 Homo sapiens cDNA
clone 563402 3'), AA593402 (nn57g10.s1 NCI CGAP_Kid6 Homo sapiens cDNA clone IMAGE:1088034), Q76795 (Human genome fragment), T26136 (Human gene signature HUMGS08373), and 219759 (H. sapiens putatively transcribed partial sequence;
UK-HGMP sequence ID AAAALWX; single read). The predicted amino acid sequence disclosed herein for fh170 7 was searched against the GenPept and GeneSeq amino acid sequence databases using the BLASTX search protocol. The predicted fh170 7 protein demonstrated at least some similarity to sequences identified as D32253 (MagA
[Magnetospirillum sp.]) and W01520 (MagA protein). The predicted fh170_7 protein also demonstrated at least some similarity to other prokaryotic membrane transport proteins:
potassium-efflux system protein kefB and NaH-antiporter protein. Based upon sequence similarity, fh170 7 proteins and each similar protein or peptide may share at least some activity. The TopPredII computer program predicts ten potential transmembrane domains within the fh170 7 protein sequence, centered around amino acids 130,160, 210, 230, 280, 310, 360, 380, 420, and 500 of SEQ ID N0:13, respectively.
Clone "fn53 4"
A polynucleotide of the present invention has been identified as clone "fn53_4".
2 0 fn53 4 was isolated from a human fetal brain cDNA library using methods which are selective for cDNAs encoding secreted proteins (see U.S. Pat. No. 5,536,637), or was identified as encoding a secreted or transmembrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. fn53_4 is a full-length clone, including the entire coding sequence of a secreted protein (also referred to herein as 2 5 "fn53 4 proteiri').
The nucleotide sequence of the 5' portion of fn53 4 as presently determined is reported in SEQ ID N0:14. An additional internal nucleotide sequence from fn53_4 as presently determined is reported in SEQ ID N0:15. What applicants believe is the proper reading frame and the predicted amino acid sequence encoded by such internal sequence 3 0 is reported in SEQ ID N0:16. Additional nucleotide sequence from the 3' portion of fn53 4, including the polyA tail, is reported in SEQ ID N0:17.
The EcoRI/NotI restriction fragment obtainable from the deposit containing clone fn53 4 should be approximately 4100 bp.

The nucleotide sequence disclosed herein for fn53 4 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and FASTA search protocols. fn53 4 demonstrated at least some similarity with sequences identified as AA 179207 (zp46c l l .s 1 Stratagene HeLa cell s3 937216 Homo Sapiens cDNA
clone 612500 3'), AA279207 (zs83e06.s 1 NCI CGAP_GCB 1 Homo sapiens cDNA clone IMAGE:704098 3', mRNA sequence), H87151 (yw 15a06.s 1 Homo sapiens cDNA clone 252274 3'), and H83373 (ys90a09.r1 Homo Sapiens cDNA clone 222040 5' similar to SP:BICD_DROME P16568 CYTOSKELETON-LIKE BICAUDAL D). The predicted amino acid sequence disclosed herein for fn53 4 was searched against the GenPept and GeneSeq amino acid sequence databases using the BLASTX search protocol. The predicted fn53 4 protein demonstrated at least some similarity to sequences identified as M31684 and XS 1652 (bicaudalD protein [Drosophila melanogaster]) and 866930 (AMML
chromosome inv( 16) product). Based upon sequence similarity, fn53 4 proteins and each similar protein or peptide may share at least some activity.
Clone "fq505 4"
A polynucleotide of the present invention has been identified as clone "fq505 4".
fq505 4 was isolated from a human adult testes cDNA library using methods which are selective for cDNAs encoding secreted proteins (see U.S. Pat. No. 5,536,637), or was 2 0 identified as encoding a secreted or transmembrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. fq505_4 is a full-length clone, including the entire coding sequence of a secreted protein (also referred to herein as "fq505 4 protein") The nucleotide sequence of fq505 4 as presently determined is reported in SEQ
ID
2 5 N0:18. What applicants presently believe to be the proper reading frame and the predicted amino acid sequence of the fq505_4 protein corresponding to the foregoing nucleotide sequence is reported in SEQ ID N0:19.
The EcoRI/NotI restriction fragment obtainable from the deposit containing clone fq505_4 should be approximately 512 bp.
3 0 The nucleotide sequence disclosed herein for fq505 4 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and FASTA search protocols. fq505 4 demonstrated at least some similarity with sequences identified as 271861 (C.hircus mRNA for EST2-31 ). The predicted amino acid sequence disclosed herein for fq505 4 was searched against the GenPept and GeneSeq amino acid sequence databases using the BLASTX search protocol. The predicted fq505 4 protein demonstrated at least some similarity to sequences identified as P92141 (Recombinant human adult T cell leukaemia derived factor polypeptide), X54539 (thioredoxin [Homo sapiens]), and X77584 {ATL-derived factor/thioredoxin [Homo sapiens]). The predicted fq505 4 protein also demonstrated at least some similarity to sequences identified as surface associated sulphydryl protein (GenProt accession number135773). The similarity between these proteins includes a WCGPC catalytic site, which is present as RCGPC at amino acids 31 to 35 of the predicted fq505_4 protein. In addition to having thioredoxin catalytic activity, at least one thioredoxin-related protein has also been reported to be "an IL-2 receptor/Tac inducer" (Tagaya et al., 1989, EMBO j. 8(3): 757-764). At least one thioredoxin-related protein is reported to be associated with the plasma membrane, "indicating that the protein may be a member of this [thioredoxin] family and function as an essential growth factor" (Martin and Dean,1991, Biochem. Biophys. Res.
Commun.175(1):
123-128). Based upon sequence similarity, fq505_4 proteins and each similar protein or peptide may share at least some activity.
Clone "fwl3 9"
A polynucleotide of the present invention has been identified as clone "fwl3_9".
2 0 fwl3_9 was isolated from a human adult testes (teratocarcinoma NCCIT) cDNA
library using methods which are selective for cDNAs encoding secreted proteins (see U.S. Pat.
No. 5,536,637), or was identified as encoding a secreted or transmembrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein.
fwl3_9 is a full-length clone, including the entire coding sequence of a secreted protein (also 2 5 referred to herein as "fwl3_9 protein").
The nucleotide sequence of fwl3 9 as presently determined is reported in SEQ
ID
N0:20. What applicants presently believe to be the proper reading frame and the predicted amino acid sequence of the fwl3 9 protein corresponding to the foregoing nucleotide sequence is reported in SEQ ID N0:21.
3 0 The EcoRI/NotI restriction fragment obtainable from the deposit containing clone fwl3 9 should be approximately 1900 bp.
The nucleotide sequence disclosed herein for fwl3_9 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and FASTA search protocols. fwl3_9 demonstrated at least some similarity with sequences identified as AA047SS7 (zf13f08.r1 Soares fetal heart NbHHI9W Homo Sapiens cDNA
clone 376839 S'), AA284S24 (zt20d07.s 1 Soares ovary tumor NbHOT Homo Sapiens cDNA clone 713677 3'), AAS02778 (ne43e04.s 1 NCI CGAP_Co3 Homo sapiens cDNA
clone IMAGE:900126), J04743 (M.musculus Ms6-hm locus, repeat elements), R3S040 (yh86a10.r1 Homo sapiens cDNA clone 136602 S'), T21414 (Human gene signature HUMGS02783), and U91318 (Human chromosome 16p13 BAC clone CTT987SK-962B4 complete sequence). Based upon sequence similarity, fwl3_9 proteins and each similar protein or peptide may share at least some activity. The TopPredII computer program predicts a potential transmembrane domain within the fwl3 9 protein sequence centered around amino acid 30 of SEQ ID N0:21.
Clone "gg619 2"
A polynucleotide of the present invention has been identified as clone "gg619_2".
gg619_2 was isolated from a human fetal kidney cDNA library using methods which are selective for cDNAs encoding secreted proteins (see U.S. Pat. No. 5,536,637), or was identified as encoding a secreted or transmembrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. gg619_2 is a full-length clone, including the entire coding sequence of a secreted protein (also referred to herein as 2 0 "gg619 2 protein") The nucleotide sequence of gg619 2 as presently determined is reported in SEQ
ID N0:22. What applicants presently believe to be the proper reading frame and the predicted amino acid sequence of the gg619_2 protein corresponding to the foregoing nucleotide sequence is reported in SEQ ID N0:23.
2 5 The EcoRI/NotI restriction fragment obtainable from the deposit containing clone gg619_2 should be approximately 1350 bp.
The nucleotide sequence disclosed herein for gg619_2 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and FASTA search protocols. gg619_2 demonstrated at least some similarity with sequences 3 0 identified as N429S7 (yy12b12.r1 Homo sapiens cDNA clone 271007 S' similar to SW:ALGS_YEAST P403S0 dolichyl-phosphate beta-glucosyltransferase), NS0844 (yy9lgOS.s1 Homo sapiens cDNA clone 280952 3' similar to SW:ALGS_YEAST P403S0 dolichyl-phosphate beta-glucosyltransferase), and N62S97 (yz7Sa06.s 1 Homo Sapiens cDNA clone 288850 3' similar to SW:ALGS YEAST P40350 Dolichyl-phosphate beta-glucosyltransferase). The predicted amino acid sequence disclosed herein for gg619_2 was searched against the GenPept and GeneSeq amino acid sequence databases using the BLASTX search protocol. The predicted gg619_2 protein demonstrated at least some similarity to sequences identified as 838093 (nodC N-terminal portion [Bradyrhizobium sp. (Parasponia)]) and X77573 (dolichyl-phosphate beta-glucosyl-transferase [Saccharomyces cerevisiae]). The enzyme UDP-glucose:dolichyl-phosphate glucosyltransferase is a transmembrane-bound enzyme of the endoplasmic reticulum involved in protein N-linked glycosylation, and catalyzes the transfer of glucose from UDP-glucose to dolichyl phosphate. Based upon sequence similarity, gg619_2 proteins and each similar protein or peptide may share at least some activity. The TopPredII
computer program predicts a potential transmembrane domain within the gg619_2 protein sequence, centered around amino acid 188 of SEQ ID N0:23.
Deposit of Clones Clones bh389_11, bk112_15, bk200_13, di386_3, em397 2, fh170_7, fn53_4, fq505_4, fwl3_9, and gg619_2 were deposited on June 10, 1997 with the American Type Culture Collection (10801 University Boulevard, Manassas, Virginia 20110-2209 U.S.A.) as an original deposit under the Budapest Treaty and were given the accession number ATCC
2 0 98451, from which each clone comprising a particular polynucleotide is obtainable. All restrictions on the availability to the public of the deposited material will be irrevocably removed upon the granting of the patent, except for the requirements specified in 37 C.F.R. ~ 1.808(b), and the term of the deposit will comply with 37 C.F.R. ~
1.806.
Each clone has been transfected into separate bacterial cells (E. coli) in this 2 5 composite deposit. Each clone can be removed from the vector in which it was deposited by performing an EcoRI/NotI digestion (5' site, EcoRI; 3' site, NotI) to produce the appropriate fragment for such clone. Each clone was deposited in either the pED6 or pNOTs vector depicted in Figures 1A and 1B, respectively. The pED6dpc2 vector ("pED6") was derived from pED6dpc1 by insertion of a new polylinker to facilitate 3 0 cDNA cloning (Kaufman et al., 1991, Nucleic Acids Res. 19: 4485-4490); the pNOTs vector was derived from pMT2 (Kaufman et al., 1989, Mol. Cell. Biol. 9: 946-958) by deletion of the DHFR sequences, insertion of a new polylinker, and insertion of the M13 origin of replication in the CIaI site. In some instances, the deposited clone can become "flipped"

{i.e., in the reverse orientation) in the deposited isolate. In such instances, the cDNA insert can still be isolated by digestion with EcoRI and NotI. However, NotI will then produce the 5' site and EcoRI will produce the 3' site for placement of the cDNA in proper orientation for expression in a suitable vector. The cDNA may also be expressed from the vectors in which they were deposited.
Bacterial cells containing a particular clone can be obtained from the composite deposit as follows:
An oligonucleotide probe or probes should be designed to the sequence that is known for that particular clone. This sequence can be derived from the sequences provided herein, or from a combination of those sequences. The sequence of an oligonucleotide probe that was used to isolate or to sequence each full-length clone is identified below, and should be most reliable in isolating the clone of interest.
Clone Probe Sequence bh389_l l SEQ ID N0:24 bk112_15 SEQ ID N0:25 bk200_13 SEQ ID N0:26 di386_3 SEQ ID N0:27 em397_2 SEQ ID N0:28 2 0 fh170 7 SEQ ID N0:29 fn53_4 SEQ ID N0:30 fq505 4 SEQ ID N0:31 fwl3_9 SEQ ID N0:32 gg619_2 SEQ ID N0:33 In the sequences listed above which include an N at position 2, that position is occupied in preferred probes/primers by a biotinylated phosphoaramidite residue rather than a nucleotide (such as , for example, that produced by use of biotin phosphoramidite (1-dimethoxytrityloxy-2-(N-biotinyl-4-aminobutyl)-propyl-3-O-(2-cyanoethyl)-(N,N-3 0 diisopropyl)-phosphoramadite) (Glen Research, cat. no. 10-1953)).
The design of the oligonucleotide probe should preferably follow these parameters:
(a) It should be designed to an area of the sequence which has the fewest ambiguous bases ("N's"), if any;

(b) It should be designed to have a Tm of approx. 80 ° C (assuming 2° for each A or T and 4 degrees for each G or C).
The oligonucleotide should preferably be labeled with g-32P ATP (specific activity 6000 Ci/mmole) and T4 polynucleotide kinase using commonly employed techniques for labeling oligonucleotides. Other labeling techniques can also be used.
Unincorporated label should preferably be removed by gel filtration chromatography or other established methods. The amount of radioactivity incorporated into the probe should be quantitated by measurement in a scintillation counter. Preferably, specific activity of the resulting probe should be approximately 4e+6 dpm/pmole.
The bacterial culture containing the pool of full-length clones should preferably be thawed and 100 ul of the stock used to inoculate a sterile culture flask containing 25 ml of sterile L-broth containing ampicillin at 100 ug/ml. The culture should preferably be grown to saturation at 37°C, and the saturated culture should preferably be diluted in fresh L-broth. Aliquots of these dilutions should preferably be plated to determine the dilution and volume which will yield approximately 5000 distinct and well-separated colonies on solid bacteriological media containing L-broth containing ampicillin at 100 ug/ml and agar at 1.5% in a 250 mm petri dish when grown overnight at 37°C. Other known methods of obtaining distinct, well-separated colonies can also be employed.
Standard colony hybridization procedures should then be used to transfer the 2 0 colonies to nitrocellulose filters and lyse, denature and bake them.
The filter is then preferably incubated at 65°C for 1 hour with gentle agitation in 6X SSC (20X stock is 175.3 g NaCI/liter, 88.2 g Na citrate/liter, adjusted to pH 7.0 with NaOH) containing 0.5% SDS,100 ug/ml of yeast IZNA, and 10 mM EDTA
(approximately 10 mL per 150 mm filter). Preferably, the probe is then added to the hybridization mix at a concentration greater than or equal to 1e+6 dpm/mL. The filter is then preferably incubated at 65°C with gentle agitation overnight. The filter is then preferably washed in 500 mL of 2X SSC/0.5% SDS at room temperature without agitation, preferably followed by 500 mL of 2X SSC/0.1% SDS at room temperature with gentle shaking for 15 minutes.
A third wash with O.1X SSC/0.5% SDS at 65°C for 30 minutes to 1 hour is optional. The 3 0 filter is then preferably dried and subjected to autoradiography for sufficient time to visualize the positives on the X-ray film. Other known hybridization methods can also be employed.

The positive colonies are picked, grown in culture, and plasmid DNA isolated using standard procedures. The clones can then be verified by restriction analysis, hybridization analysis, or DNA sequencing.
Fragments of the proteins of the present invention which are capable of exhibiting biological activity are also encompassed by the present invention. Fragments of the protein may be in linear form or they may be cyclized using known methods, for example, as described in H.U. Saragovi, et al., Bio/Technology 10, 773-778 (1992) and in R.S.
McDowell, et al., J. Amer. Chem. Soc.114, 9245-9253 (1992), both of which are incorporated herein by reference. Such fragments may be fused to carrier molecules such as immunoglobulins for many purposes, including increasing the valency of protein binding sites. For example, fragments of the protein may be fused through "linker"
sequences to the Fc portion of an immunoglobulin. For a bivalent form of the protein, such a fusion could be to the Fc portion of an IgG molecule. Other immunoglobulin isotypes may also be used to generate such fusions. For example, a protein - IgM fusion would generate a decavalent form of the protein of the invention.
The present invention also provides both full-length and mature forms of the disclosed proteins. The full-length form of the such proteins is identified in the sequence listing by translation of the nucleotide sequence of each disclosed clone. The mature forms) of such protein may be obtained by expression of the disclosed full-length 2 0 polynucleotide (preferably those deposited with ATCC) in a suitable mammalian cell or other host cell. The sequences) of the mature forms) of the protein may also be determinable from the amino acid sequence of the full-length form.
The present invention also provides genes corresponding to the polynucleotide sequences disclosed herein. "Corresponding genes" are the regions of the genome that 2 5 are transcribed to produce the mRNAs from which cDNA polynucleotide sequences are derived and may include contiguous regions of the genome necessary for the regulated expression of such genes. Corresponding genes may therefore include but are not limited to coding sequences, 5' and 3' untranslated regions, alternatively spliced exons, introns, promoters, enhancers, and silencer or suppressor elements. The corresponding genes can 3 0 be isolated in accordance with known methods using the sequence information disclosed herein. Such methods include the preparation of probes or primers from the disclosed sequence information for identification and/or amplification of genes in appropriate genomic libraries or other sources of genomic materials. An "isolated gene" is a gene that has been separated from the adjacent coding sequences, if any, present in the genome of the organism from which the gene was isolated.
Organisms that have enhanced, reduced, or modified expression of the genes) corresponding to the polynucleotide sequences disclosed herein are provided.
The desired change in gene expression can be achieved through the use of antisense polynucleotides or ribozymes that bind and/or cleave the mRNA transcribed from the gene (Albert and Morris, 1994, Trends Pharmacol. Sci. 15(7): 250-254;
Lavarosky et al., 1997, Biochem. Mol. Med. 62(1): 11-22; and Hampel, 1998, Prog. Nucleic Acid Res.
Mol. Biol. 58: 1-39; all of which are incorporated by reference herein). Transgenic animals that have multiple copies of the genes) corresponding to the polynucleotide sequences disclosed herein, preferably produced by transformation of cells with genetic constructs that are stably maintained within the transformed cells and their progeny, are provided.
Transgenic animals that have modified genetic control regions that increase or reduce gene expression levels, or that change temporal or spatial patterns of gene expression, are also provided (see European Patent No. 0 649 464 B1, incorporated by reference herein).
In addition, organisms are provided in which the genes) corresponding to the polynucleotide sequences disclosed herein have been partially or completely inactivated, through insertion of extraneous sequences into the corresponding genes) or through deletion of all or part of the corresponding gene(s). Partial or complete gene inactivation 2 0 can be accomplished through insertion, preferably followed by imprecise excision, of transposable elements (Plasterk,1992, Bioessays 14(9): 629-633; Zwaal et al.,1993, Proc. Natl.
Acad. Sci. USA 90(16): 7431-7435; Clark et al.,1994, Proc. Natl. Acad. Sci.
USA 91(2): 719-722;
all of which are incorporated by reference herein), or through homologous recombination, preferably detected by positive/negative genetic selection strategies (Mansour et al.,1988, 2 S Nature 336: 348-352; U.S. Patent Nos. 5,464,764; 5,487,992; 5,627,059;
5,631,153; 5,614, 396;
5,616,491; and 5,679,523; all of which are incorporated by reference herein).
These organisms with altered gene expression are preferably eukaryotes and more preferably are mammals. Such organisms are useful for the development of non-human models for the study of disorders involving the corresponding gene{s), and for the development of 3 0 assay systems for the identification of molecules that interact with the protein products) of the corresponding gene(s).
Where the protein of the present invention is membrane-bound (e.g., is a receptor), the present invention also provides for soluble forms of such protein. In such forms part or all of the intracellular and transmembrane domains of the protein are deleted such that the protein is fully secreted from the cell in which it is expressed. The intracellular and transmembrane domains of proteins of the invention can be identified in accordance with known techniques for determination of such domains from sequence information.
Proteins and protein fragments of the present invention include proteins with amino acid sequence lengths that are at least 25%(more preferably at least 50%, and most preferably at least 75%) of the length of a disclosed protein and have at least 60% sequence identity (more preferably, at least 75% identity; most preferably at least 90%
or 95%
identity) with that disclosed protein, where sequence identity is determined by comparing the amino acid sequences of the proteins when aligned so as to maximize overlap and identity while minimizing sequence gaps. Also included in the present invention are proteins and protein fragments that contain a segment preferably comprising 8 or more (more preferably 20 or more, most preferably 30 or more) contiguous amino acids that shares at least 75% sequence identity (more preferably, at least 85% identity;
most preferably at least 95% identity) with any such segment of any of the disclosed proteins.
Species homologues of the disclosed polynucleotides and proteins are also provided by the present invention. As used herein, a "species homologue" is a protein or polynucleotide with a different species of origin from that of a given protein or polynucleotide, but with significant sequence similarity to the given protein or polynucleotide. Preferably, polynucleotide species homologues have at least 60% sequence 2 0 identity (more preferably, at least 75% identity; most preferably at least 90% identity} with the given polynucleotide, and protein species homologues have at least 30%
sequence identity (more preferably, at least 45% identity; most preferably at least 60%
identity) with the given protein, where sequence identity is determined by comparing the nucleotide sequences of the polynucleotides or the amino acid sequences of the proteins when 2 5 aligned so as to maximize overlap and identity while minimizing sequence gaps. Species homologues may be isolated and identified by making suitable probes or primers from the sequences provided herein and screening a suitable nucleic acid source from the desired species. Preferably, species homologues are those isolated from mammalian species. Most preferably, species homologues are those isolated from certain mammalian 3 0 species such as, for example, Pan troglodytes, Gorilla gorilla, Pongo pygmaeus, Hylobates concolor, Macaca mulatta, Papio papio, Papio hamadryas, Cercopithecus aethiops, Cebus capucinus, Aotus trivirgatus, Sanguinus Oedipus, Microcebus murinus, Mus musculus, Rccttus norvegicus, Cricetulus griseus, Felis catus, Mustela vison, Canis familiaris, Oryctolagus cuniculus, Bos taunts, Ovis aries, Sus scrofa, and Eguus caballus, for which genetic maps have been created allowing the identification of syntenic relationships between the genomic organization of genes in one species and the genomic organization of the related genes in another species (O'Brien and Seuanez, 1988, Ann. Rev. Genet. 22: 323-351; O'Brien et al., 1993, Nature Genetics 3:103-112; Johansson et al., 1995, Genomics 25: 682-690; Lyons et al., 1997, Nature Genetics 15: 47-56; O'Brien et al.,1997, Trends in Genetics 13(10): 393-399;
Carver and Stubbs, 1997, Genome Research 7:1123-1137; all of which are incorporated by reference herein).
The invention also encompasses allelic variants of the disclosed polynucleotides or proteins; that is, naturally-occurring alternative forms of the isolated polynucleotides which also encode proteins which are identical or have significantly similar sequences to those encoded by the disclosed polynucleotides. Preferably, allelic variants have at least 60% sequence identity (more preferably, at least 75% identity; most preferably at least 90%
identity) with the given polynucleotide, where sequence identity is determined by comparing the nucleotide sequences of the polynucleotides when aligned so as to maximize overlap and identity while minimizing sequence gaps. Allelic variants may be isolated and identified by making suitable probes or primers from the sequences provided herein and screening a suitable nucleic acid source from individuals of the appropriate species.
The invention also includes polynucleotides with sequences complementary to those of the polynucleotides disclosed herein.
2 0 The present invention also includes polynucleotides that hybridize under reduced stringency conditions, more preferably stringent conditions, and most preferably highly stringent conditions, to polynucleotides described herein. Examples of stringency conditions are shown in the table below: highly stringent conditions are those that are at least as stringent as, for example, conditions A-F; stringent conditions are at least as 2 5 stringent as, for example, conditions G-L; and reduced stringency conditions are at least as stringent as, for example, conditions M-R.

StringencyPolynucleotideHybrid Hybridization TemperatureWash ConditionHybrid Length and Temperature (bp)t Buffer' and Buffer' A DNA:DNA z 50 65C; lxSSC -or- 65C; 0.3xSSC
42C; lxSSC, 50% formamide B DNA:DNA <50 TB*; lxSSC TB*; lxSSC

C DNA:RNA z 50 67C; lxSSC -or- 67C; 0.3xSSC
45C; lxSSC, 50% formamide D DNA:RNA <50 Tp*; lxSSC T"*; IxSSC

E RNA:RNA z 50 70C; lxSSC -or- 70C; 0.3xSSC
SOC; lxSSC, 50% formamide F RNA:RNA <50 T,*; lxSSC TF*; lxSSC

G DNA:DNA z 50 65C; 4xSSC -or- 65C; lxSSC
42C; 4xSSC, 50% formamide H DNA:DNA <50 TH*; 4xSSC T"*; 4xSSC

I DNA:RNA z 50 67C; 4xSSC -or- 67C; lxSSC
45C; 4xSSC, 50% formamide J DNA:RNA <50 T~*; 4xSSC T~*; 4xSSC

K RNA:RNA s 50 70C; 4xSSC -or- 67C; lxSSC
50C; 4xSSC, 50% formamide L RNA:RNA <50 T, *; 2xSSC T, *; 2xSSC

M DNA:DNA z 50 50C; 4xSSC -or- 50C; 2xSSC
40C; 6xSSC, 50% formamide N DNA:DNA <50 TN*; 6xSSC TN*; 6xSSC

O DNA:RNA z 50 55C; 4xSSC-or- 55C; 2xSSC
42C; 6xSSC, 50% formamide P DNA:RNA <50 T,.*; 6xSSC T,,*; 6xSSC

Q RNA:RNA z 50 60C; 4xSSC -or- 60C; 2xSSC
45C; 6xSSC, 50% formamide 2 R RNA:RNA <50 TR*; 4xSSC TR*; 4xSSC

$: The hybrid length is that anticipated for the hybridized regions) of the hybridizing polynucleotides. When hybridizing a polynucleotide to a target polynucleotide of unknown sequence, the hybrid length is assumed to be that of the hybridizing polynucleotide. When polynucleotides of known sequence are hybridized, the 2 5 hybrid length can be determined by aligning the sequences of the polynucleoHdes and identifying the region or regions of optimal sequence complementarity.
*: SSPE (lxSSPE is 0.15M NaCI, lOmM NaH2POa, and 1.25mM EDTA, pH 7.4) can be substituted for SSC
(lxSSC is 0.15M NaCI and l5mM sodium citrate) in the hybridization and wash buffers; washes are performed for 15 minutes after hybridization is complete.
3 0 *Ta - TR: The hybridization temperature for hybrids anticipated to be less than 50 base pairs in length should be 5-10°C less than the melting temperature (Tm) of the hybrid, where Tm is determined according to the following equations. For hybrids less than 18 base pairs in length, Tm(°C) = 2(# of A + T bases) + 4(# of G +
C bases). For hybrids between 18 and 49 base pairs in length, Tm(°C) =
81.5 + 16.6(log,o(Na']) + 0.41(%G+C) (600/N), where N is the number of bases in the hybrid, and [Na'] is the concentration of sodium ions in the 3 5 hybridization buffer ([Na'] for lxSSC = 0.165 M).

Additional examples of stringency conditions for polynucleotide hybridization are provided in Sambrook, J., E.F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, chapters 9 and 11, and Current Protocols in Molecular Biology,1995, F.M.
Ausubel et al., eds., John Wiley & Sons, Inc., sections 2.10 and 6.3-6.4, incorporated herein by reference.
Preferably, each such hybridizing polynucleotide has a length that is at least 25%(more preferably at least 50%, and most preferably at least 75%) of the length of the polynucleotide of the present invention to which it hybridizes, and has at least 60%
sequence identity (more preferably, at least 75% identity; most preferably at least 90% or 95% identity) with the polynucleotide of the present invention to which it hybridizes, where sequence identity is determined by comparing the sequences of the hybridizing polynucleotides when aligned so as to maximize overlap and identity while minimizing sequence gaps.
The isolated polynucleotide of the invention may be operably linked to an expression control sequence such as the pMT2 or pED expression vectors disclosed in Kaufman et al., Nucleic Acids Res. 19, 4485-4490 (1991), in order to produce the protein recombinantly. Many suitable expression control sequences are known in the art. General methods of expressing recombinant proteins are also known and are exemplified in R.
Kaufman, Methods in Enzymology 185, 537-566 (1990). As defined herein "operably 2 0 linked" means that the isolated polynucleotide of the invention and an expression control sequence are situated within a vector or cell in such a way that the protein is expressed by a host cell which has been transformed {transfected) with the ligated polynucleotide/expression control sequence.
A number of types of cells may act as suitable host cells for expression of the 2 5 protein. Mammalian host cells include, for example, monkey COS cells, Chinese Hamster Ovary (CHO) cells, human kidney 293 cells, human epidermal A431 cells, human Co1o205 cells, 3T3 cells, CV-1 cells, other transformed primate cell lines, normal diploid cells, cell strains derived from in vitro culture of primary tissue, primary explants, HeLa cells, mouse L cells, BHK, HL-60, U937, HaK or Jurkat cells.
3 0 Alternatively, it may be possible to produce the protein in lower eukaryotes such as yeast or in prokaryotes such as bacteria. Potentially suitable yeast strains include Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces strains, Candida, or any yeast strain capable of expressing heterologous proteins. Potentially suitable bacterial strains include Escherichia coli, Bacillus subtilis, Salmonella typhimurium, or any bacterial strain capable of expressing heterologous proteins. If the protein is made in yeast or bacteria, it may be necessary to modify the protein produced therein, for example by phosphorylation or glycosylation of the appropriate sites, in order to obtain the functional protein. Such covalent attachments may be accomplished using known chemical or enzymatic methods.
The protein may also be produced by operably linking the isolated polynucleotide of the invention to suitable control sequences in one or more insect expression vectors, and employing an insect expression system. Materials and methods for baculovirus/insect cell expression systems are commercially available in kit form from, e.g., Invitrogen, San Diego, California, U.S.A. (the MaxBac~ kit), and such methods are well known in the art, as described in Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987), incorporated herein by reference. As used herein, an insect cell capable of expressing a polynucleotide of the present invention is "transformed."
The protein of the invention may be prepared by culturing transformed host cells under culture conditions suitable to express the recombinant protein. The resulting expressed protein may then be purified from such culture (i.e., from culture medium or cell extracts) using known purification processes, such as gel filtration and ion exchange chromatography. The purification of the protein may also include an affinity column 2 0 containing agents which will bind to the protein; one or more column steps over such affinity resins as concanavalin A-agarose, heparin-toyopearl~ or Cibacrom blue Sepharose~; one or more steps involving hydrophobic interaction chromatography using such resins as phenyl ether, butyl ether, or propyl ether; or immunoaffinity chromatography.
2 5 Alternatively, the protein of the invention may also be expressed in a form which will facilitate purification. For example, it may be expressed as a fusion protein, such as those of maltose binding protein (MBP), glutathione-S-transferase (GST) or thioredoxin (TRX). Kits for expression and purification of such fusion proteins are commercially available from New England BioLab (Beverly, MA), Pharmacia (Piscataway, NJ) and 3 0 InVitrogen, respectively. The protein can also be tagged with an epitope and subsequently purified by using a specific antibody directed to such epitope.
One such epitope ("Flag") is commercially available from Kodak (New Haven, CT).
Finally, one or more reverse-phase high performance liquid chromatography (RP-HPLC) steps employing hydrophobic RP-HPLC media, e.g., silica gel having pendant methyl or other aliphatic groups, can be employed to further purify the protein. Some or all of the foregoing purification steps, in various combinations, can also be employed to provide a substantially homogeneous isolated recombinant protein. The protein thus purified is substantially free of other mammalian proteins and is defined in accordance with the present invention as an "isolated protein."
The protein of the invention may also be expressed as a product of transgenic animals, e.g., as a component of the milk of transgenic cows, goats, pigs, or sheep which are characterized by somatic or germ cells containing a nucleotide sequence encoding the protein.
The protein may also be produced by known conventional chemical synthesis.
Methods for constructing the proteins of the present invention by synthetic means are known to those skilled in the art. The synthetically-constructed protein sequences, by virtue of sharing primary, secondary or tertiary structural and/or conformational characteristics with proteins may possess biological properties in common therer~~ith, including protein activity. Thus, they may be employed as biologically active or immunological substitutes for natural, purified proteins in screening of therapeutic compounds and in immunological processes for the development of antibodies.
The proteins provided herein also include proteins characterized by amino acid sequences similar to those of purified proteins but into which modification are naturally 2 0 provided or deliberately engineered. For example, modifications in the peptide or DNA
sequences can be made by those skilled in the art using known techniques.
Modifications of interest in the protein sequences may include the alteration, substitution, replacement, insertion or deletion of a selected amino acid residue in the coding sequence.
For example, one or more of the cysteine residues may be deleted or replaced with another 2 S amino acid to alter the conformation of the molecule. Techniques for such alteration, substitution, replacement, insertion or deletion are well known to those skilled in the art (see, e.g., U.S. Patent No. 4,518,584). Preferably, such alteration, substitution, replacement, insertion or deletion retains the desired activity of the protein.
Other fragments and derivatives of the sequences of proteins which would be 3 0 expected to retain protein activity in whole or in part and may thus be useful for screening or other immunological methodologies may also be easily made by those skilled in the art given the disclosures herein. Such modifications are believed to be encompassed by the present invention.

USES AND BIOLOGICAL ACTIVITY
The polynucleotides and proteins of the present invention are expected to exhibit one or more of the uses or biological activities (including those associated with assays cited herein) identified below. Uses or activities described for proteins of the present invention may be provided by administration or use of such proteins or by administration or use of polynucleotides encoding such proteins (such as, for example, in gene therapies or vectors suitable for introduction of DNA).
Research Uses and Utilities The polynucleotides provided by the present invention can be used by the research community for various purposes. The polynucleotides can be used to express recombinant protein for analysis, characterization or therapeutic use; as markers for tissues in which the corresponding protein is preferentially expressed (either constitutively or at a particular stage of tissue differentiation or development or in disease states); as molecular weight markers on Southern gels; as chromosome markers or tags {when labeled) to identify chromosomes or to map related gene positions; to compare with endogenous DNA sequences in patients to identify potential genetic disorders; as probes to hybridize and thus discover novel, related DNA sequences; as a source of information to derive PCR primers for genetic fingerprinting; as a probe to "subtract-out"
2 0 known sequences in the process of discovering other novel polynucleotides;
for selecting and making oligomers for attachment to a "gene chip" or other support, including for examination of expression patterns; to raise anti-protein antibodies using DNA
immunization techniques; and as an antigen to raise anti-DNA antibodies or elicit another immune response. Where the polynucleotide encodes a protein which binds or potentially 2 5 binds to another protein (such as, for example, in a receptor-ligand interaction), the polynucleotide can also be used in interaction trap assays (such as, for example, those described in Gyuris et al., 1993, Cell 75: 791-803 and in Rossi et al., 1997, Proc. Natl. Acad.
Sci. USA 94: 8405-8410, all of which are incorporated by reference herein) to identify polynucleotides encoding the other protein with which binding occurs or to identify 3 0 inhibitors of the binding interaction.
The proteins provided by the present invention can similarly be used in assay to determine biological activity, including in a panel of multiple proteins for high-throughput screening; to raise antibodies or to elicit another immune response; as a reagent (including the labeled reagent) in assays designed to quantitatively determine levels of the protein (or its receptor) in biological fluids; as markers for tissues in which the corresponding protein is preferentially expressed (either constitutively or at a particular stage of tissue differentiation or development or in a disease state); and, of course, to isolate correlative receptors or ligands. Where the protein binds or potentially binds to another protein (such as, for example, in a receptor-ligand interaction), the protein can be used to identify the other protein with which binding occurs or to identify inhibitors of the binding interaction. Proteins involved in these binding interactions can also be used to screen for peptide or small molecule inhibitors or agonists of the binding interaction.
Any or all of these research utilities are capable of being developed into reagent grade or kit format for commercialization as research products.
Methods for performing the uses listed above are well known to those skilled in the art. References disclosing such methods include without limitation "Molecular Cloning: A Laboratory Manual", 2d ed., Cold Spring Harbor Laboratory Press, Sambrook, J., E.F. Fritsch and T. Maniatis eds., 1989, and "Methods in Enzymology: Guide to Molecular Cloning Techniques", Academic Press, Bergen S.L. and A.R. Kimmel eds.,1987.
Nutritional Uses Polynucleotides and proteins of the present invention can also be used as 2 0 nutritional sources or supplements. Such uses include without limitation use as a protein or amino acid supplement, use as a carbon source, use as a nitrogen source and use as a source of carbohydrate. In such cases the protein or polynucleotide of the invention can be added to the feed of a particular organism or can be administered as a separate solid or liquid preparation, such as in the form of powder, pills, solutions, suspensions or 2 5 capsules. In the case of microorganisms, the protein or polynucleotide of the invention can be added to the medium in or on which the microorganism is cultured.
Cytokine and Cell Proliferation/Differentiation Activity A protein of the present invention may exhibit cytokine, cell proliferation {either 3 0 inducing or inhibiting) or cell differentiation (either inducing or inhibiting) activity or may induce production of other cytokines in certain cell populations. Many protein factors discovered to date, including all known cytokines, have exhibited activity in one or more factor dependent cell proliferation assays, and hence the assays serve as a convenient confirmation of cytokine activity. The activity of a protein of the present invention is evidenced by any one of a number of routine factor dependent cell proliferation assays for cell lines including, without limitation, 32D, DA2, DA1G, T10, B9, B9/11, BaF3, MC9/G, M+ (preB M+), 2E8, RBS, DAl, 123, T1165, HT2, CTLL2, TF-1, Mo7e and CMK.
The activity of a protein of the invention may, among other means, be measured by the following methods:
Assays for T-cell or thymocyte proliferation include without limitation those described in: Current Protocols in Immunology, Ed by J. E. Coligan, A.M.
Kruisbeek, D.H.
Margulies, E.M. Shevach, W Strober, Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function 3.1-3.19; Chapter 7, Immunologic studies in Humans); Takai et al., J. Immunol. 137:3494-3500, 1986;
Bertagnolli et al., J. Immunol.145:1706-1712, 1990; Bertagnolli et al., Cellular Immunology 133:327-341, 1991; Bertagnolli, et al., J. Immunol. 149:3778-3783, 1992;
Bowman et al., J.
Immunol. 152: 1756-1761, 1994.
Assays for cytokine production and/or proliferation of spleen cells, lymph node cells or thymocytes include, without limitation, those described in:
Polyclonal T cell stimulation, Kruisbeek, A.M. and Shevach, E.M. In Current Protocols in Immunology. J.E.e.a.
Coligan eds. Vol 1 pp. 3.12.1-3.12.14, John Wiley and Sons, Toronto. 1994; and Measurement of mouse and human Interferon y, Schreiber, R.D. In Current Protocols in 2 0 Immunology. J.E.e.a. Coligan eds. Vol 1 pp. 6.8.1-6.8.8, John Wiley and Sons, Toronto.1994.
Assays for proliferation and differentiation of hematopoietic and lymphopoietic cells include, without limitation, those described in: Measurement of Human and Murine Interleukin 2 and Interleukin 4, Bottomly, K., Davis, L.S. and Lipsky, P.E. In Current Protocols in Immunology. J.E.e.a. Coligan eds. Vol 1 pp. 6.3.1-6.3.12, John Wiley and Sons, 2 S Toronto. 1991; deVries et al., j. Exp. Med. 173:1205-1211, 1991; Moreau et al., Nature 336:690-692, I9$8; Greenberger et al., Proc. Natl. Acad. Sci. U.S.A. 80:2931-2938, 1983;
Measurement of mouse and human interleukin 6 - Nordan, R. In Current Protocols in Immunology. J.E.e.a. Coligan eds. Vol 1 pp. 6.6.1-6.6.5, John Wiley and Sons, Toronto. 1991;
Smith et al., Proc. Natl. Acad. Sci. U.S.A. 83:1857-1861, 1986; Measurement of human 3 0 Interleukin 11- Bennett, F., Giannotti, J., Clark, S.C. and Turner, K. J.
In Current Protocols in Immunology. J.E.e.a. Coligan eds. Vol 1 pp. 6.15.1 John Wiley and Sons, Toronto. 1991;
Measurement of mouse and human Interleukin 9 - Ciarletta, A., Giannotti, J., Clark, S.C.
and Turner, K.J. In Current Protocols in Immunology. J.E.e.a. Coligan eds. Vol 1 pp. 6.13.1, John Wiley and Sons, Toronto. 1991.

Assays for T-cell clone responses to antigens (which will identify, among others, proteins that affect APC-T cell interactions as well as direct T-cell effects by measuring proliferation and cytokine production) include, without limitation, those described in:
Current Protocols in Immunology, Ed by J. E. Coligan, A.M. Kruisbeek, D.H.
Margulies, E.M. Shevach, W Strober, Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function; Chapter 6, Cytokines and their cellular receptors; Chapter 7, Immunologic studies in Humans);
Weinberger et al., Proc. Natl. Acad. Sci. USA 77:6091-6095, 1980; Weinberger et al., Eur. J.
Immure.

11:405-411, 1981; Takai et al., J. Immunol. 137:3494-3500, 1986; Takai et al., J. Immunol.
140:508-512, 1988.
Immune Stimulating or Suppressing Activity A protein of the present invention may also exhibit immune stimulating or immune suppressing activity, including without limitation the activities for which assays are described herein. A protein may be useful in the treatment of various immune deficiencies and disorders (including severe combined immunodeficiency (SCID)), e.g., in regulating (up or down) growth and proliferation of T and/or B lymphocytes, as well as effecting the cytolytic activity of NK cells and other cell populations.
These immune deficiencies may be genetic or be caused by viral (e.g., HIV) as well as bacterial or fungal 2 0 infections, or may result from autoimmune disorders. More specifically, infectious diseases causes by viral, bacterial, fungal or other infection may be treatable using a protein of the present invention, including infections by HIV, hepatitis viruses, herpesviruses, mycobacteria, Leishmania spp., malaria spp. and various fungal infections such as candidiasis. Of course, in this regard, a protein of the present invention may also 2 5 be useful where a boost to the immune system generally may be desirable, i.e., in the treatment of cancer.
Autoimmune disorders which may be treated using a protein of the present invention include, for example, connective tissue disease, multiple sclerosis, systemic lupus erythematosus, rheumatoid arthritis, autoimmune pulmonary inflammation, 3 0 Guillain-Barre syndrome, autoimmune thyroiditis, insulin dependent diabetes mellitis, myasthenia gravis, graft-versus-host disease and autoimmune inflammatory eye disease.
Such a protein of the present invention may also to be useful in the treatment of allergic reactions and conditions, such as asthma (particularly allergic asthma) or other respiratory problems. Other conditions, in which immune suppression is desired {including, for example, organ transplantation), may also be treatable using a protein of the present invention.
Using the proteins of the invention it may also be possible to immune responses, in a number of ways. Down regulation may be in the form of inhibiting or blocking an immune response already in progress or may involve preventing the induction of an immune response. The functions of activated T cells may be inhibited by suppressing T
cell responses or by inducing specific tolerance in T cells, or both.
Immunosuppression of T cell responses is generally an active, non-antigen-specific, process which requires continuous exposure of the T cells to the suppressive agent. Tolerance, which involves inducing non-responsiveness or anergy in T cells, is distinguishable from immunosuppression in that it is generally antigen-specific and persists after exposure to the tolerizing agent has ceased. Operationally, tolerance can be demonstrated by the lack of a T cell response upon reexposure to specific antigen in the absence of the tolerizing agent.
Down regulating or preventing one or more antigen functions (including without limitation B lymphocyte antigen functions (such as , for example, B7)), e.g., preventing high level lymphokine synthesis by activated T cells, will be useful in situations of tissue, skin and organ transplantation and in graft-versus-host disease (GVHD). For example, blockage of T cell function should result in reduced tissue destruction in tissue 2 0 transplantation. Typically, in tissue transplants, rejection of the transplant is initiated through its recognition as foreign by T cells, followed by an immune reaction that destroys the transplant. The administration of a molecule which inhibits or blocks interaction of a B7 lymphocyte antigen with its natural ligand(s) on immune cells (such as a soluble, monomeric form of a peptide having B7-2 activity alone or in conjunction with a 2 5 monomeric form of a peptide having an activity of another B lymphocyte antigen (e.g., B7-1, B7-3) or blocking antibody), prior to transplantation can lead to the binding of the molecule to the natural ligand(s) on the immune cells without transmitting the corresponding costimulatory signal. Blocking B lymphocyte antigen function in this matter prevents cytokine synthesis by immune cells, such as T cells, and thus acts as an 3 0 immunosuppressant. Moreover, the lack of costimulation may also be sufficient to anergize the T cells, thereby inducing tolerance in a subject. Induction of long-term tolerance by B lymphocyte antigen-blocking reagents may avoid the necessity of repeated administration of these blocking reagents. To achieve sufficient immunosuppression or tolerance in a subject, it may also be necessary to block the function of a combination of B lymphocyte antigens.
The efficacy of particular blocking reagents in preventing organ transplant rejection or GVHD can be assessed using animal models that are predictive of efficacy in humans. Examples of appropriate systems which can be used include allogeneic cardiac grafts in rats and xenogeneic pancreatic islet cell grafts in mice, both of which have been used to examine the immunosuppressive effects of CTLA4Ig fusion proteins in vivo as described in Lenschow et al., Science 257:789-792 (1992) and Turka et al., Proc. Natl. Acad.
Sci USA, 89:11102-11105 (1992). In addition, murine models of GVHD (see Paul ed., Fundamental Immunology, Raven Press, New York, 1989, pp. 846-847) can be used to determine the effect of blocking B lymphocyte antigen function in vivo on the development of that disease.
Blocking antigen function may also be therapeutically useful for treating autoimmune diseases. Many autoimmune disorders are the result of inappropriate activation of T cells that are reactive against self tissue and which promote the production of cytokines and autoantibodies involved in the pathology of the diseases.
Preventing the activation of autoreactive T cells may reduce or eliminate disease symptoms.
Administration of reagents which block costimulation of T cells by disrupting receptor:ligand interactions of B lymphocyte antigens can be used to inhibit T
cell 2 0 activation and prevent production of autoantibodies or T cell-derived cytokines which may be involved in the disease process. Additionally, blocking reagents may induce antigen-specific tolerance of autoreactive T cells which could lead to long-term relief from the disease. The efficacy of blocking reagents in preventing or alleviating autoimmune disorders can be determined using a number of well-characterized animal models of 2 5 human autoimmune diseases. Examples include murine experimental autoimmune encephalitis, systemic lupus erythmatosis in MRL/lpr/Ipr mice or NZB hybrid mice, murine autoimmune collagen arthritis, diabetes mellitus in NOD mice and BB
rats, and murine experimental myasthenia gravis (see Paul ed., Fundamental Immunology, Raven Press, New York, 1989, pp. 840-856).
3 0 Upregulation of an antigen function (preferably a B lymphocyte antigen function), as a means of up regulating immune responses, may also be useful in therapy.
Upregulation of immune responses may be in the form of enhancing an existing immune response or eliciting an initial immune response. For example, enhancing an immune response through stimulating B lymphocyte antigen function may be useful in cases of viral infection. In addition, systemic viral diseases such as influenza, the common cold, and encephalitis might be alleviated by the administration of stimulatory forms of B
lymphocyte antigens systemically.
Alternatively, anti-viral immune responses may be enhanced in an infected patient by removing T cells from the patient, costimulating the T cells in vitro with viral antigen pulsed APCs either expressing a peptide of the present invention or together with a stimulatory form of a soluble peptide of the present invention and reintroducing the in vitro activated T cells into the patient. Another method of enhancing anti-viral immune responses would be to isolate infected cells from a patient, transfect them with a nucleic acid encoding a protein of the present invention as described herein such that the cells express all or a portion of the protein on their surface, and reintroduce the transfected cells into the patient. The infected cells would now be capable of delivering a costimulatory signal to, and thereby activate, T cells in vivo.
In another application, up regulation or enhancement of antigen function (preferably B lymphocyte antigen function) may be useful in the induction of tumor immunity. Tumor cells {e.g., sarcoma, melanoma, lymphoma, leukemia, neuroblastoma, carcinoma) transfected with a nucleic acid encoding at least one peptide of the present invention can be administered to a subject to overcome tumor-specific tolerance in the subject. If desired, the tumor cell can be transfected to express a combination of peptides.
2 0 For example, tumor cells obtained from a patient can be transfected ex vivo with an expression vector directing the expression of a peptide having B7-2-like activity alone, or in conjunction with a peptide having B7-1-like activity and/or B7-3-like activity. The transfected tumor cells are returned to the patient to result in expression of the peptides on the surface of the transfected cell. Alternatively, gene therapy techniques can be used 2 5 to target a tumor cell for transfection in vivo.
The presence of the peptide of the present invention having the activity of a B
lymphocyte antigens) on the surface of the tumor cell provides the necessary costimulation signal to T cells to induce a T cell mediated immune response against the transfected tumor cells. In addition, tumor cells which lack MHC class I or MHC class II
3 0 molecules, or which fail to reexpress sufficient amounts of MHC class I or MHC class II
molecules, can be transfected with nucleic acid encoding all or a portion of {e.g., a cytoplasmic-domain truncated portion) of an MHC class I a chain protein and (32 microglobulin protein or an MHC class II a chain protein and an MHC class II
(3 chain protein to thereby express MHC class I or MHC class II proteins on the cell surface.

Expression of the appropriate class I or class II MHC in conjunction with a peptide having the activity of a B lymphocyte antigen (e.g., B7-1, B7-2, B7-3) induces a T
cell mediated immune response against the transfected tumor cell. Optionally, a gene encoding an antisense construct which blocks expression of an MHC class II associated protein, such as the invariant chain, can also be cotransfected with a DNA encoding a peptide having the activity of a B lymphocyte antigen to promote presentation of tumor associated antigens and induce tumor specific immunity. Thus, the induction of a T cell mediated immune response in a human subject may be sufficient to overcome tumor-specific tolerance in the subject.
The activity of a protein of the invention may, among other means, be measured by the following methods:
Suitable assays for thymocyte or splenocyte cytotoxicity include, without limitation, those described in: Current Protocols in Immunology, Ed by J. E.
Coligan, A.M.
Kruisbeek, D.H. Margulies, E.M. Shevach, W Strober, Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function 3.1-3.19; Chapter 7, Immunologic studies in Humans); Herrmann et al., Proc. Natl.
Acad. Sci.
USA 78:2488-2492,1981; Herrmann et al., J. Immunol. 128:1968-1974, 1982; Handa et al., J. Immunol. 135:1564-1572,1985; Takai et al., J. Immunol. 137:3494-3500, 1986;
Takai et al., J. Immunol. 140:508-512, 1988; Hernnann et al., Proc. Natl. Acad. Sci. USA
78:2488-2492, 2 0 1981; Herrmann et al., J. Immunol. 128:1968-1974, 1982; Handa et al., J.
Immunol.
135:1564-1572, 1985; Takai et al., J. Immunol. 137:3494-3500, 1986; Bowmanet al., J.
Virology 61:1992-1998; Takai et al., J. Immunol. 140:508-512, 1988;
Bertagnolli et al., Cellular Immunology 133:327-341, 1991; Brown et al., J. Immunol. 153:3079-3092, 1994.
Assays for T-cell-dependent immunoglobulin responses and isotype switching 2 5 (which will identify, among others, proteins that modulate T-cell dependent antibody responses and that affect Thl/Th2 profiles) include, without limitation, those described in: Maliszewski, J. Immunol. 144:3028-3033, 1990; and Assays for B cell function: In vitro antibody production, Mond, J.J. and Brunswick, M. In Current Protocols in Immunology.
J.E.e.a. Coligan eds. Vol 1 pp. 3.8.1-3.8.16, John Wiley and Sons, Toronto.
1994.
3 0 Mixed lymphocyte reaction (MLR) assays (which will identify, among others, proteins that generate predominantly Th1 and CTL responses) include, without limitation, those described in: Current Protocols in Immunology, Ed by J. E. Coligan, A.M.
Kruisbeek, D.H. Margulies, E.M. Shevach, W Strober, Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function 3.1-3.19; Chapter 7, Immunologic studies in Humans); Takai et al., J. Immunol. 137:3494-3500, 1986; Takai et al., J. Immunol. 140:508-512, 1988; Bertagnolli et al., j. Immunol.
149:3778-3783, 1992.
Dendritic cell-dependent assays (which will identify, among others, proteins expressed by dendritic cells that activate naive T-cells) include, without limitation, those described in: Guery et al., j. Immunol. 134:536-544, 1995; Inaba et al., Journal of Experimental Medicine 173:549-559, 1991; Macatonia et al., Journal of Immunology 154:5071-5079,1995; Porgador et al., Journal of Experimental Medicine 182:255-260, 1995;
Nair et al., Journal of Virology 67:4062-4069, 1993; Huang et al., Science 264:961-965, 1994; Macatonia et al., journal of Experimental Medicine 169:1255-1264, 1989;
Bhardwaj et al., Journal of Clinical Investigation 94:797-807, 1994; and Inaba et al., Journal of Experimental Medicine 172:631-640, 1990.
Assays for lymphocyte survival/apoptosis (which will identify, among others, proteins that prevent apoptosis after superantigen induction and proteins that regulate lymphocyte homeostasis) include, without limitation, those described in:
Darzynkiewicz et al., Cytometry 13:795-808,1992; Gorczyca et al., Leukemia 7:659-670,1993;
Gorczyca et al., Cancer Research 53:1945-1951, 1993; Itoh et al., Cell 66:233-243, 1991;
Zacharchuk, Journal of Immunology 145:4037-4045, 1990; Zamai et al., Cytometry 14:891-897, 1993;
Gorczyca et al., International Journal of Oncology 1:639-648, 1992.
Assays for proteins that influence early steps of T-cell commitment and 2 0 development include, without limitation, those described in: Antica et al., Blood 84:111-117, 1994; Fine et al., Cellular Immunology 155:111-122, 1994; Galy et al., Blood 85:2770-2778, 1995; Toki et al., Proc. Nat. Acad Sci. USA 88:7548-7551, 1991.
Hematopoiesis Re ug lating Activity 2 5 A protein of the present invention may be useful in regulation of hematopoiesis and, consequently, in the treatment of myeloid or lymphoid cell deficiencies.
Even marginal biological activity in support of colony forming cells or of factor-dependent cell lines indicates involvement in regulating hematopoiesis, e.g. in supporting the growth and proliferation of erythroid progenitor cells alone or in combination with other cytokines, 3 0 thereby indicating utility, for example, in treating various anemias or for use in conjunction with irradiation/chemotherapy to stimulate the production of erythroid precursors and/or erythroid cells; in supporting the growth and proliferation of myeloid cells such as granulocytes and monocytes/macrophages (i.e., traditional CSF
activity) useful, for example, in conjunction with chemotherapy to prevent or treat consequent myelo-suppression; in supporting the growth and proliferation of megakaryocytes and consequently of platelets thereby allowing prevention or treatment of various platelet disorders such as thrombocytopenia, and generally for use in place of or complimentary to platelet transfusions; and/or in supporting the growth and proliferation of hematopoietic stem cells which are capable of maturing to any and all of the above-mentioned hematopoietic cells and therefore find therapeutic utility in various stem cell disorders (such as those usually treated with transplantation, including, without limitation, aplastic anemia and paroxysmal nocturnal hemoglobinuria), as well as in repopulating the stem cell compartment post irradiation/chemotherapy, either in-vivo or ex-vivo (i.e., in conjunction with bone marrow transplantation or with peripheral progenitor cell transplantation (homologous or heterologous)) as normal cells or genetically manipulated for gene therapy.
The activity of a protein of the invention may, among other means, be measured by the following methods:
Suitable assays for proliferation and differentiation of various hematopoietic lines are cited above.
Assays for embryonic stem cell differentiation (which will identify, among others, proteins that influence embryonic differentiation hematopoiesis) include, without limitation, those described in: Johansson et al. Cellular Biology 15:141-151, 1995; Keller et 2 0 al., Molecular and Cellular Biology 13:473-486, 1993; McClanahan et al., Blood 81:2903-2915, 1993.
Assays for stem cell survival and differentiation (which will identify, among others, proteins that regulate lympho-hematopoiesis) include, without limitation, those described in: Methylcellulose colony forming assays, Freshney, M.G. In Culture of 2 5 Hematopoietic Cells. R.I. Freshney, et al. eds. Vol pp. 265-268, Wiley-Liss, Inc., New York, NY. 1994; Hirayama et al., Proc. Natl. Acad. Sci. USA 89:5907-5911, 1992;
Primitive hematopoietic colony forming cells with high proliferative potential, McNiece, LK. and Briddell, R.A. In Culture of Hematopoietic Cells. R.I. Freshney, et al. eds.
Vol pp. 23-39, Wiley-Liss, Inc., New York, NY. 1994; Neben et al., Experimental Hematology 22:353-359, 3 0 1994; Cobblestone area forming cell assay, Ploemacher, R.E. In Culture of Hematopoietic Cells. R.I. Freshney, et al. eds. Vol pp. 1-21, Wiley-Liss, Inc.., New York, NY. 1994; Long term bone marrow cultures in the presence of stromal cells, Spooncer, E., Dexter, M. and Allen, T. In Culture of Hematopoietic Cells. R.I. Freshney, et al. eds. Vol pp. 163-179, Wiley-Liss, Inc., New York, NY. 1994; Long term culture initiating cell assay, Sutherland, H.J. In Culture of Hematopoietic Cells. R.I. Freshney, et al. eds. Vol pp. 139-162, Wiley-Liss, Inc., New York, NY. 1994.
Tissue Growth Activity A protein of the present invention also may have utility in compositions used for bone, cartilage, tendon, ligament and/or nerve tissue growth or regeneration, as well as for wound healing and tissue repair and replacement, and in the treatment of burns, incisions and ulcers.
A protein of the present invention, which induces cartilage and/or bone growth in circumstances where bone is not normally formed, has application in the healing of bone fractures and cartilage damage or defects in humans and other animals.
Such a preparation employing a protein of the invention may have prophylactic use in closed as well as open fracture reduction and also in the improved fixation of artificial joints. De novo bone formation induced by an osteogenic agent contributes to the repair of congenital, trauma induced, or oncologic resection induced craniofacial defects, and also is useful in cosmetic plastic surgery.
A protein of this invention may also be used in the treatment of periodontal disease, and in other tooth repair processes. Such agents may provide an environment to attract bone-forming cells, stimulate growth of bone-forming cells or induce 2 0 differentiation of progenitors of bone-forming cells. A protein of the invention may also be useful in the treatment of osteoporosis or osteoarthritis, such as through stimulation of bone and/or cartilage repair or by blocking inflammation or processes of tissue destruction (collagenase activity, osteoclast activity, etc.) mediated by inflammatory processes.
2 5 Another category of tissue regeneration activity that may be attributable to the protein of the present invention is tendon/ligament formation. A protein of the present invention, which induces tendon/ligament-like tissue or other tissue formation in circumstances where such tissue is not normally formed, has application in the healing of tendon or ligament tears, deformities and other tendon or ligament defects in humans and 3 0 other animals. Such a preparation employing a tendon/ligament-like tissue inducing protein may have prophylactic use in preventing damage to tendon or ligament tissue, as well as use in the improved fixation of tendon or ligament to bone or other tissues, and in repairing defects to tendon or ligament tissue. De novo tendon/ligament-like tissue formation induced by a composition of the present invention contributes to the repair of congenital, trauma induced, or other tendon or ligament defects of other origin, and is also useful in cosmetic plastic surgery for attachment or repair of tendons or ligaments. The compositions of the present invention may provide an environment to attract tendon- or ligament-forming cells, stimulate growth of tendon- or ligament-forming cells, induce differentiation of progenitors of tendon- or ligament-forming cells, or induce growth of tendon/ligament cells or progenitors ex vivo for return in vivo to effect tissue repair. The compositions of the invention may also be useful in the treatment of tendinitis, carpal tunnel syndrome and other tendon or ligament defects. The compositions may also include an appropriate matrix and/or sequestering agent as a carrier as is well known in the art.
The protein of the present invention may also be useful for proliferation of neural cells and for regeneration of nerve and brain tissue, i.e. for the treatment of central and peripheral nervous system diseases and neuropathies, as well as mechanical and traumatic disorders, which involve degeneration, death or trauma to neural cells or nerve tissue. More specifically, a protein may be used in the treatment of diseases of the peripheral nervous system, such as peripheral nerve injuries, peripheral neuropathy and localized neuropathies, and central nervous system diseases, such as Alzheimer's, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and Shy-Drager syndrome. Further conditions which may be treated in accordance with the present 2 0 invention include mechanical and traumatic disorders, such as spinal cord disorders, head trauma and cerebrovascular diseases such as stroke. Peripheral neuropathies resulting from chemotherapy or other medical therapies may also be treatable using a protein of the invention.
Proteins of the invention may also be useful to promote better or faster closure of 2 5 non-healing wounds, including without limitation pressure ulcers, ulcers associated with vascular insufficiency, surgical and traumatic wounds, and the like.
It is expected that a protein of the present invention may also exhibit activity for generation or regeneration of other tissues, such as organs {including, for example, pancreas, liver, intestine, kidney, skin, endothelium), muscle (smooth, skeletal or cardiac) 3 0 and vascular (including vascular endothelium) tissue, or for promoting the growth of cells comprising such tissues. Part of the desired effects may be by inhibition or modulation of fibrotic scarring to allow normal tissue to regenerate. A protein of the invention may also exhibit angiogenic activity.

A protein of the present invention may also be useful for gut protection or regeneration and treatment of lung or liver fibrosis, reperfusion injury in various tissues, and conditions resulting from systemic cytokine damage.
A protein of the present invention may also be useful for promoting or inhibiting differentiation of tissues described above from precursor tissues or cells; or for inhibiting the growth of tissues described above.
The activity of a protein of the invention may, among other means, be measured by the following methods:
Assays for tissue generation activity include, without limitation, those described in: International Patent Publication No. W095/16035 (bone, cartilage, tendon);
International Patent Publication No. W095/05846 (nerve, neuronal);
International Patent Publication No. W091 /07491 (skin, endothelium ).
Assays for wound healing activity include, without limitation, those described in:
Winter, ~idermal Wound Healing, pps. 71-112 (Maibach, HI and Rovee, DT, eds.), Year Book Medical Publishers, Inc., Chicago, as modified by Eaglstein and Mertz, J.
Invest.
Dermatol 71:382-84 (1978).
Activin/Inhibin Activity A protein of the present invention may also exhibit activin- or inhibin-related 2 0 activities. Inhibins are characterized by their ability to inhibit the release of follicle stimulating hormone (FSH), while activins and are characterized by their ability to stimulate the release of follicle stimulating hormone (FSH). Thus, a protein of the present invention, alone or in heterodimers with a member of the inhibin a family, may be useful as a contraceptive based on the ability of inhibins to decrease fertility in female mammals 2 5 and decrease spermatogenesis in male mammals. Administration of sufficient amounts of other inhibins can induce infertility in these mammals. Alternatively, the protein of the invention, as a homodimer or as a heterodimer with other protein subunits of the inhibin-~3 group, may be useful as a fertility inducing therapeutic, based upon the ability of activin molecules in stimulating FSH release from cells of the anterior pituitary.
See, for example, 3 0 United States Patent 4,798,885. A protein of the invention may also be useful for advancement of the onset of fertility in sexually immature mammals, so as to increase the lifetime reproductive performance of domestic animals such as cows, sheep and pigs.
The activity of a protein of the invention may, among other means, be measured by the following methods:

Assays for activin/inhibin activity include, without limitation, those described in:
Vale et al., Endocrinology 91:562-572, 1972; Ling et al., Nature 321:779-782, 1986; Vale et al., Nature 321:776-779, 1986; Mason et al., Nature 318:659-663, 1985; Forage et al., Proc.
Natl. Acad. Sci. USA 83:3091-3095,1986.
Chemotactic/Chemokinetic Activity A protein of the present invention may have chemotactic or chemokinetic activity (e.g., act as a chemokine) for mammalian cells, including, for example, monocytes, fibroblasts, neutrophils, T-cells, mast cells, eosinophils, epithelial and/or endothelial cells.
Chemotactic and chemokinetic proteins can be used to mobilize or attract a desired cell population to a desired site of action. Chemotactic or chemokinetic proteins provide particular advantages in treatment of wounds and other trauma to tissues, as well as in treatment of localized infections. For example, attraction of lymphocytes, monocytes or neutrophils to tumors or sites of infection may result in improved immune responses against the tumor or infecting agent.
A protein or peptide has chemotactic activity for a particular cell population if it can stimulate, directly or indirectly, the directed orientation or movement of such cell population. Preferably, the protein or peptide has the ability to directly stimulate directed movement of cells. Whether a particular protein has chemotactic activity for a population 2 0 of cells can be readily determined by employing such protein or peptide in any known assay for cell chemotaxis.
The activity of a protein of the invention may, among other means, be measured by the following methods:
Assays for chemotactic activity (which will identify proteins that induce or prevent 2 5 chemotaxis) consist of assays that measure the ability of a protein to induce the migration of cells across a membrane as well as the ability of a protein to induce the adhesion of one cell population to another cell population. Suitable assays for movement and adhesion include, without limitation, those described in: Current Protocols in Immunology, Ed by J.E. Coligan, A.M. Kruisbeek, D.H. Margulies, E.M. Shevach, W.Strober, Puh.
Greene 3 0 Publishing Associates and Wiley-Interscience (Chapter 6.12, Measurement of alpha and beta Chemokines 6.12.1-6.12.28; Taub et al. J. Clin. Invest. 95:1370-1376, 1995; Lind et al.
APMIS 103:140-146, 1995; Muller et al Eur. J. Immunol. 25: 1744-1748; Gruber et al. J. of Immunol. 152:5860-5867, 1994; Johnston et al. J. of Immunol. 153: 1762-1768,1994.

Hemostatic and Thrombo~tic Activity A protein of the invention may also exhibit hemostatic or thrombolytic activity.
As a result, such a protein is expected to be useful in treatment of various coagulation disorders (including hereditary disorders, such as hemophilias) or to enhance coagulation and other hemostatic events in treating wounds resulting from trauma, surgery or other causes. A protein of the invention may also be useful for dissolving or inhibiting formation of thromboses and for treatment and prevention of conditions resulting therefrom (such as, for example, infarction of cardiac and central nervous system vessels (e.g., stroke).
The activity cf a protein of the invention may, among other means, be measured by the following methods:
Assay for hemostatic and thrombolytic activity include, without limitation, those described in: Linet et al., J. Clin. Pharmacol. 26:131-140, 1986; Burdick et al., Thrombosis Res. 45:413-419,1987; Humphrey et al., Fibrinolysis 5:71-79 (1991); Schaub, Prostaglandins 35:467-474, 1988.
Receptor/Ligand Activity A protein of the present invention may also demonstrate activity as receptors, receptor ligands or inhibitors or agonists of receptor/ligand interactions.
Examples of 2 0 such receptors and ligands include, without limitation, cytokine receptors and their ligands, receptor kinases and their ligands, receptor phosphatases and their~ligands, receptors involved in cell-cell interactions and their ligands (including without limitation, cellular adhesion molecules (such as selectins, integrins and their ligands) and receptor/ligand pairs involved in antigen presentation, antigen recognition and 2 5 development of cellular and humoral immune responses). Receptors and ligands are also useful for screening of potential peptide or small molecule inhibitors of the relevant receptor/ligand interaction. A protein of the present invention (including, without limitation, fragments of receptors and ligands) may themselves be useful as inhibitors of receptor/ligand interactions.
3 0 The activity of a protein of the invention may, among other means, be measured by the following methods:
Suitable assays for receptor-ligand activity include without limitation those described in:Current Protocols in Immunology, Ed by J.E. Coligan, A.M.
Kruisbeek, D.H.
Margulies, E.M. Shevach, W.Strober, Pub. Greene Publishing Associates and Wiley-Interscience {Chapter 7.28, Measurement of Cellular Adhesion under static conditions 7.28.1-7.28.22), Takai et al., Proc. Natl. Acad. Sci. USA 84:6864-6868, 1987;
Bierer et al., J. Exp. Med. 168:1145-1156, 1988; Rosenstein et al., J. Exp.
Med. 169:149-160 1989; Stoltenborg et al., J. Immunol. Methods 175:59-68,1994; Stitt et al., Cell 80:661-670, 1995.
Anti-Inflammatory Activity Proteins of the present invention may also exhibit anti-inflammatory activity.
The anti-inflammatory activity may be achieved by providing a stimulus to cells involved in the inflammatory response, by inhibiting or promoting cell-cell interactions (such as, for example, cell adhesion), by inhibiting or promoting chemotaxis of cells involved in the inflammatory process, inhibiting or promoting cell extravasation, or by stimulating or suppressing production of other factors which more directly inhibit or promote an inflammatory response. Proteins exhibiting such activities can be used to treat inflammatory conditions including chronic or acute conditions), including without limitation inflammation associated with infection (such as septic shock, sepsis or systemic inflammatory response syndrome (SIRS)), ischemia-reperfusion injury, endotoxin lethality, arthritis, complement-mediated hyperacute rejection, nephritis, cytokine or chemokine-induced lung injury, inflammatory bowel disease, Crohn's disease or resulting 2 0 from over production of cytokines such as TNF or IL-1. Proteins of the invention may also be useful to treat anaphylaxis and hypersensitivity to an antigenic substance or material.
Cadherin/Tumor Invasion Suppressor Activity Cadherins are calcium-dependent adhesion molecules that appear to play major 2 5 roles during development, particularly in defining specific cell types.
Loss or alteration of normal cadherin expression can lead to changes in cell adhesion properties linked to tumor growth and metastasis. Cadherin malfunction is also implicated in other human diseases, such as pemphigus vulgaris and pemphigus foliaceus (auto-immune blistering skin diseases), Crohn's disease, and some developmental abnormalities.
3 0 The cadherin superfamily includes well over forty members, each with a distinct pattern of expression. All members of the superfamily have in common conserved extracellular repeats (cadherin domains), but structural differences are found in other parts of the molecule. The cadherin domains bind calcium to form their tertiary structure and thus calcium is required to mediate their adhesion. Only a few amino acids in the first cadherin domain provide the basis for homophilic adhesion; modification of this recognition site can change the specificity of a cadherin so that instead of recognizing only itself, the mutant molecule can now also bind to a different cadherin. In addition, some cadherins engage in heterophilic adhesion with other cadherins.
E-cadherin, one member of the cadherin superfamily, is expressed in epithelial cell types. Pathologically, if E-cadherin expression is lost in a tumor, the malignant cells become invasive and the cancer metastasizes. Transfection of cancer cell lines with polynucleotides expressing E-cadherin has reversed cancer-associated changes by returning altered cell shapes to normal, restoring cells' adhesiveness to each other and to their substrate, decreasing the cell growth rate, and drastically reducing anchorage-independent cell growth. Thus, reintroducing E-cadherin expression reverts carcinomas to a less advanced stage. It is likely that other cadherins have the same invasion suppressor role in carcinomas derived from other tissue types. Therefore, proteins of the present invention with cadherin activity, and polynucleotides of the present invention encoding such proteins, can be used to treat cancer. Introducing such proteins or polynucleotides into cancer cells can reduce or eliminate the cancerous changes observed in these cells by providing normal cadherin expression.
Cancer cells have also been shown to express cadherins of a different tissue type than their origin, thus allowing these cells to invade and metastasize in a different tissue 2 0 in the body. Proteins of the present invention with cadherin activity, and polynucleotides of the present invention encoding such proteins, can be substituted in these cells for the inappropriately expressed cadherins, restoring normal cell adhesive properties and reducing or eliminating the tendency of the cells to metastasize.
Additionally, proteins of the present invention with cadherin activity, and 2 5 polynucleotides of the present invention encoding such proteins, can used to generate antibodies recognizing and binding to cadherins. Such antibodies can be used to block the adhesion of inappropriately expressed tumor-cell cadherins, preventing the cells from forming a tumor elsewhere. Such an anti-cadherin antibody can also be used as a marker for the grade, pathological type, and prognosis of a cancer, i.e. the more progressed the 3 0 cancer, the less cadherin expression there will be, and this decrease in cadherin expression can be detected by the use of a cadherin-binding antibody.
Fragments of proteins of the present invention with cadherin activity, preferably a polypeptide comprising a decapeptide of the cadherin recognition site, and poly-nucleotides of the present invention encoding such protein fragments, can also be used WO 98!56909 PCT/US98/11822 to block cadherin function by binding to cadherins and preventing them from binding in ways that produce undesirable effects. Additionally, fragments of proteins of the present invention with cadherin activity, preferably truncated soluble cadherin fragments which have been found to be stable in the circulation of cancer patients, and polynucleotides encoding such protein fragments, can be used to disturb proper cell-cell adhesion.
Assays for cadherin adhesive and invasive suppressor activity include, without limitation, those described in: Hortsch et al. J Biol Chem 270 (32): 18809-18817, 1995;
Miyaki et al. Oncogene 11: 2547-2552,1995; Ozawa et al. Cell 63: 1033-1038, 1990.
Tumor Inhibition Activity In addition to the activities described above for immunological treatment or prevention of tumors, a protein of the invention may exhibit other anti-tumor activities.
A protein may inhibit tumor growth directly or indirectly (such as, for example, via ADCC). A protein may exhibit its tumor inhibitory activity by acting on tumor tissue or tumor precursor tissue, by inhibiting formation of tissues necessary to support tumor growth (such as, for example, by inhibiting angiogenesis), by causing production of other factors, agents or cell types which inhibit tumor growth, or by suppressing, eliminating or inhibiting factors, agents or cell types which promote tumor growth.
2 0 Other Activities A protein of the invention may also exhibit one or more of the following additional activities or effects: inhibiting the growth, infection or function of, or killing, infectious agents, including, without limitation, bacteria, viruses, fungi and other parasites; effecting (suppressing or enhancing) bodily characteristics, including, without limitation, height, 2 5 weight, hair color, eye color, skin, fat to lean ratio or other tissue pigmentation, or organ or body part size or shape (such as, for example, breast augmentation or diminution, change in bone form or shape); effecting biorhythms or caricadic cycles or rhythms;
effecting the fertility of male or female subjects; effecting the metabolism, catabolism, anabolism, processing, utilization, storage or elimination of dietary fat, lipid, protein, 3 0 carbohydrate, vitamins, minerals, cofactors or other nutritional factors or component(s);
effecting behavioral characteristics, including, without limitation, appetite, libido, stress, cognition (including cognitive disorders), depression (including depressive disorders) and violent behaviors; providing analgesic effects or other pain reducing effects;
promoting differentiation and growth of embryonic stem cells in lineages other than hematopoietic lineages; hormonal or endocrine activity; in the case of enzymes, correcting deficiencies of the enzyme and treating deficiency-related diseases; treatment of hyperproliferative disorders (such as, for example, psoriasis); immunoglobulin-like activity (such as, for example, the ability to bind antigens or complement); and the ability to act as an antigen in a vaccine composition to raise an immune response against such protein or another material or entity which is cross-reactive with such protein.
ADMINISTRATION AND DOSING
A protein of the present invention (from whatever source derived, including without limitation from recombinant and non-recombinant sources) may be used in a pharmaceutical composition when combined with a pharmaceutically acceptable carrier.
Such a composition may also contain (in addition to protein and a earner) diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art. The term "pharmaceutically acceptable" means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredient(s). The characteristics of the carrier will depend on the route of administration. The pharmaceutical composition of the invention may also contain cytokines, lymphokines, or other hematopoietic factors such as M-CSF, GM-CSF, TNF, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10,1L-11, 2 0 IL-12, IL-13, IL-14, IL-15, IFN, TNFO, TNFl, TNF2, G-CSF, Meg-CSF, thrombopoietin, stem cell factor, and erythropoietin. The pharmaceutical composition may further contain other agents which either enhance the activity of the protein or compliment its activity or use in treatment. Such additional factors and/or agents may be included in the pharmaceutical composition to produce a synergistic effect with protein of the invention, 2 5 or to minimize side effects. Conversely, protein of the present invention may be included in formulations of the particular cytokine, iymphokine, other hematopoietic factor, thrombolytic or anti-thrombotic factor, or anti-inflammatory agent to minimize side effects of the cytokine, lymphokine, other hematopoietic factor, thrombolytic or anti-thrombotic factor, or anti-inflammatory agent.
3 0 A protein of the present invention may be active in multimers (e.g., heterodimers or homodimers) or complexes with itself or other proteins. As a result, pharmaceutical compositions of the invention may comprise a protein of the invention in such multimeric or complexed form.

The pharmaceutical composition of the invention may be in the form of a complex of the proteins} of present invention along with protein or peptide antigens.
The protein and/or peptide antigen will deliver a stimulatory signal to both B and T
lymphocytes. B
lymphocytes will respond to antigen through their surface immunoglobulin receptor. T
lymphocytes will respond to antigen through the T cell receptor (TCR) following presentation of the antigen by MHC proteins. MHC and structurally related proteins including those encoded by class I and class II MHC genes on host cells will serve to present the peptide antigens) to T lymphocytes. The antigen components could also be supplied as purified MHC-peptide complexes alone or with co-stimulatory molecules that can directly signal T cells. Alternatively antibodies able to bind surface immunolgobulin and other molecules on B cells as well as antibodies able to bind the TCR and other molecules on T cells can be combined with the pharmaceutical composition of the invention.
The pharmaceutical composition of the invention may be in the form of a liposome in which protein of the present invention is combined, in addition to other pharmaceutically acceptable carriers, with amphipathic agents such as lipids which exist in aggregated form as micelles, insoluble monolayers, liquid crystals, or iamellar layers in aqueous solution. Suitable lipids for liposomal formulation include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponin, bile acids, 2 0 and the like. Preparation of such liposomal formulations is within the level of skill in the art, as disclosed, for example, in U.S. Patent No. 4,235,871; U.S. Patent No.
4,501,728; U.S.
Patent No. 4,837,028; and U.S. Patent No. 4,737,323, all of which are incorporated herein by reference.
As used herein, the term "therapeutically effective amount" means the total 2 5 amount of each active component of the pharmaceutical composition or method that is sufficient to show a meaningful patient benefit, i.e., treatment, healing, prevention or amelioration of the relevant medical condition, or an increase in rate of treatment, healing, prevention or amelioration of such conditions. When applied to an individual active ingredient, administered alone, the term refers to that ingredient alone. When applied to 3 0 a combination, the term refers to combined amounts of the active ingredients that result in the therapeutic effect, whether administered in combination, serially or simultaneously.
In practicing the method of treatment or use of the present invention, a therapeutically effective amount of protein of the present invention is administered to a mammal having a condition to be treated. Protein of the present invention may be administered in accordance with the method of the invention either alone or in combination with other therapies such as treatments employing cytokines, lymphokines or other hematopoietic factors. When co-administered with one or more cytokines, lymphokines or other hematopoietic factors, protein of the present invention may be administered either simultaneously with the cytokine(s), lymphokine(s), other hematopoietic factor(s), thrombolytic or anti-thrombotic factors, or sequentially. If administered sequentially, the attending physician will decide on the appropriate sequence of administering protein of the present invention in combination with cytokine(s), lymphokine(s), other hematopoietic factor(s), thrombolytic or anti-thrombotic 1 0 factors.
Administration of protein of the present invention used in the pharmaceutical composition or to practice the method of the present invention can be carried out in a variety of conventional ways, such as oral ingestion, inhalation, topical application or cutaneous, subcutaneous, intraperitoneal, parenteral or intravenous injection.
Intravenous administration to the patient is preferred.
When a therapeutically effective amount of protein of the present invention is administered orally, protein of the present invention will be in the form of a tablet, capsule, powder, solution or elixir. When administered in tablet form, the pharmaceutical composition of the invention may additionally contain a solid carrier such as a gelatin or 2 0 an adjuvant. The tablet, capsule, and powder contain from about 5 to 95%
protein of the present invention, and preferably from about 25 to 90% protein of the present invention.
When administered in liquid form, a liquid carrier such as water, petroleum, oils of animal or plant origin such as peanut oil, mineral oil, soybean oil, or sesame oil, or synthetic oils may be added. The liquid form of the pharmaceutical composition may further contain 2 5 physiological saline solution, dextrose or other saccharide solution, or glycols such as ethylene glycol, propylene glycol or polyethylene glycol. When administered in liquid form, the pharmaceutical composition contains from about 0.5 to 90% by weight of protein of the present invention, and preferably from about 1 to 50% protein of the present invention.
3 0 When a therapeutically effective amount of protein of the present invention is administered by intravenous, cutaneous or subcutaneous injection, protein of the present invention will be in the form of a pyrogen-free, parenterally acceptable aqueous solution.
The preparation of such parenterally acceptable protein solutions, having due regard to pH, isotonicity, stability, and the like, is within the skill in the art. A
preferred pharmaceutical composition for intravenous, cutaneous, or subcutaneous injection should contain, in addition to protein of the present invention, an isotonic vehicle such as Sodium Chloride Injection, Ringer's Injection, Dextrose Injection, Dextrose and Sodium Chloride Injection, Lactated Ringer's Injection, or other vehicle as known in the art.
The pharmaceutical composition of the present invention may also contain stabilizers, preservatives, buffers, antioxidants, or other additives known to those of skill in the art.
The amount of protein of the present invention in the pharmaceutical composition of the present invention will depend upon the nature and severity of the condition being treated, and on the nature of prior treatments which the patient has undergone.
Ultimately, the attending physician will decide the amount of protein of the present invention with which to treat each individual patient. Initially, the attending physician will administer low doses of protein of the present invention and observe the patient's response. Larger doses of protein of the present invention may be administered until the optimal therapeutic effect is obtained for the patient, and at that point the dosage is not increased further. It is contemplated that the various pharmaceutical compositions used to practice the method of the present invention should contain about 0.01 Izg to about 100 mg (preferably about O.lng to about 10 mg, more preferably about 0.1 ug to about 1 mg) of protein of the present invention per kg body weight.
The duration of intravenous therapy using the pharmaceutical composition of the 2 0 present invention will vary, depending on the severity of the disease being treated and the condition and potential idiosyncratic response of each individual patient.
It is contemplated that the duration of each application of the protein of the present invention will be in the range of 12 to 24 hours of continuous intravenous administration.
Ultimately the attending physician will decide on the appropriate duration of intravenous 2 5 therapy using the pharmaceutical composition of the present invention.
Protein of the invention may also be used to immunize animals to obtain polyclonal and monoclonal antibodies which specifically react with the protein. Such antibodies may be obtained using either the entire protein or fragments thereof as an immunogen. The peptide immunogens additionally may contain a cysteine residue at the 3 0 carboxyl terminus, and are conjugated to a hapten such as keyhole limpet hemocyanin (KLH). Methods for synthesizing such peptides are known in the art, for example, as in R.P. Merrifield, J. Amer.Chem.Soc. 85 2149-2154 (1963); J.L. Krstenansky, et al., FEBS Lett.
211, 10 {1987). Monoclonal antibodies binding to the protein of the invention may be useful diagnostic agents for the immunodetection of the protein. Neutralizing monoclonal antibodies binding to the protein may also be useful therapeutics for both conditions associated with the protein and also in the treatment of some forms of cancer where abnormal expression of the protein is involved. In the case of cancerous cells or leukemic cells, neutralizing monoclonal antibodies against the protein may be useful in detecting and preventing the metastatic spread of the cancerous cells, which may be mediated by the protein.
For compositions of the present invention which are useful for bone, cartilage, tendon or ligament regeneration, the therapeutic method includes administering the composition topically, systematically, or locally as an implant or device.
When administered, the therapeutic composition for use in this invention is, of course, in a pyrogen-free, physiologically acceptable form. Further, the composition may desirably be encapsulated or injected in a viscous form for delivery to the site of bone, cartilage or tissue damage. Topical administration may be suitable for wound healing and tissue repair. Therapeutically useful agents other than a protein of the invention which may also 1 S optionally be included in the composition as described above, may alternatively or additionally, be administered simultaneously or sequentially with the composition in the methods of the invention. Preferably for bone and/or cartilage formation, the composition would include a matrix capable of delivering the protein-containing composition to the site of bone and/or cartilage damage, providing a structure for the 2 0 developing bone and cartilage and optimally capable of being resorbed into the body.
Such matrices may be formed of materials presently in use for other implanted medical applications.
The choice of matrix material is based on biocompatibility, biodegradability, mechanical properties, cosmetic appearance and interface properties. The particular 2 5 application of the compositions will define the appropriate formulation.
Potential matrices for the compositions may be biodegradable and chemically defined calcium sulfate, tricalciumphosphate, hydroxyapatite, polylactic acid, polyglycolic acid and polyanhydrides. Other potential materials are biodegradable and biologically well-defined, such as bone or dermal collagen. Further matrices are comprised of pure proteins 3 0 or extracellular matrix components. Other potential matrices are nonbiodegradable and chemically defined, such as sintered hydroxapatite, bioglass, aluminates, or other ceramics. Matrices may be comprised of combinations of any of the above mentioned types of material, such as polylactic acid and hydroxyapatite or collagen and tricalciumphosphate. The bioceramics may be altered in composition, such as in calcium-aluminate-phosphate and processing to alter pore size, particle size, particle shape, and biodegradability.
Presently preferred is a 50:50 (mole weight) copolymer of lactic acid and glycolic acid in the form of porous particles having diameters ranging from 150 to 800 microns.
In some applications, it will be useful to utilize a sequestering agent, such as carboxymethyl cellulose or autologous blood clot, to prevent the protein compositions from disassociating from the matrix.
A preferred family of sequestering agents is cellulosic materials such as alkylcelluloses (including hydroxyalkylcelluloses), including methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropyl methylcellulose, and carboxymethylcellulose, the most preferred being cationic salts of carboxymethylcellulose (CMC). Other preferred sequestering agents include hyaluronic acid, sodium alginate, polyethylene glycol), polyoxyethylene oxide, carboxyvinyl polymer and polyvinyl alcohol). The amount of sequestering agent useful herein is 0.5-20 wt%, preferably 1-10 wt% based on total formulation weight, which represents the amount necessary to prevent desorbtion of the protein from the polymer matrix and to provide appropriate handling of the composition, yet not so much that the progenitor cells are prevented from infiltrating the matrix, thereby providing the protein the opportunity to assist the osteogenic activity of the progenitor cells.
2 0 In further compositions, proteins of the invention may be combined with other agents beneficial to the treatment of the bone and/or cartilage defect, wound, or tissue in question. These agents include various growth factors such as epidermal growth factor (EGF), platelet derived growth factor (PDGF), transforming growth factors (TGF-a and TGF-~3), and insulin-like growth factor (IGF).
2 5 The therapeutic compositions are also presently valuable for veterinary applications. Particularly domestic animals and thoroughbred horses, in addition to humans, are desired patients for such treatment with proteins of the present invention.
The dosage regimen of a protein-containing pharmaceutical composition to be used in tissue regeneration will be determined by the attending physician considering 3 0 various factors which modify the action of the proteins, e.g., amount of tissue weight desired to be formed, the site of damage, the condition of the damaged tissue, the size of a wound, type of damaged tissue {e.g., bone), the patient's age, sex, and diet, the severity of any infection, time of administration and other clinical factors. The dosage may vary with the type of matrix used in the reconstitution and with inclusion of other proteins in the pharmaceutical composition. For example, the addition of other known growth factors, such as IGF I (insulin like growth factor I), to the final composition, may also effect the dosage. Progress can be monitored by periodic assessment of tissue/bone growth and/or repair, for example, X-rays, histomorphometric determinations and tetracycline labeling.
Polynucleotides of the present invention can also be used for gene therapy.
Such polynucleotides can be introduced either in vivo or ex vivo into cells for expression in a mammalian subject. Polynucleotides of the invention may also be administered by other known methods for introduction of nucleic acid into a cell or organism (including, without limitation, in the form of viral vectors or naked DNA).
Cells may also be cultured ex vivo in the presence of proteins of the present invention in order to proliferate or to produce a desired effect on or activity in such cells.
Treated cells can then be introduced in vivo for therapeutic purposes.
Patent and literature references cited herein are incorporated by reference as if fully set forth.

SEQUENCE LISTING
(1) GENERAL
INFORMATION:

(i) APPLICANT: Jacobs, Kenneth McCoy, John M.

LaVallie, Edward R.

Racie, Lisa A.

Treacy, Maurice Spaulding, Vikki Agostino, Michael J.

Howes, Steven H.

Fechtel, Kim (ii) TITLE OF INVENTION: SECRETED PROTEINS AND POLYNUCLEOTIDES

ENCODING THEM

(iii) NUMBER OF SEQUENCES: 34 (iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Genetics Institute, Inc.

(B) STREET: 87 CambridgePark Drive (C} CITY: Cambridge 2 (D) STATE: MA

(E) COUNTRY: U.S.A.

(F) ZIP: 02140 (v) COMPUTER READABLE FORM:

3 (A) MEDIUM TYPE: Flo O ppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: PatentIn Release #1.0, Version #1.30 3 (vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(C) CLASSIFICATION:

4O (viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Sprunger, Suzanne A.

(B) REGISTRATION NUMBER: 41,323 (ix) TELECOMMUNICATION INFORMATION:

45 (A) TELEPHONE: (617) 498-8284 (B) TELEFAX: (617} 876-5851 (2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2043 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D} TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE
DESCRIPTION:
SEQ ID
NO: l:

O

O

AAA

(2) INFORMATION
FOR SEQ
ID N0:2:

2 (i) SEQUENCE
5 CHARACTERISTICS:

(A) LENGTH: 263 acids amino (B) TYPE: amino acid (C) STRANDEDNESS:

(D) TOPOLOGY: linear (ii) MOLECULE
TYPE:
protein {xi) SEQUENCE
DESCRIPTION:
SEQ
ID
N0:2:

Met Arg ThrProGln LeuAlaLeu LeuGlnVal PhePhe LeuValPhe Pro Asp GlyValArg ProGlnPro SerSerSer ProSer GlyAlaVal Pro Thr SerLeuGlu LeuGlnArg GlyThrAsp GlyGly ThrLeuGln Ser Pro SerGluAla ThrAlaThr ArgProAla ValPro GlyLeuPro Thr Val ValProThr LeuValThr ProSerAla ProGly AsnArgThr Val Asp LeuPhePro ValLeuPro IleCysVal CysAsp LeuThrPro Gly Ala Cys Asp Ile Asn Cys Cys Cys Asp Arg Asp Cys Tyr Leu Leu His ProArg Thr PheSer PheCysLeu ProGlySer ValArgSer Val Ser SerTrp Val ValAsp AsnSerVal IlePheArg SerAsnSer Cys Pro PhePro Ser ValPhe MetAspSer AsnGlyIle ArgGlnPhe Arg Cys ValHis Val AsnSer AsnLeuAsn TyrPheGln LysLeuGln Asn Lys ValAsn Ala AsnPhe GlnAlaLeu ValAlaGlu PheGlyGly Thr Glu SerPhe Thr ThrPhe GlnThrGln SerProPro SerPheTyr Ser Arg AlaGly Asp IleLeu ThrTyrPhe ProLysTrp SerValIle Pro Ser LeuLeu Arg ProAla GlyValGly AlaGlyGly LeuCysAla Gln Glu SerAsn Pro GlyPhe LeuGluSer LysSerThr ThrCysThr Ala Arg PhePhe Gln ProGly Glu (2) INFORMATION ID 0:3:
FOR N
SEQ

(i) SEQUENCE STICS:
CHARACTERI

(A)LENGTH: 63 ase 12 b pairs (B)TYPE: nucleic acid (C)STRANDEDNESS:double (D)TOPOLOGY: linear (ii) MOLECULE cDNA
TYPE:

(xi) SEQUENCE
DESCRIPTION:
SEQ ID N0:3:

WO 98/56909 PC'T/US98/11822 GTTTAATAAA TACAAATACT CGTTAAAAAAFu~AAAAAAAAPu~AAAAAAAp, AAAAAAAAAA12 ( 2 ) INFORMATIOI~T FOR SEQ
ID NO : 4 {i) SEQUENCE CHARACTERISTICS:

4 (A) LENGTH: 261 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:

(D) TOPOLOGY: linear 4 (ii) MOLECULE TYPE: protein S O (xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:
Met His Gln Asp Leu Pro Arg Met Glu Pro Asp Met Tyr Trp Asn Lys 5 5 Pro Glu Pro Gln Pro Pro Tyr Thr Ala Ala Ser Ala Gln Phe Arg Arg Ala Ser PheMetGly SerThr PheAsnIle SerLeuAsn LysGluGlu Met Glu PheGlnPro AsnGln GluAspGlu GluAspAla HisAlaGly Ile Ile GlyArgPhe LeuGly LeuGlnSer HisAspHis HisProPro Arg Ala AsnSerArg ThrLys LeuLeuTrp ProLysArg GluSerLeu 1 Leu His GluGlyLeu ProLys AsnHisLys AlaAlaLys GlnAsnVai Arg Gly GlnGluAsp AsnLys AlaTrpLys LeuLysAla ValAspAla Phe Lys SerAlaPro LeuTyr GlnArgPro GlyTyrTyr SerAlaPro Gln Thr ProLeuSer ProThr ProMetPhe PheProLeu GluProSer Ala Pro SerLysLeu HisSer ValThrGly IleAspThr LysAspLys 3 Ser Leu LysThrVal SerSer GlyAlaLys LysSerPhe GluLeuLeu Ser Glu SerAspGly AlaLeu MetGluHis ProGluVal SerGlnVal Arg Arg LysThrVal GluPhe AsnLeuThr AspMetPro GluIlePro Glu Asn HisLeuLys GluPro LeuGluGln SerProThr AsnIleHis Thr Thr LeuLysAsp HisMet AspProTyr TrpAlaLeu GluAsnArg 4 Asp Glu AlaHisSer (2) ON FORSEQ D
INFORMATI I N0:5:

5 (i) SEQUENCE ARACTERISTICS:
O CH

(A) LENGTH : base 894 pairs (B) TY PE:nucleic acid (C) STRAND EDNESS: double (D) TO POLOGY: inear l (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID
N0:5:

O

O

CTAGTATGTT TTCAAAAAAA AAAAAAAAAA AAAAAAAAAAP~~,AAAAAAAA AAAA 894 (2) INFORMATION FOR SEQ ID N0:6:

4O (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 92 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:6:
Met Cys Ile Met Thr Ile Ser Ser Glu Gly Glu Leu Glu Leu Val Gly Leu Met Arg Leu Arg Lys Gln Leu Phe Leu Arg Ser Ala Leu Cys Asn His Arg Ser Arg Glu Leu Tyr SerGly ArgGlyGly Ala Leu Gly Thr His Val Val Phe Val Asn Gly CysHis LeuPheIle Asp Ala Gly Gly Thr Arg Val His Leu Leu Asp LysGly LeuSerPhe Thr Gln Ala Asn Val Phe Ile Cys Ile Cys Tyr LeuGln TyrIle Cys (2) INFORMATION
FOR
SEQ
ID
N0:7:

{i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 784 base pairs 2 (B) TYPE: nucleic acid {C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE
DESCRIPTION:
SEQ ID
N0:7:

CATC

(2) INFORMATION FOR SEQ ID N0:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 140 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE
DESCRIPTION:
SEQ
ID
N0:8:

Met Lys Arg Ile Ser Leu LeuLeuLeu HisPheTyr LeuIleTyr Val Phe Ile Leu Phe Tyr Phe PhePheGly ThrGluSer SerLeuLeu Met Val Leu Ser Ser Asn Val LeuLeuAla LeuGluPhe LeuGluIle Pro Ala Gln Ala Lys Glu Lys PheLeuPro MetValSer HisThrPhe Ala 3 His Met Arg Thr Glu Glu AspAlaSer GlnGluGly AspAspLeu 0 Ser Pro Lys Ser Ser Ala Asn SerHisPro LysGlnAsp AspSerPro Thr Lys Ser Ser Glu Glu Thr GlnProLys GluGlyAsp IleProLys Ile Ala Pro Glu Glu Thr Ile SerLysLys GluAspLeu ProLysSer Gln Ser Glu Lys Ala Ile Gln LysGluSer AsnIle Pro (2) INFORMATION
FOR
SEQ
ID N0:9:

(i) SEQUENCE
CHARACTERISTICS:

(A) LENGTH: 75 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:
double (D) TOPOLOGY: linear (ii) MOLECULE
TYPE:
cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:9:
AAAAAAAAAP. AAAAAAAAAA P,~~,AAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA 60 p,F~~AAAAAA AAAAA 7 5 (2) INFORMATION FOR SEQ ID NO:10:
1O (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 939 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE
DESCRIPTION.
SEQ ID
NO:10:

S

GAACAACAACGTTCACAATT GTCCAAAAAA AAAAAA,AAA 939 S5(2) INFORMATION
FOR SEQ
ID N0:11:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 197 amino acids (B) TYPE. amino acid (C) STRANDEDNESS:
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE
DESCRIPTION:
SEQ
ID
N0:11:

Met Trp AspGlnGly GlyGln ProTrpGln GlnTrpPro LeuAsnGln Gln Gln TrpMetGln SerPhe GlnHisGln GlnAspPro SerGlnIle 2 Asp Trp AlaAlaLeu AlaGln AlaTrpIle AlaGlnArg GluAlaSer Gly Gln GlnSerMet ValGlu GlnProPro GlyMetMet ProAsnGly Gln Asp MetSerThr MetGlu SerGlyPro AsnAsnHis GlyAsnPhe Gln Gly AspSerAsn PheAsn ArgMetTrp GlnProGlu TrpGlyMet His Gln GlnProPro HisPro ProProAsp GlnProTrp MetProPro 3 Thr Pro GlyProMet AspIle ValProPro SerGluAsp SerAsnSer Gln Asp SerGlyGlu PheAla ProAspAsn ArgHisIle PheAsnGln Asn Asn HisAsnPhe GlyGly ProProAsp AsnPheAla ValGlyPro Val Asn GlnPheAsp TyrGln AspLeuGln AspLeuGln HisLeuPro Arg Ile GluGluLys GlyHis HisHisSer GlyIleVal SerValHis 50 Leu Leu HisPheLeu (2) INFORMATION OR
F SEQ
ID
N0:12:

S5 (i) SEQUENCE CHARACTERISTICS:

7g (A) LENGTH: 2343 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE
DESCRIPTION:
SEQ ID
N0:12:

5"

i TATGATCATGGTATAATTAA TTGAAATTTATTAAAATCTGTTTTTATTAA AAA,AAAAAAA2340 (2) INFORMATION :
FOR SEQ
ID N0:13 (i) SEQUENCE
CHARACTERISTICS:

(A) LENGTH: 524 acids amino (B) TYPE: amino acid (C) STRANDEDNESS:

(D) TOPOLOGY: linear (ii) MOLECULE
TYPE:
protein 5O (xi) SEQUENCE DESCRIPTION: SEQ ID N0:13:
Met Glu Leu Leu Ala Ala Glu Lys His Gln Val Glu Ala Leu Lys Asn Met Gln His Gln Asn Gln Ser Leu Ser Met Leu Asp Glu Ile Leu Glu Asp ValArgLys AlaAlaAsp ArgLeuGlu GluGluIle GluGluHis Ala PheAspAsp AsnLysSer ValLysGly ValAsnPhe GluAlaVal Leu ArgValGlu GluGluGlu AlaAsnSer LysGlnAsn IleThrLys Arg GluValGlu AspAspLeu GlyLeuSer MetLeuIle AspSerGln Asn AsnGlnTyr IleLeuThr LysProArg AspSerThr IleProArg Ala AspHisHis PheIleLys AspIleVal ThrIleGly MetLeuSer Leu ProCysGly TrpLeuCys ThrAlaIle GlyLeuPro ThrMetPhe Gly TyrIleIle CysGlyVal LeuLeuGly ProSerGly LeuAsnSer Ile LysSerIle ValGlnVal GluThrLeu GlyGluPhe GlyValPhe Phe ThrLeuPhe LeuValGly LeuGluPhe SerProGlu LysLeuArg Lys ValTrpLys IleSerLeu GlnGlyPro CysTyrMet ThrLeuLeu Met IleAlaPhe GlyLeuLeu TrpGlyHis LeuLeuArg IleLysPro Thr GlnSerVal PheIleSer ThrCysLeu SerLeuSer SerThrPro Leu ValSerArg PheLeuMet GlySerAla ArgGlyAsp LysGluGly Asp IleAspTyr SerThrVal LeuLeuGly MetLeuVal ThrGlnAsp Val GlnLeuGly LeuPheMet AlaValMet ProThrLeu IleGlnAla Gly AlaSerAla SerSerSer IleValVal GluValLeu ArgIleLeu Val LeuIleGly GlnIleLeu PheSerLeu AlaAlaVal PheLeuLeu Cys'Leu Val Ile Lys Lys Tyr Leu Ile Gly Pro Tyr Tyr Arg Lys Leu His Met GluSer LysGlyAsn LysGluIle LeuIleLeu GlyIleSer Ala Phe IlePhe LeuMetLeu ThrValThr GluLeuLeu AspValSer Met Glu LeuGly CysPheLeu AlaGlyAla LeuValSer SerGlnGly Pro Val ValThr GluGluIle AlaThrSer IleGluPro IleArgAsp Phe Leu AlaIle ValPhePhe AlaSerIle GlyLeuHis ValPhePro Thr Phe ValAla TyrGluLeu ThrValLeu ValPheLeu ThrLeuSer Val Val ValMet LysPheLeu LeuAlaAla LeuValLeu SerLeuIle 2 Leu Pro ArgSer SerGlnTyr IleLysTrp IleValSer AlaGlyLeu Ala Gln ValSer GluPheSer PheValLeu GlySerArg AlaArgArg Ala Gly ValIle SerArgGlu ValTyrLeu LeuIleLeu SerValThr Thr Leu SerLeu LeuLeuAla ProValLeu TrpArgAla AlaIleThr Arg Cys ValPro ArgProGlu ArgArgSer SerLeu 4 (2) INFORMATION OR D
O F SEQ N0:14:
I

(i) SEQUENCE CHARACTERISTICS :

(A) LENGTH: 324base irs pa (B) TYPE: ic nucle acid 45 (C) STRANDEDNES S: e doubl (D) TOPOLOGY. inear l (ii) MOLECULE TYPE: DNA
c (xi) SEQUENCE DESCRIPTION: SEQ ID N0:14:

(2) INFORMATION FOR SEQ ID N0:15:

(i) SEQTJENCE CHARACTERISTICS:

(A) LENGTH: 550 base pairs 15(B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION:
SEQ ID N0:15:

O

(2) INFORMATION FOR SEQ ID
N0:16:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 170 amino acids 5 (B) TYPE: amino acid (C) STRANDEDNESS:

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE
DESCRIPTION:
SEQ
ID
N0:16:

Met Gln Val Glu Arg Glu AlaIleLeu LeuAlaAsn LeuGlnGlu Lys Ser Gln Thr Gln Leu Glu ThrLysGly AlaLeuThr GluGlnHis His Glu Arg Val His Arg Leu GluHisVal AsnAlaMet ArgGlyLeu Thr Gln Ser Ser Lys Glu Leu AlaGluLeu AspGlyGlu LysGlyArg Lys Asp Ser Gly Glu Glu Ala AspTyrGlu ValAspIle AsnGlyLeu His 2 Glu Ile Leu Glu Cys Lys ArgValAla ValThrGlu ValIleAsp 0 Tyr Leu Lys Ala Glu Ile Lys LeuLysGlu LysTyrAsn LysSerVai Ala Glu Asn Tyr Thr Asp Glu AlaLysTyr GluSerLys IleGlnMet Lys Tyr Asp Glu Gln Val Thr LeuGluLys ThrThrLys GluSerGly Ser Glu Lys Met Ala His Met LysGluLeu GlnLysMet ThrSerIle Glu 3 Ala Asn Glu Asn His Ser LeuAsnThr 5 Thr (2) INFORMATI ON FOR SEQ ID
N0:17:

4O (i) SEQUENCE :
CHARACTERISTICS

(A) LENGTH: 505 base irs pa (B) TYPE: nucleic acid (C) STRANDEDNESS: e doubl (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:17:

ATTTAAATTT P,~~?~AAAAAAA AAAAA 5 15(2) INFORMATION FOR SEQ ID N0:18:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 481 base pairs (B) TYPE: nucleic acid 2 (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:18:

O TAAACCAACA

AGACACGAAT

ATTTTCTTCG

TGAAACTTGT

AACCCTATTC

CCTGATTTTT

AATGTAAGCT

GCAAAATACA CTTGTGACAT TTGAAAAGGC AAAAAAAAA.A AAAAAAAAAA480 AAAAAAAAAA

(2) INFORMATION FOR SEQ ID N0:19:

SO(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 107 amino acids {B) TYPE: amino acid (C) STRANDEDNESS:

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION:
SEQ ID N0:19:

Met Val Gln Ile Ile Lys Asp AsnGluPhe LysThr PheLeuThr Thr Ala Ala Gly His Lys Leu Ala ValGlnPhe SerSer LysArgCys Val Gly Pro Cys Lys Arg Met Phe ValPheHis GluLeu AlaGluThr Pro Cys His Ile Lys Thr Ile Pro PheGlnMet PheLys LysSerGln Thr 2 Lys Val Thr Leu Phe Ser Arg LysArgIle IleCys CysTyrArg 0 Ile Ser Gly Phe Met Ser Asn Leu PheGluPhe CysGly AlaAspAla Ile Lys Lys Leu Glu Ala Lys Thr GluLeuMet Gln (2) INFORMATION
FOR
SEQ
ID N0:20:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1864 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double 3 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE
DESCRIPTION:
SEQ ID N0:20:

SO

(2) INFORMATION
FOR SEQ
ID N0:21:

(i) S EQUENCE
CHARACTERISTICS:

(A) LENGTH: 102 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION:
SEQ ID N0:21:

Val Leu Pro Thr Cys Arg Gln AlaThr ProTyr LeuLeuPro Ser Glu Ala Pro Ser Arg Ala His Leu ArgPro AlaLeu ProCysPro Ala Pro Ile Pro Cys Ser Ala Pro Ser GlyAla LeuLeu ArgAspGly Leu Gly Ala Gly Leu Tyr Pro Ala Ser ValSer ArgAsp SerArgAsn Leu Leu 2 Trp Gly Pro Val Phe Trp Ser AspPro ArgGly AlaHisGly Pro 5 Cys Leu Gly Cys Leu Asn Arg Arg TrpGlu GlyGly LeuHisPro Cys Ala Ser Leu Thr Leu Leu Val (2) INFORMATION
FOR
SEQ
ID
N0:22:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1041 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double 4 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:22:

TCGACATGAA GAAGAGAAAT TCTTCTTAAA TGCCAAAGGC CAGAAAGAAA CTTTACCCAG i20 gg (2) INFORMATION FOR SEQ ID N0:23:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 291 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:

3 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:23:
Met Pro Ala Leu His Arg His Glu Glu Glu Lys Phe Phe Leu Asn Ala Lys Gly Gln Lys Glu Thr Leu Pro Ser Ile Trp Asp Ser Pro Thr Lys Gln Leu Ser Val Val Val Pro Ser Asn Asn Glu Glu Lys Arg Leu Pro Val Met Met Asp Glu Ala Leu Ser Tyr Val Glu Lys Arg Gln Lys Arg Asp Pro Ala Phe Thr Tyr Glu Val Ile Val Val Asp Asp Gly Ser Lys Asp GlnThr SerLysVal PheLysTyr CysGln LysTyrGlySer Ala Asp LysVal ArgValIle LeuValLys AsnArg GlyLysGlyGly Thr 1 Ala IleArg MetGlyIle SerSerArg GlyGlu LysIleLeuMet 0 Phe Ala AspAla AspGlyAla LysPhePro AspVal GluLysLeuGlu Thr Lys GlyLeu AsnAspLeu ProTrpPro AsnGln MetAlaIleAla Gln Cys GlySer ArgAlaHis GluLysGlu SerIle AlaGlnArgSer Leu Tyr PheArg ThrLeuLeu TyrGlyPhe HisPhe LeuValTrpPhe Met 2 Leu CysVal LysGlyIle AspThrGln CysGly PheLysLeuPhe 5 Arg Thr ArgGlu AlaAlaSer ThrPheSer SerLeu HisValGluArg Arg Trp AlaPhe AspValGlu LeuTyrIle AlaGln PhePheLysIle Leu Pro IleAla GluIleAla AsnTrpThr GluIle GluGlySerLys Val Leu ValPro PheTrpSer LeuGlnMet GlyLys AspLeuLeuPhe Trp 4 Ile ArgLeu ArgTyrLeu GlyAlaTrp ArgLeu GluGlnThrArg 0 Thr Lys MetAsn (2) INFORMATI ON OR EQ
F S ID
N0:24:

(i) SEQUENCECHARACTERISTICS:

(A)LENGTH: 29 base rs pai 50 (B)TYP E: ucleic n acid (C)STRANDE DNESS: e singl (D)TOP OLOGY: inear l (ii) MOLECULETYPE: leicacid other nuc 5 (A)DESCRIP TION: = ligonucleotide"
5 /desc "o (xi) SEQUENCE DESCRIPTION: SEQ ID N0:24:

{2) INFORMATION FOR SEQ ID N0:25:
1O (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs {B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:25:

(2) INFORMATION FOR SEQ ID N0:26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs 3 0 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear {ii) MOLECULE TYPE: other nucleic acid 3 5 (A) DESCRIPTION: /desc = "oligonucleotide"
40 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:26:

(2) INFORMATION FOR SEQ ID N0:27:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "oligonucleotide"

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:27:
TNACAACAGT GATATTTGAG AGCTTCAAG 2g (2) INFORMATION FOR SEQ ID N0:28:
(i) SEQUENCE CHARACTERISTICS:
{A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "oligonucleotide"
2 O (xi) SEQUENCE DESCRIPTION: SEQ ID N0:28:
CNGTAACACC TCTCCAACGC TTTCGATGC 2g (2) INFORMATION FOR SEQ ID N0:29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single 3 0 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:29:
4 O GNCAAGGACA GACACGTGGA AATGAAGAC 2g (2) INFORMATION FOR SEQ ID N0:30:
{i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "oligonucleotide"

CA 02293363 1999-ll2-09 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:30:

(2) INFORMATION FOR SEQ ID N0:31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:31:

(2) INFORMATION FOR SEQ ID N0:32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:32:

(2) INFORMATION FOR SEQ ID N0:33:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:33:

(2) INFORMATION FOR SEQ ID N0:34:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 359 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:
(D) TOPOLOGY: linear (ii) MOLECULE TYPE. protein (xi) SEQUENCE
DESCRIPTION:
SEQ
ID
N0:34:

Arg Val LysValGln LeuAla LeuValPhe PheLysAsn LeuAlaSer Ser Cys ThrLeuAsp SerAla LeuAsnAla AlaSerTyr TyrAsnPhe Thr Val LeuLysVal ProArg SerMetThr AspProGln AsnMetGlu Phe Gln ValProVal IleLeu ThrSerGln AlaAsnAla ProLeuLeu 3 Ala Gly AsnThrCys GlnAsn ValValSer GlnValThr TyrGluIle Glu Thr AsnGlyThr PheGly IleGlnLys ValSerVal SerLeuGly Gln Thr AsnLeuThr ValGlu ProGlyAla SerLeuGln GlnHisPhe Ile Leu ArgPheArg AlaPhe GlnGlnSer ThrAlaAla SerLeuThr Ser Pro ArgSerGly AsnPro GlyTyrIle ValGlyLys ProLeuLeu Ala Leu ThrAspAsp IleSer TyrSerMet ThrLeuLeu GlnSerGln Gly Asn GlySerCys SerVal LysArgHis GluValGln PheGlyVal Asn Ala IleSerGly CysLys LeuArgLeu LysLysAla AspCysSer His Leu GlnGlnGlu IleTyr GlnThrLeu HisGlyArg ProArgPro Glu Tyr Val Ala Ile Phe Gly Asn Ala Asp Pro Ala Gln Lys Gly Gly Trp Thr Arg Ile Leu Asn Arg His Cys Ser Ile Ser Ala Ile Asn Cys Thr Ser Cys Cys Leu Ile Pro Val Ser Leu Glu Ile Gln Val Leu Trp Ala Tyr Val Gly Leu Leu Ser Asn Pro Gln Ala His Val Ser Gly Val Arg Phe Leu Tyr Gln Cys Gln Ser Ile Gln Asp Ser Gln Gln Val Thr Glu Val Ser Leu Thr Thr Leu Val Asn Phe Val Asp Ile Thr Gln Lys Pro Gln Pro Pro Arg Gly Gln Pro Lys Met Asp Trp Lys Trp Pro Phe Asp Phe Phe Pro Phe Lys Val Ala Phe Ser Arg Gly Val Phe Ser Gln 2 5 Lys Cys Ser Val Ser Pro Ile Leu Ile Leu Cys Leu Leu Glu Leu Gly Val Leu Asn Leu Glu Thr Met

Claims (38)

What is claimed is:

1. An isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:1;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:1 from nucleotide 12 to nucleotide 800;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:1 from nucleotide 78 to nucleotide 800;
(d) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:1 from nucleotide 1 to nucleotide 547;
(e) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone bh389_11 deposited under accession number ATCC 98451;
(f) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone bh389_11 deposited under accession number ATCC 98451;
(g) a polynucleotide comprising the nucleotide sequence of a mature protein coding sequence of clone bh389_11 deposited under accession number ATCC 98451;
(h) a polynucleotide encoding a mature protein encoded by the cDNA
insert of clone bh389_11 deposited under accession number ATCC 98451;
(i) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:2;
(j) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:2 having biological activity, the fragment comprising eight consecutive amino acids of SEQ ID NO:2;
(k) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(h) above;
(l) a polynucleotide which encodes a species homologue of the protein of (i) or (j) above ; and (m) a polynucleotide that hybridizes under stringent conditions to any one of the polynucleotides specified in (a)-(j).

2. The polynucleotide of claim 1 wherein said polynucleotide is operably linked to at least one expression control sequence.

3. A host cell transformed with the polynucleotide of claim 2.

4. The host cell of claim 3, wherein said cell is a mammalian cell.

5. A process for producing a protein encoded by the polynucleotide of claim 2, which process comprises:
(a) growing a culture of the host cell of claim 3 in a suitable culture medium; and (b) purifying said protein from the culture.

6. A protein produced according to the process of claim 5.

7. A protein comprising an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:2;
(b) the amino acid sequence of SEQ ID NO:2 from amino acid 1 to amino acid 178;
(c) fragments of the amino acid sequence of SEQ ID NO:2 comprising eight consecutive amino acids of SEQ ID NO:2; and (d) the amino acid sequence encoded by the cDNA insert of clone bh389_11 deposited under accession number ATCC 98451;
the protein being substantially free from other mammalian proteins.

8. The protein of claim 7, wherein said protein comprises the amino acid sequence of SEQ ID NO:2.

9. The protein of claim 7, wherein said protein comprises the amino acid sequence of SEQ ID NO:2 from amino acid 1 to amino acid 178.

10. A composition comprising the protein of claim 7 and a pharmaceutically acceptable carrier.

11. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:1.

12. An isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:3;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:3 from nucleotide 100 to nucleotide 882;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:3 from nucleotide 635 to nucleotide 867;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone bk112_15 deposited under accession number ATCC 98451;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone bk112_15 deposited under accession number ATCC 98451;
(f) a polynucleotide comprising the nucleotide sequence of a mature protein coding sequence of clone bk112_15 deposited under accession number ATCC 98451;
(g) a polynucleotide encoding a mature protein encoded by the cDNA
insert of clone bk112_l5 deposited under accession number ATCC 98451;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:4;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:4 having biological activity, the fragment comprising eight consecutive amino acids of SEQ ID NO:4;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (l) a polynucleotide that hybridizes under stringent conditions to any one of the polynucleotides specified in (a)-(i).

13. A protein comprising an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:4;
(b) the amino acid sequence of SEQ ID NO:4 from amino acid 200 to amino acid 256;

(c) fragments of the amino acid sequence of SEQ ID NO:4 comprising eight consecutive amino acids of SEQ ID NO:4; and (d) the amino acid sequence encoded by the cDNA insert of clone bk112_15 deposited under accession number ATCC 98451;
the protein being substantially free from other mammalian proteins.

14. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:3.

15. An isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:5;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:5 from nucleotide 245 to nucleotide 520;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:5 from nucleotide 181 to nucleotide 527;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone bk200_13 deposited under accession number ATCC 98451;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone bk200_13 deposited under accession number ATCC 98451;
(f) a polynucleotide comprising the nucleotide sequence of a mature protein coding sequence of clone bk200_13 deposited under accession number ATCC 98451;
(g) a polynucleotide encoding a mature protein encoded by the cDNA
insert of clone bk200_13 deposited under accession number ATCC 98451;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:6;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:6 having biological activity, the fragment comprising eight consecutive amino acids of SEQ ID NO:6;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k} a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (l) a polynucleotide that hybridizes under stringent conditions to any one of the polynucleotides specified in (a)-(i).

16. A protein comprising an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:6;
(b) fragments of the amino acid sequence of SEQ ID NO:6 comprising eight consecutive amino acids of SEQ ID NO:6; and (c) the amino acid sequence encoded by the cDNA insert of clone bk200_13 deposited under accession number ATCC 98451;
the protein being substantially free from other mammalian proteins.

17. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:5.

18. An isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:7;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:7 from nucleotide 365 to nucleotide 784;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:7 from nucleotide 518 to nucleotide 784;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone di386_3 deposited under accession number ATCC 98451;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone di386 3 deposited under accession number ATCC 98451;
(f) a polynucleotide comprising the nucleotide sequence of a mature protein coding sequence of clone di386_3 deposited under accession number ATCC 98451;
(g) a polynucleotide encoding a mature protein encoded by the cDNA
insert of clone di386_3 deposited under accession number ATCC 98451;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:8;

(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:8 having biological activity, the fragment comprising eight consecutive amino acids of SEQ ID NO:8;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (l) a polynucleotide that hybridizes under stringent conditions to any one of the polynucleotides specified in (a)-(i).

19. A protein comprising an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:8;
(b) the amino acid sequence of SEQ ID NO:8 from amino acid 1 to amino acid 140;
(c) fragments of the amino acid sequence of SEQ ID NO:8 comprising eight consecutive amino acids of SEQ ID NO:8; and (d) the amino acid sequence encoded by the cDNA insert of clone di386_3 deposited under accession number ATCC 98451;
the protein being substantially free from other mammalian proteins.

20. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:7 and SEQ ID NO:9.

21. An isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:10;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:10 from nucleotide 191 to nucleotide 781;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:10 from nucleotide 56 to nucleotide 492;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone em397_2 deposited under accession number ATCC 98451;

(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone em397_2 deposited under accession number ATCC 98451;
(f) a polynucleotide comprising the nucleotide sequence of a mature protein coding sequence of clone em397_2 deposited under accession number ATCC 98451;
(g) a polynucleotide encoding a mature protein encoded by the cDNA
insert of clone em397_2 deposited under accession number ATCC 98451;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:11;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:11 having biological activity, the fragment comprising eight consecutive amino acids of SEQ ID NO:11;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (l) a polynucleotide that hybridizes under stringent conditions to any one of the polynucleotides specified in (a)-(i).

22. A protein comprising an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:11;
(b) the amino acid sequence of SEQ ID NO:11 from amino acid 1 to amino acid 101;
(c) fragments of the amino acid sequence of SEQ ID NO:11 comprising eight consecutive amino acids of SEQ ID NO:11; and (d) the amino acid sequence encoded by the cDNA insert of clone em397 2 deposited under accession number ATCC 98451;
the protein being substantially free from other mammalian proteins.

23. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:10.

24. An isolated polynucleotide selected from the group consisting of:

(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:12;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:12 from nucleotide 65 to nucleotide 1636;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:12 from nucleotide 482 to nucleotide 1636;
(d) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:12 from nucleotide 487 to nucleotide 1006;
(e) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone fh170_7 deposited under accession number ATCC 98451;
(f) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone fh170_7 deposited under accession number ATCC 98451;
(g) a polynucleotide comprising the nucleotide sequence of a mature protein coding sequence of clone fh170_7 deposited under accession number ATCC 98451;
(h) a polynucleotide encoding a mature protein encoded by the cDNA
insert of clone fh170_7 deposited under accession number ATCC 98451;
(i) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:13;
(j) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:13 having biological activity, the fragment comprising eight consecutive amino acids of SEQ ID NO:13;
(k) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(h) above;
(l) a polynucleotide which encodes a species homologue of the protein of (i) or (j) above ; and (m) a polynucleotide that hybridizes under stringent conditions to any one of the polynucleotides specified in (a)-(j).

25. A protein comprising an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:13;

(b) the amino acid sequence of SEQ ID NO:13 from amino acid 142 to amino acid 314;
(c) fragments of the amino acid sequence of SEQ ID NO:13 comprising eight consecutive amino acids of SEQ ID NO:13; and (d) the amino acid sequence encoded by the cDNA insert of clone fh170_7 deposited under accession number ATCC 98451;
the protein being substantially free from other mammalian proteins.

26. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:12.

27. An isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:15;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:15 from nucleotide 41 to nucleotide 550;
(c) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone fn53_4 deposited under accession number ATCC 98451;
(d) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone fn53_4 deposited under accession number ATCC 98451;
(e) a polynucleotide comprising the nucleotide sequence of a mature protein coding sequence of clone fn53_4 deposited under accession number ATCC
98451;
(f) a polynucleotide encoding a mature protein encoded by the cDNA
insert of clone fn53_4 deposited under accession number ATCC 98451;
(g) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:16;
(h) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:16 having biological activity, the fragment comprising eight consecutive amino acids of SEQ ID NO:16;
(i) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(f) above;
(j) a polynucleotide which encodes a species homologue of the protein of (g) or (h) above ; and (k) a polynucleotide that hybridizes under stringent conditions to any one of the polynucleotides specified in (a)-(h).

28. A protein comprising an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:16;
(b) the amino acid sequence of SEQ ID NO:16 from amino acid 40 to amino acid 170;
(c) fragments of the amino acid sequence of SEQ ID NO:16 comprising eight consecutive amino acids of SEQ ID NO:16; and (d) the amino acid sequence encoded by the cDNA insert of clone fn53_4 deposited under accession number ATCC 98451;
the protein being substantially free from other mammalian proteins.

29. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:15, SEQ ID NO:14, and SEQ ID NO:17.

30. An isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:18;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:18 from nucleotide 84 to nucleotide 404;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:18 from nucleotide 78 to nucleotide 493;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone fq505_4 deposited under accession number ATCC 98451;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone fq505_4 deposited under accession number ATCC 98451;
(f) a polynucleotide comprising the nucleotide sequence of a mature protein coding sequence of clone fq505_4 deposited under accession number ATCC 98451;
(g) a polynucleotide encoding a mature protein encoded by the cDNA
insert of clone fq505_4 deposited under accession number ATCC 98451;

(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:19;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:19 having biological activity, the fragment comprising eight consecutive amino acids of SEQ ID NO:19;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (1) a polynucleotide that hybridizes under stringent conditions to any one of the polynucleotides specified in (a)-(i).

31. A protein comprising an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:19;
(b) the amino acid sequence of SEQ ID NO:19 from amino acid 23 to amino acid 107;
(c) fragments of the amino acid sequence of SEQ ID NO:19 comprising eight consecutive amino acids of SEQ ID NO:19; and (d) the amino acid sequence encoded by the cDNA insert of clone fq505_4 deposited under accession number ATCC 98451;
the protein being substantially free from other mammalian proteins.

32. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:18.

33. An isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:20;
{b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:20 from nucleotide 1439 to nucleotide 1744;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:20 from nucleotide 1241 to nucleotide 1754;

(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone fw13_9 deposited under accession number ATCC 98451;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone fw13_9 deposited under accession number ATCC 98451;
(f) a polynucleotide comprising the nucleotide sequence of a mature protein coding sequence of clone fw13_9 deposited under accession number ATCC 98451;
(g) a polynucleotide encoding a mature protein encoded by the cDNA
insert of clone fw13_9 deposited under accession number ATCC 98451;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:21;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:21 having biological activity, the fragment comprising eight consecutive amino acids of SEQ ID NO:21;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above; and (l) a polynucleotide that hybridizes under stringent conditions to any one of the polynucleotides specified in (a)-(i).

34. A protein comprising an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:21;
(b) the amino acid sequence of SEQ ID NO:21 from amino acid 1 to amino acid 57;
(c) fragments of the amino acid sequence of SEQ ID NO:21 comprising eight consecutive amino acids of SEQ ID NO:21; and (d) the amino acid sequence encoded by the cDNA insert of clone fw13_9 deposited under accession number ATCC 98451;
the protein being substantially free from other mammalian proteins.

35. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:20.

36. An isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:22;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:22 from nucleotide 47 to nucleotide 919;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:22 from nucleotide 124 to nucleotide 452;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone gg619_2 deposited under accession number ATCC 98451;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone gg619_2 deposited under accession number ATCC 98451;
(f) a polynucleotide comprising the nucleotide sequence of a mature protein coding sequence of clone gg619_2 deposited under accession number ATCC 98451;
(g) a polynucleotide encoding a mature protein encoded by the cDNA
insert of clone gg619_2 deposited under accession number ATCC 98451;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:23;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:23 having biological activity, the fragment comprising eight consecutive amino acids of SEQ ID NO:23;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above; and (l) a polynucleotide that hybridizes under stringent conditions to any one of the polynucleotides specified in (a)-(i).

37. A protein comprising an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:23;
(b) the amino acid sequence of SEQ ID NO:23 from amino acid 27 to amino acid 135;

(c) fragments of the amino acid sequence of SEQ ID NO:23 comprising eight consecutive amino acids of SEQ ID NO:23; and (d) the amino acid sequence encoded by the cDNA insert of clone gg619 2 deposited under accession number ATCC 98451;
the protein being substantially free from other mammalian proteins.

38. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:22.