CA2276085A1 - Secreted proteins and polynucleotides encoding them - Google Patents

Abstract

Novel polynucleotides and the proteins encoded thereby are disclosed.

Description

2 PCT/I1S98/0(1289 This application is a continuation-in-part of Ser. No. Ob/XXX,XXX (converted to a provisional application from non-provisional application Ser. No.
08/780,890}, filed January 9, 1997, which is incorporated by reference herein.
FIELD OF THE INVENTION
The present invention provides novel polynucleotides and proteins encoded by such polynucleotides, along with therapeutic, diagnostic and research utilities for these polynucleotides and proteins.
BACKGROUND OF THE INVENTION
Technology aimed at the discovery of protein factors (including e.g., cytokines, such as lymphokines, interferons, CSFs and interleukins) has matured rapidly over the past decade. The now routine hybridization cloning and expression cloning techniques clone novel polynucleotides "directly" in the sense that they rely on information directly related to the discovered protein (i.e., partial DNA/amino acid sequence of the protein in the case of hybridization cloning; activity of the protein in the case of expression cloning). More recent "indirect" cloning techniques such as signal sequence cloning) which isolates DNA sequences based on the presence of a now well-recognized secretory leader sequence motif) as well as various PCR-based or low stringency hybridization cloning techniques, have advanced the state of the art by making available large numbers of DNA/amino acid sequences for proteins that are known to have biological activity by virtue of their secreted nature in the case of leader sequence cloning, or by virtue of the cell or tissue source in the case of PCR-based techniques. It is to these proteins and the polynucleotides encoding them that the present invention is directed.
SUBSTITUTE SHEET (RULE 26) SUMMARY OF THE INVENTION
In one embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:1;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:1 from nucleotide 61 to nucleotide 642;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:1 from nucleotide 89 to nucleotide 440;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone BI164_1 deposited under accession number ATCC 98290;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone BI164_1 deposited under accession number ATCC 98290;
(f) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone BI164_1 deposited under accession number ATCC 98290;
(g) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone BI164_1 deposited under accession number ATCC 98290;
2 0 (h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:2;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:2 having biological activity;
(j) a polynucleotide which is an allelic variant of a polynucleotide of 2 5 (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (1) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(i).

3 0 Preferably, such polynucleotide comprises the nucleotide sequence of SEQ
ID
N0:1 from nucleotide 61 to nucleotide 642; the nucleotide sequence of SEQ ID
N0:1 from nucleotide 89 to nucleotide 440; the nucleotide sequence of the full-length protein coding sequence of clone BI164_1 deposited under accession number ATCC 98290; or the nucleotide sequence of the mature protein coding sequence of clone BI164_1 deposited under accession number ATCC 98290. In other preferred embodiments, the polynucleotide encodes the full-length or mature protein encoded by the cDNA
insert of clone BI164_1 deposited under accession number ATCC 98290. In yet other preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:2 from amino acid 23 to amino acid 127.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:1.
In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID N0:2;
(b) the amino acid sequence of SEQ ID N0:2 from amino acid 23 to amino acid 127;
(c) fragments of the amino acid sequence of SEQ ID N0:2; and (d) the amino acid sequence encoded by the cDNA insert of clone BI164_1 deposited under accession number ATCC 98290;
the protein being substantially free from other mammalian proteins. Preferably such protein comprises the amino acid sequence of SEQ ID N0:2 or the amino acid sequence 2 0 of SEQ ID N0:2 from amino acid 23 to amino acid 127.
In one embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:3;
2 5 (b) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:3 from nucleotide 1625 to nucleotide 1750;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:3 from nucleotide 1484 to nucleotide 1729;
(d) a polynucleotide comprising the nucleotide sequence of the full-3 0 length protein coding sequence of clone BK445_1 deposited under accession number ATCC 98290;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone BK445 1 deposited under accession number ATCC 98290;

(f) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone BK445_1 deposited under accession number ATCC 98290;
(g) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone BK445_1 deposited under accession number ATCC 98290;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:4;
(i} a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:4 having biological activity;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and {1) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-{i).
Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID
N0:3 from nucleotide 1625 to nucleotide 1750; the nucleotide sequence of SEQ
ID N0:3 from nucleotide 1484 to nucleotide 1729; the nucleotide sequence of the full-length protein coding sequence of clone BK445_1 deposited under accession number ATCC 98290;
or the 2 0 nucleotide sequence of the mature protein coding sequence of clone BK445_1 deposited under accession number ATCC 98290. In other preferred embodiments, the polynucleotide encodes the full-length or mature protein encoded by the cDNA
insert of clone BK445_1 deposited under accession number ATCC 98290. In yet other preferred embodiments) the present invention provides a polynucleotide encoding a protein 2 5 comprising the amino acid sequence of SEQ ID N0:4 from amino acid 1 to amino acid 35.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:3.
In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group 3 0 consisting of:
(a) the amino acid sequence of SEQ ID N0:4;
(b) the amino acid sequence of SEQ ID N0:4 from amino acid 1 to amino acid 35;
(c) fragments of the amino acid sequence of SEQ ID N0:4; and (d) the amino acid sequence encoded by the cDNA insert of clone BK445_1 deposited under accession number ATCC 98290;
the protein being substantially free from other mammalian proteins. Preferably such protein comprises the amino acid sequence of SEQ ID N0:4 or the amino acid sequence of SEQ ID N0:4 from amino acid i to amino acid 35.
In one embodiment) the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:5;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:5 from nucleotide 99 to nucleotide 1058;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:5 from nucleotide 1 to nucleotide 644;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone BP101 2 deposited under accession number ATCC 98290;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone BP101 2 deposited under accession number ATCC 98290;
(f) a polynucleotide comprising the nucleotide sequence of the mature 2 0 protein coding sequence of clone BP101 2 deposited under accession number ATCC 98290;
(g) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone BP101 2 deposited under accession number ATCC 98290;
(h) a polynucleotide encoding a protein comprising the amino acid 2 5 sequence of SEQ ID N0:6;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:6 having biological activity;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a}-(g) above;
3 0 (k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (1) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(i).

WO 98!30582 PCTlUS98100289 Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID
N0:5 from nucleotide 99 to nucleotide 1058; the nucleotide sequence of SEQ ID
N0:5 from nucleotide 1 to nucleotide 644; the nucleotide sequence of the full-length protein coding sequence of clone BP101 2 deposited under accession number ATCC 98290;
or the nucleotide sequence of the mature protein coding sequence of clone BP101 2 deposited under accession number ATCC 98290. In other preferred embodiments, the polynucleotide encodes the full-length or mature protein encoded by the cDNA
insert of clone BP101 2 deposited under accession number ATCC 98290. In yet other preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:6 from amino acid 1 to amino acid 182.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:5.
In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID N0:6;
(b) the amino acid sequence of SEQ ID N0:6 from amino acid 1 to amino acid 182;
(c) fragments of the amino acid sequence of SEQ ID N0:6; and 2 0 (d) the amino acid sequence encoded by the cDNA insert of clone BP101 2 deposited under accession number ATCC 98290;
the protein being substantially free from other mammalian proteins. Preferably such protein comprises the amino acid sequence of SEQ ID N0:6 or the amino acid sequence of SEQ ID N0:6 from amino acid 1 to amino acid 182.
2 5 in one embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:7;
{b) a polynucleotide comprising the nucleotide sequence of SEQ ID
3 0 N0:7 from nucleotide 237 to nucleotide 1184;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:7 from nucleotide 207 to nucleotide 935;

(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone CD124_3 deposited under accession number ATCC 98290;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone CD124_3 deposited under accession number ATCC 98290;
. (f) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone CDI24 3 deposited under accession number ATCC 98290;
(g) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone CD124_3 deposited under accession number ATCC 98290;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:8;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:8 having biological activity;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (1) a polynucleotide capable of hybridizing under stringent conditions 2 0 to any one of the polynucleotides specified in (a)-(i).
Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID
N0:7 from nucleotide 237 to nucleotide 1184; the nucleotide sequence of SEQ ID
N0:7 from nucleotide 207 to nucleotide 935; the nucleotide sequence of the full-length protein coding sequence of clone CD124_3 deposited under accession number ATCC 98290;
or the 2 5 nucleotide sequence of the mature protein coding sequence of clone CD124_3 deposited under accession number ATCC 98290. In other preferred embodiments, the poiynucleotide encodes the full-length or mature protein encoded by the cDNA
insert of clone CD124 3 deposited under accession number ATCC 98290. In yet other preferred embodiments, the present invention provides a polynucleotide encoding a protein 3 0 comprising the amino acid sequence of SEQ ID NO:B from amino acid 1 to amino acid 233.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:7.

In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID N0:8;
(b) the amino acid sequence of SEQ ID N0:8 from amino acid 1 to amino acid 233;
(c) fragments of the amino acid sequence of SEQ ID N0:8; and (d) the amino acid sequence encoded by the cDNA insert of clone CD124_3 deposited under accession number ATCC 98290;
the protein being substantially free from other mammalian proteins. Preferably such protein comprises the amino acid sequence of SEQ ID NO:8 or the amino acid sequence of SEQ ID N0:8 from amino acid 1 to amino acid 233.
In one embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:9;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:9 from nucleotide 142 to nucleotide 828;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
2 0 N0:9 from nucleotide 1 to nucleotide 522;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone CW924_1 deposited under accession number ATCC 98290;
(e) a polynucleotide encoding the full-length protein encoded by the 2 5 cDNA insert of clone CW924_1 deposited under accession number ATCC 98290;
(f) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone CW924_1 deposited under accession number ATCC 98290;
(g) a polynucleotide encoding the mature protein encoded by the 3 0 cDNA insert of clone CW924_1 deposited under accession number ATCC 98290;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:10;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:10 having biological activity;

(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (1) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(i).
Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID
N0:9 from nucleotide 142 to nucleotide 828; the nucleotide sequence of SEQ ID
N0:9 from nucleotide 1 to nucleotide 522; the nucleotide sequence of the full-length protein coding sequence of clone CW924_1 deposited under accession number ATCC 98290;
or the nucleotide sequence of the mature protein coding sequence of clone CW924_1 deposited under accession number ATCC 98290. In other preferred embodiments, the polynucleotide encodes the full-length or mature protein encoded by the cDNA
insert of clone CW924_1 deposited under accession number ATCC 98290. In yet other preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:10 from amino acid 1 to amino acid 127.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:9.
2 0 In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:10;
(b) the amino acid sequence of SEQ ID NO:10 from amino acid 1 to 2 5 amino acid 127;
(c) fragments of the amino acid sequence of SEQ ID NO:10; and (d) the amino acid sequence encoded by the cDNA insert of clone CW924_1 deposited under accession number ATCC 98290;
the protein being substantially free from other mammalian proteins. Preferably such 3 0 protein comprises the amino acid sequence of SEQ ID NO:10 or the amino acid sequence of SEQ ID N0:10 from amino acid 1 to amino acid 127.
In one embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:

(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:11;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:11 from nucleotide 3 to nucleotide 1937;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:11 from nucleotide 204 to nucleotide 414;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone DF518 3 deposited under accession number ATCC 98290;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone DF518 3 deposited under accession number ATCC 98290;
(f) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone DF518 3 deposited under accession number ATCC 98290;
(g) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone DF518 3 deposited under accession number ATCC 98290;
(h} a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:12;
(i) a polynucleotide encoding a protein comprising a fragment of the 2 0 amino acid sequence of SEQ ID N0:12 having biological activity;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-{g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and 2 S (1) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(i).
Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID
NO:11 from nucleotide 3 to nucleotide 1937; the nucleotide sequence of SEQ ID
N0:11 from nucleotide 204 to nucleotide 414; the nucleotide sequence of the full-length protein 3 0 coding sequence of clone DF518 3 deposited under accession number ATCC
98290; or the nucleotide sequence of the mature protein coding sequence of clone DF518 3 deposited under accession number ATCC 98290. In other preferred embodiments, the polynucleotide encodes the full-length or mature protein encoded by the cDNA
insert of clone DF518_3 deposited under accession number ATCC 98290. In yet other preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:12 from amino acid 67 to amino acid 137.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:11.
. In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID N0:12;
(b) the amino acid sequence of SEQ ID NO:I2 from amino acid 67 to amino acid 137;
(c) fragments of the amino acid sequence of SEQ ID N0:12; and (d) the amino acid sequence encoded by the cDNA insert of clone DF518_3 deposited under accession number ATCC 98290;
the protein being substantially free from other mammalian proteins. Preferably such protein comprises the amino acid sequence of SEQ ID N0:12 or the amino acid sequence of SEQ ID N0:12 from amino acid 67 to amino acid 137.
In one embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
2 0 (a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:13;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:13 from nucleotide 137 to nucleotide 457;
(c), a polynucleotide comprising the nucleotide sequence of SEQ ID
2 5 N0:13 from nucleotide 323 to nucleotide 457;
(d) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:13 from nucleotide 82 to nucleotide 322;
(e) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone DM406_1 deposited under accession 3 0 number ATCC 98290;
(f) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone DM406_1 deposited under accession number ATCC 98290;

(g) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone DM406_1 deposited under accession number ATCC 98290;
(h) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone DM406_1 deposited under accession number ATCC 98290;
(i) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:14;
(j) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:14 having biological activity;
(k) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(h) above;
(1) a polynucleotide which encodes a species homologue of the protein of (i) or (j) above ; and (m) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(j).
Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID
N0:13 from nucleotide 137 to nucleotide 457; the nucleotide sequence of SEQ ID
N0:13 from nucleotide 323 to nucleotide 457; the nucleotide sequence of SEQ ID N0:13 from nucleotide 82 to nucleotide 322; the nucleotide sequence of the full-length protein coding 2 0 sequence of clone DM406_1 deposited under accession number ATCC 98290; or the nucleotide sequence of the mature protein coding sequence of clone DM406_1 deposited under accession number ATCC 98290. In other preferred embodiments, the polvnucleotide encodes the full-length or mature protein encoded by the cDNA
insert of clone DM406_1 deposited under accession number ATCC 98290. In yet other preferred 2 S embodiments, the present invention provides a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:14 from amino acid 1 to amino acid 62.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:13.
3 0 In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID N0:14;

(b) the amino acid sequence of SEQ ID N0:14 from amino acid 1 to amino acid 62;
(c) fragments of the amino acid sequence of SEQ ID N0:14; and (d) the amino acid sequence encoded by the cDNA insert of clone DM406_1 deposited under accession number ATCC 98290;
the protein being substantially free from other mammalian proteins. Preferably such protein comprises the amino acid sequence of SEQ ID N0:14 or the amino acid sequence of SEQ ID N0:14 from amino acid 1 to amino acid 62.
In one embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:15;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:15 from nucleotide 312 to nucleotide 851;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:15 from nucleotide 56 to nucleotide 470;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone EH189_1 deposited under accession number ATCC 98290;
2 0 (e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone EH189_1 deposited under accession number ATCC 98290;
(f} a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone EH189_1 deposited under accession number ATCC 98290;
(g) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone EH189_1 deposited under accession number ATCC 98290;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:16;
(i) a polynucleotide encoding a protein comprising a fragment of the . 3 0 amino acid sequence of SEQ ID N0:16 having biological activity;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (I) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(i).
Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID
N0:15 from nucleotide 312 to nucleotide 851; the nucleotide sequence of SEQ ID
N0:15 from nucleotide 56 to nucleotide 470; the nucleotide sequence of the full-length protein coding sequence of clone EH189_1 deposited under accession number ATCC 98290;
or the nucleotide sequence of the mature protein coding sequence of clone EH189_1 deposited under accession number ATCC 98290. In other preferred embodiments, the polynucleotide encodes the full-length or mature protein encoded by the cDNA
insert of clone EH189_1 deposited under accession number ATCC 98290. In yet other preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:16 from amino acid 1 to amino acid 53.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:15.
In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID N0:16;
2 0 (b) the amino acid sequence of SEQ ID N0:16 from amino acid 1 to amino acid 53;
(c) fragments of the amino acid sequence of SEQ ID N0:16; and (d) the amino acid sequence encoded by the cDNA insert of clone EH189_1 deposited under accession number ATCC 98290;
2 5 the protein being substantially free from other mammalian proteins.
Preferably such protein comprises the amino acid sequence of SEQ ID N0:16 or the amino acid sequence of SEQ ID N0:16 from amino acid 1 to amino acid 53.
In one embodiment) the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
3 0 (a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:17;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:17 from nucleotide 20 to nucleotide 541;

(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:17 from nucleotide 272 to nucleotide 541;
(d) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:17 from nucleotide 1 to nucleotide 448;
(e) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone EH203_2 deposited under accession number ATCC 98290;
(f} a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone EH203_2 deposited under accession number ATCC 98290;
(g) a poiynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone EH203 2 deposited under accession number ATCC 98290;
(h) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone EH203_2 deposited under accession number ATCC 98290;
(i) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:18;
(j) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:18 having biological activity;
(k) a polynucleotide which is an allelic variant of a polynucleotide of 2 0 (a)-(h) above;
(1) a polvnucleotide which encodes a species homologue of the protein of (i) or (j) above ; and (m) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(j).
2 5 Preferably, such polynucleotide comprises the nucleotide sequence of SEQ
ID
N0:17 from nucleotide 20 to nucleotide 541; the nucleotide sequence of SEQ ID
N0:17 from nucleotide 272 to nucleotide 541; the nucleotide sequence of SEQ ID N0:17 from nucleotide 1 to nucleotide 448; the nucleotide sequence of the full-length protein coding sequence of clone EH203_2 deposited under accession number ATCC 98290; or the 3 0 nucleotide sequence of the mature protein coding sequence of clone EH203 2 deposited under accession number ATCC 98290. In other preferred embodiments, the polynucleotide encodes the full-length or mature protein encoded by the cDNA
insert of clone EH203_2 deposited under accession number ATCC 98290. In yet other preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:18 from amino acid 1 to amino acid 143.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:17.
In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID N0:18;
(b) the amino acid sequence of SEQ ID N0:18 from amino acid 1 to amino acid 143;
(c) fragments of the amino acid sequence of SEQ ID N0:18; and (d) the amino acid sequence encoded by the cDNA insert of clone EI-I203 2 deposited under accession number ATCC 98290;
the protein being substantially free from other mammalian proteins. Preferably such protein comprises the amino acid sequence of SEQ ID NO:18 or the amino acid sequence of SEQ ID N0:18 from amino acid 1 to amino acid 143.
In certain preferred embodiments, the p.olynucleotide is operably linked to an expression control sequence. The invention also provides a host cell, including bacterial, yeast, insect and mammalian cells, transformed with such polynucleotide compositions.
2 0 Also provided by the present invention are organisms that have enhanced, reduced, or modified expression of the genes) corresponding to the polynucleotide sequences disclosed herein.
Processes are also provided for producing a protein, which comprise:
(a) growing a culture of the host cell transformed with such 2 5 polynucleotide compositions in a suitable culture medium; and (b) purifying the protein from the culture.
The protein produced according to such methods is also provided by the present invention. Preferred embodiments include those in which the protein produced by such process is a mature form of the protein.
3 0 Protein compositions of the present invention may further comprise a pharmaceutically acceptable carrier. Compositions comprising an antibody which specifically reacts with such protein are also provided by the present invention.
Methods are also provided for preventing, treating or ameliorating a medical condition which comprises administering to a mammalian subject a therapeutically effective amount of a composition comprising a protein of the present invention and a pharmaceutically acceptable carrier.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures lA and 1B are schematic representations of the pED6 and pNOTs vectors, respectively, used for deposit of clones disclosed herein.
DETAILED DESCRIPTION
ISOLATED PROTEINS AND POLYNUCLEOTIDES
Nucleotide and amino acid sequences, as presently determined, are reported below for each clone and protein disclosed in the present application. The nucleotide sequence of each clone can readily be determined by sequencing of the deposited clone in accordance with known methods. The predicted amino acid sequence (both full-length and mature) can then be determined from such nucleotide sequence. The amino acid sequence of the protein encoded by a particular clone can also be determined by expression of the clone in a suitable host cell, collecting the protein and determining its sequence. For each disclosed protein applicants have identified what they have determined to be the reading frame best identifiable with sequence information available at the time of filing.
2 0 As used herein a "secreted" protein is one which, when expressed in a suitable host cell, is transported across or through a membrane, including transport as a result of signal sequences in its amino acid sequence. "Secreted" proteins include without limitation proteins secreted wholly (e.g., soluble proteins) or partially (e.g. , receptors) from the cell in ~~hich they are expressed. "Secreted" proteins also include without limitation proteins 2 5 which are transported across the membrane of the endoplasmic reticulum.
Clone "BI164 1"
A polynucleotide of the present invention has been identified as clone "BI164_I ".
BI164_1 was isolated from a human fetal kidney cDNA library using methods which are 3 0 selective for cDNAs encoding secreted proteins (see U.S. Pat. No.
5,536,637), or was identified as encoding a secreted or transmembrane protein on the .basis of computer analysis of the amino acid sequence of the encoded protein. BI164_1 is a full-length clone, including the entire coding sequence of a secreted protein (also referred to herein as "BI164_1 protein').

The nucleotide sequence of BI164_l as presently determined is reported in SEQ
ID NO:1. What applicants presently believe to be the proper reading frame and the predicted amino acid sequence of the BI164_1 protein corresponding to the foregoing nucleotide sequence is reported in SEQ ID N0:2.
The EcoRI/NotI restriction fragment obtainable from the deposit containing clone BI164_1 should be approximately 800 bp.
The nucleotide sequence disclosed herein for BI164_1 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and FASTA search protocols. BI164_1 demonstrated at least some similarity with sequences identified as AA169106 (ms65e05.r1 Stratagene mouse embryonic carcinoma (#937317) Mus musculus cDNA clone 616448 5'), AA568401 (nfl6bll.sl NCI CGAP_Pr1 Homo sapiens cDNA clone IMAGE:913917 similar to contains element TAR1 repetitive element), and AA579465 (nf29h01.s1 NCI CGAP_Prl Homo Sapiens cDNA clone IMAGE:915217).
Based upon sequence similarity, BI164_1 proteins and each similar protein or peptide may share at least some activity.
Clone "BK445 1"
A polynucleotide of the present invention has been identified as clone "BK445_1".
BK445_1 was isolated from a human adult retina cDNA library using methods which are 2 0 selective for cDNAs encoding secreted proteins (see U.S. Pat. No.
5,536,637), or was identified as encoding a secreted or transmembrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. BK445_1 is a full-length clone, including the entire coding sequence of a secreted protein (also referred to herein as "BK445_1 protein") 2 5 The nucleotide sequence of BK445_1 as presently determined is reported in SEQ
ID N0:3. What applicants presently believe to be the proper reading frame and the predicted amino acid sequence of the BK445_1 protein corresponding to the foregoing nucleotide sequence is reported in SEQ ID N0:4.
The EcoRI/NotI restriction fragment obtainable from the deposit containing clone 3 0 BK445_1 should be approximately 3400 bp.
The nucleotide sequence disclosed herein for BK445_1 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and FASTA search protocols. BK445_1 demonstrated at least some similarity with sequences identified as F08866 (H. sapiens partial cDNA sequence; clone c-2th07), M87889 (Human carcinoma cell-derived Alu RNA transcript, clone CD140), U52111 (Human Xq28 genomic DNA in the region of the ALD locus containing the genes for creatine transporter {SLC6A8), CDM, adrenoleukodystrophy (ALD), Na+-isocitrate dehydrogenase gamma), and 269649 (Human DNA sequence from cosmid L69F7B, Huntington's Disease Region, chromosome 4p16.3 contains Huntington Disease (HD) gene). The predicted amino acid sequence disclosed herein for BK445_1 was searched against the GenPept and GeneSeq amino acid sequence databases using the BLASTX search protocol. The predicted BK445_1 protein demonstrated at least some similarity to sequences identified as L24521 (transformation-related protein [Homo sapiens]) and U22376 (alternatively spliced product using exon 13A [Homo sapiens]). Based upon sequence similarity, BK445_1 proteins and each similar protein or peptide may share at least some activity.
The nucleotide sequence of BK445 1 indicates that it may contain an Alu repetitive element.
Clone "BP101 2"
A polynucleotide of the present invention has been identified as clone "BP101_2".
BP101 2 was isolated from a human fetal kidney cDNA library using methods which are selective for cDNAs encoding secreted proteins (see U.S. Pat. No. 5,536,637), or was identified as encoding a secreted or transmembrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. BP101 2 is a full-length clone, 2 0 including the entire coding sequence of a secreted protein (also referred to herein as "BP101_2 protein") The nucleotide sequence of BP101 2 as presently determined is reported in SEQ
ID N0:5. What applicants presently believe to be the proper reading frame and the predicted amino acid sequence of the BP101 2 protein corresponding to the foregoing 2 5 nucleotide sequence is reported in SEQ ID N0:6. Another possible reading frame and predicted amino acid sequence encoded by BP101 2 is encoded by nucleotides 992-of SEQ ID N0:5 and is reported in SEQ ID N0:28; this alternative open reading frame could be joined to the reading frame reported in SEQ ID N0:6 if an insertion or deletion resulting in a frameshift was made in the sequence of SEQ ID N0:5. Amino acids 126 to 3 0 138 of SEQ ID N0:28 are a predicted leader/signal sequence, with the predicted mature amino acid sequence beginning at amino acid 139 of SEQ ID N0:28, or are a transmembrane domain.
The EcoRI/NotI restriction fragment obtainable from the deposit containing clone BP101 2 should be approximately 2280 bp.

The nucleotide sequence disclosed herein for BP101 2 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and FASTA search protocols. BP101 2 demonstrated at least some similarity with sequences identified as M87918 (Human carcinoma cell-derived Aiu RNA transcript, clone NE51), N74481 (za54d08.s1 Homo Sapiens cDNA clone 296367 3' similar to contains Alu repetitive element), and W03189 (za54d08.r1 Soares fetal liver spleen 1NFLS Homo sapiens cDNA
clone 296367 5'). The predicted amino acid sequence disclosed herein for BP101 2 was searched against the GenPept and GeneSeq amino acid sequence databases using the BLASTX search protocol. The predicted BP101 2 protein demonstrated at least some similarity to sequences identified as L11672 (zinc finger protein [Homo Sapiens]). Based upon sequence similarity, BP101 2 proteins and each similar protein or peptide may share at least some activity. The nucleotide sequence of BP101 2 indicates that it may contain an Alu repetitive element.
Clone "CD124 3"
A polynucleotide of the present invention has been identified as clone "CD124 3".
CD124_3 was isolated from a human fetal brain cDNA library using methods which are selective far cDNAs encoding secreted proteins (see U.S. Pat. No. 5,536,637), or was identified as encoding a secreted or transmembrane protein on the basis of computer 2 0 analysis of the amino acid sequence of the encoded protein. CD124_3 is a full-length done, including the entire coding sequence of a secreted protein (also referred to herein as "CD124 3 protein").
The nucleotide sequence of CD124_3 as presently determined is reported in SEQ
ID N0:7. What applicants presently believe to be the proper reading frame and the 2 5 predicted amino acid sequence of the CD124_3 protein corresponding to the foregoing nucleotide sequence is reported in SEQ ID N0:8.
The EcoRI/NotI restriction fragment obtainable from the deposit containing clone CD124_3 should be approximately 1400 bp.
The nucleotide sequence disclosed herein for CD124_3 was searched against the 3 0 GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and FASTA search protocols. CD124_3 demonstrated at least some similarity with sequences identified as AA123334 (mq10f01.r1 Barstead MPLRBl Mus musculus cDNA clone 5'), AA215297 (zr94b03.r1 NCI_CGAP GCB1 Homo sapiens cDNA clone), AA361664 (EST71136 T-cell lymphoma Homo sapiens cDNA 5' end), M16362 (Mouse opa repeat mRNA, 3' end (MOUSE)), N56580 (SH2201F Homo sapiens cDNA clone), Q12515 (CSP-2 peptide from P. falciparum (clone 4)), W53105 (md14d02.r1 Soares mouse embryo NbME13.5 14.5 Mus musculus cDNA clone 368355 5'), and X78609 (G.gallus genomic DNA repeat region, clone 16E1). Based upon sequence similarity, CD124_3 proteins and each similar protein or peptide may share at least some activity. The nucleotide sequence of CD124 3 indicates that it may contain a simple repeat sequence and a chicken genomic repeat sequence.
Clone "CW924 1"
A polynucleotide of the present invention has been identified as clone "CW924_1".
CW924_1 was isolated from a human fetal brain cDNA library using methods which are selective for cDNAs encoding secreted proteins (see U.S. Pat. No. 5,536,637), or was identified as encoding a secreted or transmembrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. CW924_1 is a full-length clone, including the entire coding sequence of a secreted protein (also referred to herein as "CW924_1 protein").
The nucleotide sequence of CW924_1 as presently determined is reported in SEQ
ID N0:9. What applicants presently believe to be the proper reading frame and the predicted amino acid sequence of the CW924_1 protein corresponding to the foregoing 2 0 nucleotide sequence is reported in SEQ ID NO:10.
The EcoRI/NotI restriction fragment obtainable from the deposit containing clone CW924_1 should be approximately 2300 bp.
The nucleotide sequence disclosed herein for CW924_1 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and 2 5 FASTA search protocols. CW924_1 demonstrated at least some similarity with sequences identified as H86434 (ys93h08.r1 Homo sapiens cDNA clone 222399 5'), T15605 (IB1619 Infant brain, Bento Soares Homo sapiens cDNA 3'end similar to IB570 H. sapiens brain cDNA clone IB570), U17259 (Mus musculus p19 mRNA, complete cds (MOUSE)), and W54334 {md05b08.r1 Soares mouse embryo NbME13.5 14.5 Mus musculus cDNA clone 3 0 367479 5'). The predicted amino acid sequence disclosed herein for CW924_1 was searched against the GenPept and GeneSeq amino acid sequence databases using the BLASTX search protocol. The predicted CW924_1 protein demonstrated at least some similarity to sequences identified as P50649 (Sequence encoded by brain specific (Class III) clone p1A75 ORF 1) and U17259 (p19 [Mus musculusJ). The predicted CW924_1 protein also demonstrated at least some similarity to mouse p21 protein. Based upon sequence similarity, CW924 1 proteins and each similar protein or peptide may share at least some activity. Amino acids 74 to 86 of SEQ ID N0:10 are a possible leader/signal sequence, with the predicted mature amino acid sequence beginning at amino acid 87, or are a transmembrane domain.
Clone "DF518 3"
A polynucleotide of the present invention has been identified as clone "DF518_3".
DF518 3 was isolated from a human adult brain cDNA library using methods which are selective for cDNAs encoding secreted proteins (see U.S. Pat. No. 5,536,637}, or was identified as encoding a secreted or transmembrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. DF518_3 is a full-length clone, including the entire coding sequence of a secreted protein (also referred to herein as "DF518_3 protein").
The nucleotide sequence of DF518_3 as presently determined is reported in SEQ
ID NO:11. What applicants presently believe to be the proper reading frame and the predicted amino acid sequence of the DF518_3 protein corresponding to the foregoing nucleotide sequence is reported in SEQ ID N0:12.
The EcoRI/NotI restriction fragment obtainable from the deposit containing clone 2 0 DF518_3 should be approximately 2650 bp.
The nucleotide sequence disclosed herein for DF518_3 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN /BLASTX and FASTA search protocols. DF518 3 demonstrated at least some similarity with sequences identified as AA190696 (zp89a02.r1 Stratagene HeLa cell s3 937216 Homo Sapiens cDNA
2 5 clone 627338 5'), H13983 (EST00009 Homo sapiens genomic clone C1-14 5'), and T90095 (yd39d08.s1 Homo sapiens cDNA clone 110607 3'). Based upon sequence similarity) DF518_3 proteins and each similar protein or peptide may share at least some activity.
Clone "DM406 1"
3 0 A polynucleotide of the present invention has been identified as clone "DM406_1 ".
DM406_1 was isolated from a human adult brain cDNA library using methods which are selective for cDNAs encoding secreted proteins (see U.S. Pat. No. 5,536,637), or was identified as encoding a secreted or transmembrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. DM406_1 is a full-length WO 98!30582 PCT/US98100Z89 clone, including the entire coding sequence of a secreted protein {also referred to herein as "DM406_1 protein") The nucleotide sequence of DM406_1 as presently determined is reported in SEQ
ID N0:13. What applicants presently believe to be the proper reading frame and the predicted amino acid sequence of the DM406_1 protein corresponding to the foregoing nucleotide sequence is reported in SEQ ID N0:14. Amino acids 50 to 62 are a predicted leader/signal sequence, with the predicted mature amino acid sequence beginning at amino acid 63, or are a transmembrane domain.
The EcoRI/NotI restriction fragment obtainable from the deposit containing clone DM40b_1 should be approximately 1700 bp.
The nucleotide sequence disclosed herein for DM406_1 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and FASTA search protocols. DM406_1 demonstrated at least some similarity with sequences identified as D82016 (Human fetal brain cDNA 5'-end GEN-430610) and H12174 (ym17fO8.r1 Homo sapiens cDNA clone 48073 5'). Based upon sequence similarity, DM406_1 proteins and each similar protein or peptide may share at least some activity.
Clone "EH189 1"
A polynucleotide of the present invention has been identified as clone "EH189_1".
2 0 EH189_1 was isolated from a human adult blood (peripheral blood mononuclear cells treated in z~iz~o with granulocyte-colony stimulating factor) cDNA library using methods which are selective for cDNAs encoding secreted proteins (see U.S. Pat. No.
5,536,637), or was identified as encoding a secreted or transmembrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. EH189_1 is a full-length 2 5 clone, including the entire coding sequence of a secreted protein (also referred to herein as "EH189_1 protein") The nucleotide sequence of EH189_1 as presently determined is reported in SEQ
ID N0:15. What applicants presently believe to be the proper reading frame and the predicted amino acid sequence of the EH189_1 protein corresponding to the foregoing 3 0 nucleotide sequence is reported in SEQ ID N0:16.
The EcoRI/NotI restriction fragment obtainable from the deposit containing clone EH189_1 should be approximately 1450 bp.
The nucleotide sequence disclosed herein for EH189_1 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and FASTA search protocols. EH189_1 demonstrated at least some similarity with sequences identified as AA681168 (vr75f04.s1 Knowles Softer mouse 2 cell Mus musculus cDNA
clone 1134559 5'). Based upon sequence similarity, EH189_1 proteins and each similar protein or peptide may share at least some activity.
Clone "EH203 2"
A polynucleotide of the present invention has been identified as clone "EH203 2".
EH203_2 was isolated from a human adult blood (peripheral blood mononuclear cells treated in vivo with granulocyte-colony stimulating factor) cDNA library using methods which are selective for cDNAs encoding secreted proteins {see U.S. Pat. No.
5,536,637), or was identified as encoding a secreted or transmembrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. EH203_2 is a full-length clone, including the entire coding sequence of a secreted protein (also referred to herein as "EH203 2 protein") The nucleotide sequence of EH203_2 as presently determined is reported in SEQ
ID N0:17. What applicants presently believe to be the proper reading frame and the predicted amino acid sequence of the EH203 2 protein corresponding to the foregoing nucleotide sequence is reported in SEQ ID N0:18. Amino acids 1 to 84 are a predicted leader/signal sequence, with the predicted mature amino acid sequence beginning at 2 0 amino acid 85, or are a transmembrane domain.
The EcoRI/NotI restriction fragment obtainable from the deposit containing clone EH203_2 should be approximately 1400 bp.
The nucleotide sequence disclosed herein for EH203_2 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and 2 5 FASTA search protocols. EH203_2 demonstrated at least some similarity with sequences identified as AA482321 (ab15c05.r1 Stratagene lung (#937210) Homo Sapiens cDNA
clone 840872 5'), H56345 (yq97bI2.s1 Homo Sapiens cDNA clone 203711 3'), T92363 (ye19h06.s1 Homo Sapiens cDNA clone 118235 3'). Based upon sequence similarity, EH203_2 proteins and each similar protein or peptide may share at least some activity.
Deposit of Clones Clones BI164_l, BK445_l, BPI01 2, CD124 3, CW924_l, DF518_3, DM406_l, EH189_l, and EH203_2 were deposited on January 8, 1997 with the American Type Culture Collection as an original deposit under the Budapest Treaty and were given the accession number ATCC 98290, from which each clone comprising a particular polynucleotide is obtainable. All restrictions on the availability to the public of the deposited material will be irrevocably removed upon the granting of the patent, except for the requirements specified in 37 C.F.R. ~ 1.808{b).
Each clone has been transfected into separate bacterial cells (E. coli) in this composite deposit. Each clone can be removed from the vector in which it was deposited by performing an EcoRI/NotI digestion {5' site, EcoRI; 3' site, NotI) to produce the appropriate fragment for such clone. Each clone was deposited in either the pED6 or pNOTs vector depicted in Fig. 1. The pED6dpc2 vector ("pED6") was derived from pED6dpc1 by insertion of a new polylinker to facilitate cDNA cloning (Kaufman et al., 1991, Nucleic Acids Res. 19: 4485-4490); the pNOTs vector was derived from pMT2 (Kaufman et al., 1989, Mol. Cell. Biol. 9: 946-958) by deletion of the DHFR
sequences, insertion of a new polylinker, and insertion of the M13 origin of replication in the CIaI site.
In some instances, the deposited clone can become "flipped" (i.e., in the reverse orientation) in the deposited isolate. In such instances, the cDNA insert can still be isolated by digestion with EcoRI and NotI. However, NotI will then produce the 5' site and EcoRI will produce the 3' site for placement of the cDNA in proper orientation for expression in a suitable vector. The cDNA may also be expressed from the vectors in which they were deposited.
2 0 Bacterial cells containing a particular clone can be obtained from the composite deposit as follows:
An oligonucleotide probe or probes should be designed to the sequence that is known for that particular clone. This sequence can be derived from the sequences provided herein, or from a combination of those sequences. The sequence of the 2 5 oligonucleotide probe that was used to isolate each ful I-length clone is identified below, and should be most reliable in isolating the clone of interest.
Clone Probe Sequence BI164_1 SEQ ID N0:19 3 0 BK445_1 SEQ ID N0:20 BP101 2 SEQ ID N0:21 CD124 3 SEQ ID N0:22 CW924_1 SEQ ID N0:23 DF518_3 SEQ ID N0:24 DM406_1 SEQ ID N0:25 EH189_1 SEQ ID N0:26 EH203_2 SEQ ID N0:27 In the sequences listed above which include an N at position 2, that position is occupied in preferred probes/primers by a biotinylated phosphoaramidite residue rather than a nucleotide {such as , for example, that produced by use of biotin phosphoramidite (1-dimethoxytrityloxy-2-{N-biotinyl-4-aminobutyl)-propyl-3-O-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramadite) (Glen Research, cat. no.10-1953)).
The design of the oligonucleotide probe should preferably follow these parameters:
(a) It should be designed to an area of the sequence which has the fewest ambiguous bases ("N's"), if any;
(b) It should be designed to have a Tm of approx. 80 ° C (assuming 2° for each A or T and 4 degrees for each G or C).
The oligonucleotide should preferably be labeled with g-''P ATP (specific activity 6000 Ci / mmole) and T4 polynucleotide kinase using commonly employed techniques for labeling oligonucleotides. Other labeling techniques can also be used.
Unincorporated label should preferably be removed by gel filtration chromatography or other established 2 0 methods. The amount of radioactivity incorporated into the probe should be quantitated by measurement in a scintillation counter. Preferably, specific activity of the resulting probe should be approximately 4e+6 dpm/pmole.
The bacterial culture containing the pool of full-length clones should preferably be thawed and 100 Itl of the stock used to inoculate a sterile culture flask containing 25 ml 2 5 of sterile L-broth containing ampicillin at 100 ug/ml. The culture should preferably be grown to saturation at 37°C, and the saturated culture should preferably be diluted in fresh L-broth. Aliquots of these dilutions should preferably be plated to determine the dilution and volume which will yield approximately 5000 distinct and well-separated colonies on solid bacteriological media containing L-broth containing ampicillin at 100 3 0 ug/ml and agar at 1.5% in a 150 mm petri dish when grown overnight at 37°C. Other known methods of obtaining distinct, well-separated colonies can also be employed.
Standard colony hybridization procedures should then be used to transfer the colonies to nitrocellulose filters and lyse, denature and bake them.

The filter is then preferably incubated at 65°C for 1 hour with gentle agitation in 6X SSC (20X stock is 175.3 g NaCI / liter, 88.2 g Na citrate / liter, adjusted to pH 7.0 with NaOH) containing 0.5% SDS,100 flg/ml of yeast RNA, and 10 mM EDTA
(approximately mL per 150 mm filter). Preferably, the probe is then added to the hybridization mix at 5 a concentration greater than or equal to le+6 dpm/mL. The filter is then preferably incubated at 65°C with gentle agitation overnight. The filter is then preferably washed in 500 mL of 2X SSC/0.5% SDS at room temperature without agitation, preferably followed by 500 mL of 2X SSC/0.1% SDS at room temperature with gentle shaking for 15 minutes.
A third wash with 0.1X SSC/0.5% SDS at 65°C for 30 minutes to 1 hour is optional. The 10 filter is then preferably dried and subjected to autoradiography for sufficient time to visualize the positives on the X-ray film. Other known hybridization methods can also be employed.
The positive colonies are picked, grown in culture, and plasmid DNA isolated using standard procedures. The clones can then be verified by restriction analysis, 1 S hybridization analysis, or DNA sequencing.
Fragments of the proteins of the present invention which are capable of exhibiting biological activity are also encompassed by the present invention. Fragments of the protein may be in linear form or they may be cyclized using known methods, for example, as described in H.U. Saragovi, et al., Bio/Technology 10, 773-778 (1992) and in R.S.
2 0 McDowell, et al., J. Amer. Chem. Soc.114, 9245-9253 (1992), both of which are incorporated herein by reference. Such fragments may be fused to carrier molecules such as immunoglobulins for many purposes, including increasing the valence of protein binding sites. For example, fragments of the protein may be fused through "linker"
sequences to the Fc portion of an immunoglobulin. For a bivalent form of the protein) such a fusion 2 5 could be to the Fc portion of an IgG molecule. Other immunoglobulin isotypes may also be used to generate such fusions. For example, a protein - IgM fusion would generate a decavalent form of the protein of the invention.
The present invention also provides both full-length and mature forms of the disclosed proteins. The full-length form of the such proteins is identified in the sequence 3 0 listing by translation of the nucleotide sequence of each disclosed clone.
The mature form of such protein may be obtained by expression of the disclosed full-length polynucleotide (preferably those deposited with ATCC) in a suitable mammalian cell or other host cell.
The sequence of the mature form of the protein may also be determinable from the amino acid sequence of the full-length form.

The present invention also provides genes corresponding to the polynucleotide sequences disclosed herein. "Corresponding genes" are the regions of the genome that are transcribed to produce the mRNAs from which cDNA polynucleotide sequences are derived and may include contiguous regions of the genome necessary for the regulated expression of such genes. Corresponding genes may therefore include but are not limited to coding sequences, 5' and 3' untranslated regions, alternatively spliced exons, introns, promoters, enhancers, and silencer or suppressor elements. The corresponding genes can be isolated in accordance with known methods using the sequence information disclosed herein. Such methods include the preparation of probes or primers from the disclosed sequence information for identification and/or amplification of genes in appropriate genomic libraries or other sources of genomic materials. An "isolated gene" is a gene that has been separated from the adjacent coding sequences, if any, present in the genome of the organism from which the gene was isolated.
Organisms that have enhanced, reduced, or modified expression of the genes) corresponding to the polynucleotide sequences disclosed herein are provided.
The desired change in gene expression can be achieved through the use of antisense polynucleotides or ribozymes that bind and /or cleave the mRNA transcribed from the gene (Albert and Morris, 1994, Trends Pharmacol. Sci.15(7): 250-254; Lavarosky et al., 1997, Biochem. Mol. Med. 62(1): 11-22; and Hampel, 1998, Prog. Nucleic Acid Res.
Mol. Biol. 58: 1-2 0 39; all of which are incorporated by reference herein). Transgenic animals that have multiple copies of the genes) corresponding to the polynucleotide sequences disclosed herein, preferably produced by transformation of cells with genetic constructs that are stably maintained within the transformed cells and their progeny, are provided.
Transgenic animals that have modified genetic control regions that increase or reduce 2 5 gene expression levels, or that change temporal or spatial patterns of gene expression, are also provided (see European Patent No. 0 649 464 B1, incorporated by reference herein).
In addition, organisms are provided in which the genes) corresponding to the polynucleotide sequences disclosed herein have been partially or completely inactivated, through insertion of extraneous sequences into the corresponding genes) or through 3 0 deletion of all or part of the corresponding gene(s). Partial or complete gene inactivation can be accomplished through insertion, preferably followed by imprecise excision, of transposable elements (Plasterk,1992, Bioessays 14(9): 629-633; Zwaal et al.,1993) Proc. Natl.
Acad. Sci. USA 90(16): 7431-7435; Clark et al.,1994, Proc. Natl. Acad. Sci.
USA 91(2): 719-722;
all of which are incorporated by reference herein), or through homologous recombination, preferably detected by positive/negative genetic selection strategies (Mansour et al.,1988, Nature 336: 348-352; U.S. Patent Nos. 5,464,764; 5,487,992; 5,627,059;
5,631,153; 5,614, 396;
5,616,491; and 5,679,523; all of which are incorporated by reference herein).
These organisms with altered gene expression are preferably eukaryotes and more preferably are mammals. Such organisms are useful for the development of non-human models for the study of disorders involving the corresponding gene(s), and for the development of assay systems for the identification of molecules that interact with the protein products) of the corresponding gene(s).
Where the protein of the present invention is membrane-bound (e.g., is a receptor), the present invention also provides for soluble forms of such protein. In such forms part or all of the intracellular and transmembrane domains of the protein are deleted such that the protein is fully secreted from the cell in which it is expressed. The intracellular and transmembrane domains of proteins of the invention can be identified in accordance with known techniques for determination of such domains from sequence information.
Proteins and protein fragments of the present invention include proteins with amino acid sequence lengths that are at least 25%(more preferably at least 50°io) and most preferably at least 75%) of the length of a disclosed protein and have at least 60'%~ sequence identity (more preferably, at least 75% identity; most preferably at least 90%
or 95°~a identity) with that disclosed protein, where sequence identity is determined by comparing 2 0 the amino acid sequences of the proteins when aligned so as to maximize overlap and identity while minimizing sequence gaps. Also included in the present invention are proteins and protein fragments that contain a segment preferably comprising 8 or more (more preferably 20 or more, most preferably 30 or more) contiguous amino acids that shares at least 75% sequence identity (more preferably, at least 85°~~
identity; most 2 5 preferably at least 95'% identity) with any such segment of any of the disclosed proteins.
Species homologs of the disclosed polynucleotides and proteins are also provided by the present invention. As used herein, a "species homologue" is a protein or polynucleotide with a different species of origin from that of a given protein or polynucleotide, but with significant sequence similarity to the given protein or 3 0 polynucleotide, as determined by those of skill in the art. Species homologs may be isolated and identified by making suitable probes or primers from the sequences provided herein and screening a suitable nucleic acid source from the desired species.

The invention also encompasses allelic variants of the disclosed polynucleotides or proteins; that is, naturally-occurring alternative forms of the isolated polynucleotide which also encode proteins which are identical, homologous, or related to that encoded by the polynucleotides .
S The invention also includes polynucleotides with sequences complementary to those of the polynucleotides disclosed herein.
The present invention also includes polynucleotides capable of hybridizing under reduced stringency conditions, more preferably stringent conditions, and most preferably highly stringent conditions, to polynucleotides described herein. Examples of stringency conditions are shown in the table below: highly stringent conditions are those that are at least as stringent as, for example, conditions A-F; stringent conditions are at least as stringent as, for example, conditions G-L; and reduced stringency conditions are at least as stringent as, for example, conditions M-R.

StringencyPolynucleotideHybridHybridization TemperatureWash ConditionHybrid Lengthand Temperature (bp)$ Buffer' and Buffer' A DNA:DNA z 50 65C; lxSSC -or- 65C; 0.3xSSC
42C; lxSSC, 50% formamide B DNA:DNA <50 TB*; lxSSC TB*; lxSSC

C DNA:RNA s 50 67C; lxSSC -or- 67C; 0.3xSSC
45C; lxSSC, 50% formamide D DNA:RNA <50 T"*; lxSSC Tp*; lxSSC

E RNA:RNA z 50 70C; lxSSC-or- 70C; 0.3xSSC
50C; lxSSC) 50% formamide F RNA:RNA <50 T, *;1 xSSC TF*;1 xSSC

G DNA:DNA ~ 50 65C; 4xSSC -or- 65C; lxSSC
42C; 4xSSC, 50'%
formamide Fi DNA:DNA <50 T""; 4xSSC TH*; 4xSSC

1 DNA:RNA a 50 67C; 4xSSC -or- 67C; lxSSC
45C; 4xSSC, SO/ formamide J DNA:RNA <50 Ti'; 4xSSC T,*; 4xSSC

K RNA:RNA ~ 50 70C; 4xSSC -or- 67'C; lxSSC
50' C: 4xSSC, 50'7 formamide L RNA:RNA <50 T, *; 2xSSC T,'; 2xSSC

M DNA:DNA ~ 50 50'C; 4xSSC -err- 50C; 2xSSC
40C; 6xSSC, 50,~~
formamide N DNA:DNA <50 TN*; 6xSSC T~*; 6xSSC

O DNA:RNA ; 50 55C; 4xSSC -or- 55'C; 2xSSC
42C; 6xSSC) 50% formamide P DNA:RNA <50 T~*; 6xSSC T,.'; 6xSSC

Q RNA:RNA ~ 50 60C; 4xSSC -or- 60' C; 2xSSC
45C; 6xSSC) 50/ formamide 2 R RNA:RNA <SO TH'; 4xSSC TR*; 4xSSC

s: The hybrid length is that anticipated for the hybridized regions) of the hybridizing polynucleotides. When hybridizing a poiynucleotide to a target polynucleotide of unknown sequence, the hybrid length ~s assumed to be that of the hybridizing polynucleotide. When polynucleotides of known sequence are hybridized, the 2 5 hybrid length can be determined by aligning the sequences of the polynucleotides and identifying the region or regions of optimal sequence complementarity.
t: SSPE (lxSSPE is 0.15M NaCI, lOmM NaHZPO" and 1.25mM EDTA, pH 7.4) can be substituted for SSC
(lxSSC is O.15M NaCI and lSmM sodium citrate) in the hybridization and wash buffers; washes are performed for 15 minutes after hybridization is complete.
3 0 "TB - TR: The hybridization temperature for hybrids anticipated to be less than 50 base pairs in length should be 5-10°C less than the melting temperature (Tm) of the hybrid, where Tm is determined according to the following equations. For hybrids less than 18 base pairs in length, Tm(°C) = 2{# of A + T bases) + 4(# of G +
C bases). For hybrids between 18 and 49 base pairs in length, T,"(°C) =
81.5 + 16.6(log~a[Na']) + 0.41(%G+C) (600/N), where N is the number of bases in the hybrid) and (Naa] is the concentration of sodium ions in the 3 5 hybridization buffer ([Na'] for lxSSC = 0.165 M).

Additional examples of stringency conditions for polynucleotide hybridization are provided in Sambrook, J., E.F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, chapters 9 and 11, and Current Protocols in Molecular Biology,1995, F.M.
Ausubel et al., eds., John Wiley & Sons, Inc., sections 2.10 and 6.3-6.4, incorporated herein by reference.
Preferably, each such hybridizing polynucleotide has a length that is at least 25%(more preferably at least 50%, and most preferably at least 75%) of the length of the polynucleotide of the present invention to which it hybridizes, and has at least 60%
sequence identity (more preferably, at least 75% identity; most preferably at least 90% or 95% identity) with the polynucleotide of the present invention to which it hybridizes, where sequence identity is determined by comparing the sequences of the hybridizing polynucleotides when aligned so as to maximize overlap and identity while minimizing sequence gaps.
The isolated polynucleotide of the invention may be operably linked to an expression control sequence such as the pMT2 or pED expression vectors disclosed in Kaufman et al., Nucleic Acids Res. 19, 4485-4490 (1991), in order to produce the protein recombinantly. Many suitable expression control sequences are known in the art. General methods of expressing recombinant proteins are also known and are exemplified in R.
Kaufman, Methods in Enzymology 185, 537-566 (1990). As defined herein "operably 2 0 linked" means that the isolated polynucleotide of the invention and an expression control sequence are situated within a vector or cell in such a way that the protein is expressed by a host cell which has been transformed (transfected) with the ligated polynucleotide/expression control sequence.
A number of types of cells may act as suitable host cells for expression of the 2 5 protein. Mammalian host cells include, for example, monkey COS cells, Chinese Hamster Ovary (CHO) cells, human kidney 293 cells, human epidermal A431 cells, human Co1o205 cells, 3T3 cells, CV-1 cells, other transformed primate cell lines, normal diploid cells, cell strains derived from in vitro culture of primary tissue, primary explants, HeLa cells, mouse L cells, BHK, HL-60, U937, HaK or Jurkat cells.
3 0 Alternatively, it may be possible to produce the protein in lower eukaryotes such as yeast or in prokaryotes such as bacteria. Potentially suitable yeast strains include Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces strains, Candida, or any yeast strain capable of expressing heterologous proteins. Potentially suitable bacterial strains include Escherichia coli, Bacillus subtilis, Salmonella typhimurium, or any bacterial strain capable of expressing heterologous proteins. If the protein is made in yeast or bacteria, it may be necessary to modify the protein produced therein, for example by phosphorylation or glycosylation of the appropriate sites, in order to obtain the functional protein. Such covalent attachments may be accomplished using known chemical or enzymatic methods.
The protein may also be produced by operably linking the isolated polynucleotide of the invention to suitable control sequences in one or more insect expression vectors, and employing an insect expression system. Materials and methods for baculovirus/insect cell expression systems are commercially available in kit form from, e.g., Invitrogen, San Diego, California, U.S.A. (the MaxBac~ kit}, and such methods are well known in the art, as described in Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987)) incorporated herein by reference. As used herein, an insect cell capable of expressing a polynucleotide of the present invention is "transformed."
The protein of the invention may be prepared by culturing transformed host cells under culture conditions suitable to express the recombinant protein. The resulting expressed protein may then be purified from such culture (i.e., from culture medium or cell extracts) using known purification processes, such as gel filtration and ion exchange chromatography. The purification of the protein may also include an affinity column 2 0 containing agents which will bind to the protein; one or more column steps over such affinity resins as concanavalin A-agarose, heparin-toyopearl~ or Cibacrom blue Sepharose0; one or more steps involving hydrophobic interaction chromatography using such resins as phenyl ether, butyl ether, or propyl ether; or immunoaffinity chromatography.
2 5 Alternatively) the protein of the invention may also be expressed in a form which will facilitate purification. For example, it may be expressed as a fusion protein, such as those of maltose binding protein (MBP), glutathione-S-transferase (GST) or thioredoxin (TRX). Kits for expression and purification of such fusion proteins are commercially available from New England BioLab (Beverly, MA), Pharmacia (Piscataway, NJ) and 3 0 InVitrogen, respectively. The protein can also be tagged with an epitope and subsequently purified by using a specific antibody directed to such epitope.
One such ' epitope ("Flag") is commercially available from Kodak (New Haven, CT}.
Finally, one or more reverse-phase high performance liquid chromatography (RP-HPLC) steps employing hydrophobic RP-HPLC media, e.g., silica gel having pendant WO 98/30582 PCTIi3S98/00289 methyl or other aliphatic groups, can be employed to further purify the protein. Some or all of the foregoing purification steps, in various combinations, can also be employed to provide a substantially homogeneous isolated recombinant protein. The protein thus purified is substantially free of other mammalian proteins and is defined in accordance with the present invention as an "isolated protein."
The protein of the invention may also be expressed as a product of transgenic animals, e.g., as a component of the milk of transgenic cows, goats, pigs, or sheep which are characterized by somatic or germ cells containing a nucleotide sequence encoding the protein.
The protein may also be produced by known conventional chemical synthesis.
Methods for constructing the proteins of the present invention by synthetic means are known to those skilled in the art. The synthetically-constructed protein sequences, by virtue of sharing primary, secondary or tertiary structural and/or conformational characteristics with proteins may possess biological properties in common therewith, including protein activity. Thus, they may be employed as biologically active or immunological substitutes for natural, purified proteins in screening of therapeutic compounds and in immunological processes for the development of antibodies.
The proteins provided herein also include proteins characterized by amino acid sequences similar to those of purified proteins but into which modification are naturally 2 0 provided or deliberately engineered. For example, modifications in the peptide or DNA
sequences can be made by those skilled in the art using known techniques.
Modifications of interest in the protein sequences may include the alteration, substitution, replacement, insertion or deletion of a selected amino acid residue in the coding sequence.
For example, one or more of the cysteine residues may be deleted or replaced with another 2 5 amino acid to alter the conformation of the molecule. Techniques for such alteration, substitution, replacement, insertion or deletion are well known to those skilled in the art (see, e.g., U.S. Patent No. 4,518,584). Preferably, such alteration, substitution, replacement, insertion or deletion retains the desired activity of the protein.
Other fragments and derivatives of the sequences of proteins which would be 3 0 expected to retain protein activity in whole or in part and may thus be useful for screening or other immunological methodologies may also be easily made by those skilled in the art given the disclosures herein. Such modifications are believed to be encompassed by the present invention.

WO 98/3!1582 PCTII1S98/00289 USES AND BIOLOGICAL ACTIVITY
The polynucleotides and proteins of the present invention are expected to exhibit one or more of the uses or biological activities (including those associated with assays cited herein) identified below. Uses or activities described for proteins of the present invention may be provided by administration or use of such proteins or by administration or use of polynucleotides encoding such proteins (such as, for example, in gene therapies or vectors suitable for introduction of DNA).
Research Uses and Utilities The polynucleotides provided by the present invention can be used by the research community for various purposes. The polynucleotides can be used to express recombinant protein for analysis, characterization or therapeutic use; as markers for tissues in which the corresponding protein is preferentially expressed (either constitutively or at a particular stage of tissue differentiation or development or in disease states); as molecular weight markers on Southern gels; as chromosome markers or tags (when labeled) to identify chromosomes or to map related gene positions; to compare with endogenous DNA sequences in patients to identify potential genetic disorders; as probes to hybridize and thus discover novel, related DNA sequences; as a source of information to derive PCR primers for genetic fingerprinting; as a probe to "subtract-out"
2 0 known sequences in the process of discovering other novel polynucleotides;
for selecting and making oligomers for attachment to a "gene chip" or other support, including for examination of expression patterns; to raise anti-protein antibodies using DNA
immunization techniques; and as an antigen to raise and-DNA antibodies or elicit another immune response. Where the polynucleotide encodes a protein which binds or potentially 2 5 binds to another protein (such as, for example, in a receptor-ligand interaction), the polynucleotide can also be used in interaction trap assays (such as, for example, that described in Gyuris et al., Cell 75:791-803 (1993)) to identify polynucleotides encoding the other protein with which binding occurs or to identify inhibitors of the binding interaction.
3 0 The proteins provided by the present invention can similarly be used in assay to determine biological activity, including in a panel of multiple proteins for high-throughput screening; to raise antibodies or to elicit another immune response; as a reagent (including the labeled reagent) in assays designed to quantitatively determine levels of the protein (or its receptor) in biological fluids; as markers for tissues in which the corresponding protein is preferentially expressed (either constitutively or at a particular stage of tissue differentiation or development or in a disease state); and, of course, to isolate correlative receptors or ligands. Where the protein binds or potentially binds to another protein (such as, for example, in a receptor-ligand interaction), the protein can be used to identify the other protein with which binding occurs or to identify inhibitors of the binding interaction. Proteins involved in these binding interactions can also be used to screen for peptide or small molecule inhibitors or agonists of the binding interaction.
Any or all of these research utilities are capable of being developed into reagent grade or kit format for commercialization as research products.
Methods for performing the uses listed above are well known to those skilled in the art. References disclosing such methods include without limitation "Molecular Cloning: A Laboratory Manual", 2d ed., Cold Spring Harbor Laboratory Press, Sambrook, J., E.F. Fritsch and T. Maniatis eds., 1989, and "Methods in Enzymology: Guide to Molecular Cloning Techniques", Academic Press, Berger, S.L, and A.R. Kimmel eds.,1987.
Nutritional Uses Polynucleotides and proteins of the present invention can also be used as nutritional sources or supplements. Such uses include without limitation use as a protein 2 0 or amino acid supplement, use as a carbon source, use as a nitrogen source and use as a source of carbohydrate. In such cases the protein or polynucleotide of the invention can be added to the feed of a particular organism or can be administered as a separate solid or liquid preparation, such as in the form of powder, pills, solutions, suspensions or capsules. In the case of microorganisms, the protein or polynucleotide of the invention 2 5 can be added to the medium in or on which the microorganism is cultured.
C~okine and Cell Proliferation/Differentiation Activity A protein of the present invention may exhibit cytokine, cell proliferation (either inducing or inhibiting) or cell differentiation (either inducing or inhibiting) activity or may 3 0 induce production of other cytokines in certain cell populations. Many protein factors discovered to date, including all known cytokines, have exhibited activity in one or more factor dependent cell proliferation assays, and hence the assays serve as a convenient confirmation of cytokine activity. The activity of a protein of the present invention is evidenced by any one of a number of routine factor dependent cell proliferation assays for cell lines including, without limitation, 32D, DA2, DA1G, T10, B9, B9/11, BaF3, MC9/G, M+ (preB M+), 2E8, RBS, DAl,123, T1165, HT2, CTLL2, TF-1, Mo7e and CMK.
The activity of a protein of the invention may, among other means, be measured by the following methods:
Assays for T-cell or thymocyte proliferation include without limitation those described in: Current Protocols in Immunology, Ed by J. E. Coligan, A.M.
Kruisbeek, D.H.
Margulies, E.M. Shevach, W Strober, Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function 3.1-3.19; Chapter 7, Immunologic studies in Humans); Takai et al., J. Immunol. 137:3494-3500, 1986;
Bertagnolli et al., J. Immunol.145:1706-1712, 1990; Bertagnolli et al., Cellular Immunology 133:327-341, 1991; Bertagnolli, et al., J. Immunol. 149:3778-3783, 1992;
Bowman et al., J.
Immunol. 152: 1756-1761, 1994.
Assays for cytokine production and /or proliferation of spleen cells, lymph node cells or thymocytes include, without limitation, those described in:
Polyclonal T cell stimulation, Kruisbeek, A.M. and Shevach, E.M. In Current Protocols in Immunology. J.E.e.a.
Coligan eds. Vol 1 pp. 3.12.1-3.12.14, John Wiley and Sons, Toronto. 1994; and Measurement of mouse and human Interferon y, Schreiber, R.D. In Current Protocols in Imnrunolog~~. J.E.e.a. Coligan eds. Vol 1 pp. 6.8.1-6.8.8, John Wiley and Sons, Toronto. 1994.
2 0 Assays for proliferation and differentiation of hematopoieHc and lymphopoietic cells include, without limitation, those described in: Measurement of Human and Murine Interleukin 2 and Interleukin 4, Bottomly, K., Davis, L.S. and Lipsky, P.E. In Current Protocols in Immunology. J.E.e.a. Coligan eds. Vol 1 pp. 6.3.1-6.3.12, John Wiley and Sons, Toronto. 1991; deVries et al., J. Exp. Med. 173:1205-1211, 1991; Moreau et al., Nature 2 5 336:690-692) 1988; Greenberger et al., Proc. Natl. Acad. Sci. U.S.A.
80:2931-2938, 1983;
Measurement of mouse and human interleukin 6 - Nordan, R. In Crrrrent Protocols irr Immunology. J.E.e.a. Coligan eds. Vol 1 pp. 6.6.1-6.6.5, John Wiley and Sons, Toronto. 1991;
Smith et al.) Proc. Natl. Acad. Sci. U.S.A. 83:1857-1861, 1986; Measurement of human Interleukin 11 - Bennett, F., Giannotti, J., Clark, S.C. and Turner, K. J. In Current Protocols 3 0 in Immunology. J.E.e.a. Coligan eds. Vol 1 pp. 6.15.1 John Wiley and Sons, Toronto. 1991;
Measurement of mouse and human Interleukin 9 - Ciarletta, A., Giannotti, J., Clark, S.C.
and Turner, K.J. In Current Protocols in Immunology. J.E.e.a. Coligan eds. Vol 1 pp. 6.13.1, John Wiley and Sons, Toronto. 1991.

Assays for T-cell clone responses to antigens (which will identify, among others, proteins that affect APC-T cell interactions as well as direct T-cell effects by measuring proliferation and cytokine production) include, without limitation, those described in:
Current Protocols in Immunology, Ed by J. E. Coligan, A.M. Kruisbeek, D.H.
Margulies, E.M. Shevach, W Strober, Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function; Chapter 6, Cytokines and their cellular receptors; Chapter 7, Immunologic studies in Humans);
Weinberger et al., Proc. Natl. Acad. Sci. USA 77:6091-6095, 1980; Weinberger et al., Eur. J.
Immun.

11:405-411, 1981; Takai et al., J. Immunol. 137:3494-3500, 1986; Takai et al., ). Immunol.
140:508-512, 1988.
Immune Stimulating or Sup_pressin~ Activity A protein of the present invention may also exhibit immune stimulating or immune suppressing activity, including without limitation the activities for which assays are described herein. A protein may be useful in the treatment of various immune deficiencies and disorders (including severe combined immunode6ciency (SCID)), e.g., in regulating (up or down) growth and proliferation of T and/or B lymphocytes, as well as effecting the cytolytic activity of NK cells and other cell populations.
These immune deficiencies may be genetic or be caused by viral (e.g., HIV ) as well as bacterial or fungal 2 0 infections, or may result from autoimmune disorders. More specifically) infectious diseases causes by viral, bacterial, fungal or other infection may be treatable using a protein of the present invention, including infections by HIV, hepatitis viruses, herpesviruses, mycobacteria, Leishmania spp,, malaria spp. and various fungal infections such as candidiasis. Of course, in this regard, a protein of the present invention may also 2 5 be useful where a boost to the immune system generally may be desirable, i.e., in the treatment of cancer.
Autoimmune disorders which may be treated using a protein of the present invention include, for example, connective tissue disease, multiple sclerosis, systemic lupus erythematosus, rheumatoid arthritis, autoimmune pulmonary inflammation, 3 0 Guillain-Barre syndrome, autoimmune thyroiditis, insulin dependent diabetes mellitis, myasthenia gravis, graft-versus-host disease and autoimmune inflammatory eye disease.
Such a protein of the present invention may also to be useful in the treatment of allergic reactions and conditions, such as asthma (parricularly allergic asthma) or other respiratory problems. Other conditions, in which immune suppression is desired (including, for example, organ transplantation), may also be treatable using a protein of the present invention.
Using the proteins of the invention it may also be possible to immune responses, in a number of ways. Down regulation may be in the form of inhibiting or blocking an immune response already in progress or may involve preventing the induction of an immune response. The functions of activated T cells may be inhibited by suppressing T
cell responses or by inducing specific tolerance in T cells, or both.
Immunosuppression of T cell responses is generally an active, non-antigen-specific, process which requires continuous exposure of the T cells to the suppressive agent. Tolerance, which involves inducing non-responsiveness or anergy in T cells, is distinguishable from immunosuppression in that it is generally antigen-specific and persists after exposure to the tolerizing agent has ceased. Operationally, tolerance can be demonstrated by the lack of a T cell response upon reexposure to specific antigen in the absence of the tolerizing agent.
Down regulating or preventing one or more antigen functions (including without limitation B lymphocyte antigen functions (such as , for example, B7)), e.g., preventing high level lymphokine synthesis by activated T cells, will be useful in situations of tissue, skin and organ transplantation and in graft-versus-host disease (GVHD). For example, blockage of T cell function should result in reduced tissue destruction in tissue 2 0 transplantation. Typically, in tissue transplants, rejection of the transplant is initiated through its recognition as foreign by T cells, followed by an immune reaction that destroys the transplant. The administration of a molecule which inhibits or blocks interaction of a B7 lymphocyte antigen with its natural ligand(s) on immune cells (such as a soluble, monomeric form of a peptide having B7-2 activity alone or in conjunction with a 2 5 monomeric form of a peptide having an activity of another B lymphocyte antigen (c.~., B7-1, B7-3) or blocking antibody), prior to transplantation can lead to the binding of the molecule to the natural ligand(s) on the immune cells without transmitting the corresponding costimulatory signal. Blocking B lymphocyte antigen function in this matter prevents cytokine synthesis by immune cells, such as T cells, and thus acts as an 3 0 immunosuppressant. Moreover, the lack of costimulation may also be sufficient to anergize the T cells, thereby inducing tolerance in a subject. Induction of long-term tolerance by B lymphocyte antigen-blocking reagents may avoid the necessity of repeated administration of these blocking reagents. To achieve sufficient immunosuppression or tolerance in a subject, it may also be necessary to block the function of a combination of B lymphocyte antigens.
The efficacy of particular blocking reagents in preventing organ transplant rejection or GVHD can be assessed using animal models that are predictive of efficacy in humans. Examples of appropriate systems which can be used include allogeneic cardiac grafts in rats and xenogeneic pancreatic islet cell grafts in mice, both of which have been used to examine the immunosuppressive effects of CTLA4Ig fusion proteins in vivo as described in Lenschow ef al., Science 257:789-792 (1992) and Turka et al., Proc. Natl. Acad.
Sci USA, 89:11102-11105 (1992). In addition, marine models of GVHD (see Paul ed., Fundamental Immunology, Raven Press, New York, 1989, pp. 846-847) can be used to determine the effect of blocking B lymphocyte antigen function in vivo on the development of that disease.
Blocking antigen function may also be therapeutically useful for treating autoimmune diseases. Many autoimmune disorders are the result of inappropriate activation of T cells that are reactive against self tissue and which promote the production of cytokines and autoantibodies involved in the pathology of the diseases.
Preventing the activation of autoreactive T cells may reduce or eliminate disease symptoms.
Administration of reagents which block costimulation of T cells by disrupting receptor:ligand interactions of B lymphocyte antigens can be used to inhibit T
cell 2 0 activation and prevent production of autoantibodies or T cell-derived cytokines which may be involved in the disease process. Additionally, blocking reagents may induce antigen-specific tolerance of autoreactive T cells which could lead to long-term relief from the disease. The efficacy of blocking reagents in preventing or alleviating autoimmune disorders can be determined using a number of well-characterized animal models of 2 5 human autoimmune diseases. Examples include marine experimental autoimmune encephalitis, systemic lupus erythmatosis in MRL/Ipr/Ipr mice or NZB hybrid mice) marine autoimmune collagen arthritis, diabetes mellitus in NOD mice and BB
rats, and marine experimental myasthenia gravis (see Paul ed., Fundamental Immunology, Raven Press, New York,1989, pp. 840-856).
3 0 Upregulation of an antigen function (preferably a B lymphocyte antigen function), as a means of up regulating immune responses, may also be useful in therapy.
Upregulation of immune responses may be in the form of enhancing an existing immune response or eliciting an initial immune response. For example, enhancing an immune response through stimulating B lymphocyte antigen function may be useful in cases of viral infection. In addition, systemic viral diseases such as influenza, the common cold, and encephalitis might be alleviated by the administration of stimulatory forms of B
lymphocyte antigens systemically.
Alternatively, anti-viral immune responses may be enhanced in an infected patient by removing T cells from the patient, costimulating the T cells in vitro with viral antigen-pulsed APCs either expressing a peptide of the present invention or together with a stimulatory form of a soluble peptide of the present invention and reintroducing the in vitro activated T cells into the patient. Another method of enhancing anti-viral immune responses would be to isolate infected cells from a patient, transfect them with a nucleic acid encoding a protein of the present invention as described herein such that the cells express all or a portion of the protein on their surface, and reintroduce the transfected cells into the patient. The infected cells would now be capable of delivering a costimulatory signal to, and thereby activate) T cells in vivo.
In another application, up regulation or enhancement of antigen function (preferably B lymphocyte antigen function) may be useful in the induction of tumor immunity. Tumor cells (e.g., sarcoma, melanoma, lymphoma, leukemia, neuroblastoma, carcinoma) transfected with a nucleic acid encoding at least one peptide of the present invention can be administered to a subject to overcome tumor-specific tolerance in the subject. If desired, the tumor cell can be transfected to express a combination of peptides.
2 0 For example, tumor cells obtained from a patient can be transfected ex vivn with an expression vector directing the expression of a peptide having B7-2-like activity alone, or in conjunction with a peptide having B7-1-like activity and/or B7-3-like activity. The transfected tumor cells are returned to the patient to result in expression of the peptides on the surface of the transfected cell. Alternatively, gene therapy techniques can be used 2 5 to target a tumor cell for transfection in vivo.
The presence of the peptide of the present invention having the activity of a B
lymphocyte antigens) on the surface of the tumor cell provides the necessary costimulation signal to T cells to induce a T cell mediated immune response against the transfected tumor cells. In addition, tumor cells which lack MHC class I or MHC class II
3 0 molecules, or which fail to reexpress sufficient amounts of MHC class I or MHC class II
molecules, can be transfected with nucleic acid encoding all or a portion of (e.g., a cytoplasmic-domain truncated portion) of an MHC class I a chain protein and (32 microglobulin protein or an MHC class II a chain protein and an MHC class II
~i chain protein to thereby express MHC class I or MHC class II proteins on the cell surface.

Expression of the appropriate class I or class II MHC in conjunction with a peptide having the activity of a B lymphocyte antigen (e.g., B7-1, B7-2, B7-3) induces a T
cell mediated immune response against the transfected tumor cell. Optionally, a gene encoding an antisense construct which blocks expression of an MHC class II associated protein, such as the invariant chain, can also be cotransfected with a DNA encoding a peptide having the activity of a B lymphocyte antigen to promote presentation of tumor associated antigens and induce tumor specific immunity. Thus, the induction of a T cell mediated immune response in a human subject may be sufficient to overcome tumor-specific tolerance in the subject.
The activity of a protein of the invention may, among other means, be measured by the following methods:
Suitable assays for thymocyte or splenocyte cytotoxicity include, without limitation, those described in: Current Protocols in Immunology, Ed by J. E.
Coligan, A.M.
Kruisbeek, D.H. Margulies, E.M. Shevach, W Strober, Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function 3.1-3.19; Chapter 7, Immunologic studies in Humans); Herrmann et al., Proc. Natl.
Acad. Sci.
USA 78:2488-2492, 1981; Herrmann et al., J. Immunol. 128:1968-1974) 1982;
Handa et al., J. Immunol. 135:1564-1572,1985; Takai et al., J. Immunol. 137:3494-3500, 1986;
Takai et al., J. Immunol. 140:508-512, 1988; Herrmann et al., Proc. Natl. Acad. Sci. USA
78:2488-2492, 2 0 1981; Herrmann et al., J. Immunol. 128:1968-1974, 1982; Handa et al., J.
Immunol.
135:1564-1572, 1985; Takai et al., J. Immunol. 137:3494-3500, 1986; Bowmanet al., ].
Virology 61:1992-1998; Takai et al., J. Immunol. 140:508-512, 1988;
Bertagnolli et al., Cellular Immunology 133:327-341, 1991; Brown et al., J. Immunol. 153:3079-3092) 1994.
Assays for T-cell-dependent immunoglobulin responses and isotype switching 2 5 (which will identify, among others, proteins that modulate T-cell dependent antibody responses and that affect Thl /Th2 profiles) include, without limitation, those described in: Maliszewski, J. Immunol. 144:3028-3033, 1990; and Assays for B cell function: ht vitro antibody production, Mond, J.J. and Brunswick, M. In Current Protocols in Immunology.
j.E.e.a. Coligan eds. Vol 1 pp. 3.8.1-3.8.16, John Wiley and Sons, Toronto.
1994.
3 0 Mixed lymphocyte reaction (MLR) assays (which will identify, among others, proteins that generate predominantly Th1 and CTL responses) include, without limitation, those described in: Current Protocols in Immunology, Ed by J. E. Coligan, A.M.
Kruisbeek, D.H. Margulies, E.M. Shevach, W Strober, Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function 3.1-3.19; Chapter 7, Immunologic studies in Humans); Takai et al., J. Immunol. 137:3494-3500,1986; Takai et al., J. Immunol. 140:508-512, 1988; Bertagnolli et al., J. Immunol.
149:3778-3783, 1992.
Dendritic cell-dependent assays (which will identify, among others, proteins expressed by dendritic cells that activate naive T-cells) include, without limitation, those S described in: Guery et al., J. Immunol. 134:536-544, 1995; Inaba et al., Journal of Experimental Medicine 173:549-559, 1991; Macatonia et al., Journal of Immunology 154:5071-5079,1995; Porgador et al., Journal of Experimental Medicine 182:255-260,1995;
Nair et al., Journal of Virology 67:4062-4069, 1993; Huang et al., Science 264:961-965, 1994; Macatonia et al., Journal of Experimental Medicine 169:1255-12b4, 1989;
Bhardwaj et al., Journal of Clinical Investigation 94:797-807, 1994; and Inaba et al., Journal of Experimental Medicine 172:631-640, 1990.
Assays for lymphocyte survival/apoptosis (which will identify, among others, proteins that prevent apoptosis after superantigen induction and proteins that regulate lymphocyte homeostasis) include, without limitation, those described in:
Darzynkiewicz et al., Cytometry 13:795-808,1992; Gorczyca et al., Leukemia 7:659-670, 1993;
Gorczyca et al., Cancer Research 53:1945-1951, 1993; ltoh et al., Cell 66:233-243, 1991;
Zacharchuk, journal of Immunology 145:4037-4045, 1990; Zamai et al., Cytometry 14:891-897, 1993;
Gorczyca et al., International Journal of Oncology 1:639-648, 1992.
Assays for proteins that influence early steps of T-cell commitment and 2 0 development include, without limitation, those described in: Antica et al.) Blood 84:111-117, 1994; Fine et al., Cellular Immunology 155:111-I22, 1994; Galy et al., Blood 85:2770-2778) 1995; Toki et al., Proc. Nat. Acad Sci. USA 88:7548-7551, 1991.
Hematopoiesis Regulating Activity 2 5 A protein of the present invention may be useful in regulation of hematopoiesis and, consequently, in the treatment of myeloid or lymphoid cell deficiencies.
Even marginal biological activity in support of colony forming cells or of factor-dependent cell lines indicates involvement in regulating hematopoiesis, e.g. in supporting the growth and proliferation of erythroid progenitor cells alone or in combination with other cytokines, 3 0 thereby indicating utility, for example, in treating various anemias or for use in conjunction with irradiation/chemotherapy to stimulate the production of erythroid precursors and / or erythroid cells; in supporting the growth and proliferation of myeloid cells such as granulocytes and monocytes/macrophages (i.e., traditional CSF
activity) useful, for example, in conjunction with chemotherapy to prevent or treat consequent myelo-suppression; in supporting the growth and proliferation of megakaryocytes and consequently of platelets thereby allowing prevention or treatment of various platelet disorders such as thrombocytoperua, and generally for use in place of or complimentary to platelet transfusions; and/or in supporting the growth and proliferation of hematopoietic stem cells which are capable of maturing to any and all of the above-mentioned hematopoietic cells and therefore find therapeutic utility in various stem cell disorders (such as those usually treated with transplantation, including, without limitation, aplastic anemia and paroxysmal nocturnal hemoglobinuria), as well as in repopulating the stem cell compartment post irradiation/chemotherapy, either in-vivo or ex-vivn (i.e., in conjunction with bone marrow transplantation or with peripheral progenitor cell transplantation {homologous or heterologous)) as normal cells or genetically manipulated for gene therapy.
The activity of a protein of the invention may, among other means, be measured by the following methods:
Suitable assays for proliferation and differentiation of various hematopoietic lines are cited above.
Assays for embryonic stem cell differentiation (which will identify, among others, proteins that influence embryonic differentiation hematopoiesis) include) without limitation, those described in: Johansson et al. Cellular Biology 15:141-151, 1995; Keller et 2 0 al.) Molecular and Cellular Biology 13:473-486, 1993; McClanahan et al., Blood 81:2903-2915, 1993.
Assays for stem cell survival and differentiation {which will identify, among others, proteins that regulate lympho-hematopoiesis) include, without limitation, those described in: Methylcellulose colony forming assays, Freshney, M.G. In Culture of 2 5 Hematopoietic Celts. R.I. Freshney, et aI. eds. Vol pp. 265-268, Wiley-Liss) lnc., New York, NY. 1994; Hirayama et al., Proc. Natl. Acad. Sci. USA 89:5907-5911, 1992;
Primitive hematopoietic colony forming cells with high proliferative potential, McNiece, LK. and Briddell, R.A. In Culture of Hematopoietic Cells. R.I. Freshney, et a1. eds.
Vol pp. 23-39) Wiley-Liss, Inc., New York, NY.1994; Neben et al., Experimental Hematology 22:353-359, 3 0 1994; Cobblestone area forming cell assay, Ploemacher, R.E. In Culture of Hematopoietic Cells. R.I. Freshney, et al. eds. Vol pp. 1-21, Wiley-Liss, Inc.., New York, NY. 1994; Long term bone marrow cultures in the presence of stromal cells, Spooncer, E., Dexter, M. and Allen, T. In Culture of Hematopoietic Cells. R.I. Freshney, et al. eds. Vol pp. 163-179, Wiley-Liss, Inc., New York, NY. 1994; Long term culture initiating cell assay, Sutherland, H.J. In Culture of Hematopoietic Cells. R.I. Freshney, et al. eds. Vol pp. 139-162, Wiley-Liss, Inc., New York, NY. 1994.
Tissue Growth Activity A protein of the present invention also may have utility in compositions used for bone, cartilage, tendon, ligament and/or nerve tissue growth or regeneration, as well as for wound healing and tissue repair and replacement, and in the treatment of burns, incisions and ulcers.
A protein of the present invention, which induces cartilage and / or bone growth in circumstances where bone is not normally formed, has application in the healing of bone fractures and cartilage damage or defects in humans and other animals.
Such a preparation employing a protein of the invention may have prophylactic use in closed as well as open fracture reduction and also in the improved fixation of artificial joints. De novo bone formation induced by an osteogenic agent contributes to the repair of congenital, trauma induced, or oncologic resection induced craniofacial defects, and also is useful in cosmetic plastic surgery.
A protein of this invention may also be used in the treatment of periodontal disease, and in other tooth repair processes. Such agents may provide an environment to attract bone-forming cells, stimulate growth of bone-forming cells or induce 2 0 differentiation of progenitors of bone-forming cells. A protein of the invention may also be useful in the treatment of osteoporosis or osteoarthritis, such as through stimulation of bone and/or cartilage repair or by blocking inflammation or processes of tissue destruction (collagenase activity, osteoclast activity, etc.) mediated by inflammatory processes.
2 5 Another category of tissue regenerarion activity that may be attributable to the protein of the present invention is tendon/ligament formation. A protein of the present invention, which induces tendon/ligament-like tissue or other tissue formation in circumstances where such tissue is not normally formed, has application in the healing of tendon or ligament tears, deformities and other tendon or ligament defects in humans and 3 0 other animals. Such a preparation employing a tendon/ligament-like tissue inducing protein may have prophylactic use in preventing damage to tendon or ligament tissue, as well as use in the improved fixation of tendon or ligament to bone or other tissues, and in repairing defects to tendon or ligament tissue. De novo tendon/ligament-like tissue formation induced by a composition of the present invention contributes to the repair of congenital, trauma induced, or other tendon or ligament defects of other origin, and is also useful in cosmetic plastic surgery for attachment or repair of tendons or ligaments. The compositions of the present invention may provide an environment to attract tendon- or ligament-forming cells, stimulate growth of tendon- or ligament-forming cells, induce differentiation of progenitors of tendon- or ligament-forming cells, or induce growth of tendon/ligament cells or progenitors ex vivo for return in vivo to effect tissue repair. The compositions of the invention may also be useful in the treatment of tendinitis, carpal tunnel syndrome and other tendon or ligament defects. The compositions may also include an appropriate matrix and/or sequestering agent as a carrier as is well known in the art.
The protein of the present invention may also be useful for proliferation of neural cells and for regeneration of nerve and brain tissue, i.e. for the treatment of central and peripheral nervous system diseases and neuropathies, as well as mechanical and traumatic disorders, which involve degeneration) death or trauma to neural cells or nerve tissue. More specifically, a protein may be used in the treatment of diseases of the peripheral nervous system, such as peripheral nerve injuries, peripheral neuropathy and localized neuropathies, and central nervous system diseases, such as Alzheimer's, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and Shy-Drager syndrome. Further conditions which may be treated in accordance with the present 2 0 invention include mechanical and traumatic disorders, such as spinal cord disorders, head trauma and cerebrovascular diseases such as stroke. Peripheral neuropathies resulting from chemotherapy or other medical therapies may also be treatable using a protein of the invention.
Proteins of the invention may also be useful to promote better or faster closure of 2 5 non-healing wounds, including without limitation pressure ulcers) ulcers associated with vascular insufficiency, surgical and traumatic wounds, and the like.
It is expected that a protein of the present invention may also exhibit activity for generation or regeneration of other tissues, such as organs (including, for example, pancreas, liver, intestine, kidney, skin, endothelium), muscle (smooth, skeletal or cardiac) 3 0 and vascular (including vascular endothelium) tissue, or for promoting the growth of cells comprising such tissues. Part of the desired effects may be by inhibition or modulation of fibrotic scarring to allow normal tissue to regenerate. A protein of the invention may also exhibit angiogenic activity.

WO 98/30552 PCTlUS98100289 A protein of the present invention may also be useful for gut protection or regeneration and treatment of lung or liver fibrosis, reperfusion injury in various tissues, and conditions resulting from systemic cytokine damage.
A protein of the present invention may also be useful for promoting or inhibiting differentiation of tissues described above from precursor tissues or cells; or for inhibiting the growth of tissues described above.
The activity of a protein of the invention may, among other means, be measured by the following methods:
Assays for tissue generation activity include, without limitation, those described in: International Patent Publication No. W095 / 16035 (bone, cartilage, tendon);
International Patent Publication No. W095/05846 (nerve, neuronal);
International Patent Publication No. W091 /07491 (skin, endothelium ).
Assays for wound healing activity include, without limitation, those described in:
Winter, Epidermal Wound Healing, pps. 71-112 (Maibach, HI and Rovee, DT, eds.), Year Book Medical Publishers, Inc., Chicago, as modified by Eaglstein and Mertz, J.
Invest.
Dermatol 71:382-84 (1978).
Activin/Inhibin Activity A protein of the present invention may also exhibit activin- or inhibin-related 2 0 activities. Inhibins are characterized by their ability to inhibit the release of follicle stimulating hormone (FSH), while activins and are characterized by their ability to stimulate the release of follicle stimulating hormone (FSH). Thus, a protein of the present invention, alone or in heterodimers with a member of the inhibin a family, may be useful as a contraceptive based on the ability of inhibins to decrease fertility in female mammals 2 5 and decrease spermatogenesis in male mammals. Administration of sufficient amounts of other inhibins can induce infertility in these mammals. Alternatively) the protein of the invention, as a homodimer or as a heterodimer with other protein subunits of the inhibin-(3 group, may be useful as a fertility inducing therapeutic, based upon the ability of activin molecules in stimulating FSH release from cells of the anterior pituitary.
See, for example, 3 0 United States Patent 4,798,885. A protein of the invention may also be useful for advancement of the onset of fertility in sexually immature mammals, so as to increase the lifetime reproductive performance of domestic animals such as cows, sheep and pigs.
The activity of a protein of the invention may, among other means, be measured by the following methods:

Assays for activin/inhibin activity include, without limitation, those described in:
Vale et al., Endocrinology 91:562-572, 1972; Ling et al., Nature 321:779-782,1986; Vale et al., Nature 321:776-779,1986; Mason et al., Nature 318:659-663, 1985; Forage et al., Proc.
Natl. Acad. Sci. USA 83:3091-3095,1986.
Chemotactic/Chemokinetic Activity A protein of the present invention may have chemotactic or chemokinetic activity (e.g., act as a chemokine) for mammalian cells, including, for example, monocytes, fibroblasts, neutrophils, T-cells, mast cells, eosinophils, epithelial and/or endothelial cells.
Chemotactic and chemokinetic proteins can be used to mobilize or attract a desired cell population to a desired site of action. Chemotactic or chemokinetic proteins provide particular advantages in treatment of wounds and other trauma to tissues, as well as in treatment of localized infections. For example, attraction of lymphocytes, monocytes or neutrophils to tumors or sites of infection may result in improved immune responses against the tumor or infecting agent.
A protein or peptide has chemotactic activity for a particular cell population if it can stimulate, directly or indirectly, the directed orientation or movement of such cell population. Preferably, the protein or peptide has the ability to directly stimulate directed movement of cells. Whether a particular protein has chemotactic activity for a population 2 0 of cells can be readily determined by employing such protein or peptide in any known assay for cell chemotaxis.
The activity of a protein of the invention may, among other means, be measured by the following methods:
Assays for chemotactic activity (which will identify proteins that induce or prevent 2 5 chemotaxis) consist of assays that measure the ability of a protein to induce the migration of cells across a membrane as well as the ability of a protein to induce the adhesion of one cell population to another cell population. Suitable assays for movement and adhesion include, without limitation, those described in: Current Protocols in Immunology, Ed by J.E. Coligan, A.M. Kruisbeek, D.H. Margulies, E.M. Shevach, W.Strober, Pub.
Greene 3 0 Publishing Associates and Wiley-Interscience (Chapter 6.12, Measurement of alpha and beta Chemokines 6.12.1-6.12.28; Taub et al. J. Clin. Invest. 95:1370-1376) 1995; Lind et al.
APMIS 103:140-146, 1995; Muller et al Eur. J. Immunol. 25: 1744-1748; Gruber et al. J. of Immunol. 152:5860-5867,1994; Johnston et al. J. of Immunol. 153: 1762-1768, 1994.

WO 98!30582 PCTIUS98/00289 Hemostatic and Thrombol~tic Activity A protein of the invention may also exhibit hemostatic or thrombolytic activity.
As a result, such a protein is expected to be useful in treatment of various coagulation disorders {including hereditary disorders, such as hemophilias) or to enhance coagulation and other hemostatic events in treating wounds resulting from trauma, surgery or other causes. A protein of the invention may also be useful for dissolving or inhibiting formation of thromboses and for treatment and prevention of conditions resulting therefrom (such as, for example, infarction of cardiac and central nervous system vessels (e.g., stroke).
The activity of a protein of the invention may, among other means, be measured by the following methods:
Assay for hemostatic and thrombolytic activity include, without limitation, those described in: Linet et al.) J. Clin. Pharmacol. 26:131-140, 1986; Burdick et al., Thrombosis Res. 45:413-419,1987; Humphrey et al., Fibrinolysis 5:71-79 (1991 ); Schaub, Prostaglandins 35:467-474,1988.
Rece~tor/Ligand Activity A protein of the present invention may also demonstrate activity as receptors) receptor ligands or inhibitors or agonists of receptor/ligand interactions.
Examples of 2 0 such receptors and ligands include) without limitation, cytokine receptors and their ligands, receptor kinases and their ligands, receptor phosphatases and their ligands, receptors involved in cell-cell interactions and their ligands (including without limitation, cellular adhesion molecules (such as selectins, integrins and their ligands) and receptor/ligand pairs involved in antigen presentation, antigen recognition and 2 5 development of cellular and humoral immune responses). Receptors and ligands are also useful for screening of potential peptide or small molecule inhibitors of the relevant receptor/ligand interaction. A protein of the present invention (including, without limitation, fragments of receptors and ligands) may themselves be useful as inhibitors of receptor/ligand interactions.
3 0 The activity of a protein of the invention may, among other means, be measured by the following methods:
Suitable assays for receptor-ligand activity include without limitation those described in:Current Protocols in Immunology, Ed by J.E. Coligan, A.M.
Kruisbeek, D.H.
Margulies, E.M. Shevach, W.Strober, Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 7.28, Measurement of Cellular Adhesion under static conditions 7.28.1-7.28.22), Takai et al., Proc. Natl. Acad. Sci. USA 84:6864-6868, 1987;
Bierer et al., J. Exp. Med.168:1145-1156, 1988; Rosenstein et al., J. Exp.
Med.169:149-160 1989; Stoltenborg et al., J. Immunol. Methods 175:59-68, 1994; Stitt et al., Cell 80:661-670, 2995.
Anti-Inflammatory Activity Proteins of the present invention may also exhibit anti-inflammatory activity.
The anti-inflammatory activity may be achieved by providing a stimulus to cells involved in the inflammatory response, by inhibiting or promoting cell-cell interactions (such as, for example, cell adhesion), by inhibiting or promoting chemotaxis of cells involved in the inflammatory process, inhibiting or promoting cell extravasation, or by stimulating or suppressing production of other factors which more directly inhibit or promote an inflammatory response. Proteins exhibiting such activities can be used to treat inflammatory conditions including chronic or acute conditions), including without limitation inflammation associated with infection (such as septic shock) sepsis or systemic inflammatory response syndrome (SIRS)), ischemia-reperfusion injury, endotoxin lethality, arthritis, complement-mediated hyperacute rejection, nephritis) cytokine or chemokine-induced lung injury, inflammatory bowel disease, Crohn's disease or resulting 2 0 from over production of cytokines such as TNF or IL-1. Proteins of the invention may also be useful to treat anaphylaxis and hypersensitivity to an antigenic substance or material.
Cadherin/Tumor Invasion Suppressor Activity Cadherins are calcium-dependent adhesion molecules that appear to play major 2 5 roles during development, particularly in defining specific cell types.
Loss or alteration of normal cadherin expression can lead to changes in cell adhesion properties linked to tumor growth and metastasis. Cadherin malfunction is also implicated in other human diseases, such as pemphigus vulgaris and pemphigus foliaceus (auto-immune blistering skin diseases), Crohn's disease, and some developmental abnormalities.
3 0 The cadherin superfamily includes well over forty members, each with a distinct pattern of expression. All members of the superfamily have in common conserved extracellular repeats (cadherin domains), but structural differences are found in other parts of the molecule. The cadherin domains bind calcium to form their tertiary structure and thus calcium is required to mediate their adhesion. Only a few amino acids in the WO 98I3t1582 PCT/US98100289 first cadherin domain provide the basis for homophilic adhesion; modification of this recognition site can change the specificity of a cadherin so that instead of recognizing only itself, the mutant molecule can now also bind to a different cadherin. In addition, some cadherins engage in heterophilic adhesion with other cadherins.
E-cadherin, one member of the cadherin superfamily, is expressed in epithelial cell types. Pathologically, if E-cadherin expression is lost in a tumor, the malignant cells become invasive and the cancer metastasizes. Transfection of cancer cell lines with polynucleotides expressing E-cadherin has reversed cancer-associated changes by returning altered cell shapes to normal, restoring cells' adhesiveness to each other and to their substrate, decreasing the cell growth rate, and drastically reducing anchorage-independent cell growth. Thus, reintroducing E-cadherin expression reverts carcinomas to a less advanced stage. It is likely that other cadherins have the same invasion suppressor role in carcinomas derived from other tissue types. Therefore, proteins of the present invention with cadherin activity, and polynucleotides of the present invention encoding such proteins, can be used to treat cancer. Introducing such proteins or polynucleotides into cancer cells can reduce or eliminate the cancerous changes observed in these cells by providing normal cadherin expression.
Cancer cells have also been shown to express cadherins of a different tissue type than their origin, thus allowing these cells to invade and metastasize in a different tissue 2 0 in the body. Proteins of the present invention with cadherin activity, and polynucleotides of the present invention encoding such proteins, can be substituted in these cells for the inappropriately expressed cadherins, restoring normal cell adhesive properties and reducing or eliminating the tendency of the cells to metastasize.
Additionally, proteins of the present invention with cadherin activity, and 2 5 polynucleotides of the present invention encoding such proteins, can used to generate antibodies recognizing and binding to cadherins. Such antibodies can be used to block the adhesion of inappropriately expressed tumor-cell cadherins, preventing the cells from forming a tumor elsewhere. Such an anti-cadherin antibody can also be used as a marker for the grade, pathological type, and prognosis of a cancer, i.e. the more progressed the 3 0 cancer, the less cadherin expression there will be, and this decrease in cadherin expression can be detected by the use of a cadherin-binding antibody.
Fragments of proteins of the present invention with cadherin activity, preferably a polypeptide comprising a decapeptide of the cadherin recognition site, and poly-nucleotides of the present invention encoding such protein fragments, can also be used to block cadherin function by binding to cadherins and preventing them from binding in ways that produce undesirable effects. Additionally, fragments of proteins of the present invention with cadherin activity, preferably truncated soluble cadherin fragments which have been found to be stable in the circulation of cancer patients, and polynucleotides encoding such protein fragments, can be used to disturb proper cell-cell adhesion.
Assays for cadherin adhesive and invasive suppressor activity include, without limitation, those described in: Hortsch et al. J Biol Chem 270 (32): 18809-18817, 1995;
Miyaki et al. Oncogene 11: 2547-2552,1995; Ozawa et al. Cell 63: 1033-1038, 1990.
Tumor Inhibition Activity In addition to the activities described above for immunological treatment or prevention of tumors, a protein of the invention may exhibit other anti-tumor activities.
A protein may inhibit tumor growth directly or indirectly (such as, for example, via ADCC). A protein may exhibit its tumor inhibitory activity by acting on tumor tissue or tumor precursor tissue, by inhibiting formation of tissues necessary to support tumor growth (such as, for example, by inhibiting angiogenesis), by causing production of other factors, agents or cell types which inhibit tumor growth, or by suppressing, eliminating or inhibiting factors, agents or cell types which promote tumor growth.
2 0 Other Activities A protein of the invention may also exhibit one or more of the following additional activities or effects: inhibiting the growth, infection or function of, or killing, infectious agents, including) without limitation, bacteria) viruses, fungi and other parasites; effecting (suppressing or enhancing) bodily characteristics, including, without limitation, height, 2 5 weight, hair color, eye color, skin, fat to lean ratio or other tissue pigmentation, or organ or body part size or shape (such as, for example, breast augmentation or diminution, change in bone form or shape); effecting biorhythms or caricadic cycles or rhythms;
effecting the fertility of male or female subjects; effecting the metabolism, catabolism, anabolism, processing, utilization, storage or elimination of dietary fat, lipid, protein, 3 0 carbohydrate, vitamins, minerals, cofactors or other nutritional factors or component(s);
effecting behavioral characteristics, including, without limitation, appetite, libido, stress, cognition (including cognitive disorders), depression (including depressive disorders) and violent behaviors; providing analgesic effects or other pain reducing effects;
promoting differentiation and growth of embryonic stem cells in lineages other than hematopoietic lineages; hormonal or endocrine activity; in the case of enzymes, correcting deficiencies of the enzyme and treating deficiency-related diseases; treatment of hyperproliferative disorders (such as, for example, psoriasis); immunoglobulin-like activity (such as, for example, the ability to bind antigens or complement); and the ability to act as an antigen in a vaccine composition to raise an immune response against such protein or another material or entity which is cross-reactive with such protein.
ADMINISTRATION AND DOSING
A protein of the present invention (from whatever source derived, including without limitation from recombinant and non-recombinant sources) may be used in a pharmaceutical composition when combined with a pharmaceutically acceptable carrier.
Such a composition may also contain (in addition to protein and a earner) diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art. The term "pharmaceutically acceptable" means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredient(s). The characteristics of the carrier will depend on the route of administration. The pharmaceutical composition of the invention may also contain cytokines, lymphokines, or other hematopoietic factors such as M-CSF, GM-CSF, TNF, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6) IL-7, IL-8, IL-9, IL-10, IL-11, 2 0 IL-12, IL-13, IL-14, IL-15) IFN, TNFO, TNFl, TNF2, G-CSF, Meg-CSF, thrombopoietin, stem cell factor) and erythropoietin. The pharmaceutical composition may further contain other agents which either enhance the activity of the protein or compliment its activity or use in treatment. Such additional factors and /or agents may be included in the pharmaceutical composition to produce a synergistic effect with protein of the invention, 2 5 or to minimize side effects. Conversely, protein of the present invention may be included in formulations of the particular cytokine, lymphokine, other hematopoietic factor, thrombolytic or anti-thrombotic factor, or anti-inflammatory agent to minimize side effects of the cytokine, lymphokine, other hematopoietic factor, thrombolytic or anti-thrombotic factor, or anti-inflammatory agent.
3 0 A protein of the present invention may be active in multimers (e.g., heterodimers or homodimers) or complexes with itself or other proteins. As a result, pharmaceutical compositions of the invention may comprise a protein of the invention in such multimeric or complexed form.

The pharmaceutical composition of the invention may be in the form of a complex of the proteins) of present invention along with protein or peptide antigens.
The protein and/or peptide antigen will deliver a stimulatory signal to both B and T
lymphocytes. B
lymphocytes will respond to antigen through their surface immunoglobulin receptor. T
lymphocytes will respond to antigen through the T cell receptor (TCR) following presentation of the antigen by MHC proteins. MHC and structurally related proteins including those encoded by class I and class II MHC genes on host cells will serve to present the peptide antigens) to T lymphocytes. The antigen components could also be supplied as purified MHC-peptide complexes alone or with co-stimulatory molecules that can directly signal T cells. Alternatively antibodies able to bind surface immunolgobulin and other molecules on B cells as well as antibodies able to bind the TCR and other molecules on T cells can be combined with the pharmaceutical composition of the invention.
The pharmaceutical composition of the invention may be in the form of a liposome in which protein of the present invention is combined) in addition to other pharmaceutically acceptable carriers, with amphipathic agents such as lipids which exist in aggregated form as micelles, insoluble monolayers, liquid crystals, or lamellar layers in aqueous solution. Suitable lipids for liposomal formulation include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponin, bile acids, 2 0 and the like. Preparation of such liposomal formulations is within the level of skill in the art, as disclosed, for example, in U.S. Patent No. 4,235,871; U.S. Patent No.
4,501,728; U.S.
Patent No. 4,837,028; and U.S. Patent No. 4,737,323, all of which are incorporated herein by reference.
As used herein, the term "therapeutically effective amount" means the total 2 5 amount of each active component of the pharmaceutical composition or method that is sufficient to show a meaningful patient benefit, i.e., treatment, healing, prevention or amelioration of the relevant medical condition, or an increase in rate of treatment, healing, prevention or amelioration of such conditions. When applied to an individual active ingredient, administered alone, the term refers to that ingredient alone. When applied to 3 0 a combination, the term refers to combined amounts of the active ingredients that result in the therapeutic effect, whether administered in combination, serially or simultaneously.
In practicing the method of treatment or use of the present invention, a therapeutically effective amount of protein of the present invention is administered to a mammal having a condition to be treated. Protein of the present invention may be administered in accordance with the method of the invention either alone or in combination with other therapies such as treatments employing cytokines, lymphokines or other hematopoietic factors. When co-administered with one or more cytokines, lymphokines or other hematopoietic factors, protein of the present invention may be administered either simultaneously with the cytokine(s), lymphokine(s), other hematopoietic factor(s), thrombolytic or anti-thrombotic factors) or sequentially. If administered sequentially, the attending physician will decide on the appropriate sequence of administering protein of the present invention in combination with cytokine(s), lymphokine(s), other hematopoietic factor(s), thrombolytic or anti-thrombotic factors.
Administration of protein of the present invention used in the pharmaceutical composition or to practice the method of the present invention can be carried out in a variety of conventional ways, such as oral ingestion, inhalation, topical application or cutaneous, subcutaneous, intraperitoneal, parenteral or intravenous injection.
Intravenous administration to the patient is preferred.
When a therapeutically effective amount of protein of the present invention is administered orally, protein of the present invention will be in the form of a tablet, capsule, powder, solution or elixir. When administered in tablet form, the pharmaceutical composition of the invention may additionally contain a solid carrier such as a gelatin or 2 0 an adjuvant. The tablet, capsule, and powder contain from about 5 to 95%
protein of the present invention, and preferably from about 25 to 90% protein of the present invention.
When administered in liquid form) a liquid carrier such as water, petroleum, oils of animal or plant origin such as peanut oil, mineral oil) soybean oil, or sesame oil, or synthetic oils may be added. The liquid form of the pharmaceutical composition may further contain 2 5 physiological saline solution, dextrose or other saccharide solution, or glycols such as ethylene glycol, propylene glycol or polyethylene glycol. When administered in liquid form, the pharmaceutical composition contains from about 0.5 to 90% by weight of protein of the present invention) and preferably from about 1 to 50% protein of the present invention.
3 0 When a therapeutically effective amount of protein of the present invention is administered by intravenous, cutaneous or subcutaneous injection, protein of the present invention will be in the form of a pyrogen-free, parenterally acceptable aqueous solution.
The preparation of such parenterally acceptable protein solutions, having due regard to pH, isotonicity, stability, and the like, is within the skill in the art. A
preferred pharmaceutical composition for intravenous, cutaneous, or subcutaneous injection should contain, in addition to protein of the present invention, an isotonic vehicle such as Sodium Chloride Injection, Ringei s Injection, Dextrose Injection, Dextrose and Sodium Chloride Injection, Lactated Ringer's Injection, or other vehicle as known in the art.
The pharmaceutical composition of the present invention may also contain stabilizers, preservatives, buffers, antioxidants, or other additives known to those of skill in the art.
The amount of protein of the present invention in the pharmaceutical composition of the present invention will depend upon the nature and severity of the condition being treated, and on the nature of prior treatments which the patient has undergone.
Ultimately, the attending physician will decide the amount of protein of the present invention with which to treat each individual patient. Initially, the attending physician will administer low doses of protein of the present invention and observe the patient's response. Larger doses of protein of the present invention may be administered until the optimal therapeutic effect is obtained for the patient, and at that point the dosage is not increased further. It is contemplated that the various pharmaceutical compositions used to practice the method of the present invention should contain about 0.01 ug to about 100 mg (preferably about O.lng to about 10 mg, more preferably about 0.1 ug to about 1 mg) of protein of the present invention per kg body weight.
The duration of intravenous therapy using the pharmaceutical composition of the 2 0 present invention will vary, depending on the severity of the disease being treated and the condition and potential idiosyncratic response of each individual patient.
It is contemplated that the duration of each application of the protein of the present invention will be in the range of 12 to 24 hours of continuous intravenous administration.
Ultimately the attending physician will decide on the appropriate duration of intravenous 2 5 therapy using the pharmaceutical composition of the present invention.
Protein of the invention may also be used to immunize animals to obtain polyclonal and monoclonal antibodies which specifically react with the protein. Such antibodies may be obtained using either the entire protein or fragments thereof as an immunogen. The peptide immunogens additionally may contain a cysteine residue at the 3 0 carboxyl terminus, and are conjugated to a hapten such as keyhole limpet hemocyanin (KLH). Methods for synthesizing such peptides are known in the art, for example, as in R.P. Merrifield, J. Amer.Chem.Soc. 85, 2149-2154 (1963); J.L. Krstenansky, et aL, FEBS Lett.
211) 10 (1987). Monoclonal antibodies binding to the protein of the invention may be useful diagnostic agents for the immunodetection of the protein. Neutralizing monoclonal WO 98/30582 PCTIUS98l00289 antibodies binding to the protein may also be useful therapeutics for both conditions associated with the protein and also in the treatment of some forms of cancer where abnormal expression of the protein is involved. In the case of cancerous cells or leukemic cells, neutralizing monoclonal antibodies against the protein may be useful in detecting and preventing the metastatic spread of the cancerous cells, which may be mediated by the protein.
For compositions of the present invention which are useful for bone, cartilage, tendon or ligament regeneration, the therapeutic method includes administering the composition topically, systematically, or locally as an implant or device.
When administered, the therapeutic composition for use in this invention is, of course, in a pyrogen-free, physiologically acceptable form. Further, the composition may desirably be encapsulated or injected in a viscous form for delivery to the site of bone, cartilage or tissue damage. Topical administration may be suitable for wound healing and tissue repair. Therapeutically useful agents other than a protein of the invention which may also optionally be included in the composition as described above, may alternatively or additionally, be administered simultaneously or sequentially with the composition in the methods of the invention. Preferably for bone and/or cartilage formation, the composition would include a matrix capable of delivering the protein-containing composition to the site of bone and/or cartilage damage, providing a structure for the 2 0 developing bone and cartilage and optimally capable of being resorbed into the body.
Such matrices may be formed of materials presently in use for other implanted medical applications.
The choice of matrix material is based on biocompatibility, biodegradability, mechanical properties, cosmetic appearance and interface properties. The particular 2 5 application of the compositions will define the appropriate formulation.
Potential matrices for the compositions may be biodegradable and chemically defined calcium sulfate, tricalciumphosphate, hydroxyapatite, polylactic acid, polyglycolic acid and polyanhydrides. Other potential materials are biodegradable and biologically well-defined, such as bone or dermal collagen. Further matrices are comprised of pure proteins 3 0 or extracellular matrix components. Other potential matrices are nonbiodegradable and chemically defined, such as sintered hydroxapatite, bioglass, aluminates, or other ceramics. Matrices may be comprised of combinations of any of the above mentioned types of material, such as polylactic acid and hydroxyapatite or collagen and tricalciumphosphate. The bioceramics may be altered in composition, such as in calcium-aluminate-phosphate and processing to alter pore size, particle size, particle shape, and biodegradability.
Presently preferred is a 50:50 (mole weight) copolymer of lactic acid and glycolic acid in the form of porous particles having diameters ranging from 150 to 800 microns.
In some applications, it will be useful to utilize a sequestering agent, such as carboxymethyl cellulose or autologous blood clot, to prevent the protein compositions from disassociating from the matrix.
A preferred family of sequestering agents is cellulosic materials such as alkylcelluloses (including hydroxyalkylcelluloses), including methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropyl-methylcellulose, and carboxymethylcellulose, the most preferred being cationic salts of carboxymethylcellulose (CMC). Other preferred sequestering agents include hyaluronic acid, sodium alginate, polyethylene glycol), polyoxyethylene oxide, carboxyvinyl polymer and polyvinyl alcohol). The amount of sequestering agent useful herein is 0.5-20 wt%~, preferably 1-10 wt°/~ based on total formulation weight, which represents the amount necessary to prevent desorbtion of the protein from the polymer matrix and to provide appropriate handling of the composition, yet not so much that the progenitor cells are prevented from infiltrating the matrix, thereby providing the protein the opportunity to assist the osteogenic activity of the progenitor cells.
2 0 In further compositions, proteins of the invention may be combined with other agents beneficial to the treatment of the bone and /or cartilage defect, wound, or tissue in question. These agents include various growth factors such as epidermal growth factor (EGF), platelet derived growth factor (PDGF), transforming growth factors (TGF-a and TGF-Vii), and insulin-like growth factor (IGF).
2 5 The therapeutic compositions are also presently valuable for veterinary applications. Particularly domestic animals and thoroughbred horses) in addition to humans, are desired patients for such treatment with proteins of the present invention.
The dosage regimen of a protein-containing pharmaceutical composition to be used in tissue regeneration will be determined by the attending physician considering 3 0 various factors which modify the action of the proteins, e.g., amount of tissue weight desired to be formed, the site of damage, the condition of the damaged tissue, the size of a wound, type of damaged tissue (e.g., bone), the patient's age, sex, and diet, the severity of any infection, time of administration and other clinical factors. The dosage may vary with the type of matrix used in the reconstitution and with inclusion of other proteins in the pharmaceutical composition. For example, the addition of other known growth factors, such as IGF I (insulin like growth factor I), to the final composition, may also effect the dosage. Progress can be monitored by periodic assessment of tissue/bone growth and / or repair, for example, X-rays, histomorphometric determinations and tetracycline labeling.
Polynucleotides of the present invention can also be used for gene therapy.
Such polynucleotides can be introduced either in vivo or ex vivo into cells for expression in a mammalian subject. Polynucleotides of the invention may also be administered by other known methods for introduction of nucleic acid into a cell or organism (including, without limitation, in the form of viral vectors or naked DNA).
Cells may also be cultured ex vivo in the presence of proteins of the present invention in order to proliferate or to produce a desired effect on or activity in such cells.
Treated cells can then be introduced iri vivo for therapeutic purposes.
Patent and literature references cited herein are incorporated by reference as if fully set forth.

SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Jacobs, Kenneth McCoy, John M.
LaVallie) Edward R.
Racie, Lisa A.
Merberg, David Treacy, Maurice Spaulding, Vikki Agostino, Michael J.
(ii) TITLE OF INVENTION: SECRETED PROTEINS AND POLYNUCLEOTIDES
ENCODING THEM
(iii) NUMBER OF SEQUENCES: 28 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Genetics Institute, Inc.
(B) STREET: 87 CambridgePark Drive (C) CITY: Cambridge (D) STATE: MA
fE) COUNTRY: U.S.A.
(F) ZIP: 02140 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30 (vi) CURRENT APPLICATION DATA:
(A> APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Sprunger, Suzanne A.
(B) REGISTRATION NUMBER: 41,323 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (617) 498-8284 (B) TELEFAX: (617) 876-5851 (2) INFORMATION FOR SEQ ID N0:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 719 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION:
SEQ ID N0:1:

TCCAGGAAGG CCAGCAAGGA GCAAGGACCAACCCCAGTGGF~~AAAAAAAA F,~~~AAAAAAA660 1~AAAAAAp,Ap, AAAAAAAAAA A,F~~AAAAAAAA,~~AAAP~AA P,AAAAAAAA719 P,F~APA

(2) INFORMATION FOR SEQ :
ID N0:2 (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 194 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
Met Lys Met Lys Ile Gln Lys Lys Glu Lys Gln Leu Ser Asn Leu Lys Val Leu Asn His Ser Pro Met Ser Asp Ala Ser Val Asn Phe Asp Tyr Lys Ser Pro Ser Pro Phe Asp Cys Ser Thr Asp Gln Glu Glu Lys Ile Glu Asp Val Ala Ser His Cys Leu Pro Gln Lys Asp Leu Tyr Thr Ala Glu Glu Glu Ala Ala Thr Leu Phe Pro Arg Lys Met Thr Ser His Asn Gly Met Glu Asp Ser Gly Gly Gly Gly Thr Gly Val Lys Lys Lys Arg Lys Lys Lys Glu Pro Gly Asp Gln Glu Gly Ala Ala Lys Gly Ser Lys Asp Arg Glu Pro Lys Pro Lys Arg Lys Arg Glu Pro Lys Glu Pro Lys Glu Pro Arg Lys Ala Lys Glu Pro Lys Lys Ala Lys Glu His Lys Glu Pro Lys Gln Lys Asp Gly Ala Lys Lys Ala Arg Lys Pro Arg Glu Ala Ser Gly Thr Lys Glu Ala Lys Glu Lys Arg Ser Cys Thr Asp Ser Ala Ala Arg Thr Lys Ser Arg Lys Ala Ser Lys Glu Gln Gly Pro Thr Pro Val Glu (2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2584 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE
DESCRIPTION:
SEQ ID
N0:3:

CTTCAGACTC TCAGAAGACTAGCCTCTAAATACCTCAATTTATCTGCACTACTGTGGTC~.'1320 ACTTGAAATT CTCTTCCCTCTTCTGCAGT':'TGTAATGGCATTCAGGCCAAAAACTGTAG';380 GGTTAAGTCT GGTTCCTGCTGTTCTATATAGCAGGAAGCAAAGG:'TCTCTCATGAATTT~.'156C

TAGCATAATA ACATAAGCGTGGATTCCAAAAATTCATTACACAGATCCTGGAAATCTGT".'1620 AATTTCTTCT

AAATGTGGAT

GTTCCCATGG

GAGCCTGTTT

CTAAAAATGT

AATCAGAAAA

TTTTATTTTG

ATGTTAATGT

AAAACAGGCA

TTCCTGAACC

AAAAATGATC

ATTAACATTG

TAATTCACTT AAAATATCAA TAAACCCATT P~~~AAAAAAA P,~~AAAAAAAA2 (2) INFORMATION FOR SEQ ID N0:4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 42 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:
Met Phe Tyr Thr Phe Cys Glu Ser Trp Arg Ile Tyr Ile Cys Phe Thr Met Cys Ile Ala Asn Lys Ile Ser Ile Ser Cys Ala Arg Glu Leu Asn Thr Leu Ser Lys Gly His Phe Ile Thr Leu (2) INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2233 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

WO 98130582 PCT/US98l00289 (xi) SEQUENCE DESCRIPTION:
SEQ ID N0:5:

ATACAGCTGT GCTCACTGCAGAAAGCCTTTTCATAAGATA GAAACATTGTACCGACATTGlOBC

CCAAGATGAG CATGACAATGAGATAAAGATTAAATACTTC TGTGGGCTTT.GTGATCTTAT1140 ATTTGTGTCA GAAAAAP.CTGAAACTTCAATTAAAACCGAA GATGATTTTCCAGTAATAGA1260 GCAGCATTTC

TGAAAAATCA

ACAGGCAATA

CTATCAGAAT

GACTCATATA

GCATCTAAAC

AAGAAAACTT

TCCTGGATAG

CTAGAATCGT

GTTTATGGAT

GCTGAGGCGG

ATCGAGACCA TCCTGGCTAA CATGGTGAAA ACTAAAAAAA P~~AAAAAAAA2220 CCCCGTCTCT

(2) INFORMATION FOR SEQ ID N0:6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 320 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:6:
Met Glu Leu Thr Ala His Phe Arg Val His Cys Arg Asn Ala Gly Pro Val Ala Val Ala Glu Lys Ser Ile Thr Gln Val Ala Glu Lys Phe Ile Leu Arg Gly Tyr Cys Pro Asp Cys Asn Gln Val Phe Val Asp Glu Thr Ser Thr Gln Asn His Lys Gln Asn Ser Gly His Lys Val Arg Val Ile Asn Ser Val Giu Glu Ser Val Leu Leu Tyr Cys His Ser Ser Glu Gly Asn Lys Asp Pro Ser Ser Asp Leu His Leu Leu Leu Asp Gln Ser Lys Phe Ser Ser Leu Lys Arg Thr Met Ser Ile Lys Glu Ser Ser Ser Leu Glu Cys Ile Ala Ile Pro Lys Lys Lys Met Asn Leu Lys Asp Lys Ser His Glu Gly Val Ala Cys Val Gln Lys Glu Lys Ser Val Val Lys Thr Trp Phe Cys Glu Cys Asn Gln Arg Phe Pro Ser Glu Asp Ala Val Glu Lys His Val Phe Ser Ala Asn Thr Met Gly Tyr Lys Cys Val Val Cys Gly Lys Val Cys Asp Asp Ser Gly Val Ile Arg Leu His Met Ser Arg Ile His Gly Gly Ala His Leu Asn Asn Phe Leu Phe Trp Cys Arg Thr Cys Lys Lys Glu Leu Thr Arg Lys Asp Thr Ile Met Ala His Val Thr Glu Phe His Asn Gly His Arg Tyr Phe Tyr Glu Met Asp Glu Val Glu Gly Glu Thr Leu Pro Ser Ser Ser Thr Thr Leu Asp Asn Leu Thr Ala Asn Lys Pro Ser Ser Ala Ile Thr Val Ile Asp His Ser Pro Ala Asn Ser Ser Pro Arg Gly Lys Trp Gln Cys Arg Ile Cys Glu Asp Met Phe Asp Ser Gln Glu Tyr Val Asn Ser Thr Ala Cys Leu Trp Gln Ala Thr Ser Phe Ile Asp Thr Ala Val Leu Thr Ala Glu Ser Leu Phe Ile Arg (2) INFORMATION FOR SEQ ID N0:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1285 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE
DESCRIPTION:
SEQ ID
N0:7:

TCAATGAGCCP~~AAAAAAAA AAAAA 1285 (2) INFORMATION
FOR SEQ
ID N0:8:

(i) SEQUENCE
CHARACTERISTICS:

(A) LENGTH: 316 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein {xi) SEQUENCE DESCRIPTION: SEQ ID N0:8:
Met Met Ser Lys Pro Gln Thr Ser Gly Ala Tyr Val Leu Asn Lys Val Pro Val Lys His Arg Leu Gly His Ala Gly Gly Ala Gly Glu Asp Cys Gln Ile Phe Ser Thr Pro Gly His Pro Lys Met Ile Tyr Ser Ser Ser Asn Leu Lys Thr Pro Ser Lys Leu Cys Ser Gly Ser Lys Ser His Asp Val Gln Glu Val Leu Lys Lys Lys Gln Glu Ala Met Lys Leu Gln Gln Asp Met Arg Lys Lys Arg Gln Glu Val Leu Glu Lys Gln Ile Glu Cys Gln Lys Met Leu Ile Ser Lys Leu Glu Lys Asn Lys Asn Met Lys Pro Glu Glu Arg Ala Asn Ile Met Lys Thr Leu Lys Glu Leu Gly Glu Lys Ile Ser Gln Leu Lys Asp Glu Leu Lys Thr Ser Ser Ala Val Ser Thr Pro Ser Lys Val Lys Thr Lys Thr Glu Ala Gln Lys Glu Leu Leu Asp Thr Glu Leu Asp Leu His Lys Arg Leu Ser Ser Gly Glu Asp Thr Thr Glu Leu Arg Lys Lys Leu Ser Gln Leu Gln Val Glu Ala Ala Arg Leu Gly Ile Leu Pro Val Gly Arg Gly Lys Thr Met Ser Ser Gln Gly Arg Gly Arg Gly Arg Gly Arg Gly Gly Arg Gly Arg Gly Ser Leu Asn His Met Val Val Asp His Arg Pro Lys Ala Leu Thr Val Gly Gly Phe Ile Glu Glu Glu Lys Glu Asp Leu Leu Gln His Phe Ser Thr Ala Asn Gln Gly Pro Lys Phe Lys Asp Arg Arg Leu Gln Ile Ser Trp His Lys Pro Lys Val Pro Ser Ile Ser Thr Glu Thr Glu Glu Glu Glu Val Lys Glu Glu Glu Thr Glu Thr Ser Asp Leu Phe Leu Pro Asp Asp Asp Asp Glu Asp Glu Asp Glu Tyr Glu Ser Arg Ser Trp Arg Arg (2) INFORMATION FOR SEQ ID N0:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2346 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii1 MOLECULE TYPE: cDNA
(xi) SEQUENCE
DESCRIPTION:
SEQ
ID N0:9:

CACGCGAGGCGCTGTCCTTTCAGCACCACAAGCTCGGGCT~:~AGGAGGGhGGACTCCTGGC60 AACCGATATT

GCCCAC'~TCG TTGTGTTAAAAGGGGACATTTGTCCAAACTCCCCAACCGAGTTTTAGAAG1800 TAATTCTTGA
AATTTTCTGACAGGAAACAAATAAAGATAGATGTGTCTGAGP~AAAAAAAA2340 (2? INFORMATION FOR SEQ 0:
ID NO:1 (i) SEQUENCE CHARACTERISTICS:
{A) LENGTH: 229 amino acids (B) TYPE: amino acid {C) STRANDEDNESS:
{D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein {xi) SEQUENCE DESCRIPTION: SEQ ID N0:10:
Met Val Lys Leu Asn Ser Asn Pro Ser Glu Lys Gly Thr Lys Pro Pro Ser Val Glu Asp Gly Phe Gln Thr Val Pro Leu Ile Thr Pro Leu Glu Val Asn His Leu Gln Leu Pro Ala Pro Glu Lys Val Ile Val Lys Thr Arg Thr Glu Tyr Gln Pro Glu Gln Lys Asn Lys Gly Lys Phe Arg Val Pro Lys Ile Ala Glu Phe Thr Val Thr Ile Leu Val Ser Leu Ala Leu Ala Phe Leu Ala Cys Ile Val Phe Leu Val Val Tyr Lys Ala Phe Thr Tyr Asp His Ser Cys Pro Glu Gly Phe Val Tyr Lys His Lys Arg Cys Ile Pro Ala Ser Leu Asp Ala Tyr Tyr Ser Ser Gln Asp Pro Asn Ser Arg Ser Arg Phe Tyr Thr Val Ile Ser His Tyr Ser Val Ala Lys Gln Ser Thr Ala Arg Ala Ile Gly Pro Trp Leu Ser Ala Ala Ala Val Ile His Glu Pro Lys Pro Pro Lys Asn Pro Gly Pro Leu Lys Ala Cys Pro Ser Gln Asn Gly Gly Arg Gly Gly Lys Glu Asp Pro His Trp Leu Thr Gln Ala Pro Val Thr Lys Gln His Cys Thr Pro Gly Ile Trp Gly Arg Gly Arg Gly Arg Ala Gly Trp Gly Glu Lys Arg Thr Lys Asn Val Val Cys Ala Gly Val Val (2) INFORMATION FOR SEQ ID N0:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2104 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION:
SEQ ID N0:11:

~.CTTCCAGTC CCCTGACGAG GACGAGGAGGAGGACTATGAGCAGTGGCTGGAGATCAAAG540 TTGCATTTTT GCACGATAAG AATAGCAGGGGATTCCTCTACTACAGGAAGAAGG':GGCTG7~~

AAGAGGATAA GGTAGAGCTC
CCACCTGCTG

GTGCCGTGTAATAAAGTCCC AGTGCTCATCCF,AAAAAAAAP,AAAAAA.AAA AP,AAAAAAAA2100 (2) INFORMATION
FOR
SEQ
ID N0:12:

(i) S EQUENCE CHARACTERISTICS:

(A) LENGTH: 645 acids amino (B) TYPE: amino acid (C) STRANDEDNESS:

(D) TOPOLOGY: linear (ii) OLECULE TYPE: protein M

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:12:
Met Ser Leu Lys Met Asp Asn Arg Asp Val Ala Gly Lys Ala Asn Arg Trp Phe Gly Val Ala Pro Pro Lys Ser Gly Lys Met Asn Met Asn Ile Leu His GlnGluGlu LeuIle AlaGlnLys LysArgGlu IleGluAla Lys Met GluGinLys AlaLys GlnAsnGln ValAlaSer ProGlnPro Pro His ProGlyGlu IleThr AsnAlaHis AsnSerSer CysIleSer Asn Lys PheAlaAsn AspGly SerPheLeu GlnGlnPhe LeuLysLeu Gln Lys AlaGlnThr SerThr AspAlaPro ThrSerAla ProSerAla Pro Pro SerThrPro ThrPro SerAlaGly LysArgSer LeuLeuIle Ser Arg ArgThrGly LeuGly LeuAlaSer LeuProGly ProValLys Ser Tyr SerHisAla LysGln LeuProVal AlaHisArg ProSerVal Phe Gln SerProAsp GluAsp GluGluGlu AspTyrGlu GlnTrpLeu Glu Ile LysValSer ProPro GluGlyAla GluThrArg LysValIle Glu Lys LeuAlaArg PheVal AlaGluGly GlyProGlu LeuGluLys Val Aia MetGluAsp TyrLys AspAsnPro AlaPheAla PheLeuHis Asp Lys AsnSerArg GlyPhe Leu,TyrTyr ArgLysLys ValAlaGlu Ile Arg LysGluAla GlnLys SerGlnAla AlaSerGln LysValSer Pro Pro GluAspGlu GluVaI LysAsnLeu AlaGluLys LeuAlaArg Phe Ile AlaAspGly GlyPro GluValGlu ThrIleAla LeuGlnAsn Asn Arg GluAsnGln AlaPhe SerPheLeu TyrGluPro AsnSerGln Gly Tyr LysTyrTyr ArgGln LysLeuGlu GluPheArg LysAlaLys Ala Ser Ser Thr Gly Ser Phe Thr Ala Pro Asp Pro Gly Leu Lys Arg Lys Ser Pro Pro Glu Ala Leu Ser Gly Ser Leu Pro Pro Ala Thr Thr Cys Pro Ala Ser Ser Thr Pro Ala Pro Thr Ile Ile Pro A1a Pro Ala Ala Pro Gly Lys Pro Ala Ser Ala Ala Thr Val Lys Arg Lys Arg Lys Ser Arg Trp Gly Pro Glu Glu Asp Lys Val Glu Leu Pro Pro Ala Glu Leu Val Gln Arg Asp Val Asp Ala Ser Pro Ser Pro Leu Ser Val Gln Asp Leu Lys Gly Leu Gly Tyr Glu Lys Gly Lys Pro Val Gly Leu Val Gly Val Thr Glu Leu Ser Asp Ala Gln Lys Lys Gln Leu Lys Glu Gln Gln Glu Met Gln Gln Met Tyr Asp Met Ile Met Gln His Lys Arg Ala Met Gln Asp Met Gln Leu Leu Trp Glu Lys Ala Val Gln Gln His Gln His Gly Tyr Asp Ser Asp Glu Glu Val Asp Ser Glu Leu Gly Thr Trp Glu His Gln Leu Arg Arg Met Glu Met Asp Lys Thr Arg Giu Trp Ala Glu Gln Leu Thr Lys Met Gly Arg Gly Lys His Phe Ile Gly Asp Phe Leu Pro Pro Asp Glu Leu Glu Lys Phe Met Glu Thr Phe Lys Ala Leu Lys Glu Gly Arg Glu Pro Asp Tyr Ser Glu Tyr Lys Glu Phe Lys Leu Thr Val Glu Asn Ile Gly Tyr Gln Met Leu Met Lys Met Gly Trp Lys Glu Gly Glu Gly Leu Gly Ser Glu Gly Gln Gly Ile Lys Asn Pro Val Asn Lys Gly Thr Thr Thr Val Asp Gly Ala Gly Phe Gly Ile Asp Arg Pro Ala Glu Leu Ser Lys Glu Asp Asp Glu Tyr Glu Ala Phe Arg Lys Arg Met Met Leu Ala Tyr Arg Phe Arg Pro Asn Pro Leu Asn Asn Pro Arg Arg Pro Tyr Tyr (2) INFORMATION FOR SEQ ID N0:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1642 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE
DESCRIPTION:
SEQ ID
N0:13:

GAGTTTGTAT TAAAAATTGT AGGCACTCCAAAAAAAAAAAAAAAAAAAAA P,I~.AAAAAAAA1620 P.,AAAAAAAAA P.,F~~AAAAAAA 16 (2) INFORMATION FOR SEQ
ID N0:14:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 107 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:14:
Met Ser Glu Pro Asp Thr Ser Ser Gly Phe Ser Gly Ser Val Glu Asn Gly Thr Phe Leu Glu Leu Phe Pro Thr Ser Leu Ser Thr Ser Val Asp Pro Ser Ser Gly His Leu Ser Asn Val Tyr Ile Tyr Val Ser Ile Phe Leu Ser Leu Leu Ala Phe Leu Leu Leu Leu Leu Ile Ile Ala Leu Gln Arg Leu Lys Asn Ile Ile Ser Ser Ser Ser Ser Tyr Pro Glu Tyr Pro Ser Asp Ala Gly Ser Ser Phe Thr Asn Leu Glu Val Cys Ser Ile Ser 7g Ser Gln Arg Ser Thr Phe Ser Asn Leu Ser Ser (2) INFORMATION FOR SEQ ID N0:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1365 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE
DESCRIPTION:
SEQ ID N0:15:

ACAACTTCCA CGTGGTACAGTCTCTCCTCA TCTTCGACATTTTGAA.AAAACTGATTGGAA660 CTTTCACCGA AAAAGATATTGAACTGATCT TGTTAATGCTGAAAAACGTGGG'~T'.~:".~CA':720 ATTAATATTA CATTGTGATA TAATTATTCC F,~~,4AAAAAAA AAAAA 1365 (2) INFORMATION FOR SEQ ID N0:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 180 amino acids {B) TYPE: amino acid {C) STRANDEDNESS:
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:16:
Met Ala Ser Ile Ser Gly Gln Leu Glu Glu Leu Tyr Met Ala His Ser Arg Lys Asp Met Asn Asp Thr Leu Thr Ser Ala Leu Met Gly Ala Cys Val Thr Ala Ser Ala Met Pro Ser Arg LEU Met Met Glu His Val Leu Leu Val Ser Ile Leu His His Thr Val Gly Ile Glu Val Gly Ala His Phe Leu Glu Ala Val Val Arg Lys Phe Asp Ala Ile Tyr Lys Tyr Gly Ser Glu Gly Lys Glu Cys Asp Asn Leu Phe Thr Val Ile Ala His Leu Tyr Asn Phe His Val Val Gln Ser Leu Leu Ile Phe Asp Ile Leu Lys Lys Leu Ile Gly Thr Phe Thr Glu Lys Asp Ile Glu Leu Ile Leu Leu Met Leu Lys Asn Val Gly Phe Ser Leu Arg Lys Asp Asp Ala Leu Ser 130 135 ~ 140 Leu Lys Glu Leu Ile Thr Glu Ala Gln Thr Lys Ala Ser Gly Ala Gly Ser Glu Phe Gln Asp Gln Thr Arg Val Arg Val Arg Arg Leu Ile Cys Phe Leu Ser Pro (2) INFORMATION FOR SEQ ID N0:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1310 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE
DESCRIPTION:
SEQ ID
N0:17:

gl TCMAAAAAAA P~~AAAAAAA.A P~AAAAAAAAA A,F~P.AAAAAAA AAAAAAAAAA 1310 (2) INFORMATION FOR SEQ ID N0:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 174 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:18:
Met Gln Ala Pro Ala Phe Arg Asp Lys Lys Gln Gly Val Ser Ala Lys Asn Gln Gly Ala His Asp Pro Asp Tyr Glu Asn Ile Thr Leu Ala Phe Lys Asn Gln Asp His Ala Lys Gly Gly His Ser Arg Pro Thr Ser Gln Val Pro Ala Gln Cys Arg Pro Pro Ser Asp Ser Thr Gln Val Pro Cys Trp Leu Tyr Arg Ala Ile Leu Ser Leu Tyr Ile Leu Leu Ala Leu Ala Phe Val Leu Cys Ile Ile Leu Ser Ala Phe Ile Met Val Lys Asn Ala 85 ~ 90 95 Glu Met Ser Lys Glu Leu Leu Gly Phe Lys Arg Glu Leu Trp Asn Val Ser Asn Ser Val Gln Ala Cys Glu Glu Arg Gln Lys Arg Gly Trp Asp Ser Val Gln Gln Ser Ile Thr Met Val Arg Ser Lys Ile Asp Arg Leu Glu Thr Thr Leu Ala Gly Ile Lys Asn Ile Asp Thr Lys Val Gln Lys Ile Leu Glu Val Leu Gln Lys Met Pro Gln Ser Ser Pro Gln (2) INFORMATION FOR SEQ ID N0:19:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:19:

(2) INFORMATION FOR SEQ ID N0:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:20:

(2) INFORMATION FOR SEQ ID N0:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:21:

(2) INFORMATION FOR SEQ ID N0:22:
(i) SEQUENCE CHARACTERISTICS:

WO 98/30582 PCTlUS98l00289 (Ay LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid {A) DESCRIPTION: /desc = "oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:22:

(2) INFORMATION FOR SEQ ID N0:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (iiy MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:23:

(2) INFORMATION FOR SEQ ID N0:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (Cy STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:24:

{2) INFORMATION FOR SEQ ID N0:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs WO 98/30582 PCTlUS98/00289 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:25:

(2) INFORMATION FOR SEQ ID N0:26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:26:

(2) INFORMATION FOR SEQ ID N0:27:
(~) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:27:

(2) INFORMATION FOR SEQ ID N0:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 307 amino acids (B) TYPE: amino acid gs (C) STRANDEDNESS:
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:28:
Met Ser Leu Ala Ser His Lys Phe His Arg Tyr Ser Cys Ala His Cys Arg Lys Pro Phe His Lys Ile Glu Thr Leu Tyr Arg His Cys Gln Asp Glu His Asp Asn Glu Ile Lys Ile Lys Tyr Phe Cys Gly Leu Cys Asp Leu Ile Phe Asn Val Glu Glu Ala Phe Leu Ser His Tyr Glu Glu His His Ser Ile Asp Tyr Val Phe Val Ser Glu Lys Thr Glu Thr Ser Ile Lys Thr Glu Asp Asp Phe Pro Val Ile Glu Thr Ser Asn Gln Leu Thr Cys Gly Cys Arg Glu Ser Tyr Ile Cys Lys Val Asn Arg Lys Glu Asp Tyr Ser Arg Cys Leu Gln Ile Met Leu Asp Lys Gly Lys Leu Trp Phe Arg Cys Ser Leu Cys Ser Ala Thr Ala Gln Asn Leu Thr Asp Met Asn Thr His Ile His Gln Val His Lys Glu Lys Ser Asp Glu Glu Glu Gln Gln Tyr Val Ile Lys Cys Gly Thr Cys Thr Lys Ala Phe His Asp Pro Glu Ser Ala Gln Gln His Phe His Arg Lys His Cys Phe Leu Gln Lys Pro Ser Val Ala His Phe Gly Ser Glu Lys Ser Asn Leu Tyr Lys Phe Thr Ala Ser Ala Ser His Thr Glu Arg Lys Leu Lys Gln Ala Ile Asn Tyr Ser Lys Ser Leu Asp Met Glu Lys Gly Val Glu Asn Asp Leu Ser Tyr Gln Asn Ile Glu Glu Glu Ile Val Glu Leu Pro Asp Leu Asp Tyr Leu Arg Thr Met Thr His Ile Val Phe Val Asp Phe Asp Asn Trp Ser Asn Phe Phe Gly His Leu Pro Gly His Leu Asn Gln Gly Thr Phe Ile Trp Gly Phe Gln Gly Thr Val Asn Lys Lys Asn Lys Arg Lys Leu Phe Pro Thr Ser g7

Claims (37)

What is claimed is:

1. A composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:1;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:1 from nucleotide 61 to nucleotide 642;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:1 from nucleotide 89 to nucleotide 440;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone BI164_1 deposited under accession number ATCC 98290;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone BI164_1 deposited under accession number ATCC 98290;
(f) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone BI164_1 deposited under accession number ATCC 98290;
(g) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone BI164_1 deposited under accession number ATCC 98290;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:2;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:2 having biological activity;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (l) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(i).

2. A composition of claim 1 wherein said polynucleotide is operably linked to at least one expression control sequence.

3. A host cell transformed with a composition of claim 2.

4. The host cell of claim 3, wherein said cell is a mammalian cell.

5. A process for producing a protein encoded by a composition of claim 2, which process comprises:
(a) growing a culture of the host cell of claim 3 in a suitable culture medium; and (b) purifying said protein from the culture.

6. A protein produced according to the process of claim 5.

7. The protein of claim 6 comprising a mature protein.

8. A composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:2;
(b) the amino acid sequence of SEQ ID NO:2 from amino acid 23 to amino acid 127;
(c) fragments of the amino acid sequence of SEQ ID NO:2; and (d) the amino acid sequence encoded by the cDNA insert of clone BI164_1 deposited under accession number ATCC 98290;
the protein being substantially free from other mammalian proteins.

9. The composition of claim 8, wherein said protein comprises the amino acid sequence of SEQ ID NO:2.

10. The composition of claim 8, wherein said protein comprises the amino acid sequence of SEQ ID NO:2 from amino acid 23 to amino acid 127.

11. The composition of claim 8, further comprising a pharmaceutically acceptable carrier.

12. A method for preventing, treating or ameliorating a medical condition which comprises administering to a mammalian subject a therapeutically effective amount of a composition of claim 11.

13. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:1.

14. A composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:3;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:3 from nucleotide 1625 to nucleotide 1750;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:3 from nucleotide 1484 to nucleotide 1729;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone BK445_1 deposited under accession number ATCC 98290;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone BK445_1 deposited under accession number ATCC 98290;
(f) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone BK445_1 deposited under accession number ATCC 98290;
(g) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone BK445_1 deposited under accession number ATCC 98290;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:4;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:4 having biological activity;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (l) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(i).

15. A composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:4;

(b) the amino acid sequence of SEQ ID NO:4 from amino acid 1 to amino acid 35;
(c) fragments of the amino acid sequence of SEQ ID NO:4; and (d) the amino acid sequence encoded by the cDNA insert of clone BK445_1 deposited under accession number ATCC 98290;
the protein being substantially free from other mammalian proteins.

16. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:3.

17. A composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:5;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:5 from nucleotide 99 to nucleotide 1058;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:5 from nucleotide 1 to nucleotide 644;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone BP101_2 deposited under accession number ATCC 98290;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone BP101_2 deposited under accession number ATCC 98290;
(f) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone BP101_2 deposited under accession number ATCC 98290;
(g) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone BP101_2 deposited under accession number ATCC 98290;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:6;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:6 having biological activity;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;

(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (l) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(i).

18. A composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:6;
(b) the amino acid sequence of SEQ ID NO:6 from amino acid 1 to amino acid 182;
(c) fragments of the amino acid sequence of SEQ ID NO:6; and (d) the amino acid sequence encoded by the cDNA insert of clone BP101_2 deposited under accession number ATCC 98290;
the protein being substantially free from other mammalian proteins.

19. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:5.

20. A composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:7;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:7 from nucleotide 237 to nucleotide 1184;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:7 from nucleotide 207 to nucleotide 935;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone CD124_3 deposited under accession number ATCC 98290;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone CD124_3 deposited under accession number ATCC 98290;
(f) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone CD224_3 deposited under accession number ATCC 98290;

(g) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone CD124_3 deposited under accession number ATCC 98290;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:8;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:8 having biological activity;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (l) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(i).

21. A composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:8;
(b) the amino acid sequence of SEQ ID NO:8 from amino acid 1 to amino acid 233;
(c) fragments of the amino acid sequence of SEQ ID NO:8; and (d) the amino acid sequence encoded by the cDNA insert of clone CD124_3 deposited under accession number ATCC 98290;
the protein being substantially free from other mammalian proteins.

22. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:7.

23. A composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:9;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:9 from nucleotide 142 to nucleotide 828;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:9 from nucleotide 1 to nucleotide 522;

(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone CW924_1 deposited under accession number ATCC 98290;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone CW924_1 deposited under accession number ATCC 98290;
(f) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone CW924_1 deposited under accession number ATCC 98290;
(g) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone CW924_1 deposited under accession number ATCC 98290;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:10;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:10 having biological activity;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (l) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(i).

24. A composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:10;
(b) the amino acid sequence of SEQ ID NO:10 from amino acid 1 to amino acid 127;
(c) fragments of the amino acid sequence of SEQ ID NO:10; and (d) the amino acid sequence encoded by the cDNA insert of clone CW924_1 deposited under accession number ATCC 98290;
the protein being substantially free from other mammalian proteins.

25. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:9.

26. A composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:11;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:11 from nucleotide 3 to nucleotide 1937;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:11 from nucleotide 204 to nucleotide 414;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone DF518_3 deposited under accession number ATCC 98290;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone DF518_3 deposited under accession number ATCC 98290;
(f) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone DF518_3 deposited under accession number ATCC 98290;
(g) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone DF518_3 deposited under accession number ATCC 98290;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:12;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:12 having biological activity;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above; and (l) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(i).

27. A composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:12;
(b) the amino acid sequence of SEQ ID NO:12 from amino acid 67 to amino acid 137;

(c) fragments of the amino acid sequence of SEQ ID NO:12; and (d) the amino acid sequence encoded by the cDNA insert of clone DF518_3 deposited under accession number ATCC 98290;
the protein being substantially free from other mammalian proteins.

28. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:11.

29. A composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:13;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:13 from nucleotide 137 to nucleotide 457;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:13 from nucleotide 323 to nucleotide 457;
(d) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:13 from nucleotide 82 to nucleotide 322;
(e) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone DM406_1 deposited under accession number ATCC 98290;
(f) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone DM406_1 deposited under accession number ATCC 98290;
(g) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone DM406_1 deposited under accession number ATCC 98290;
(h) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone DM406_1 deposited under accession number ATCC 98290;
(i) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:14;
(j) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:14 having biological activity;
(k) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(h) above;

(l) a polynucleotide which encodes a species homologue of the protein of (i) or (j) above ; and (m) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(j).

30. A composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:14;
(b) the amino acid sequence of SEQ ID NO:14 from amino acid 1 to amino acid 62;
(c) fragments of the amino acid sequence of SEQ ID NO:14; and (d) the amino acid sequence encoded by the cDNA insert of clone DM406_1 deposited under accession number ATCC 98290;
the protein being substantially free from other mammalian proteins.

31. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:13.

32. A composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:15;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:15 from nucleotide 312 to nucleotide 851;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:15 from nucleotide 56 to nucleotide 470;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone EH189_1 deposited under accession number ATCC 98290;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone EH189_1 deposited under accession number ATCC 98290;
(f) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone EH189_1 deposited under accession number ATCC 98290;

(g) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone EH189_1 deposited under accession number ATCC 98290;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:16;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:16 having biological activity;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (l) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(i).

33. A composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:16;
(b) the amino acid sequence of SEQ ID NO:16 from amino acid 1 to amino acid 53;
(c) fragments of the amino acid sequence of SEQ ID NO:16; and (d) the amino acid sequence encoded by the cDNA insert of clone EH189_1 deposited under accession number ATCC 98290;
the protein being substantially free from other mammalian proteins.

34. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:15.

35. A composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:17;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:17 from nucleotide 20 to nucleotide 541;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:17 from nucleotide 272 to nucleotide 541;

(d) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:17 from nucleotide 1 to nucleotide 448;
(e) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone EH203_2 deposited under accession number ATCC 98290;
(f) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone EH203_2 deposited under accession number ATCC 98290;
(g) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone EH203_2 deposited under accession number ATCC 98290;
(h) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone EH203_2 deposited under accession number ATCC 98290;
(i) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:18;
(j) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:18 having biological activity;
(k) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(h) above;
(l) a polynucleotide which encodes a species homologue of the protein of (i) or (j) above ; and (m) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(j).

36. A composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:18;
(b) the amino acid sequence of SEQ ID NO:18 from amino acid 1 to amino acid 143;
(c) fragments of the amino acid sequence of SEQ ID NO:18; and (d) the amino acid sequence encoded by the cDNA insert of clone EH203_2 deposited under accession number ATCC 98290;
the protein being substantially free from other mammalian proteins.

37. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:17.