CA2273199A1 - Nucleic acid and amino acid sequences relating to helicobacter pylori and vaccine compositions thereof - Google Patents

Abstract

Recombinant or substantially pure preparations of H. pylori polypeptides are described. The nucleic acids encoding the polypeptides also are described. The H. pylori polypeptides are useful for diagnostics and vaccine compositions, wherein the figure depicts an amino acid sequence alignment of five H. pylori proteins.

Description

DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTS PARTIE DE CETTE DEMANDS OU CE BREVET
COMPRENO PLUS D'UN TOME_ CECf EST LE TOME _ ~ DE,~
NOTE: Pour les tomes additionels, veuiilez cantacter !e Bureau canadien des brevets ~3I~
I
Y
JUMBO APPLlCATIONS/PATENTS
THiS SECTION OF THE APPLICATION/PATENT CONTAINS MORE
I THAN ONE VOLUME
THIS IS VOLUME y_ ~' OF ~ -MOTE: For additional volumes ~piease cantact~the Canadian Patent Ofifice NUCLEIC ACID AND AMINO ACID SEQUENCES RELATING TO
HELICOBACTER PYLORI AND VACCINE COMPOSITIONS THEREOF
Background of the Invention Helicobacter pylori is a gram-negative, S-shaped, microaerophilic bacterium that was discovered and cultured from a human gastric biopsy specimen. (Warren, J.R. and B. Marshall, ( 1983 ) Lancet 1: 1273-1275; and Marshall et al., ( 1984) Microbios Lett. _25 83-88). H. pylori has been strongly linked to chronic gastritis and duodenal ulcer disease- (Rathbone et. al., ( 1986) Gut 27: 635-641 ). Moreover, evidence is accumulating for an etiologic role of H. pylori in nonulcer dyspepsia, gastric ulcer disease, and gastric adenocarcinoma. (Blaser M. J., (1993) Trends Microbiol.
_l : 255-260). Transmission of the bacteria occurs via the oral route, and the risk of infection increases with age. (Taylor, D.N. and M. J. Blaser, ( 1991 ) Epidemiol. Rev 13: 42-50).
H. pylori colonizes the human gastric mucosa, establishing an infection that usually persists for decades. Infection by H. pylori is prevalent worldwide. Developed countries have infection rates over 50% of the adult population, while developing countries have infection rates reaching 90% of the adults over the age of 20.
(Hopkins R. J. and J. G. Morris ( 1994) Am. J. Med. 97: 265-277).
The bacterial factors necessary for colonization of the gastric environment, and for virulence of this pathogen, are poorly understood. Examples of the putative virulence factors include the following: urease, an enzyme that may play a role in neutralizing gastric acid pH (Eaton et al., ( 1991 ) Infect. Immunol. S 9:
2470-2475;
Ferrero, R.L. and A. Lee ( 1991 ) Microb. Ecol. Hlth. Dis. 4: 121-134; Labigne et al., ( 1991 ) J. Bacteriol. 173: 1920-1931 ); the bacterial flagellar proteins responsible for motility across the mucous layer. (Hazell et al., (1986) J. Inf. Dis. 153: 658-663; Leying et al., ( 1992) Mol. Microbiol. 6: 2863-2874; and Haas et al., ( 1993 ) Mol.
Microbiol. _8 753-760); Vac A, a bacterial toxin that induces the formation of intracellular vacuoles in epithelial cells {Schmitt, W. and R. Haas, (1994) Molecular Microbiol. 12(2):
307-319);
and several gastric tissue-specific adhesins. (Boren et al., (1993) Science 262: 1892-1895; Evans et al., (1993) J. Bacteriol. 175: 674-683; and Falk et al., (1993) Proc. Natl.
Acad. Sci. USA 90: 2035-203).
Numerous therapeutic agents are currently available that eradicate H. pylori infections in vitro. (Huesca et. al., (1993) Zbl. Bakt. 280: 244-252; Hopkins, R. J. and J.
G. Morris, supra). However, many of these treatments are suboptimally effective in vivo because of bacterial resistance, altered drug distribution, patient non-compliance or poor drug availabilty. (Hopkins, R. J. and J. G. Morris, supra). Treatment with antibiotics combined with bismuth are part of the standard regime used to treat H. pylori infection.

(Malfertheiner, P. and J. E. Dominguez-Munoz (1993) Clinical Therapeutics 15 Supp.
B: 37-48). Recently, combinations of a proton pump inhibitors and a single antibiotic have been shown to ameliorate duodenal ulcer disease. (Malfertheiner, P. and J. E.
Dominguez-Munoz supra). However, methods employing antibiotic agents can have the problem of the emergence of bacterial strains which are resistant to these agents.
(Hopkins, R. J. and J. G. Morris, supra). These limitations demonstrate that new more effective methods are needed to combat H. pylori infections in vivo. In particular, the design of new vaccines that may prevent infection by this bacterium is highly desirable.
Summary of the Invention This invention relates to novel genes, e.g., genes encoding polypeptides such as bacterial surface proteins, from the organism Helicobacter pylori (H. pylori), and other related genes, their products, and uses thereof. The nucleic acids and peptides of the present invention have utility for diagnostic and therapeutics for H. pylori and other Helicobacter species. They can also be used to detect the presence of H.
pylori and other Helicobacter species in a sample; and for use in screening compounds for the ability to interfere with the H. pylori life cycle or to inhibit H. pylori infection. More specifically, this invention features compositions of nucleic acids corresponding to entire coding sequences of H. pylori proteins, including surface or secreted proteins or parts thereof, nucleic acids capable of binding mRNA from H. pylori proteins to block protein translation, and methods for producing H. pylori proteins or parts thereof using peptide synthesis and recombinant DNA techniques. This invention also features antibodies and nucleic acids useful as probes to detect H. pylori infection.
In addition, vaccine compositions and methods for the protection or treatment of infection by H.
pylori are within the scope of this invention.
Detailed Description of the Drawings Figure 1 depicts an amino acid sequence alignment of five H. pylori proteins (depicted in the single letter amino acid code and designated by their amino acid Sequence ID Numbers; shown N-terminal to C-terminal, left to right).
Figure 2 depicts the N-terminal portion of three H. pylori proteins (depicted in the single letter amino acid code and designated by their amino acid Sequence ID
Numbers; shown N-terminal to C-terminal, left to right).

Detailed Description of the Invention -In one aspect, the invention features a recombinant or substantially pure preparation of H. pylori polypeptide of SEQ ID NO: 98. The invention also includes substantially pure nucleic acid encoding an H. pylori polypeptide of SEQ ID
NO: 98, such nucleic acid is contained in SEQ ID NO: 1. The H. pylori polypeptide sequences of the invention described herein are contained in the Sequence Listing, and the nucleic acids encoding H. pylori polypeptides of the invention are contained in the Sequence Listing.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
99, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 2.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pvlori polypeptide having an amino acid sequence of SEQ ID NO:
100, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 3.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
101, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 4:
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
102, such as a nucleic acid comprising a nucleotide sequence of SEQ TD NO: 5.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
103, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 6.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
104, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 7.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
105, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 8.
In another aspect, the invention features a substantially pure nucleic acid -- encoding an H. pylori polypeptide havin? a~ i amino acid sequence of SEQ ID
NO: 106, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 9.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
107, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 10.

In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
108, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 11.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
109, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 12.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
110, such asp nucleic acid comprising a nucleotide sequence of SEQ ID NO: 13.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
111, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 14.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
112, 1 S such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 15.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
113, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 16.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
114, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 17.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
11 S, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 18.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
116, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 19.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
117, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 20.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
118, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 21.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
119, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 22.

In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
120, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 23.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
121, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 24.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
122, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 25.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
123, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 26.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
124, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 27.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
125, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 28.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
i 26, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 29.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid-sequence of SEQ ID NO:
127, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 30.
In another aspect, the invention features a substantiaily pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
128, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 31.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
I29, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 32.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
130, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 33.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori poiypeptide having an amino acid sequence of SEQ ID NO:
131, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 34.

In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
132, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 35.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
133, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 36.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
134, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 37. -In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
135, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 38.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
136, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 39.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
137, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 40.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
138, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 41.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
139, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 42.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
140, such as a nucleic acid comprising a nucleotide sequence of SEQ ID N0:43.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
141, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 44.
In another aspect, the invention features a substantially pyre nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
142, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 45.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
143, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 46.

_7_ In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
144, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 47.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
145, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 48.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
146, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 49.
l 0 In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
147, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 50.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
148, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 51.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
149, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 52.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
150, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 53.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
151, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 54.
In another aspect, the invention features a substantially pure nucleic acid encoding an X. pylori polypeptide having an amino acid sequence of SEQ ID NO:
152, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 55.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
153, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 56.
In another aspect, the irve~ ction features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
154, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 57.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
155, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 58.

_g_ In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
156, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 59.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
157, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 60.
In another aspect, the invention features a substantially pure nucleic acid encoding an N. pylori polypeptide having an amino acid sequence of SEQ ID NO:
158, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 61.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
159, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 62.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
160, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 63.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
161, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 64.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
162, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 65.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
163, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 66.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
164, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 67.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
165, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 68.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
166, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 69.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
167, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 70.

In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
168, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 71.
In another aspect, the invention features a substantially pure nucleic acid S encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID
NO: 169, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 72.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
170, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 73.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
17I, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 74.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
172;
1 S such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 75.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
173, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 76.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
174, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 77.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
175, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 78.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
176, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 79.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
177, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 80.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
I78, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 81.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori palypeptide having an amino acid sequence of SEQ ID NO:
179, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 82.

In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
180, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 83.
In another aspect, the invention features a substantially pure nucleic acid S encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID
NO: 181, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 84.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
182, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 85.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori poIypeptide having an amino acid sequence of SEQ ID NO:
183, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 86.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
184, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 87.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
185, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 88.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
186, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 89.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
187, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 90.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
188, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 91.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
189, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 92.
In another aspect, the invention features a substa itially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
190, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 93.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
191, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 94.

In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
192, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 95.
In another aspect, the invention features a substantially pure nucleic acid S encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID
NO: 193, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 96.
In another aspect, the invention features a substantially pure nucleic acid encoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:
194, such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 97.
In another aspect, the invention features an isolated nucleic acid having a nucleotide sequence encoding an H. pylori polypeptide at least about 60%
homologous to an amino acid sequence selected from the group consisting of SEQ ID NO: 98-SEQ
ID NO: 194. In a preferred embodiment, the isolated nucleic acid includes a nucleotide sequence selected from the group consisting of SEQ ID NO: 1-SEQ ID NO: 97, or a complement thereof.
In another aspect, the invention features an isolated nucleic acid having a nucleotide sequence encoding an H. pylori polypeptide selected from the group consisting of SEQ ID NO: 98-SEQ ID NO: 194.
In another aspect, the invention features an isolated nucleic acid which encodes an H. pylori polypeptide, having a nucleotide sequence at least about 60%
homologous to a nucleotide sequence selected from the group consisting of SEQ ID NO: 1-SEQ ID
NO: 97, or a complement thereof.
In another aspect, the invention features an isolated nucleic acid molecule encoding an H. pylori polypeptide, having a nucleotide sequence which hybridizes under stringent hybridization conditions to a nucleic acid molecule having the nucleotide sequence selected from the group consisting of SEQ ID NO: 1-SEQ ID NO: 97, or a complement thereof.
In another aspect, the invention features an isolated nucleic acid having a nucleotide sequence of at least 8 nucleotides in length, wherein the sequence hybridizes under stringent hybridization conditions to a nucleic acid having a nucleotide sequence selected from the group c insisting of SEQ ID NO: 1-SEQ ID NO: 97, or a complement thereof.
Particularly preferred is an isolated nucleic acid having a nucleotide sequence encoding an H. pylori cell envelope polypeptide or a fragment thereof, the nucleic acid selected from the group consisting of SEQ ID NO: 63, SEQ ID NO: 7, SEQ ID NO:
8, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 61, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 91, SEQ ID NO: 94, SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID NO: 26, SEQ ID NO: 36, SEQ ID NO: 42, SEQ ID NO: 52, SEQ ID NO: 22, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 34, SEQ
ID NO: 35, SEQ ID NO: 60, SEQ ID NO: 69, and SEQ ID NO: 83, or a complement thereof.
In one embodiment, the H. pylori cell envelope polypeptide or a fragment thereof is an H. pylori flagella-associated polypeptide or a fragment thereof encoded by a nucleic acid having a nucleotide sequence of SEQ ID NO: 63, or a complement thereof.
In another embodiment, the H. pylori cell envelope polypeptide or a fragment thereof is an H. pylori inner membrane polypeptide or a fragment thereof encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 48, SEQ ID NO:
49, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 38, and SEQ ID NO: 39, or a complement thereof.
In another embodiment, the H. pylori inner membrane polypeptide or a fragment thereof is an H. pylori polypeptide or a fragment thereof involved in transport encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 48, SEQ ID
NO:
49. SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 43, and SEQ ID
NO: 44, or a complement thereof.
In another embodiment, the H. pylori cell envelope polypeptide or a fragment thereof is an H. pylori outer membrane polypeptide or a fragment thereof encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, SEQ
ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID
NO: 27, SEQ ID NO: 28, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 61, SEQ ID
NO: 79, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 91, SEQ ID
NO: 94, SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID NO: 26, SEQ ID NO: 36, SEQ ID
NO: 42, SEQ ID NO: 52, SEQ ID NO: 22, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID
NO: 65, and SEQ ID NO: 66, or a complement thereof.
In another embodiment, the H. pylori outer membrane polypeptide or a fragment thereof is an H. pylori polypeptide having a terminal phenylalanine residue or a fragment thereof encoded by a nucleic acid selected from the group consisting of SEQ
ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID
NO: 14, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID
NO: 28, SEQ ID NO: 36, SEQ ID NO: 42, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID

NO: 52, SEQ ID NO: 61, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID
NO: 85, SEQ ID NO: 91, and SEQ ID NO: 94, or a complement thereof.
In another embodiment, H. pylori outer membrane polypeptide or a fragment thereof is an H. pylori polypeptide having a terminal phenylalanine residue and a C-terminal tyrosine cluster or a fragment thereof encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 11, SEQ ID NO: 26, SEQ ID NO: 36, SEQ ID
NO:
42, and SEQ ID NO: 52, or a complement thereof.
Particularly preferred is an isolated nucleic acid having a nucleotide sequence encoding an H. pylori cell envelope polypeptide or a fragment thereof selected from the group consisting of SEQ ID NO: 160, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO:
106, SEQ ID NO: 110, SEQ ID NO: 1 I 1, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID
NO: 124, SEQ ID NO: 125, SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 158, SEQ
ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 181, SEQ ID NO: 182, SEQ ID NO: 188, SEQ ID NO: 191, SEQ ID NO: 102, SEQ ID NO: 108, SEQ ID NO: 123, SEQ ID NO:
133, SEQ ID NO: 139, SEQ ID NO: 149, SEQ ID NO: 119, SEQ ID NO: 126, SEQ ID
NO: 127, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 145, SEQ ID NO: 146, SEQ
ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 135, SEQ ID NO: 136, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO:
103, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 157, SEQ ID NO: 166, and SEQ
1D NO: 180.
In another embodiment, the H. pylori cell envelope polypeptide or a fragment thereof is an N. pylori flagella-associated polypeptide or a fragment thereof having an amino acid sequence of SEQ ID NO: 160.
In another embodiment, the H. pylori cell envelope polypeptide or a fragment thereof is an H. pylori inner membrane polypeptide or a fragment thereof selected from the group consisting of SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 114, SEQ ID
NO: 11 S, SEQ ID NO: 116, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 135, and SEQ ID NO: 136.
In another embodiment, the H. pylori inner membrane polypeptide or a fragment thereof is an H. pylori polypeptide or a fragment thereof involved in transport selected from the group consisting of SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NC: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 140, and SEQ ID NO: 141.
In another embodiment, the H. pylori cell envelope polypeptide or a fragment thereof is an H. pylori outer membrane polypeptide or a fragment thereof selected from the group consisting of SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID
NO: 110, SEQ ID NO: 111, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 124, SEQ
ID NO: 125, SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 158, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 181, SEQ ID NO: 182, SEQ ID NO: I88, SEQ ID NO:
191, SEQ ID NO: 102, SEQ ID NO: 108, SEQ ID NO: 123, SEQ ID NO: 133, SEQ ID
NO: 139, SEQ ID NO: 149, SEQ ID NO: 119, SEQ ID NO: 126, SEQ ID NO: I27, SEQ
ID NO: 162, and SEQ ID NO: 163.
In another embodiment, the H. pylori outer membrane polypeptide or a fragment thereof is an H. pylori polypeptide having a terminal phenylalanine residue or a fragment thereof selected from the group consisting of SEQ ID NO: 104, SEQ ID
NO:
105, SEQ ID NO: 106, SEQ ID_NO: I08, SEQ ID NO: 110, SEQ ID NO: 11 I, SEQ ID
NO: 120, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ
ID NO: 133, SEQ ID NO: 139, SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: I49, SEQ ID NO: 158, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 181, SEQ ID NO:
182, SEQ ID NO: 188, and SEQ TD NO: 191.
In another embodiment, the H. pylori outer membrane polypeptide or a fragment thereof is an H. pylori polypeptide having a terminal phenylalanine residue and a C-terminal tyrosine cluster or a fragment thereof selected from the group consisting of SEQ ID NO: 108, SEQ ID NO: I23, SEQ ID NO: 133, SEQ ID NO: 139, and SEQ ID
NO: I49.
Particularly preferred is an isolated nucleic acid having a nucleotide sequence encoding an H. pylori cytoplasmic polypeptide or a fragment thereof, wherein the nucleic acid is selected from the group consisting of SEQ ID NO: 57, SEQ ID
NO: 58, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 92, and SEQ ID NO: 93, or a complement thereof.
In one embodiment, the H. pvlori cytoplasmic polypeptide or a fragment thereof is an H. pylori polypeptide or a fragment thereof involved in mRNA
translation, wherein the nucleic acid is selected from the group consisting of SEQ ID NO: 57 and SEQ ID
NO: 58, or a complement thereof.
In another embodiment, the H. pylori cytoplasmic polypeptide or a fragment thereof is an H. pylori polypeptide or a fragment thereof involved in genome replication, transcription, recombination and repair, wherein the nucleic acid is selected from the group consisting of SEQ ID NO: 86, SEQ ID NO: 87, or a complement thereof.
Particularly preferred is an isolated ruc'.eic acid having a nucleotide sequence encoding an H. pylori cytoplasmic polypeptide or a fragment thereof selected from the group consisting of SEQ ID NO: 154, SEQ ID NO: 155, SEQ ID NO: 183, SEQ ID NO:
184, SEQ ID NO: 185, SEQ ID NO: 186, SEQ ID NO: 189, and SEQ ID NO: 190.
In one embodiment, the H. pylori cytoplasmic polypeptide or a fragment thereof is an H. pylori polypeptide or a fragment thereof involved in mRNA translation selected from the group consisting of SEQ ID NO: 154 and SEQ ID NO: 155.

In another embodiment, the H. pylori cytoplasmic polypeptide or a fragment thereof is an H. pylori polypeptide or a fragment thereof involved in genome replication, transcription, recombination and repair selected from the group consisting of SEQ ID
NO: 183 and SEQ ID NO: 184.
Particularly preferred is an isolated nucleic acid having a nucleotide sequence encoding an H. pylori secreted polypeptide or a fragment thereof, the nucleic acid selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO:
10, SEQ ID NO: 12, SEQ ID NO: 20, SEQ ID NO: 25, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 53 SEQ ID NO: 64, SEQ ID NO: 67, SEQ ID NO: 70, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 90, SEQ ID NO: 95, and SEQ ID NO: 97, or a complement thereof.
Particularly preferred is an isolated nucleic acid having a nucleotide sequence encoding an H. pylori secreted polypeptide or a fragment thereof selected from the group consisting of SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 117, SEQ ID NO: 122, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO:
142, SEQ ID NO: 143, SEQ ID NO: 150 SEQ ID NO: 161, SEQ ID NO: 164, SEQ ID
NO: 167, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 178, SEQ ID NO: 179, SEQ
ID NO: 187, SEQ ID NO: 192, and SEQ ID NO: 194.
Particularly preferred is an isolated nucleic acid having a nucleotide sequence encoding an H. pylori cellular polypeptide or a fragment thereof, the nucleic acid selected from the group consisting of SEQ ID NO: i 5, SEQ ID NO: 16, SEQ ID
NO: 21, SEQ ID NO: 33, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 47, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56 SEQ ID NO: 59, SEQ ID NO: 62, SEQ ID NO: 68, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, and SEQ ID NO: 96, or a complement thereof.
Particularly preferred is an isolated nucleic acid having a nucleotide sequence encoding an H. pylori cellular polypeptide or a fragment thereof selected from the group consisting of SEQ ID NO: I 12, SEQ ID NO: 113, SEQ ID NO: I 18; SEQ ID NO:
130, SEQ ID NO: 134, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 144, SEQ ID NO:
151, SEQ ID NO: 152, SEQ ID NO: 153, SEQ ID NO: 156, SEQ ID NO: 159, SEQ ID
- NO: 165, SEn Io NO: 168, SEQ ID NO: 169, SEQ ID NO: 170, SEQ ID NO: 171, SEQ
ID NO: 172, SEQ ID NO: 173, and SEQ ID NO: 193.
In another aspect, the invention features a probe having a nucleotide sequence consisting of at least 8 nucleotides of a nucleotide sequence selected from the group . 35 consisting of SEQ ID NO: 1-SEQ ID NO: 97, or a complement thereof.

In another aspect, the invention features an isolated H. pylori polypeptide having an amino acid sequence at least about 60% homologous to an H. pylori polypeptide selected from the group consisting of SEQ ID NO: 98-SEQ ID NO: 194.
In another aspect, the invention features an isolated H. pylori polypeptide which is encoded by a nucleic acid having a nucleotide sequence at least about 60%
homologous to a nucleotide sequence selected from the group consisting of SEQ
ID NO:
1-SEQ ID NO: 97. In one embodiment, the isolated H. pylori polypeptide is encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO: 1-SEQ
ID NO:
97. _ In another aspect, the invention features an isolated H. pylori polypeptide which is encoded by a nucleic acid which hybridizes under stringent hybridization conditions to a nucleic acid selected from the group consisting of SEQ ID NO: 1-SEQ ID
NO: 97, or a complement thereof.
In another aspect, the invention features an isolated H. pylori polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NO: 97-SEQ
ID
NO: I 94.
Particularly preferred is an isolated H pylori cell envelope polypeptide or a fragment thereof, wherein the polypeptide is selected from the group consisting of SEQ
ID NO: 160, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 124, SEQ ID NO:
125, SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 158, SEQ ID NO: 176, SEQ ID
NO: 177, SEQ ID NO: 181, SEQ ID NO: 182, SEQ ID NO: 188, SEQ ID NO: 191, SEQ
ID NO: 102, SEQ ID NO: 108, SEQ ID NO: 123, SEQ ID NO: 133, SEQ ID NO: 139, SEQ ID NO: 149, SEQ ID NO: I 19, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO:
162, SEQ ID NO: 163, SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 114, SEQ ID
NO: 115, SEQ ID NO: 116, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 135, SEQ
ID NO: 136, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 103, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 157, SEQ ID NO: 166, and SEQ ID NO: I 80.
In one embodiment, the H. pylori cell envelope polypeptide or a fragment thereof is an H. pylori flagella-associated polypeptide or a fragment thereof having an amino -- acid sequence of SEQ ID NO: 160.
In another embodiment, the H. pylori cell envelope polypeptide or a fragment thereof is an H. pylori inner membrane polypeptide or a fragment thereof selected from - the group consisting of SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 114, SEQ
ID
NO: 115, SEQ ID NO: 116, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 135, and SEQ ID NO: 136.

WO 98/24475 PCTfUS97/22104 In another embodiment, the H. pylori inner membrane polypeptide or a fragment thereof is an H. pylori polypeptitle or a fragment thereof involved in transport selected from the group consisting of SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO:
i 35, and SEQ ID NO: 136.
In another embodiment, the H. pylori cell envelope polypeptide or a fragment thereof is an H. pylori outer membrane polypeptide or a fragment thereof selected from the group consisting of SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID
NO: 110, SEQ ID NO: 111, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 124, SEQ
ID NO: 125, SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 158, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 181, SEQ ID NO: 182, SEQ ID NO: 188, SEQ ID NO:
191, SEQ ID NO: 102, SEQ ID NO: 108, SEQ ID NO: 123, SEQ ID NO: I33, SEQ ID
NO: 139, SEQ ID NO: 149, SEQ ID NO: 119, SEQ ID NO: 126, SEQ ID NO: 127, SEQ
ID NO: 162, and SEQ ID NO: 163.
In another embodiment, the H. pylori outer membrane polypeptide or a fragment thereof is an H. pylori polypeptide having a terminal phenylalanine residue or a fragment thereof selected from the group consisting of SEQ ID NO: 104, SEQ ID
NO:
105, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID
NO: I 20, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ
ID NO: 133, SEQ ID NO: 139, SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 158, SEQ ID NO: I76, SEQ ID NO: 177, SEQ ID NO: 181, SEQ ID NO:
182, SEQ ID NO: 188, and SEQ ID NO: 191.
In another embodiment, the H. pylori outer membrane polypeptide or a fragment thereof is an H. pylori polypeptide having a terminal phenylalanine residue and a C-terminal tyrosine cluster or a fragment thereof selected from the group consisting of SEQ ID NO: 108, SEQ ID NO: 123, SEQ ID NO: 133, SEQ ID NO: 139, and SEQ ID
NO: 149.
Particularly preferred is an isolated H. pylori cell envelope golypeptide or a fragment thereof, wherein the polypeptide is encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 63, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 23, SEQ ID NO: ?4. SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 61, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 91, SEQ ID NO: 94, SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID NO: 26, SEQ ID NO: 36, SEQ ID NO: 42, SEQ ID NO: 52, SEQ ID NO: 22, SEQ iD NO: 29, SEQ ID NO: 30, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 34, SEQ ID NO: 35, SEQ
ID NO: 60, and SEQ ID NO: 69, SEQ ID NO: 83.
In one embodiment, the H. pylori cell envelope polypeptide or a fragment thereof is an H. pylori flagella-associated polypeptide or a fragment thereof encoded by a nucleic acid having a nucleotide sequence of SEQ ID NO: 63.
In another embodiment, the H. pylori cell envelope polypeptide or a fragment thereof is an H. pylori inner membrane polypeptide or a fragment thereof encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 48, SEQ ID NO:
49, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 38, and SEQ ID NO: 39.
In another embodiment, the H. pylori inner membrane po~lypeptide or a fragment thereof is an H. pylori polypeptide or a fragment thereof involved in transport encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 48, SEQ ID
NO:
49, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 43, and SEQ ID
1 S NO: 44.
In another embodiment, the H. pylori cell envelope polypeptide or a fragment thereof is an H. pylori outer membrane polypeptide or a fragment thereof encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, SEQ
ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID
NO: 27, SEQ ID NO: 28, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 61, SEQ ID
NO: 79, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 91, SEQ ID
NO: 94, SEQ ID NO: S, SEQ ID NO: 1 l, SEQ ID NO: 26, SEQ ID NO: 36, SEQ ID
NO: 42, SEQ ID NO: 52, SEQ ID NO: 22, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID
NO: 65, and SEQ ID NO: 66.
In another embodiment, the H. pylori outer membrane polypeptide or a fragment thereof is an H. pylori polypeptide having a terminal phenylalanine residue or a fragment thereof encoded by a nucleic acid selected from the group consisting of SEQ
ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID
NO: 14, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID
NO: 28, SEQ ID NO: 36, SEQ ID NO: 42, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID
NO: 52, SEQ ID NO: 61, SEQ ID NO. 79, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID
NO: 85, SEQ ID NO: 91, and SEQ ID NO: 94.
In another embodiment, the H. pylori outer membrane polypeptide or a fragment thereof is an H. pylori polypeptide having a terminal phenylalanine residue and a C-terminal tyrosine cluster or a fragment thereof encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 11, SEQ ID NO: 26, SEQ ID NO: 36, SEQ ID
NO:
42, and SEQ ID NO: 52.

Particularly preferred is an isolated H. pylori cytoplasmic polypeptide or a fragment thereof, wherein the polypeptide is selected from the group consisting of SEQ
ID NO: 154, SEQ ID NO: 155, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 185, SEQ ID NO: 186, SEQ ID NO: 189, and SEQ ID NO: 190.
In another embodiment, the H. pylori cytoplasmic polypeptide or a fragment thereof is an H. pylori polypeptide or a fragment thereof involved in mRNA
translation selected from the group consisting of SEQ ID NO: 154 and SEQ ID NO: 155.
In another embodiment, the H. pylori cytoplasmic polypeptide or a fragment thereof is an H. pylori polypeptide or a fragment thereof involved in genome replication, transcription, recombination and repair selected from the group consisting of SEQ ID NO: 183 and SEQ ID NO: 184.
Particularly preferred is an isolated H. pylori cytoplasmic polypeptide or a fragment thereof, wherein the polypeptide is encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 86, SEQ ID NO:
87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 92, and SEQ ID NO: 93.
In one embodiment, the H. pylori cytoplasmic polypeptide or a fragment thereof is an H. pylori polypeptide or a fragment thereof involved in mRNA
translation, wherein the polypeptide is encoded by a nucleic acid selected from the group consisting of SEQ
ID NO: 57, and SEQ ID NO: 58.
In another embodiment, the H. pylori cytoplasmic polypeptide or a fragment thereof is an H. pylori polypeptide or a fragment thereof involved in genome replication, transcription, recombination and repair, wherein the polypeptide is encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 86 and SEQ ID NO: 87.
Particularly preferred is an isolated H. pylori cellular polypeptide or a fragment thereof, wherein the polypeptide is selected from the group consisting of SEQ
ID NO:
112, SEQ ID NO: 113, SEQ ID NO: 118, SEQ ID NO: 130, SEQ ID NO: 134, SEQ ID
NO: 137, SEQ ID N0: 138, SEQ ID NO: 144, SEQ ID NO: 151, SEQ ID NO: 152, SEQ
ID NO: 153, SEQ ID NO: I56, SEQ ID NO: 159, SEQ ID NO: I65, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 170, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO:
173, and SEQ ID NO: 193.
F articularly preferred is an isolated H. pylori cellular polypeptide or a fragment thereof, wherein the poiypeptide is encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 21, SEQ ID NO: 33, SEQ
ID NO: 37, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 47, SEQ ID NO: 54, SEQ
ID NO: 55, SEQ ID NO: 56 SEQ ID NO: 59, SEQ ID NO: 62, SEQ ID NO: 68, SEQ ID
NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID
NO: 76, and SEQ ID NO: 96.

WO 98/24475 PC~'/ITS97/22104 Particularly preferred is an isolated H pylori secreted polypeptide or a fragment thereof, wherein the polypeptide is selected from the group consisting of SEQ
ID NO:
100, SEQ ID NO: 101, SEQ ID NO: 107, SEQ ID NO: 109,_SEQ ID NO: 117, SEQ ID
NO: 122, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 142, SEQ ID NO: 143, SEQ
ID NO: 150 SEQ ID N~: 161, SEQ ID NO: 164, SEQ ID NO: 167, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 178, SEQ ID NO: 179, SEQ ID NO: 187, SEQ ID NO:
192, and SEQ ID NO: I 94.
Particularly preferred is an isolated H. pylori secreted polypeptide or a fragment thereof, wherein the polypeptide is encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID
NO: 20, SEQ ID NO: 25, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 45, SEQ ID
NO: 46, SEQ ID NO: 53 SEQ ID NO: 64, SEQ ID NO: 67, SEQ ID NO: 70, SEQ ID
NO: 77, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 90, SEQ ID
NO: 95, and SEQ ID NO: 97.
In another aspect, the invention features a chimeric H. pylori polyneptide comprising at least two H. pylori polypeptides or fragments thereof, wherein the polypeptides are encoded by nucleic acid sequences selected from the group consisting of SEQ ID NO:1-SEQ ID N0:97.
In another aspect, the invention features a chimeric H. pylori polypeptide comprising at least two H. pylori polypeptides or fragments thereof, wherein the polypeptides are selected from the group consisting of SEQ ID N0:98-SEQ ID
N0:194.
In another aspect, the invention features a fusion protein comprising an H.
pylori polypeptide which comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 98-SEQ ID NO: 194 operatively linked to a non-H. pylori polypeptide.
In another aspect, the invention features a vaccine formulation for,prophylactic or therapeutic treatment of an H. pylori infection comprising an effective amount of at least one isolated nucleic acid of the invention.
In another aspect, the invention features a vaccine formulation for prophylactic or therapeutic treatment of an H. pylori infection comprising an effective amount of at least one H. pylori polypeptide of the invention.
Preferably, the vaccine formulation of the invention further includes a pharmaceutically acceptable carrier. In one embodiment, the pharmaceutically acceptable carrier includes an adjuvant. In another embodiment, the pharmaceutically acceptable carrier includes a delivery system, e.g., a live vector, e.g., a bacteria or a virus. In another embodiment, the pharmaceutically acceptable carrier includes both an adjuvant and a delivery system.

In another aspect, the invention features a method of treating or reducing a risk of H. pylori infection in a subject. The method includes administering to a subject a vaccine formulation of the invention, such that treatment or reduction of risk of H. pylori infection occurs.
In another aspect, the invention features a method of producing a vaccine formulation of the invention. The method includes combining at least one isolated H.
pylori polypeptide or a fragment thereof selected from the group consisting of SEQ ID
NO: 98-SEQ ID NO: 194 with a pharmaceutically acceptable carrier to thereby form a vaccine formulation.
In another aspect, the invention features a method of producing a vaccine formulation of the invention. The method includes culturing a cell undez condition that permit expression of an H. pylori polypeptide or a fragment thereof selected from the group consisting of SEQ ID NO: 98-SEQ ID NO: 194; isolating the H. pylori polypeptide from the cell; and combining at least one isolated H. pylori polypeptide or a 1 S fragment thereof with a pharmaceutically acceptable carrier to thereby form a vaccine formulation.
In another aspect, the invention pertains to any individual H. pylori polypeptide member or nucleic acid encoding such a member from the above-identified groups of H.
pylori polypeptides.
In another aspect, the invention features nucleic acids capable of binding mRNA
of H. pylori. Such nucleic acid is capable of acting as antisense nucleic acid to control the translation of mRNA of H. pylori. A further aspect features a nucleic acid which is capable of binding specifically to an H. pylori nucleic acid. These nucleic acids are also referred to herein as complements and have utility as probes and as capture reagents.
In another aspect, the invention features an expression system comprising an open reading frame corresponding to H. pylori nucleic acid. The nucleic acid further comprises a control sequence compatible with an intended host. The expression system is useful for making polypeptides corresponding to H. pylori nucleic acid.
In another aspect, the invention features a cell transformed with the expression system to produce H. pylori polypeptides.
In another aspect, the invention features a method of generating antibodies against H. pylori polypeptides which are capable of binding specifically to H.
pylori polypeptides. Such antibodies have utility as reagents for immunoassays to evaluate the abundance and distribution of H. pylori-specific antigens.
In another aspect, the invention features a method of generating vaccines for immunizing an individual against H. pylori. The vaccination method includes:
immunizing a subject with at least one H. pylori polypeptide according to the present invention, e.g., a surface or secreted polypeptide, or active portion thereof, and a pharmaceutically acceptable carrier. Such vaccines have therapeutic and/or prophylactic utilities.
In another aspect, the invention provides a method for generating a vaccine comprising a modified immunogenic H. pylori polypeptide, e.g., a surface or secreted polypeptide, or active portion thereof, and a pharmacologically acceptable carrier.
In another aspect, the invention features a method of evaluating a compound, e.g.
a polypeptide, e.g., a fragment of a host cell polypeptide, for the ability to bind an H.
pylori polypeptide. The method includes: contacting the candidate compound with an H. pylori polypeptide and determining if the compound binds or otherwise interacts with an H. pylori polypeptide. Compounds which bind H. pylori are candidates as activators or inhibitors of the bacterial life cycle. These assays can be performed in vitro or in VIVO.
In another aspect, the invention features a method of evaluating a compound, e.g.
I 5 a polypeptide, e.g., a fragment of a host cell polypeptide, for the ability to bind an H.
pylori nucleic acid, e.g., DNA or RNA. The method includes: contacting the candidate compound with an H. pylori nucleic acid and determining if the compound binds or otherwise interacts with an H. pylori polypeptide. Compounds which bind H.
pylori are candidates as activators or inhibitors of the bacterial life cycle. These assays can be performed in vitro or in vivo.
The invention features H. pylori polypeptides, preferably a substantially pure preparation of an H. pylori polypeptide, or a recombinant H. pylori polypeptide. In preferred embodiments: the polypeptide has biological activity; the polypeptide has an amino acid sequence at least 60%, 70%, 80%, 90%, 95%, 98%, or 99% identical or homologous to an amino acid sequence of the invention contained in the Sequence Listing, preferably it has about 65% sequence identity with an amino acid sequence of the invention contained in the Sequence Listing, and most preferably it has about 92% to about 99% sequence identity with an amino acid sequence of the invention contained in the Sequence Listing; the polypeptide has an amino acid sequence essentially the same as an amino acid sequence of the invention contained in the Sequence Listing;
the polypeptide is at least 5, 1 ~, 2 J, 50, 100, or I 50 amino acid residues in length; the polypeptide includes at least 5, preferably at least 10, more preferably at least 20, more preferably at least 50, 100, or I SO contiguous amino acid residues of the invention contained in the Sequence Listing. In yet another preferred embodiment, the amino acid sequence which differs in sequence identity by about 7% to about 8% from the H. pylori amino acid sequences of the invention contained in the Sequence Listing is also encompassed by the invention.
___...._____ ..... r._~_..

In preferred embodiments: the H. pylori polypeptide is encoded by a nucleic acid of the invention contained in the Sequence Listing, or by a nucleic acid having at least 60%, 70%, 80%, 90%, 95%, 98%, or 99% homology with a nucleic acid of the invention contained in the Sequence Listing.
S In a preferred embodiment, the subject H. pylori polypeptide differs in amino acid sequence at 1, 2, 3, 5, 10 or more residues from a sequence of the invention contained in the Sequence Listing. The differences, however, are such that the H. pylori polypeptide exhibits an H. pylori biological activity, e.g., the H. pylori polypeptide retains a biological activity of a naturally occurring H. pylori polypeptide.
In preferred embodiments, the polypeptide includes all or a fragment of an amino acid sequence of the invention contained in the Sequence Listing; fused, in reading frame, to additional amino acid residues, preferably to residues encoded by genomic DNA 5' or 3' to the genomic DNA which encodes a sequence of the invention contained in the Sequence Listing.
In yet other preferred embodiments, the H. pylori polypeptide is a recombinant fusion protein having a first H. pylori polypeptide portion and a second polypeptide portion, e.g., a second polypeptide portion having an amino acid sequence unrelated to H. pylori. The second polypeptide portion can be, e.g., any of glutathione-S-transferase, a DNA binding domain, or a polymerase activating domain. In preferred embodiment the fusion protein can be used in a two-hybrid assay.
Polypeptides of the invention include those which arise as a result of alternative transcription events, alternative RNA splicing events, and alternative translational and postranslational events.
The invention also encompasses an immunogenic component which includes at least one H. pylori polypeptide in an immunogenic preparation; the immunogenic component being capable of eliciting an immune response specific for the H.
pylori polypeptide, e.g., a humoral response, an antibody response, or a cellular response. In preferred embodiments, the immunogenic component comprises at least one antigenic determinant from a polypeptide of the invention contained in the Sequence Listing.
In another aspect, the invention provides a substantially pure nucleic acid having a nucleotide sequence which encodes an H. pylori polypeptide. In preferred embodiments: the encoded polypeptide has biological activity; the encoded polypeptide has an amino acid sequence at least 60%, 70%, 80%, 90%, 95%, 98%, or 99%
homologous to an amino acid sequence of the invention contained in the Sequence Listing; the encoded polypeptide has an amino acid sequence essentially the same as an amino acid sequence of the invention contained in the Sequence Listing; the encoded polypeptide is at least 5, 10, 20, 50, 100, or 150 amino acids in length; the encoded polypeptide comprises at least 5, preferably at least 10, more preferably at least 20, more preferably at least 50, 100, or 150 contiguous amino acids of the invention contained in the Sequence Listing.
In preferred embodiments: the nucleic acid of the invention is that contained in the Sequence Listing; the nucleic acid is at least 60%, 70%, 80%, 90%, 95%, 98%, or 99% homologous with a nucleic acid sequence of the invention contained in the Sequence Listing.
In a preferred embodiment, the encoded H. pylori polypeptide differs (e.g., by amino acid substitution, addition or deletion of at least one amino acid residue) in amino acid sequence at 1, 2, 3, 5, 10 or more residues, from a sequence of the invention contained in the Sequence Listing. The differences, however, are such that:
the H.
pylori encoded polypeptide exhibits a H. pylori biological activity, e.g., the encoded H.
pylori enzyme retains a biological activity of a naturally occurring H.
pylori.
In preferred embodiments, the encoded polypeptide includes all or a fragment of an amino acid sequence of the invention contained in the Sequence Listing;
fused, in reading frame, to additional amino acid residues, preferably to residues encoded by genomic DNA 5' or 3' to the genomic DNA which encodes a sequence of the invention contained in the Sequence Listing.
In preferred embodiments, the subject H. pylori nucleic acid will include a transcriptional regulatory sequence, e.g. at least one of a transcriptional promoter or transcriptional enhancer sequence, operably linked to the H. pylori gene sequence, e.g., to render the H. pylori gene sequence suitable for expression in a recombinant host cell.
In yet a further preferred embodiment, the nucleic acid which encodes an H.
pylori polypeptide of the invention, hybridizes under stringent conditions to a nucleic acid probe corresponding to at least 8 consecutive nucleotides of the invention contained in the Sequence Listing; more preferably to at least 12 consecutive nucleotides of the invention contained in the Sequence Listing; more preferably to at least 20 consecutive nucleotides of the invention contained in the Sequence Listing; more preferably to at least 40 consecutive nucleotides of the invention contained in the Sequence Listing.
In a preferred embodiment, the nucleic acid encodes a peptide which differs by at least one amino acid residue from the sequences of the invention contained in the Sequence Listing.
In a preferred embodiment, the nucleic acid differs by at least one nucleotide from a nucleotide sequence of the invention contained in the Sequence Listing which encodes amino acids of the invention contained in the Sequence Listing.
In another aspect, the invention encompasses: a vector including a nucleic acid which encodes an H. pylori polypeptide or an H. pylori polypeptide variant as described herein; a host cell transfected with the vector; and a method of producing a recombinant H. pylori poiypeptide or H. pylori polypeptide variant; including culturing the cell, e.g., in a cell culture medium, and isolating the H. pylori or H. pylori polypeptide variant, e.g., from the cell or from the cell culture medium.
In another aspect, the invention features, a purified recombinant nucleic acid having at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% homology with a sequence of the invention contained in the Sequence Listing.
The invention also provides a probe or primer which includes a substantially purified oligonucleotide. The oligonucleotide includes a region of nucleotide sequence which hybridizes under stringent conditions to at least 8 consecutive nucleotides of sense or antisense sequence of the invention contained in the Sequence Listing, or naturally occurring mutants thereof. In preferred embodiments, the probe or primer further includes a label group attached thereto. The label group can be, e.g., a radioisotope, a fluorescent compound, an enzyme, and/or an enzyme co-factor.
Preferably the oligonucleotide is at least 8 and less than 10, 20, 30, 50, 100, or 150 nucleotides in length.
The invention also provides an isolated H. pylori polypeptide which is encoded by a nucleic acid which hybridizes under stringent hybridization conditions to a nucleic acid contained in the Sequence Listing.
The invention further provides nucleic acids, e.g., RNA or DNA, encoding a polypeptide of the invention. This includes double stranded nucleic acids as well as coding and antisense single strands.
The H. pylori strain, from which genomic sequences have been sequenced, has been deposited in the American Type Culture Collection (ATCC # 55679;
deposited by Genome Therapeutics Corporation, 100 Beaver Street, Waltham, MA 02154) as strain HP-J99.
Included in the invention are: allelic variations; natural mutants; induced mutants; proteins encoded by DNA that hybridizes under high or low stringency conditions to a nucleic acid which encodes a polypeptide of the invention contained in the Sequence Listing (for definitions of high and low stringency see Current Protocols in Molecular Biology, John Wiley & Sons, New Ynrk. 1989, 6.3.1 - 6.3.6 and 6.4.1-6.4.10, hereby incorporated by reference); and, polypeptides specifically bound by antisera to H.
pylori polypeptides, especially by antisera to an active site or binding domain of H.
- pylori polypeptide. The invention also includes fragments, preferably biologically active fragments. These and other polypeptides are also referred to herein as H. pylori polypeptide analogs or variants.

Putative functions have been determined for several of the H. pylori polypeptides of the invention, as shown in Table 1.
Accordingly, uses of the claimed H. pylori polypeptides based on these identified functions, as well as other functions as described herein, are also within the scope of the S invention.
In addition, the present invention encompasses H. pylori polypeptides characterized as shown in Table 1 below, including: H. pylori cell envelope proteins, H.
pylori secreted proteins, H. pylori cytoplasmic proteins and H. pylori cellular proteins.
Members of these groups were identified by BLAST homology searches and by searches for secretion signal or transmembrane protein motifs. Polypeptides related by significant homology to the polypeptides of Table 1 are also considered to be classified in the manner of the homologs shown in Table 1.

ntSeqID[PCT]aaSeqID[PCT]

A. CELL ENVELOPE

A.1 Flagella-associated hp1p13939_24322162_f3_17 63 160 A.2 Outer membrane A.2.1 Terminal phe residue 02ge10116 23462 f2_43 7 104 02ge10116 804550 f2_44 8 105 02ge41622 14875000 c2 9 106 01cp20708 214843 c2 49 13 110 01cp20708 4960952 c1 43 14 111 06ae11016 4729625 c3 68 23 120 06ep10615 49068 c2 87 24 121 06gp71906 35158328 f3 27 124 06gp71906 3941642 f2 70 28 125 13ae10610 156411 c3 33 50 147 13ae10610 6522827 c3 -37 51 148 hp4e53394_11798952_c2_10161 158 06ge20501 4298568 c3 53 79 176 11ae12004 3367666 c2 41 80 177 hp7e10433_5345837 c3_13 84 181 14ce61516_2460~ g 1' i_f2_985 182 11ap20714 2077 c3 103 91 188 02cp10615 21908138 f1 94 191 A.2.2 No terminal phe residue 07gp11909_26460892 f2 5 102 A.2.3 Phe and Tyr cluster at C-terminus 02ge41622 34176513 c1 11 108 06gp71906 20486556_f2 26 123 hp7e10520_14728137_f1_1 36 133 02ae31010 417818 f3 29 2 139 13ae10610 26855313 f3 52 149 A.2.4 Via homology hp5p15212_13729635_c3_35 22 119 07ee11402 1046877 c3 100 29 126 14ee41924 1046877 c3 104 30 127 hp1p13939 21641016 f1 65 162 ~

hp4p62853_ 66 163 4766691_f3 23 A.3 Inner membrane A.3.1 Proteins involved in transport 06cp30603 664083 c1 94 48 145 09cp10713 36359687 c1_11949 146 04ep4i903 16667055 c1_37 17 114 04ep41903 19689182 c1 18 115 14ce31519 24650009 c1 19 116 09ce10413 26734687 f3 43 140 hp6p10904_6726062_f3_13 44 141 A.3.2 Other inner membrane proteins 02ae31010 16679640 f2 38 135 07ee50709 16679640 f3 39 136 A.4 Other cell envelope proteins 01ce61016 1056562 c3 123 1 gg 09cp61003 16619192 c2 2 gg 02ge10116 15632000 c2 6 103 04ae61517 12345837 f2 34 131 04ae61517 21744091 f3 35 132 hp4e13394_26750068_c3_11360 157 hp5p15575_1053590_c1_35 69 166 hp7e10433_5345837_c2_8 83 180 B. CYTOPLASMIC PROTEINS

B.1. Proteins involved in mRNA
translation hp3e10946_32609412 f3 57 154 hp3e10946_34175837_f3_3 58 155 B.2 Proteins involved in genome replication, transcription, recombination and repair _ 14ce61516 12600937 f2 86 183 14cp11908 25402267 c3 87 184 B.3 Other cytoplasmic proteins 05ce10910 23712780 ci 88 1 85 _ hp7e10192_237i2780_f2_5 89 186 11ap20714 34663910 f3 92 189 hp8e10065 4962812 f2 18 93 190 C. SECRETED PROTEINS

01ce61016 23593955 c3 3 100 09cp61003 23593955 c1 4 101 02ge41622 20730462 f1_19 10 107 01cp20708 10628177 c2 12 109 05ae30220 24415693 c3 20 117 06gp10409 4015687 f2 11 25 122 hp2e10911_10213593 c1_73 31 128 hp2e10911_35567005_c2_88 32 129 09ze10333 1457137 f3 11 45 142 06cp30603 10744075 c3 46 143 12ae10622 30273255 f1 53 150 05ce10208 4707035 c2 17 64 161 -06ep30223 176437 c2 134 67 164 hp5p15575_26016387_f2_16 70 167 hp6p12244_4881375_c3_97 77 174 06ce20610 34647187 c2 78 175 hp7e10433_36339535 f3_3 81 17$

hp7e10433_36339535_f3_3 82 179 hp7e10420_24391078_f1_3 90 187 02ce71018 35720091 c3 95 192 hpE~10363_30517031_f3_3 97 194 D. OTHER CELLULAR PROTEINS

01ae11010 26437877 c2 15 112 hp4p33322_5891077_c2 45 16 113 hp3p21118_54628_c3_3 21 118 02ae31010 1064125 f1 11 33 130 hp2e10911_15680337_c3_10537 134 hp2e10911_24804577_c3_10440 137 hp2e10911_32234750_c1_68 41 138 06cp30603 26070252 c3 47 144 03ae10804 235286 f3 19 54 151 09ge11604 4804692 c1 8 55 152 hp2p10610_21987687 c2 56 153 hp4e13394_26182793 f2 59 156 hp4e53394 2082126 c2 102 62 159 06ep30223 25402187 c1 68 165 hp6e10491_12712706_f3_12 71 168 hp6p12129_12542880_c3 72 169 hp6p12129 17067265 c3_29 73 170 hp6p12129_214055 f1 2 74 171 hp6p12129_214055_f3_17 75 172 hp6p12244_33492712_c3_88 76 173 hp1e13054 22360653_f2 96 193 [In Table l, "nt" represents nucleotide Seq. ID number and "aa" represents amino acid Seq. ID number]
_ .___ _ . __. _.~~.___..

Definitions The terms "purified polypeptide" and "isolated polypeptide" and "a substantially pure preparation of a polypeptide" are used interchangeably herein and, as used herein, mean a poIypeptide that has been substantially, and preferably completely, separated from other proteins, lipids, and nucleic acids with which it naturally occurs.
Preferably, the polypeptide is also separated from substances, e.g., antibodies or gel matrix, e.g., polyacrylamide, which are used to purify it. Preferably, the polypeptide constitutes at least 10, 20, SO 70, 80 or 95% dry weight of the purified preparation.
Preferably, the preparation contains: sufficient polypeptide to allow protein sequencing; at least 1, 10, or 100 pg of the polypeptide; at least 1, 10, or 100 mg of the polypeptide.
Furthermore, the terms "purified polypeptide" and "isolated polypeptide" and "a substantially pure preparation of a polypeptide," as used herein, refer to both a polypeptide obtained from nature or produced by recombinant DNA techniques as described herein.
For example, an "isolated" or "purified" protein or biologically active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the H. pylori protein is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized. The language "substantially free of cellular material" includes preparations of H.
pylori protein in which the protein is separated from cellular components of the cells from which it is isolated or recombinantly produced. In one embodiment, the language "substantially free of cellular material" includes preparations of H. pylori protein having less than about 30% (by dry weight) of non-H. pylori protein (also referred to herein as a "contaminating protein"), more preferably less than about 20% of non-H. pylori protein, still more preferably Less than about 10% of non-H. pylori protein, and most preferably less than about 5% non-H. pylori protein. When the H. pylori protein or biologically active portion thereof is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, more preferably less than about 10%, and most preferably less than about 5% of the volume of the protein preparation.
The language "subst ntially free of chemical precursors or other chemicals"
includes preparations of H. pylori protein ial which the protein is separated from chemical precusors or other chemicals which are involved in the synthesis of the protein.
In one embodiment, the language "substantially free of chemical precursors or other chemicals" includes preparations of H. pylori protein having less than about 30% (by dry weight) of chemical precursors or non-H. pylori chemicals, more preferably less than about 20% chemical precursors or non-H. pylori chemicals, still more preferably less than about 10% chemical precursors or non-H. pylori chemicals, and most preferably less than about 5% chemical precursors or non-H. pylori chemicals.
A purified preparation of cells refers to, in the case of plant or animal cells, an in vitro preparation of cells and not an entire intact plant or animal. In the case of cultured cells or microbial cells, it consists of a preparation of at least 10% and more preferably 50% of the subject cells.
A purified or isolated or a substantially pure nucleic acid, e.g., a substantially pure DNA, (are terms used interchangeably herein) is a nucleic acid which is one or both of the following: not immediately contiguous with both of the coding sequences with which it is immediately contiguous (i.e., one at the 5' end and one at the 3' end) in the naturally-occurring genome of the organism from which the nucleic acid is derived; or which is substantially free of a nucleic acid with which it occurs in the organism from which the nucleic acid is derived. The term includes, for example, a recombinant DNA
which is incorporated into a vector, e.g., into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other DNA sequences. -Substantially pure DNA also includes a recombinant DNA which is part of a hybrid gene encoding additional H. pylori DNA sequence.
A "contig" as used herein is a nucleic acid representing a continuous stretch of genomic sequence of an organism.
An "open reading frame", also referred to herein as ORF, is a region of nucleic acid which encodes a polypeptide. This region may represent a portion of a coding sequence or a total sequence and can be determined from a stop to stop codon or from a start to stop codon.
As used herein, a "coding sequence" is a nucleic acid which is transcribed into messenger RNA and/or translated into a polypeptide when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a translation start codon at the five prime terminus and a translation stop code at the three prime terminus. A coding sequence can include but is not limited to messenger R:~1A, synthetic DNA, and recombinant nucleic acid sequences.
A "complement" of a nucleic acid as used herein referes to an anti-parallel or antisense sequence that participates in Watson-Crick base-pairing with the original sequence.
A "gene product" is a protein or structural RNA which is specifically encoded by a gene.

As used herein, the term "probe" refers to a nucleic acid, peptide or other chemical entity which specifically binds to a molecule of interest. Probes are often associated with or capable of associating with a label. A label is a chemical moiety capable of detection. Typical labels comprise .dyes, radioisotopes, luminescent and chemiluminescent moieties, fluorophores, enzymes, precipitating agents, amplification sequences, and the like. Similarly, a nucleic acid, peptide or other chemical entity which specifically binds to a molecule of interest and immobilizes such molecule is referred herein as a "capture ligand". Capture ligands are typically associated with or capable of associating with a support such as nitro-cellulose, glass, nylon membranes, beads, particles and the like. The specificity of hybridization is dependent on conditions such as the base pair composition of the nucleotides, and the temperature and salt concentration of the reaction. These conditions are readily discernable to one of ordinary skill in the art using routine experimentation.
Homologous refers to the sequence similarity or sequence identity between two 1 S polypeptides or between two nucleic acid molecules. When a position in both of the two compared sequences is occupied by the same base or amino acid monomer subunit, e.g., if a position in each of two DNA molecules is occupied by adenine, then the molecules are homologous at that position. The percent of homology between two sequences is a function of the number of matching or homologous positions shared by the two sequences divided by the number of positions compared x 100. For example, if 6 of 10 of the positions in two sequences are matched or homologous then the two sequences are 60% homologous. By way of example, the DNA sequences ATTGCC and TATGGC
share 50% homology. Generally, a comparison is made when two sequences are aligned to give maximum homology.
Nucleic acids are hybridizable to each other when at least one strand of a nucleic acid can anneal to the other nucleic acid under defined stringency conditions.
Stringency of hybridization is determined by: (a) the temperature at which hybridization andlor washing is performed; and. (b) the ionic strength and polarity of the hybridization and washing solutions. Hybridization requires that the two nucleic acids contain complementary sequences; depending on the stringency of hybridization, however, mismatches may be tolerated. Typically, hybridization of two sequences at high stingency (such as, for example, in a solution of 0.5X SSC, at 65° C) requires that the sequences be essentially completely homologous. - Conditions of intermediate stringency (such as, for example, 2X SSC at 65 ° C) and low stringency (such as, for example 2X
SSC at 55° C), require correspondingly less overall complementarity between the hybridizing sequences. ( 1 X SSC is 0.15 M NaCI, 0.015 M Na citrate). A
preferred, non-limiting example of stringent hybridization conditions are hybridization in 6X

WO 98124475 PCTfUS97/22104 sodium chIoride/sodium citrate (SSC) at about 45~C, followed by one or more washes in 0.2 X SSC, 0.1% SDS at 50-65pC.
The terms peptides, proteins, and polypeptides are used interchangeably herein.
As used herein, the term "surface protein" refers to all surface accessible proteins, e.g. inner and outer membrane proteins, proteins adhering to the cell wall, and secreted proteins.
A polypeptide has H. pylori biological activity if it has one, two and preferably more of the following properties: (1) if when expressed in the course of an H.
pylori infection, it can promote, or mediate the attachment of H. pylori to a cell;
(2) it has an enzymatic activity, structural or regulatory function characteristic of an N.
pylori protein; (3) the gene which encodes it can rescue a lethal mutation in an H.
pylori gene;
(4) or it is immunogenic in a subject. A polypeptide has biological activity if it is an antagonist, agonist, or super-agonist of a polypeptide having one of the above-listed properties.
A biologically active fragment or analog is one having an in vivo or in vitro activity which is characteristic of the H. pylori polypeptides of the invention contained in the Sequence Listing, or of other naturally occurring H. pylori polypeptides, e.g., one or more of the biological activities described herein. Especially preferred are fragments which exist in vivo, e.g., fragments which arise from post transcriptional processing or which arise from translation of alternatively spliced RNA's. Fragments include those expressed in native or endogenous cells as well as those made in expression systems, e.g., in CHO cells. Because peptides such as H. pylori polypeptides often exhibit a range of physiological properties and because such properties may be attributable to different portions of the molecule, a useful H. pylori fragment or H. pylori analog is one which exhibits a biological activity in any biological assay for H. pylori activity. Most preferably the fragment or analog possesses 10%, preferably 40%, more preferably 60%, 70%, 80% or 90% or greater of the activity of H. pylori, in any in vivo or in vitro assay.
Analogs can differ from naturally occurring H. pylori polypeptides in amino acid sequence or in ways that do not involve sequence, or both. Non-sequence modifications include changes in acetylation, methylation, phosphorylation, carboxylation, or glycosylation. Preferred analogs include H. pylori polypeptides (or biologically act'.ve fragments thereof) whose sequences differ from the wild-type sequence by one or more conservative amino acid substitutions or by one or more non-conservative amino acid substitutions, deletions, or insertions which do not substantially diminish the biological activity of the H. pylori polypeptide. Conservative substitutions typically include the substitution of one amino acid for another with similar characteristics, e.g., substitutions within the following groups: valine, gIycine; glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. Other conservative substitutions can be made in view of the table below.

CONSERVATIVE AMINO ACID REPLACEMENTS
For Amino Acid Code Replace with any of Alanine A D-Ala, Gly, beta-Ala, L-Cys, D-Cys Arginine R - D-Arg, Lys, D-Lys, homo-Arg, D-homo-Arg, Met, Ile, D-Met, D-Ile, Orn, D-Orn Asparagine N D-Asn, Asp, D-Asp, Glu, D-Glu, Gln, D-Gln Aspartic Acid D D-Asp, D-Asn, Asn, Glu, D-Glu, Gln, D-Gln Cysteine C D-Cys, S-Me-Cys, Met, D-Met, Thr, D-Thr Glutamine Q D-Gln, Asn, D-Asn, Glu, D-Giu, Asp, D-Asp Glutamic Acid E D-Glu, D-Asp, Asp, Asn, D-Asn, Gln, D-Gln Glycine G Ala, D-Ala, Pro, D-Pro, J3-Ala, Acp Isoleucine I D~~IIe, Val, D-Val, Leu, D-Leu, Met, D-Met Leucine L D-Leu, Val, D-Val, Leu, D-Leu, Met, D-Met Lysine K D-Lys, Arg, D-Arg, homo-Arg, D-homo-Arg, Met, D-Met, Ile, D-Ile, Orn, D-Orn Methionine M D-Met, S-Me-Cys, Ile, D-Ile, Leu, D-Leu, Val, D-Val Phenylalanine F D-Phe, Tyr, D-Thr, L-Dopa, His, D-His, Trp, D-Trp, Trans-3,4, or 5-phenylproline, cis-3,4, or 5-phenylproline Proline P D-Pro, L-I-thioazolidine-4-carboxylic acid, D-or L-1-oxazolidine-4-carboxylic acid Serine S D-Ser, Thr, D-Thr, alto-Thr, Met, D-Met, Met(O), D-Met(O), L-Cys, D-Cys Threonine T D-Thr, Ser, D-Ser, allo-Thr, Met, D-Met, Met(O), D-Met(O), Val, D-Val Tyrosine Y D-Tyr, Phe, D-Phe, L-Dopa, His, D-His Valine V D-Val, Leu, D-Leu, Ile, D-Ile, Met, D-Met Other analogs within the invention are those with modifications which increase peptide stability; such analogs may contain, for example, one or more non-peptide bonds (which replace the peptide bonds) in the peptide sequence. Also included are:
analogs that include residues other than naturally occurring L-amino acids, e.g., D-amino acids or non-naturally occurring or synthetic amino acids, e.g., ~i or y amino acids; and cyclic analogs.
As used herein, the term "fragment", as applied to an X. pylori analog, will ordinarily be at least about 20 residues, more typically at least about 40 residues, preferably at least about 60 residues in length. Fragments of H pylori polypeptides can be generated by methods known to those skilled in the art. The ability of a candidate fragment to exhibit a biological activity of H. pylori polypeptide can be assessed by methods known to those skilled in the art as described herein. Also included are H.
pylori polypeptides containing residues that are not required for biological activity of the peptide or that result from alternative mRNA splicing or alternative protein processing events.
An "immunogenic component" as used herein is a moiety, such as an H. pylori polypeptide, analog or fragment thereof, that is capable of eliciting a humoral and/or cellular immune response in a host animal alone or in combination with an adjuvant.
An "antigenic component" as used herein is a moiety, such as an H. pylori polypeptide, analog or fragment thereof, that is capable of binding to a specific antibody with sufficiently high affinity to form a detectable antigen-antibody complex.
As used herein, the term "transgene" means a nucleic acid (encoding, e.g., one or more polypeptides), which is partly or entirely heterologous, i.e., foreign, to the transgenic animal or cell into which it is introduced, or, is homologous to an endogenous gene of the transgenic animal or cell into which it is introduced, but which is designed to be inserted, or is inserted, into the cell's genome in such a way as to alter the genome of the cell into which it is inserted (e.g., it is inserted at a location which differs from that of the natural gene or its insertion results in a knockout). A transgene can include one or more transcriptional regulatory sequences and any other nucleic acid, such as introns, that may be necessary for optimal expression of the selected nucleic acid, all operably linked to the selected nucleic acid, and may include an enhancer sequence.
As used-herein, the term "transgenic cell" refers to a cell containing a transgene.
As used herein, a "transgenic animal" is any animal in which one or more, and preferably essentially all, of the cells of the animal includes a transgene.
The transgene can be introduced into the cell, directly or indirectly by introduction into a precursor of the cell, by way of deliberate genetic manipulation, such as by a process of transformation of competent cells or by microinjection or by infection with a recombinant virus. This molecule may be integrated within a chromosome, or it may be extrachromosomallv r~:plicating DNA.
The term "antibody" as used herein is intended to include fragments thereof which are specifically reactive with H. pylori polypeptides.
As used herein, the term "cell-specific promoter" means a DNA sequence that serves as a promoter, i.e., regulates expression of a selected DNA sequence operably linked to the promoter, and which effects expression of the selected DNA
sequence in specifc cells of a tissue. The term also covers so-called "leaky" promoters, which regulate expression of a selected DNA primarily in one tissue, but cause expression in other tissues as well.
Misexpression, as used herein, refers to a non-wild type pattern of gene expression. It includes: expression at non-wild type levels, i.e., over or under S expression; a pattern of expression that differs from wild type in terms of the time or stage at which the gene is expressed, e.g., increased or decreased expression (as compared with wild type) at a predetermined developmental period or stage; a pattern of expression that differs from wild type in terms of decreased expression (as compared with wild type) in a predetermined cell type or tissue type; a pattern of expression that differs from wild type in terms of the splicing size, amino acid sequence, post-transitional modification, or biological activity of the expressed polypeptide; a pattern of expression that differs from wild type in terms of the effect of an environmental stimulus or extracellular stimulus on expression of the gene, e.g., a pattern of increased or decreased expression (as compared with wild type) in the presence of an increase or decrease in the strength of the stimulus.
As used herein, "host cells" and other such terms denoting microorganisms or higher eukaryotic cell lines cultured as unicellular entities refers to cells which can become or have been used as recipients for a recombinant vector or other transfer DNA, and include the progeny of the original cell which has been transfected. It is understood by individuals skilled in the art that the progeny of a single parental cell may not necessarily be completely identical in genomic or total DNA compliment to the original parent, due to accident or deliberate mutation.
As used herein, the term "control sequence" refers to a nucleic acid having a base sequence which is recognized by the host organism to effect the expression of encoded sequences to which they are ligated. The nature of such control sequences differs depending upon the host organism; in prokaryotes, such control sequences generally include a promoter, ribosomal binding site, terminators, and in some cases operators; in eukaryotes, generally such control sequences include promoters, terminators and in some instances, enhancers. The term control sequence is intended to include at a - 30 minimum, all components whose presence is necessary for expression, and may also include additional components whose presence is advantageous, for example, leader sequences.
As used herein, the term "operably linked" refers to sequences joined or ligated to function in their intended manner. For example, a control sequence is operably linked to coding sequence by ligation in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequence and host cell.

The metabolism of a substance, as used herein, means any aspect of the, expression, function, action, or regulation of the substance. The metabolism of a substance includes modifications, e.g., covalent or non-covalent modifications of the substance. The metabolism of a substance includes modifications, e.g., covalent or non-covalent modification, the substance induces in other substances. The metabolism of a substance also includes changes in the distribution of the substance. The metabolism of a substance includes changes the substance induces in the distribution of other substances.
A "sample" as used herein refers to a biological sample, such as, for example, tissue or fluid isloated from an individual (including without limitation plasma, serum, cerebrospinal fluid, lymph, tears, saliva and tissue sections) or from in vitro cell culture constituents, as well as samples from the environment.
The practice of the invention will employ, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See e.g., Sambrook, Fritsch, and Maniatis, Molecular Cloning; Laboratory Manual 2nd ed. (1989); DNA Cloning, Volumes I and II (D.N
Glover ed. 1985); Oligonucleotide Synthesis (M.J. Gait ed, 1984); Nucleic Acid Hybridization (B.D. Hames & S.J. Higgins eds. 1984); the series, Methods in Enzymoloqy (Academic Press, Inc.), particularly Vol. 154 and Vol. 155 (Wu and Grossman, eds.) and PCR-A Practical Approach (McPherson, Quirke, and Taylor, eds., 1991 ).
I. Isolation of Nucleic Acids of H.~vlori and Uses Therefor H. pylori Genomic Sequence This invention provides nucleotide sequences of the genome of H. pylori which thus comprises a DNA sequence library of H. pylori genomic DNA.The detailed description that follows provides nucleotide sequences of H. pylori, and also describes how the sequences were obtained and how ORFs and protein-coding sequences were identified. Also described are methods of using the disclosed H. pylori sec uences in methods including diagnostic and therapeutic applications. Furthermore, the library can be used as a database for identification and comparison of medically important sequences in this and other strains of H. pylori.
To determine the genomic sequence of H. pylori, DNA was isolated from a strain of H. pylori (ATCC # 55679; deposited by Genome Therapeutics Corporation, 100 Beaver Street, Waltham, MA 02154) and mechanically sheared by nebulization to a median size of 2 kb. Following size fractionation by gel electrophoresis, the fragments were blunt-ended, ligated to adapter oligonucleotides, and cloned into each of different pMPX vectors (Rice et al., abstracts of Meeting of Genome Mapping and Sequencing, Cold Spring Harbor, NY, 5/I 1-5/15, 1994, p. 225) to construct a series of S "shotgun" subclone libraries.
DNA sequencing was achieved using multiplex sequencing procedures essentially as disclosed in Church et al., 1988, Science 240:185; U.S. Patents No.
4,942,124 and 5,149,625). DNA was extracted from pooled cultures and subjected to chemical or enzymatic sequencing. Sequencing reactions were resolved by electrophoresis, and the products were transferred and covalently bound to nylon membranes. Finally, the membranes were sequentially hybridized with a series of labelled oligonucleotides complimentary to "tag" sequences present in the different shotgun cloning vectors. In this manner, a large number of sequences could be obtained from a single set of sequencing reactions. The cloning and sequencing procedures are described in more detail in the Exemplification.
Individual sequence reads obtained in this manner were assembled using the FALCONTM program (Church et al., 1994, Automated DNA Sequencing and Analysis, J.C. Venter, ed., Academic Press) and PHRAP (P. Green, Abstracts of DOE Human Genome Program Contractor-Grantee Workshop V, Jan. 1996, p.157). The average contig length was about 3-4 kb.
A variety of approaches are used to order the contigs so as to obtain a continuous sequence representing the entire H. pylori genome. Synthetic oligonucleotides are designed that are complementary to sequences at the end of each contig. These oligonucleotides may be hybridized to libaries of H. pylori genomic DNA in, for example, lambda phage vectors or plasmid vectors to identify clones that contain sequences corresponding to the functional regions between individual contigs.
Such clones are then used to isolate template DNA and the same oligonucleotides are used as primers in polymerase chain reaction (PCR) to amplify functional fragments, the nucleotide sequence of which is then determined.
The H. pylori sequences were analyzed for the presence of open reading frames (ORFs) comprising at least 180 nucleotides As a result of the analysis of ORFs based on stop-to-stop codon reads, it should be understood that these ORFs may not correspond to the ORF of a naturally-occurring H. pylori polypeptide. These ORFs may contain start codons which indicate the initiation of protein synthesis of a naturally-occurnng H. pylori polypeptide. Such start codons within the ORFs provided herein can be identified by those of ordinary skill in the relevant art, and the resulting ORF and the encoded H. pylori polypeptide is within the scope of this invention. For example, within the ORFs a codon such as AUG or GUG (encoding methionine or valine) which is part of the initiation signal for protein synthesis can be identified and the ORF
modified to correspond to a naturally-occurring H. pylori polypeptide. The predicted coding regions were defined by evaluating the coding potential of such sequences with the program GENEMARKT"' (Borodovsky and McIninch, 1993, Comp. Chem. 17:123).
Other H. pylori Nucleic Acids The nucleic acids of this invention may be obtained directly from the DNA of the above referenced H. pylori strain by using the polymerase chain reaction (PCR). See "PCR, A Practical Approach" (McPherson, Quirke, and Taylor, eds., IRL Press, Oxford, UK, 1991 ) for details aboutthe PCR. High fidelity PCR can be used to ensure a faithful DNA copy prior to expression. In addition, the authenticity of amplified products can be checked by conventional sequencing methods. Clones carrying the desired sequences described in this invention may also be obtained by screening the libraries by means of the PCR or by hybridization of synthetic oligonucleotide probes to filter lifts of the library colonies or plaques as known in the art (see, e.g., Sambrook et al., Molecular Cloning, A Laboratory Manual 2nd edition, 1989, Cold Spring Harbor Press, NY).
It is also possible to obtain nucleic acids encoding H. pylori polypeptides from a cDNA library in accordance with protocols herein described. A cDNA encoding an H.
pylori polypeptide can be obtained by isolating total mRNA from an appropriate strain.
Double stranded cDNAs can then be prepared from the total mRNA. Subsequently, the cDNAs can be inserted into a suitable plasmid or viral (e.g., bacteriophage) vector using any one of a number of known techniques. Genes encoding H. pylori polypeptides can also be cloned using established polymerase chain reaction techniques in accordance with the nucleotide sequence information provided by the invention. The nucleic acids of the invention can be DNA or RNA. Preferred nucleic acids of the invention are contained in the Sequence Listing.
The nucleic acids of the invention can also be chemically synthesized using standard techniques. Various methods of chemically synthesizing polydeoxynucleotides -- 30 are known, including solid-phase synthesis which, like peptide synthesis, has been fully automated in commercially available DNA synthesizers (See e.g., Itakura et al.
U.S.
Patent No. 4,598,049; Caruthers et al. U.S. Patent No. 4,458,066; and Itakura U.S.
Patent Nos. 4,401,796 and 4,373,071, incorporated by reference herein).
Nucleic acids isolated or synthesized in accordance with features of the present invention are useful, by way of example, without limitation, as probes, primers, capture ligands, antisense genes and for developing expression systems for the synthesis of proteins and peptides corresponding to such sequences. As probes, primers, capture _~.._____ ligands and antisense agents, the nucleic acid normally consists of all or part (approximately twenty or more nucleotides for specificity as well as the ability to form stable hybridization products) of the nucleic acids of the invention contained in the Sequence Listing. These uses are described in further detail below.
Probes A nucleic acid isolated or synthesized in accordance with the sequence of the invention contained in the Sequence Listing can be used as a probe to specifically detect H pylori. With the sequence information set forth in the present application, sequences of twenty ar more nucleotides are identified which provide the desired inclusivity and exclusivity with respect to H. pylori, and extraneous nucleic acids likely to be encountered during hybridization conditions. More preferably, the sequence will comprise at least twenty to thirty nucleotides to convey stability to the hybridization product formed between the probe and the intended target molecules.
Sequences larger than 1000 nucleotides in length are difficult to synthesize but 1 S can be generated by recombinant DNA techniques. Individuals skilled in the art will readily recognize that the nucleic acids, for use as probes, can be provided with a label to facilitate detection of a hybridization product.
Nucleic acid isolated and synthesized in accordance with the sequence of the invention contained in the Sequence Listing can also be useful as probes to detect homologous regions (especially homologous genes) of other Helicobacter species using appropriate stringency hybridization conditions as described herein.
Capture Ligand For use as a capture ligand, the nucleic acid selected in the manner described above with respect to probes, can be readily associated with a support. The manner in which nucleic acid is associated with supports is well known. Nucleic acid having twenty or more nucleotides in a sequence of the invention contained in the Sequence Listing have utility to separate H. pylori nucleic acid from the nucleic acid of each other and other organisms. Nucleic acid having twenty or more nucleotides in a sequence of the invention contained in the Sequence Listing can also have utility to separate other Helicobacter species from each other and from other organisms. Preferably, the - sequence will comprise at least twenty nucleotides to convey stability to the hybridization product formed between the probe and the intended target molecules.
Sequences larger than 1000 nucleotides in length are difficult to synthesize but can be - generated by recombinant DNA techniques.

Primers Nucleic acid isolated or synthesized in accordance with the sequences described herein have utility as primers for the amplification of H. pylori nucleic acid. These nucleic acids may also have utility as primers for the amplification of nucleic acids in other Helicobacter species. With respect to polymerise chain reaction (PCR) techniques, nucleic acid sequences of > 10-15 nucleotides of the invention contained in the Sequence Listing have utility in conjunction with suitable enzymes and reagents to create copies of H. pylori nucleic acid. More preferably, the sequence will comprise twenty or more nucleotides to convey stability to the hybridization product formed between the primer and the intended target molecules. Binding conditions of primers greater than 100 nucleotides are more difficult to control to obtain specificity. High fidelity PCR can be used to ensure a faithful DNA copy prior to expression. In addition, amplified products can be checked by conventional sequencing methods.
The copies can be used in diagnostic assays to detect specific sequences, including genes from H. pylori and/or other Helicobacter species. The copies can also be incorporated into cloning and expression vectors to generate polypeptides corresponding to the nucleic acid synthesized by PCR, as is described in greater detail herein.
Antisense Nucleic acid or nucleic acid-hybridizing derivatives isolated or synthesized in accordance with the sequences described herein have utility as antisense agents to prevent the expression of H. pylori genes. These sequences also have utility as antisense agents to prevent expression of genes of other Helicobacter species.
In one embodiment, nucleic acid or derivatives corresponding to H. pylori nucleic acids is loaded into a suitable carrier such as a liposome or bacteriophage for introduction into bacterial cells. For example, a nucleic acid having twenty or more nucleotides is capable of binding to bacteria nucleic acid or bacteria messenger RNA.
Preferably, the antisense nucleic acid is comprised of 20 or more nucleotides to provide necessary stability of a hybridization product of non-naturally occurring nucleic acid and bacterial nucleic acid and/or bacterial messenger RNA. Nucle~c ~ aid having a sequence greater than 1000 nucleotides in length is difficult to synthesize but can be generated by recombinant DNA techniques. Methods for loading antisense nucleic acid in liposomes is known in the art as exemplified by U.S. Patent 4,241,046 issued December 23, 1980 to Papahadjopoulos et al.
_~._ _ _ r _ . _ II. Exyression of H. pylori Nucleic Acids Nucleic acid isolated or synthesized in accordance with the sequences described herein have utility to generate polypeptides. The nucleic acid of the invention exemplified in the Sequence Listing or fragments of the nucleic acid encoding active portions of H. pylori polypeptides can be cloned into suitable vectors or used to isolate nucleic acid. The isolated nucleic acid is combined with suitable DNA linkers and cloned into a suitable vector.
The function of a specific gene or operon can be ascertained by expression in a bacterial strain under conditions where the activity of the gene products) specified by the gene or operon in question can be specifically measured. Alternatively, a gene product may be produced in large quantities in an expressing strain fir use as an antigen, an industrial reagent, for structural studies, etc. This expression can be accomplished in a mutant strain which lacks the activity of the gene to be tested, or in a strain that does not produce the same gene products}. This includes, but is not limited to other 1 S Helicobacter strains, or other bacterial strains such as E. toll, Norcardia, Corynebacterium, Campylobacter, and Streptomyces species. In some cases the expression host will utilize the natural Helicobacter promoter whereas in others, it will be necessary to drive the gene with a promoter sequence derived from the expressing organism (e.g., an E. toll beta-galactosidase promoter for expression in E.
toll).
To express a gene product using the natural H. pylori promoter, a procedure such as the following can be used. A restriction fragment containing the gene of interest, together with its associated natural promoter element and regulatory sequences (identified using the DNA sequence data) is cloned into an appropriate recombinant plasmid containing an origin of replication that functions in the host organism and an appropriate selectable marker. This can be accomplished by a number of procedures known to those skilled in the art. It is most preferably done by cutting the plasmid and the fragment to be cloned with the same restriction enzyme to produce compatible ends that can be ligated to join the two pieces together. The recombinant plasmid is introduced into the~host organism by, for example, electroporation and cells containing the recombinant plasmid are identified by selection for the marker on the plasmid.
Expression of the desired gene rro~~uct is detected using an assay specific for that gene product.
In the case of a gene that requires a different promoter, the body of the gene (coding sequence) is specifically excised and cloned into an appropriate expression plasmid. This subcloning can be done by several methods, but is most easily accomplished by PCR amplification of a specific fragment and Iigation into an expression plasmid after treating the PCR product with a restriction enzyme or exonuclease to create suitable ends for cloning.
A suitable host cell for expression of a gene can be any procaryotic or eucaryotic cell. For example, an H. pylori polypeptide can be expressed in bacterial cells such as E.
coli, insect cells (baculovirus), yeast, or mammalian cells such as Chinese hamster ovary cell (CHO). Other suitable host cells are known to those skilled in the art.
Expression in eucaryotic cells such as mammalian, yeast, or insect cells can lead to partial or complete glycosylation and/or formation of relevant inter- or intra-chain disulfide bonds of a recombinant peptide product. Examples of vectors for expression in yeast S. cerivisae include pYepSec 1 (Baldari. et al., ( 1987) Embo J. 6:229-234), pMFa (Kurjan and Herskowitz, (1982) Cell 30:933-943), pJRY88 (Schultz et al., (1987) Gene 54:I 13-123), and pYES2 (Invitrogen Corporation, San Diego, CA). Baculovirus vectors available for expression of proteins in cultured insect cells (SF 9 cells) include the pAc series (Smith et al., ( 1983) Mol. Cell Biol. 3:2156-2165) and the pVL series (Lucklow, V.A., and Summers, M.D., (1989) Virology 170:31-39). Generally, COS cells (Gluzman, Y., ( 1981 ) Cell 23:175-I 82) are used in conjunction with such vectors as pCDM 8 (Aruffo, A. and Seed, B., (1987) Proc. Natl. Acad. Sci. USA 84:8573-8577) for transient amplification/expression in mammalian cells, while CHO (dhfr-Chinese Hamster Ovary) cells are used with vectors such as pMT2PC (Kaufman et al. ( 1987}, EMBO J. 6: I 87-195) for stable amplification/expression in mammalian cells.
Vector DNA can be introduced into mammalian cells via conventional techniques such as calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, or electroporation. Suitable methods for transforming host cells can be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press ( 1989)), and other laboratory textbooks.
Expression in procaryotes is most often carried out in E. coli with either fusion or non-fusion inducible expression vectors. Fusion vectors usually add a number of NH2 terminal amino acids to the expressed target gene. These NH2 terminal amino acids often are referred to as a reporter group. Such reporter groups usually serve two purposes: 1 ) to increase the solubility of the target recombinant protein;
and 2) to aid in - the parification of the target recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the reporter group and the target recombinant protein to - enable separation of the target recombinant protein from the reporter group subsequent to purification of the fusion protein. Such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin and enterokinase. Typical fusion expression vectors include pGEX (Amrad Corp., Melbourne, Australia), pMAL (New England Biolabs, Beverly, MA) and pRITS (Pharmacia, Piscataway, NJ) which fuse glutathione S-transferase, maltose E binding piotein, or protein A, respectively, to the target recombinant protein. A preferred reporter group is poly(His), which may be fused to the amino or carboxy terminus of the protein and which renders the recombinant fusion protein easily purifiable by metal chelate chromatography.
Inducible non-fusion expression vectors include pTrc (Amann et al., (1988) Gene 69:301-31 S) arid pET 1 I d (Studier et al., Gene Expression Technolo~w Methods in Enzymology 185, Academic Press, San Diego, California (1990) 60-89). While target gene expression relies on host RNA polymerase transcription from the hybrid trp-lac fusion promoter in pTrc, expression of target genes inserted into pETl 1 d relies on transcription from the T7 gn 10-lac 0 fusion promoter mediated by coexpressed viral RNA polymerase (T7 gnl). This viral polymerase is supplied by host strains BL21 (DE3) or HMS 174(DE3) from a resident ~, prophage harboring a T7 gn 1 under the transcriptional control of the IacUV 5 promoter.
1 S For example, a host cell transfected with a nucleic acid vector directing expression of a nucleotide sequence encoding an H. pylori polypeptide can be cultured under appropriate conditions to allow expression of the polypeptide to occur.
The polypeptide may be secreted and isolated from a mixture of cells and medium containing the peptide. Alternatively, the polypeptide may be retained cytoplasmically and the cells harvested, lysed and the protein isolated. A cell culture includes host cells, media and other byproducts. Suitable media for cell culture are well known in the art.
Polypeptides of the invention can be isolated from cell culture medium, host cells, or both using techniques known in the art for purifying proteins including ion-exchange chromatography, gel filtration chromatography, ultrafiltration, electrophoresis, and immunoaffinity purification with antibodies specific for such polypeptides.
Additionally, in many situations, polypeptides can be produced by chemical cleavage of a native protein (e.g., tryptic digestion) and the cleavage products can then be purified by standard techniques. _ In the case of membrane bound proteins, these can be isolated from a host cell by contacting a membrane-associated protein fraction with a detergent forming a solubilized complex, where the membrane-associated protein is no longer entirely embedded in the membrane fraction and is solubilized at least to an extent which allows it to be chromatographically isolated from the membrane fraction. Several different criteria are used for choosing a detergent suitable for solubilizing these complexes. For example, one property considered is the ability of the detergent to solubilize the H.
pylori protein within the membrane fraction at minimal denaturation of the membrane-associated protein allowing for the activity or functionality of the membrane-associated protein to return upon reconstitution of the protein. Another property considered when selecting the detergent is the critical micelle concentration (CMC) of the detergent in that the detergent of choice preferably has a high CMC value allowing for ease of removal after reconstitution. A third property considered when selecting a detergent is the hydrophobicity of the detergent. Typically, membrane-associated proteins are very hydrophobic and therefore detergents which are also hydrophobic, e.g., the triton series, would be useful for solubilizing the hydrophobic proteins. Another property important to a detergent can be the capability of the detergent to remove the H. pylori protein with minimal protein-protein interaction facilitating further purification. A fifth property of the detergent which should be considered is the charge of the detergent. For example, if it is desired to use ion exchange resins in the purification process then preferably detergent should be an uncharged detergent. Chromatographic techniques which can be used in the final purification step are known in the art and include hydrophobic interaction, lectin affinity, ion exchange, dye affinity and immunoaffinity.
1 S One strategy to maximize recombinant H. pylori peptide expression in E.
coli is to express the protein in a host bacteria with an impaired capacity to proteolytically cleave the recombinant protein (Gottesman, S., Gene Expression Technolow Methods in Enz~ogy_ I 85, Academic Press, San Diego, California (1990) 119-128).
Another strategy would be to alter the nucleic acid encoding an H. pylori peptide to be inserted into an expression vector so that the individual codons for each amino acid would be those preferentially utilized in highly expressed E. coli proteins (Wada et al., ( 1992) Nuc. Acids Res. 20:2111-2118). Such alteration of nucleic acids of the invention can be carried out by standard DNA synthesis techniques.
The nucleic acids of the invention can also be chemically synthesized using standard techniques. Various methods of chemically synthesizing polydeoxynucleotides are known, including solid-phase synthesis which, like peptide synthesis, has been fully automated in commercially available DNA synthesizers (See, e.g., Itakura et al. U.S.
Patent No. 4,598,049; Caruthers et al. U.S. Patent No. 4,458,066; and Itakura U.S.
Patent Nos. 4,401,796 and 4,373,071, incorporated by reference herein).
III. H. pylori Polypeptides This invention encompasses isolated H. pylori polypeptides encoded by the disclosed H. pylori genomic sequences, including the polypeptides of the invention contained in the Sequence Listing. Polypeptides of the invention are preferably at least 5 amino acid residues in length. Using the DNA sequence information provided herein, the amino acid sequences of the polypeptides encompassed by the invention can be deduced using methods well-known in the art. It will be understood that the sequence of an entire nucleic acid encoding an H. pylori polypeptide can be isolated and identified based on an ORF that encodes only a fragment of the cognate protein-coding region.
This can be acheived, for example, by using the isolated nucleic acid encoding the ORF, or fragments thereof, to prime a polymerise chain reaction with genomic H.
pylori DNA
as template; this is followed by sequencing the amplified product.
The polypeptides of the invention can be isolated from wild-type or mutant H.
pylori cells or from heterologous organisms or cells (including, but not limited to, bacteria, yeast, insect, plant and mammalian cells) into which an H. pylori nucleic acid has been introduced and expressed. In addition, the polypeptides can be part of recombinant fusion proteins.
H. pylori polypeptides of the invention can be chemically synthesized using commercially automated procedures such as those referenced herein.
H. pylori polypeptides of the invention are also intended to include chimeric proteins and truncated proteins as decribed herein.
Chimeric H. pylori proteins H. pylori chimeric polypeptides comprise one or more H. pylori polypeptides fused together. These combined sequences can be made by combining two or more genes, or two or more polypeptide encoding sequences, or at least one gene and at least one polypeptide encoding sequence in tandem, and the subsequent expression of the encoded proteins by conventional molecular biological techniques. The combined nucleotide sequences may be composed of a combination of either full length H.
pylori nucleotide sequences or fragments of such sequences, e.g., fragments which contain immunoIogically relevant portions of the encoded H. pylori protein. These chimeric H.
pylori proteins then contain the combined or synergistic vaccine potential of each individual H. pylori protein sequence and can be used in vaccine formulations of the invention.
Truncated~ene expression and,proteinproduction H. pylori proteins encoded by a given nucleotide sequence can also be used in a biologically active truncat ~d form. Such truncation can be produced, for example, by the elimination of either 5' and/or 3' regions of the encoding nucleotide sequence.
These truncations can affect recombinant expression of the encoded protein and/or subsequent purification of the protein. For example, truncation of a nucleotide sequence encoding a predicted export sequence of a specific protein may alter expression of the protein. Alternatively, C-terminal truncation of an H. pylori polypeptide by elimination of the 3' end of the nucleic acid coding region may also improve protein expression and subsequent purification and use, as is outlined in Example VIII below.
Deletion of nucleic acid regions encoding internal H. pylori protein regions can also result in improved protein expression, purification and/or efficacy as a vaccine candidate.
IV. Identification of Nucleic Acids Encoding Vaccine Components and Tar etg s for Agents Effective Against H. pylori The disclosed H. pylori genome sequence includes segments that direct the synthesis of ribonucleic acids and polypeptides, as well as origins of replication, promoters, other types of regulatory sequences, and intergenic nucleic acids.
The invention encompasses nucleic acids encoding immunogenic components of vaccines and targets for agents effective against H. pylori. Identification of said immunogenic components involved in the determination of the function of the disclosed sequences can be achieved using a variety of approaches. Non-limiting examples of these approaches are described briefly below.
Homologyy to known sequences: Computer-assisted comparison of the disclosed H. pylori sequences with previously reported sequences present in publicly available databases is useful for identifying functional H. pylori nucleic acid and polypeptide sequences. It will be understood that protein-coding sequences, for example, may be compared as a whole, and that a high degree of sequence homology between two proteins (such as, for example, >80-90%) at the amino acid level indicates that the two proteins also possess some degree of functional homology, such as, for example, among enzymes involved in metabolism, DNA synthesis, or cell wall synthesis, and proteins involved in transport, cell division, etc. In addition, many structural features of particular protein classes have been identified and correlate with specific consensus sequences, such as, for example, binding domains for nucleotides, DNA, metal ions, and other small molecules; sites for covalent modifications such as phosphorylation, acylation, and the like; sites of protein:protein interactions, etc. These consensus sequences may be quite short and thus may represent only a fraction of the entire protein-coding sequence. Identification of such a feature in an H. pylori sequence is therefore useful in determining the function of the encoded protein and identifying useful targets of antibacterial drugs.
Of particular relevance to the present invention are structural features that are common to secretory, transmembrane, and surface proteins, including secretion signal peptides and hydrophobic transmembrane domains. H. pylori proteins identified as containing putative signal sequences and/or transmembrane domains are useful as immunogenic components of vaccines.

Identification of essential eg nes: Nucleic acids that encode proteins essential for growth or viability of H. pylori are preferred drug targets. H. pylori genes can be tested for their biological relevance to the organism by examining the effect of deleting and/or disrupting the genes, i.e., by so-called gene "knockout", using techniques known to those skilled in the relevant art. In this manner, essential genes may be identified.
Strain-specific sequences: Because of the evolutionary relationship between different H. pylori strains, it is believed that the presently disclosed H.
pylori sequences are useful for identifying, and/or discriminating between, previously known and new H.
pylori strains. It is believed that other H. pylori strains will exhibit at least 70%
sequence homology with the presently disclosed sequence. Systematic and routine analyses of DNA sequences derived from samples containing H. pylori strains, and comparison with the present sequence allows for the identification of sequences that can be used to discriminate between strains, as well as those that are common to all H. pylori strains. In one embodiment, the invention provides nucleic acids, including probes, and peptide and polypeptide sequences that discriminate between different strains of H.
pylori. Strain-specific components can also be identified functionally by their ability to elicit or react with antibodies that selectively recognize one or more H.
pylori strains.
In another embodiment, the invention provides nucleic acids, including probes, and peptide and polypeptide sequences that are common to all H. pylori strains but are not found in other bacterial species.
Specific Example: Determination Of Candidate Protein Antigens For Antibod~nd Vaccine Development The selection of candidate protein antigens for vaccine development can be derived from the nucleic acids encoding H. pylori polypeptides. First, the ORF's can be analyzed for homology to other known exported or membrane proteins and analyzed using the discriminant analysis described by Klein, et al. (Klein, P., Kanehsia, M., and DeLisi, C. ( 1985) Biochimica et Biophysica Acta 815, 468-476) for predicting exported and membrane proteins.
- 30 Homology searches can be performed using the BLAST algorithm contained in the Wisconsin Sequence Analysis Package (Genetics Computer Group, Unweaity Research Park, 575 Science Drive, Madison, WI 53711 ) to compare each predicted ORF
amino acid sequence with all sequences found in the current GenBank, SWISS-PROT
and PIR databases. BLAST searches for local alignments between the ORF and the databank sequences and reports a probability score which indicates the probability of finding this sequence by chance in the database. ORF's with significant homology (e.g.
probabilities lower than 1 x 10-6 that the homology is only due to random chance) to membrane or exported proteins represent protein antigens for vaccine development.
Possible functions can be provided to H. pylori genes based on sequence homology to genes cloned in other organisms.
Discriminant analysis (Klein, et al. supra) can be used to examine the ORF
amino acid sequences. This algorithm uses the intrinsic information contained in the ORF amino acid sequence and compares it to information derived from the properties of known membrane and exported proteins. This comparison predicts which proteins will be exported, membrane associated or cytoplasmic. ORF amino acid sequences identified as exported or membrane associated by this algorithm are likely protein antigens for vaccine development.
Surface exposed outer membrane proteins are likely to represent the best antigens to provide a protective immune response against H. pylori. Among the algorithms that can be used to aid in prediction of these outer membrane proteins include the presence of an amphipathic beta-sheet region at their C-terminus. This region which has been detected in a large number of outer membrane proteins in Gram negative bacteria is often characterized by hydrophobic residues (Phe or Tyr) approximately at positions 1, 3, 5, 7 and 9 from the C-terminus (e.g., see Figure 1, block F).
Importantly, these sequences have not been detected at the C-termini of periplasmic proteins, thus allowing preliminary distinction between these classes of proteins based on primary sequence data. This phenomenon has been reported previously by Struyve et al.
(J. Mol.
Biol. 218:141-148, 1991 ).
Also illustrated in Figure 1 are additional amino acid sequence motifs found in many outer membrane proteins of H. pylori. The amino acid sequence alignment in Figure 1 depicts portions of the sequence of five H. pylori proteins (depicted in the single letter amino acid code) labeled with their amino acid Sequence ID
Numbers and shown N-terminal to C-terminal, left to right. Six distinct blocks (labeled A
through F) of similar amino acid residues are found including the distinctive hydrophobic residues (Phe or Tyr; F or Y according to the single letter code for amino acid residues) frequently found at positions near the C-terminus of outer membrane proteins.
The presence of several shared motifs clearly establishes the similarity between members of this group of proteins.
In addition, outer membrane proteins isolated from H. pylori frequently share a motif near the mature N-terminus (i.e., after processing to remove the secretion signal) as illustrated in the blocked amino acid residues in Figure 2. Figure 2 depicts the N-terminal portion of three H. pylori proteins (designated by their amino acid Sequence ID
Numbers and shown N-terminal to C-terminal, left to right).

One skilled in the art would know that these shared sequence motifs are highly significant and establish a similarity among this group of proteins.
Infrequently it is not possible to distinguish between multiple possible nucleotides at a given position in the nucleic acid sequence. In those cases the ambiguities are denoted by an extended alphabet as follows:
These are the official IUPAC-IUB single-letter base codes Code Base Description G Guanine A Adenine T Thymine C Cytosine R Purine (A or G) Y Pyrimidine (C or T or U) M Amino (A or C) K Ketone (G or T) S Strong interaction (C or G) W Weak interaction (A or T) H Not-G (A or C or T) B Not-A (C or G or T) V Not-T (not-U) (A or C or G) D Not-C (A or G or T) N Any (A or C or G or T) The amino acid translations of this invention account for the ambiguity in the nucleic acid sequence by translating the ambiguous codon as the letter "X". In all cases, the permissible amino acid residues at a position are clear from an examination of the nucleic acid sequence based on the standard genetic code.
V. Production of Fragments and Analo, s~pylori Nucleic Acids and Polypeptides 1 S Based or the discovery of the H. pylori gene products of the invention provided in the Sequence Lsiting, one skilled in the art can alter the disclosed structure (of H.
pylori genes), e.g., by producing fragments or analogs, and test the newly produced structures for activity. Examples of techniques known to those skilled in the relevant art which allow the production and testing of fragments and analogs are discussed below.
These, or analogous methods can be used to make and screen libraries of polypeptides, -Sa-e.g., libraries of random peptides or libraries of fragments or analogs of cellular proteins for the ability to bind H. pylori polypeptides. Such screens are useful for the identification of inhibitors of H. pylori.
Generation of Fragments Fragments of a protein can be produced in several ways, e.g., recombinantly, by proteolytic digestion, or by chemical synthesis. Internal or terminal fragments of a polypeptide can be generated by removing one or more nucleotides from one end (for a terminal fragment) or both ends (for an internal fragment) of a nucleic acid which encodes the polypeptide. Expression of the mutagenized DNA produces polypeptide fragments. Digestion with"end-nibbling" endonucleases can thus generate DNA's which encode an array of fragments. DNA's which encode fragments of a protein can also be generated by random shearing, restriction digestion or a combination of the above-discussed methods.
Fragments can also be chemically synthesized using techniques known in the art such as conventional Merrifield solid phase f Moc or t-Boc chemistry. For example, peptides of the present invention may be arbitrarily divided into fragments of desired length with no overlap of the fragments, or divided into overlapping fragments of a desired length.
Alteration of Nucleic Acids and Polvpeptides: Random Methods Amino acid sequence variants of a protein can be prepared by random mutagenesis of DNA which encodes a protein or a particular domain or region of a protein. Useful methods include PCR mutagenesis and saturation mutagenesis. A
library of random amino acid sequence variants can also be generated by the synthesis of a set of degenerate oligonucleotide sequences. (Methods for screening proteins in a library of variants are elsewhere herein).
(Al PCR Muta~enesis -- 30 In PCR mutagenesis, reduced Taq polymerase fidelity is used to introduce random mutations into a cloned fragment of DNA (Leung et aL, 1989, Technique I
: I 1-1 S). The DNA region to be mutagenized is amplified using the polymerase chain reaction (PCR) under conditions that reduce the fidelity of DNA synthesis by Taq DNA
polymerase, e.g., by using a dGTP/dATP ratio of five and adding Mn2+ to the PCR
reaction. The pool of amplified DNA fragments are inserted into appropriate cloning vectors to provide random mutant libraries.

~B) Saturation Mutaeenesis Saturation mutagenesis allows for the rapid introduction of a large number of single base substitutions into cloned DNA fragments (Mayers et al., 1985, Science 229:242). This technique includes generation of mutations, e.g., by chemical treatment or irradiation of single-stranded DNA in vitro, and synthesis of a complimentary DNA
strand. The mutation frequency can be modulated by modulating the severity of the treatment, and essentially all possible base substitutions can be obtained.
Because this procedure does not involve a genetic selection for mutant fragments both neutral substitutions, as well as those that alter function, are obtained. The distribution of point mutations is not biased toward conserved sequence elements.
~C) De;generate Oli~onucleotides A library of homologs can also be generated from a set of degenerate oligonucleotide sequences. Chemical synthesis of a degenerate sequences can be carried out in an automatic DNA synthesizer, and the synthetic genes then ligated into an appropriate expression vector. The synthesis of degenerate oligonucleotides is known in the art (see for example, Narang, SA ( I 983) Tetrahedron 39:3; Itakura et al.
( I 981 ) Recombinant DNA, Proc 3rd Cleveland Sympos. Macromolecules, ed. AG Walton, Amsterdam: Elsevier pp273-289; Itakura et al. (1984) Anhu. Rev. Biochem.
53:323;
Itakura et al. (1984) Science 198:1056; Ike et al. (1983) Nucleic Acid Res. I
1:477. Such techniques have been employed in the directed evolution of other proteins (see, for example. Scott et al. ( 1990) Science 249:386-390; Roberts et al. ( 1992) PNAS
89:2429-2433; Devlin et al. (1990) Science 249: 404-406; Cwirla et al. (1990) PNAS 87:

6382; as well as U.S. Patents Nos. 5,223,409, 5,198,346, and 5,096,815).
Alteration of Nucleic Acids and Polvpeptides~ Methods for Directed Muta enesis Non-random or directed, mutagenesis techniques can be used to provide specific sequences or mutations in specific regions. These techniques can be used to create variants which include, e.g., deletions, insertions, or substitutions, of residues of the known amino acid sequence of a protein. The sites for mutation can be modified w individually or in series, e.g., by ( 1 ) substituting first with conserved amino acids and then with more radical choices depending upon results achieved, (2) deleting the target residue, or (3) inserting residues of the same or a different class adjacent to the located - site, or combinations of options 1-3.

(Al Alanine Scanning Muta~ enesis Alanine scanning mutagenesis is a useful method for identification of certain residues or regions of the desired protein that are preferred locations or domains for mutagenesis, Cunningham and Wells (Science 244:1081-1085, 1989). In alanine S scanning, a residue or group of target residues are identified (e.g., charged residues such as Arg, Asp, His, Lys, and Glu) and replaced by a neutral or negatively charged amino acid (most preferably alanine or polyalanine). Replacement of an amino acid can affect the interaction of the amino acids yvith the surrounding aqueous environment in or outside the cell. Those domains demonstrating functional sensitivity to the substitutions are then refined by introducing further or other variants at or for the sites of substitution.
Thus, while the site for introducing an amino acid sequence variation is predetermined, the nature of the mutation per se need not be predetermined. For example, to optimize the performance of a mutation at a given site, alanine scanning or random mutagenesis may be conducted at the target codon or region and the expressed desired protein subunit variants are screened for the optimal combination of desired activity.
(B) Oligonucleotide-Mediated Muta enesis Oligonucleotide-mediated mutagenesis is a useful method for preparing substitution, deletion, and insertion variants of-DNA, see, e.g., Adelman et al., (DNA
2:183, 1983). Briefly, the desired DNA is altered by hybridizing an oligonucleotide encoding a mutation to a DNA template, where the template is the single-stranded form of a plasmid or bacteriophage containing the unaltered or native DNA sequence of the desired protein. After hybridization, a DNA polymerase is used to synthesize an entire second complementary strand of the template that will thus incorporate the oligonucleotide primer, and will code for the selected alteration in the desired protein DNA. Generally, oligonucleotides of at least 25 nucleotides in length are used. An optimal oligonucleotide will have 12 to 15 nucleotides that are completely complementary to the template on either side of the nucleotides) coding for the mutation. This ensures that the oligonucleotide will hybridize properly to the single-stranded DNA template molecule. The oligonucleotides are readily synthesized using techniques known in the art such a~ th at described by Crea et al. (Proc.
Natl. Acad Sci.
USA, 75: 5765 [ 1978]).
(C) Cassette Mut~enesis Another method for preparing variants, cassette mutagenesis, is based on the technique described by Wells et al. (Gene, 34:315[1985)). The starting material is a plasmid (or other vector) which includes the protein subunit DNA to be mutated. The codon(s) in the protein subunit DNA to be mutated are identified. There must be a unique restriction endonuclease site on each side of the identified mutation site(s). If no such restriction sites exist, they may be generated using the above-described oligonucleotide-mediated mutagenesis method to introduce them at appropriate locations in the desired protein subunit DNA. After the restriction sites have been introduced into the plasmid, the plasmid is cut at these sites to linearize it. A double-stranded oligonucleotide encoding the sequence of the DNA between the restriction sites but containing the desired mutations) is synthesized using standard procedures.
The two strands are synthesized separately and then hybridized together using standard techniques. This double-stranded oligonucleotide is referred to as the cassette. This cassette is designed to have 3' and S' ends that are comparable with the ends of the linearized plasmid, such that it can be directly ligated to the plasmid. This plasmid now contains the mutated desired protein subunit DNA sequence.
~D) Combinatorial Muta eg nesis Combinatorial mutagenesis can also be used to generate mutants (Ladner et al., WO 88/06630). In this method, the amino acid sequences for a group of homologs or other related proteins are aligned, preferably to promote the highest homology possible.
All of the amino acids which appear at a given position of the aligned sequences can be selected to create a degenerate set of combinatorial sequences. The variegated library of variants is generated by combinatorial mutagenesis at the nucleic acid level, and is encoded by a variegated gene library. For example, a mixture of synthetic oligonucleotides can be enzymatically ligated into gene sequences such that the degenerate set of potential sequences are expressible as individual peptides, or alternatively, as a set of larger fusion proteins containing the set of degenerate sequences.
Other Modifications of Hwlori Nucleic Acids and Polypeptides It is possible to modify the structure of an H. pylori polypeptide for such purposes as increasing solubility, enhancing stability (e.g., shelf life ex vivo and resi~tar ce to proteolytic degradation in vivo). A modified H. pylori protein or peptide can be produced in which the amino acid sequence has been altered, such as by amino acid substitution, deletion, or addition as described herein.
An H. pylori peptide can also be modified by substitution of cysteine residues preferably with alanine, serine, threonine, leucine or glutarnic acid residues to minimize dimerization via disulfide linkages. In addition, amino acid side chains of fragments of the protein of the invention can be chemically modified. Another modification is cyclization of the peptide.
In order to enhance stability and/or reactivity, an N. pylori polypeptide can be modified to incorporate one or more polymorphisms in the amino acid sequence of the protein resulting from any natural allelic variation. Additionally, D-amino acids, non-natural amino acids, or non-amino acid analogs can be substituted or added to produce a modified protein within the scope of this invention. Furthermore, an H. pylori polypeptide can be modified using polyethylene glycol (PEG) according to the method of A. Sehon and co-workers (Wie et al., supra) to produce a protein conjugated with PEG. In addition, PEG can be added during chemical synthesis of the protein.
Other modifications of H. pylori proteins include reduction/alkyIation (Tarr, Methods of Protein Microcharacterization, J. E. Silver ed., Humana Press, Clifton NJ 155-( 1986)); acylation (Tarr, supra); chemical coupling to an appropriate carrier (Mishell and Shiigi, eds, Selected Methods in Cellular Immunology, WH Freeman, San Francisco, CA
1 S ( 1980), U.S. Patent 4,939,239; or mild formalin treatment (Marsh, ( 1971 ) Int. Arch. of Allergy and Appl. Immunol., 41: 199 - 215).
To facilitate purification and potentially increase solubility of an H. pylori protein or peptide, it is possible to add an amino acid fusion moiety to the peptide backbone. For example, hexa-histidine can be added to the protein for purification by immobilized metal ion affinity chromatography (Hochuli, E. et al., ( 1988) BiolTechnology, 6: 1321 - 1325). In addition, to facilitate isolation of peptides free of irrelevant sequences, specific endoprotease cleavage sites can be introduced between the sequences of the fusion moiety and the peptide.
To potentially aid proper antigen processing of epitopes within an H. pylori polypeptide, canonical protease sensitive sites can be engineered between regions, each comprising at least one epitope via recombinant or synthetic methods. For example, charged amino acid pairs, such as KK or RR, can be introduced between regions within a protein or fragment during recombinant construction thereof. The resulting peptide can be rendered sensitive to cleavage by cathepsin andlor other trypsin-like enzymes which would generate portions of the protein containing one or more epitopes.
In addition, such charged amino acid residues can result in an increase in the solubility of the peptide.
- Primary Methods for Screenin~L Polyneptides and Analogs Various techniques are known in the art for screening generated mutant gene products. Techniques for screening large gene libraries often include cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the genes under conditions in which detection of a desired activity, e.g:; in this case, binding to H. pylori polypeptide or an interacting protein, facilitates relatively easy isolation of the vector encoding the gene whose product was detected. Each of the techniques described below is amenable to high through-put analysis for screening large numbers of sequences created, e.g., by random mutagenesis techniques.
(A) Two Hybrid Systems Two hybrid assays such as the system described above (as with the other screening methods described herein), can be used to identify polypeptides, e.g., fragments or analogs of a naturally-occurring H. pylori polypeptide, e.g., of cellular proteins, or of randomly generated polypeptides which bind to an H. pylori protein.
(The H. pylori domain is used as the bait protein and the library of variants are expressed as fish fusion proteins.) In an analogous fashion, a two hybrid assay (as with the other screening methods described herein), can be used to find polypeptides which bind a H.
pylori polypeptide.
(B) Display Libraries In one approach to screening assays, the candidate peptides are displayed on the surface of a cell or viral particle, and the ability of particular cells or viral particles to bind an appropriate receptor protein via the displayed product is detected in a "panning assay". For example, the gene library can be cloned into the gene for a surface membrane protein of a bacterial cell, and the resulting fusion protein detected by panning (Ladner et al., WO 88/06630; Fuchs et al. ( 1991 ) BiolTechnology 9:1370-1371;
and Goward et al. (1992) ?'IBS 18:136-140). In a similar fashion, a detectably labeled ligand can be used to score for potentially functional peptide homologs.
Fluorescently labeled ligands, e.g., receptors, can be used to detect homologs which retain ligand-binding activity. The use of fluorescently labeled ligands, allows cells to be visually inspected and separated under a fluorescence microscope, or, where the morphology of the cell permits, to be separated by a fluorescence-activated cell sorter. .
A gene library can be expressed as a fusion prote~n r n the surface of a viral particle. For instance, in the filamentous phage system, foreign peptide sequences can be expressed on the surface of infectious phage, thereby conferring two significant benefits. First, since these phage can be applied to affinity matrices at concentrations 3 S well over 1 O 13 phage per milliliter, a large number of phage can be screened at one time.
Second, since each infectious phage displays a gene product on its surface, if a particular phage is recovered from an affinity matrix in low yield, the phage can be amplified by another round of infection. The group of almost identical E. toll filamentous phages M 13, fd., and fl are most often used in phage display libraries. Either of the phage gIII
or gVIII coat proteins can be used to generate fusion proteins without disrupting the ultimate packaging of the viral particle. Foreign epitopes can be expressed at the NH2-terminal end of pIII and phage bearing such epitopes recovered from a large excess of phage lacking this epitope (Ladner et al. PCT publication WO 90/02909; Garrard et al., PCT publication WO 92/09690; Marks et al. (1992) J. Biol. Chem. 267:16007-16010;
Griffiths et al. ( 1993) EMBO J 12:725-734; Clackson et al. ( I99I ) Nature 352:624-628;
and Barbas et al. (1992) PNAS 89:4457-4461). -IO A common approach uses the maltose receptor of E. toll (the outer membrane protein, Lama) as a peptide fusion partner (Charbit et al. (1986) EMBO 5, 3029-3037).
Oligonucleotides have been inserted into plasmids encoding the Lama gene to produce peptides fused into one of the extracellular loops of the protein. These peptides are available for binding to ligands, e.g., to antibodies, and can elicit an immune response when the cells are administered to animals. Other cell surface proteins, e.g., OmpA
(Schorr et al. (1991) Vaccines 91, pp. 387-392), PhoE (Agterberg, et aI.
(1990) Gene 88, 37-45), and PAL (Fuchs et al. (1991) BiolTech 9, 1369-1372), as well as large bacterial surface structures have served as vehicles for peptide display. Peptides can be fused to pilin, a protein which polymerizes to form the pilus-a conduit for interbacterial exchange of genetic information (Thiry et al. (1989) Appl. Environ. Microbiol. 55, 984-993).
Because of its role in interacting with other cells, the pilus provides a useful support for the presentation of peptides to the extracellular environment. Another large surface structure used for peptide display is the bacterial motive organ, the flagellum. Fusion of peptides to the subunit protein flagellin offers a dense array of many peptide copies on the host cells (Kuwajima et al. (1988) BiolTech. 6, 1080-1083). Surface proteins of other bacterial species have also served as peptide fusion partners. Examples include the Staphylococcus protein A and the outer membrane IgA protease of Neisseria (Hansson et al. ( 1992) J. Bacteriol. 174, 423 9-4245 and Klauser et al. ( 1990) EMBD
J. 9, 1991-1999).
-- 30 In the filamentous phage systems and the Lama system described above, the physical link between the per fide and its encoding DNA occurs by the containment of the DNA within a particle (cell or phage) that carries the peptide on its surface.
Capturing the peptide captures the particle and the DNA within. An alternative scheme uses the DNA-binding protein LacI to form a link between peptide and DNA (Cull et al.
3 S ( 1992) PNAS USA 89:1865-1869). This system uses a plasmid containing the LacI gene with an oligonucleotide cloning site at its 3'-end. Under the controlled induction by arabinose, a LacI-peptide fusion protein is produced. This fusion retains the natural _ -.~..r.._.~__.~_ ability of LacI to bind to a short DNA sequence known as LacO operator (LacO).
By installing two copies of LacO on the expression plasmid, the LacI-peptide fusion binds tightly to the plasmid that encoded it. Because the plasmids in each cell contain only a single oligonucleotide sequence and each cell expresses only a single peptide sequence, the peptides become specifically and stably associated with the DNA sequence that directed its synthesis. The cells of the library are gently lysed and the peptide-DNA
complexes are exposed to a matrix of immobilized receptor to recover the complexes containing active peptides. The associated plasmid DNA is then reintroduced into cells for amplification and DNA sequencing to determine the identity of the peptide ligands.
As a demonstration of the practical utility of the method, a large random library of dodecapeptides was made and selected on a monoclonal antibody raised against the opioid peptide dynorphin B. A cohort of peptides was recovered, all related by a consensus sequence corresponding to a six-residue portion of dynorphin B.
(Cull et al.
(1992) Proc. Natl. Acad. Sci. U.S.A. 89-1869) This scheme, sometimes referred to as peptides-on-plasmids, differs in two important ways from the phage display methods. First, the peptides are attached to the C-terminus of the fusion protein, resulting in the display of the library members as peptides having free carboxy termini. Both of the filamentous phage coat proteins, pIII
and pVIII, are anchored to the phage through their C-termini, and the guest peptides are placed into the outward-extending N-terminal domains. In some designs, the phage-displayed peptides are presented right at the amino terminus of the fusion protein.
(Cwirla, et al. (1990) Proc. Natl. Acad. Sci. U.S.A. 87, 6378-6382) A second difference is the set of biological biases affecting the population of peptides actually present in the libraries. The LacI fusion molecules are confined to the cytoplasm of the host cells.
The phage coat fusions are exposed briefly to the cytoplasm during translation but are rapidly secreted through the inner membrane into the periplasmic compartment, remaining anchored in the membrane by their C-terminal hydrophobic domains, with the N-termini, containing the peptides, protruding into the periplasm while awaiting assembly into phage particles. The peptides in the LacI and phage libraries may differ significantly as a result of their exposure to different proteolytic activities. The phage coat proteins require transport across the inner membrane and signal peptidase processing as a prelude to incorporation into phage. Certain peptides exert a deleterious effect on these processes and are underrepresented in the libraries (Gallop et al. ( 1994) J.
Med. Chem. 37(9):1233-1251). These particular biases are not a factor in the LacI
display system.
The number of small peptides available in recombinant random libraries is enormous. Libraries of 107-109 independent clones are routinely prepared.
Libraries as large as 1011 recombinants have been created, but this size approaches the practical limit for clone libraries. This limitation in library size occurs at the step of transforming the DNA containing randomized segments into the host bacterial cells. To circumvent this limitation, an in vitro system based on the display of nascent peptides in polysome complexes has recently been developed. This display library method has the potential of producing libraries 3-6 orders of magnitude larger than the currently available phage/phagemid or plasmid libraries. Furthermore, the construction of the libraries, expression of the peptides, and screening, is done in an entirely cell-free format.
In one application of this method (Gallop et al. ( 1994) J. Med. Chem.
37(9):1233-1251 ), a molecular DNA library encoding 1012 decapeptides was constructed and the library expressed in an E. coli S30 in vitro coupled transcription/translation system. Conditions were chosen to stall the ribosomes on the mRNA, causing the accumulation of a substantial proportion of the RNA in polysomes and yielding complexes containing nascent peptides still linked to their encoding RNA.
The polysomes are sufficiently robust to be affinity purified on immobilized receptors in much the same way as the more conventional recombinant peptide display libraries are screened. RNA from the bound complexes is recovered, converted to cDNA, and amplified by PCR to produce a template for the next round of synthesis and screening.
The polysome display method can be coupled to the phage display system.
Following several rounds of screening, cDNA from the enriched pool of polysomes was cloned into a phagemid vector. This vector serves as both a peptide expression vector, displaying peptides fused to the coat proteins, and as a DNA sequencing vector for peptide identification. By expressing the polysome-derived peptides on phage, one can either continue the affinity selection procedure in this format or assay the peptides on individual clones for binding activity in a phage ELISA, or for binding specif city in a completion phage ELISA (Barret, et al. (1992) Anal. Biochem 204,357-364). To identify the sequences of the active peptides one sequences the DNA produced by the phagemid host.
Secondary Screenin of Polype~tides and Analogs The high through-put assays described above can be followed by secondar r screens in order to identify further biological activities which will, e.g., allow one skilled in the art to differentiate agonists from antagonists. The type of a secondary screen used will depend on the desired activity that needs to be tested. For example, an assay can be developed in which the ability to inhibit an interaction between a protein of interest and its respective ligand can be used to identify antagonists from a group of peptide fragments isolated though one of the primary screens described above.
.T. .__. ... . ...

Therefore, methods for generating fragments and analogs and testing them for activity are known in the art. Once the core sequence of interest is identified, it is routine for one skilled in the art to obtain analogs and fragments.
Peptide Mimetics of H. pylori Polypeptides The invention also provides for reduction of the protein binding domains of the subject H. pylori polypeptides to generate mimetics, e.g. peptide or non-peptide agents.
The peptide mimetics are able to disrupt binding of a polypeptide to its counter ligand, e.g., in the case of an H. pylori polypeptide binding to a naturally occurring ligand. The critical residues of a subject H. pylori polypeptide which are involved in molecular recognition of a polypeptide can be determined and used to generate H. pylori-derived peptidomimetics which competitively or noncompetitively inhibit binding of the H.
pylori polypeptide with an interacting polypeptide (see, for example, European patent applications EP-412,762A and EP-B31,080A).
For example, scanning mutagenesis can be used to map the amino acid residues of a particular H. pylori polypeptide involved in binding an interacting polypeptide, peptidomimetic compounds (e.g. diazepine or isoquinoline derivatives) can be generated which mimic those residues in binding to an interacting polypeptide, and which therefore can inhibit binding of an H. pylori polypeptide to an interacting polypeptide and thereby interfere with the function of H. pylori polypeptide. For instance, non-hydrolyzable peptide analogs of such residues can be generated using benzodiazepine (e.g., see Freidinger et al. in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), azepine (e.g., see Huffman et al.
in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), substituted gama lactam rings (Garvey et al. in Peptides:
Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), keto-methylene pseudopeptides (Ewenson et al. ( 1986) J Med Chem 29:295; and Ewenson et al. in Peptides: Structure and Function (Proceedings of the 9th American Peptide Symposium) Pierce Chemical Co. Rockland, IL, 1985), ~i-turn dipeptide cores (Nagai et al. (1985) Tetrahedron Lett 26:647; and Sato et al. (1986) JChem Soc Perkin Trans 1:1231 ), and ~i-aminoalcohols (cordon et al. ( 1085 ~ Biochem Biophys Res Commun 126:419; and Dann et al. ( 1986) Biochem Biophys Res Commun 134:71 ).
VI. Vaccine Formulations for H. pvlori Nucleic Acids and Polyp~tides This invention also features vaccine compositions or formulations (used interchangeably herein) for protection against infection by H. pylori or for treatment of H. pylori infection. As used herein, the term "treatment of H. pylori infection" refers to therapeutic treatment of an existing or established X. pylori infection. The terms "protection against H. pylori infection" or "prophylactic treatment" refer to the use of H.
pylori vaccine formulation for reducing the risk of or preventing an infection in a subject at risk for H pylori infection. In one embodiment, the vaccine compositions contain one or more immunogenic components, such as a surface protein, from H. pylori, or portion thereof, and a pharmaceutically acceptable carrier. For example, in one embodiment, the vaccine formulations of the invention contain at least one or combination of H. pylori polypeptides or fragments thereof, from same or different H. pylori antigens.
Nucleic acids and H. pylori poIypeptides for use in the vaccine formulations of the invention include the nucleic acids and polypeptides set forth in the Sequence Listing, preferably those H. pylori nucleic acids that encode surface proteins and surface proteins or fragments thereof. For example, a preferred nucleic acid and H. pylori polypeptide for use in a vaccine composition of the invention is selected from the group of nucleic acids which encode cell envelope proteins and H. pylori cell envelope proteins as set forth in Table 1.- However, any nucleic acid encoding an immunogenic H. pylori protein and H.
pylori polypetide, or portion thereof, can be used in the present invention.
These vaccines have therapeutic and/or prophylactic utilities.
One aspect of the invention provides a vaccine composition for protection against infection by H. pylori which contains at least one immunogenic fragment of an H. pylori protein and a pharmaceutically acceptable carrier. Preferred fragments include peptides of at least about 10 amino acid residues in length, preferably about 10-20 amino acid residues in length, and more preferably about 12-16 amino acid residues in length.
Immunogenic components of the invention can be obtained, for example, by screening polypeptides recombinantly produced from the corresponding fragment of the nucleic acid encoding the full-length H. pylori protein. In addition, fragments can be chemically synthesized using techniques known in the art such as conventional Merrifield solid phase f Moc or t-Boc chemistry.
In one embodiment, immunogenic components are identified by the ability of the peptide to stimulate T cells. Peptides which stimulate T cells, as determined by, for example, T cell prol-iferation or cytokine secretion are defined herein as comprising at least one T cell enitc pe. T cell epitopes are believed to be involved in initiation and perpetuation of the immune response to the protein allergen which is responsible for the clinical symptoms of allergy. These T cell epitopes-are thought to trigger early events at the level of the T helper cell by binding to an appropriate HLA molecule on the surface of an antigen presenting cell, thereby stimulating the T cell subpopulation with the relevant T cell receptor for the epitope. These events lead to T cell proliferation, lymphokine secretion, local inflammatory reactions, recruitment of additional immune cells to the site of antigen/T cell interaction, and activation of the B cell cascade, leading to the production of antibodies. A T cell epitope is the basic element, or smallest unit of recognition by a T cell receptor, where the epitope comprises amino acids essential to receptor recognition (e.g., approximately 6 or 7 amino acid residues). Amino acid sequences which mimic those of the T cell epitopes are within the scope of this invention.
In another embodiment, immunogenic components of the invention are identified through genomic vaccination. The-basic protocol is based on the idea that expression libraries consisting of all or parts of a pathogen genome, e.g., an H. pylori genome, can confer protection when used to genetically immunize a host. This expression library immunization (ELI) is analogous to expression cloning and involves reducing a genomic expression library of a pathogen, e.g., H. pylori, into plasmids that can act as genetic vaccines. The plasmids can also be designed to encode genetic adjuvants which can dramatically stimulate the humoral response. These genetic adjuvants can be introduced at remote sites and act as well extracelluraly as intraceIlularly.
This is a new approach to vaccine production that has many of the advantages of live/attenuated pathogens but no risk of infection. An expression library of pathogen DNA is used to immunize a host thereby producing the effects of antigen presentation of a live vaccine without the risk. For example, in-the present invention, random fragments from the H. pylori genome or from cosmid or plasmid clones, as well as PCR
products from genes identified by genornic sequencing, can be used to immunize a host.
The feasibility of this approach has been demonstrated with Mycoplasma pulmonis (Barry et al., Nature 377:632-635, 1995), where even partial expression libraries of Mycoplasma pulmonis, a natural pathogen in rodents, provided protection against challenge from the pathogen.
ELI is a technique that allows for production of a non-infectious multipartite vaccine, even when little is known about pathogen's biology, because ELI uses the immune system to screen candidate genes. Once isolated, these genes can be used as genetic vaccines or for development of recombinant protein vaccines. Thus, ELI
allows for production of vaccines in a systematic, largely mechanized fashion.
Screening immunogenic components can be accomplished using one or more of several different assays. For example, in vitro, peptide T cell stimulatory activity is assayed by contacting a peptide known or suspected of being immunogenic with an antigen presenting cell which presents appropriate MHC molecules in a T cell culture.
Presentation of an immunogenic H. pylori peptide in association with appropriate MHC
molecules to T cells in conjunction with the necessary costimulation has the effect of transmitting a signal to the T cell that induces the production of increased levels of cytokines, particularly of interleukin-2 and interleukin-4. The culture supernatant can be obtained and assayed for interleukin-2 or other known cytokines. For example, any one of several conventional assays for interleukin-2 can be employed, such as the assay described in Proc. Natl. Acad. Sci USA, 86: 1333 (1989) the pertinent portions of which are incorporated herein by reference. A kit for an assay for the production of interferon is also available from Genzyme Corporation (Cambridge, MA).
Alternatively, a common assay for T cell proliferation entails measuring tritiated thymidine incorporation. The proliferation of T cells can be measured in vitro by determining the amount of 3H-labeled thymidine incorporated into the replicating DNA
of cultured cells. Therefore, the rate of DNA synthesis and, in turn, the rate of cell division can be quantified_ Vaccine compositions or formulations of the invention containing one or more immunogenic components (e.g., H. pylori polypeptide or fragment thereof or nucleic acid encoding an H. pylori polypeptide or fragment thereof) preferably include a 1 S pharmaceutically acceptable earner. The term "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Suitable pharmaceutically acceptable carriers include, for example, one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol and the like, as well as combinations thereof. Pharmaceutically acceptable earners may further comprise minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives or buffers, which enhance the shelf life or effectiveness of the H. pylori nucleic acid or polypeptide. For vaccine formulations of the invention containing H. pylori polypeptides, the polypeptide is preferably coadministered with a suitable adjuvant and/or a delivery system described herein.
It will be apparent to those of skill in the art that the therapeutically effective amount of DNA or protein-of this invention will depend, inter alia, upon the administration schedule, the unit dose of an H. pylori nucleic acid or polypeptide administered, whether the protein or nucleic acid is administered in combination with other therapeutic agents, the immune status and health of the patient, and the therapeutic activity of the particular protein or nucleic acid.
Vaccine formulations are conventionally administered parenterally, e.g., by inj ection, either subcutaneously or intramuscularly. Methods for intramuscular immunization are described by Wolff et al. (1990) Science 247: 1465-1468 and by Sedegah et al. (1994) Immunology 91: 9866-9870. Other modes of administration include oral and pulmonary formulations, suppositories, and transdermal applications.
Oral immunization is preferred over parenteral methods for inducing protection against infection by H. pylori. Czinn et. al. ( 1993) Vaccine 11: 637-642. Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like.
In one embodiment; the vaccine formulation includes, as a pharmaceutically acceptable carrier, an adjuvant. Examples of the suitable adjuvants for use in the vaccine formulations of the invention include, but are not limited, to aluminum hydroxide; N-acetyl-muramyl--L-threonyl-D-isoglutamine (thr-MDP); N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred to as nor-MDP); N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphos-phoryloxy)-ethylamine (CGP 19835A, referred to a MTP-PE); RIBI, which contains three components from bacteria; monophosphoryl lipid A;
trehalose dimycoloate; cell wall skeleton (MPL + TDM + CWS) in a 2% squalene/Tween 80 emulsion; and cholera toxin. Others which may be used are non-toxic derivatives of cholera toxin, including its B subunit, and/or conjugates or genetically engineered fusions of the H. pylori polypeptide with cholera toxin or its B subunit, procholeragenoid, fungal polysaccharides, including schizophyllan, muramyl dipeptide, muramyl dipeptide derivatives, phorbol esters, labile toxin of E. coli, non-H.
pylori bacterial lysates, block polymers or saponins.
In another embodiment, the vaccine formulation includes, as a pharmaceutically acceptable carrier, a delivery system. Suitable delivery systems for use in the vaccine formulations of the invention include biodegradable microcapsules or immuno-stimulating complexes (ISCOMs), cochleates, or liposomes, genetically engineered attenuated live vectors such as viruses or bacteria, and recombinant (chimeric) virus-like particles, e.g., bluetongue. In another embodiment of the invention, the vaccine formulation includes both a delivery system and an adjuvant.
Delivery systems in humans may include enteric release capsules protecting the antigen from the acidic environment of the stomach, and including H. pylori polypeptide in an insoluble form as fusion proteins. Suitable carriers for the vaccines of the invention are enteric coated capsules and polylactide-glycolide microspheres.
Suitable - diluents are 0.2 N NaHC03 and/or saline.
Vaccines of the invention can be administered as a primary prophylactic agent in adults or in children, as a secondary prevention, after successful eradication of H. pylori - in an infected host, or as a therapeutic agent in the aim to induce an immune response in a susceptible host to prevent infection by H. pylori. The vaccines of the invention are administered in amounts readily determined by persons of ordinary skill in the art.
Thus, for adults a suitable dosage will be in the range of 10 ~g to 10 g, preferably 10 p.g to 100 mg, for example 50 ~g to 50 mg. A suitable dosage for adults will also be in the range of 5 pg to 500 mg. Similar dosage ranges will be'applicable for children.
The amount of adjuvant employed will depend on the type of adjuvant used. For example, when the mucosal adjuvant is cholera toxin, it is suitably used in an amount of 5 ~g to 50 pg, for example 10 ~.g to 35 p.g. When used in the form of microcapsules, the amount used will depend on the amount employed in the matrix of the microcapsule to achieve the desired dosage. The determination of this amount is within the skill of a person of ordinary skill in the art.-Those skilled in the art will recognize that the optimal dose may be more or less depending upon the patient's body weight, disease, the route of administration, and other factors. Those skilled in the art will also recognize that appropriate dosage levels can be obtained based on results with known oral vaccines such as, for example, a vaccine based on an E. coli lysate (6 mg dose daily up to total of 540 mg) and with an enterotoxigenic E. coli purified antigen (4 doses of 1 mg) (Schulman et al., J. Urol.
150:917-921 (1993)); Boedecker et al., American Gastroenterological Assoc.
999:A-222 ( 1993)). The number of doses will depend upon the disease, the formulation, and efficacy data from clinical trials. Without intending any limitation as to the course of treatment, the treatment can be administered over 3 'to 8 doses for a primary immunization schedule over 1 month (Boedeker, American Gastroenterological Assoc.
888:A-222 (1993)).
In a preferred embodiment, a vaccine composition of the invention can be based on a killed whole E. coli preparation with an immunogenic fragment of an H.
pylori protein of the invention expressed on its surface or it can be based on an E.
coli lysate, wherein the killed E. coli acts as a carrier or an adjuvant.
It will be apparent to those skilled in the art that some of the vaccine compositions of the invention are useful only for preventing H. pylori infection, some are useful only for treating H. pylori infection, and some are useful for both preventing and treating H. pylori infection. In a preferred embodiment, the vaccine composition of-the invention provides protection against H. pylori infection by stimulating humoral and/or cell-mediated immunity against H. pylori. It should be understood that amelioratio l of any of the symptoms of H. pylori infection is a desirable clinical goal, including a lessening of the dosage of medication used to treat H. pylori-caused disease, or an increase in the production of antibodies in the serum or mucous of patients.

VII. Antibodies Reactive With H. pylori Polypeptides The invention also includes antibodies specifically reactive with the subject H.
pylori polypeptide. Anti-protein/anti-peptide antisera or monoclonal antibodies can be made by standard protocols (See, for example, Antibodies: A Laboratory Manual ed. by Harlow and Lane (Cold Spring Harbor Press: 1988)). A mammal such as a mouse, a hamster or rabbit can be immunized with an immunogenic form of the peptide.
Techniques for conferring immunogenicity on a protein or peptide include conjugation to carriers or other techniques well known in the art. An immunogenic portion of the subject H. pylori polypeptide can be administered in the presence of adjuvant.
The I 0 progress of immunization can be monitored by detection of antibody titers in plasma or serum. Standard ELISA or other immunoassays can be used with the-immunogen as antigen to assess the levels of antibodies.
In a preferred embodiment, the subject antibodies are immunospecific for antigenic determinants of the H. pylori polypeptides of the invention, e.g.
antigenic determinants of a polypeptide of the invention contained in the Sequence Listing, or a closely related human or non-human mammalian homolog (e.g., 90% homologous, more preferably at least 95% homologous). In yet a further preferred embodiment of the invention, the anti-H. pylori antibodies do not substantially cross react (i.e., react specifically) with a protein which is for example, Iess than 80% percent homologous to a sequence of the invention contained in the Sequence Listing. By "not substantially cross react", it is meant that the antibody has a binding affinity for a non-homologous protein which is less than 10 percent, more preferably less than 5 percent, and even more preferably less than I percent, of the binding affinity for a protein of the invention contained in the Sequence Listing. In a most preferred embodiment, there is no crossreactivity between bacterial and mammalian antigens.
The term antibody as used herein is intended to include fragments thereof which are also specifically reactive with H. pylori polypeptides. Antibodies can be fragmented using conventional techniques and the fragments screened for utility in the same manner as described above for whole antibodies. For example, F(ab')2 fragments can be generated by treating antibody with pepsin. The resulting F(ab')2 fragment can be treated to reduce disulfide bridges to produce Fab' fragments. The antibody of the invention is further intended to include bispecific and chimeric molecules having an anti-H. pylori portion.
Both monoclonal and polyclonal antibodies (Ab) directed against H. pylori polypeptides or H. pylori polypeptide variants, and antibody fragments such as Fab' and F(ab')2, can be used to block the action of H. pylori polypeptide and allow the study of the role of a particular H. pylori polypeptide of the invention in aberrant or unwanted intracellular signaling, as well as the normal cellular function of the H.
pylori and by microinjection of anti-H. pylori polypeptide antibodies of the present invention.
Antibodies which specifically bind H. pylori epitopes can also be used in immunohistochemical staining of tissue samples in order to evaluate the abundance and S pattern of expression of H. pylori antigens. Anti H. pylori polypeptide antibodies can be used diagnostically in immuno-precipitation and immuno-blotting to detect and evaluate H. pylori levels in tissue or bodily fluid as part of a clinical testing procedure. Likewise, the ability to monitor H. pylori polypeptide levels in an individual can allow determination of the efficacy of a given treatment regimen for an individual afflicted with such a disorder. The level of an H. pylori polypeptide can be measured in cells found in bodily fluid, such as in urine samples or can be measured in tissue, such as produced by gastric biopsy. Diagnostic assays using anti-H. pylori antibodies can include, for example, immunoassays designed to aid in early diagnosis of H.
pylori infections. The present invention can also be used as a method of detecting antibodies contained in samples from individuals infected by this bacterium using specific H. pylori antigens.
Another application of anti-H. pylori polypeptide antibodies of the invention is in the immunological screening of cDNA libraries constructed in expression vectors such as ~,gtl 1, ~.gtl8-23, 7~ZAP, and ~,ORF8. Messenger libraries of this type, having coding sequences inserted in the correct reading frame and orientation, can produce fusion proteins. For instance, ~,gt 11 will produce fusion proteins whose amino termini consist of !3-galactosidase amino acid sequences and whose carboxy termini consist of a foreign polypeptide. Antigenic epitopes of a subject H. pylori polypeptide can then be detected with antibodies, as, for example, reacting nitrocellulose filters lifted from infected plates with anti-H. pylori polypeptide antibodies. Phage, scored by this assay, can then be isolated from the infected plate. Thus, the presence of H. pylori gene homologs can be detected and cloned from other species, and alternate isoforms (including splicing variants) can be detected and cloned.
VIII. Kits Containing Nucleic Acids. Polypeptides or Antibodies of the Invention - The nucleic acid, polypeptides and antibodies of the snv~ntion can be combined with other reagents and articles to form kits. Kits for diagnostic purposes typically comprise the nucleic acid, polypeptides or antibodies in vials or other suitable vessels.
- Kits typically comprise other reagents for performing hybridization reactions, polymerise chain reactions (PCR), or for reconstitution of lyophilized components, such as aqueous media, salts, buffers, and the like. Kits may also comprise reagents for sample processing such as detergents, chaotropic salts and the like. Kits may also __~_~._.~. ~._.___~_ ___ __.__.r___..._~ .

comprise immobilization means such as particles, supports, wells, dipsticks and the like.
Kits may also comprise labeling means such as dyes, developing reagents, radioisotopes, fluorescent agents, luminescent or chemiluminescent agents, enzymes, intercalating agents and the like. With the nucleic acid and amino acid sequence information provided herein, individuals skilled in art can readily assemble kits to serve their particular purpose. Kits further can include instructions for use.
IX. Drue Screening Assays Usin~Hwlori Polypeptides By making available purified and recombinant H. pylori polypeptides, the I 0 present invention provides assays which can be used to screen for drugs which are either agoilists or antagonists of the normal cellular function, in this case, of the subject H.
pylori polypeptides, or of their role in intracellular signaling. Such inhibitors or potentiators may be useful as new therapeutic agents to combat H. pylori infections in humans. A variety of assay formats will suffice and, in light of the present inventions, 15 will be comprehended by the skilled artisan.
In many drug screening programs which test libraries of compounds and natural extracts, high throughput assays are desirable in order to maximize the number of compounds surveyed in a given period of time. Assays which are performed in cell-free systems, such as may be derived with purified or semi-purified proteins, are often 20 preferred as "primary" screens in that they can be generated to permit rapid development and relatively easy detection of an alteration in a molecular target which is mediated by a test compound. Moreover, the effects of cellular toxicity and/or bioavailability of the test compound can be generally ignored in the in vitro system, the assay instead being focused primarily on the effect of the drug on the molecular target as may be manifest in 25 an alteration of binding affinity with other proteins or change in enzymatic properties of the molecular target. Accordingly, in an exemplary screening assay of the present invention, the compound of interest is contacted with an isolated and purified H. pylori polypeptide.
Screening assays can be constructed in vitro with a purified H. pylori 30 polypeptide or fragment thereof, such as an H. pylori polypeptide having enzymatic activity, such that the activity of .he polypeptide produces a detectable reaction product.
The efficacy of the compound can be assessed by generating dose response curves from data obtained using various concentrations of the test compound. Moreover, a control assay can also be performed to provide a baseline for comparison. Suitable products 35 include those with distinctive absorption, fluorescence, or chemi-luminescence properties, for example, because detection may be easily automated. A variety of synthetic or naturally occurring compounds can be tested in the assay to identify those which inhibit or potentiate the activity of the N. pylori polypeptide. Some of these active compounds may directly, or with chemical alterations to promote membrane permeability or solubility, also inhibit or potentiate the same activity (e.g., enzymatic activity) in whole, live H. pylori cells.
This invention is further illustrated by the following examples which should not be construed as limiting. The contents of all references and published patent applications cited throughout this application are hereby incorporated by reference.
EXEMPLIFICATION
I. Cloning and Sequencing of H pylori DNA
H. pylori chromosomal DNA was isolated according to a basic DNA protocol outlined in Schleif R.F. and Wensink P.C., Practical Methods in Molecular Biology, p.98, Springer-Verlag, NY., 1981, with minor modifications. Briefly, cells were pelleted, resuspended in TE ( 10 mM Tris, 1 mM EDTA, pH 7.6) and GES lysis buffer (5.1 M guanidium thiocyanate, 0.1 M EDTA, pH 8.0, 0.5% N-laurylsarcosine) was added. Suspension was chilled and ammonium acetate (NH4Ac) was added to final concentration of 2.0 M. DNA was extracted, first with chloroform, then with phenol-chloroform, and reextracted with chloroform. DNA was precipitated with isopropanol, washed twice with 70% EtOH, dried and resuspended in TE.
Following isolation whole genomic H. pylori DNA was nebulized (Bodenteich et al., Automated DNA Seguencing and Analysis (J.C. Venter, ed.), Academic Press, I 994) to a median size of 2000 bp. After nebulization, the DNA was concentrated and separated on a standard 1 % agarose gel. Several fractions, corresponding to approximate sizes 900-1300 bp, 1300-1700 bp, 1700-2200 bp, 2200-2700 bp, were excised from the gel and purified by the GeneCIean procedure (Bio101, Inc.).
The purified DNA fragments were then blunt-ended using T4 DNA polymerase.
The healed DNA was then ligated to unique BstXI-linker adapters in 100-1000 fold molar excess. These linkers are complimentary to the BstXI-cut pMPX vectors, while tl- a overhang is not self complimentary. Therefore, the linkers will not concatemerize nor will the cut-vector religate itself easily. The linker-adopted inserts were separated from the unincorporated linkers on a 1 % agarose gel and purified using GeneClean. The linker-adopted inserts were then ligated to each of the 20 pMPX vectors to construct a series of "shotgun" subclone Libraries. The vectors contain an out-of frame IacZ gene at the cloning site which becomes in-frame in the event that an adapter-dimer is cloned, allowing these to be avoided by their blue-color.

All subsequent steps were based on the multiplex DNA sequencing protocols outlined in Church G.M. and Kieffer-Higgins S., Science 240:185-188, 1988.
Only major modifications to the protocols are highlighted. Briefly, each of the 20 vectors was then transformed into DHSa competent cells (GibcoBRL, DHSa transformation S protocol). The libraries were assessed by plating onto antibiotic plates containing ampicillin, methicillin and IPTG/Xgal. The plates were incubated overnight at 37oC.
Successful transformants were then used for plating of clones and pooling into the multiplex pools. The clones were picked and pooled into 40 ml growth medium cultures. The cultures were grown overnight at 37oC. DNA was purified using the Qiagen Midi-prep kits and Tip-100 columns (Qiagen, Inc.). In this manner, 100 ~g of DNA was obtained per pool. Fifteen 96-well plates of DNA were generated to obtain a 5- I 0 fold sequence redundancy assuming 250-300 base average read-lengths.
These purified DNA samples were then sequenced using the multiplex DNA
sequencing based on chemical degradation methods (Church G.M. and Kieffer-Higgins S., Science 240:185-188, 1988) or by Sequithrem (Epicenter Technologies) dideoxy sequencing protocols. The sequencing reactions were electrophoresed and transferred onto nylon membranes by direct transfer electrophoresis from 40 cm gels (Richterich P.
and Church G.M., Methods in Enrymology 218:187-222, 1993) or by electroblotting (Church, supra). 24 samples were run per gel. 45 successful membranes were produced by chemical sequencing and 8 were produced by dideoxy sequencing. The DNA was covalently bound to the membranes by exposure to ultraviolet light, and hybridized with labeled oligonucleotides complimentary to tag sequences on the vectors (Church, supra).
The membranes were washed to rinse off non-specifically bound probe, and exposed to X-ray film to visualize individual sequence ladders. After autoradiography, the hybridized probe was removed by incubation at 65° C, and the hybridization cycle repeated with another tag sequence until the membrane had been probed 3 8 times for chemical sequencing membranes and 10 times for the dideoxy sequencing membranes.
Thus, each gel produced a large number of films, each containing new sequencing information. Whenever a new blot was processed, it was initially probed for an internal standard sequence added to each of the pools.
Digital images of the films were generated using a laser-scanning densitomet :r (Molecular Dynamics, Sunnyvale, CA). The digitized images were processed on computer workstations (VaxStation 4000's) using the program REPLICATM (Church et al., Automated DNA Sequencing and Analysis (J.C. Venter, ed.), Academic Press, 1994).
Image processing included lane straightening, contrast adjustment to smooth out intensity differences, and resolution enhancement by iterative gaussian deconvolution.
The sequences were then automatically picked in REPLICATM and displayed for interactive proofreading before being stored in a project database. The proofreading was accomplished by a quick visual scan of the film image followed by mouse clicks on the bands of the displayed image to modify the base calls. Many of the sequence errors could be detected and corrected because multiple sequence reads covering the same portion of the genomic DNA provide adequate sequence redundancy for editing.
Each sequence automatically received an identification number (corresponding to microtiter plate, probe information, and lane set number). This number serves as a permanent identifier of the sequence so it is always possible to identify the original of any particular sequence without recourse to a specialized database.
Routine assembly of H. pylori sequences was done using the program FALCON
(Church, Church et al., Automated DNA Sequenicng and Analysis (J.C. Venter, ed.), Academic Press, 1994). This program has proven to be fast and reliable for most sequences. The assembled contigs were displayed using a modified version of GelAssemble, developed by the Genetics Computer Group (GCG) (Devereux et al., 1 S Nucleic Acid Res. 12:387-95, 1984) that interacts with REPLICATM. This provided for an integrated editor that allows multiple sequence gel images to be instantaneously called up from the REPLICATM database and displayed to allow rapid scanning of contigs and proofreading of gel traces where discrepancies occurred between different sequence reads in the assembly.
I1. Identification, cloning and expression of recombinant H. pylori DNA
sequences To facilitate the cloning, expression and purification of membrane and secreted proteins from H. pylori a powerful gene expression system, the pET System (Novagen), for cloning and expression of recombinant proteins in E. coli, was selected.
Also, a DNA sequence encoding a peptide tag, the His-Tag, was fused to the 3' end of DNA
sequences of interest in order to facilitate purification of the recombinant protein products. The 3' end was selected for fusion in order to avoid alteration of any 5' terminal signal sequence. The exception to the above was ppiB, a gene cloned for use as a control in the expression studies. In this study, the sequence for H. pylori ppiB
contains a DNA sequence encoding a His-Tag fused to the 5' end of the full length gene, because the protein product of this gene does not c~nt~.in a signal sequence and is expressed as a cytosolic protein.

WO 98/24475 PCT/US97t22104 PCR Amplifrcation and cloning of DNA sequences containing ORF's for membrane and secreted proteins from the J99 Strain of Helicobacter pylori.
Sequences chosen (from the list of the DNA sequences of the invention) for cloning from the J99 strain of H. pylori were prepared for amplification cloning by polymerase chain reaction (PCR). Synthetic oligonucleotide primers (Table 3) specific for the 5' and 3' ends of open reading frames (ORFs) were designed and purchased (GibcoBRL Life Technologies, Gaithersburg, MD, USA). All forward primers (specific for the 5' end of the sequence) were designed to include an NcoI cloning site at the extreme 5' terminus, except for HpSeq. 4821082 where NdeI was used. These primers were designed to permit initiation of protein translation at a methionine residue followed by a valine residue and the coding sequence for the remainder of the native H.
pylori DNA sequence. An exception is H. pylori sequence 4821082 where the initiator methionine is immediately followed by the remainder of the native H. pylori DNA
sequence. All reverse primers (specific for the 3' end of any H. pylori ORF) included a EcoRI site at the extreme 5' terminus to permit cloning of each H. pylori sequence into the reading frame of the pET-28b. The pET-28b vector provides sequence encoding an additional 20 carboxy-terminal amino acids (only 19 amino acids in HpSeq.

and HpSeq.14640637) including six histidine residues (at the extreme C-terminus), which comprise the His-Tag. An exception to the above, as noted earlier, is the vector construction for the ppiB gene. A synthetic oligonucleotide primer specific for the 5' end of ppiB gene encoded a BamHI site at its extreme 5' terminus and the primer for the 3' end of the ppiB gene encoded a XhoI site at its extreme 5' terminus.

OIi~POnucleotide primers used for PCR amplification of H. pylori DNA sequences Outer membrane Forward primer 5' Reverse Primer 5' to 3' to 3' Proteins Protein 16225006 5'-TATACCATGGTGGG 5'-ATGAATTCGAGTA

CGCTAA-3' (SEQ ID AGGATTTTTG-3' (SEQ

_ N0:195) ID N0:196) Protein 26054702 5'-TTAACCATGGTGA 5'-TAGAATTCGCATA

AAAGCGATA-3' (SEQ ACGATCAATC-3' (SEQ
ID

N0:197) ID N0:198) Protein 7116626 5'-ATATCCATGGTGA 5'-ATGAATTCAATTT

GTTTGATGA-3' (SEQ TTTATTTTGCCA-3' ID

N0:199) (SEQ ID N0:200) I Protein 29479681 5'-AATTCCATGGTGG 5'-ATGAATTCTCGAT

GGGCTATG-3' (SEQ AGCCAAAATC-3' (SEQ
ID

N0:201 ) ID N0:202) Protein 14640637 5'-AATTCCATGGTG 5'-AAGAATTCTCTA

CATAACTTCCATT-3' GCATCCAAATGGA-3' (SEQ ID N0:203) (SEQ ID N0:204) Periplasmic/ Secreted Proteins Protein 30100332 5'-ATTTCCATGGTCATG 5'-ATGAATTCCATC

TCTCATATT-3' (SEQ TTTTATTCCAC-3' ID

N0:205) (SEQ ID N0:206) Protein 4721061 5'-AACCATGGTGATTT 5'-AAGAATTCCAC

TAAGCATTGAAAG-3' TCAAAATTTTTTAAC

(SEQ ID N0:207) AG-3' (SEQ ID N0:208) 'i Other Surface Proteins Protein 4821082 5'-GATCATCCATATGTT 5'-TGAATTCAACCA

ATCTTCTAAT-3' (SEQ TTTTAACCCTG-3' ID N0:209) (SEQ ID N0:210) Protein 978477 5'-TATACCATGGTGAA S'-AGAATTCAATT

ATTTTTTCTTTTA-3' GCGTCTTGTAAAAG-(SEQ ID N0:211 ) 3' (SEQ ID N0:212) Inner Membrane Protein Protein 26380318 5'-TATACCATGGTGAT 5'-ATGAATTCCCACTT

GGACAAACTC-3' (SEQ GGGGCGATA-3' (SEQ

ID N0:213) ID N0:214) Cytoplasmic Protein ppi 5'-TTATGGATCCAAAC 5'-TATCTCGAGTTATA

CAATTAAAACT-3' (SEQ GAGAAGGGC-3' (SEQ

ID N0:215) ID N0:216) Genomic DNA prepared from the J99 strain of H. pylori (ATCC #55679;
deposited by Genome Therapeutics Corporation, 100 Beaver Street, Waltham, MA
02154) was used as the source of template DNA for PCR amplification reactions (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994). To amplify a DNA sequence containing an H. pylori ORF, genomic DNA
(50 nanograms) was introduced into a reaction vial containing 2 mM MgCl2, 1 micromolar synthetic oligonucleotide primers (forward and reverse primers) complementary to and flanking a defined H. pylori ORF, 0.2 mM of each deoxynucleotide triphosphate; dATP, dGTP, dCTP, dTTP and 2.5 units of heat stable ___ ._~._._r. __.

DNA polymerase (Amplitaq, Roche Molecular Systems, Inc., Branchburg, NJ, USA) in a final volume of 100 microliters. The following thermal cycling conditions were used to obtain amplified DNA products for each ORF using a Perkin Elmer Cetus/
GeneAmp PCR System 9600 thermal cycler:
Protein 26054702, Protein 7116626, Protein 29479681, Protein 30100332, and Protein 4821082;
Denaturation at 94°C for 2 min, 2 cycles at 94°C for 1 S sec, 30°C for 15 sec and 72°C
for 1.5 min 23 cycles at 94°C for I S sec, 55°C for 15 sec and 72°C
for 1.5 min Reactions were concluded at 72°C for 6 minutes.
Protein 16225006;
Denaturation at 94°C for 2 min, 25 cycles at 95°C for I S sec, 55°C for 15 sec and 72°C for 1.5 min Reaction was concluded at 72°C for 6 minutes.
Protein 4721061;
Denaturation at 94°C for 2 min, 2 cycles at 94°C for 15 sec, 36°C for 15 sec and 72°C
for 1.5 min 23 cycles at 94°C for 15 sec, 60°C for 15 sec and 72°C
for 1.5 min Reactions were concluded at 72°C for 6 minutes.
Protein 26380318;
Denaturation at 94°C for 2 min, 2 cycles at 94°C for 15 sec, 38°C for 15 sec and 72°C for 1.5 min 23 cycles at 94°C for 15 ses, 62°C for 15 sec and 72°C
for 1.5 min Reactions were concluded at 72°C for 6 minutes.
Protein 14640637;
Denaturation at 94°C for 2 min, 2 cycles at 94°C for 15 sec, 33°C for 15 sec and 72°C for 1.5 min 30 cycles at 94°C for 15 sec, SS°C for 15 sec and 72°C
for 1.5 min Reactions were concluded at 72°C for 6 minutes. -Conditions for amplification of H. pylori ppiB;
Denaturation at 94°C for 2 min, 2 cycles at 94°C for 15 sec, 32°C for 15 sec and 72°C for 1.5 min 25 cycles at 94°C for 1 S sec, 56°C for 15 sec and 72°C
for 1.5 min Reactions were concluded at 72°C for 6 minutes Upon completion of thermal cycling reactions, each sample of amplified DNA
was washed and purified using the Qiaquick Spin PCR purification kit (Qiagen, Gaithersburg, MD, USA). All amplified DNA samples were subjected to digestion with the restriction endonucleases, NcoI and EcoRI (New England BioLabs, Beverly, MA, USA), or in the case of HpSeq. 4821082 (SEQ ID NO: 1309), with NdeI and EcoRI
(Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994). DNA samples were then subjected to electrophoresis on 1.0 %
NuSeive (FMC BioProducts, Rockland, ME USA) agarose gels. DNA was visualized by 1 S exposure to ethidium bromide and long wave uv irradiation. DNA contained in slices isolated from the agarose gel was purified using the Bio 101 GeneClean Kit protocol (Bio 101 Vista, CA, USA).
Cloning of H. pylori DNA sequences into the pET 28b prokaryotic expression vector.
The pET-28b vector was prepared for cloning by digestion with NcoI and EcoRI, or in the case of H. pylori protein 4821082 with NdeI and EcoRI (Current Protocols in Molecular Biology, 3ohn Wiley and Sons, Inc., F. Ausubel et al., eds., 1994).
In the case of cloning ppiB, the pET-28a vector, which encodes a His-Tag that can be fused to the S' end of an inserted gene, was used and the cloning site prepared for cloning with the ppiB gene by digestion with BamHI and XhoI restriction endonucleases.
Following digestion, DNA inserts were cloned (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994) into the previously digested pET-28b expression vector, except for the amplified insert for ppiB, which was cloned into the pET-28a expression vector. Products of the ligation reaction were then used to transform the BL21 strain of E. coli (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., ids., 1994) as described below.
Transformation of competent bacteria with recombinant plasmids Competent bacteria, E coli strain BL21 or E. coli strain BL21(DE3), were transformed with recombinant pET expression plasmids carrying the cloned H.
pylori sequences according to standard methods (Current Protocols in Molecular, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994). Briefly, 1 microliter of ligation reaction was mixed with 50 microliters of electrocompetent cells and subjected to a high voltage pulse, after which, samples were incubated in 0.45 milliliters SOC medium (0.5% yeast extract, 2.0 % tryptone, 10 mM NaCI, 2.5 mM KCI, 10 mM MgCl2, 10 mM MgS04 and 20, mM glucose) at 37oC with shaking for 1 hour. Samples were then spread on LB
agar plates containing 25 microgram/ml kanamycin sulfate for growth overnight.
Transformed colonies of BL21 were then picked and analyzed to evaluate cloned inserts as described below.
Identification of recombinant pET expression plasmids carrying H. pylori sequences Individual BL21 clones transformed with recombinant pET-28b-H.pylori ORFs were analyzed by PCR amplification of the cloned inserts using the same forward and reverse primers, specific for each H. pylori sequence, that were used in the original PCR
amplification cloning reactions. Successful amplification verified the integration of the H. pylori sequences in the expression vector (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994).
Isolation and Preparation of plasmid DNA from BL21 transformants Individual clones of recombinant pET-28b vectors carrying properly cloned H.
pylori ORFs were picked and incubated in 5 mls of LB broth plus 25 microgram/ml kanamycin sulfate overnight. The following day plasmid DNA was isolated and purified using the Qiagen plasmid purification protocol (Qiagen Inc., Chatsworth, CA, USA).
Expression of recombinant H. pylori sequences in E coli The pET vector can be propagated in any E coli K-12 strain e.g. HMS174, HB 101, JM109, DHS, etc. for the purpose of cloning or plasmid preparation.
Hosts for expression include E. coli strains containing a chromosomal copy of the gene for T7 RNA polymerise. These hosts are lysogens of bacteriophage DE3, a lambda derivative that carries the lacI gene, the lacUVS promoter and the gene for T7 RNA
polymerise.
T7 RNA polymerise is induced by addition of isopropyl-B-D-thiogalactoside {IPTG), and the T7 RN ~ polymerise transcribes any target plasmid, such as pET-28b, carrying a T7 promoter and a gene of interest. Strains used include: BL21 (DE3) (Studier, F.W., Rosenberg, A.H., Dunn, J.J., ind Dubendorff, J.W. (1990) Meth. Enzymol. 185, 60-89).
To express recombinant H. pylori sequences, 50 nanograms of plasmid DNA
isolated as described above was used to transform competent BL21 (DE3) bacteria as described above {provided by Novagen as part of the pET expression system kit). The IacZ gene (beta-galactosidase) was expressed in the pET-System as described for the H.

WO 98!24475 PCT/US97/22104 pylori recombinant constructions. Transformed cells were cultured in SOC
medium for 1 hour, and the culture was then plated on LB plates containing 25 micrograms/ml kanamycin sulfate. The following day, bacterial colonies were pooled and grown in LB
medium containing kanamycin sulfate (25 micrograms/ml) to an optical density at 600 nM of 0.5 to 1.0 O.D. units, at which point, 1 millimolar IPTG was added to the culture for 3 hours to induce gene expression of the H. pylori recombinant DNA
constructions.
After induction of gene expression with IPTG, bacteria were pelleted by centrifugation in a Sorvall RC-3B centrifuge at 3500 x g for 15 minutes at 4°C. Pellets were resuspended in 50 milliliters of cold 10 mM Tris-HCI, pH 8.0, 0.1 M NaCI
and 0.1 mM EDTA (STE buffer). Cells were then centrifuged at 2000 x g for 20 min at 4oC.
Wet pellets were weighed-and frozen at -80°C until ready for protein purification.
III. Purification of recombinant proteins from E toll Analytical Methods The concentrations of purified protein preparations were quantified spectrophotometrically using absorbance coefficients calculated from amino acid content (Perkins, S.J. 1986 Eur. J. Biochem. 157, 169-180). Protein concentrations were also measured by the method of Bradford, M.M. ( 1976) Anal. Biochem. 72, 248-254, and Lowry, O.H., Rosebrough, N., Farr, A.L. & Randall, R.J. ( 1951 ) J. Biol.
Chem. 193, pages 265-275, using bovine serum albumin as a standard.
SDS-polyacrylamide gels ( 12% or 4.0 to 25 % acrylamide gradient gels) were purchased from BioRad (Hercules, CA, USA), and stained with Coomassie blue.
Molecular weight markers included rabbit skeletal muscle myosin (200 kDa), E.
toll (-galactosidase ( 116 kDa), rabbit muscle phosphorylase B (97.4 kDa), bovine serum albumin (66.2 kDa), ovalbumin (45 kDa), bovine carbonic anhydrase (31 kDa), soybean trypsin inhibitor (21.5 kDa), egg white lysozyme ( 14.4 kDa) and bovine aprotinin (6.5 kDa). -1. Purification of soluble proteins All steps were carried out at 4oC. Frozen cells were thawed, resuspended in 5 volumes of lysis buffer (20 mM Tris, pH 7.9, 0.5 M NaCI, 5 mM imidazole with 10%
glycerol, 0.1 % 2-mercaptoethanol, 200 fig/ ml lysozyme, 1 mM
phenylmethyIsulfonyl fluoride (PMSF), and 10 ug/ml each of leupeptin, aprotinin, pepstatin, L-1-chloro-3-[4-tosylamido]-7-amino-2-heptanone (TLCK), L-1-chloro-3-[4-tosylamidoJ-4-phenyl-2-butanone (TPCK), and soybean trypsin inhibitor, and ruptured by several passages through a small volume microfluidizer (Model M-1 l OS, Microfluidics International Corporation, Newton, MA). The resultant homogenate was made 0.1 % Brij 35, and centrifuged at 100,000 x g for 1 hour to yield a clear supernatant (crude extract).
Following filtration through a 0.8 ~m Supor filter (Gelman Sciences, FRG) the crude extract was loaded directly onto a Ni2+- nitrilotriacetate-agarose (NTA) with a 5 milliliter bed volume (Hochuli, E., Dbeli, H., and Schacheer, A. (1987) J.
Chromatography 411, 177-184) pre-equilibrated in lysis buffer containing 10 glycerol, 0.1 % Brij 35 and 1 mM PMSF. The column was washed with 250 ml (50 bed volumes) of lysis buffer containing 10 % glycerol, 0.1 % Brij 35, and was eluted with sequential steps of lysis buffer containing 10 % glycerol, 0.05 % Brij 35, 1 mM PMSF, and 20, 100, 200, and 500 mM imidazole in succession. Fractions were monitored by absorbance at OD280 nm, and peak fractions were analyzed by SDS--PAGE.
Fractions containing the recombinant protein eluted at 100 mM imidazole.
Recombinant protein 14640637 and proteins, beta-galactosidase (IacZ) and peptidyl-prolyl cis-traps isomerase (ppiB) Fractions containing the recombinant proteins from the Ni2+-NTA-agarose columns were pooled and then concentrated to approximately 5 ml by centrifugal filtration (Centriprep-10, Amicon, MA), and loaded directly onto a 180-ml column (1.6 X 91 cm) of Sephacryl S-100 HR gel filtration medium equilibrated in Buffer A
(10 mM
Hepes, pH 7.5, 150 mM NaCI, 0.1 mM EGTA) and run in Buffer A at 18 ml/h.
Fractions containing the recombinant protein were identified by absorbance at 280 nm and analyzed by SDS-PAGE. Fractions were pooled and concentrated by centrifugal filtration.
Recombinant protein 7116626 Fractions containing the recombinant protein from the Ni2+ -NTA-agarose column were pooled and dialyzed overnight against 1 liter of dialysis buffer ( 10 mM
MOPS, pH 6.5, 50 mM NaCI, 0.1 mM EGTA, 0.02% Brij 35 and 1 mM PMSF). In the morning, a fine white precipitate was removed by centrifugation and the resulting supernatant was loaded onto an 8 ml (8 x 75 mm) MonoS high performance liquid chromatography column (Pharmacia Biotechnology, Inc., Piscataway, NJ; USA) equilibrated in buffer B (I O mM MOPS, pH 6.5, 0.1 mM EGTA) containing 50 mM
NaCI. The column was washed with 10 bed volumes of buffer B containing 50 mM
NaCI, and developed with a 50-ml linear gradient of increasing NaCI (50 to 500 mM).
Recombinant protein 7116626 eluted as a sharp peak at 300 mM NaCI.

_78_ 2. Purifrcation of insoluble proteins from inclusion bodies The following steps were carried out at 4oC. Cell pellets were resuspended in lysis buffer with 10% glycerol 200 p.g/ ml lysozyme, 5 mM EDTA, i mM PMSF and 0.1 -mercaptoethanol. After passage through the cell disrupter, the resulting homogenate was made 0.2 % deoxycholate, stirred 10 minutes, then centrifuged at 20,000 x g, for 30 min. The pellets were washed with lysis buffer containing 10 % glycerol, 10 mM
EDTA, 1 % Triton X-100, 1 mM PMSF and 0.1 % -mercaptoethanol, followed by several washes with lysis buffer containing 1 M urea, 1 mM PMSF and 0.1 % 2-mercaptoethanol. The resulting white pellet was composed primarily of inclusion bodies, free of unbroken cells and membranous materials.
Recombinant proteins 26054702, 16225006, 30100332, 4721061 The following steps were carried out at room temperature. Purified inclusion bodies were dissolved in 20 ml 8.0 M urea in lysis buffer with 1 mM PMSF and 0.1 2-mercaptoethanol, and incubated at room temperature for 1 hour. Materials that did not dissolve were removed by centrifugation. The clear supernatant was filtered, then loaded onto a Ni2~ -NTA agarose column pre-equilibrated in 8.0 M urea in Lysis Buffer. The column was washed with 250 ml (50 bed volumes) of lysis buffer containing 8 M urea, 1.0 mM PMSF and 0.1 % 2-mercaptoethanol, and developed with sequential steps of lysis buffer containing 8M urea, 1 mM PMSF, 0.1 % 2-mercaptoethanol and 20, 100, 200, and 500 mM imidazole in succession.
Fractions were monitored by absorbance at OD2g0 nm, and peak fractions were analyzed by SDS-PAGE. Fractions containing the recombinant protein eluted at 100 mM imidazole.
Recombinant proteins 29479681, 26380318 The pellet containing the inclusion bodies was solubilized in buffer B
containing 8 M urea, I mM PMSF and 0.1 % 2-mercaptoethanol, and incubated for 1 hour at room temperature. Insoluble materials were removed by centrifugation at 20,000 x g for 30 min, and the cleared supernatant was loaded onto a 15 ml ( 1.6 x 7.5 cm ) SP-Sepharose column pre-equilibrated in buffer B, 6 M urea, 1 mM PMSF, 0.1 % 2-mercaptoethanol.
- After washing the column with 1~ bid volumes, the column was developed with a linear gradient from 0 to 500 mM NaCI.
Dialysis and concentration of protein samples Urea was removed slowly from the protein samples by dialysis against Tris-buffered saline (TBS; 10 mM Tris pH 8.0, 150 mM NaCI) containing 0.5 deoxycholate (DOC) with sequential reduction in urea concentration as follows;
6M, _. ..._~__.._.._ _ .__ _._._____. ......r...__._ .._.. . .

4M, 3M, 2M, 1 M, 0.5 M and finally TBS without any urea. Each dialysis step was conducted for a minimum of 4 hours at room temperature.
After dialysis, samples were concentrated by pressure filtration using Amicon stirred-cells. Protein concentrations were measured using the methods of Perkins ( 1986 Eur. J. Biochem. 157, 169-180), Bradford ((1976) Anal. Biochem. 72, 248-254) and Lowry ((1951) J. Biol. Chem. 193, pages 265-275)) The recombinant proteins purified by the methods described above are summarized in Table 4 below.

J99 Homolog Gene Bacterial Method RelativeFinal Composit Sequenceidentifiedsymbolcell of MW on concentratioionof Identifierby Blastof fraction purificationSDS- n of buffer used to purified purify Homologrecombinant PAGE protein gel protein s vuacmcmva auc t a a»cum 16225006P28635 YEAC inclusion His-Tag 18 kDa 5 mg/mlB
bodies 26054702P15929 tlgH Inclusion His-Tag 37 kDa 1.18 B
bodies mg/ml ---- as dry pellet 71 16626P26093 e(P4) Soluble His-Tag 29 kDa 0.8 A
fraction mg/ml 1.85 C
mg/ml 29479681P13036 fecA InclusionsSP- 23 kDa 2.36 B
bodies Sepharose mglml 0.5 B
mg ml ---- as dry pellet 14640637P16665 TPFI Soluble His-Tag 17 kDa 2.4 A
fraction mg/ml gel filtration HR

Periplasmic/Secreted Protein ~

_ ~~ P23847 dppA Inclusion His-Tag I1 kDa 2.88 B
~032 bodies mg/ml 4721061 P36175 GCP Inclusion His-Tag 38 kDa 2.8 B
bodies mg/ml _80_ Other Surface Proteins 4821082 P08089 M Inciusion His-Tag20 kDa 1.16 B
proteinbodies mg/ml 978477 L28919 FBP54 Inclusion SP- 44 kDa 2.56 B
bodies Sepharose mg/ml -[ I 0.3 mg/mlB ~~

loner Membrane Yrotems 26380318 P15933 flit Inclusion SP- 11 kDa 22 mg/mlB
bodies Sepharose l;ontrol Yrotems Wth tl~s-l a~

P00722 IacZ Soluble His-Tag 116 10 mg/mlA
fraction kDa gel filtration HR

ppiB Soluble His-Tag 21 4.4 A
fraction kDa mg/ml gel filtration HR

Buffer composition s:

A=10 mM Hepes pH 7.5, mM NaCI, 0.1 mM EGTA

B= 10 mM Tris pH 8.0, mM NaCI, 0.5 % DOC

C= 10 mM MOPS
pH 6.5, mM NaCI, 0.1 EGTA

I

IV. Analysis of H pylori proteins as Vaccine candidates To analyze H. pylori proteins for use in the vaccine formulations of the invention, several H. pylori proteins were expressed, characterized immunologically and tested in animal efficacy studies as outlined below. Specifically, the immunomodulatory effects of H. pylori proteins were investigated in a mouse/H. pylori model which mimics the human H. pylori infection in humans. In these studies, the effect of oral immunization of selected H. pylori poiypeptides in H. pylori infected mice was determined.
-- Identification, cloning and expression of recombinant Helicobacter pylori seguences.
1 S To facilitate the cloning, expression and purification of membrane andlor secreted proteins from H. pylori, the pET gene expression system (Novagen), for cloning '-and expression of recombinant proteins in Escherichia coli was selected.
Further, for proteins that have a signal sequence at their amino-terminal end, a DNA
sequence encoding a peptide tag (His-tag) was fused to the 5' end of the H. pylori DNA
sequences of interest in order to facilitate purification of the recombinant protein products.

PCR amplification and cloning of DNA sequences containing ORFs for membrane and secreted proteins from the J99 strain of Helicobacter pylori.
The sequences selected (from the list of the DNA sequences of the invention) for S cloning from H. pylori strain J99 were prepared for amplification cloning by the polymerase chain reaction (PCR). All of the selected sequences encode for outer membrane H. pylori proteins, with vac9 (SEQ ID N0:125), vacl0 (SEQ ID N0:147), vac22 (SEQ ID N0:121 ) and vac41 (SEQ ID N0:176) sequences all sharing a terminal phenylalanine residue. Likewise, the vac32 (SEQ ID N0:108), vac36 (SEQ ID
N0:149) and vac37 (SEQ ID N0:139) sequences all share a terminal phenylalanine residue and a tyrosine cluster at the C-terminus. Synthetic oligonucleotide primers for each ORF of interest (Table 5) specific for the predicted mature 5' end of the ORF and downstream (3') of the predicted translational termination codon were designed and purchased (GibcoBRL Life Technologies, Gaithersburg, MD, USA). All forward primers {specific for the 5' terminus of the region of ORF of interest) were designed to include a BamIII
restriction site followed by a NdeI restriction site. These primers were designed to permit the initiation of protein translation at a methionine residue encoding within the NdeI restriction site sequence (in the case of producing a non His-tagged recombinant protein) or to fuse in frame with the DNA sequence encoding the His-tag (for producing His-tagged recombinant protein), followed by the coding sequence for the remainder of the native H. pylori DNA. All reverse oligonucleotide primers (specific for downstream (3') of the predicted translational termination codon of the ORF) were designed to include an EcoRI restriction site at the 5' terminus. This combination of primers would enable each ORF-of interest to be cloned into pET28b (to produce a His-tagged recombinant protein) or pET30a (to produce a non His-tagged or native recombinant protein). The pET28b vector provides sequence encoding an additional 20 amino-terminal amino acids (plus the methionine in the NdeI restriction site) including a stretch of six histidine residues which makes up the His-tag.
Genomic DNA prepared from H. pylori strain J99 (ATCC 55679) was used as the source of template DNA for the PCR amplification reactions (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausube~ et al., eds., 1994).
To amplify a DNA sequence containing a specific H. pylori ORF, genomic DNA (50 nanograms) was introduced into a reaction tube containing 200 nanograms of both the forward and reverse synthetic oligonucleotide primer specific for the ORF of interest, and 45 microliters of PCR SuperMix purchased (GibcoBRL Life Technologies, Gaithersburg, MD, USA) in a total of 50 microliters. The PCR SuperMix is supplied in 1.1X concentrations and contains 22mM Tris-HCl (pH 8.4), SSmM KCI, 1.65 mM

MgCl2, 220 micromolar of each dATP, dCTP, dGTP and dTTP, 22 units recombinant Taq polymerase/ml and stabilizers. The following thermal cycling conditions were used to obtain amplified DNA products for each ORF using a Perkin-Elmer Cetus/Gene Amp PCR System thermal cycler.
Table 5: Oligonucleotide primers Gene Forward primer Reverse primer vac9 CGCGGATCCATATGGCTGAAA CCGGAATTCATCAGTATTCAA

(nt SEQ AAACGCCTTTTTTTAAAACTAA TGGGAATAAAGCC (SEQ ID
ID

N0:28) AAACCAC (SEQ ID NO: 257) NO: 258) (aa SEQ
ID

NO: 125) vacl0 CGCGGATCCATATGAAAGAAG CCGGAATTCGCTTAAAAGAAA

(nt SEQ AAGAAAAAGAAGAAAAAAAG ATAGTCCCCCAAACGC (SEQ
ID

NO:50) ACAGAAAGG (SEQ ID NO: 259) ID NO: 260) (aa SEQ
ID

NO: 147) vac22 CGCCGGATCCATATGAAAGAG CCGGAATTCATATAAATATCA

(nt SEQ GTCATTCCACCCCTTCAACCCC TATAGGCAGAAAAAC (SEQ ID
ID

N0:24) (SEQ ID NO: 261 ) NO: 262) (aa SEQ
ID

NO: 121) vac32 CGCGGATCCATATGGAGGCAG CCGGAATTCGATTGATTTTGTC

(nt SEQ AGCTTGATGAAAAATC (SEQ ID AAATCTAAAATCCC (SEQ ID
ID

NO:11 NO: 263) NO: 264) ) (aa SEQ
ID

NO: 108) vac36 TATTATACATATGGAAGAAGA TAATCTCGAGTTTAGAAGGCG
(hop B) TGGG (SEQ ID NO: 265) TA (SEQ ID NO: 266) (nt SEQ
ID

N0:52) (aa SEQ
ID

N0:149) _.._.___ __ _.____T . . ... . .

vac37 TTATATTCATATGGAAGACGAT AATTCTCGAGCCTCTTTATAA

(i-hop) GGC (SEQ ID NO: 267) GCC (SEQ ID NO: 268) (nt SEQ
ID

N0:42) (aa SEQ
ID

NO: 139) vac41 CGCGGATCCATATGGTAGAAG CCGGAATTCGGAGCCAATAGG

(nt SEQ CCTTTCAAAAACACCAAAAAG GAGCTAAAGCC (SEQ ID NO:
ID

N0:79) ACGG (SEQ ID NO: 269) 270) (aa SEQ
ID

NO: 176) Sequences for Vac32, Vac9 and Vac22 Denaturation at 94°C for 30 sec 35 cycles at 94°C for 15 sec, 55°C for 15 sec, and 72°C
for 1.5 min Reactions were concluded at 72°C for 8 minutes Sequences for VaclO and Vac41 Denaturation at 94°C for 30 sec 35 cycles at 94°C for 15 sec, 55°C for 15 sec, and 72°C
for 2.5 min I0 Reactions were concluded at 72°C for 8 minutes Sequences for Vac36 and Vac37 Denaturation at 2 cycles at 94°C for 15 sec, 30°C for 15 sec, and 72°C
for 1.5 min 23 cycles at 94°C for 15 sec, 55°C for 15 sec, and 72°C
for 1.5 min Reactions were concluded at 72°C for 6 minutes Upon completion of the thermal cycling reactions, each sample of amplified DNA was subjected to electrophoresis on 1.0% agarose gels. The DNA was visualized ''0 by exposure to ethidium bromide and long wave UV irradiation, and cut out in gel slices. DNA was purified using the Wizard PCR Preps Kit (Promega Corp., Madison, WI, USA), and then subj ected to digestion with BamHI and EcoRI (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994).
The digested PCR amplicon was then re-electrophoresed and purified as before.

Ligation of H. pylori DNA sequences into cloning vectors The pOKl2 vector (J. Vieira and J. Messing, Gene 100:189-194, 1991) was prepared for cloning for digestion with BamHI and EcoRI in the case of Vac9, 10, 22, 31 and 32, whereas the pSU21 vector (B. Bartolome et al., Gene 102:75-78, 1991 ) was prepared for cloning by digestion with BamHI and EcoRI in the case of Vac 41 (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994). The vectors were subjected to electrophoresis on 1.0% agarose gels and purified using the Wizard PCR Preps kit (Promega Corp., Madison, WI, USA). Following ligation of the purified, digested vector and the purified, digested amplified H. pylori ORF, the products of the ligation reaction were transformed into E. coli JM109 competent cells according to standard methods (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994). Individual bacterial colonies were screened for those containing the correct recombinant plasmids by incubating in LB broth overnight (plus 25ug/ml kanamycin sulfate for the pOKl2 based plasmids or 25ug/ml chloramphenicol for the pSU21 based plasmids) followed by plasmid DNA
preparation using the Magic Minipreps system (Promega Corp., Madison, WI, USA), and then analyzed by restriction digestion (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994).
Cloning of H. pylori DNA sequences into the pET28b and pET30a prokaryotic expression vectors Both the pET28b and pET30a expression vectors were prepared for cloning by digestion with NdeI and EcoRI (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994). The H. pylori DNA sequences were removed from pOKl2 (Vac9,10,23,31 and 32) or pSU21 (Vac41 ) plasmid backbones by digestion with NdeI and EcoRI (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al.) eds., 1994). The pET28b, pET30a and H.
pylori DNA
sequences were ali electrophoresed on a 1 % agarose gel and purified using the Wizard PCR Preps kit (Promega Corp., Madison WI, USA). Following ligation of the purified, digested expression vector and the purified, digest H. pylori DNA sequences, the products of the ligation reaction were transformed into E. col i JM 109 competes _ cells (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994). Individual bacterial colonies were screened for those containing the correct recombinant plasmids by preparing plasmid DNA as described above followed by 3 S analysis by restriction digestion profiles and DNA sequencing (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994).
These recombinant plasmids were then used to transform specific E. coli expression strains.

Transformation of competent bacteria with recombinant expression plasmids Competent bacterial strains (BL21 (DE3), BL21 (DE3)pLyS, HMS 174(DE3) and HMS 174(DE3)pLysS were prepared and transformed with the recombinant pET28b expression plasmids carrying the cloned H. pylori sequences according to standard methods (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F.
Ausubel et al., eds., 1994). These expression host strains contain a chromosomal copy of the gene for T7 RNA polymerase. These hosts are lysogens of bacteriophage DE3, a lambda derivate that carries the lacl gene, the IacUV~ promoter and the gene for T7 RNA polymerase. T7 RNA polymerase expression is induced by the addition of isopropyl-(3-D thiogalactoside ( 1 PTG), and the T7 RNA polymerase then transcribes any target plasmid, such as pET28b, that carries a T7 promoter sequence and a gene of Interest.
Expression of recombinant H. pylori sequences in E. coli Transformants were collected from LB agar plates containing 25ug/ml kanamycin sulfate (ensures maintenance of the pET28b-based recombinant plasmids) and used to inoculate LB broth containing 25ug/ml kanamycin sulfate and grown to an optical density at 600nm of 0.5 to 1.0 OD units, at which point 1 mM 1 PTG was added to the culture for one to three hours to induce gene expression of the H.
pylori recombinant DNA constructions. After induction of gene expression with 1 PTG, bacteria were pelleted by centrifugation and resuspended in SDS-PAGE
solubilization buffer and subjected to SDS-PAGE (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994). Proteins were visualized by staining with Coomassie Brilliant Blue or detected by western immunoblotting using the specific anti-His tag monoclonal antibody (Clontech, Palo Alto, CA, USA) using standard methods (Current Protocols-in Molecular Biology, John Wiley and Sons, Inc., F.
Ausubel et al., eds., 1994). The host strain that provided the highest level of recombinant protein production was then chosen for use in a large-scale induction in order to purify the recombinant protein. All of the following proteins listed were expressed recombinantly and the strain giving the highest level of expression listed:
BL21 (DE3) (vac31, vac26, vac37); BL21 (DE3) pLysS (vac 9, 32); HMS 174(DE3) (vac 10,11 ).

Purifrcation of recombinant proteins and generation of specific antiserum Large scale cultures were inoculated and grown as above, and induced with 1mM
1 PTG for 3 hours. After induction, bacteria were pelleted by centrifugation in a Sorvall centrifuge at 3500 x g for 15 min at 4°C. All of the expressed recombinant proteins S were present in the insoluble inclusion body fraction. Inclusion bodies were purified according to standard protocols (Antibodies, Cold Spring Harbor Laboratory Press, E.
Harlow and D. Lane, eds., 1988). The recombinant protein produced by vac32 was solubilized in 8M urea and partially purified by nickel chromatography (REF
here).
Denatured recombinant proteins were purified by electrophoresis on SDS-PAGE
gels, and after visualization with Coomassie Brilliant Blue, the protein was excised from the gel and the gel slices homogenized. This material was used to raise specific polyclonal antibodies in mice or rabbits according to standard protocols (Antibodies, Cold Spring Harbor Laboratory Press, E. Harlow and D. Lane, eds., 1988).
Immunological characterization of recombinant proteins In all cases where antibody was attempted to be raised, high titre antisera was generated, confirming the immunogenicity of the recombinant proteins. Further, these specific antisera were used to analyze whether the protein encoded by the cloned gene was expressed in H. pylori. Western immunoblot analysis using standard protocols (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994) confirmed that the H. pylori strain J99 did express proteins of the expected molecular weight that reacted with the vacl0, vac32, vac3l, vac36 antiserum.
The specific antiserum was also used to determine the level of antigenic conservation between a large number of H. pylori isolates that had been obtained from distinct geographical sites around the world, and from all types of clinical manifestations, including gastritis, duodenal ulcer, gastric ulcer and gastric cancer. It was found that every strain produced a protein that reacted specifically with each antiserum.
Further, H. pylori cells from strains J99, 17874, AH244 and SS 1-were fractionated into different cellular compartments (Doig and Trust 1994 Infect.
Immun.
62:4526-4533: O'Toole et al. 1995 J. Bacteriol. 177:6049-6057). The specific antiserum was used to probe .hese fractions by western immunoblot to identify in which fraction the protein was localized. In all cases, the immunoreactive protein was present in the outer membrane as had been predicted by the sequence features and motif searches described herein.

_87_ Demonstration of protein effrcacy as a vaccine Purification of vac36 for efficac~studies All the following steps were carried out at 4°C. Cell pellets were resuspended in volumes per gram of cell of lysis buffer (50mM Sodium Phosphate pH 8.0, 0.5 M
5 NaC 1, 5mM Imidazole) with 1 OmM EDTA, 1 mM phenylmethylsulfonyl fluoride (PMSF) and 0.1 % (3-mercaptoethanol, and ruptured by several passages through a small volume microfluidizer (Model M-1 lOS, Microfluidics International Corporation, Newton, MA). The resulting homogenate was made 0.2% sodium deoxycholate (DOC), stirred 20 minutes, then centrifuged ( 10,000 g x 30 min). The pellets were washed twice with Lysis Buffer containing 1 OmM EDTA, 1 % Triton X-100, 1 mM PMSF and 0.1 %
~i -mercaptoethanol, then with lysis buffer containing 1 M urea, 1 mM PMSF and 0.1 % (3-mercaptoethanol. The resulting white pellet is composed primarily of inclusion bodies, free of unbroken cells and membranous materials.
The inclusion bodies were dissolved in 20 ml 6M guanidine-HC 1 in lysis buffer with 1 mM PMSF and 0.1 % ~-mercaptoethanol, and incubated on ice for 1 hour.
Materials that did not dissolve were removed by centrifugation {100,000 g x 30 min.) The clear supernatant was filtered through a 0.8 pm Supor filter (Gelman Sciences, FRG) and then load directly onto a 10 ml Ni2+ - NTA agarose column (Hochuli et al.
1987) pre-equilibrated in 6M guanidine-HCl in Lysis Buffer containing 1 mM
PMSF
and 0.1 % (3-Mercaptoethanol. The column was washed with 20m1 (2 bed volumes) of Lysis Buffer containing 6M guanidine-HCI, 1 mM PMSF and 0.1 %~3-mercaptoethanol, then guanidine-HCl was removed slowly with a 100 ml linear gradient (from 6M
to 0 M
Guanidine-HCl) of lysis buffer containing 0.5% Brij 35, 1 mM PMSF, 0.1 % ~i-mercaptochanol. Next, the column was developed with a 25 ml linear gradient of increasing imidazole (5 to 500 mM) in Lysis buffer containing 0.5% Brij 35, 1 mM
PMSF and 0.1 % (3-mercaptoethanol. The recombinant proteins elute as a peak centered at 100mM imidazole.
Fractions containing the recombinant proteins were pooled and then concentrated to approximately 8 ml by centrifugal filtration (Centriprep-10, Amicon, MA), and loaded directly onto a 350-ml column (2.2 X 91 cm) of Sephacyl S-100 HR gel filtration medium equilibrated in Buffer A (50mM Sodium Phosphate, pH 8.0, 500 mM NaC 1, 0.1 mM EGTA, 1 mM PMSF, 0.1 %(3-mercaptoethanol, 0.5% Brij 35) and ran in Buffer A at 30 ml/h. Fractions containing the recombinant protein were identified by absorbance at 280 nm and analyzed by SDS-PAGE. Fractions were pooled, concentrated to 1.5 to 2 mg/ml and dialysed overnight against 10 mM Potassium Phosphate pH 7.5, 150 mM NaCI, 0.1 mM EGTA and 0.5% Brij 35. The concentration of protein in the dialysate was quantified, then aliquoted prior to freezing at - 20°C.

_88_ Mouse model of Heliocobacterpylori infection A marine model of H. pylori infection was produced by infection of C57BL/6 mice with with H. pylori Sydney strain SS l and was used to assess the efficacy of recombinant H. pylori vac36. This mouse-adapted H. pylori strain is cagA+
vacA+, shows colonization levels in C57BL/6 mice equivalent to those observed in humans, forms adhesion pedestals, colonizes for at least 8 months, and elicits a chronic-active gastritis and mucosal atrophy (Lee et al., Gastroenterology, 112:1386-1397, 1997).
Dose-response studies have shown 100% infection rates of inbred C57BL/6 and Balb/C
mice at 8 weeks post-challenge with a single inoculation of 106 organisms.
Assessment of gastric H. pylori infection The presence of H. pylori organisms in gastric tissue was determined by culture of gastric tissue and by a quantitative urease assay. In the latter method, a longitudinal segment of antrum, representing approximately '/4 of the total antral region was placed in 1 ml of urea broth. After 4 hr, the extent of color change resulting from urea hydrolysis and increased pH was quantiated by spectrophotometric measurement of A550 (Fox et al., Immunol. 88:400-406, I996). The assay sensitivity is ~ 103 H. pylori organisms. A
positive (H pylori-infected) gastric tissue was defined as that sample showing standard deviations above the mean A550 value derived from a group of unchallenged uninfected age-matched control mice.
Assessment of local immune response to immunization in gastric tissue Longitudinal sections of gastric tissues from the esophageal to the duodenal junction were embedded in OCT embedding compound, frozen in liquid nitrogen, and cryosections immunostained with monoclonal antibodies recognizing CD4+ or CD8+T
cells or with antisera against mouse IgA for identification of IgA containing (IgACC) plasma cells (Pappo et al., Infect. Immun. 63:1246-1252, 1995). The degree of local gastric immune response was expressed quantitatively as the number of CD4+~
CD8+ or IgACC cells per mm2 of gastric region examined.
Protective activity of purified recombinant Hwlori vac36 antigen The ability of purified recombinant vac36 antigen derived from H. pylori to interfere with the establishment of an H. pylori infection was examined in mice. Groups (n=I O) of 6-8 week-old female C57BL/6 mice were immunized orally 4 times at weekly intervals as follows: 1 ) 100 ~g of recombinant vac36 antigen and 10 ~g cholera toxin (CT) adjuvant, 2) I mg H. pylori lysate antigens and 10 ~.g CT, and 3) 0.2 M
._.._. ._ ~. __ .~.._...T _ bicarbonate buffer and 10 ug CT adjuvant. The mice were challenged 2 weeks later on 3 consecutive days by oral administration of 108 H. pylori organisms. The experiment was terminated 2 weeks post-challenge, and the H. pylori infection level assessed by bacterial colony counts and by quantitative urease assays.
Oral immunization with vac36 antigen interfered with the establishment of H.
pylori infection upon challenge with live H. pylori organisms. Mice immunized with purified recombinant vac36 antigen exhibited a significantly lower level of colonization by H. pylori, as assessed by gastric urease activity and bacterial count assays (Table 6).
Oral immunization with vac36 antigen also resulted in the generation of a local protective gastric immune response. Greater numbers of CD4+T cells and of IgACC
were recruited in the gastric tissues of vac36-immunized mice when compared with unirnmunized H. pylori-infected mice (Table 7).
Table 6 Recombinant vac36 antigen protects mice from challenge with H. nvlnri Y'accine Urease p H. pylori p Treatment Activitya burden Group vac36 0.1990.080 0.0022 55,800112,5990.0125 H. pylori 0.0570.007 0.0002 2,3601955 0.0002 lysate buffer 1.65510.420 - 131,00018,39-a Urease activity is expressed as mean A550~ SEM of duplicate antral samples from n=10 mice/group.
b by Wilcoxon Rank Sum Test compared with mice immunized with CT adjuvant alone c The level of H. pylori in gastric tissue was assessed by bacterial counts, and shown as mean colony forming units~SEM

Table 7 vac36-immunized mice generate a local gastric immune response upon challenge with H. pylori Vaccine TreatmeCD4+ CD8+ IgACC

nt Group cardi corpu antru cardi corpu antru cardi corpu antru as s m a s m a s m vac36 33 54 31 3 0 1 24 79 67 9a 8* 12 16 13 pylori 31 36 248 42 2I 21 319 73 79 lysate 13 19 13* I5 buffer a Mean number of cells/mm~ of gastric region ~ SEM
* p<0.05 by Wilcoxon Rank Sum Test when compared with unimmunized H.
pylori infected mice V. Seauence Variance Analysis of~enes in Helicobacterpvlori strains Four genes were cloned and sequenced from several strains of H. pylori to compare the DNA and deduced amino acid sequences. This information was used to determine the sequence variation between the H. pylori strain, J99, and other H. pylori strains isolated from human patients.
Preparation of Chromosomal DNA.
Cultures of H. pylori strains (as listed in Table 10) were grown in BLBB ( 1 Tryptone, 1 % Peptamin 0.1 % Glucose, 0.2% Yeast Extract 0.5% Sodium Chloride, 5%
Fetal Bovine Serum) to an OD600 of 0.2. Cells were centrifuged in a Sorvall RC-3B at 3500 x g at 4°C for 15 minutes and the pellet resuspended in 0.95 mls of 10 mM Tris-HCI, 0.1 mM EDTA (TE). Lysozyme was added to a final concentration of 1 mg/ml along with, SDS to 1 % and RNAse A + T 1 to 0.5mg/ml and 5 units/mI
respectively, and incubated at 37°C for one hour. Proteinase K was then added to a final concentration of 0.4mg/ml and the sample was incubated at 55 C for more than one hour. NaCI was added to the sample to a concentration of 0.65 M, mixed carefully, and 0.15 mI
of 10%

WO 98!24475 PCT/US97/22104 CTAB in 0.7M NaCL (final is 1 % CTAB/70mM NaCL) was added followed by incubation at 65°C for 20 minutes. At this point, the samples were extracted with chloroform:isoamyl alcohol, extracted with phenol, and extracted again with chloroform:isoamyl alcohol. DNA was precipitated with either EtOH (I.5 x volumes) or isopropanol (0.6 x volumes) at -70°C for l Ominutes, washed in 70%
EtOH and resuspended in TE.
PCR Amplification and cloning.
Genomic DNA prepared from twelve strains of Helicobacter pylori was used as the source of template DNA for PCR amplification reactions (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., editors;
1994). To amplify a DNA sequence containing an H. pylori ORF, genomic DNA (10 nanograms) was introduced into a reaction vial containing 2 mM MgCl2, 1 micromolar synthetic oligonucleotide primers (forward and reverse primers, see Table 8) complementary to and flanking a defined H. pylori ORF, 0.2 mM of each deoxynucleotide triphosphate;
dATP, dGTP, dCTP, dTTP and 0.5 units of heat stable DNA polymerase (Amplitaq, Roche Molecular Systems, Inc., Branchburg, NJ, USA) in a final volume of 20 microliters in duplicate reactions.
Table 8 Oligonucleotide primers used for PCR amplification of H. pylori DNA sequences.
Outer membrane Forward primer 5' Reverse Primer 5' to 3' to 3' Proteins _ Protein 26054702 5'-TTAACCATGGTGAAAA 5'-TAGAATTCGCCTCTAA

(for strains AH4, GCGATA-3' (SEQ ID AACTTTAG-3' (SEQ
AH15, ID

AH61, 5294, 5640, N0:217) N0:218) AH18, and AH244) Protein 26054702 5'-TTAACCATGGTGAAAA 5'-TAGAATTCGCATAA

(for strains AHS, GCGATA-3' (SEQ ID CGATCAATC-3' (SEQ
5155, ID

7958, AH24,and J99)N0:219) N0:220) Protein 7116626 5'-ATATCCATGGTGAGTT S'-ATGAATTCAATTTT

TGATGA-3' (SEQ ID TTATTTTGCCA-3' (SEQ
ID

_ N0:221 ) N0:222) Protein 29479681 S'-AATTCCATGGCTATC 5'-ATGAATTCGCCAAAA

CAAATCCG-3' (SEQ TCGTAGTATT-3' (SEQ
ID ID

N0:223) N0:224) Protein 346 5'-GATACCATGGAATTT 5'-TGAATTCGAAAAAGTG

ATGAAAAAG-3' (SEQ TAGTTATAC-3' (SEQ
ID ID

N0:225) N0:226) The following thermal cycling conditions were used to obtain amplified DNA
products for each ORF using a Perkin Elmer Cetus/ GeneAmp PCR System 9600 thermal cycler:
Protein 7116626 and Protein 346;
Denaturation at 94°C for 2 min, 2 cycles at 94°C for 15 sec, 30°C for 15 sec and 72°C for 1.5 min 23 cycles at 94°C for 15 sec, 55°C for 15 sec and 72°C
for 1.5 min Reactions were concluded at 72°C for 6 minutes.
Protein 26054702 for strains AHS, 5155, 7958, AH24,and J99;
Denaturation at 94°C for 2 min, 2 cycles at 94°C for 15 sec, 30°C for 15 sec and 72°C for 1.5 min 25 cycles at 94°C for 15 sec, 55°C for 15 sec and 72°C
for 1.5 min Reaction was concluded at 72°C for 6 minutes.
Protein 26054702 and Protein 294796813 for strains AH4, AH15, AH61, 5294, 5640, AH 18, and Hp244 ;
Denaturation at 94°C for 2 min, 2 cycles at 94°C for 15 sec, 30°C for 20 sec and 72°C for 2 min cycles at 94°C for 15 sec, 55°C for 20 sec and 72°C for 2 min Reactions were concluded at 72°C for 8 minutes.
Upon completion of thermal cycling reactions, each pair of samples were 25 combined and used directly for cloning into the pCR cloning vector as described below.
Cloning of H. pylori DNA sequences into the pCR TA cloning vector.
All amplified inserts were cloned into the pCR 2.1 vector by the method described in the Original TA cloning kit (Invitrogen, San Diego, CA). Products of the ligation reaction were then used to transform the TOP10F' (INVaF' in the case ofH.
- pylori sequence 350) strain of E coli as described below.
Transformation of competent bacteria with recombinant plasmids - Competent bacteria, E coli strain TOP10F' or E. coli strain INVaF' were transformed with recombinant pCR expression plasmids carrying the cloned H.
pylori sequences according to standard methods (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., editors, 1994). Briefly, 2 microliters of 0.5 WO 98/24475 PCT/US97t22104 micromolar BME was added to each vial of 50 microliters of competent cells.
Subsequently, 2 microliters of ligation reaction was mixed with the competent cells and incubated on ice for 30 minutes. The cells and ligation mixture were then subjected to a "heat shock" at 42°C for 30 seconds, and were subsequently placed on ice for an additional 2 minutes, after which, samples were incubated in 0.45 milliliters SOC
medium (0.5% yeast extract, 2.0 % tryptone, 10 mM NaCI, 2.5 mM KCI, 10 mM
MgCl2, 10 mM MgS04 and 20, mM glucose) at 37°C with shaking for 1 hour.
Samples were then spread on LB agar plates containing 25 microgram/ml kanamycin sulfate or 100 micrograms/ml ampicillan for growth overnight. Transformed colonies of TOP10F' or INVaF' were then picked and analyzed to evaluate cloned inserts as described below.
Identification of recombinant PCR plasmids carrying H. pylori sequences Individual TOP10F' or INVaF' clones transformed with recombinant pCR-H.pylori ORFs were analyzed by PCR amplification of the cloned inserts using the same forwardand reverse primers, specific for each H. pylori sequence, that were used in the original PCR amplification cloning reactions. Successful amplification verified the integration of the H. pylori sequences in the cloning vector (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., editors, 1994).
Individual clones of recombinant pCR vectors carrying properly cloned H.
pylori ORFs were picked for sequence analysis. Sequence analysis was performed on ABI
Sequencers using standard protocols (Perkin Elmer) using vector-specific primers (as found in PCRII or pCR2.l, Invitrogen, San Diego, CA) and sequencing primers specific to the ORF as listed in Table 9 below.

Table 9 Oli~onucleotide primers used for sequencin~of X_pylori DNA sequences Outer membraneForward primers 5' Reverse Primers 5' to Proteins to 3' 3' Protein 260547025'CCCTTCATTTTAGAAATC 5'CTTTGGGTAAAAACGCATC

G-3' (SEQ ID N0:227) -3' (SEQ ID N0:234) S'ATTTCAACCAATTCAAT 5'CGATCTTTGATCCTAATTC

GCG-3' (SEQ ID N0:228)A-3' (SEQ ID N0:235) 5'GCCCCTTTTGATTTGAA 5'ATCAAGTTGCCTATGCTGA

GCT-3' (SEQ ID N0:229)-3' (SEQ ID N0:236) 5'TCGCTCCAAGATACCAA

GAAGT-3' (SEQ ID N0:230) 5'CTTGAATTAGGGGCAAA

GATCG-3' (SEQ ID N0:231 ) 5'ATGCGT"T'TT'TACCCAAA

GAAGT-3' (SEQ ID N0:232) S'ATAACGCCACTTCCTTA

TTGGT-3' (SEQ ID N0:233) Protein 71166265'TTGAACACTTTTGATTAT S'GTCTTTAGCAAAAATGGCG

GCGG-3' (SEQ ID N0:237)TC-3' (SEQ ID N0:239) 5'GGATTATGCGATTGTTTT 5'AATGAGCGTAAGAGAGCC

ACAAG-3' (SEQ ID N0:238)TTC-3' (SEQ ID N0:240) Protein 5'CTTATGGGGGTATTGTC S'AGGTTGTTGCCTAAAGACT

29479681 A-3' (SEQ ID N0:241 -3' (SEQ ID N0:243) ) S'AGCATGTGGGTATCCAG 5'-CTGCCTCCACCTTTGATC-C-3' (SEQ ID N0:242) 3' (SE(j ID N0:244) Protein 346 5'ACCAATATCAATTGGCA 5'CTTGCTTGTCATATCTAGC-CT-3' (SEQ ID N0:245)3' (SEQ ID N0:247) 5'ACTTGGAAAAGCTCTGC S'-GTTGAAGTGTTGGTGCTA-A-3' (SEQ ID N0:246) 3' (SEQ ID N0:248) 5'CAAGCAAGTGGTTTGGT 5'GCCCATAATCAAAAAGCC

TTTAG-3' (SEQ ID N0:249)CAT-3' (SEQ ID N0:251 ) 5'TGGAAAGAGCAAATCAT 5'CTAAAACCAAACCACTTGC

TGAAG-3' (SEQ ID N0:250)TTGTC-3' (SEQ ID N0:252) Vector Primers5'-GTAAAACGACGGCCAG- 5'-CAGGAAACAGCTATGAC-I

3' (SEQ ID N0:253) 3' (SEQ ID N0:254) Results To establish the PCR error rate in these experiments, five individual clones of Protein 26054702, prepared from five separate PCR reaction mixtures from H.
pylori strain J99, were sequenced over a total length of 897 nucleotides for a cumulative total of 4485 bases of DNA sequence. DNA sequence for the five clones was compared to a DNA sequence obtained previously by a different method, i.e., random shotgun cloning and sequencing. The PCR error rate for the experiments described herein was determined to be 2 base changes out of 4485 bases, which is equivalent to an estimated error rate of less than or equal to 0.04%.
l 0 DNA sequence analysis was performed on four different open reading frames identified as genes and amplified by PCR methods from a dozen different strains of the bacterium Helicobacter pylori. The deduced amino acid sequences of three of the four open reading frames that were selected for this study showed statistically significant BLAST homology to defined proteins present in other bacterial species. Those ORFs included: Protein 26054702, homologous to the val A & B genes encoding an ABC
transporter in F. novicida; Protein 7116626, homologous to lipoprotein a (P4) present in the outer membrane of H. influenzae; Protein 29479681, homologous to fecA, an outer membrane receptor in iron (III) dicitrate transport in E. toll. Protein 346 was identified as an unknown open reading frame, because it showed low homology with sequences in the public databases.
To assess the extent of conservation or variance in the ORFs across various strains of H. pylori, changes in DNA sequence and the deduced protein sequence were compared to the DNA and deduced protein sequences found in the J99 strain of H.
pylori (see Table 10 below). Results are presented as percent identity to the J99 strain of H. pylori sequenced by random shotgun cloning. To control for any variations in the J99 sequence each of the four open reading frames were cloned and sequenced again from the J99 bacterial strain and that sequence information was compared to the sequence information that had been collected from inserts cloned by random shotgun sequencing of the J99 strain. The data demonstrate that there is variation in the DNA
sequence ranging from as little as 0.12 % difference (Protein 346, J99 strain) to approximately 7% change (Protein 26054702, strain AHS). The deduced protein sequences show either no variation ( Protein 346, strains AH 18 and AH24) or up to as much as 7.66% amino acid changes (Protein 26054702, Strain AHS).

Table 10 Multiple Strain DNA Sequence analysis of H. pylori Vaccine Candidates J99 Protein #: 26054702 26054702 7116626 7116626 29479681 29479681 346 346 Length of Region Sequenced: 248 a.a. 746 nt. 232 a.a. 96 nt. 182 a.a. 548 nt. 273 a.a. 819 nt.
Strain Tested AA Nuc. AA Nuc. AA Nuc. AA Nuc.

identity identityidentityidentityidentityidentityidentityidentity J99 100.00% 100.00%100.00%100.00%100.00%100.00%99.63%99.88%

AH244 95.16% 95.04%n.d. n.d. 99.09% 96.71%98.90%96.45%

AH4 95.97% 95.98%97.84%95.83%n.d. n.d. 97.80%95.73%

AHS 92.34% 93.03%98.28%96.12%98.91% 96.90%98.53%95.73%

AH 1 95.16% 94.91 97.41 95.98%99.82% 97.99%99.63%96.09%
S % %

AH61 n.d. n.d. 97.84%95.98%99.27% 97.44%n.d. n.d.

5155 n.d. n.d. n.d. n.d. 99.45% 97.08%98.53%95.60%

5294 94.35% 94.37%'98.28%95.40%99.64% 97.26%97.07%95.48%

7958 94.35% 94.10%97.84%95.40ion.d. n.d. 99.63%96.46%

5640 95.16% 94.37%97.41%95.69%99.09% 97.63%98.53%95.48%

AH 18 n._d. n.d. 98.71 95.69%99.64% 97.44%I 00.00%95.97%
%

AH24 94.75% 95.04%97.84%95.40%99.27% 96.71%100.00%96.46%

n.d.= not done.
VI. Experimental Knock-Out Protocol for the Determination of Essential H.
pylori Genes as Potential Ther~eutic Tarp Therapeutic targets are chosen from genes wh ose protein products appear to play key roles in essential cell pathways such as cell envelope synthesis, DNA
synthesis, transcription, translation, regulation and colonization/virulence.
The protocol for the deletion of portions of H. pylori genes/ORFs and the insertional mutagenesis of a kanamycin-resistance cassette in order to identify genes which are essential to the cell is modified from previously published methods (Labigne-Roussel et al., 1988, J. Bacteriology 170, pp. 1704-1708; Cover et a1.,1994, J. Biological Chemistry 269, pp. 10566-10573; Reyrat et al., 1995, Proc. Natl. Acad. Sci.
92, pp 8768-8772). The result is a gene "knock-out."
Identification and Cloning of H. pylori Gene Sequences The sequences of the genes or ORFs (open reading frames) selected as knock-out targets are identified from the H. pylori genomic sequence and used to design primers to specifically amplify the genes/ORFs. All synthetic oligonucleotide primers are designed with the aid of the OLIGO program (National Biosciences, Inc., Plymouth, MN
55447, USA), and can be purchased from Gibco/BRL Life Technologies (Gaithersburg, MD, USA). If the ORF is smaller than 800 to 1000 base pairs, flanking primers are chosen outside of the open reading frame.
Genomic DNA prepared from the Helicobacter pylori HpJ99 strain (ATCC
55679; deposited by Genome Therapeutics Corporation, 100 Beaver Street, Waitham, MA 02154) is used as the source of template DNA for amplification of the ORFs by PCR (polymerase chain reaction) (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., editors, 1994). For the preparation of genomic DNA
from H. pylori, see Example I. PCR amplification is carried out by introducing nanograms of genomic HpJ99 DNA into a reaction vial containing 10 mM Tris pH
8.3, 50 mM KCI, 2 mM MgCl2, 2 microMolar synthetic oligonucleotide primers (forward=F 1 and reverse=R 1 ), 0.2 mM of each deoxynucleotide triphosphate (dATP,dGTP, dCTP, dTTP), and 1.25 units of heat stable DNA polymerase (Amplitaq, Roche Molecular Systems, Inc., Branchburg, NJ, USA) in a final volume of 40 microliters. The PCR is carried out with Perkin Elmer Cetus/GeneAmp PCR System 9600 thermal cyclers.
Upon completion of thermal cycling reactions, each sample of amplified DNA is visualized on a 2% TAE agarose gel stained with Ethidium Bromide (Current Protocols in Molecular Biology, John_Wiley and Sons, Inc., F. Ausubel et al., editors, 1994) to determine that a single product of the expected size had resulted from the reaction.
Amplified DNA is then washed and purified using the Qiaquick Spin PCR
purification -- 30 kit (Qiagen, Gaithersburg, MD, USA).
PCR products a.e cloned into the pT7Blue T-Vector (catalog#69820-1, Novagen, Inc., Madison, WI, USA) using the TA cloning strategy (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., editors, 1994). The ligation of the PCR product into the vector is accomplished by mixing a 6 fold molar excess of the PCR product, 10 ng of pT7Blue-T vector (Novagen), 1 microliter of T4 DNA
Ligase Buffer (New England Biolabs, Beverly, MA, USA), and 200 units of T4 DNA Ligase (New England Biolabs) into a final reaction volume of 10 microliters. Ligation is allowed to proceed for 16 hours at 16°C.
Ligation products are electroporated (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., editors, 1994) into electroporation-S competent XL-1 Blue or DHS-a E.coli cells (Clontech Lab., Inc. Palo Alto, CA, USA).
Briefly, 1 microliter of ligation reaction is mixed with 40 microliters of electrocompetent cells and subjected to a high voltage pulse (25 microFarads, 2.5 kV, 200 ohms) after which the samples are incubated in 0.45 ml SOC medium (0.5%
yeast extract, 2% tryptone, 10 mM NaCI, 2.5 mM KCI, 10 mM MgCl2, 10 mM MgS04 and 20 mM glucose) at 37°C with shaking for 1 hour. Samples are then spread onto LB ( 10 g/1 bacto tryptone, 5 g/1 bacto yeast extract, 10 g/1 sodium chloride) plates containing 100 microgramlml of Ampicillin, 0.3% X-gal, and 100 microgram/ml IPTG. These plates are incubated overnight at 37°C. Ampicillin-resistant colonies with white color are selected, grown in 5 ml of liquid LB containing 100 microgramlml of Ampicillin, and plasmid DNA is isolated using the Qiagen miniprep protocol (Qiagen, Gaithersburg, MD, USA).
To verify that the correct H.pylori DNA inserts had been cloned, these pT7Blue plasmid DNAs are used as templates for PCR amplification of the cloned inserts, using the same forward and reverse primers used for the initial amplification of the H.pylori sequence. Recognition of the primers and a PCR product of the correct size as visualized on a 2% TAE, ethidium bromide stained agarose gel are confirmation that the correct inserts had been cloned. Two to six such verified clones are obtained for each knock-out target, and frozen at -70°C for storage. To minimize errors due to PCR, plasmid DNA from these verified clones are pooled, and used in subsequent cloning steps.
The sequences of the genes/ORFs are again used to design a second pair of primers which flank the region of H. pylori DNA to be either interrupted or deleted (up to 250 basepairs) within the ORFs but are oriented away from each other. The pool of circular plasmid DNAs of the previously isolated clones are used as templates for this round of PCR. Since the orientation of amplification of this pair of deletion primers is away from each other, the portion of the ORF between the prT mers is not included in the resultant PCR product. The PCR product is a linear piece of DNA with H. pylori DNA
at each end and the pT7Blue vector backbone between them which, in essence, resultes in the deletion of a portion of the ORFs. The PCR product is visualized on a 1 % TAE, ethidium bromide stained agarose gel to confirm that only a single product of the correct size has been amplified.

A Kanamycin-resistance cassette (Labigne-Roussel et al., 1988 J. Bacteriology 170, 1704-1708) is ligated to this PCR product by the TA cloning method used previously (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F.
Ausubel et al., editors, 1994). The Kanamycin cassette containing a Campylobacter kanamycin resistance gene is obtained by carrying out an EcoRI digestion of the recombinant plasmid pCTBB:kan (Cover et al.,1994, J. Biological Chemistry 269, pp.
10566-10573). The proper fragment (1.4 kb) is isolated on a 1% TAE gel, and isolated using the QIAquick gel extractionkit (Qiagen, Gaithersburg, MD, USA). The fragment is end repaired using the Klenow fill-in protocol, which involved mixing 4ug of the DNA fragment, 1 microliter of dATP,dGTP, dCTP, dTTP at 0.5 mM, 2 microliter of Klenow Buffer (New England Biolabs) and 5 units of Klenow DNA Polymerase I
Large (Klenow) Fragment (New England Biolabs) into a 20 microliter reaction, incubating at 30°C for 15 min, and inactivating the enzyme by heating to 75°C
for 10 minutes. This blunt-ended Kanamycin cassette is then purified through a Qiaquick column (Qiagen, Gaithersburg, MD, USA) to eliminate nucleotides. The "T" overhang is then generated by mixing 5 micrograms of the blunt-ended kanamycin cassette, 10 mM Tris pH
8.3, SO
mM KCI, 2 mM MgCl2, S units of DNA Polymerase (Amplitaq, Roche Molecular Systems, Inc., Branchburg, NJ, USA), 20 microliters of S mM dTTP, in a 100 microliter reaction and incubating the reaction for 2 hours at 37°C. The "Kan-T"
cassette is purified using a QIAquick column (Qiagen, Gaithersburg, MD, USA). The PCR
product of the deletion primers (F2 and R2) is ligated to the Kan-T cassette by mixing 10 to 25 ng of deletion primer PCR product, SO - 75 ng Kan-T cassette DNA, 1 microliter l Ox T4 DNA Ligase reaction mixture, 0.5 microliter T4 DNA Ligase (New England Biolabs, Beverly, MA, USA) in a 10 microliter reaction and incubating for 16 hours at 16°C.
The ligation products are transformed into XL-1 Blue or DHS-a E. col i cells by electroporation as described previously. After recovery in SOC, cells are plated onto LB
plates containing 100 microgram/ml Ampicillin and grown overnight at 37°C. These plates are then replica plated onto plates containing 25 microgram/mI
Kanamycin and allowed to grow overnight. Resultant colonies have both the Ampicillin resistance gene present in the pT7Blue vector, .uud the newly introduced Kanamycin resistance gene.
Colonies are picked into LB containing 25 microgram/ml Kanamycin and plasmid DNA
is isolated from the cultured cells using the Qiagen miniprep protocol (Qiagen, Gaithersburg, MD, USA).
Several tests by PCR amplification are conducted on these plasmids to verify that the Kanamycin is inserted in the H. pylori gene/ORF, and to determine the orientation of the insertion of the Kanamycin-resistance gene relative to the H. pylori gene/ORF. To verify that the Kanamycin cassette is inserted into the H. pylori sequence, the plasmid DNAs are used as templates for PCR amplification with the set of primers originally used to clone the H. pylori gene/ORFs. The correct PCR product is the size of the deleted gene/ORF but increased in size by the addition of a 1.4 kilobase Kanamycin cassette. To avoid potential polar effects of the kanamycin resistance cassette on H.
pylori gene expression, the orientation of the Kanamycin resistance gene with respect to the knock-out gene/ORF is determined and both orientations are eventually used in H.
pylori transformations (see below). To determine the orientation of insertion of the kanamycin resistance gene, primers are designed from the ends of the kanamycin resistance gene ("Kan-1" S'-ATCTTACCTATCACCTCAAAT-3' (SEQ ID N0:255)), and "Kan-2" 5'-AGACAGGAACATCTTTGTGAA-3' (SEQ ID N0:256)). By using each of the cloning primers in conjunction with each of the Kan primers (4 combinations of primers), the orientation of the Kanamycin cassette relative to the H.pylori sequence is determined. Positive clones are classified as either in the "A" orientation (the same direction of transcription is present for both the H. pylori gene and the Kanamycin resistance gene), or in the "B" orientation (the direction of transcription for the H.pylori gene is opposite to that of the Kanamycin resistance gene). Clones which share the same orientation (A or B) are pooled for subsequent experiments and independently transformed into H. pylori.
Transformation of Plasmid DNA into H. pylori cells Two strains of H. pylori are used for transformation: ATCC 55679, the clinical isolate which provided the DNA from which the H. pylori sequence database is obtained, and AH244, an isolate which had been passaged in, and has the ability to colonize the mouse stomach. Cells for transformation are grown at 37°C, 10% C02, 100% humidity, either on Sheep-Blood agar plates or in Brucella Broth liquid.
Cells are grown to exponential phase, and examined microscopically to determine that the cells are "healthy" (actively moving cells) and not contaminated. If grown on plates, cells are - 30 harvested by scraping cells from the plate with a sterile loop, suspended in 1 ml of '3rucella Broth, spun down ( 1 minute, top speed in eppendorf microfuge) and resuspended in 200 microliters Brucella Broth. If grown in Brucella Broth liquid, cells are centrifuged (15 minutes at 3000 rpm in a Beckman TJ6 centrifuge) and the cell pellet . resuspended in 200 microliters of Brucella broth. An aliquot of cells is taken to determine the optical density at 600 nm, in order to calculate the concentration of cells.
An aliquot ( 1 to 5 OD6oo units/25 microliter) of the resuspended cells is placed onto a prewarmed Sheep-Blood agar plate, and the plate is further incubated at 37°C, 6% C02, 100% humidity for 4 hours. After this incubation, 10 microliters of plasmid DNA ( 100 micrograms per microliter) is spotted onto these cells. A positive control (plasmid DNA
with the ribonuclease H gene disrupted by kanamycin resistance gene) and a negative control (no plasmid DNA) are done in parallel. The plates are returned to 37°C, 6% C02 for an additional 4 hours of incubation. Cells are then spread onto that plate using a swab wetted in Brucella broth, and grown for 20 hours at 37°C, 6% C02.
Cells are then transferred to a Sheep-Blood agar plate containing 25 micrograms/ml Kanamycin, and allowed to grow for 3 to S days at 37°C, 6% C02, I 00% humidity. If colonies appear, they are picked and regrown as patches on a fresh Sheep-Blood agar plate containing 25 micrograms/ml Kanamycin.
Three sets of PCR tests are done to verify that the colonies of transformants have arisen from homologous recombination at the proper chromosomal location. The template for PCR (DNA from the colony) is obtained by a rapid boiling DNA
preparation method as follows. An aliquot of the colony (stab of the colony with a I S toothpick) is introduced into 100 microliters of 1% Triton X-100, 20 mM
Tris, pH 8.5, and boiled for 6 minutes. An equal volume of phenol : chloroform (1:1 ) is added and vortexed. The mixture is microfuged for 5 minutes and the supernatant is used as DNA
template for PCR with combinations of the following primers to verify homologous recombination at the proper chromosomal location.
TEST 1. PCR with cloning primers originally used to amplify the gene/ORF. A
positive result of homologous recombination at the correct chromosomal location should show a single PCR product whose size is expected to be the size of the deleted gene/ORF but increased in size by the addition of a 1.4 kilobase Kanamycin cassette. A
PCR product of just the size of the gene/ORF is proof that the gene had not been knocked out and that the transformant is not the result of homologous recombination at the correct chromosome location.
TEST 2. PCR with F3 (primer designed from sequences upstream of the gene/ORF and not present on the plasmid), and either primer Kan-1 or Kan-2 (primers designed from the ends of the kanamycin resistance gene), depending on whether the plasmid DNA used was of "A" or "B" orientation. Homologous recombination at the correct chromosomal location will result in a single PCR product of the expected s~ze (i.e., from the location of F3 to the insertion site of kanamycin resistance gene). No PCR product or PCR products) of incorrect sizes) will prove that the plasmid had not integrated at the correct site and that the gene had not been knocked out.
TEST 3. PCR with R3 (primer designed from sequences downstream of the gene/ORF and not present on the plasmid) and either primer Kan-1 or Kan-2, depending on whether the plasmid DNA used was of "A" or "B" orientation. Homologous recombination at the correct chromosomal location will result in a single PCR
product of the expected size (i.e., from the insertion site of kanamycin resistance gene to the downstream location of R3). Again, no PCR product or PCR products) of incorrect sizes) will prove that the plasmid had not integrated at the correct site and that the gene had not been knocked out.
Transformants showing positive results for all three tests above indicate that the gene is not essential for survival in vitro.
A negative result in any of_the three above tests for each transformant indicates that the gene had not been disrupted, and that the gene is essential for survival in vitro.
In the event that no colonies result from two independent transformations while the positive control with the disrupted ribonuclease H plasmid DNA produces transformants, the plasmid DNA is further analyzed by PCR on DNA from transformant populations prior to plating for colony formation. This will verify that the plasmid can enter the cells and undergo homologous recombination at the correct site.
Briefly, plasmid DNA is incubated according to the transformation protocol described above.
DNA is extracted from the H. pylori cells immediately after incubation with the plasmid DNAs and the DNA is used as template for the above TEST 2 and TEST 3. Positive results in TEST 2 and TEST 3 would verify that the plasmid DNA could enter the cells and undergo homologous recombination at the correct chromosomal location. If TEST
2 and TEST 3 are positive, then failure to obtain viable transformants indicates that the gene is essential, and cells suffering a disruption in that gene are incapable of colony formation.
VII. High-throuehput drub screen assay Cloning, expression and protein purification Cloning, transformation, expression and purification of the H. pylori target gene and its protein product,e.g., an X. pylori enzyme, to be used in a high-throughput drug screen assay, is carned out essentially as described in Examples II and III
above.
Development and application of a screening assay for a particular H. pylori gene product, peptidyl-propyl cis-traps isomerase, is described below as a specific example.
Enzymatic Assay The assay is essentially as described by Fisher (Fischer, G., et.al. ( 1984) Biomed.
Biochim. Acta 43:1101-1111). The assay measures the cis-traps isomerization ofthe Ala-Pro bond in the test peptide N-succinyl-Ala-Ala-Pro-Phe-p-nitroanilide (Sigma # S-7388, lot # 84H5805). The assay is coupled with a-chymotrypsin, where the ability of the protease to cleave the test peptide occurs only when the Ala-Pro bond is in traps.
The conversion of the test peptide to the traps isomer in the assay is followed at 390 nm on a Beckman Model DU-650 spectophotometer. The data are collected every second with an average scanning of time of 0.5 second. Assays are carried out in 35 mM
Hepes, pH 8.0, in a final volume of 400 ul, with 10 p.M a,-chymotrypsin (type I -5 from bovine Pancreas, Sigma # C-7762, lot 23H7020) and 10 nM PPIase. To initiate the reaction, 10 p l of the substrate ( 2 mM N-Succinyl-Ala-Ala-Pro-Phe-p-nitroanilide in DMSO) is added to 390 ~l of reaction mixture at room temperature.
Enzymatic assay in crude bacterial extract.
A 50 ml culture of Helicobacter pylori (strain J99) in Brucella broth is harvested at mid-log phase (OD 60o nm ~ 1 ) and resuspended in lysis buffer with the following protease inhibitors: 1 mM PMSF, and 10 pg/ml of each of aprotinin; leupeptin, pepstatine, TLCK, TPCK, and soybean trypsin inhibitor. The suspension is subjected to 3 cycles of freeze-thaw ( I 5 minutes at -70 ° C, then 30 minutes at room temperature), followed by sonication (three 20 second bursts). The lysate is centrifuged ( 12,000 g x 30 minutes) and the supernatant is assayed for enzymatic activity as described above.
Many H. pylori enzymes can be expressed at high levels and in an active form in E. coli. Such high yields of purified proteins provide for the design of various high throughput drug screening assays.
VIII. Truncated gene expression and protein production Identification, cloning and expression of recombinant Helicobacter pylori sequences.
To facilitate the cloning, expression and purification of membrane proteins from H. pylori, the pET gene expression system. (Novagen), for cloning and expression of recombinant proteins in Escherichia coli was selected. Further, for proteins that have a signal sequence at their amino-terminal end, a DNA sequence encoding a peptide tag (His-tag) was fused to the 5' end of the H. pylori DNA sequences of interest in order to facilitate purification of the recombinant protein products. In some cases, the DNA
sequence was cloned in frame with the glutathione-S-transferase-protein to produce a GST-fusion protein. The vectors used in this case were the pGEX series from Pharmacia LKB (Uppsala, Sweden).
PCR amplification and cloning of DNA sequences containing ORFs for membrane and secreted proteins from the J99 strain of Helicobacter pylori.
The sequences chosen (from the list of the DNA sequences of the invention) for cloning from H. pylori strain J99 were prepared for amplification cloning by the polymerase chain reaction (PCR). Synthetic oligonucleotide primers for the ORF
of interest (Table 11 ) specific for the predicted mature 5' end of the ORF and either downstream (3') of the predicted translational termination codon or at specific points within the coding region were designed and purchased (GibcoBRL Life Technologies, Gaithersburg, MD, USA). All forward primers (specific for the 5' terminus of the region of ORF of interest) were designed to include either a BamHI or a NdeI
restriction site. These primers within the NdeI restriction site sequence were designed to permit the initiation of protein translation at a methionine residue (encoded within the Ndei restriction site sequence, in the case of producing a non His-tagged recombinant protein) or to fuse in frame with the DNA sequence encoding the His-tag (for producing His tagged recombinant protein), followed by the coding sequence for the remainder of the native H. pylori DNA. The primer with the BamHI restriction site was produced to fuse the H. pylori specific sequence in-frame with the C-terminus of the glutathione-S-transferase gene in the pGEX vectors (Pharmacia LKB, Uppsala, Sweden}. All reverse oligonucleotide primers designed to include an EcoRI restriction site at the 5' terminus.
Several reverse oligonucleotide primers were selected that would cause a truncation of the polypeptide to remove certain portions of the C-terminus, and in these cases the EcoRI restriction site at the 5' end was followed by a translational termination codon.
This combination of primers would enable the ORF of interest (or parts of the ORF of interest) to be cloned into pET28b (to produce a His-tagged recombinant protein), pET30a (to produce a non His tagged or native recombinant protein) or the pGEX-4T or pGEX-SX series (to produce a GST fusion protein). The pET28b vector provides sequence encoding an additional 20 amino-terminal amino acids (plus the methionine in the NdeI restriction site) including a stretch of six histidine residues which makes up the His-tag, whereas the pGEX vectors fuse the H. pylori protein to a 26,OOODa glutathione-S-transferase protein.
Genomic DNA prepared from H. pylori strain J99 (ATCC 55679) was used as the source of template DNA for the PCR amplification reactions (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994).
To amplify a DNA sequence containing a specific H. pylori ORF, genomic DNA (50 nanograms) was introduced into a reaction tube containing 200 nanograms of both the forward and reverse synthetic oligonucleotide primer specific for the ORF of interest, and 45 microliters of PCR SuperMix purchased (GibcoBRL Life Technologies, Gaithersburg, MD, USA) in a total of 50 microliters. The PCR SuperMix is supplied in 1.1X concentrations and contains 22mM Tris-HCl (pH 8.4), SSmM KCI, 1.65mM
MgCl2, 220 micromolar of each dATP, dCTP, dGTP and dTTP, 22units recombinant Taq polymerase/mI and stabilizers. The following thermal cycling conditions were used to obtain amplified DNA products for each ORF using a Perkin Elmer Cetus/GeneAmp PCR System thermal cycler.

WO 98/24475 PCTlUS97/22104 Table 11: Oligonucleotide primers Gene and location Sequence Vac38- BamHI post signal sequence CGGGATCCGAAGGTGATGGTGTTTATA

TAGG (SEQ ID NO: 27I ) Vac38- Ndel post signal sequence CGCATATGGAAGGTGATGGTGTTTATA

TAGGG (SEQ ID NO: 272) Vac38- EcoRI/stop codon (removes GCGAATTCTCACTCTTTCCAATAGTTTG
C-terminal third of protein) CTGCAGAGC (SEQ ID NO: 273) Vac38- EcoRt/stop codon (removes CCGGAATTCTTAATCCCGTTTCAAATG
C-terminal 11 amino acids) GTAATAAAGG (SEQ ID NO: 274) Vac38- EcoRI downstream of GCGAATTCCCTTTTATTTAAAAAGTGT
native stop codon AGTTA1'ACC (SEQ ID NO: 275) Sequences for Vac38 (full length or truncated) Denaturation at 94°C for 30 sec 35 cycles at 94°C for 15 sec, 55°C for 15 sec, and 72°C
for 1.5 min Reactions were concluded at 72°C for 8 minutes I 0 Upon completion of the thermal cycling reactions, each sample of amplified DNA was subjected to electrophoresis on 1.0% agarose gels. The DNA was visualized by exposure to ethidium bromide and long wave UV irradiation, and cut out in gel slices. DNA was purified using the Wizard PCR Preps kit (Promega Corp., Madison WI, USA), and then subjected to digestion with BamHI and EcoRI (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994).
The digested PCR amplicon was then re-eIectrophoresed and purified as before.
Ligation of H. pylori DNA sequences into cloning vectors The pOKl2 vector (J. Vieira and J. Messing, Gene 100:189-194, 1991) was prepared for cloning by digestion with BamHI and EcoRI or NdeI and EcoRI in the case of Vac41 (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F.
Ausubel et al., eds., 1994). The vectors were subj ected to electrophoresis on 1.0%
agarose gels and purified using the Wizard PCR Preps kit (Promega Corp., Madison WI, USA). Following ligation of the purified, digested vector and the purified, digested SUBSTITUTE SHEET (RULE 26) amplified H. pylori ORF, the products of the ligation reaction were transformed into E.
col i JM 109 competent cells according to standard methods (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994).
Individual bacterial colonies were screened for those containing the correct recombinant plasmids by incubating in LB broth overnight (plus 25ug/ml kanamycin sulfate) followed by plasmid DNA preparation using the Magic Minipreps system (Promega Corp., Madison WI, USA), and Then analyzed by restriction digestion (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994).
Cloning of H. pylori DNA sequences into the pET28b, pET30a and pGEX4T 3 prokaryotic expression vectors Both the pET28b and pET30a expression vectors were prepared for cloning by digestion with NdeI and EcoRI, and the pGEX4T-3 vector was prepared for cloning by digestion with BamHI and EcoRI (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994). The H. pylori DNA sequences were removed from pOKl2 plasmid backbones by digestion with NdeI and EcoRI or BamHI
and EcoRI (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F.
Ausubel et al., eds., 1994). The pET28b, pET30a, pGEX4T-3 and H. pylori DNA
sequences were all electrophoresed on a 1 % agarose gel and purified using the Wizard PCR Preps kit (Promega Corp., Madison WI, USA). Following ligation of the purified, digested expression vector and the purified, digested H. pylori DNA sequences, the products of the ligation reaction were transformed into E. coli JM 109 competent cells (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994). Individual bacterial colonies were screened for those containing the correct recombinant plasmids by preparing plasmid DNA as described above followed by analysis by restriction digestion profiles and DNA sequencing (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994).
These recombinant plasmids were then used to transform specific E. coli expression strains.
Transformation of competent bacteria with recombinant expression plasmids Competent bacterial strains BL21 (I~~E3), BL21 (DE3)pLysS, HMS 174(DE3) and HMS 174(DE3)pLysS were prepared and transformed with the recombinant pET28b expression plasmids carrying the cloned H. pylori sequences according to standard methods (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F.
3 5 Ausubel et al., eds., 1994). These expression host strains contain a chromosomal copy of the gene for T7 RNA polymerise. These hosts are lysogens of bacteriophage DE3, a lambda derivative that carries the lacl gene, the IacUVS promoter and the gene for T7 RNA polymerase. T7 RNA polymerase expression is induced by the addition of isopropyl-(3-D-thiogalactoside (IPTG), and the T7 RNA polymerase then transcribes any taget plasmid, such as pET28b, that carnes a T7 promoter sequence and a gene of interest.
Competent bacterial strains JM109 and DHSa were prepared and transformed with the recombinant pGEX4T-3 expression plasmid carrying the cloned H. pylori sequences according to standard methods (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994).
Expression of recombinant H. pylori sequences in E coli Transformants were collected from LB agar plates containing 25ug/ml kanamycin sulfate (ensures maintenance of the pET28b-based recombinant plasmids) or 100ug/ml ampicillin (ensures maintenance of the pGEX4T-3-based recombinant plasmids) and used to inoculate LB broth containing 25ug/ml kanamycin sulfate or 1 OOug/ml ampicillin and grown to an optical density at 600nm of 0.5 to 1.0 OD
units, at which point 1 mM IPTG was added to the culture for one to three hours to induce gene expression of the H. pylori recombinant DNA constructions. After induction of gene expression with IPTG, bacteria were pelleted by centrifugation and resuspended in SDS-PAGE solubilization buffer and subjected to SDS-PAGE (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994).
Proteins were visualized by staining with Coomassie Brilliant Blue or detected by western immunoblotting using the specific anti-His tag monoclonal antibody (Clontech, Palo Alto, CA, USA) or the anti-GST tag antibody (Pharmacia LKB) using standard methods (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., eds., 1994)) The host strain that provided the highest level of recombinant protein production was then chosen for use in a large-scale induction in order to purify the recombinant protein. The strains used were HMS 174(DE3) (pET28b-based constructs) and DHSa (pGEX4T-3-based constructs).
Removal of the C-terminal regions appeared in both systems to improve the level of expression, although this increase was far more prominent in the GST-fusion system.
All recombi~ pant proteins produced were of the predicted molecular weight based on the DNA sequence plus, if necessary, the size of the fusion tag. The truncated portion of the H. pylori protein contains some extremely hydrophobic stretches, and removal of these may be the reason for the increased expression.

WO 98!24475 PCT/US97/22104 EQUIVALENTS
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments and methods described herein. Such equivalents are intended to be encompassed by the scope of the following claims.

SEQUENCE LISTING
1) GENERAL INFORMATION:
S (i) APPLICANT:
(A) NAME: Astra Aktiebolag (B) STREET: S-151 85 (C) CITY: Sodertalje (D) STATE:
(E) COUNTRY: Sweden (F) POSTAL CODE (ZIP) (ii) TITLE OF INVENTION: NUCLEIC ACID AND AMINO ACID SEQUENCES
RELATING TO HELICOBACTER PYLORI AND
IS VACCINE COMPOSITIONS THEREOF
(iii) NUMBER OF SEQUENCES: 275 (iv) COMPUTER READABLE FORM-:
(A) MEDIUM TYPE: CD/ROM IS09660 (B) COMPUTER:
(C) OPERATING SYSTEM:
(D) SOFTWARE:
ZS (v) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER
(B) FILING DATE:
(vi) PRIOR APPLICATION DATA:
30 (A) APPLICATION NUMBER: US 08/759,625 (B) FILING DATE: 05-DEC-1996 (vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/823,745 3S (B) FILING DATE: 25-MAR-1997 (viii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/891,928 (B) FILING DATE: 14-JULY-1997 (ix) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: LAHIVE & COCKFIELD
(B) STREET: 28 State Street (C) CITY: Boston 4S (D) STATE: Massachusetts (E) COUNTRY: USA
(F) ZIP: 02109-1875 (x) ATTORNEY/AGENT INFORMATION:
S0 (A) NAME: Mandragouras, Amy E.
(B) REGISTRATION NUMBER: 36,207 (C) REFERENCE/DOCKET NUMBER: GTN-O11CP2PC
(xi) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: (617)227-7400 (B) TELEFAX: (617)227-5941 S
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 687 base pairs (B) TYPE: nucleic acid (C} STRANDEDNESS: double lO (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori ( ix) FEATURE
(A) NAME/KEY: misc_feature (B) LOCATION 1...687 2S (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:

40 (2) INFORMATION FOR SEQ ID N0:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 666 base pairs (B) TYPE: nucleic acid 4S (C) STRANDEDNESS: double (D) TOPOLOGY: ~i:cular (ii) MOLECULE TYPE: DNA (genomic) SO (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature S (B) LOCATION 1...666 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:

AATATGAAGA
GTTTAAAGAG

lO CTTTATGAGAGCTTAAAAACCAAGCAAAAGCCCCACACTTTGTTCATTTC TTGCGTGGAT120 (~) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
2$ (A) LENGTH: 1008 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular 3O (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
4O (A) NAME/KEY: misc_feature (B) LOCATION 1...1008 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:
4S ATGTTAGTTACTCGTTTTAA ATTTCTTATTCTTTAGGCGTGCTTGTTGTT60' AAAAGCCTTC

~CATTATTAT TGAATGTGTGCAACGCTTCAGCACAAGAAGTCAAAGTCAAGGATTATTTT120 (2) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 825 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double 1S (D} TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO -(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...825 3O (xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:

{2) INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS:
S~ (A) LENGTH: 1287 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
S (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori lO (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...1287 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:5:

(2) INFORMATION
FOR SEQ ID N0:6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 537 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: e doubl 4S (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
- SO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori S
(ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...537 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:6:

AAAACeTGAA
GCGCAATTCA
TTCTTTTAGA
GCCAAGGGTA

(2) INFORMATION FOR SEQ ID N0:7:
2O (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 723 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
3O (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 3S (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...723 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:7:

GGCTATCAAA CTTTC..3.CC GTCGTTTTTTGCGCGCTTGGTTAAGCCCAATATCATTGGC360 T~ 723 (2) INFORMATION FOR SEQ ID N0:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 942 base pairs S (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
IS (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...942 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:8:

AATACTGGTT

CAGCTCACCGAAAA.AGGGGTTTCACCCAAAGAGATGGATAAGGATAAGTTTGAAGAAGAA180 TTTTCCATAGCCGATGATAAGAGTGGGGTGTTTTTAGGGG.GCGGGTATGCTTATGGGGAA300 3O TTTAA.AAACAATATCAATATTAACGCTCCTGTTTCTATGATTAGCGTTAAATTTGGGTAT420 CAAAA.ATACTTCGTGCCTTATTTTGGGACACGATTTTATGGGGATTTGTTGCTTGGGGGA480 (2) INFORMATION FOR SEQ ID N0:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1182 base pairs --- ~S (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: Np (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
S (A) NAME/KEY: misc_feature (B) LOCATION 1...1182 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:9:
lO ATGACTTCAG CTTCAAGCCATTCTTTTAAA GAACAAGATTTTCATATTCC TATCGCTTTC60 GCCCTAAGAG AACCTATCGTTATACAATAT GAC'TCTCATCCTTATTTTCA AATCAAGCCT780 (2) INFORMATION FOR SEQ ID NO:10:
(1) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1308 base pairs 3S (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
__4S (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature SO (B) LOCATION 1...1308 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
TTGATTTTCT TAAAAAP.ATC TCTTTGCGCG TTGTTAATTT CAGGTTTTTT CATACCACCC 60 GCTTCCCCTCCAAATAACCCCTATTG~AATAGCCTAACCAAAATGCAAGGTCGTCTCATG180 GGGCATTACCCTTTAAGCGC'TTTTAAAAAACTTTTCTGGTTTATAGACCCTACTTTTAGG420 lO TTAGGTTTGGGGGGACAGCTTGTCATTTTTCATAACGCCAACTCTCATAGTATGGGGGAT660 (2) INFORMATION FOR SEQ ID NO:11:
ZS (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 663 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
3S (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature -(B) LOCATION 1...663 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:

ATGAATAAAA CAACAATTAA G.:C~TGGCGTTATTATCATCGCTTCAAGCC60 AATATTAATG

S (2) INFORMATION FOR SEQ ID N0:12:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 351 base pairs (B) TYPE: nucleic acid 1~ (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) IS (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

2~ (A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...351 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:12:

TTGAATCTCC ATTTTATGAA AGGATTTGTT ATGAGTGGATTAAGAACATT TAGTTGTGTA

GTGGTTTTAT GCGGTGCAAT GGTTAATGTA GCTGTAGCTGGTCCTAAAAT AGAGGCAAGG

GGATTTGTTG GTGGTGCAAT AGGAGGATAT ATTGGGTCTGAAGTAGGCGA TAGGGTAGAA

GATTATATCC GTGGCGTTGA TAGAGAGCCA CAAAACAAAGAACCACAAAC CCCAAGAGAA

3S (2) INFORMATION FOR SEQ ID N0:13:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1311 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D} TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) 4S (iii) HYFJTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

SD (A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...1311 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:13:

lO GATAAAATAGAGTTTTTTGATTCTAAATTGGTGATAACTCCAGGGCTTAGATACACTTTT420 (2) INFORMATION FOR SEQ ID N0:14:
(i) SEQUENCE CHARACTERISTICS:
30 (A) LENGTH: 2304 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular 3S (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:-4S (A) NAME/KEY: misc_feature (B) LOCATION 1...2304 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:14:

lO ATAGCCGCTTACAATCAAAATCGTTTTCAAAACAACCGCCCCAATAACGATAAAAGCGGG900 (2) INFORMATION FOR SEQ ID N0:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 348 base pairs 40 (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
SO (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc feature (B) LOCATION 1...348 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:15:

lO ATCAAAGATTTTAAAAACAA CCCCAACCTCTTTAAAACCTTATCGTAA 348 (2) INFORMATION FOR SEQ ID N0:16:
(i) SEQUENCE CHARACTERISTICS:
1S (A) LENGTH: 1170 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular 20 (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
30 (A) NAME/KEY: misc_feature (B) LOCATION 1...1170 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:16:

4S ACGCCCTTTA AAATCGCTATGGTAGGC~GC TATTCTAATGAAAAAAATCAAAGCGTTCTC660 ATTAAAGCGG TTGCTTTAAGCCGA~A:AAA CAAGACATTGTATTATTACTCAAAGGCAAG720 (2) INFORMATION FOR SEQ ID N0:17:
(i) SEQUENCE CHARACTERISTICS:
S (A) LENGTH: 939 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular IO (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
2O (A) NAME/KEY: misc_feature (B) LOCATION 1...939 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:17:

AAGGTAAAGA

(2) INFORMATION FOR SEQ ID N0:18:
(i) SEQUENCE-CHARACTERISTICS:
4$ (A) LENGTH: 1224 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular $O (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
_ _ ._._. _r_ (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori S (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...1224 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:18:

GCGATTGGAT CATTCTTGGTGCTAAGCTTTGA~AAGCTTTTGAATTTAGACGCTCAATCA780 TATAAACAAG AAGAAAACTCCTAA

(2) INFORMATION FOR SEQ ID N0:19:
3S (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 378 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
4S (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori S0 (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...378 (xi) SEQU'ENCE DESCRIPTION: SEQ ID N0:19:

TATAGCGTGC CGTTGTTGTGCTATTTTTATATCCTCTTCTTTGCACTTAA~GGGGTATAAA360 lO (2) INFORMATION FOR SEQ ID N0:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 993 base pairs (B) TYPE: nucleic acid 1S (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) 2O (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
2S (A) ORGANISM: Helicobacter pylori (ix) FEATURE: -(A) NAME/KEY: misc_feature (B) LOCATION 1...993 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:20:

4S CCCAATTTCA CTCGCTATGACGGCATGAGTTTTAACGCTTTT~AAGAGTATAAAAAAAGG780 GTGTTTGCAA AAAATGAAAAAAAGAATATCGCTTTTTCCT~'.ATCAATGTGATCCCTTAC840 SO

(2) INFORMATION FOR SEQ ID N0:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 510 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular S (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

1~

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

1S (A) NAME/KEY: misc_feature (B) LOCATION 1...510 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:21:

3O (2) INFORMATION FOR SEQ ID N0:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 648 base pairs (B) TYPE: nucleic acid 3S (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
4S (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...648 SU
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:22:

AAAAGGCGCG AAAGGATAAA

(2) INFORMATION FOR SEQ ID N0:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 762 base pairs 1S (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular {ii) MOLECULE TYPE: DNA (genomic) (iii} HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
2S (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...762 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:23:

CCACGATTTA ACGCTAA~~." TTCTTTAATCGTTTCGTTTT AG 762 (2) INFORMATION FOR SEQ ID N0:24:
SO (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1011 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular S
(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 1~
(ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...1011 IS (xi) SEQUENCE DESCRIPTION: SEQ ID N0:24:

AATTTATTTT

ATGTATACCCCCTCACTTGCAAACAGAAhACTGGTGCATTTGCATGACAACCACCCTTAT360 3S (2) INFORMATION FOR SEQ ID N0:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 327 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) -- 45 (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
S~ (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...327 WO 98/24475 PG"T/US97/22I04 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:25:

(2) INFORMATION FOR SEQ ID N0:26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 588 base pairs 1S (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
2S (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...588 (xi} SEQUENCE DESCRIPTION: SEQ ID N0:26:

TACAGAAGGC TTTATAGCGTGTATCTCAATTATGTGTTTGCTTATTAA 5gg - 4S (2) INFORMATION FOR SEQ ID N0:27:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 684 base pairs (B) TYPE: nucleic acid S0 (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
S (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...684 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:27:

(2) INFORMATION FOR SEQ ID N0:28:
(i) SEQUENCE CHARACTERISTICS:
30 (A) LENGTH: 918 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular 3S (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
4S (A) NAME/KEY: misc_feature (B) LOCATION 1...918 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:28:

AAAGCGTTTG AAAGCACTCA
TTTTTTTAGC

TTGGGTTTTA GGCTAGGCAC AGGGGCTACTACGCGCACAA GCATGTGGCA~1ACAAGCCTAT180 lO CAGCAACAAACGATCCGACAAAACTTCAGCGTTTTTAGGAATAAAGAAGTTTTTGTCAGC900 (2) INFORMATION FOR SEQ ID N0:29:
1S (i) SEQUENCE CHARACTERISTICS: - -(A) LENGTH: 777 base pairs (8) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
2S (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 3O (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...777 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:29:

4S GCCTATCAAA GC~~CGCATTTTGATATTATCGCTTACTACACGCACCAAAATATTTTCTAT600 TATAGGAGCG ~C3CCACAGTGATGAAAAACCTTTTCAAACCCACACAAGCCGATAAAGAG660 SO (2) INFORMATION FOR SEQ ID N0:30:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 579 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
lO (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature 15 (B) LOCATION 1...579 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:30:

GTCAAAGACC 'IGTTTAGGACTAACCCTGATGTGAATGTGGGCGGAGGGAGCGTGATGGGG24G

3O (2) INFORMATION FOR SEQ ID N0:31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 381 base pairs (B) TYPE: nucleic acid 35 (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) 4O (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAIs SOURCE:
4$ (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...381 SO
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:31:

(2) INFORMATION FOR SEQ ID N0:32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1698 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular 1S (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
2S (A) NAME/KEY: misc_feature (B) LOCATION 1...1698 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:32:

GCATGGGGGACTGGGGGGAGTGCGAGCGTA ACTTTTAACAGCCAAACTTCG~TCATTCTC720 4S AGCGTGATTGGGGGGTATTTAACGCCTGAG CAAAAAAATCAAACCCTAAG~CAGCTTTTG960 GGGCAGAATAATTTTGATAACCTCATGAAC GATAGCGGTTTGAACACG..~GATTAAGGAT1020 S

(2) INFORMATION FOR SEQ ID N0:33:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 519 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
ZO (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature ZS (B) LOCATION 1...519 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:33:

AATAAGAGCA

(2) INFORMATION FOR SEQ ID N0:34:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 996 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double 4S (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) SO
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...996 S
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:34:

lO CTTGATAAAA AGCTCTCCCAAACAATACAGCCATGCGCGCAACTTAACGCATCAAAACAC180 GCCGGGCAAA GGCTCTCTGT_GGCGTATAACAAAGCCGCAACATGGATTCTAAACCCTGAA840 ACTTTCCCCT ATTTTCAGCCTAACCTCATTGGGGTGCATAACAACGCCTATTiCATTATT900 (2) INFORMATION FOR SEQ ID N0:35:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 384 base pairs 30 (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
4O (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature 4S (B) LOCATION 1...384 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:35:

_.._w. ~._.._ ___._.._ ___~...~_.__..__ .. .

(2) INFORMATION FOR SEQ ID N0:36:
S (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 738 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular lO
(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
IS (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 2O (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...738 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:36:

4O (2) INFORMATION FOR SEQ ID N0:37:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 873 base pairs (B) TYPE: nucleic acid 4S (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) SO (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature S (B) LOCATION 1...873 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:37:

lO AAAATCGTTTTATCGGATGTGAGTTTTACCAATTGCTTTTTATGGCAGCACGCAAGGCTC120 ZS (2) INFORMATION FOR SEQ ID N0:38:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 333 base pairs (B) TYPE: nucleic acid 30 (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) 3S (iii) HYPOTHETICAL: NO
~(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
40 (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...333 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:38:

SO AP.AAAACTCTGGTTTTTCAAGCTTTTTGGC ACGCAATTCG CTCTGTCTTTGATCCCGCTT180 (2) INFORMATION FOR SEQ ID N0:39:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1056 base pairs $ (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular 1~
(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO _ (iv) ANTI-SENSE: NO
IS (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature 20 (B) LOCATION 1...1056 (xi) SEQUENCE DESCRIPTION: SEQ ID 140:39:

ATTT'TAGAAAAACGACTGACCCCCAAAATCGTGGCGGTGATAAGCGAGTCTAATGATCCT600 TTAGGGCTT"TTTAATGACATTACTCGTTTGCTATAA 1056 (2) INFORMATION FOR SEQ ID N0:40:
4S (i) SEQUENCE CHARA~TERISTICS:
(A) LENGTH. ~03 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular SU
(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori S
(ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...303 IO (xi) SEQUENCE DESCRIPTION: SEQ ID N0:40:
ATGCAAAAGA ATTTGGATAG TCTTTTAGAA AATTTAAGGGCTGAAATTGA TGCGTTGGAT

AATGAATTGA GCGATCTTTT AGACAAACGC TTAGGAATCGCTTTAAAAAT CGCTCTCATC

AAACAAGAAA GCCCCCAAGA AAACCCCATT TATTGCCCTAAAAGAGAGCA AGAGATTTTA

IS AAACGACTCA GCCAAAGGGG TTTCAAGCAT TTGAATGGAGAAATCCTTGC AAGTTTTTAT

GCAGAGGTTT TTAAGATTTC TAGAAATTTT CAAGAAAACGCCCTAAAAGA GTTAAAAAAA

T~ 303 (2) INFORMATION FOR SEQ ID N0:43:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 525 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double 2S (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...525 4O (xi) SEQUENCE DESCRIPTION: SEQ ID N0:41:

GTGAAAATGC GTTTTTTTAG TGGTTTTGGG TTTGTTAATGAAAGCGTTTT GTTTGAAGAG

TGGCTTTTAA AAGGGGCTTA TGATGTGTCA GGCTTTTCTATGGGGGCGAT TAAGGCGATA

GAATACGCCT ATAATGAAGT CTTGCAACAA CGGCGCATCCATTCCTTATT GTTGTTTTCG

AAAGATCCGC AAAGCTACAT GGATAACTTT TATAAGGAAGTGGGATTGGA CGCTCAATTG

GAGCGTTTTA AAAAAGAGGG TTCTTTAGAA GAATTGGAATTTTTATTGGA TTACAAGTAT

AGTGATTCTA TAATTAGATT TTTATTGGAA AAGGGCGTGAAGATTGAAGT GTTTATCGGT

TTAAAAGATA GAATCACTGA CATTCAAGCC CTTTTAGAATTTTTTATGCC CTTAGTTCAA

_ SO GTGTGGCAGT TTAAGGATTG TAACCATTTG TTGCAP.AAATCTTAA 525 (2) INFORMATION FOR SEQ ID N0:42:

(i) SEQUENCE CHARACTERISTICS:

_.____.~~.._.._ __..._~._.~T...... _...._._ _ (A) LENGTH: 1416 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular S
(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
lO (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori IS (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...1416 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:42:

AGAGATAAAG
AATACAAGGA

TACCACACGCTCAAAAAAGGGCTTTTA:~AAACCGCTCTGCTTTTTAGCCTTCCTTTAAGC120 GGCTTTGGCATTCAAGTGGGCTATAAGCAATTTTTTGGGA.GCAAGAAGAATATAGGCTTA960 -(2)INFORMATION FOR SEQ ID N0:43:
(i) SEQUENCE CHARACTERISTICS:
_ (A) LENGTH: 390 base pairs SO (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
S
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...30 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:43:

TATTATGCTC

GATTAAAGTC

AGTGGTGGTC

TTTAGAAGCT

AAGCGACAAG

TAATCATGAA

(2) INFORMATION FOR SEQ ID N0:44:

ZS (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 225 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
3S (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 4O (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...225 (xi) SEQUENCE
DESCRIPTION:
SEQ ID N0:44:

ATGCTCGTCT TACTAGCGATTGTGTTGAGTATTT~r.CTT TTATCGCGCA AGGTAAGATT60 GAAGCTTTGA GCGCTGTF~GTCAAGCAAACAGACCCTAAAA CCCTT 225 (2) INFORMATION FOR SEQ ID N0:45:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 672 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:' double (D) TOPOLOGY: circular S (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
1S (A) NAME/KEY: misc_feature (B) LOCATION 1...672 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:45:

(2) INFORMATION FOR SEQ ID N0:46: -3S (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 351 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
4S (iv) ANTI-SE'dSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori SO (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...351 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:46:

TTGATGAAAT CTAAAATCAC TCATTTTATC GTTATCTCTTTTGTTTTAAG CGTGTTGAGC

GCCTGCAAAG ATGAGCCTAA AAAATCGTCC CAATCGCACCAAAACAACAC TAAAACCACT

CAAAACAATC AAATCAATCA ACCTAATAAG GATATAAAAAAGATTGAGCA TGAAGAAGAA

S GATGAAAAAG TCACCAAAGA AGTGAATGAT CTGATCAATAACGAAAATAA AATTGATGAA

ATCAATAATG AAGAAAACGC TGATCCTTCG CAAAAAAGAACGAACAATGT TTTGCAACGA

(2) INFORMATION FOR SEQ ID N0:47:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 240 base pairs (B) TYPE: nucleic acid (C) STR.ANDEDNESS: double IS (D) TOPOLOGY: circular _ (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...240 3O (xi) SEQUENCE DESCRIPTION: SEQ ID N0:47:

ATGTTTGAAA AAATACGCAA GATTTTAGCG GATATTGAAGATTCGCAAAA TGAAATTGAA

ATGCTTTTAA AATTAGCGAA TTTGAGTTTG GGGGATTTTATTGAGATTAA AAGAGGGAGC

ATGGACATGC CAAAGGGCGT GAATGAAGCG TTTTTTACGCAATTAAGCGA AGAAGTGGAG

(2) INFORMATION FOR SEQ ID N0:48:

(i) SEQUENCE CHARACTERISTICS:

40 (A) LENGTH: 156 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular - 4S (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

SO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

_..._.._..._.~_ ___. . _._......_._ . _..._..._r____..

(A) NAME/KEY: misc_feature (B) LOCATION 1...156 S
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:48:

IO (2) INFORMATION FOR SEQ ID N0:49:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1350 base pairs (B) TYPE: nucleic acid IS (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) ZO (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
ZS (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...1350 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:49:

AAATAAAAAT

4S AGCGGTATCCATGCGACGATCGCTGCGGTGGTTCTAGCTTTTATGATACCGG'.'GAAAATC780 CCTAAAGATTCTAAAAATGTAGAGCTTTTGGAATTAGGCAAACGATACGCaf.AGACGAGT840 WO 98/24475 PCTfUS97/22104 (2) INFORMATION FOR SEQ ID N0:50:
S (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2448 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular lO
(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
1S (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 2O (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...2448 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:50:

TGCTCCATCACTTTTAAAAGCCTTGGAG~CGGTTCTGTTGTCGCTAATAAAAATTTATTC1260 GACGTTTATACTTTAGTGGATAAAGACTGGCAATTGCACGTAACTCAAC;GTTTAGCCCT1620 lO CTCAAAGGGT TGAGCCTGAA CGCGGTGTTT AATAATGTTT TTAACCAACA ATATATTGAT 2340 (2) INFORMATION FOR SEQ ID N0:51:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2445 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double 20 (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...2445 3S (xi) SEQUENCE DESCRIPTION: SEQ ID NO:51:

4S GGCGCGAT~AAAATGGAGACTAGGAGCGCGAGCGATTTTATCCCTAAAGGCAAAGACTAC540 GCCAT~..=.~i'GGGGCTGCCACTTTTTTAACCAACTTTGGGGATAGGGAAACCATTATGGGC600 lO GCGGCTTTAAACGTCTCGCCTTTAGAAAATTTGAATTTCAGGCTTTCTTACGCGTATGTA1680 ZS (2) INFORMATION FOR SEQ ID N0:52:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1584 base pairs (B) TYPE: nucleic acid 30 (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) 3S (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
4O (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...1584 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:52:

ATTTAATGAC

lO ACCCAACTGT TAAACAACACCACAAACACTTTGGCTAAAGTTACCGCTCTAAACAACGAG1020 (2) INFORMATION FOR SEQ ID N0:53:
(i) SEQUENCE CHARACTERISTICS:
2$ (A) LENGTH: 1380 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular 3O (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
4O (A) NAME/KEY: misc_feature (B) LOCATION 1...1380 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:53:
4S GTGGTGTTATTAACAATGACAAAACGACTTTTTAAAGGGTTGTTAG';GAT TTCTCTTGCG60 GTGAGTTTGC ATGGTGGTGAAGTTAAGGAAAAAAAGCCGGTCA..3~;CGGT CAAAGAAGAT120 lO AATAAATTCA GTTTGAAAGA AGCGGATTTA AAACACCATT TAGAGCAAGA GCTTAAAAAA 1200 1S (2) INFORMATION FOR SEQ ID N0:54:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 315 base pairs (B) TYPE: nucleic acid ZO (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) ZS (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO -(vi) ORIGINAL SOURCE:
3O (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...315 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:54:

4S (2) INFORMATION FOR SEQ Ir> N0:55:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 498 base pairs (B) TYPE: nucleic acid SO (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
S (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...498 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:55:

AAATTTAAGG CATTTTAG 4gg (2) INFORMATION FOR SEQ ID N0:56:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 642 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double 30 (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...642 4S (xi) SEQUENCE DESCRIPTION: SEQ ID N0:56:

AAACACAAGA
AAAGTTTTTA

S (2) INFORMATION FOR SEQ ID N0:57:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 762 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) IS (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE: -20 (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...762 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:57:

ATCAAAGCCC

(2) INFORMATION FOR SEQ ID N0:58:
(i) SEQUENCE CHARACTERISTICS:
4S (A) LENGTH: 744 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular S~ (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
__..-.~.. ___.. __ ...~ _ _ _.._._..r . .. . _ (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori S (ix) FEATURE:
(A) NAME/K.EY: misc_feature (B) LOCATION 1...744 lO
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:58:

AGCCGGGAAT

TCAGTGGATG GACTTAACACAAGCCACCATGAGCATACTATCGCCATAGTTGGCAATAAA ?20 ZS (2) INFORMATION FOR SEQ ID N0:59:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1023 base pairs (B) TYPE: nucleic acid 3O (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) 3S (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
4O (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...1023 _4S
(xi) SEQUENCE DESCRIPTION: SEQ ID NC.:f 3:

TAATTACTTA AAACAGCGCC

SO GGCAATAACC CTGACACAGA AACTTCGCTTTTTTATGCGAGCGATTATGAAA.AAAGCCAG180 ACAAAATACA AATACACTAG CGAAATTATCGTTAAATTTTTCCAi4AAAAGCCCCTTGAAA420 TGA _ 1023 (2) INFORMATION FOR SEQ ID N0:60:
IS (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 603 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
2S (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 3O (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...603 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:60:

AATGGTATAA AGGGTGTTGAAAAP.Ai~ICAAAGAGAACGCCAAAACGCCCCCAACCACCCAC540 4S CAAAAGCCTAAAACGCP'rGCGACAACCAACGCCCATACCAACCAAAAAAAGGATGAAAAA600 Z''~'~' 6 (2) INFORMATION FOR SEQ ID N0:61:
SO (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 4B0 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
{iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...480 IS (xi) SEQUENCE DESCRIPTION: SEQ ID N0:61:

(2) INFORMATION FOR SEQ ID N0:62:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 705 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO.
(iv) ANTI-SENSE: NO
4O (vi) ORIGINAL SOURCE:

{A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc feature _ (B) LOCATION 1...705 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:62:

SO GACGCTTTAA ACAAATTGAT TAATGAAATC CACACGCGCCACATTGATTT

AAAGCCTAAA AGATAAAAAT

(2) INFORMATION FOR SEQ ID N0:63:
IO (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 864 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
ZO (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori ZS (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...864 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:63:

GCGAAATGGC

(2) INFORMATION FOR SEQ ID N0:64:
(i) SEQUENCE CHARACTERISTICS:
SO (A) LENGTH: 606 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
S (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori IO (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...606 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:64:

AATTCGTTGC

(2) INFORMATION FOR SEQ ID N0:65:
3O (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1068 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double -(D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
4O (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 4S (ix) FEATURE:
(A) NAME/KEY: misw_.eature (B) LOCATION 1...1068 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:65:
SO

AAAAAATCAT

lO GGCTGGAGGGACACCAACACCTTTAGATTAGGGGTAACTTACATGGGTAAAAGCTTGCGT840 (2) INFORMATION FOR SEQ ID N0:66:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1764 base pairs 2O (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
30 (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature 35 (B) LOCATION 1...1764 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:66:

AAAAAGCTCA
AAAAACGCCA

TTATATTCGGTAACAAGTTTAGAA.ATTGATAAAAGCCAACAAAATATTTTAGGCATCATC360 TTA.C.CAAGCTATCAATCGTGTTCAAGGGCTTATGAACTTAACCAATCAAAAAGTCGTA480 _ ._ _..__ _.... . _._ _~_T..._ _... . _....

AATCATGGGT

(2) INFORMATION FOR SEQ ID N0:67:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 618 base pairs 20 {B) TYPE: nucleic acid {C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
3O (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature 3S (B) LOCATION 1...618 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:67:

AATCTTAAGC

ATCCAATCAGCGGTGGGGAGTGTGGGCTTGTTTTTCAATGCGGCTAAAAATTTTGGCTTG~~C

SO

(2) INFORMATION FOR SEQ ID N0:68:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 762 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular S (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
1~
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
1S (A) NAME/KEY: misc_feature (B) LOCATION 1...762 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:68:

GGTGTTTTAT CGTTTGCTCG-CTCCCATAi~ACGACAAAATCAAGCGGTTTTATCAAAACCA 180 (2) INFORMATION FOR SEQ ID N0:69:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1239 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double 4~ (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori S~
(ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...1239 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:69:

AAAAACAAAT AAAACACAGA

GGTGATATTGATAAACAAATAGAACTAGAACAAGAA.AAA.AAGGAAGCAAATAAGAGTGGG420 CAAAAAATATTTGCTGATATTAA'rAAAGAAATAGAAGCAGTTGCTAATACTGAAAAGAAA1200 ZS (2) INFORMATION FOR SEQ ID N0:70:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 450 base pairs (B) TYPE: nucleic acid 3O (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) 3S (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
4O (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature -- (B) LOCATION 1...450 (xi} SEQUENCE DE..:C:IPTION: SEQ ID N0:70:

(2) INFORMATION FOR SEQ ID N0:71:
S (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 615 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
IS (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 2O (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATIGN 1...615 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:71:

ATGCAAGCAG TGATTTTAGC GAATGGGGAG TTTCCTAAATCTAAAAAATG CTTAGACATT

TTACAAAACG CTCCCTTTTT AATCGCATGC GATGGGGCTGTTATATCATT GCATGCGCTT

CAATTCAAAC CCAGCGTTGT TATAGGCGAT TTGGATAGCATTGATTCGCA TTTGAAAGCC

TTGTATAACC CTATACGCGT GAGCGAACAA GACAGCAACGATTTGTCCAA AGCCTTTTTT

GACCACGCTT TAGCGAACAC TTTTTTATTG TTGGAGTATTTTAAATTTTG CAAP.AAAATC

CAATCCGTAA GCGATTATGG CCTTTTTAGG GTGTTAGAAACCCCTTTTAC TTTGCCCAGT

TTTAAGGGGG AGCAAATCTC GCTTTTTAGC TTGGATCTTAAAGCCCGATT CACTTCTAAA

AACCTCAAAT ACCCCTTAAA AGACTTGCGT CTAAAAACGCTCTTTTCCGG CTCGCTCAAT

(2) INFORMATION FOR SEQ ID N0:72:

40 (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 843 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

SO (iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...843 S (xi) SEQUENCE DESCRIPTION: SEQ ID N0:72:

lO CGACAAGGAA CAAGGCACAACAATTATCTTGGTTTAACCTCTACAAACCTTCTAATCGGC240 (2) INFORMATION FOR SEQ ID N0:73:
ZS (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 930 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (Henomic) ( i i i ) H'IPOTHETI CAL : NO
3S (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 4O (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...930 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:73:
TGTGACAGGG CAATTCCCCA TTGGCTTTTTAGTCTGGGATACCGCTACCC CCCCCCwr'.A60 (2) INFORMATION FOR SEQ ID N0:74:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 564 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double 1S (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO -{iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...564 3O (xi) SEQUENCE DESCRIPTION: SEQ ID N0:74:

ATATCATTGA

(2) INFORMATION FOR SEQ ID N0:75:
4S (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 597 base pairs (B) TYPE: nucleic acid (C1 STRANDEDNESS: double (D) TOPOLOGY: circular SO
(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori S
(ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...597 IO (xi) SEQUENCE DESCRIPTION: SEQ ID N0:75:

(2) INFORMATION FOR SEQ ID N0:76:
ZS (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 570 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
3S (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 4O (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...570 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:76:
_ 4S

ATGATGACTA A~P.~CGCTTATGCGTTTGTCGTGATTGAAAAAAGTATTAT GGTGTTTAAA60 AAGCCTGATT CCAATGAAGA AAATTTTTAA _ 570 (2) INFORMATION FOR SEQ ID N0:77:
S (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1773 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular lO
(ii) MOLECULE TYPE: DNA_(genomic) (iii) HYPOTHETICAL: NO
IS (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 2O (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...1773 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:77:

GACAATTCGC TCTTCCACACTAAAGCCATG CCCACTAAAA GCGTGGATGCGATCACTTCT960.

AACGACATGG GCGATGACATGAATAACGCG.AACGACATGA ACGACGACATGGGTAACAGC1680 (2) INFORMATION FOR SEQ ID N0:78:
S (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 588 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular l~
(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
IS (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 2O (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...588 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:78:

TTGAATTTAC GATTGGCTGG AGCAAGCGTT TTAACGGCTTGTGTCTTTTC GGGGTGTTTT

TTTTTAAAAA TGTTTGACAA AAAACTTTCT AGCAACGATTGGCATATCCA AAAAGTAGAA

ATGAACCATC AAGTGTATGA CATTGAAACC ATGCTCGCTGATAGCGCTTT TAGAGAGCAT

GAAGAAGAGC AAGACTCCTC TTTAAATACC GCTTTGCCTGAAGATAAAAC AGCGATTGAA

CCAAAGCCCA AAAGCTCTAT GGGAGAGTTT GTGTTTGATCAAAAAGAAAA TCGTATTTAT

GGGAAAGGCT ATTGCAACCG GTATTTTGCT AGCTACACATGGCAGGGCGA TAGGCACATC

GCAATTGAAG ATAGCGGGAT TTCAAGAAAA GTGTGTAGAGATGAGCATTT GATGGCGTTT

GAATTGGAAT TTATGGAGAA TTTTAAGGGT AATTTTGCGGTAACTAAGGG CAAGGACACG

{2) INFORMATION FOR SEQ ID N0:79:

(i) SEQUENCE CHARACTERISTICS:

40 (A) LENGTH: 2235 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular 4S (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

SU

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

WO 98/24475 PCTlUS97/22104 (A) NAME/ICEY: misc_feature (B) LOCATION 1...2235 S
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:79:

AACGATTTGT

4S (2) INFORMATION FOR SEQ ID N0:8(':
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1590 base pairs (B) TYPE: nucleic acid SD (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
S (vi) ORIGINAL SOURCE:
(A) ORGANISN~' Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature 1~ (B) LOCATION 1...1590 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:80:

CCAGGCGATGATGGCACCAATTTTGGCGCTTTAGGGATATiGTCCCCTTTCTTAGACCCT540 (2) INFORMATION FOR SEQ ID N0:81:
(i) SEQUENCE CHARACTERISTICS:
4S (A) LENGTH: 564 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular S~ (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori S (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...564 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: B1:
lO

IS TTGGGCTTAG GGGCGTGTTTGAAACTCGCT ATTGAAGAAATTGTAGAAAA~'GGTTGCTCT300 ZO GGGGCTACGC TTTCATCGGCATAG

(2) INFORMATION FOR SEQ ID N0:82:
(i) SEQUENCE CHARACTERISTICS:
2S (A) LENGTH: 615 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular 3O (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
4O (A) NAME/KEY: misc_feature (B) LOCATION 1...615 (xi} SEQUENCE DESCRIPTION: SEQ ID N0:82:

CCGGTTCGCT

GGGGTGGTGT GTAATGAAAA AATAGCCTTA GAATTTCTAA AAATGGGTCTTAAGGATAGC 12~

ACCCCAACAT

__._ _~..___ .. _.. .~_.._re___ T....

(2) INFORMATION FOR SEQ ID N0:83:
S (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 579 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
IS (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 2O (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...579 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:83:
ATGAATGCAT TGAAAP~AATT AAGTTTTTGCGCCTTGTTATCCCTAGGCCTCTTCGCTCAA60 (2) INFORMATION FOR SEQ ID N0:84:
(i) SEQUENCE CHARACTERISTICS:
40 (A) LENGTH: 261 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular 4S (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
SO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

WO 98/24475 PCTfUS97/22104 (A) NAME/KEY: misc_feature (B) LOCATION 1...261 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:84:
S

lO CTGAAGAAAT CGCTCTTTTA A 261 (2) INFORMATION FOR SEQ ID N0:85:
(i) SEQUENCE CHARACTERISTICS:
1S (A) LENGTH: 228 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular 20 (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
30 (A) NAME/KEY: misc_feature (B) LOCATION 1...228 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:85:

4O (2) INFORMATION FOR SEQ ID N0:86:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 636 base pairs (B) TYPE: nucleic acid 4S (C) STRANDEDNESS: double (D) TOPOLOG'-: circular (ii) MOLECULE TYPE: DNA (genomic) SO (iii) HYPOTHETICAL: NO
(iv} ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature S (B) LOCATION 1...636 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:86:

lO CACTTCAAATTAGGGGATTTGTTTGAAATTGAAAAAACCTTAAGCTTTAATAAAGACGCT120 (2) INFORMATION FOR SEQ ID N0:87:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1221 base pairs 2S (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
3S (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...1221 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:87:

ACCCCAACAT

lO CAAAAAGACT CGTTATTTTG A 1221 (2) INFORMATION FOR SEQ ID N0:8B:
(i) SEQUENCE CHARACTERISTICS:
15 (A) LENGTH: 828 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular 2O (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
3O (A) NAME/KEY: misc_feature (B) LOCATION 1...828 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:88:

ACGCCAGCCA AGATGAAATC

ATTGAAATCG CTACTTGGCA TAAAACCTTA ACCCTAACCATTCCCCCTAACACCAAAC..:C720 GATTGTATTG CAAGCTCGTT TGATCTGCTA AAATTGAAACGCTTCTAA g2g SO (2) INFORMATION FOR SEQ ID N0:89:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 837 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular S
(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
IO (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature 1S (B) LOCATION 1...837 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:89:

TACCACCCGG AACCAAAGAA

CGCCGCCAAT ACi~ATCAATTTGGCGACAACATGTTTGGCGGGCAGAATTTCAGCGATTTT240 (2) INFORMATION FOR SEQ ID N0:90:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 699 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double 4O (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
' (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori SO
(ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...699 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:90:

AATTTAATTT

AATGTGGATT ATTTGACCTTTTTGAAACTGCAATCGCATT.ATTACGCTTTCAAAAACCAT420 TCGCACATGC CTTGGTATGTGTTAATTTTTGATTGGTAG Egg (2) INFORMATION FOR SEQ ID N0:91:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 345 base-pairs 2O (B) TYPE: nucleic acid (C) STR.ANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
3O (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature 3S (B) LOCATION 1...345 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:91:

AGGCTGAAGA

(2) INFORMATIC_: 'OR SEQ ID N0:92:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 306 base pairs _ SO (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) WO 98/24475 PCT/~JS97122104 (iii) HYPOTHETICAL: NO
S
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
IO (A) NAME/KEY: misc_feature (B) LOCATION 1...306 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:92:

(2) INFORMATION FOR SEQ ID N0:93:
(i) SEQUENCE CHARACTERISTICS:
ZS (A) LENGTH: 1446 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular 3O (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
4O (A) NAME/KEY: misc_feature (B) LOCATION 1...1446 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:93:
~S ATGAGAATTT TACAAAGGGC TTTGACTTTT GAAGACGTGT TGATGGTGCC TAGAAAATCC 60 AATACCCTGA

lO AGGGGCATGGGCAGCATTGGGGCTATGACT AAAGGGAGCTCTGATAGGTATTTTCAAGAG1200 (2) INFORMATION FOR SEQ ID N0:94:
(i) SEQUENCE CHARACTERISTICS:
20 (A) LENGTH: 615 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:double (D) TOPOLOGY: circular ZS (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
3S (A) NAME/KEY: misc_feature (B) LOCATION 1...615 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:94:

AAGATTTGAT

GCAAACGCCA

ATAAATTTTT

TGGAGCGCTT

TGCATTCTTT

4S TATTTTGACA CTTTAGATGA TGGGGCTAGC AAACTCTCCA CTT~AGAGTG 360 AACAGCACCC

ATTTTAGAAA TGTATGCAGT CCTTTTGAAT TTTGAAGGGC _T.CAATTCT 420 GCTTGCAAAG

TAGCGCAAGG

AAi~.AAATCCA

AAGAATTATG

(2) INFORMATION FOR SEQ ID N0:95:
(i) SEQUENCE CHARACTERISTICS:
.._._._~_ , .._. . ____..__..~a~ T_..

WO 98/24475 PCT/~JS9'7/22104 (A) LENGTH: 249 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

lO (iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori IS (ix) FEATURE: _ (A) NAME/KEY: misc_feature (B) LOCATION 1...249 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:95:

ATGGGCGTCG GACGGGTCGG CAATATGGCA CTGTTGGCGTGTGCAGGTCC GATGGGCATC

GGCGCTATTG CTATCGCCAT TAACGGCGGC AGACAACGGTCGCGGF~TGTT GGTGGTCGAT

ATAGACGACA AACGTCTGGA GCAGGTACAG AAGATGCTGCCGGGGAATTG GCGGCCAGTA

ACGGCATTGA GCTGGTGTCT GTGCATACCA AAGCGAGGAGCGATCCGTGC CAGATGCTGC

(2) INFORMATION FOR SEQ ID N0:96:

(i) SEQUENCE CHARACTERISTICS:

30 (A) LENGTH: 204 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular 3$ (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

{iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

{A) ORGANISM: Helicobacter pylori - {ix) FEATURE:

--- 4$ (A) NAME/KEY: misc_featvre (B) LOCATION 1...204 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:96:

SO TTGTCCGGTA CAGCCGTGAG TTGCCGGTGC ACATGCCGCATACAGTTGGT ATTGGTGCGC

ACCAGCATCC CGGTTGTTAT CGGGTGCTCA TGCCCATTCCTTTCCAGTAT TGGGTTCACA

ACGGGAACCC ACCAATCACC CGTTAAACGC TGCGGGGTTAACGCCGGAAA AACACCGTCA

WO 98/24475 PCTlUS97/22104 (2) INFORMATION FOR SEQ ID N0:97:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 345 base pairs S (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii} MOLECULE TYPE: DNA (genomic) 1~
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
IS (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...345 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:97:

(2) INFORMATION FOR SEQ ID
N0:98:

(i) SEQUENCE CHARACTERISTICS :

(A) LENGTH: 228 amino a cids 3S (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein 4O (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori _4S (ix) ?EATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...228 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:98:
S~
Met Arg Phe Lys Gly Ser Arg Val Glu Ala Phe Leu Gly Ala Leu Glu Phe Gln Glu Asn Glu Tyr Glu Glu Phe Lys Glu Leu Tyr Glu Ser Leu _... ...._ _.... .. ...w..-___ _.__._~._~___ __ .....

WO 98/24475 PCTiUS97/22104 Lys ThrLys GlnLysPro HisThr LeuPheIle SerCysVal AspSer 35 ~ 45 Arg ValVal ProAsnLeu IleThr GlyThrGln ProGlyGlu LeuTyr $ Val IleArg AsnMetGly AsnVal IleProPro LysThrSer TyrLys 65 7~ 75 80 Glu SerLeu SerThrIle AlaSer ValGluTyr AlaIleAla HisVal Gly ValGln AsnLeuIle IleCys GlyHisSer AspCysGly AlaCys loo 105 llo Gly SerIle HisLeuIle HisAsp GluThrThr LysAlaLys ThrPro Tyr IleAla AsnTrpIle GlnPhe LeuGluPro IleLysGlu GluLeu 1$ Lys AsnHis ProGlnPhe SerAsn HisPheAla LysArgSer TrpLeu Thr GluArg LeuAsnAla ArgLeu GlnLeuAsn AsnLeuLeu SerTyr Asp PheIle GlnGluArg ValIle AsnAsnGlu LeuLysIle PheGIy Trp HisTyr IleIleGlu ThrGly ArgIleTyr AsnTyrAsn PheGlu Ser HisPhe PheGluPro IleGlu GluThrIle LysGlnArg IleSer 2$ His GluAsn Phe (2) INFORMATION FOR SEQ ID N0:99:
3O (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 221 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear , 3$ (ii) MOLECULE TYPE: protein - (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
4~ (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...221 4$
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:99:
Val Glu Ala Phe Leu Gly Ala Leu Glu Phe Gln Glu Asn Glu Tyr Glu $0 Glu Phe Lys Glu Leu Tyr Glu Ser Leu Lys Thr Lys Gln Lys Pro His Thr Leu Phe Ile Ser Cys Val Asp Ser Arg Val Val Pro Asn Leu Ile Thr Gly Thr Gln Pro Gly Glu Leu Tyr Val Ile Arg Asn Met Gly Asn Val Ile ProProLys ThrSer TyrLysGlu SerLeuSer ThrIle Ala Ser Val GluTyrAla IleAla HisValGly ValGlnAsn LeuIle Ile Cys Gly HisSerAsp CysGly AlaCysGly SerIleHis LeuIle His Asp Glu ThrThrLys AlaLys ThrProTyr IleAlaAsn TrpIle Gln 17.5 120 125 Phe Leu GluProIle LysGlu GluLeuLys AsnHisPro GlnPhe Ser Asn His PheAlaLys ArgSer TrpLeuThr GluArgLeu AsnAla Arg Leu Gln LeuAsnAsn LeuLeu SerTyrAsp PheIleGln GluArg Val 1S 165 170 _ 17~

Ile Asn AsnGluLeu LysIle PheGlyTrp HisTyrIle IleGlu Thr Gly Arg IleTyrAsn TyrAsn PheGluSer HisPhePhe GluPro Ile Glu Glu ThrIleLys GlnArg IleSerHis GluAsnPhe (2) INFORMATION FOR SEQ ID NO:100:
ZS (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 335 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
3S (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...335 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:100:
Met Leu Val Thr Arg Phe Lys Lys Ala Phe Ile Ser Tyr Ser Leu Gly -- 4$ Val Leu Val Val Ser Leu Leu Leu Asn Val Cys Asn Ala Ser Ala Gln Glu Val Lys Val Lys Asp Tyr Phe Gly Glu Gln Thr Ile Lys Leu Pro Val Ser Lys Ile Ala Tyr Ile Gly Ser Tyr Val Glu Val Pro Ala Met Leu Asn Val Trp Asp Arg Val Val Gly Val Ser Asp Tyr Ala Phe Lys Asp Asp Ile Val Lys Ala Thr Leu Lys Gly Glu Asp Leu Lys Arg Val r..__ __n..__... _~~.._.T....

Lys HisMet SerThrAsp HisThrAla AlaLeu AsnValGlu LeuLeu Lys LysLeu SerProAsp LeuValVal ThrPhe ValGlyAsn ProLys S Ala ValGlu HisAlaLys LysPheGly IleSer PheLeuSer PheGln Glu ThrThr IleAlaGlu AlaMetGln AlaMet GlnAlaGln AlaThr Val LeuGlu IleAspAla SerLysLys PheAla LysMetGln GluThr Leu AspPhe IleAlaGlu ArgLeuLys GlyVal LysLysLys LysGly Val GluLeu PheHisLys AlaAsnLys IleSer GlyHisGln AlaIle 1S Ser SerAsp IleLeuGlu LysGlyGly IleAsp AsnPheGly LeuLys Tyr ValLys PheGlyArg AlaAspIle SerVai GluLysIle ValLys Glu AsnPro GluIleIle PheIleTrp TrpVal SerProLeu ThrPro Glu AspVal LeuAsnAsn ProLysPhe SerThr IleLysAla IleLys Asn LysGln ValTyrLys LeuProThr MetAsp IleGlyGly ProArg 2$ Ala ProLeu IleSerLeu PheIleAla LeuLys AlaHisPro GluAla Phe LysGly ValAspIle AsnAlaIle ValLys AspTyrTyr LysVal Val PheAsp LeuAsnAsp AlaGluIle GluPro PheLeuTrp His (2) INFORMATION FOR SEQ ID NO:101:
(i) SEQUENCE CHARACTERISTICS:
3$ (A) LENGTH: 274 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL- SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...274 SO (xi) SEQUENCE DESCRIPTION: SEQ ID NO:101:
Met Leu Val Thr Arg Phe Lys Lys Ala Phe Ile Ser Tyr Ser Leu Gly Val Leu Val Val Ser Leu Leu Leu Asn Val Cys Asn Ala Ser Ala Gln Glu Va1 Lys VaI Lys Asp Tyr Phe Gly Glu Gln Thr Ile Lys Leu Pro Val Ser Lys Ile Ala Tyr Ile Gly Ser Tyr Val Glu Val Pro Ala Met 50 _ 55 60 Leu Asn Val Trp Asp Arg Val Val Gly Val Ser Asp Tyr Ala Phe Lys Asp Asp Ile Val Lys Ala Thr Leu Lys Gly Glu Asp Leu Lys Arg Val 1~ Lys His Met Ser Thr Asp His Thr Ala Ala Leu Asn Val Glu Leu Leu Lys Lys Leu Ser Pro Asp Leu Val Val Thr Phe Val Gly Asn Pro Lys Ala Val Glu His Ala Lys Lys Phe Gly Ile Ser Phe Leu Ser Phe Gln Glu Thr Thr Ile Ala Glu Ala Met Gln Ala Met Gln Ala Gln Ala Thr Val Leu Glu Ile Asp Ala Ser Lys Lys Phe Ala Lys Met Gln Glu Thr 2~ Leu Asp Phe Ile Ala Asg Arg Leu Lys Gly Val Lys Lys Lys Lys Gly Val Glu Leu Phe His Lys Ala Asn Lys Ile Ser Gly His Gln Ala Ile Asn Ser Asp Ile Leu Gln Gln Gly Gly Ile Asp Asn Phe Gly Leu Lys Tyr Val Lys Phe Gly Arg Ala Asp Ile Ser Val Glu Lys Ile Val Lys Glu Asn Pro Glu Ile Ile Phe Ile Arg Trp Val Thr Pro Leu Thr Pro 30 Asp Tyr Val Leu Asn Asn Pro Lys Phe Ser Thr Ile Asn Ala Ile Lys Asn Ile 3S (2} INFORMATION FOR SEQ ID N0:102:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 428 amino acids (B) TYPE: amino acid 4~ (D) TOPOLOGY: linear (ii} MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
S~ (A) NAME/KEY: misc_feature (B) LOCATION 1...428 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:102:
__ _~.....r....

Met LysLys LysPheLeu SerLeu ThrLeuGly SerLeu LeuValSer Ala LeuSer AlaGluAsp AsnGly PhePheVal SerAla GlyTyrGln S Ile GlyGlu SerAlaGln MetVal LysAsnThr LysGly IleGlnAsp Leu SerAsp SerTyrGlu ArgLeu AsnAsnLeu LeuThr AsnTyrSer Val LeuAsn AlaLeuIle ArgGln SerAlaAsp ProAsn AlaIleAsn 1~ 65 70 75 80 Asn AlaArg GlyAsnLeu AsnAla SerAlaLys AsnLeu IleAsnAsp Lys LysAsn SerProAla TyrGln AlaValLeu LeuAla LeuAsnAla 15 Ala AlaGly LeuTrpGln ValMet SerTyrAla IleSer ProCysGly Pro GlyLys AspThrSer LysAsn GlyGlyVal GlnThr PheHisAsn Thr ProSer AsnGlnTrp GlyGly ThrThrIle ThrCys GlyThrThr Gly TyrGlu ProGlyPro TyrSer IleLeuSer ThrGlu AsnTyrAla Lys IleAsn LysAlaTyr GlnIle IleGlnLys AlaPhe GlySerSer 25 Gly LysAsp IleProAla LeuSer AspThrAsn ThrGlu LeuLysPhe Thr IleAsn LysAsnAsn GiyAsn ThrAsnThr AsnAsn AsnGlyGlu Glu IleVal ThrLysAsn AsnAla GlnValLeu LeuGlu GlnAlaSer 3~ 225 230 235 240 Thr IleIle ThrThrLeu AsnSer AlaCysPro TrpIle AsnAsnGly Gly AlaGly GlyAlaSer SerGly SerLeuTrp GluGly IleTyrLeu 3S Lys GlyAsp GlySerAla CysGly IlePheLys AsnGlu IleSerAla Ile GlnAsp MetIleLys AsnAla AlaIleAla ValGlu GlnSerLys Ile ValAla AlaAsnAla GlnAsn GlnArgAsn LeuAsp ThrGlyLys 4fl305 310 315 320 Thr PheAsn ProTyrLys AspAla AsnPheAia GlnSer MetPheAla Asn AlaLys AlaGlnAla GluIle LeuAsnArg AlaGln AlaValVal 4S Lys AspPhe GluArgIle ProAla GluPheVal LysAsp SerLeuGly Val CysHis GluValGln AsnGly HisLeuArg GlyThr ProSerGly Thr ValThr AspAsnThr TrpGly AlaGlyCys AlaTyr ValGlyGlu Thr ValThr AsnLeuLys AspSer IleAlaHis PheGly AspGlnAla Glu ArgIle HisAsnAla ArgAsn LeuAlaThr Leu (2) INFORMATION FOR SEQ ID N0:103:
(i) SEQUENCE CHARACTERISTICS:
$ (A) LENGTH: 178 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein 1~
(iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 1$
(ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...178 ZO (xi)SEQUENCE SEQID
DESCRIPTION: N0:103:

Met Asn -ProLeuLea GlnAspTyr AlaArgIle LeuLeu GluTrpAsn Gln Thr HisAsnLeu SerGlyAla ArgAsnLeu SerGlu LeuGluPro ~$ 20 25 30 Gln Ile ThrAspAla LeuLysPro LeuGluPhe ValLys AspPheLys Ser Cys LeuAspIle GlySerGly AlaGlyLeu ProAla IleProLeu Ala Leu GluLysPro GluAlaGln PheIleLeu LeuGlu ProArgVal Lys Arg AlaAlaPhe LeuAsnTyr LeuLysSer ValLeu ProLeuAsn Asn Ile GluIleIle LysLysArg LeuGluAsp TyrGln AsnLeuLeu 3$ 100- 105 I10 Gln Val AspLeuIle ThrSerArg AlaValAla SerSer SerPheLeu Ile Glu LysSerGln ArgPheLeu LysAspLys GlyTyr PheLeuPhe 4~ Tyr Lys GlyGluGln LeuLysAsn GluIleAla TyrLys ThrThrGlu Cys Phe MetHisGln LysArgVal TyrPheTyr LysSer LysGluSer Leu Cys 4$

(2) INFORMATION FOR SEQ ID N0:104:
(i) SEQUENCE CHARACTERISTICS:
$~ (A) LENGTH: 240 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...240 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:104:
Leu GlyLeu LysLysArg AlaIleLeu TrpSer LeuMetGly PheCys IS Ala GlyLeu SerAlaLeu AspTyrAsp ThrLeu AspProLys TyrTyr Lys TyrIle LysTyrTyr LysAlaTyr GluAsp LysGluVal GluGlu Leu IIeArg AspLeuLys ArgAlaAsn AlaLys SerGlyLeu IleLeu Gly IleAsn ThrGlyPhe PheTyrAsn HisGlu IleMetVal LysThr Asn SerSer SerIleThr GlyAsnIle LeuAsn TyrLeuPhe AlaTyr 2.5Gly LeuArg PheGlyTyr GlnThrPhe ArgPro SerPhePhe AlaArg Leu ValLys ProAsnIle IleGlyArg ArgIle TyrIleGln TyrTyr Gly GlyAla ProLysLys AlaGlyPhe GlySer ValGlyPhe GlnSer Val MetLeu AsnGlyAsp PheLeuLeu AspPhe ProLeuPro PheVal Gly LysTyr LeuTyrMet GlyGlyTyr MetGly LeuGlyLeu GlyVal 35 Val AlaHis GlyValAsn TyrThrAla GluTrp GlyMetSer PheAsn Ala GlyLeu AlaLeuThr ValLeuGlu LysAsn ArgIleGlu PheGlu Phe LysIle LeuAsnAsn PheProPhe LeuGln SerAsnSer SerLys 4~ 210 215 220 Glu ThrTrp TrpGlyAla IleAlaSer IleGly TyrGlnTyr ValPhe (2) INFORMATION FOR SEQ ID N0:105:
( i ) SEQUENC..~ .:HARACTERISTICS
(A) LENGTH: 313 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear Sfl (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES

(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
$ (A) NAME/KEY: misc_feature (B) LOCATION 1...313 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:105:
Ifl Leu Lys Leu Lys Tyr Trp Leu Val Tyr Leu Ala Phe Ile Ile Gly Leu Gln Ala Thr Asp Tyr Asp Asn Leu Glu Glu Glu Asn Gln Gln Leu Asp Glu Lys Ile Asn Asn Leu Lys Arg Gln Leu Thr Glu Lys Gly Val Ser 1$ 35 40 45 Pro Lys Glu Met Asp Lys Asp Lys Phe Glu Glu Glu Tyr Leu Glu Arg Thr Tyr Pro Lys Ile Ser Ser Lys Lys Arg Lys Lys Leu Leu Lys Ser 20 Phe Ser Ile Ala Asp Asp Lys Ser Gly Val Phe Leu Gly Gly Gly Tyr Ala T~.~r Gly Glu Leu Asn Leu Ser Tyr Gln Gly Glu Met Leu Asp Arg Tyr Gly Ala Asn Ala Pro Ser Ala Phe Lys Asn Asn Ile Asn Ile Asn 2$ 115 120 125 Ala Pro Val Ser Met Ile Ser Val Lys Phe Gly Tyr Gln Lys Tyr Phe Val Pro Tyr Phe Gly Thr Arg Phe Tyr Gly Asp Leu Leu Leu Gly Gly Gly Ala Leu Lys Glu Asn Ala Leu Lys Gln Pro Val Gly Ser Phe Phe Tyr Val Leu Gly Ala Met Asn Thr Asp Leu Leu Phe Asp Met Pro Leu Asp Phe Lys Thr Lys Lys His Phe Leu Gly Val Tyr Ala Gly Phe Gly 3$ 195 200 205 Ile Gly Leu Met Leu Tyr Gln Asp Lys Pro Asn Gln Asn Gly Arg Asn Leu Ile Val Gly Gly Tyr Ser Ser Pro Asn Phe Leu Trp Lys Ser Leu Ile Glu Val Asp Tyr Thr Phe Asn Val Gly Val Ser Leu Thr Leu Tyr Arg Lys His Arg Leu Glu Ile Gly Thr Lys Leu Pro Ile Ser Tyr Leu Arg Met Gly Val Glu Glu Gly Ala Ile Tyr His Asn Lys Glu Asn Asp 4$ 275 280 285 Glu Arg Leu Leu Ile Ser Ala Asn Asn Gln Phe Lys Arg Ser Ser Phe Leu Leu Val Asn Tyr Ala Phe Ile Phe $~
(2) INFORMATION FOR SEQ ID N0:106:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 393 amino acids (B) TYPE: amino acid _ (D) TOPOLOGY: linear S
(ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...393 IS (xi) SEQUENCE DESCRIPTION: SEQ ID N0:106:
Met Thr SerAla SerSerHis SerPheLys GluGlnAsp PheHis Ile Pro Ile AlaPhe AlaPheAsp LysAsnTyr LeuIlePro AlaGly Ala Cys Ile TyrSer LeuLeuGlu SerIleAla LysAlaAsn LysLys Ile Arg Tyr ThrLeu HisAlaLeu ValValGly LeuAsnGlu GluAsp Lys 2S Thr Lys LeuAsn GlnIleThr GluProPhe LysGluPhe AlaVal Leu Glu Val LysAsp IleGluPro PheLeuAsp ThrIlePro AsnPro Phe Asp Glu AspPhe ThrLysArg PheSerLys MetValLeu ValLys Tyr loo l05 llo Phe Leu AlaAsp LeuPhePro LysTyrSer LysMetVal TrpSer Asp Val Asp ValIle PheCysAsn GluPheSer AlaAspPhe LeuAsn Ile 3S Lys Glu AspAsp GluAsnTyr PheTyrGly ValTyrAsp LysIle Tyr Pro Tyr GluGly PhePheTyr CysAsnLeu ThrTyrGln ArgLys Asn Gln Phe CysLys LysIleLeu GluIleIle ArgAlaGln LysIle Asp Lys Glu ProGln LeuThrGlu PheCysArg SerLysIle AlaPro Leu Lys Ile GluTyr CysIlePhe ProHisTyr TyrSerLeu SerGlu Glu 4S His Leu LysGly ValAlaAsn AlaIleTyr HisAsnThr IleLys '~ln Ala Leu ArgGlu ProIleVaI IleGlnTyr AspSerHis ProTyr Phe Gln Ile LysPro TrpThrTyr ProPheGly LeuLysAla AspLeu Trp Leu Asn AlaLeu AlaLysThr ProPheMet SerAspTrp SerTyr Leu Ile Thr GlyGly GlyGlyIle GlyG.lyGlu LysTrpHis TyrTyr His Gly Ile Ala Ala Tyr His Tyr Tyr Phe Pro Leu Trp Lys Ala Glu Glu Gln Ile Ala His Asp Ala Leu Lys Thr Phe Leu Lys His Tyr Phe Leu S His Ile His Glu Ile Pro Gln Asn Ala Arg Arg Arg Leu Phe Lys Tyr Cys Ile Ser Ile Pro Leu Lys Ser Phe Ile Ser Lys Thr Leu Lys Phe Leu Lys Leu His Ala Leu Val Lys Lys Ile Leu Ile Gln Leu Lys Leu Leu Lys Lys Asn Gln Ser Gln Asn Phe (2) INFORMATION FOR SEQ ID N0:107:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 435 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
2S (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...435 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:107:
Leu IlePheLeu LysLysSer LeuCysAla LeuLeu IleSerGly Phe 1 s to is Phe IleProPro LeuMetLys AlaAlaSer PheVal TyrAspLeu Lys Phe MetSerPhe AsnPheAsn LeuAlaSer ProPro AsnAsnPro Tyr Trp AsnSerLeu ThrLysMet GlnGlyArg LeuMet ProGlnIle Gly Val GlnLeuAsp LysArgGln AlaLeuMet PheGly AlaTrpPhe Ile Gln AsnLeuHis ThrHisTyr SerTyrPhe ProTyr SerTrpGly Val ~S 85 90 95 Thr MetTyrTyr GlnTyrIle GlyLy:Asn LeuArg PhePheLeu Gly Ile ValProArg SerTyrGln IleGlyHis TyrPro LeuSerAla Phe _ _ S0 Lys LysLeuPhe TrpPheIle AspProThr PheArg GlyGlyAla Phe Gln PheLysPro AlaTyrAsp ProAsnArg TrpTrp AsnGlyTrp Phe Glu GlyValVal AspTrpTyr GlyGlyArg AsnTrp AsnAsnGln Pro Lys Lys LysAsnTyr AspPhe AspGlnPhe LeuTyrPhe ValSerSer Glu Phe GlnPheLeu LysGly TyrLeuGly LeuGlyGly GlnLeuVal $ 195 200 205 Ile Phe HisAsnAla AsnSer HisSerMet GlyAspAsn TyrProTyr Gly Gly AsnSerTyr LeuLys ProGlyAsp AlaThrPro GlnTrpPro 225 230 235 2.40 Asn Gly TyrProTyr PheSer GlnLysAsp AsnProGln GlyGlyGlu Ile Gly LysTyrSer AsnPro ThrIleLeu AspArgVal TyrTyrHis Ala Tyr LeuLysAla AspPhe LysAsnLeu MetProTyr MetAspAsn 1$ 275 280 285 _ -Ile Phe MetThrPhe GlyThr GlnSerSer GlnThrHis TyrCysVal Arg Tyr AlaSerGlu CysLys AsnAlaArg PheTyrAsn SerPheGly Gly Glu PheTyrAla GlnAla GlnTyrLys GlyPheGly IlePheAsn Arg Tyr TyrPheSer AsnLys ProGlnMet HisPheryr AlaThrTyr Gly Gln SerLeuTyr ThrGly LeuProTrp TyrArgAla ProAsnPhe Z$ 355 360 365 Asp Met IleGlyLeu TyrTyr LeuTyrLys AsnLysTrp LeuSerVal Arg Ala AspAlaPhe PheSer PheValGly GlyGlyAsp GlyTyrHis Leu Tyr GlyLysGly GlyLys TrpPheVal MetTyrGln GlnPheLeu Thr Leu ThrIleAsp ThrArg GluLeuIle AspPheVal LysSerLys Ile Pro Lys 3$ 435 (2) INFORMATION FOR SEQ ID N0:108:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 220 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein -- 4$
(iii) _i~ ?OTHETICAL: YES
(vi) ORIGINAL SOURCE: w (A) ORGANISM: Helicobacter pylori $0 (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...220 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:108:
Met AsnLysThr ThrIleLys IleLeu MetGly MetAlaLeu LeuSer Ser LeuGlnAla AlaGluAla GluLeu AspGlu LysSerLys LysPro Lys PheAlaAsp ArgAsnThr PheTyr LeuGly ValGlyTyr GlnLeu Ser AlaIleAsn ThrSerPhe SerThr SerSer IleAspLys SerTyr Phe MetThrGly AsnGlyPhe GlyVal ValLeu GlyGlyLys PheVal 65 70 75 gp Ala LysThrGln AlaValGlu HisVal GlyPhe ArgTyrGly LeuPhe Tyr AspGlnThr PheSerSer HisLys SerTyr IleSerThr TyrGly Leu GluPheSer GlyLeuTrp AspAla PheAsn SerProLys MetPhe Leu GlyLeuGlu PheGlyLeu GlyIle AlaGly AlaThrTyr MetPro Gly GlyAlaMet HisGlyIle IleAla GlnTyr LeuGlyLys GluAsn 145 150 1~5 160 Ser LeuPheGln LeuLeuVal LysVal GlyPhe ArgPheGly PhePhe His AsnGluIle ThrPheGly LeuLys PhePro ValIlePro AsnLys Lys ThrGluIle ValAspGly LeuSer AlaThr ThrLeuTrp GlnArg Leu ProValAla TyrPheAsn TyrIle TyrAsn Phe (2) INFORMATION FOR SEQ ID N0:209:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 116 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...116 - SO (xi) SEQUENCE DESCRIPTION: SEQ ID N0:109:
Leu Asn Leu His Phe Met Lys Gly Phe Val Met Ser Gly Leu Arg Thr Phe Ser Cys Val Val Val Leu Cys Gly Ala Met Val Asn Val Ala Val WO 98/24475 PCTiUS97/22104 Ala Gly Pro Lys Ile Glu Ala Arg Gly Glu Leu Gly Lys Phe Val Gly Gly Ala Val Gly Asn Phe Val Gly Asp Lys Met Gly Gly Phe Val Gly Gly Ala Ile Gly Gly Tyr Ile Gly Ser Glu Val Gly Asp Arg Val Glu Asp Tyr Ile Arg Gly Val Asp Arg Glu Pro Gln Asn Lys Glu Pro Gln Thr Pro Arg Glu Pro Ile Arg Asp Phe Tyr Asp Tyr Gly Tyr Ser Phe Gly His Ala Trp IS (2) INFORMATION FOR SEQ ID NO:110:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 436 amino acids (B) TYPE: amino acid 2~ (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...436 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:110:
3S Me.tSer ArgAspPhe LysPhe AspSerAsn TyrLeu AsnValAsn Thr Asn Pro LysLeuGly ProVal TyrThrAsn GlnAsn TyrProGly Phe Phe Ile PheAspHis LeuArg ArgTyrVal MetAsn AlaPheGlu Pro Asn Leu AsnLeuVal ValAsn ThrAsnLys ValLys GlnThrPhe Asn Val Gly MetArgPhe MetThr MetAspMet PheIle ArgSerAsp Gln 4S Ser Thr CysGluLys ThrAsp IleIleAsn GlyVal CysFisMet Pro Pro Tyr ValLeuSer LysThr ProAsnAsn AsnGln GluMetPhe Asn Asn Tyr ThrAlaVal TrpLeu SerAspLys IleGlu PhePheAsp Ser S~ 115 120 125 Lys Leu ValIleThr ProGly LeuArgTyr ThrPhe LeuAsnTyr Asn Asn Lys GluProGlu LysHis AspPheSer ValTrp ThrSerLys Lys Gln Arg GlnAsn GluTrpSer ProAlaLeu AsnIle GlyTyrLys Pro Met Glu AsnTrp IleTrpTyr AlaAsnTyr ArgArg SerPheIle Pro $ Pro Gln HisThr MetValGly IleThrArg ThrAsn TyrAsnGln Ile Phe Asn GluIle GluValGly GlnArgTyr SerTyr LysAsnLeu Leu Ser Phe AsnThr AsnTyrPhe ValIlePhe AlaLys ArgTyrTyr Ala 1~ 225 230 235 240 Gly Gly TyrSer ProGlnPro ValAspAla ArgSer GlnGlyVal Glu Leu Glu LeuTyr TyrAlaPro IleArgGly LeuGln PheHisVal Ala 1$ Tyr Thr TyrIle AspAlaArg IleThrSer AsnAla AspAsgI1e Ala Tyr Tyr PheThr GlyIleVal AsnLysPro PheAsp IleLysGly Lys Arg Leu ProTyr ValSerPro AsnGlnPhe IlePhe AspMetMet Tyr 2~ 305 310 315 320 Thr Tyr LysHis ThrThrPhe GlyIleSer SerTyr PheTyrSer Arg Ala Tyr SerSer MetLeuAsn GlnAlaLys AspGln ThrValCys Leu 25 Pro Leu AsnPro GluTyrThr GlyGlyLeu LysTyr GlyCysAsn Ser Val Gly LeuLeu ProLeuTyr PheValLeu AsnVal GlnValSer Ser Ile Leu TrpGln SerGlyArg HisLysIle ThrGly SerLeuGln Ile Asn Asn LeuPhe AsnMetLys TyrTyrPhe ArgGly IleGlyThr Ser Pro Thr GlyArg GluProAIa ProGlyArg SerIle ThrAlaTyr Leu 35 Asn Tyr GluPhe (2) INFORMATION FOR SEQ ID NO:111:
4O (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 767 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 4S (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...767 WO 98/24475 PrCT/US97/22104 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:111:
Met LysArgIle LeuVal SerLeu AlaValLeu SerHisSer AlaHis Ala ValLysThr HisAsn LeuGlu ArgValGlu AlaSerGly ValAla Asn AspLysGlu AlaPro LeuSer TrpArgSer LysGluVal ArgAsn Tyr MetGlySer ArgThr ValIle SerAsnLys GlnLeuThr LysSer Ala AsnGlnSer IleGlu GluAla LeuGlnAsn ValProGly ValHis Ile ArgAsnSer ThrGly IleGly AlaValPro SerIleSer IleArg Gly PheGlyAla GlyGly ProGly HisSerAsn ThrGlyMet IleLeu Val AsnGlyIle ProIle TyrVal AlaProTyr ValGluIle GlyThr Val IlePhePro ValThr PheGln SerValAsp ArgIleSer ValThr Lys GlyGlyGlu SerVal AigTyr GlyProAsn AlaPheGly GlyVal Ile AsnIleIle ThrLys GlyIle ProThrAsn TrpGluSer GlnVal Ser GluArgThr ThrPhe TrpGly LysSerGlu AsnGlyGly PhePhe Asn GlnAsnSer LysAsn IleAsp LysSerLeu ValAsnAsn MetLeu Phe AsnThrTyr LeuArg ThrGly GlyMetMet AsnLysHis PheGly Ile GlnAlaGln ValAsn TrpLeu LysGlyGln GlyPheArg TyrAsn Ser ProThrAsp IleGln AsnTyr MetLeuAsp SerLeuTyr GlnIle Asn AspSerAsn LysIle ThrAla PhePheGln TyrTyrSer TyrPhe Leu ThrAspPro GlySer LeuGly IleAlaAla TyrAsnGln AsnArg Phe GlnAsnAsn ArgPro AsnAsn AspLysSer GlyArgAla LysArg Trp GlyAlaVal TyrGln AsnPhe PheGlyAsp ThrAspArg ValGly Gly AspPheThr PheSer TyrTyr GlyHisAsp MetSerArg AspPhe Ll: PheAspSer AsnTyr LeuAsn ValAsnThr AsnProLys LeuGly Pro ValTyrThr AsnGln AsnTyr ProGlyPhe PheIlePhe AspHis 5~ Leu ArgArgTyr ValMet AsnAla PheGluPro AsnLeuAsn LeuVal Val AsnThrAsn LysVal LysGln ThrPheAsn ValGlyMet ArgPhe Met ThrMetAsp MetPhe IleArg SerAspGln SerThrCys GluLys Thr Asp Ile Ile Asn Gly Val ~Cys His Met Pro Pro Tyr Val Leu Ser Lys Thr Pro Asn Asn Asn Gln Glu Met Phe Asn Asn Tyr Thr Ala Val Trp Leu Ser Asp Lys Ile Glu Phe Phe Asp Ser Lys Leu Val Ile Thr Pro Gly Leu Arg Tyr Thr Phe Leu Asn Tyr Asn Asn Lys Glu Pro Glu I~ Lys His Asp Phe Ser Val Trp Thr Ser Lys Lys Gln Arg Gln Asn Glu Trp Ser Pro Ala Leu Asn Ile Gly Tyr Lys Pro Met Glu Asn Trp Ile Trp Tyr Ala Asn Tyr Arg Arg Ser Phe Ile Pro Pro Gln His Thr Met Val Gly Ile Thr Arg Thr Asn Tyr Asn Gln Ile Phe Asn Glu Ile Glu Val Gly Gln Arg Tyr Ser Tyr Lys Asn Leu Leu Ser Phe Asn Thr Asn Tyr Phe Val Ile Phe Ala Lys Arg Tyr Tyr Ala Gly Gly Tyr Ser Pro Gln Pro Val Asp Ala Arg Ser Gln Gly Val Glu Leu Glu Leu Tyr Tyr Ala Pro Ile Arg Gly Leu Gln Phe His Val Ala Tyr Thr Tyr Ile Asp 2$ 595 600 605 Ala Arg Ile Thr Ser Asn Ala Asp Asp Ile Ala Tyr Tyr Phe Thr Gly Ile Val Asn Lys Pro Phe Asp Ile Lys Gly Lys Arg Leu Pro Tyr Val Ser Pro Asn Gln Phe Ile Phe Asp Met Met Tyr Thr Tyr Lys His Thr Thr Phe Gly Ile Ser Ser Tyr Phe Tyr Ser Arg Ala Tyr Ser Ser Met Leu Asn Gln Ala Lys Asp Gln Thr Val Cys Leu Pro Leu Asn Pro Glu Tyr Thr Gly Gly Leu Lys Tyr Gly Cys Asn Ser Val Gly Leu Leu Pro Leu Tyr Phe Val Leu Asn Val Gln Val Ser Ser Ile Leu Trp Gln Ser 4~ Gly Arg His Lys Ile Thr Gly Ser Leu Gln Ile Asn Asn Leu Phe Asn Met Lys Tyr Tyr Phe Arg Gly Ile Gly Thr Ser Pro Thr Gly Arg Glu Pro Ala Pro Gly Arg Ser Ile Thr Ala Tyr Leu Asn Tyr Glu Phe (2) INFORMATION FOR SEQ ID N0:112:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 115 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein -19$-{iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
$ (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...115 (xi)SEQUENCE SEQID
DESCRIPTION: N0:112:

Leu HisProLeu CysAlaHis GlyGlnCys GlySer GluAlaIle Ala 1$ Cys LeuGluAla IleSerVal GlyIleVal ProVal IleAlaAsn Ser Pro LeuSerAla ThrArgGln PheAlaLeu AspGlu ArgSerLeu Phe Glu ProAsnAsn AlaLysAsp LeuSerAla LysIle AspTrpTrp Leu Glu AsnLysLeu GluArgGlu ArgMetGln AsnGlu TyrAlaLys Ser Ala LeuAsF~Tyr ThrLeuGlu AsnSerVal IleGln IleGluLys Val 2$ Tyr GluGluAla IleLysAsp PheLysAsn AsnPro AsnLeuPhe Lys Thr LeuSer -(2) INFORMATION FOR SEQ ID N0:113:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 389 amino acids (B) TYPE: amino acid 3$ (D) TOPOLOGY: linear --(ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
4$ (A) NAME/KEY: misc_feature (B) LOCATION 1...389 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:113:
$0 Met Val Ile Val Leu Val Val Asp Ser Phe Lys Asp Thr Sex Asn Gly Thr Ser Met Thr Ala Phe Arg Phe Phe Glu Ala Leu Lys Lys Arg Gly His Ala Met Arg Val Val Ala Pro His Val Asp Asn Leu Gly Ser Glu Glu Glu Gly Tyr Tyr Asn Leu Lys Glu Arg Tyr Ile Pro Leu Val Thr 50 , 55 60 Glu Ile SerHis LysGlnHis IleLeuPhe AlaLys ProAspGlu Lys 65 70 75 g0 Ile Leu ArgLys AlaPheLys GlyAlaAsp MetIle HisThrTyr Leu Pro Phe LeuLeu GluLysThr AlaValLys IleAla ArgGluMet Arg 1~ Val Pro TyrIle GlySerPhe HisLeuGln ProGlu HisIleSer Tyr Asn Met LysLeu GlyGlnPhe SerTrpLeu AsnThr MetLeuPhe Ser Trp Phe LysSer SerHisTyr ArgTyrIle HisHis IleHisCys Pro Ser Lys PheIle ValGluGlu LeuGluLys TyrAsn TyrGlyGly Lys Lys Tyr AlaIle SerAsnGly PheAspPro MetPhe LysPheGlu His Pro Gln LysSer LeuPheAsp ThrThrPro PheLys IleAlaMet Val Gly Arg TyrSer AsnGruLys AsnGlnSer ValLeu IleLysAla Val Ala Leu SerArg TyrLysGln AspIleVal LeuLeu LeuLysGly Lys Gly Pro AspGlu LysLysIle LysLeuLeu AlaGln LysLeuGly Val Lys Thr GluPhe GlyPheVal AsnSerHis GluLeu LeuGluIle Leu Lys Thr CysThr LeuTyrAla HisThrAla AsnVal GluSerGlu Ala Ile Ala CysLeu GluAlaIle SerValGly IleVal ProValIle Ala Asn Ser ProLeu SerAlaThr ArgGlnPhe AlaLeu AspGluArg Ser Leu Phe GluPro AsnAsnAla LysAspLeu SerAla LysIleAsp Trp Trp Leu GluAsn LysLeuGlu ArgGluArg MetGln AsnGluTyr Ala Lys Ser AlaLeu AsnTyrThr LeuGluAsn SerVa1 IleGlnIle Glu Lys Val TyrGlu GluAlaIle LysAspPhe LysAsn AsnProAsn Leu Phe Lys ThrLeu Ser (2) INFORMATION FOR SEQ ID N0:114:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 312 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
$ (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...312 1~
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:114:
Leu AlaSer TyrGlyPhe PheLeu GlyAlaLeu PheIleLeu AlaSer 1$ Gly IleVal CysLeuGln ThrAla GlyAsnPro PheValThr LeuLeu -Ser LysGly LysGluAla ArgAsn LeuValLeu ValGlnAla PheAsn Ser LeuGly ThrThrLeu GlyPro IlePheGly SerLeuLeu IlePhe Ser AlaThr LysThrSer AspAsn LeuSerLeu IleAspLys LeuAla 65 70 75 gp Asp AlaLys SerValGln MetPro TyrLeuGly LeuAlaVal PheSer 2$ Leu LeuLeu AlaLeuVal MetTyr LeuLeuLys LeuProAsp ValGlu Lys GluMet ProLysGlu ThrThr GlnLysSer LeuPheSer HisLys His PheVal PheGlyAla LeuGly IlePhePhe TyrValGly GlyGlu 3~ 130 135 140 Val AlaIle GlySerPhe LeuVal LeuSerPhe GluLysLeu LeuAsn Leu AspAla GlnSerSer AlaHis TyrLeuVal TyrTyrTrp GlyGly 3$ Ala MetVal GlyArgPhe LeuGly SerAlaLeu MetAsnLys IleAla Pro AsnLys TyrLeuAla PheAsn AlaLeuSer SerIleIle LeuIle Ala LeuAla IleLeuIle GlyGly LysIleAla LeuPheAla LeuThr Phe ValGly PhePheAsn SerIle MetPhePro ThrIlePhe SerLeu Ala ThrLeu AsnLeuGly HisLeu ThrSerLys AlaSerGly ValIle 245. 250 255 4$ Ser MetAla IleValGly GlyAla LeuIlePro ProIleGln GlyVal Val ThrAsp MetLeuThr AlaThr GluSerAsn LeuLeuTyr AlaTyr Ser ValPro LeuLeuCys TyrPhe TyrIleLeu PhePheAla LeuLys $~ 290 295 300 Gly TyrLys GlnGluGlu AsnSer (2) INFORMATION FOR SEQ ID N0:115:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 407 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...407 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:115:
Met Gln Lys Thr Ser Asn Thr Leu Ala Leu Gly Ser Leu Thr Ala Leu Phe Phe Leu Met Gly Phe Ile Thr Val Leu Asn Asp Ile Leu Ile Pro His Leu Lys Pro Ile Phe Asp Leu Thr Tyr Phe Glu Ala Ser Leu Ile Gln Phe Cys Phe Phe Gly Ala Tyr Phe Ile Met Gly Gly Val Phe Gly Asn Val Ile Ser Lys Ile Gly Tyr Pro Phe Gly Val Val Leu Gly Phe Val Ile Thr Ala Ser Gly Cys Ala Leu Phe Tyr Pro Ala Ala His Phe Gly Ser Tyr Gly Phe Phe Leu Gly Ala Leu Phe Ile Leu Ala Ser Gly Ile Val Cys Leu Gln Thr Ala Gly Asn Pro Phe Val Thr Leu Leu Ser Lys Gly Lys Glu Ala Arg Asn Leu Val Leu Val Gln Ala Phe Asn Ser Leu Gly Thr Thr Leu Gly Pro Ile Phe Gly Ser Leu Leu Ile Phe Ser 4~ Ala Thr Lys Thr Ser Asp Asn Leu Ser Leu Ile Asp Lys Leu Ala Asp Ala Lys Ser Val Gln Met Pro Tyr Leu Gly Leu Ala Val Phe Ser Leu Leu Leu Ala Leu Val Met Tyr Leu Leu Lys Leu Pro Asp Val Glu Lys 4$ 195 200 205 Glu Met Pro Lys Glu Thr Thr Gln Lys Ser Leu Phe Ser His Lys _a s Phe Val Phe Gly Ala Leu Gly Ile Phe Phe Tyr Val Gly Gly Glu Val Ala Ile Gly Ser Phe Leu Val Leu Ser Phe Glu Lys Leu Leu Asn Leu Asp Ala Gln Ser Ser Ala His Tyr Leu Val Tyr Tyr Trp Gly Gly Ala Met Val Gly Arg Phe Leu Gly Ser Ala Leu Met Asn Lys Ile Ala Pro 275 280 _ 285 Asn Lys TyrLeuAla PheAsnAla LeuSer SerIleIle LeuIleAla Leu Ala IleLeuIle GlyGlyLys IleAla LeuPheAla LeuThrPhe $ 305 310 315 320 Val Gly PhePheAsn SerIleMet PhePro ThrIlePhe SerLeuAla Thr Leu AsnLeuGly HisLeuThr SerLys AlaSerGly ValIleSer Met Ala IleValGly GlyAlaLeu IlePro ProIleGln GlyValVal 355 _360 365 Thr Asp MetLeuThr AlaThrGlu SerAsn LeuLeuTyr AlaTyrSer Val Pro LeuLeuCys TyrPheTyr IleLeu PhePheAla LeuLysGly Tyr Lys GlnGluGlu AsnSer (2) INFORMATION FOR SEQ ID N0:116:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 125 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 2$
(ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
3O (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature 3$ (B) LOCATION 1...125 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:116:
Met Asn Lys Ile Ala Pro Asn Lys Tyr Leu Ala Phe Gly Ala Leu Ser 40 1 s to is Ser Ile IleLeu IleAlaLeu AlaIleLeu IleGly GlyLysIleAla Leu Phe AlaLeu ThrPheVal GlyPhePhe AsnSer IleMetPhePro 4$ Thr Ile PheSer LeuAlaThr LeuAsnLFU GlyIle SerLeuLeuMet Ala Ser GlyVal IleSerMet AlaIleVal GlyGly AlaLeuIlePro Pro Ile GlnGly ValValThr AspMetLeu ThrAla ThrGluSerAsn $~ 85 90 95 Leu Leu TyrAla TyrSerVal ProLeuLeu CysTyr PheTyrIleLeu Phe Phe AlaLeu LysGlyTyr LysGlnGlu GluAsn Ser (2) INFORMATION FOR SEQ ID N0:117:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 330 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...330 2O (xi) SEQUENCE DESCRIPTION: SEQ ID N0:117:
Leu Lys Lys Ile Leu Pro Ala Leu Leu Met Gly Phe Val Gly Leu Asn Ala Ser Asp Arg Leu Leu Glu Ile Met Arg Leu Tyr Gln Lys Gln Gly Leu Glu Val Val Gly Gln Lys Leu Asp Ser Tyr Leu Ala Asp Lys Ser Phe Trp Ala Glu Glu Leu Gln Asn Lys Asp Thr Asp Phe Gly Tyr Tyr 30 Gln Asn Lys Gln Phe Leu Phe Val Ala Asp Lys Ser Lys Pro Ser Leu Glu Phe Tyr Glu Ile Glu Asn Asn Met Leu Lys Lys Ile Asn Ser Ser Lys Ala Leu Val Gly Ser Lys Lys Gly Asp Lys Thr Leu Glu Gly Asp 35 loo l05 llo Leu Ala Thr Pro Ile Gly Val Tyr Arg Ile Thr Gln Lys Leu Glu Arg Leu Asp Gln Tyr Tyr Gly Val Leu Ala Phe Val Thr Asn Tyr Pro Asn Leu Tyr Asp Thr Leu Lys Lys Arg Thr Gly His Gly Ile Trp Val His Gly Met Pro Leu Asn Gly Asp Arg Asn Glu Leu Asn Thr Lys Gly Cys Ile Ala Ile Glu Asn Pro Ile Leu Ser Ser Tyr Asp Lys Val Leu Lys 4$ 1~t0 185 190 Gly Glu Lye Ila Phe Leu Ile Thr Tyr Glu Asp Lys Phe Ser Pro Ser Thr Lys Glu Glu Leu Ser Met Ile Leu Ser Ser Leu Phe Gln Trp Lys 5Q Glu Ala Trp Ala Arg Gly Asp Phe Glu Arg Tyr Met Arg Phe Tyr Asn Pro Asn Phe Thr Arg Tyr Asp Gly Met Ser Phe Asn Ala Phe Lys Glu Tyr Lys Lys Arg Val Phe Ala Lys Asn Glu Lys Lys Asn Ile Ala Phe Ser Ser Ile Asn Val Ile Pro Tyr Pro Asn Ser Gln Asn Lys Arg Leu Phe Tyr Val Val Phe Asp Gln Asp Tyr Lys Ala Tyr Gln Gln Asn Lys Leu Ser Tyr Ser Ser Asn Ser Gln Lys Glu Leu Tyr Val Glu Ile Glu Asn Asn Gln Ala Ser Ile Ile Met Glu Lys (2) INFORMATION FOR SEQ ID N0:118:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 169 amino acids 1S (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 2S (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...169 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:118:
Leu Phe Glu Lys Trp Ile Gly Leu Thr Leu Leu Leu Ser Ser Leu Gly Tyr Pro CysGlnLys ValSer IleSerPhe LysGlnTyr GluAsnLeu 3S Ile His IleHisGln LysGly CysAsnAsn GluValVal CysArgThr Leu Ile SerIleAla LeuLeu GluSerSer LeuGlyLeu AsnAsnLys Arg Glu LysSerLeu LysAsp ThrSerTyr SerMetPhe HisIleThr Leu Asn ThrAlaLys LysPhe TyrProThr TyrSerLys ThrLeuLeu Lys Thr LysLeuLeu AsnAsp ValGlyPhe AlaIleGln LeuAlaLys --~S Gln Ile LeuLysGlu AsnPhe AspTyrTyr HisGlnLys HisProAsn Lys Ser ValTyrGln LeuVal GlnMetAla IleGlyAla.TyrAsnGly Gly Met LysHisAsn ProAsn GlyAlaTyr MetLysLys PheArgCys _ 145 150 155 160 Ile Tyr SerGlnVal ArgTyr AsnGlu (2) INFORMATION FOR SEQ ID N0:119:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 215 amino acids (B) TYPE: amino acid $ (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE: _ (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
1$ (A) NAME/KEY: misc_feature (B) LOCATION 1...215 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:119:
Met Lys LysPro TyrArgLys IleSerAsp TyrAla IleValGly Gly Leu Ser AlaLeu ValMetVal SerIleVal GlyCys LysSeiAsn Ala Asp Asp LysPro LysGluGln SerSerLeu SerGln SerValGln Lys 2$ 35 40 45 Gly Ala PheVal IleLeuGlu GluGlnLys AspLys SerTyrLys Val Val Glu GluTyr ProSerSer ArgThrHis IleVal ValArgAsp Leu Gln Gly AsnGlu ArgValLeu SerAsnGlu GluIle GlnLysLeu Ile Lys Glu GluGlu AlaLysIle AspAsnGly ThrSer LysLeuVal Gln Pro Asn AsnGly GlySerAsn GluGlySer GlyPhe GlyLeuGly Ser 3$ 115 120 125 Ala Ile LeuGly SerAlaAla GlyAlaIle LeuGly SerTyrIle Gly Asn Lys LeuPhe AsnAsnPro AsnTyrGln GlnAsn AlaGlnArg Thr Tyr Lys SerPro GlnAlaTyr GlnArgSer GlnAsn SerPheSer Lys Ser Ala ProSer AlaSerSer MetGlyThr AlaSer LysGlyGln Ser Gly Phe PheGly SerSerArg ProThrSer SerPro AlaIleSer Ser 4$ 195 200 205 Gly Thr ArgGly PheAsnAla (2) INFORMATION FOR SEQ ID N0:120:
$0 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 253 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear WO 98/24475 PCT/US97l22104 (ii) MOLECULE TYPE: protein S
(iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...253 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:120:
IS Leu Lys Thr Leu Phe Ser Val Tyr Leu Phe Leu Ser Leu Asn_ Pro Leu Phe LeuGluAla LysGlu IleThrTrp SerGlnPhe LeuGluAsn Phe Lys AsnLysAsn GluAsp AspLysPro LysProLeu ThrIleAsp Lys Asn AsnGluLys GlnGln IleLeuAsp LysAsnGln GlnIleLeu Lys Arg AlaLeuGlu LysSer LeuLysPhe PhePheIle PheGlyTyr Asn 2$ Tyr SerGlnAla AlaTyr SerThrThr AsnGlnAsn LeuThrLeu Thr Ala AsnSerIle GlyPhe AsnThrAla ThrGlyLeu GluHisPhe Leu Arg AsnHisPro LysVal GlyPheArg IlePheSer ValTyrAsn Tyr Phe HisSerVal SerLeu SerGlnPro GlnIleLeu MetValGln Asn Tyr GlyGlyAla LeuAsp PheSerTrp IlePheVal AspLysLys Thr 3S Tyr ArgPheArg SerTyr LeuGlyIle AlaLeuGlu GlnGlyVal Leu Leu ValAspThr IleLys ThrGlySer PheThrThr IleIlePro Arg Thr LysLysThr PhePhe GlnAlaPro LeuArgPhe GlyPheIle Val Asp PheIleGly TyrLeu SerLeuGln LeuGlyIle GluMetPro Leu Val ArgAsnVal PheTyr ThrTyrAsn AsnHisGln GluArgPhe Lys - 4S Pro ArgPheAsn AlaAsn LeuSe'-Leu IleValSer Phe (2) INFORMATION FOR SEQ ID N0:121:
SO (i} SEQUENCE CHARACTERISTICS:
(A) LENGTH: 336 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
S (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...336 (xi)--SEQUENCE DESCRIPTION. SEQ ID N0:121:
Leu Phe Phe Lys Phe Ile Leu Cys Leu Ser Leu Gly Ile Phe Ala Trp IS 1 5 to is Ala Lys Glu Val Ile Pro Thr Pro Ser Thr Pro Leu Thr Pro Ser Lys Arg Tyr Ser Ile Asn Leu Met Thr Glu Asn Asp Gly Tyr Ile Asn Pro 20 Tyr Ile Asp Glu Tyr Tyr Thr Ala Gly Asn Gln Ile Gly Phe Ser Thr Lys Glu Phe Asp Phe Ser Lys Asn Lys Ala Met Lys Trp Ser Ser Tyr Leu Gly Phe Phe Asn Lys Ser Pro Arg Val Thr Arg Phe Gly Ile Ser Leu Ala Gln Asp Met Tyr Thr Pro Ser Leu Ala Asn Arg Lys Leu Val His Leu His Asp Asn His Pro Tyr Gly Gly Tyr Leu Arg Val Asn Leu 30 Asn Val Tyr Asn Arg His Gln Thr Phe Met Glu Leu Phe Thr Ile Ser Leu Gly Thr Thr Gly Gln Asp Ser Leu Ala Ala Gln Thr Gln Arg Leu Ile His Lys Trp Gly His Asp Pro Gln Phe Tyr Gly Trp Asn Thr Gln Leu Lys Asn Glu Phe Ile Phe Glu Leu His Tyr Gln Leu Leu Lys Lys Val Pro Leu Leu Lys Thr Arg Phe Phe Ser Met Glu Leu Met Pro Gly 40 Phe Asn Val Glu Leu Gly Asn Ala Arg Asp Tyr Phe Gln Leu Gly Ser Leu Phe Arg Ala Gly Tyr Asn Leu Asp Ala Asp Tyr Gly Val Asn Lys Val Asn Thr Ala Phe Asp Gly Gly Met Pro Tyr Ser Asp Lys Phe Ser Ile :~r Phe Phe Ala Gly Ala Phe Gly Arg Phe Gln Pro Leu Asn Ile Phe Ile Gln Gly Asn Ser Pro Glu Thr Arg Gly Ile Ala Asn Leu Glu S0 Tyr Phe Val Tyr Ala Ser Glu Ile Gly Ala Ala Met Met Trp Arg Ser Leu Arg Val Ala Phe Thr Ile Thr Asp Ile Ser Lys Thr Phe Gln Ser Gln Pro Lys His His Gln Ile Gly Thr Leu Glu Leu Asn Phe Ala Phe ...___._r.~._ _T

(2) INFORMATION FOR SEQ ID N0:122:

S (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 108 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii)MOLECULE TYPE: protein (iii)HYPOTHETICAL: YES

(vi)ORIGINAL SOURCE:

IS (A) ORGANISM: Helicobacter pylori (ix)FEATURE:

(A) NAME/ItEY: misc_feature (B) LOCATION 1...108 (xi)SEQUENCE DESCRIPTION: SEQ
ID N0:122:

Met Lys Pro Ile Phe Ser Leu Phe Leu Ile Val Leu Lys Phe Leu Ala 2S His Pro Ile Asn Pro Leu Leu Glu Tyr Phe Pro Ser Tyr Pro Leu Thr Gln Phe Leu Asp Leu Glu Pro His Ile Lys Lys Lys Arg Phe Val Ala Tyr Arg Pro Phe Gln Trp Gly Asn Ile Ile Lys Arg His Thr Ile Asp Leu Glu Glu Arg Gln Ser Asn Gln Asp Ile Phe Arg.Gln Pro Ser Asn Ala Glu Ile Asn Val Ser Ser Gln Leu Arg Gly Ile Ser Thr Phe Ser 3S Ala Ser Ser Arg Ile Val Ile Asp Ala Gln Ser Val (2) INFORMATION
FOR
SEQ
ID
N0:123:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 195 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 4S (ii)MOLECULE TYPE: protein (iii)HYPOTHETICAL: YES

(vi)ORIGINAL SOURCE:

_ 50 (A) ORGANISM: Helicobacter pylori (ix)FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...195 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:123:
Met Ser AsnAsn ProPheLys LysVal GlyMetIle SerSerGln Asn Asn Asn GlyAla LeuAsnGly LeuGly ValGlnVal GlyTyrLys Gln Phe Phe GlyGlu SerLysArg TrpGly LeuArgTyr TyrGlyPhe Phe Asp Tyr AsnHis GlyTyrIle LysSer SerPhePhe AsnSerSer Ser Asp Ile TrpThr TyrGlyGly GlySer AspLeuLeu ValAsnPhe Ile 65 70 75 8p Asn Asp SerIle ThrArgLys AsnAsn LysLeuSer ValGlyLeu Phe Gly Gly IleGln LeuAlaGly ThrThr TrpLeuAsn SerGlnTyr Met Asn Leu ThrAla PheAsnAsn ProTyr SerAlaLys ValAsnAla Ser Asn Phe GlnPhe LeuPheAsn LeuGly LeuArgThr AsnLeuAla Thr Ala Lys LysLys AspSerGlu ArgSer AlaGlnHis GlyValGlu Leu Gly Ile LysIle ProThrIle AsnThr AsnTyrTyr SerPheLeu Gly Thr Lys LeuGlu TyrArgArg LeuTyr SerValTyr LeuAsnTyr Val Phe Ala Tyr (2) INFORMATION FOR SEQ ID N0:124:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 227 amino acids 3S (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 4S (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...227 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:124:

Val Arg Phe Gly Lys Ile Asp Tyr Leu Asn Met Leu Pro Phe Asp Val Phe Ile Lys Ser Tyr Pro Thr Pro Cys Tyr Phe Lys Gln Phe Leu Arg Leu Lys LysThr TyrProSer LysLeu AsnGluSer PheLeuPhe Arg Arg Ile AspAla GlyPheIle SerSer IleAlaGly TyrProPhe Ala $ Leu Cys SerTyr SerLeuGly IleVal AlaTyrLys GluValLeu Ser Val Leu ValVal AsnArgGlu AsnAla PheAspLys GluSerAla Ser Ser Asn AlaLeu SerLysVal LeuGly LeuLysGly GluValLeu Ile Gly Asn LysAla LeuGlnPhe TyrTyr SerAsnPro LysLysAsp Phe Ile Asp LeuAla AlaLeuTrp TyrGlu LysLysArg LeuProPhe Val 1$ Phe Gly ArgLeu CysTyrTyr GlnAsn LysAspPhe TyrLysArg Leu Ser Leu AlaPhe LysHisGln LysThr LysIlePro HisTyrIle Leu Lys Glu AlaAla LeuLysThr AsnLeu LysArgGln AspIleLeu Asn lso las 190 Tyr Leu GlnLys IleTyrTyr ThrLeu GlyLysLys GluGlnSer Gly Leu Lys AlaPhe TyrArgGlu LeuLeu PheLysArg IleGlnLys Pro 2$ Lys Arg Phe (2) INFORMATION FOR SEQ ID N0:125:
3O (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 305 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 3$ (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
40 (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...305 4$
(xi) SEQUENCE DE..~.'.IPTION: SEQ ID N0:125:
Met Gly Arg Ile Glu Ser Lys Lys Arg Leu Lys Ala Leu Ile Phe Leu $0 Ala Ser Leu Gly Val Leu Trp Gly Asn Ala Ala Glu Lys Thr Pro Phe Phe Lys Thr Lys Asn His Ile Tyr Leu Gly Phe Arg Leu Gly Thr Gly Ala Thr Thr Arg Thr Ser Met Trp Gln Gln Ala Tyr Lys Asp Asn Pro Thr Cys Pro Ser Ser Val Cys Tyr Gly Glu Lys Leu Glu Ala His Tyr 65 70 75 8p Lys Gly Gly Lys Asn Leu Ser Tyr Thr Gly Gln Ile Gly Asp Glu Ile Ala Phe Asp Lys Tyr His Ile Leu GIy Leu Arg Val Trp Gly Asp Val Glu Tyr Ala Lys Ala Gln Leu Gly Gln Lys Val Gly Gly Asn Thr Leu Leu Ser Gln Ala Asn Tyr Asn Pro Ser Ala Ile Lys Thr Tyr Asp Pro Thr Ser Asn Ala Gln Gly Ser Leu Val Leu Gln Lys Thr Pro Ser Pro Gln Asp Phe Leu Phe Asn Asn Gly His Phe Met Ala Phe Gly Leu Asn Val Asn Met Phe Val Asn Leu Pro Ile Asp Thr Leu Leu Lys Leu Ala Leu Lys Thr Glu Lys Met Leu Phe Phe Lys Ile Gly Val Phe Gly Gly Gly Gly Val Glu Tyr Ala Ile Leu Trp Ser Pro Gln Tyr Lys Asn Gln Asn Thr His Gln Asp Asp Lys Phe Phe Ala Ala Gly Gly Gly Phe Phe Val Asn Phe Gly Gly Ser Leu Tyr Ile Gly Lys Arg Asn Arg Phe Asn Val Gly Leu Lys Ile Pro Tyr Tyr Ser Leu Ser Ala Gln Ser Trp Lys Asn Phe Gly Ser Ser Asn Val Trp Gln Gln Gln Thr Ile Arg Gln Asn Phe Ser Val Phe Arg Asn Lys Glu Val Phe Val Ser Tyr Ala Phe Leu Phe 3$ (2) INFORMATION FOR SEQ ID N0:126:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 258 amino acids (B} TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
$0 (A) NAME/KEY: misc_feature (B) LOCATION 1...258 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:126:

Met Phe LeuArgSer TyrProLys LeuArgTyr AlaLeu CysLeuPro Leu Leu ThrGluThr CysTyrSer GluGluArg ThrLeu AsnLysVal S Thr Thr GlnAlaLys ArgIlePhe ThrTyrAsn AsnGlu PheLysVal Thr Ser LysGluLeu AspGlnArg GlnSerAsn GluVal LysAspLeu Phe Arg ThrAsnPro AspValAsn ValGlyGly GlySer ValMetGly Gln Lys IleTyrVal ArgGlyIle GluAspArg LeuLeu ArgValThr Val Asp GlyAlaAla GlnAsnGly AsnIleTyr HisHis GlnGlyAsn 1S Thr Val IleAspPro GlyMetLeu LysSerVal G1uVa1 ThrLysGly Ala Ala AsnAlaSer AlaGlyPro GlyAlaIle AlaGly ValIleLys Met Glu ThrLysGly AlaAlaAsp-PheIlePro ArgGly LysAsnTyr Ala Ala SerGlyAla ValSerPhe TyrThrAsn PheGly AspArgGlu Thr Phe ArgSerAla TyrGlnSer AlaHisPhe AspIle IleAlaTyr 2S Tyr Thr HisGlnAsn IlePheTyr TyrArgSer GlyAla ThrValMet Lys Asn LeuPheLys ProThrGln AlaAspLys GluPro GlyThrPro Ser Glu GlnAsnAsn AlaLeuIle LysMetAsn GlyTyr LeuSerAsp Arg Asp ThrLeuThr PheSerTrp AsnMetThr ArgAsp AsnAlaThr Arg Leu (2) INFORMATION FOR SEQ ID N0:127:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 192 amino acids (B) TYPE: amino acid {D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein 4S (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori SO ( ix) FEATURE
(A) NAME/KEY: misc_feature (B) LOCATION 1...192 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:127:

Met Phe Leu Arg Ser Tyr Pro Lys Leu Arg Tyr Ala Leu Cys Leu Pro Leu Leu Thr Glu Thr Cys Tyr Ser Glu Glu Arg Thr Leu Asn Lys Val Thr Thr Gln Ala Lys Arg Ile Phe Thr Tyr Asn Asn Glu Phe Lys Val Thr Ser Lys Glu Leu Asp Gln Arg Gln Ser Asn Glu Val Lys Asp Leu Phe Arg Thr Asn Pro Asp Val Asn Val Gly Gly Gly Ser Val Met Gly Gln Lys Ile Tyr Val Arg Gly Ile Glu Asp Arg Leu Leu Arg Val Thr Val Asp Gly Aia Ala Gln Asn Gly Asn Ile Tyr His His Gln Gly Asn Thr Val Ile Asp Pro Gly Met Leu Lys Ser Val Glu Val Thr Lys Gly Ala Ala Asn Ala Ser Ala Gly Pro Gly Ala Ile Ala Gly Val Ile Lys Met Glu Thr Lys Gly Ala Ala Asp Phe Ile Pro Arg Gly Lys Asn Tyr Ala Ala Ser Gay Ala Val Ser Phe Tyr Thr Asn Phe Gly Asp Arg Glu Thr Phe Arg Ser Ala Tyr Gln Ser Ala His Phe Asp Ile Ile Ala Tyr (2) INFORMATION FOR SEQ ID N0:128:
(i) SEQUENCE CHARACTERISTICS:
3fl (A) LENGTH: 126 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein 3$
(iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...126 4S (xi) SEQUENCE DESCRIPTION: SEQ ID N0:128:
Val Pro Leu Ser Leu Gly Gly Asn Leu Leu Asn Pro Asn Asn Ser Ser Val Leu Asn Leu Lys Asn Ser Gln Leu Val Phe Ser Asp Gln Gly Ser S~ 20 25 30 Leu Asn Ile Ala Asn Ile Asp Leu Leu Ser Asp Leu Asn Gly Asn Lys Asn Arg Val Tyr Asn Ile Ile Gln Ala Asp Met Asn Gly Asn Trp Tyr Glu Arg Ile Asn Phe Phe Gly Met Arg Ile Asn Asp Gly Ile Tyr Asp Ala Lys Asn Gln Thr Tyr Ser Phe Thr Asn Pro Leu Asn Asn Ala Val $ Lys Phe Thr Glu Ser Phe Phe Ile His Arg Leu Cys Gly Ser Leu Ser Gln Ile Gln Lys Lys Lys Asn Thr Ile Val Ser Pro Arg Leu IO (2) INFORMATION FOR SEQ ID N0:129:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 565 amino acids (B) TYPE: amino acid ~$ (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
2$ (A) NAME/KEY: misc_feature (B) LOCATION 1...565 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:129:
Val Tyr SerTyr SerAspAsp AlaGln GlyValPhe TyrLeuThr Ser Ser Val LysGly TyrTyrAsn ProAsn GlnSerTyr GlnAlaSer Gly Ser Asn AsnThr ThrLysAsn AsnAsn LeuThrSer GluSerSer Val 3$ 35 40 45 Ile Ser GlnThr TyrAsnAla GlnGly AsnProIle SerAlaLeu His Val Tyr AsnLys GlyTyrAsn PheSer AsnIleLys AlaLeuGly Gln Met Ala LeuLys LeuTyrPro GluIle LysLysIle LeuGlyAsn Asp Phe Ser LeuSer SerLeuSer AsnLeu LysGlyAsp AlaLeuAsn Gln Leu Thr LysLeu IleThrPro SerAsp TrpLysAsn IleAsnGlu Leu 4$ 115 720 125 Ile Asp AsnAla AsnAsnSEi ValVal GlnAsnPhe AsnAsnGly Thr Leu Ile IleGly AlaThrLys IleGly GlnThrAsp ThrAsnSer Ala $~ Val Val PheGly GlyLeuGly TyrGln LysProCys AspTyrThr Asp Ile Val CysGln LysPheArg GlyThr TyrLeuGly GlnLeuLeu Glu Ser Asn SerAla AspLeuGly TyrIle AspThrThr PheAsnAla Lys Glu Ile Tyr Leu Thr Gly Thr Leu Gly Ser Gly Asn Ala Trp Gly Thr Gly Gly Ser Ala Ser Val Thr Phe Asn Ser Gln Thr Ser Leu Ile Leu $ 225 230 235 240 Asn Gln Ala Asn Ile Val Ser Ser Gln Thr Asp Gly Ile Phe Ser Met Leu Gly Gln Glu Gly Ile Asn Lys Val Phe Asn Gln Ala Gly Leu Ala 1~ Asn Ile Leu Gly Glu Val Ala Met Gln Ser Ile Asn Lys Ala Gly Gly Leu Gly Asn Leu Ile Val Asn Thr Leu Gly Ser Asp Ser Val Ile Gly Gly Tyr Leu Thr Pro Glu Gln Lys Asn Gln Thr Leu Ser Gln Leu Leu 1$ 305 310 315 320 Gly Gln Asn Asn Phe Asp Asn Leu Met Asn Asp Ser Gly Leu Asn Thr Ala Ile Lys Asp Leu Ile Arg Gln Lys Leu Gly Phe Trp Thr Gly Leu Val Gly Gly Leu Ala Gly Leu Gly Gly Ile Asp Leu Gln Asn Pro Glu Lys Leu Ile Gly Ser Met Ser Ile Asn Asp Leu Leu Ser Lys Lys Gly Leu Phe Asn Gln Ile Thr Gly Phe Ile Ser Ala Asn Asp Ile Gly Gln 2$ 385 390 395 400 Val Ile Ser Val Met Leu Gln Asp Ile Val Lys Pro Ser Asp Ala Leu Lys Asn Asp Val Ala Ala Leu Gly Lys Gln Met Ile Gly Glu Phe Leu Gly Gln Asp Thr Leu Asn Ser Leu Glu Ser Leu Leu Gln Asn Gln Gln Ile Lys Ser Val Leu Asp Lys Val Leu Ala Ala Lys Gly Leu Gly Ser Ile Tyr Glu Gln Gly Leu Gly Asp Leu Ile Pro Asn Leu Gly Lys Lys 3$ 465 470 475 480 Gly Ile Phe Ala Pro Tyr Gly Leu Ser Gln Val Trp Gln Lys Gly Asp Phe Ser Phe Asn Ala Gln Gly Asn Val Phe Val Gln Asn Ser Thr Phe Ser Asn Ala Asn Gly Gly Thr Leu Ser Phe Asn Ala Gly Asn Ser Leu Ile Phe Ala Gly Asn Asn His Ile Ala Phe Thr Asn His Ser Gly Thr Leu Asn Leu Leu Ser Asn Gln Val Ser Asn Ile Asn Val Thr Met Leu ~$ 545 550 555 560 A~_~ Ala Ala Thr Ala (2) INFORMATION FOR SEQ ID N0:130:
$~ _ (i} SEQUENCE CHARACTERISTICS:
(A) LENGTH: 172 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein $
(iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...172 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:130:
1$ Val Phe GlyLeuSer LeuAla AspMetIle LeuGluArg PheLysAsp Phe Met ArgGluTyr ProGlu ProTyrLys PheLeuGln ValPheTyr Ala Gln GluLysGlu ArgPhe LeuAsnHis LysMetAsn AspTyrIle Lys Gln AsnLysSer LysGlu GluAlaSer IleLeuAla ArgGlnGly Phe Val SerValIle GlyArg AlaLeuGlu LysIleIle GluLeuLeu 65 70 75 g0 2$ Leu Lys AspPheCys IleLys AsnAsnVal LysMetThr AsnAspLys Thr Leu ArgAlaLys ArgIle AsnGlyGlu LeuAspLys ValLysArg Ala Leu LeuValHis PheGly GlyTyrSer ValLeuPro AspIleIle Leu Tyr GlnThrAsn LysAsp AsnIleLys IleLeuAla IleLeuSer Val Lys AsnSerPhe ArgGlu ArgPheThr LysAspAla LeuLeuGlu 3$ Ile Lys ThrPheAla IleAla CysAsnPhe SerHis (2) INFORMATION FOR SEQ ID N0:131:
4O (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 331 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 4$ (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
- $~ (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...331 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:131:' Met Lys Arg Phe Val Leu Phe Leu Leu Phe Ile Cys Val Cys Val Cys $ 1 5 10 15 Val Gln Ala Tyr Ala Glu Gln Asp Tyr Phe Phe Arg Asp Phe Lys Ser Ile Asp Leu Pro Gln Lys Leu His Leu Asp Lys Lys Leu Ser Gln Thr Ile Gln Pro Cys Ala Gln Leu Asn Ala Ser Lys His Tyr Thr Ala Thr 50 55 _ 60 Gly Val Arg Glu Pro Asp Ala Cys Thr Lys Ser Phe Lys Lys Ser Ala 65 70 75 g0 Met Val Ser Tyr Asp Leu Ala Leu Gly Tyr Leu Val Ser Gln Asn Lys 1$ 85 90 95 Pro Tyr Gly Leu Lys Ala Ile Glu Ile Leu Asn Ala Trp Ala Asn Glu Leu Gln Ser Val Asp Thr Tyr Gln Ser Glu Asp Asn Ile Asn Phe Tyr Met Pro Tyr Met Asn Met Ala Tyr Trp Phe Val Lys Lys Glu Phe Pro Ser Pro Glu Tyr Glu Asp Phe Ile Arg Arg Met Arg Gln 'fyr Ser Gln Ser Ala Leu Asn Thr Asn His Gly Ala Trp Gly Ile Leu Phe Asp Val 2$ 165 170 175 Ser Ser Ala Leu Ala Leu Asp Asp His Ala Leu Leu Gln Ser Ser Ala Asn Arg Trp Gln Glu Trp Val Phe Lys Ala Ile Asp Glu Asn Gly Val Ile Ala Ser Ala Il.e Thr Arg Ser Asp Thr Ser Asp Tyr His Gly Gly Pro Thr Lys Gly Ile Lys Gly Ile Ala Tyr Thr Asn Phe Ala Leu Leu Ala Ile Thr Ile Ser Gly Glu Leu Leu Phe Glu Asn Gly Tyr Asp Leu 3$ 245 250 255 Trp Gly Ser Gly Ala Gly Gln Arg Leu Ser Val Ala Tyr Asn Lys Ala Ala Thr Trp Ile Leu Asn Pro Glu Thr Phe Pro Tyr Phe Gln Pro Asn Leu Ile Gly Val His Asn Asn Ala Tyr Phe Ile Ile Leu Ala Lys His Tyr Ser Ser Pro Ser Ala Asp Glu Leu Leu Glu Gln Gly Asp Leu His Glu Asp GIy Phe Arg Leu Lys Leu Arg Ser Pro 4$ 325 330 (2) INFORMATION FOR SEQ ID N0:132:
(i) SEQUENCE CHARACTERISTICS:
$~ (A) LENGTH: 128 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
$ (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...128 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:132:
Mec Arg GlnTyrSer GlnSer AlaLeuAsn ThrAsn HisGlyAla Trp 1$ Gly Ile LeuPheAsp ValSer SerAlaLeu AlaLeu AspAsp_His_Ala Leu Leu GlnSerSer AlaAsn ArgTrpGln GluTrp ValPheLys Ala Ile Asp GluAsnGly ValIle AlaSerAla IleThr ArgSerAsp Thr Ser Asp TyrHisGly GlyPro ThrLysGly IleLys GlyIleAla Tyr 65 70 75 g0 Thr Asn PheAlaLeu LeuAla IleThrIle SerGly GluLeuLeu Phe 2$ Glu Asn GlyTyrAsp LeuTrp GlySerGly AlaGly GlnArgLeu Ser Val Ala TyrAsnLys AlaAla ThrTrpIle LeuAsn ProGluThr Phe (2) INFORMATION FOR SEQ ID N0:133:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 245 amino acids (B) TYPE: amino acid 3$ (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori - (ix) FEATURE:
__ 4$ (A) NAME/KE't: misc_feature (B) LOCA_I~N 1...245 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:133: _ $0 Leu Arg Thr Leu Leu Lys Met Leu Val Gly Val Ser Leu Leu Thr His Ala Leu Met Ala Thr Glu Glu Ser Ala Ala Pro Ser Trp Thr Lys Asn Leu Tyr Met Gly Phe Asn Tyr Gln Thr Gly Ser Ile Asn Leu Met Thr Asn Ile His Glu Val Arg Glu Val Thr Ser Tyr Gln Thr Gly Tyr Thr Asn Val MetThrSer IleAsn SerValLys LysLeuThr AsnMetGly $ 65 70 75 g0 Ser Asn GlyIleGly LeuVal MetGlyTyr AsnHisPhe PheHisPro Asp Lys ValLeuGly LeuArg TyrPheAla PheLeuAsp TrpGlnGly I~ Tyr Gly MetArgTyr ProLys GlyTyrTyr GlyGlyAsn AsnMetIle Thr Tyr GlyValGly ValAsp AlaIleTrp AsnPhePhe GlnGlySer Phe Tyr GlnAspAsp IleGly ValAspIle GlyValPhe GlyGlyIle Ala Ile AlaGlyAsn SerTrp TyrIleGly AsnLysGly GlnGluLeu Leu Gly IleThrAsn SerSer AlaValAsp AsnThrSer PheGlnPhe Leu Phe AsnPheGly PheLys AlaLeuPhe ValAspGlu HisGluPhe Glu Ile GlyPheLys PhePro ThrLeuAsn AsnLysTyr TyrThrThr Asp Ala LeuLysVal GlnMet ArgArgVal PheAlaPhe TyrValGly Tyr Asn TyrHisPhe (2} INFORMATION FOR SEQ ID N0:134:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 290 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
4O (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature 4' (B) LOCATION 1...290 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:134:
Met Phe Glu Glu Ile Thr Leu Ala His Lys Asp Leu Phe Ser Arg Phe - 50 1 s l0 15 Leu Gln Thr Gln Lys Ile Val Leu Ser Asp Val Ser Phe Thr Asn Cys Phe Leu Trp Gln His Ala Arg Leu Ile Gln Val Ala Val Ile Arg Asp WO 98124475 PCT/iTS97/22104 Cys Leu ValIle GlnThrThr TyrGluAsn GlnLys ProPheTyr Phe Tyr Pro IleGly LysArgPro HisGluCys ValLys GluLeuLeu Glu S Leu Glu LysAsn LeuArgPhe HisSerLeu ThrLeu GluGlnLys Asp 85 ~~ 90 95 Asp Leu LysAsp AsnPheVal GlyValPhe AspPhe ThrTyrAsn Arg Asp Arg SerAsp TyrValTyr SerIleGlu GluLeu IleAlaLeu Lys Gly Lys LysTyr HisLysLys LysAsnHis LeuAsn GlnPheLeu Thr Asn His AlaAsn PheValTyr GluLysIle SerPro GlnAsnArg Lys 1$ Glu Val LeuGlu AlaSerLys AlaTrpPhe LeuGlu SerGlnThr Asp Asp Ile GlyLeu IleAsnGlu AsnLysGly IleGln SerValLeu Glu Asn Tyr GluSer LeuAspLeu LysGlyGly LeuIle ArgValAsn Gly Glu Ile ValSer PheSerPhe GlyGluVal LeuAsn GluGluSer Ala Leu Ile HisIle GluLysAla ArgThrAsp IleAla GlyAlaTyr Gln 2S Ile Ile AsnGln GlnLeuLeu LeuAsnGlu PheSer HisLeuThr Tyr Ala Asn ArgGlu GluAspLeu GlyLeuGlu GlyLeu ArgArgSer Lys Met Ser TyrAsn ProValPhe LeuIleAsp LysTyr GluAlaVal Ala Arg Asn (2) INFORMATION FOR SEQ ID N0:135:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 110 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
4S (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature SO (B) LOCATION 1...110 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:135:
Met Met Phe Ile Val Ala Val Leu Met Leu Ala Phe Leu Ile Phe Val His Glu Leu Gly His Phe Ile Ile Ala Arg Ile Cys Gly Val Lys Val Glu Val Phe Ser Ile Gly Phe Gly Lys Lys Leu Trp Phe Phe Lys Leu $ 35 40 45 Phe Gly Thr Gln Phe Ala Leu Ser Leu Ile Pro Leu Gly Gly Tyr Val Lys Leu Lys Gly Met Asp Lys Glu Glu Asn Glu Glu Asn Lys Ile Asn Gln Ala Asn Asp Ser Tyr Ala Lys Lys Ala Leu Ser Lys Ser Tyr Gly Tyr Cys Leu Val Gly Arg Phe Leu Ile Phe Phe Leu Arg Phe IS (2) INFORMATION FOR SEQ ID N0:136:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 351 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein 2$
(iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...351 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:136:
3$ Met MetPheIle ValAlaVal LeuMet LeuAlaPhe LeuIlePhe Val His GluLeuGly HisPheIle IleAla ArgIleCys GlyValLys Val Glu ValPheSer IleGlyPhe GlyLys LysLeuTrp PhePheLys Leu Phe GlyThrGln PheAlaLeu SerLeu IleProLeu GlyGlyTyr Val 50 _ 55 60 Lys LeuLysGly MetAspLys GluGlu AsnGluGlu AsnLysIle Asn -- 4$ Gln AlaAsnAsp SerTyrAla GlnLys Se'.ProPhe GlnLysLeu Trp 85 j 95 Ile LeuPheGly GlyAlaPhe PheAsn PheLeuPhe AlaValLeu Val Tyr PhePheLeu AlaLeuSer GlyGlu LysValLeu LeuProVal Ile $~ 115 120 125 Gly GlyLeuGlu LysAsnAla LeuGlu AlaGlyLeu LeuLysGly Asp Arg IleLeuSer IleAsnHis GlnLys IleAlaSer PheArgGlu Ile Arg Glu IleVal AlaArg SerGlnGly GluLeuIle LeuGluIle Glu Arg Asn AsnGln IleLeu GluLysArg LeuThrPro LysIleVal Ala $ Val Ile SerGlu SerAsn AspProAsn GluIleIle LysTyrLys Ile Ile Gly IleLys ProAsp MetGlnLys MetGlyVal ValSerTyr Ser Val Phe GlnAla PheGlu LysAlaLeu SerArgPhe LysGluGly Val Val Leu IleVal AspSer LeuArgArg LeuIleMet GlySerAla Ser Val Lys GluLeu SerGly ValIleGly IleValGly AlaLeuSer His 1$ Ala Asn SerVal SerMet LeuLeuLeu PheGlyAla PheLeuSer Ile Asn Leu GlyIle LeuAsn LeuLeuPro IleProAla LeuAspGiy Ala Gln Met LeuGly ValVal PheLysAsn IlePheHis IleAlaLeu Pro 2~ 305 310 315 320 Thr Pro IleGln AsnAla LeuTrpLeu ValGlyVal GlyPheLeu Val Phe Val MetPhe LeuGly LeuPheAsn AspIleThr ArgLeuLeu 2$

(2) INFORMATION FOR 5EQ ID N0:137:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 100 amino acids 30 (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein 3S (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 4O (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...100 (xi) SEQUENCE_ DESCRIPTION: SEQ ID N0:137:
Met Gln Ly:. 7.sn Leu Asp Ser Leu Leu Glu Asn Leu Arg Ala Glu Ile Asp Ala Leu Asp Asn Glu Leu Ser Asp Leu Leu Asp Lys Arg Leu Gly $~ Ile Ala Leu Lys Ile Ala Leu Ile Lys Gln Glu Ser Pro Gln Glu Asn Pro Ile Tyr Cys Pro Lys Arg Glu Gln Glu Ile Leu Lys Arg Leu Ser Gln Arg Gly Phe Lys His Leu Asn Gly Glu Ile Leu Ala Ser Phe Tyr 65 70 75 gp Ala Glu Val Phe Lys Ile Ser Arg Asn Phe Gln Glu Asn Ala Leu Lys Glu Leu Lys Lys (2) INFORMATION FOR SEQ ID N0:138:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH. 174 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...174 2S (xi) SEQUENCE DESCRIPTION: SEQ ID N0:138:
Val LysMet ArgPhePhe SerGly PheGlyPhe ValAsn GluSerVal Leu PheGlu GluTrpLeu LeuLys GlyAlaTyr AspVal SerGlyPhe Ser MetGly AlaIleLys AlaIle GluTyrAla TyrAsn GluValLeu Gln GlnArg ArgIleHis SerLeu LeuLeuPhe Ser:ProCysMetLeu 3S Ala HisLys SerLeuAla PheLys ArgLeuGln LeuPhe LeuPheGln 65 70 75 gp Lys AspPro GlnSerTyr MetAsp AsnPheTyr LysGlu ValGlyLeu Asp AlaGln LeuGluArg PheLys LysGluGly SerLeu GluGluLeu loo l05 llo Glu PheLeu LeuAspTyr LysTyr SerAspSer IleIle ArgPheLeu Leu GluLys GlyValLys IleGlu ValPheIle GlyLeu LysAspArg 4S Ile ThrAsp IleGlnAla LeuLeu GluPhePhe MetPro LeuValGln Val TrpGln PheLysAsp CysAsn HisLeuLeu GlnLys Ser S0 (2) INFORMATION FOR SEQ ID N0:139:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 471 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein S (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori IO (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...471 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:139:
Met LysAsnThr AsnThr LysGluIle LysAsnThr ArgMet LysLys Gly TyrSerGln TyrHis ThrLeuLys LysGlyLeu LeuLys ThrAla 2O Leu LeuPheSer LeuPro LeuSerVal AlaLeuAla GluAsp AspGly Phe TyrMetGly ValGly TyrGlnIle GlyGlyAla GlnGln AsnIle Asn AsnLysGly SerThr LeuArgAsn AsnValIle AspAsp PheArg Gln ValGlyVal GlyMet AlaGlyGly AsnGlyLeu LeuAla LeuAla Thr AsnThrThr MetAsp AlaLeuLeu GlyIleGly AsnGln IleVal 3O Asn ThrAsnThr ThrVal GlyAsnAsn AsnAlaGlu LeuThr GlnPhe Lys LysIleLeu ProGln IleGluGln ArgPheGlu ThrAsn LysAsn Ala TyrSerVal GlnAla LeuGlnVal TyrLeuSer AsnVal LeuTyr 3$ 145 150 155 160 Asn LeuValAsn AsnSer AsnAsnGly SerAsnAsn GlyVal ValPro Glu TyrValGly IleIle LysValLeu TyrGlySer GInAsn GluPhe 4O Ser LeuLeuAla ThrGlu SerValAla LeuLeuAsn AlaLeu ThrArg Val AsnLeuAsp SerAsn SerValPhe LeuLysGly LeuLeu AlaGln Met GlnLeuPhe AsnAsp ThrSerSer AlaLysLeu GlyGln IleAla Glu AsnLeuLys AsnGly GlyAlaGly AlaMetLeu Gln.~y~AspVal Lys ThrIleSer AspArg IleAlaThr TyrGlnGlu AsnLeu LysGln _ SO Leu GlyGIyMet LeuLys AsnTyrAsp GluProTyr LeuPro GlnPhe Gly ProGlyThr SerSer GlnHisGly ValIleAsn GlyPhe GlyIle Gln ValGlyTyr LysGln PhePheGly SerLysLys AsnIle GlyLeu Arg TyrTyrAla PhePhe AspTyrGly PheThrGln LeuGly SerLeu Asn SerAlaVal LysAla AsnIlePhe ThrTyrGly AlaGly ThrAsp $ 340 345 350 Phe LeuTrpAsn IlePhe ArgArgVal PheSerAsp GlnSer LeuAsn Val GlyValPhe GlyGly IleGlnIle AlaGlyAsn ThrTrp AspSer 1~ Ser LeuArgGly GlnIle GluAsnSer PheLysGlu TyrPro ThrPro Thr AsnPheGln PheLeu PheAsnLeu GlyLeuArg AlaHis PheAla Ser ThrMetHis ArgArg PheLeuSer AlaSerGln SerIle GInHis 1$ 420 425 430 Gly MetGluPhe GlyVal LysIlePro AlaIleAsn GlnArg TyrLeu Lys AlaAsnGly AlaAsp ValAspTyr ArgArgLeu TyrAla PheTyr 2~ Ile AsnTyrThr IleGly Phe (2) INFORMATION FOR SEQ ID N0:140:
2S (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 129 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 30 (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
3$ (A) ORGANISM: Helicobacter pylori _( i x ) FEATURE
(A) NAME/KEY: misc_feature (B) LOCATION 1...129 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:140:
Met Lys Ser Ile Arg Arg Gly Asp Gly Leu Asn Val Val Pro Phe Ile 4$ Asp Ile Met Leu Val Leu Leu Al~ Ile Val Leu Ser Ile Ser Thr Phe Ile Ala Gln Gly Lys Ile Lys Val Ser Leu Pro Asn Ala Lys Asn Ala Glu Lys Ser Gln Pro Asn Asp Gln Lys Val Val Val Ile Ser Val Asp $0 50 55 60 Glu His Asp Asn Ile Phe Val Asp Asp Lys Pro Thr Asn Leu Glu Ala Leu Ser Ala Val Val Lys Gln Thr Asp Pro Lys Thr Leu Ile Asp Leu .____.._.._ _ .. ........

Lys Ser Asp Lys Ser Ser Arg Phe Glu Thr Phe I1~ Ser Ile Met Asp Ile Leu Lys Glu His Asn His Glu Asn Phe Ser Ile Ser Thr Gln Ala $ Gln (2) INFORMATION
FOR
SEQ
ID
N0:141:

IO (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 75 amir~o acids (B) TYPE: amino acid (D) TOPOLOGY: linear IS (ii)MOLECULE TYPE: protein (iii)HYPOTHETICAL: YES

{vi)ORIGINAL SOURCE:

20 (A) ORGANISM: Helicobacter pylori (ix;FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...75 (xi)SEQUENCE DESCRIPTION: SEQ
ID N0:141:

Met Leu Val Leu Leu Ala Ile Val IleSer Thr Phe Ile Leu Ser Ala 30 Gln Gly Lys Ile Lys Val Ser Leu AlaLys Asn Ala Glu Pro Asn Lys Ser Arg Pro Asn Asp Gln Lys Val IleSer Val Asp Glu Val Val His Asp Asn Ile Phe Val Asp Asp Lys AsnLeu Glu Ala Leu Pro Thr Ser Ala Val Val Lys Gln Thr Asp Pro Leu Lys Thr (2) INFORMATION FOR SEQ ID N0:142:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 223 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 'ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
SO (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc feature WO 98/24475 PCTlUS97/22104 (B) LOCATION 1...223 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:142:
S Met PheSerLeu SerTyrVal SerLysLys PheLeu SerValLeu Leu Leu IleSerLeu PheLeuSer AlaCysLys SerAsn AsnLysAsp Lys Leu AspGluAsn LeuLeuSer SerGlyThr Gln,SerSerLysGlu Leu 1~ 35 40 45 Asn AspLysArg AspAsnIle AspLysLys SerTyr AlaGlyLeu Glu Asp ValPheLeu AspAsnLys SerIleSer ProAsn AspLysTyr Met IS Leu LeuValPhe GlyArgAsn GlyCysSer TyrCys GluArgLeu Lys Lys AspLeuLys AsnValLys GluLeuArg AsnTyr IleLysGlu His Phe SerAlaTyr TyrValAsn IlgSerTyr SerLys GluHisAsn Phe 2~ 115 120 I25 Lys ValGlyAsp LysAspLys AsnAspGlu LysGlu IleLysMet Ser Thr GluGluLeu AlaGlnIle TyrAlaVal GlnSer ThrProThr Ile 2S Val LeuSerAsp LysThrGly LysThrIle TyrGlu LeuProGly Tyr Met ProSerVal GlnPheLeu AlaValLeu GluPhe IleGlyAsp Gly Lys TyrGlnAsp ThrLysAsn AspGluAsp LeuThr LysLysLeu Lys 3~ 195 200 205 Ala TyrIleLys TyrLysThr AsnLeuSer LysSer LysSerSer (2) INFORMATION FOR SEQ ID N0:143:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 116 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
4S (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/ICEY: misc_feature S~ (B) LOCATION 1...116 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:143:
Leu Met Lys Ser Lys Ile Thr His Phe Ile Val Ile Ser Phe Val Leu Ser Val LeuSerAla CysLys AspGluPro LysLysSer SerGln Ser His Gln AsnAsnThr LysThr ThrGlnAsn AsnGlnIle AsnGln Pro Asn Lys AspIleLys LysIle GluHisGlu GluGluAsp GluLys Val Thr Lys GluValAsn AspLeu IleAsnAsn GluAsnLys IleAsp Glu Ile Asn AsnGluGlu AsnAla AspProSer GlnLysArg ThrAsn Asn Val Leu GlnArgAla ThrAsn HisGlnAsp AsnLeuSer SerPro Leu Asn Arg LysTyr (2) INFORMATION FOR SEQ ID N0:144:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 79 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...79 3S (xi) SEQUENCE DESCRIPTION: SEQ ID N0:144:
Met Phe Glu Lys Ile Arg Lys Ile Leu Ala Asp Ile Glu Asp Ser Gln Asn Glu Ile Glu Met Leu Leu Lys Leu Ala Asn Leu Ser Leu Gly Asp Phe Ile Glu Ile Lys Arg Gly Ser Met Asp Met Pro Lys Gly Val Asn Glu Ala Phe Phe Thr Gln Leu Ser Glu Glu Val Glu Arg Leu Lys Glu 4S Leu Ile Asn Ala Leu Asn Lys Ile Lys Lys Gly Let Leu Val Phe (2) INFORMATION FOR SEQ ID N0:145:
- SO (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 51 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii)MOLECULE TYPE: protein (iii)HYPOTHETICAL: YES

S (vi)ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix)FEATURE:

(A) NAME/KEY: misc feature _ (B) LOCATION 1...51 (xi)SEQUENCE DESCRIPTION: SEQ ID N0:145:

Met Ser Met Phe Ile Ser Asn Leu Ala Phe Glu His Lys Thr Ser Asp Ala Met Glu Val Ala Lys Ile Ala Ile Leu Ser Leu Ile Leu Gly Ser Gly Ile Ile Gly Ala Leu Tyr Leu Phe Ala Lys Arg Ala Leu Asp Ala Leu Lys Lys (2) INFORMATION
FOR
SEQ
ID
N0:146:

2S (i) SEQUENCE CHARACTERISTICS:

(A} LENGTH: 449 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii} MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi} ORIGINAL SOURCE:
3S (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...449 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:146:
Met Gly Leu Lys Ile Lys Ile Leu Arg Leu Ser Met Asn Leu Lys Lys 4S Thr Glu Asn Ala Leu Ser Leu Thr Leu Lys Asn Phe Ile Lys Ser Glu Ser Phe Gly Gly Ile Phe Leu Phe Leu Asn Ala Val Leu Ala Met Val Val Ala Asn Ser Phe Leu Lys Glu Ser Tyr Phe Ala Leu Trp His Thr Pro Phe Gly Phe Gln Val Gly Asp Phe Phe Ile Gly Phe Ser Leu His Asn Trp Ile Asp Asp Val Leu Met Ala Leu Phe Phe Leu Met Ile Gly Leu Glu IleLysArg GluLeu LeuPheGly GluLeuSer SerPheLys Lys Ala SerPhePro ValIle AlaAlaIle GlyGlyMet IleAlaPro S Gly Leu IleTyrPhe PheLeu AsnAlaAsn ThrProSer GlnHisGly Phe Gly IleProMet AlaThr AspIleAla PheAlaLeu GlyValIle Met Leu LeuGlyLys ArgVal ProThrAla LeuLysVal PheLeuIle Thr Leu AlaValAla AspAsp LeuGlyAla IleValVal IleAlaLeu Phe Tyr ThrThrAsn LeuLys PheAlaTrp LeuLeuGly AlaLeuGly IS Val Val LeuValLeu AlaIle LeuAsnArg LeuAsnIle Arg_Ser_Leu Ile Pro TyrLeuLeu LeuGly ValLeuLeu TrpPheCys ValHisGln Ser Gly IleHisAla ThrIle AlaAlaVal ValLeuAla PheMetIle Pro Val LysIlePro LysAsp SerLysAsn ValGluLeu LeuGluLeu Gly Lys ArgTyrAla GluThr SerSerGly ValLeuLeu ThrLysGlu 2S Gln Gln GluIleLeu HisSer IleGluGlu LysAlaSer AlaLeuGln Ser Pro LeuGluArg LeuGlu HisPheLeu AlaProIle SerGlyTyr Phe Ile MetProLeu PheAla PheAlaAsn AlaGlyVal SerValAsp Ser Ser IleAsnLeu GluVal AspLysVal LeuLeuGly ValIleLeu Gly Leu CysLeuGly LysPro LeuGlyIle PheLeuIle ThrPheIle 3S Ser Glu LysLeuLys IleThr AlaArgPro LysGlyIle GlyTrpTrp His Ile LeuGlyAla GlyLeu LeuAlaGly IleGlyPhe ThrMetSer Met Phe IleSerAsn LeuAla PheThrSer GluHisLys AspAlaMet Glu Val AlaLysIle AlaIle LeuLeuGly SerLeuIle SexGlyIle 420_ 425 430 Ile Gly AlaLeuTyr LeuPhe AlaLeuAsp LysArgAla AlaLeuLys 4S Lys (2) INFORMATION FOR SEQ ID N0:147: ..
SO (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 815 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
S (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature IO (B) LOCATION 1...815 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:147:
Met Asn Asp Lys Arg Phe Arg Lys Tyr Cys Ser Phe Ser Ile Phe Leu Ser Leu Leu Gly Thr Phe Glu Leu Glu Ala Lys Glu Glu Glu Lys Glu Glu Lys Lys Thr Glu Arg Asn Lys Asp Lys Glu Lys-ASn Ala Gln His 2O Thr Leu Gly Lys Val Thr Thr Gln Ala Ala Lys Ile Phe Asn Tyr Asn Asn Gln Thr Thr Ile Ser Ser Lys Glu Leu Glu Arg Arg Gln Ala Asn Gln Ile Ser Asp Met Phe Arg Arg Asn Pro Asn Ile Asn Val Gly Gly Gly Ala Val Ile Ala Gln Lys Ile Tyr Val Arg Gly Ile Glu Asp Arg Leu Ala Arg Val Thr Val Asp Gly Val Ala Gln Met Gly Ala Ser Tyr 3O Gly His Gln Gly Asn Thr Ile Ile Asp Pro Gly Met Leu Lys Ser Val Val Val Thr Lys Gly Ala Ala Gln Ala Ser Ala Gly Pro Met Ala Leu Ile Gly Ala Ile Lys Met Glu Thr Arg Ser Ala Ser Asp Phe Ile Pro Lys Gly Lys Asp Tyr Ala Ile Ser Gly Ala Ala Thr Phe Leu Thr Asn Phe Gly Asp Arg Glu Thr Ile Met Gly Ala Tyr Arg Asn His His Phe 4O Asp Ala Leu Leu Tyr Tyr Thr His Gln Asn Ile Phe Tyr Tyr Arg Asp Gly Asp Asn Ala Met Lys Asn Leu Phe Asp Pro Lys Ala Asp Asn Lys Val Thr Ala Ser Pro Ser Glu Gln Asn Asn Val Met Ala Lys Ile Asn Gly Tyr Leu Ser Glu Arg Asp Thr Leu Thr Leu Ser Tyr Asn Met i.m Arg Asp Asn Ala Asn Arg Pro Leu Arg Ala Asn Phe Thr Gly Thr Phe SO Leu Pro Tyr Ser Cys Gly Asp Phe Asn Ala Phe Pro Asn Glu Lys Asn Pro Ser Asp Cys Leu Phe Glu Asn Asp Ala Ser Leu Phe Lys Thr Tyr Ser Val Asn Leu Val His Asn Val Ser Leu Asn Tyr Glu Arg Glu Gly .__._.~._.~.,...- _ __~.... _ . ____._._..T....... - _ Gly Ser ArgPhe GlyAspPro LysLeuLys IleAsn GlyTyrThr Ser Ile Arg AsnVal GlnIleAsp ProLeuPhe ArgPro SerAspIle Ala $ 355 360 365 Thr Thr IlePro PheThrPro AsnProGln LeuSer GlnGlyGlu Glu Asn Gln CysVal AlaGlnGly GlyIleTyr AspAla LeuLysGln Thr 1~ Cys Ser IleThr PheLysSer LeuGlyGly GlySer ValValAla Asn Lys Asn LeuPhe IleIleAsn SerGlyPhe AsnAla AsnValIle His Thr Ile AspHis LysAsnAsp AsnLeuLeu GluTyr GlyLeuAsn Tyr 1$ 435 440 445 Gln Asn LeuThr ThrPheAsp LysAlaIle ProAsp SerGluLeu Val Lys Pro GlyAsp AlaProAsp AlaCysLeu ArgVal ThrGlyPro Asp 2~ Asp Pro AsnMet AsnGlyArg CysGlnArg AsnGly AlaThrAla Asn Val Val GlyVal TyrAlaGln AlaAsnTyr ThrLeu HisProMet Val Thr Leu GlyAla GlyThrArg TyrAspVal TyrThr LeuValAsp Lys 2$ 515 520 525 Asp Trp GlnLeu HisValThr GlnGlyPhe SerPro SerAlaAla Leu Asn Val SerPro LeuGluAsn LeuAsnPhe ArgLeu SerTyrAla Tyr Val Thr ArgGly ProMetPro GlyGlyLeu ValTrp MetArgGln Asp Asn Leu ArgTyr AsnArgAsn LeuLysPro GluIle GlyGlnAsn Ala Glu Phe AsnThr GluTyrSer SerGlnTyr PheAsp PheArgAla Ala 3$ 595 600 605 Gly Phe ValGln LeuIleSer AsnTyrIle AsnGln PheSerSer Thr Leu Phe ValThr AsnLeuPro AlaGlnAsp IleIle TyrValPro Gly Tyr Glu ValSer GlyThrAla LysTyrLys GlyPhe SerLeuGly Leu Ser Val AlaArg SerTrpPro SerLeuLys GlyArg LeuIleAla Asp Val Tyr GluLeu AlaAlaThr ThrGlyAsn ValPhe IleLeuThr Ala 4$ 675 680 685 Ser Tyr ThrIle ProArgThr GlyLeu~e_ IleThr TrpLeuSer Arg Phe Val ThrAsn LeuSerTyr CysSerTyr SerPro TyrArgAsn Gly $~ Pro Thr AspIle AspArgArg ProSerAsn CysPro LysThrPro Gly Ile Phe HisVal Hi_sLysPro GlyTyrGly ValSer SerPhePhe Ile Thr Tyr LysPro ThrTyrLys LysLeuLys GlyLeu SerLeuAsn Ala Val Phe Asn Asn Val Phe Asn Gln Gln Tyr Ile Asp Gln Ala Ser Pro Val Met Ser Pro Asp Glu Pro Asn Gln Asp Lys Tyr Ala Arg Gly Met $ 785 790 795 g00 Ala Glu Pro Gly Phe Asn Ala Arg Phe Glu Ile Ser Tyr Lys Phe (2) INFORMATION FOR SEQ ID N0:148:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 814 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 1$
(ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
ZO (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature 2$ (B) LOCATION 1...814 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:148:
Met ThrSer ValLeu GluLysTyr CysSerPhe SerIle PheLeuSer 30 1 5 to is Leu LeuGly ThrPhe GluLeuGlu AlaLysGlu GluGlu LysGluGlu Lys LysThr GluArg AsnLysAsp LysGluLys AsnAla GlnHisThr 3$ Leu GlyLys ValThr ThrGlnAla AlaLysIle PheAsn TyrAsnAsn Gln ThrThr IleSer SerLysGlu LeuGluArg ArgGln AlaAsnGln 65 70 75 8p Ile SerAsp MetPhe ArgArgAsn ProAsnIle AsnVal GlyGlyGly Ala ValIle AlaGln LysIleTyr ValArgGly IleGlu AspArgLeu 100_ 105 110 Ala ArgVal ThrVal AspGlyVal AlaGlnMet GlyAla SerTyrGly _4$ His GlnGly Asr~Thr IleIleAsp ProGlyMet LeuLys SerValVal Val ThrLys GlyAla AlaGlnAla SerAlaGly ProMet AlaLeuIle 145 150 155 160 _ Gly AlaIle LysMet GluThrArg SerAlaSer AspPhe IleProLys $0 165 170 175 Gly LysAsp TyrAla IleSerGly AlaAlaThr PheLeu ThrAsnPhe Gly AspArg GluThr IleMetGly AlaTyrArg AsnHis HisPheAsp Ala Leu Leu Tyr Tyr Thr His Gln Asn Ile Phe Tyr Tyr Arg Asp Gly Asp Asn AlaMetLys AsnLeu PheAspPro LysAlaAsp AsnLysVal Thr Ala SerProSer GluGln AsnAsnVal MetAlaLys IleAsnGly Tyr Leu SerGluArg AspThr LeuThrLeu SerTyrAsn MetThrArg Asp Asn AlaAsnArg ProLeu ArgAlaAsn PheThrGly ThrPheLeu 1~ 275 280 285 Pro Tyr SerCysGly AspPhe AsnAlaPhe ProAsnGlu LysAsnPro Ser Asp CysLeuPhe GluAsn AspAlaSer LeuPheLys ThrTyrSer IS Val Asn LeuValHis AsnVal SerLeuAsn TyrGluArg GluGlyGly Ser Arg PheGlyAsp ProLys LeuLysIle AsnGlyTyr ThrSerIle Arg Asn ValGlnIle AspPro LeuPheArg ProSerAsp IleAlaThr 2~ 355 360 365 Thr Ile ProPheThr ProAsn ProGlnLeu SerGlnGly GluGluAsn 370. - 375 380 Gln Cys ValAlaGln GlyGly IleTyrAsp AlaLeuLys GlnThrCys 2$ Ser Ile ThrPheLys SerLeu GlyGlyGly SerValVal AlaAsnLys Asn Leu PheIleIle AsnSer GlyPheAsn AlaAsnVal IleHisThr Ile Asp HisLysAsn AspAsn LeuLeuGlu TyrGlyLeu AsnTyrGln 3~ 435 440 445 Asn Leu ThrThrPhe AspLys AlaIlePro AspSerGlu LeuValLys Pro Gly AspAlaPro AspAla CysLeuArg ValThrGly ProAspAsp 35 Pro Asn MetAsnGly ArgCys GlnArgAsn GlyAlaThr AlaAsnVal Val Gly ValTyrAla GlnAla AsnTyrThr LeuHisPro MetValThr Leu Gly AlaGlyThr ArgTyr AspValTyr ThrLeuVal AspLysAsp Trp Gln LeuHisVal ThrGln GlyPheSer ProSerAla AlaLeuAsn Val Ser ProLeuGlu AsnLeu AsnPheArg LeuSerTyr AlaTyrVal 4$ Thr Arg GlyProMet ProGly GlyLeuVal TrpMetArg GlnAspAsn Leu Arg TyrAsnArg AsnLeu LysProGlu IleGlyGln AsnAlaGlu Phe Asn ThrGluTyr SerSer GlnTyrPhe AspPheArg AlaAlaGly $~ 595 600 605 Phe Val GlnLeuIle SerAsn TyrIleAsn GlnPheSer SerThrLeu Phe Val ThrAsnLeu ProAla GlnAspIle IleTyrVal ProGlyTyr WO 98/24475 PCT/iTS97/22104 Glu ValSer GlyThr AlaLysTyr LysGlyPhe SerLeu GlyLeuSer Val AlaArg SerTrp ProSerLeu LysGlyArg LeuIle AlaAspVal S Tyr GluLeu AlaAla ThrThrGly AsnValPhe IleLeu ThrAlaSer 675 " 680 685 Tyr ThrIle ProArg ThrGlyLeu SerIleThr TrpLeu SerArgPhe Val ThrAsn LeuSer TyrCysSer TyrSerPro TyrArg AsnGlyPro Thr AspIle AspArg ArgProSer AsnCysPro LysThr ProGlyIle Phe HisVal HisLys ProGlyTyr GlyValSer SerPhe PheIleThr IS Tyr LysPro ThrTyr LysLysLeu LysGlyLeu SerLeu AsnAlaVal Phe AsnAsn ValPhe AsnGlnGln TyrIleAsp GlnAla SerProVal Met SerPro AspGlu ProAsnGln AspLysTyr AlaArg GlyMetAla Glu ProGly PheAsn AlaArgPhe GluIleSer TyrLys Phe (2) INFORMATION FOR SEQ ID N0:149:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 527 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
3S (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...527 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:149:
Met Lys Gln Asn Leu Lys Pro Phe Lys Met Ile Lys Glu Asn Leu Met 4S 1 5 to is Thr Gln Ser Gln Lys Val Arg Phe Leu Ala Pro Leu Ser i..a Ala Leu Ser Leu Ser Phe Asn Pro Val Gly Ala Glu Glu Asp Gly Gly Phe Met S0 Thr Phe Gly Tyr Glu Leu Gly Gln Val Val Gln Gln Val Lys Asn Pro Gly Lys Ile Lys Ala Glu Glu Leu Ala Gly Leu Leu Asn Ser Thr Thr Thr Asn Asn Thr Asn Ile Asn Ile Ala Gly Thr Gly Gly Asn Val Ala Gly ThrLeu GlyAsnLeu PheMet AsnGlnLeu GlyAsnLeu IleAsp Leu TyrPro ThrLeuLys ThrAsn AsnLeuHis GlnCysGly SerThr $ 115 120 125 Asn SerGly AsnGlyAla ThrAla AlaAlaAla ThrAsnAsn SerPro Cys PheGln GlyAsnLeu AlaLeu TyrAsnGlu MetValAsp SerIle l~ Lys ThrLeu SerGlnAsn IleSer LysAsnIle PheGlnGly AspAsn Asn ThrThr SerAlaAsn LeuSer AsnGlnLeu SerGluLeu AsnThr Ala SerVal TyrLeuThr TyrMet AsnSerPhe LeuAsnAla AsnAsn 1$ 195 200 205 Gln AlaGly GlyIlePhe GlnAsn AsnThrAsn GlnAlaTyr GluAsn Gly ValThr AlaGlnGln IleAla TyrValLeu LysGlnAla SerIle Thr MetGly ProSerGly AspSer GlyAlaAla GlyAlaPhe LeuAsp Ala AlaLeu AlaGlnHis ValPhe AsnSerAla AsnAlaGly AsnAsp Leu SerAla LysGluPhe ThrSer LeuValGln AsnIleVal AsnAsn 2$ 275 280 285 Ser GlnAsn AlaLeuThr LeuAla AsnAsnAla AsnIleSer AsnSer Thr GlyTyr GlnValSer TyrGly GlyAsnIle AspGlnAla ArgSer 3~ Thr GlnLeu LeuAsnAsn ThrThr AsnThrLeu AlaLysVal ThrAla Leu AsnAsn GluLeuLys AlaAsn ProTrpLeu GiyAsnPhe AlaAla Gly AsnSer SerGlnVal AsnAla PheAsnGly PheIleThr LysIle 3$ 355 360 365 Gly TyrLys GlnPhePhe GlyGlu AsnLysAsn ValGlyLeu ArgTyr Tyr GlyPhe PheSerTyr AsnGly AlaGlyVal GlyAsnGly ProThr Tyr AsnGln ValAsnLeu LeuThr TyrGlyVal GlyThrAsp ValLeu Tyr AsnVal PheSerArg SerPhe GlySerArg SerLeuAsn AlaGly Phe PheGly GlyIleGln LeuAla GlyAspThr TyrIleSer ThrLeu 4$ 435 440 445 Arg AsnSer ProGlnLeu Ala:.~.ArgProThr AlaThrLys PheGln Phe LeuPhe AspValGly LeuArg MetAsnPhe GlyIleLeu LysLys $~ Asp LeuLys SerHisAsn GlnHis SerIleGlu IleGlyVal GlnIle Pro ThrIle TyrAsnThr TyrTyr LysAlaGly GlyAlaGlu ValLys Tyr PheArg ProTyrSer ValTyr TrpValTyr GlyTyrAla Phe (2) INFORMATION FOR SEQ ID N0:150:
S (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 459 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
1$ (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A} NAME/KEY: misc_feature (B) LOCATION 1...459 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:150:
Val Val Leu Leu Thr Met Thr Lys Arg Leu Phe Lys Gly Leu Leu Ala 2S Ile Ser Leu Ala Val Ser Leu His Gly Gly Glu Val Lys Glu Lys Lys Pro Val Lys Pro Val Lys Glu Asp Pro Gln Glu Leu Ala Ala Lys Arg Val Glu Ala Phe Ser Arg Phe Ser Asn Val Val Thr Glu Ile Glu Lys Lys Tyr Val Asp Lys Ile Ser Ile Ser Glu Ile Met Thr Lys Ala Ile Glu Gly Leu Leu Ser Asn Leu Asp Ala His Ser Ala Tyr Leu Asn Glu Lys Lys Phe Lys_Glu Phe Gln Ala Gln Thr Glu Gly Glu Phe Gly Gly Leu Gly Ile Thr Val Gly Met Arg Asp Gly Val Leu Thr Val Ile Ala Pro Leu Glu Gly Thr Pro Ala Tyr Lys Ala Gly Val Lys Ser Gly Asp Ser Ile Leu Lys Ile Asn Asn Glu Ser Thr Leu Ser Met Ser Ile Asp Asp Ala Val Asn Leu Met Arg Gly Lys Pro Lys Thr Ser Ile Gln Ile lb5 170 175 4$ Thr Va) Val Arg Lys Asn Glu Pro Lys Pro Leu Val Phe Asn Ile Val Arg Asp Ile Ile Lys Ile Pro Ser Val Tyr Val Lys Lys Ile Lys Asp Thr Pro Tyr Leu Tyr Val Arg Val Asn Ser Phe Asp Lys Asn Val Thr Lys Ser Val Leu Asp Gly Leu Lys Ala Asn Pro Asn Ile Lys Gly Val Val Leu Asp Leu Arg Gly Asn Pro Gly Gly Leu Leu Asn Gln Ala Val _._._ _~w~._.~,._ Gly Leu SerAsnLeu PheIleLys GluGly ValLeuVal SerGln Arg Gly Lys AsnLysGlu GluAsnLeu GluTyr LysAlaAsn GlyArg Ala $ Pro Tyr ThrAsnLeu ProValVal ValLeu ValAsnGly GlySer Ala Ser Ala SerGluIle ValAlaGly AlaLeu GlnAspHis LysArg Ala Ile Ile IleGlyGlu LysThrPhe GlyLys GlySerVal GlnVal Leu 1~ 325 330 335 Leu Pro ValAsnLys AspGluAla IleLys IleThrThr AlaArg Tyr Tyr Leu ProSerGly ArgThrIle GlnAla LysGlyIle ThrPro Asp 15 Ile Val IleTyrPro GlyLysVal ProGlu AsnGluAsn LysPhe Ser Leu Lys GluAlaAsp LeuLysHis HisLeu GluGlnGlu LeuLys Lys Leu Asp AspLysThr ProIleSer_LysGlu AlaAspLys AspLys Lys 2~ 405 410 415 Ser Glu GluGluLys GluValThr ProLys MetIleAsn AspAsp Ile Gln Leu LysThrAla IleAspSer LeuLys ThrTrpSer IleVal Asp 2$ Glu Lys MetAspGlu LysValPro LysLys Lys (2) INFORMATION FOR SEQ ID N0:151:
3O (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 104 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 35 (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
40 (A) ORGANISM~.-Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...104 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:151:
Leu Leu Leu His Pro Leu His Ala His Ala Gln Val Leu Gly Phe Thr $~. Asn His Asp His Ala Pro Trp Leu Tyr Asp Phe Ile Lys Ser Phe Cys Asn Leu Ser Gly Gln Pro Phe Leu Asp Leu Gln Ala Phe Ala Ile Asn Phe Asn Glu Phe Ser Asp Arg Ala Asn Ala Tyr Asn Leu Phe Leu Arg Asp Ile Ser His Ala Asn Ile Pro Lys Lys Arg Glu Gln Met Val Leu Ala Ser Gly Val Lys Phe Asn Val Leu Ser His Tyr His Phe Ile Ala $ 85 90 95 Asn Ala Leu Lys Ile Arg Ala Phe (2) INFORMATION FOR SEQ ID N0:152:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 165 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 1$
(ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
ZO (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature 2$ (B) LOCATION 1...165 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:152:
Met Ile GluLeu IleLeuHis AsnLys SerIleGln IleAspGlu Thr 30 1 s l0 15 Leu Leu AsnVal LysGluHis LeuGlu LysPheTyr SerAsnLys Glu Gln Glu ThrIle AlaLysThr LeuGlu SerGlnThr GluLeuThr Cys 3$ Ser Tyr LeuLeu AspLysAsp PheSer LeuLeuGlu LysHisLeu Glu Asn Ser LeuGly HisPheThr PheGlu SerGluPhe AlaLeuLeu Lys Asp Lys GluPro LeuAsnLeu AlaGln IleLysGln IleGlyVal Leu Lys Val IleThr TyrGluMet ThrGln AlaLeuLys AsnGlnIle-Ile His Leu ThrGln IleValAsn GluGlu AsnLeuGlu PheAspGlu Glu 4$ Leu Val IleTyr HisLeuAsn PheLys LeuAsnGln AsnThrTyr Lys _0 Val Leu AlaLys PheCysVal LeuLys LysLysGly ThrLeuHis Glu 145 150 155~ 160 Lys Phe LysAla Phe $~ 165 (2) INFORMATION FOR SEQ ID N0:153:
(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 213 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
ld (A) ORGANISM: Helicobacter pylori (ix).FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...213 IS
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:153:
Met Asp ThrGluThr GlnGlu LysPheLeu AlaTyrLeu PheGluLys 2~ Ala Leu GlnLysAsn LeuGln AlaTyrTrp IleThrThr ThrGluThr Lys Asn GluLeuThr ArgGlu GluPheSer AsnLeuIle argLysThr Met Ile GluLeuIle LeuHis AsnLysSer IleGlnIle AspGluThr Leu Leu AsnValLys GluHis LeuGluLys PheTyrSer AsnLysGlu Gln Glu ThrIleAla LysThr LeuGluSer GlnThrGlu LeuThrCys 30 Ser Tyr LeuLeuAsp LysAsp PheSerLeu LeuGluLys HisLeuGlu Asn Ser LeuGlyHis PheThr PheGluSer GluPheAla LeuLeuLys Asp Lys GluProLeu AsnLeu AlaGlnIle LysGlnIle GlyValLeu Lys Val IleThrTyr GluMet ThrGlnAla LeuLysAsn G1nIleIle His Leu ThrGlnIle ValAsn GluGluAsn LeuGluPhe AspGluGlu Leu Val IleTyrHis LeuAsn PheLysLeu AsnGlnAsn ThrTyrLys Val Leu AlaLysPhe CysVal LeuLysLys LysGlyThr LeuHisGlu Lys Phe LysAlaPhe (2) INFORMATION FOR SEQ ID N0:154:
(i) SEQUENCE CHARACTERISTICS:
w 5~ (A) LENGTH: 253 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...253 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:154:
Met AlaIle SerIle LysSerPro LysGluIle LysAla LeuArgLys IS Ala GlyGlu LeuThr AlaGlnAla LeuAlaLeu LeuGlu ArgGluVal Arg ProGly ValSer LeuLeuGlu LeuAspLys MetAla GluAspPhe Ile LysSer SerHis AlaArgPro AlaPheLys GlyLeu TyrGlyPhe Pro AsnSer ValCys MetSerLeu AsnGluVal ValIle HisGlyIle 65 70 75 g0 Pro ThrAsp TyrVal LeuGlnGlu GlyAspIle IleGly LeuAspLeu Gly ValGlu ValAsp GlyTyrTyr GlyAspSer AlaLeu ThrLeuPro Ile GlyAla IleSer ProGlnAsp GluLysLeu LeuAla CysSerLys Glu SerLeu MetHis AlaIleSer SerIleArg ValGly MetHisPhe Lys GluLeu SerGln IleLeuGlu GlyAlaIle ThrGlu ArgGlyPhe Val ProLeu LysGly PheCysGly HisGlyIle GlyLys LysProHis Glu GluPro GluIle ProAsnTyr LeuGluLys GlyVal LysAlaAsn Ser GlyPro LysIle LysGluGly MetValPhe CysLeu GluProMet Val CysGln LysGln GlyGluPro LysIleLeu AlaAsp LysTrpSer Val ValSer ValAsp GlyLeuAsn ThrSerHis HisGlu HisThrIle Ala IleVal GlyAsn LysAlaVal IleLeuThr GluArg (2) INFORMATION FOR SEQ ID N0:155:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 247 amino acids $0 (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...247 IO (xi) SEQUENCE DESCRIPTION: SEQ ID N0:155:
Lys Pro Lys Arg Asn Gln Ser Pro Lys Lys Ser Arg Glu Leu Thr Ala Gln Ala LeuAla LeuLeuGlu ArgGluVal ArgProGly ValSer Leu I$ 20 25 30 Leu Glu LeuAsp LysMetAla GluAspPhe IleLysSer SerHis Ala Arg Pro AlaPhe LysGlyLeu TyrGlyPhe ProAsnSer ValCys Met 2O Ser Leu AsnGlu ValValIle HisGlyIle ProThrAsp TyrVal Leu Gln Glu GlyAsp IleIleGly LeuAspLeu GlyValGlu ValAsp Gly Tyr Tyr GlyAsp SerAlaLeu ThrLeuPro IleGlyAla IleSer Pro.

25 loo los llo Gln Asp GluLys LeuLeuAla CysSerLys GluSerLeu MetHis Ala Ile Ser SerIle ArgValGly MetHisPhe LysGluLeu SerGln Ile 3O Leu Glu GlyAla IleThrGlu ArgGlyPhe ValProLeu LysGly Phe Cys Gly HisGly IleGlyLys LysProHis GluGluPro GluIle Pro Asn Tyr LeuGlu LysGlyVal LysAlaAsn SerGlyPro LysIle Lys 35 lso ls5 190 Glu Gly MetVal PheCysLeu GluProMet ValCysGln LysGln Gly Glu Pro LysIle LeuAlaAsp LysTrpSer ValValSer ValAsp Gly 4O Leu Asn ThrSer HisHisGlu HisThrIle AlaIleVal GlyAsn Lys Ala Val IleLeu ThrGluArg - 4S (2) INFORMATION FOR SEQ ID N0:156:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 340 amino acids (B) TYPE: amino acid $O (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES

(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori S (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...340 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:156:
Met Tyr Arg Lys Asp Leu Asp Asn Tyr Leu Lys Gln Arg Leu Pro Lys Ala Val Phe Leu Tyr Gly Glu Phe Asp Phe Phe Ile His Tyr Tyr Ile 1S Gln Thr Ile Ser Ala Leu Phe Lys Gly Asn Asn Pro Asp Thr Glu Thr Ser Leu Phe Tyr Ala Ser Asp Tyr Glu Lys Ser Gln Ile Ala Thr Leu Leu Glu Gln Asp Ser Leu Phe Gly Gly Ser Ser Leu Val Ile Leu Lys Leu Asp Phe Ala Leu His Lys Lys Phe Lys Glu Asn Asp Ile Asn Pro Phe Leu Lys Ala Leu Glu Arg Pro Ser His Asn Arg Leu Ile Ile Gly Leu Tyr Asn Ala Lys Ser Asp Thr Thr Lys Tyr Lys Tyr Thr Ser Glu Ile Ile Val Lys Phe Phe Gln Lys Ser Pro Leu Lys Asp Glu Ala Ile Cys-Val Arg Phe Phe Thr Pro Lys Ala Trp Glu Ser Leu Lys Phe Leu Gln Glu Arg Ala Asn Phe Leu His Leu Asp Ile Ser Gly His Leu Leu Asn Ala Leu Phe Glu Ile Asn Asn Glu Asp Leu Ser Val Ser Phe Asn 3S Asp Leu Asp Lys Leu Ala Val Leu Asn Ala Pro Ile Thr Leu Glu Asp Ile Gln Glu Leu Ser Ser Asn Ala Gly Asp Met Asp Leu Gln Lys Leu Ile Leu Gly Leu Phe Leu Lys Lys Ser Val Leu Asp Ile Tyr Asp Tyr Leu Leu Lys Glu Gly Lys Lys Asp Ala Asp Ile Leu Arg Gly Leu Glu Arg Tyr Phe Tyr Gln Leu Phe Leu Phe Phe Ala His Ile Lys Thr Thr 4S Gly Leu Met Asp Ala Lys Glu Val Leu Gly ~~yr Ala Pro Pro Lys Glu Ile Val Glu Asn Tyr Ala Lys Asn Ala Leu Arg Leu Lys Glu Ala Gly Tyr Lys Arg Val Phe Glu Ile Phe Arg Leu Trp His Leu Gln Ser Met = S0 305 310 315 320 Gln Gly Gln Lys Glu Leu Gly Phe Leu Tyr Leu Thr Pro Ile Gln Lys Ile Ile Asn Pro _. .____ ~_._... _ ____.... _.

- 241 - .
(2) INFORMATION FOR SEQ ID N0:157:
(i) SEQUENCE CHARACTERISTICS:
$ (A) LENGTH: 200 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...200 2O (xi) SEQUENCE DESCRIPTION: SEQ ID N0:157:
Val Phe MetThrSer AlaLeu LeuC:lyLeu GlnIle ValLeuAla Val Leu Ile ValValVal ValLeu LeuGlnLys SerSer SerIleGly Leu Gly Ala TyrSerGly SerAsn AspSerLeu PheGly AlaLysGly Pro Ala Ser PheMetAla LysLeu ThrMetPhe LeuGly LeuLeuPhe Val Ile Asn ThrIleAla LeuGly TyrPheTyr AsnLys GluTyrGly Lys Ser Val LeuAspGlu ThrLys ThrAsnLys GluLeu SerProLeu Val Pro Ala ThrGlyThr LeuAsn ProThrLeu AsnPro ThrLeuAsn Pro loo los llo Th-rLeu AsnProLeu GluGln AlaProThr AsnPro LeuMetPro Thr Gln Thr ProLysGlu LeuPro LysGluPro AlaLys ThrProPhe Val 4~ Glu Ser ProLysGln AsnGlu LysAsnGlu LysAsn AspAlaLys Glu Asn Gly IleLysGly ValGlu LysAsnLys GluAsn AlaLys~'hrPro Pro Thr ThrHisGln LysPro LysThrHis AlaThr ThrAsnAla His l80 ls5 190 Thr Asn GlnLysLys AspGlu Lys (2) INFORMATION FOR SEQ ID N0:158:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 159 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
S
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
IO (A) NAME/KEY: misc_feature (B) LOCATION 1...159 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:15B:
IS Met Arg Ser Pro Asn Leu Glu Lys Glu Glu Thr Glu Ile Ile Glu Thr 1 5 10 _ 15 Leu Leu Val Arg Glu Lys Met Arg Leu Cys Pro Leu Tyr Trp Arg Ile Leu Ala Phe Leu Ile Asp Ser Leu Leu Val Ala Phe Leu Leu Ser Asp Leu Leu Arg Ala Cys Ala Phe Leu His Ser Leu Tyr Trp Leu Thr Asn Pro Ile Tyr Tyr Ser Ala Phe Val Val Met Gly Phe Ile Ile Leu Tyr 2S Gly Val Tyr Glu Ile Phe Phe Val Cys Leu Cys Lys Met Ser Leu Ala Lys Leu Val Phe Arg Ile Lys Ile Ile Asp Il.e Tyr Leu Ala Asp Cys Pro Ser Arg Ala Ile Leu Leu Lys Arg Leu Gly Leu Lys Ile Val Val Phe Leu Cys Pro Phe Leu Trp Phe Val Val Phe Lys Asn Pro Tyr His Arg Ala Trp His Glu Glu Lys Ser Lys Ser Leu Leu Val Leu Phe (2) INFORMATION FOR SEQ ID N0:159:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 234 amino acids 40 (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein - 4S (iii} HYPOTHF'TICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori _ SO (ix) FEATURE:
(A) NAME/KEY: misc_feature (B} LOCATION 1...234 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:159:
.._. _._ . _~...__._~

Leu AsnThr AspPheSer HisIleThr AspIleGlu GlyMetArg Phe Val AsnGlu GluAspAla LeuAsnLys LeuIleAsn GluIleHis Thr Arg HisIle AspLeuLys AspSerIle MetLeuAla LeuSerPhe Asn Ala LeuTyr LeuAlaAsn AlaLeuAla GlnLysPhe GlyAlaThr Tyr 1~Asp IleLeu PheLeuGlu ProIleLeu AlaProLeu AsnSerLys Cys Glu IleAla LeuValSer GluSerMet AspIleVal MetAsnGlu Ser Leu IleAsn SerPheAsp IleAlaLeu AspTyrVal TyrGlyGlu Ala Lys ArgAla TyrGluGlu AspIleLeu SerHisIle TyrGlnTyr Arg Lys GlyAsn AlaIleLys SerLeuLys AspLysAsn IlePheIle Val 2~Asp ArgGly IleGluThr GlyPheArg AlaGlyLeu GlyValGln Thr Cys LeuLys LysGluCys GlnAspIle TyrIleLeu ThrProIle Leu Ala GlnAsn ValAlaGln GlyLeuGlu SerLeuCys AspGlyVal Ile Ser ValTyr ArgProGlu CysPheVal SerValGlu HisHisTyr Lys Glu LeuLys ArgLeuSer AsnGluGlu IleGluLys TyrLeuGly Ala 3~Asn AsnAla ProAsnLeu LysLysGlu His (2) INFORMATION FOR SEQ ID N0:160:
3S (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 287 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 4~ (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL-SOURCE:
4S (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...287 S~
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:160:
Leu Lys Gln Ser Glu Met Ala Met Glu Phe Asn Asp Pro Arg Met Arg Phe Phe Ile Gly Asp Val Arg Asp Leu Glu Arg Leu Asn Tyr Ala Leu Glu Gly ValAspIle CysIleHis AlaAla AlaLeuLys HisValPro S Ile Ala GluTyrAsn ProLeuGlu CysIle LysThrAsn IleMetGly 50 '- 55 60 Ala Ser AsnValIle AsnAlaCys LeuLys AsnGluIle SerGlnVal Ile Ala LeuSerThr AspLysAla AlaAsn ProIleAsn LeuTyrGly Ala Thr LysLeuCys SerAspLys LeuPhe ValSerAla AsnAsnPhe Lys Gly ProSerGln ThrGlnPhe GlyVal ValArgTyr GlyAsnVal IS Val Gly SerArgGly SerValVal ProPhe PheLysLys LeuValGln Asn Lys AlaSerGlu IleProIle ThrAsp IleArgMet ThrArgPhe Trp Ile ThrLeuAsp GluGlyVal SerPhe ValLeuLys SerLeuLys Arg Met HisGlyGly GluIlePhe ValPro LysIlePro SerMetLys Met Ile AspLeuAla LysAlaLeu AlaPro AsnIlePro ThrLysIle 25 Ile Gly IleArgPro GlyGluLys LeuHis GluValMet IleProLys Asp Glu SerHisLeu AlaLeuGlu PheGlu AspPhePhe IleIleGln Pro Thr IleSerPhe GlnThrPro LysAsp TyrThrLeu ThrLysLeu His Glu LysGlyGln LysValAla ProAsp PheGluTyr SerSerHis Thr Asn AsnGlnTrp LeuGluPro AspAsp LeuLeuLys LeuLeu (2) INFORMATION FOR SEQ ID N0:161:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 201 amino acids 4O (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein 4S (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori SO (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...201 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:161:

Met Arg LeuHisThr AlaPhePhe GlyIleAsn SerLeu LeuValAla Thr Leu LeuIleSer GlyCysSer LeuPheLys LysArg AsnThrAsn Ala Gln LeuIlePro ProSerAla AsnGlyLeu GlnAla ProIleTyr Pro Pro ThrAsnPhe ThrProArg LysSerIle GlnPro LeuProSer Pro Arg LeuGluAsn AsnAspGln ProIleIle SerSer AsnProThr 65 70 75 gp Asn Ala IleProAsn ThrPro-Ile LeuThrPro AsnAsn ValIleGlu Leu Asn AlaValGly MetGlyVal AlaProGlu SerThr IleSerPro Ser Gln AlaLeuAla LeuAlaLys ArgAlaAla IleVal AspGlyTyr Arg Gln LeuGlyGlu LysMetTyr GlyIleArg ValAsn AlaGlnAsp Thr Val LysAspMet ValLeuGln AsnSerVal IleLys ThrArgVal Asn Ala LeuIleArg AsnAlaGlu IleThrGlu ThrIle TyrLysAsp Gly Leu CysGlnVal SerMetGlu LeuLysLeu AspGly ArgIleTrp Tyr Arg IleLeuSer GlySerArg Gly (2) INFORMATION FOR SEQ ID N0:162:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 355 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
4O (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...355 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:162:
Met Ser Tyr Thr Ile Asn Lys Arg Phe Ser Val Gly Val Gly Leu Arg $0 1 5 10 15 Gly Leu Tyr Ala Thr Gly Ser Phe Asn Asn Thr Val Tyr Val Pro Leu Glu Gly Ala Ser Val Leu Ser Ala Glu Gln Ile Leu Asn Leu Pro Asn Asn Val Phe Ala Asp Gln Val Pro Ser Asn Met Met Thr Leu Leu Gly Asn IleGly TyrGln ProAlaLeu AsnCysGln LysAlaGly GlyAsp 65 70 75 gp $ Met SerAsp GlnSer CysGlnGlu PheTyrAsn GlyLeuLys LysIle Met GlyTyr SerGly LeuIleLys AlaSerAla AsnLeuTyr GlyThr Thr GlnVal ValGln LysSerAsn GlyGlnGly ValSerGly GlyTyr Arg ValGIy SerSer LeuArgVal PheAspHis GlyMetPhe SerVal Val TyrAsn SerSer ValThrPhe AsnMetLys GlyGlyLeu ValAla 1$ Ile ThrGlu LeuGly ProSerLeu GlySerVal LeuThrLys GlySer Leu AsnIle AsnVal SerLeuPro GlnThrLeu SerLeuAla TyrAla His GlnPhe PheLys AspArgLeu ArgValGlu GlyValPhe GluArg 2~ 195 200 205 Thr PheTrp SerGln GlyAsnLys PheLeuVal ThrProAsp PheAla Asn AlaThr TyrLys GlyLeuSer GlyThrVal AlaSerLeu AspSer 2$ Glu ThrLeu LysLys MetValGly LeuAlaAsn PheLysSer ValMet Asn MetGly AlaGly TrpArgAsp ThrAsnThr PheArgLeu GlyVal Thr TyrMet GlyLys SerLeuArg LeuMetGly AlaIleAsp TyrAsp Gln AlaPro SerPro GlnAspAla IleGlyIle ProAspSer AsnGly Tyr ThrVal AlaPhe GlyThrLys TyrAsnPhe ArgGlyPhe AspLeu 3$ Gly ValAla Gly-Ser PheThrPhe LysSerAsn ArgSerSer LeuTyr Gln SerPro ThrIle GlyGlnLeu ArgIlePhe SerAlaSer LeuGly Tyr Arg Trp 4~ 355 (2) INFORMATION FOR SEQ ID N0:163:
(i) SEQUENCE_CHARACTERISTICS:
4$ (A) LENGTH: 587 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein $~
(iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...587 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:163:
Met LysAsn PheSer ProLeuTyr CysLeu LysLysLeu LysLysArg His LeuIle AlaLeu SerLeuPro LeuLeu SerTyrAla AsnGlyPhe Lys IleGln GluGln SerLeuAsn GlyThr AlaLeuGly SerAlaTyr Val AlaGly AlaArg GlyAlaAsp AlaSer PheTyrAsn ProAlaAsn Met GlyPhe ThrAsn AspTrpGly GluAsn ArgSerGlu PheGluMet ' Thr ThrThr ValIle AsnIlePro AlaPhe SerPheLys ValProThr 2~ Thr AsnGln GlyLeu 'TyrSerVal ThrSer LeuGluIle AspLysSer Gln GynAsn IleLeu GlyIleIle AsnThr IleGlyLeu GlyAsnIle Leu LysAla LeuGly AsnThrAla AlaThr AsnGlyLeu SerGlnAla Ile AsnArg ValGln GlyLeuMet AsnLeu ThrAsnGln LysValVal Thr LeuAla SerLys ProAspThr GlnIle ValAsnGly TrpThrGly Thr ThrAsn PheVal LeuProLys PhePhe TyrLysThr ArgThrHis Asn GlyPhe ThrPhe GlyGlySer PheThr AlaProSer GlyLeuGly Met LysTrp AsnGly LysGlyGly GluPhe LeuHisAsp ValPheIle 3$ 210 215 220 Met MetVal GluLeu AlaProSer MetSer TyrThrIle AsnLysArg Phe SerVal GlyVal GlyLeuArg GlyLeu TyrAlaThr GlySerPhe 4~ Asn AsnThr ValTyr VaIProLeu GluGly AlaSerVal LeuSerAla Glu GlnIle LeuAsn LeuProAsn AsnVal PheAlaAsp GlnVal.Pro Ser AsnMet MetThr LeuLeuGly AsnIle GlyTyrGln ProAlaLeu 4$ 290 295 300 Asn CysGln LysAla GlyGlyAsp MetSer AspGlnSer CysGlnGlu Phe TyrAsn GlyLeu LysLysIle MetGly TyrSerGly LeuIleLys Ala SerAla AsnLeu TyrGlyThr ThrGln ValValGln LysSerAsn Gly GlnGly ValSer GlyGlyTyr ArgVal GlySerSer LeuArgVal Phe AspHis GlyMet PheSerVal ValTyr AsnSerSer ValThrPhe Asn MetLysGly GlyLeuVal AlaIle ThrGluLeu GlyPro SerLeu Gly SerValLeu ThrLysGly SerLeu AsnIleAsn ValSer LeuPro Gln ThrLeuSer LeuAlaTyr AlaHis GlnPhePhe LysAsp ArgLeu Arg ValGluGly ValPheGlu ArgThr PheTrpSer GlnGly AsnLys Phe LeuValThr ProAspPhe AlaAsn AlaThrTyr LysGly LeuSer Gly ThrValAla SerLeuAsp SerGlu ThrLeuLys LysMet ValGly Leu AlaAsnPhe LysSerVal MetAsn MetGlyAla GlyTrp ArgAsp I$ 485 490 495 Thr AsnThrPhe ArgLeuGly ValThr TyrMetGly LysSer LeuArg Leu MetGlyAla IleAspTyr AspGln AlaProSer ProGln AspAla Ile GlyIlePro AspSerAsn GlyTyr ThrValAla PheGly ThrLys Tyr AsnPheArg GlyPheAsp LeuGly ValAlaGly SerPhe ThrPhe Lys SerAsnArg SerSerLeu TyrGln SerProThr IleGly GlnLeu 2$ 565 570 575 Arg IlePheSer AlaSerLeu GlyTyr ArgTrp (2) INFORMATION FOR SEQ ID N0:164:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 205 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
4O (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...205 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:164:
Leu Ile Phe Arg Phe Phe Leu Ile Leu Ser Leu Leu Lys Gly Val Leu Leu Ala Lys Lys Asp Trp Asn Phe Phe Lys Pro Leu Glu Pro Thr Lys Lys Tyr Phe Gly Ser Phe Lys Ile Gly Tyr Leu Tyr Gln His Ala Glu _ .._...__._._._.~_ WO 98124475 PCT/US97l22104 Thr Thr Lys Arg Phe Pro Ile Arg Pro Lys Asn Arg Pro Pro Ile Leu Met AspLys IleTyr HisAspAla SerLeu GlyPheAsp AlaGly Tyr S Vai LeuLys LysLys AlaLeuLeu GlyGly TyrLeuAsp AlaGly Met Gly AspSer TyrPhe MetSerAla GlyLeu ValAlaGly ValArg Leu Phe LysGly TrpVal IleProLys IleAla LeuGlyTyr GlnLeu Gln Ile LeuGly AlaLys IleAspLys TyrGln PheAsnIle GlnSer Ala Val GlySer ValGly LeuPhePhe AsnAla AlaLysAsn PheGly Leu IS Ser IleGlu AlaArg GlyGlyIle ProPhe TyrPheIle GlnSer Arg Phe SerLys AlaPhe GlyThrPro ArgLeu AsnIleTyr SerVal Gly Ile ThrPhe ThrPhe TyrAspPhe ThrArg PheLeuGly (2) INFORMATION FOR SEQ ID NO:165:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 253 amino acids (B) TYPE: amino acid . (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...253 4O (xi) SEQUENCE DESCRIPTION: SEQ ID N0:165:
Leu Trp His Ala Ala Phe Ser Val Gly Glu Trp Gly Trp Asn Gly Asp Glu Ile Pro Tyr Arg Asp Cys Asp Glu Trp Gly Leu Asp Asp Phe Tyr Gly Val Lys Pro Thr Asr :ys Ala Gly Val Leu Ser Phe Ala Arg Ser His Arg Arg Gln Asn Gln Ala Val Leu Ser Lys Pro Lys Ser Phe Arg $0 Met Lys Lys Ile Ala Phe Ile Leu Ala Leu Trp Val Gly Leu Leu Gly Ala Phe Glu Pro Lys Lys Ser His Ile Tyr Phe Gly Ala Met Val Gly Leu Ala Pro Val Lys Ile Thr Pro Lys Pro Ala Ser Asp Ser Ser Tyr - 2$0 -Thr AlaPheLeu TrpGlyAla LysGly GlyTyrGln PheAla PhePhe Lys AlaLeuAla LeuArgGly GluPhe SerTyrLeu MetAla IleLys $ 130 135 140 Pro ThrAlaLeu HisThrIle AsnThr SerLeuLeu SerLeu AsnMet Asp ValLeuSer AspPheTyr ThrTyr LysLysTyr SerPhe GlyVal Tyr GlyGlyLeu GlyIleGly TyrPhe TyrGlnSer AsnHis LeuGly Met LysAsnSer SerPheMet GlyTyr AsnGlyLeu PheAsn ValGly Leu GlySerThr IleAspArg HisHis ArgValGlu LeuGly AlaLys 1$ 210 215 220 Ile ProPheSer LysTheArg AsnSer PheLysAsn SerTyr PheLeu Glu SerValPhe IleHisAla AlaTyr SerTyrMet Phe 245 _ 250 (2) INFORMATION FOR SEQ ID N0:166:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 412 amino acids 2$ (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein 3O (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 3$ (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...412 (xi} SEQUENCE DESCRIPTION: SEQ ID N0:166:

Met Glu Ser Val Lys Thr Val Lys Thr Asn Lys Val Gly Lys Asn Thr Glu Thr Ala Asn Thr Glu Ala Ser Lys Glu Thr His Phe Lys Gln Ala 4$ per Ala Ile Thr Asn Thr Leu Arg Ser Ile Gly Gly Ile Phe Thr Lys Ile Ala Lys Lys Val Arg Glu Leu Val Lys Lys His Pro Lys Lys Ser Ser Val Ala Leu Val VaI Leu Thr His Ile Ala Cys Lys Arg Ala Lys $0 65 70 75 80 Glu Leu Asp Asp Lys Val Gln Asp Lys Ser Lys Gln Ala Glu Lys Glu Asn Gln Ile Asn Trp Trp Lys Tyr Ser Gly Leu Thr Ile Ala Ala Ser Leu LeuLeuAla AlaCysSer ThrGly AspIleAsp LysGlnIle Glu Leu GluGlnGlu LysLysGlu AlaAsn LysSerGly IleLysLeu Glu $ Gln GluArgGln LysThrGlu GlnGlu ArgGlnLys ThrAsnLys Ser Glu IleGluLeu GluGlnGlu ArgGln LysThrAsn LysSerGly Ile Glu LeuAlaAsn SerGlnIle LysAla GluGlnGlu ArgGlnLys Thr 1~ 180 185 190 Glu GlnGluLys GlnLysAla AsnLys SerGluIle GluLeuGlu Gln Gln LysGlnLys ThrIleAsn ThrGln ArgAspLeu IleLysGlu Gln 1$ Lys AspPheIle LysGluThr GluGln AsnCysGln GluLysHis Gly Gln LeuPheIle LysLysAla ArgIle LysThrGly IleThrThr Gly Ile AlaIleGlu IleGluAla GluCys LysThrPro LysProAla Lys 2~ 260 265 270 Thr AsnGlnThr ProIleGln ProLys HisLeuPro AsnSerLys Gln Pro ArgSerGln ArgGlySer LysAla GlnGluLeu IleAlaTyr Leu 2$ Gln LysGluLeu GluSerLeu ProTyr SerGlnLys AlaIleAla Lys Gln ValAspPhe TyrLysPro SerSer IleAlaTyr LeuGluLeu Asp Pra ArgAspPhe LysValThr GluGlu TrpGlnLys GluAsnLeu Lys Ile ArgSerLys AlaGlnAla LysMet LeuGluMet ArgAsnPro Gln Ala HisLeuPro ThrSerGln SerLeu LeuPheVal GlnLysIle Phe 3$ Ala AspIleAsn LysGluIle GluAla ValAlaAsn ThrGluLys Lys Thr GluLysAla GlyTyrGly TyrSer LysArgMet 4O {2) INFORMATION FOR SEQ ID N0:167:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 149 amino acids (B) TYPE: amino acid 4$ {D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
$~
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...149 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:167:
Leu AsnTrp GluHisLeu MetLysLys LeuAlaPhe SerLeu LeuPhe Thr GlyThr PheLeuGly LeuPheLeu AsnAlaSer AspPhe LysSer Met AspAsn LysGlnLeu LeuGluGln AlaGlyLys ValAla ProSer Glu ValPro GluPheArg ThrGluVal AsnLysArg LeuGlu AlaMet Lys GluGlu GluArgGln LysTyrLys AlaAspPhe LysLys AlaMet 1$ 65 70 75 g0 Asp LysAsn LeuAlaSer LeuSerGln GluAspArg AsnLys ArgLys Lys GluIle LeuGluVal IleAlaAsn LysLysLys ThrMet ThrMet Lys GluTyr ArgGluGlu GlyLeuAsp LeuHisAsp CysAla CysGlu Gly ProPhe HisAspHis GluLysLys GlyGlnLys GlyLys LysPro Ser HisHis LysHis 25 14s (2) INFORMATION FOR SEQ ID N0:168:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 204 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...204 4S (xi) SEQUENCE DESCRIPTION: SEQ ID N0:368:
Met Gln Ala Val Ile Leu Ala Asn Gly Glu Phe Pro Lys Ser Lys Lys Cys Leu Asp Ile Leu Gln Asn Ala Pro Phe Leu Ile Ala Cys Asp Gly Ala Val Ile Ser Leu His Ala Leu Gln Phe Lys Pro Ser Val Val Ile Gly Asp Leu Asp Ser Ile Asp Ser His Leu Lys Ala Leu Tyr Asn Pro Ile Arg Val Ser Glu Gln Asp Ser Asn Asp Leu Ser Lys Ala Phe Phe Tyr AlaLeuAsn ArgGlyCys AspAsp PheIlePhe LeuGly LeuAsn Gly LysArgGlu AspHisAla LeuAla AsnThrPhe LeuLeu LeuGlu 100 $~ 105 110 Tyr PheLysPhe CysLysLys IleGln SerValSer AspTyr GlyLeu Phe ArgValLeu GluThrPro PheThr LeuProSer PheLys GlyGiu Gln IleSerLeu PheSerLeu AspLeu LysAlaArg PheThr SerLys Asn LeuLysTyr ProLeuLys AspLeu ArgLeuLys ThrLeu PheSer 15Gly SerLeuAsn GluAlaThr AsnHis CysPheSer LeuSer SerGlu Pro LysSerVal ValLeuVal TyrGln LysPheSer (2) INFORMATION FOR SEQ ID N0:169:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 280 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...280 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:169:
Val Phe AspSerLeu GlyGlyPhe LeuGlyTyr LysThrPhe LysPro Ile Val AspLysVal LysAsnIle AsnAlaTrp IleLysAsn TyrAsp Asn Lys LysAlaGln GluIleMet GlyPheIle GluAsnPro ThrPro Asp Phe GlnAs~.:.snLysPheLeu CysValLeu AsnArgGln GlyThr Arg His AsnAsnTyr LeuGlyLeu ThrSerThr AsnLeuLeu IleGly $~ Ala Ile TyrPheSer IleArgHis CysIleLys AlaThrTrp GlnAsn -Asp Arg AspGlnP_heTyrAlaPro TyrAspAsp AlaPheGln AspAsp Ser Glu PheLysAsn AsnCysLeu AlaPheMet LeuPheHis ThrGln - 2$4 -Asn Arg Ile Thr Ala Thr Gln Gly Thr Asn His Phe Ile Pro Phe Ser Glu Asp GluValAsp SerLysGlu ArgTyr LeuSerHis AlaLeu Leu $ 145 150 155 160 Asp Phe LeuLysGly GluIleLys GluPro LysLysSer AspSer Leu Phe Leu AsnAlaLys LysGluAsn LysPro LeuLysPhe SerSer Ser Ala Ser LysValPhe-AspAlaGly ArgGlu IleTyrArg TyrTyr His Thr Gln AspPheIle HisThrPro TyrAsn AlaAsnAla SerLeu Tyr Asp Ile LysGluPhe PheGlnGly ArgAsn LysGlnGly ArgLeu Asn 1$ 225 230 235 _ 240 Ser Pro ThrLysAla LysAspGlu TyrTyr LysGlnLeu TyrAla Asn Leu Gln TyrAlaLeu LysAspLeu AlaLys GluIleGln ProLys Val Tyr Glu TyrGlyPhe LeuArgGlu (2) INFORMATION FOR SEQ ID N0:170:
2S (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 309 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
3$ (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...309 (xi} SEQUENCE DESCRIPTION: SEQ ID N0:170:
Cys Asp Arg Ala Ile Pro His Trp Leu Phe Ser Leu Gly Tyr Arg Tyr - 4$ Pro Pro Pro Leu Lys Pro Thr Asn Ala Phe Asn Leu Glu Val Phe Asp Ser Leu Gly Gly Phe Leu Gly Tyr Lys Thr Phe Lys Pro Ile Val Asp Lys Val Lys Asn Ile Asn Ala Trp Ile Lys Asn Tyr Asp Asn Lys Lys $0 50 55 60 Ala Gln Glu Ile Met Gly Phe Ile Glu Asn Pro Thr Pro Asp Phe Gln Asn Asn Lys Phe Leu Cys Val Leu Asn Arg Gln Gly Thr Arg His Asn Asn TyrLeuGly LeuThrSer ThrAsn LeuLeuIle GlyAla IleTyr Phe SerIleArg HisCysIle LysAla ThrTrpGln AsnAsp ArgAsp $ Gln PheTyrAla ProTyrAsp AspAla PheGlnAsp AspSer GluPhe Lys AsnAsnCys LeuAlaPhe MetLeu PheHisThr GlnAsn ArgIle Thr AlaThrGln GlyThrAsn HisPhe IleProPhe SerGlu AspGlu Val AspSerLys GluArgTyr LeuSer HisAlaLeu LeuAsp PheLeu Lys GlyGluIle LysGluPro LysLys SerAspSer LeuPhe LeuAsn I$Ala LysLysGlu AsnLysPro LeuLys PheSerSer SerAla SerLys Val PheAspAla GlyArgGlu IleTyr ArgTyrTyr HisThr GlnAsp Phe IleHisThr ProTyrAsn AlaAsn AlaSerLeu TyrAsp IleLys Glu PhePheGln GlyArgAsn LysGln GlyArgLeu AsnSer ProThr Lys AlaLysAsp GluTyrTyr LysGln LeuTyrAla AsnLeu GlnTyr 2$Ala LeuLysAsp LeuAlaLys GluIle GlnProLys ValTyr GluTyr Gly PheLeuArg Glu 3O (2) INFORMATION FOR SEQ ID N0:171:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 187 amino acids (B) TYPE: amino acid 35 (D) TOPOLOGY: linear {ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori {ix) FEATURE.
(A) NAME/KEY: misc_feature (B) LOCATION 1...187 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:171:
Leu Glu Thr Tyr Ile Ile Asp Ala Asp Asn Ile Asp Gly Asp Leu Phe Phe Tyr Asn Leu Thr Arg Asn Ser Asn Asp Phe Ser Met Leu Pro Val Phe Glu Leu Asp Arg Ile Ala Gln Lys Ile Arg Asn Ile Leu Lys Lys His Gly Ser Arg Lys Asp Ile Ile Leu Lys His Asn Glu Ile Lys Glu Ala Phe PheSerPro PheLysPro GlnLeu LysThrVal GlnValPhe $ 65 70 75 80 Leu Ser HisSerHis Al~'~AspLys AsnLys AlaLeuGly ValLysAsp Tyr Leu GluSerLys ThrLysArg LysVal PheIleAsp SerLeuPhe Trp Asp TyrLysAsp AspValLeu AsnLys LeuAlaLys HisAspAsp Ile Ser LysIleGlu AspAlaPhe ThrLeu IleLeuArg LysSerLeu Gln Asp MetIleGlu LysCysPro TyrPhe ValPheLeu GlnSerLys Asn Ser ValSerAsn GlnGlyLeu SerArg IleThrTyr SerAlaTrp Ile Tyr GluGluLeu LysIleAla SerPhe Tyr (2) INFORMATION FOR SEQ ID N0:172:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 198 amino acids 2$ (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein 3O (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 3$ (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...198 (xi)SEQUENCE SEQID
DESCRIPTION: N0:172:

Leu Glu ThrTyrIleIle AspAla AspAsnIle AspGlyAsp LeuPhe Phe Tyr AsnLeuThrArg AsnSer AsnAspPhe SerMetLeu ProVal 45 Phe Glu LeuAspArgIle AlaGln LyrcIleArg AsnIleLeu LysLys His Gly SerArgLysAsp IleIle LeuLysHis AsnGluIle LysGlu Ala Phe PheSerProPhe LysPro GlnLeuLys ThrValGln ValPhe $0 65 70 75 BO

Leu Ser HisSerHisAla AspLys AsnLysAla LeuGlyVal LysAsp Tyr Leu GluSerLysThr LysArg LysValPhe IleAspSer LeuPhe Trp Asp Tyr Lys Asp Asp Val Leu Asn Lys Leu Ala Lys His Asp Asp Ile Ser Lys Ile Glu Asp Ala Phe Thr Leu Ile Leu Arg Lys Ser Leu S Gln Asp Met Ile Glu Lys Cys Pro Tyr Phe Val Phe Leu GIn Ser Lys Asn Ser Val Ser Asn Gln Gly Leu Ser Arg Ile Thr Tyr Ser Ala Trp Ile Tyr Glu Glu Leu Lys Ile Ala Ser Phe Leu Leu Ala Leu Leu Thr Arg Val Ala Gln Phe Gln (2) INFORMATION FOR SEQ ID N0:173:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 189 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
2S (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...189 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:173:
Met Met ThrLys AsnAla TyrAlaPhe ValValIle GluLysSer Ile 3S 1 5 to is Met Val PheLys CysAla LysAspLys GlyLeuIle ProIleThr Glu Gly Phe ValPro LeuLys GluGlyPhe LeuArgSer PheLysGlu Arg Cys Asn LeuAsp PheLeu GluAsnLeu AspLeuLeu PheLeuTyr Asp Tyr Gln PhePro SerGlu ValPheSer LeuCysLys AspLeuLys Asn 65 7D 75 gp Ser Ile TrpAsp ArgLys LeuValVal ValLeuVal GluAlaLeu Glu Gly Phi.ItsGly LeuAsn LeuSerLeu LysIleGlu AspArgHis Ser Asn Ser LeuGly AsnGly ValGlnLys LeuLeuThr AsnAlaAsp Leu S0 Gly Ser AsnHis LysPro IleValIIe AspSerMet LysThrTyr His Gln Ser GlnGln GluLys TyrLysArg GluArgGly GluThrLeu Glu Val Arg ProThr ThrPro ProSerTyr GlyGlyGly SerIIeArg Ile Ser Gly Asp Lys Lys Pro Asp Ser Asn Glu Glu Asn Phe S (2) INFORMATION FOR SEQ ID N0:174:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 590 amino acids (B) TYPE: amino acid 1~ (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...590 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:I74:
ZS Met Lys Ala Ile Lys Ile Leu Leu Ile Met Thr Leu Ser Leu Asn Ala Ile Ser ValAsnArg AlaLeuPhe AspLeuLys AspSer GlnLeuLys Gly Glu LeuThrPro LysIleVal AspPheGly GlyTyr LysSerAsn Thr Thr GluTrpGly AlaThrAla LeuAsnTyr IleAsn AlaAlaAsn Gly Asp AlaLysLys PheSerAla LeuValGlu LysMet ArgPheAsn 3S Ser Gly IleLeu-Gly AsnPheArg AlaHisAla HisLeu ArgGlnAla Leu Lys LeuGlnLys AsnLeuLys TyrCysLeu LysIle IleAlaArg Asp Ser PheTyrSer TyrArgThr GlyIleTyr IlePro LeuGlyIle Ser Leu LysAspGln LysThrAla GlnLysMet LeuAla AspLeuSer Val Val GlyAlaTyr LeuLysLys GlnGlnGlu AsnGlu LysAlaGln 4S Ser Pro TyrTyrArg SerAsnAsn TyrTyrAsn SerTyr TyrSerPro Tyr Tyr GlyMetTyr GlyMetTyr GlyMetGly MetTyr GlyMetTyr Gly Met GlyMetTyr AspPheTyr AspPheTyr AspGly MetTyrGly Phe Tyr ProAsnMet PhePheMet MetGlnVal GlnAsp TyrLeuMet Leu Glu AsnTyrMet TyrAlaLeu AspGlnGlu GluIle LeuAspHis -2$9-Asp Ala Ser Ile Asn Gln Leu Asp Thr Pro Thr Asp Asp Asp Arg Asp Asp Lys AspAsp LysSerSer GlnProAla AsnLeuMet SerPhe Tyr $ Arg Asp ProLys PheSerLys AspIleGln ThrAsnArg LeuAsn Ser Ala Leu ValAsn LeuAspAsn SerHisMet LeuLysAsp AsnSer Leu Phe His ThrLys AlaMetPro ThrLysSer ValAspAla IleThr Ser 1~ 305 310 315 320 Gln Ala LysGlu LeuAsnHis LeuValGly GlnIleLys GluMet Lys Gln Asp GlyAla SerProAsn LysIleAsp SerValVal AsnLys Ala 1$ Met Glu ValArg AspLysLeu AspAsnAsn LeuAsnGln LeuAsp Asn Asp Leu LysAsp GlnLysGly LeuSerSer GluGlnGln AlaGln Val Asp Lys AlaLeu AspSerVal Gln-GlnLeu SerHisSer SerAsp Val Val Gly AsnTyr LeuAspGly SerLeuLys IleAspGly AspAsp Arg Asp Asp LeuAsn AspAlaIle AsnAsnPro MetGlnGln ProAla Gln 2$ Gln Thr ProIle AsnAsnMet AspAsnThr HisAlaAsn AspSer Lys Asp Gln GlyGly AsnAlaLeu IleAsnPro AsnAsnAla ThrAsn Asp Asp His AsnAsp AspHisMet AspThrAsn ThrThrAsp ThrSer Asn 3~ 465 470 475 480 Ala Asn AspThr ProThrAsp AspLysAsp AlaSerGly AsnAsn Thr Gly Asp MetAsn AsnThrAsp ThrGlyAsn ThrAspThr GlyAsn Thr 3$ Asp Thr GlyAsn ThrAspAsp MetSerAsn MetAsnAsn GlyAsn Asp Asp Thr GlyAsn ThrAsnAsp AspMetGly AsnSerAsn AspMet Gly Asp Asp MetAsn AsnAlaAsn AspMetAsn AspAspMet GlyAsn Ser Asn Asp AspMet GlyAspMet GlyAspMet AsnAspAsp MetGly Gly Asp Met GlyAsp MetGlyAsp MetGlyGly AspMetGly Asn 4$

(2) INFORMATION FOR SEQ ID N0:175:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 195 amino acids $~ (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...195 IO (xi) SEQUENCE DESCRIPTION: SEQ ID N0:175:
Leu Asn LeuArgLeu AlaGly AlaSerVal LeuThrAla CysValPhe Ser Gly CysPhePhe LeuLys MetPheAsp LysLysLeu SerSerAsn Asp Trp HisIleGln LysVal GluMetAsn HisGInVal TyrAspIle Glu Thr MetLeuAla AspSer AlaPheArg GluHisGlu GluGluGln 2O Asp Ser SerLeuAsn ThrAla LeuProGlu AspLysThr AlaIIeGlu Ala Lys GluGlnGlu GlnLys GluLysArg LysHisTrp TyrGluLeu Phe Lys LysLysPro LysPro LysSerSer MetGlyGlu PheValPhe 25 loo l05 to Asp Gln LysGluAsn ArgIle TyrGlyLys GlyTyrCys AsnArgTyr 115 _ 120 125 Phe Ala SerTyrThr TrpGln GlyAspArg HisIleAla IleGluAsp 30 Ser Gly IleSerArg LysVal CysArgAsp GluHisLeu MetAlaPhe Glu Leu GluPheMet GluAsn PheLysGly AsnPheAla ValThrLys Gly Lys AspThrLeu IleLeu AspAsnGln LysMetLys IleTyrLeu Lys Thr Pro _. 195 (2) INFORMATION FOR SEQ ID N0:176:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 744 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: p~otein (iii) HYPOTHETICAL: YES
SO (vi} ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc feature (B) LOCATION 1...744 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:176:
$ Met LeuLys LeuAlaSer LysThr IleCysLeu SerLeu IleSerSer Phe ThrAla ValGluAla PheGln LysHisGln LysAsp GlyPhePhe Ile GluAla GlyPheGlu ThrGly LeuLeuGln GlyThr GlnThrGln 1~ 35 40 45 Glu GlnThr IleAlaThr Thr_GinGluLysPro LysPro LysProLys Pro LysPro IleThrPro GlnSer ThrTyrGly LysTyr TyrIleSer 1$ Gln SerThr IleLeuLys AsnAla ThrGluLeu PheAla GluAspAsn Ile ThrAsn LeuThrPhe TyrSer GlnAsnPro ValTyr ValThrAla Tyr AsnGln GluSerAla GluGlu AlaGlyTyr GlyAsn AsnSerLeu 2~ 115 120 125 Ile MetIle GlnAsnPhe LeuPro TyrAsnLeu AsnAsn IleGluLeu Ser TyrThr AspAspGln GlyAsn ValValSer LeuGly ValIleGlu 2$ Thr IlePro LysGlnSer GlnIle IleLeuPro AlaSer LeuPheAsn Asp ProGln LeuAsnAla AspGly PheGlnGln LeuGln ThrAsnThr Thr ArgPhe SerAspAla SerThr GlnAsnLeu PheAsn LysLeuSer Lys ValThr ThrAsnLeu GlnMet ThrTyrIle AsnTyr AsnGlnPhe Ser SerGly AsnGlySer GlySer LysProPro CysPro ProTyrGlu 3$ Asn GlnAla AsnCysVal AlaLys ValProPro PheThr SerGlnAsp Ala LysAsn LeuThrAsn LeuMet LeuAsnMet MetAla ValPheAsp Ser LysSer TrpGluAsp AlaVal LeuAsnAla ProPhe GlnPheSer Asp AsnAsn LeuSerAla ProCys TyrSerAsp TyrLeu ThrCysVal Asn ProTyr AsnAspGly LeuVal AspProLys LeuIle AlaLysAsn 4$ L~s GlyAsp GluTyrAsn IleGlu AsnGlyGln ThrGly SerValIle Leu ThrPro GlnAspVal IleTyr SerTyrArg ValAla AsnAsnIle Tyr ValAsn LeuLeuPro ThrArg GlyGlyAsp LeuGly LeuGlySer $0 355 360 365 Gln TyrGly GlyProAsn GIyPro GlyAspAsp GlyThr AsnPheGly Ala LeuGly IleLeuSer ProPhe LeuAspPro GluIle LeuPheGly Lys Glu Leu Asn Lys Val Ala Ile Met Gln Leu Arg Asp Ile Ile His Glu TyrGlyHis ThrLeuGly TyrThrHis AsnGly AsnMetThr Tyr $ Gln ArgValArg MetCysGlu GluAsnAsn GlyPro GluGluArg Cys Gln GlyGlyArg IleGluGln ValAspGly LysGIu ValGlnVal Phe Asp AsnGlyHis GluValArg AspThrAsp Gly.SerThrTyrAsp Val 1~ 465 470 475 480 Cys SerArgPhe LysAspLys ProTyrThr AlaGly SerTyrPro Asn Ser IleTyrThr AspCysSer GlnValPro AlaGly LeuIleGly Val IS Thr SerAlaVal TrpGlnGln LeuIleAsp GlnAsn AlaLeuPro Val Asp PheThrAsn LeuSerSer GlnThrAsn TyrLeu AsnAlaSer Leu Asn ThrGlnAsp PheAlaThr Thr-MetLeu SerAla IleSerGln Ser 2~ 545 550 555 560 Leu SerSerSer LysSerSer AlaThrThr TyrArg ThrSerLys Thr Ser ArgProPhe GlyAlaPro LeuLeuGly ValAsn LeuLysMet Gly 25 Tyr GlnLysTyr PheAsnAsp TyrLeuGly LeuSer SerTyrGly Ile Ile LysTyrAsn TyrAlaGln AlaAsnAsn GluLys IleGlnGln Leu Ser TyrGlyVal GlyMetAsp ValLeuPhe AspPhe IleThrAsn Tyr Thr AsnGluLys AsnProLys SerAsnLeu ThrLys LysValPhe Thr Ser SerLeuGly ValPheGly GlyLeuArg GlyLeu TyrAsnSer Tyr 35 Tyr LeuLeuAsn GlnTyrLys GlySerGly AsnLeu AsnValThr Gly Gly LeuAsnTyr ArgTyrLys HisSerLys TyrSer IleGlyIle Ser Val ProLeuVal GlnLeuLys SerArgIle ValSer SerAspGly Ala 4~ 705 71~ 715 720 Tyr ThrAsnSer IleThrLeu AsnGluGly GlySer HisPheLys Val Phe PheAsnTyr GlyTrpIle Phe (2) INFORMATION FOR SEQ ID N0:177:
(i} SEQUENCE CHARACTERISTICS:
(A) LENGTH: 529 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori ( ix ) FEATURE
(A) NAME/KEY: misc_feature (B) LOCATION 1...529 IO (xi) SEQUENCE DESCRIPTION: SEQ ID N0:177:
Met Thr TyrIleAsn TyrAsn GlnPheSer SerGlyAsn GlySer Gly Ser Lys ProProCys ProPro TyrGluAsn GlnAlaAsn CysVal AIa Lys Val ProProPhe ThrSer GlnAspAla LysAsnLeu ThrAsn Leu Met Leu AsnMetMet AlaVal PheAspSer LysSerTrp GluAsp Ala 2O Val Leu AsnAlaPro PheGln PheSerAsp AsnAsnLeu SerAla Pro Cys Tyr SerAspTyr LeuThr CysValAsn ProTyrAsn AspGly Leu Val Asp ProLysLeu IleAla LysAsnLys GlyAspGlu TyrAsn Ile 25 loo l05 llo Glu Asn GlyGlnThr GlySer ValIleLeu ThrProGln AspVal Ile Tyr Ser TyrArgVal AlaAsn AsnIleTyr ValAsnLeu LeuPro Thr 3O Arg Gly GlyAspLeu GlyLeu GlySerGln TyrGlyGly ProAsn Gly Pro Gly AspAspGly ThrAsn PheGlyAla LeuGlyIle LeuSer Pro Phe Leu AspProGlu IleLeu PheGlyLys GluLeuAsn LysVal Ala Ile Met GlnLeuArg AspIle IleHisGlu TyrGlyHis ThrLeu Gly Tyr Thr HisAsnGly AsnMet ThrTyrGln ArgValArg MetCys Glu 4O Glu Asn AsnGlyPro GluGlu ArgCysGln GlyGlyArg IleGlu Gln Val Asp GlyLysGlu ValGln ValPheAsp AsnGlyHis GluVal Arg Asp Thr AspGlySer ThrTyr AspValCys SerArgPhe LysAsp Lys Pro Tyr ThrAlaGly SerTyr ProAsnSer ~:.fTyrThr AspCys Ser Gln Val ProAlaGly LeuIle GlyValThr SerAlaVal TrpGln Gln SO Leu Ile AspGlnAsn AlaLeu ProValAsp PheThrAsn LeuSer Ser Gln Thr AsnTyrLeu AsnAla SerLeuAsn ThrGlnAsp PheAla Thr Thr Met LeuSerAla IleSer GlnSerLeu SerSerSer LysSer Ser 340 345 _ 350 Ala ThrThr TyrArgThr SerLys ThrSerArg ProPhe GlyAlaPro Leu LeuGly ValAsnLeu LysMet GlyTyrGln LysTyr PheAsnAsp Tyr LeuGly LeuSerSer TyrGly IleIleLys TyrAsn TyrAlaGln Ala AsnAsn GluLysIle GlnGln LeuSerTyr GlyVal GlyMetAsp 1~ Val LeuPhe AspPheIle ThrAsn TyrThrAsn GluLys AsnProLys 420 _ 425 430 Ser AsnLeu ThrLysLys ValPhe ThrSerSer LeuGly ValPheGly Gly LeuArg GlyLeuTyr AsnSer TyrTyrLeu LeuAsn GlnTyrLys Gly SerGly AsnLeuAsn ValThr GlyGlyLeu AsnTyr ArgTyrLys 465 470 475 4g0 His SerLys TyrSerIle GlyIle SerValPro LeuVal GlnLeuLys 2~ Ser ArgIle ValSerSer AspGly AlaTyrThr AsnSer IleThrLeu Asn GluGly GlySerHis PheLys ValPhePhe AsnTyr GlyTrpIle Phe (2) INFORMATION FOR SEQ ID N0:178:
(i) SEQUENCE CHARACTERISTICS:
3~ (A) LENGTH: 187 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...187 4S (xi) SEQUENCE r~ESCRIPTION: SEQ ID N0:178:
Leu Gly Cys Val Ser Met Thr Leu Gly Ile Asp Glu Ala Gly Arg Gly Cys Leu Ala Gly Ser Leu Phe Val Ala Gly Val Val Cys Asn Glu Lys S~ 20 25 30 Ile Ala Leu Glu Phe Leu Lys Met Gly Leu Lys Asp Ser Lys Lys Leu Ser Pro Lys Lys Arg Phe Phe Leu Glu Asp Lys Ile Lys Thr His Gly _._.__. . _.......__r..._. ~._._..._.

- 26$ -Glu Val GlyPhe PheValVal LysLysSer AlaAsnGlu IleAspHis 65 70 75 g0 Leu Gly LeuGly AlaCysLeu LysLeuAla IleGluGlu IleValGlu $ Asn Gly CysSer LeuAlaAsn GluIleLys IleAspGly AsnThrAla Phe Gly LeuAsn LysArgTyr ProAsnIle GlnThrIle IleLysGly Asp Glu ThrIle AlaGlnIle AlaMetAla SerValLeu AlaLysAla Ser Lys AspArg GluMetLeu GluLeuHis AlaLeuPhe LysGluTyr Gly Trp AspLys AsnCysGly TyrGlyThr LysGlnHis IleGluAla 1$ Ile Asn LysLeu GlyAlaThr LeuSerSer Ala (2) INFORMATION FOR SEQ ID N0:179:
2O (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 204 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 2$ (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
30 (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...204 3$
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:179:
Met Thr LeuGly IleAspGlu AlaGly ArgGlyCys LeuAlaGly Ser 40 I~euPhe ValAla GlyValVal CysAsn GluLysIle AlaLeuGlu Phe Leu Lys MetGly _LeuLysAsp SerLys LysLeuSer ProLysLys Arg Phe Phe LeuGlu AspLysIle LysThr HisGlyGlu ValGlyPhe Phe 4$ 50 55 60 Val Val LysLys SerAlaAsn GluIle AspHisLeu GlyLeuGly Ala Cys Leu LysLeu AlaIleGlu GluIle ValGluAsn GlyCysSer Leu $0 Ala Asn GluIle LysIleAsp GlyAsn ThrAlaPhe GlyLeuAsn Lys Arg Tyr ProAsn IleGlnThr IleIle LysGlyAsp GluThrIle Ala Gln Ile AlaMet AlaSerVal LeuAla LysAlaSer LysAspArg Glu Met Leu Glu Leu His Ala Leu Phe Lys Glu Tyr Gly Trp Asp Lys Asn Cys Gly Tyr Gly Thr Lys Gln His Ile Glu Ala Ile Asn Lys Leu Gly Ala Thr Pro Phe His Arg His Ser Phe Thr Leu Lys Asn Arg Ile Leu Asn Pro Lys Leu Leu Glu Val Glu Gln Arg Leu Val (2) INFORMATION FOR SEQ ID N0:180:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 192 amino acids IS (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein ZO (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori ZS ( i.x ) FEATURE
(A) NAME/KEY: misc_feature (B) LOCATION 1...192 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:180:
Met Asn Ala Leu Lys Lys Leu Ser Phe Cys Ala Leu Leu Ser Leu Gly Leu Phe AlaGln ThrValHis AlaGlnHis LeuLys AspThrIle Asn 3S Tyr Pro AspTrp LeuLysIle AsnLeuPhe AspLys LysAsnPro Pro Asn Gln TyrVal GlySerAla SerIleSer GlyLys ArgAsnAsp Phe Tyr Ser AsnTyr IleProTyr AspAspLys LeuPro ProGluLys Asn 65 70 75 g0 Ala Glu GluIle AlaLeuLeu ArgAlaArg MetAsn~AlaTyrSer Thr Leu Glu SerAla LeuLeuThr LysMetCys AsnArg IleValLys Ala 4S Leu Gln ValLys AsnAsnVal IleSerHis LeuPhe GlyPheVal 'asp Phe Leu ThrSer LysSerIle LeuAlaLys ArgPhe ValAspThr Thr Asn His ArgVal TyrValMet ValGlnPhe ProPhe IleGlnPro Glu Asp Leu IleAla TyrPheLys AlaLysArg IleAsp LeuSerLeu Ala Ser Ala ThrAsn LeuSerAla IleLeuAsn LysAla LeuPheHis Leu . _. . _ _____.._....r __ . ... _ (2) INFORMATION FOR SEQ ID N0:181:
(i) SEQUENCE CHARACTERISTICS:
S (A) LENGTH: 86 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein l~
(iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...86 ZO (xi)SEQUENCE SEQ ID
DESCRIPTION: N0:18:1:

Met AsnAlaLeu LysLys LeuSerPhe CysAlaLeu LeuSer LeuGly Leu PheAlaGln ThrVal HisAlaGln HisLeuLys AspThr IleAsn Tyr ProAspTrp LeuLys IleAsnLeu PheAspLys LysAsn ProPro Asn GlnTyrVal GlySer AlaSerIle SerGlyLys ArgAsn AspPhe Tyr SerAsnTyr IlePro TyrAspAsp LysLeuPro ProGlu ArgThr Leu LysLysSer LeuPhe 3S (2) INFORMATION FOR SEQ ID N0:182:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 75 amino acids (B) TYPE: amino acid 4~ (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
S~ (A) NAME/KEY: misc_feature (B) LOCATION 1...75 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:182:

Leu Lys Ile Leu Thr Leu Phe Leu IIe Gly Leu Asn Ala Leu Phe Ala Leu Asp Leu Asn Ala Leu Lys Thr Glu Ile Lys Glu Thr Tyr Leu Lys Glu Tyr Lys Asp Leu Lys Leu Glu Ile Glu Thr Ile Asn Leu Glu Ile Pro Glu Arg Phe Ser His Ala Ser Ile Leu Ser Tyr Glu Leu Asn Ala Ser Asn Lys Leu Lys Lys Asp Gly Ser Cys Phe (2) INFORMATION FOR SEQ ID N0:183:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 211 amino acids _ _ (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...211 3O (xi) SEQUENCE DESCRIPTION: SEQ ID N0:183:
Met Phe SerIleIle LeuGly GlyGlyGly GlyAsn ThrProCys Gly Leu Thr TrpGlnHis PheLys LeuGlyAsp LeuPhe GluIleGlu Lys Thr Leu SerPheAsn LysAsp AlaLeuThr GlnGly GlnAspTyr Asp Tyr Ile ThrArgThr SerGln AsnGlnGly ValLeu GlnThrThr Gly 40 Phe Val AsnAlaGlu AsnLeu AsnProPro PheThr TrpSerLeu Gly Leu Leu GlnMet-Asp PhePhe TyrArgLys LysSer TrpTyrAla Gly Gln Phe MetArgLys IleThr ProLysThr GluIle LysAsnLys Ile - 45 loo los llo Asn Ser ..r,,IleAla HisTyr PheThrThr LeuLeu AsnAlaLeu Lys Arg Pro LeuLeuSer ValLeu ValArgAsp IleAsp LysThrPhe Arg $0 Glu Gln LysIleGln LeuPro LeuLysPro ThrAla LysThrGln Ser Leu Asp GlyIleAsp PheAsp PheMetHis ThrLeu IleAsnAla Leu Met Lys GlnThrIle GlnGly ValValGln TyrCys AspAlaLys Ile Gln Ala Thr Lys Glu Val Ile Ser Gln Glu Thr Pro Ile Gln Lys Asp Ser Leu Phe (2) INFORMATION FOR SEQ ID N0:184:
(i) SEQUENCE CHARACTERISTICS:
l~ (A) LENGTH: 406 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 1$
(ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...406 2S (xi) SEQUENCE DESCRIPTION: SEQ ID N0:184:
Val IleGly ProLeuSer SerGln LeuAsnAla IleLysTrp GlyGlu Phe LysLeu GlyAspLeu PheGlu AlaSerAsn GlyAspPhe AspIle Gln LysArg HisIleAsn HisLys GlyGluPhe ValIleThr AlaGly Leu SerAsn AsnGlyVal LeuGly GlnSerAsp IleLysAla LysVal Phe GluSer HisThrIle ThrIle AspMetPhe GlyCysAla PheTyr 65 70 75 g0 Arg --SerPhe AlaTyrLys MetVal ThrHisAla ArgValPhe SerLeu Lys ProLys PheGluIle AsnHis LysIleGly LeuPheLeu SerThr loo l05 llo Leu PhePhe GlyTyrHis LysLys PheGlyTyr GluAsnMet CysSer Trp AlaLys IleLysAsn AspLys ValIleLeu ProLeuLys ProThr 4$ Ala AsnThr GlnThrLeu GluGly IleAspPhe AspPheMet GluLys Phe IleAla GluLeuGlu GlnCys ArgLeuAla GluLeuGln AlaTyr Leu LysAla ThrGlyLeu GluAsn ThrThrLeu SerAsnAsp GluGlu Asn AlaLeu AsnValPhe AsnAsn SerGlyGly GlyGlyGly AsnThr Pro CysGly LeuThrTrp GlnHis PheLysLeu GlyAspLeu PheGlu Ile Glu Lys Thr Leu Ser Phe Asn Lys Asp Ala Leu Thr Gln Gly Gln Asp Tyr Asp Tyr Ile Thr Arg Thr Ser Gln Asn Gln Gly Val Leu Gln $ Thr ThrGly PheValAsn AlaGlu AsnLeu AsnProPro PheThrTrp Ser LeuGly LeuLeuGln MetAsp PhePhe TyrArgLys LysSerTrp Tyr AlaGly GlnPheMet ArgLys IleThr ProLysThr GluIleLys 1~ 290 295 300 Asn LysIle AsnSerArg IleAla HisTyr PheThrThr LeuLeuAsn Ala LeuLys ArgProLeu LeuSer ValLeu ValArgAsp IleAspLys 1$ Thr PheArg GluGlnLys IleGln LeuPro LeuLysPro ThrAlaLys Thr GlnSer LeuAspGly IleAsp PheAsp PheMetHis ThrLeuIle Asn AlaLeu MetLysGln ThrIle GlnGly ValVa1Gln TyrCysAsp Ala LysIle GlnAlaThr LysGlu ValIle SerGlnGlu ThrProIle Gln LysAsp SerLeuPhe 2$

(2) INFORMATION FOR SEQ ID N0:185:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 275 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein 3S (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 4O (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...275 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:185:
4$
Met Ser Lys Ser Leu Tyr Gln Thr Leu Asn Val Ser G_a Asn Ala Ser Gln Asp Glu Ile Lys Lys Ser Tyr Arg Arg Leu Ala Arg Gln Tyr His Pro Asp Leu Asn Lys Thr Lys Glu Ala Glu Glu Lys Phe Lys Glu Ile Asn Ala Ala Tyr Glu Ile Leu Ser Asp Glu Glu Lys Arg Arg Gln Tyr Asp Gln Phe Gly Asp Asn Met Phe Gly Gly Gln Asn Phe 5er Asp Phe Ala ArgSerArg GlyProSer GluAsp LeuAspAsp IleLeuSer Ser Ile PheGlyLys GlyGlyPhe SerGln ArgPheSer GlnAsnSer Gln Gly PheSerGly PheAsnPhe SerAsn PheAlaPro GluAsnLeu Asp Val ThrAlaIle LeuAsnVal SerVal LeuAspThr LeuLeuGly Asn Lys LysGlnVal SerValAsn AsnGlu ThrPheSer LeuLysIle Pro Ile GlyValGlu GluGlyGlu LysIle ArgValArg AsnLysGly Lys Met GlyArgThr GlyArgGly AspLeu LeuLeuGln IleHisIle Glu Glu AspGluMet TyrArgArg GluLys AspAspIle IleGlnIle Phe Asp LeuProLeu LysThrAla LeuPhe GlyGlyLys IleGluIle Ala Zd Thr TrpHisLys ThrLeuThr LeuThr IleProPro AsnThrLys Ala Met GlnLysPhe ArgIleLys AspLys GlyIlELys SerArgLys Thr Ser HisValGly AspCysIle AlaSer SerPheAsp LeuLeuLys Leu Lys Arg Phe (2) INFORMATION FOR SEQ ID N0:186:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 278 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
4O (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature 4S (B) LOCATION 1...:'78 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:186:
Met Ser Lys Ser Leu Tyr Gln Thr Leu Asn Val Ser Glu Asn Ala Ser _ Gln Asp Glu Ile Lys Lys Ser Tyr Arg Arg Leu Ala Arg Gln Tyr His Pro Asp Leu Asn Lys Thr Lys Glu Ala Glu Glu Lys Phe Lys Glu Ile Asn Ala Ala Tyr Glu Ile Leu Ser Asp Glu Glu Lys Arg Arg Gln Tyr Asp GlnPheGly AspAsnMet PheGly GlyGlnAsn PheSerAsp Phe Ala ArgSerArg GlyProSer GluAsp LeuAspAsp IleLeuSer Ser Ile PheGlyLys GlyGlyPhe SerGln ArgPheSer GlnAsnSer Gln Gly PheSerGly PheAsnPhe SerAsn PheAlaPro GluAsnLeu Asp Val ThrAlaIle LeuAsnVal SerVal LeuAspThr LeuLeuGly Asn Lys LysGlnVal SerVal.AsnAsnGlu ThrPheSer LeuLysIle Pro Ile GlyValGlu GluGlyGlu LysIle ArgValArg AsnLysGly Lys Met GlyArgThr GlyArgGly AspLeu LeuLeuGln IleHisIle Glu Glu AspGluMet TyrArgArg GluLys AspAspIle IleGlnIle Phe Asp LeuProLeu LysThrAla LeuPhe GlyGlyLys IleGluIle Ala Thr TrpHisLys ThrLeuThr LeuThr IleProPro AsnThrLys Ala Met GlnLysPhe ArgIleLys AspLys GlyIleLys SerArgLys Thr Ser HisValGly AspCysIle AlaSer SerPheAsp LeuProLys Ile Glu ThrLeuLeu MetSer (2) INFORMATION FOR SEQ ID N0:187:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 232 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B} LOCATION 1...232 SO (xi) SEQUENCE DESCRIPTION: SEQ ID N0:187:
Val Val Gln Lys Phe Asn Phe Tyr Lys Thr Gly Gly Met Arg Leu Lys His Phe Lys Thr Phe Leu Phe Ile Thr Met Ala Val Ile Val Ile Gly 20 25 , 30 Thr GlyCys 'AlaAsnLys LysLysLys LysAsp GluTyrAsn LysPro Ala IlePhe TrpTyrGln GlyIleLeu ArgGlu IleLeuPhe AlaAsn Leu GluThr AlaAspAsn TyrTyrSer SerLeu GlnSerGlu HisIle Asn SerPro LeuValPro GluAlaMet LeuAla LeuGlyGln AlaHis Met LysLys LysGluTyr ValLeuAla SerPhe TyrPheAsp GluTyr Ile LysArg PheGlyThr LysAspAsn ValAsp TyrLeuThr PheLeu Lys LeuGln SerHisTyr TyrAlaPhe LysAsn HisSerLys AspGln Glu PheIle SerAsnSer IleValSer LeuGly GluPheIle GluLys Tyr ProAsn SerArgTyr ArgProTyr ValGlu TyrMetGln IleLys Phe IleLeu GlyGlnAsn GluLeuAsn ArgAla IleAlaAsn ValTyr Lys LysArg HisLysPro GluGlyVal LysArg TyrLeuGlu ArgIle Asp GluThr LeuGluLys GluThrLys ProLys ProSerHis MetPro Trp TyrVal LeuIlePhe AspTrp (2) INFORMATION FOR SEQ ID N0:188:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 114 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
4O (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...114 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:188:
Met Arg Phe Leu Asn Asn Lys His Arg Glu Lys Gly Leu Lys Ala Glu 1 5 to is Glu Glu Ala Cys Gly Phe Leu Lys Thr Leu Gly Phe Glu Met Ile Glu Arg Asn Phe Phe Ser Gln Phe Gly Glu Ile Asp Ile Ile Ala Leu Lys Lys Gly Val Leu His Phe Ile Glu Val Lys Ser Gly Glu Asn Phe Asp Pro Ile Tyr Ala Ile Thr Pro Ser Lys Lys Met Ile Lys Thr Lys Leu 65 70 75 g0 $ Ile Arg Cys Tyr Leu Ser Gln Lys Asn Ser Asp Phe Cys Ile Asp Pro Asp Ala Leu Ile Val Lys Asn Gly Glu Leu Leu Glu Asn Ile Lys Phe Thr Phe (2) INFORMATION
FOR
SEQ
ID
N0:189:

(i) SEQUENCE CHARACTERISTICS:

1$ (A) LENGTH: 101 amino acids (B) TYPE: amino acid (D) TOPOLOGY. linear (ii)MOLECULE TYPE: protein (iii)HYPOTHETICAL: YES

(vi)ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix)FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...101 3O (xi)SEQUENCE DESCRIPTION: SEQ
ID N0:189:

Met Gly Ser Ile Gly Ala Met Thr Ser Ser Asp Arg Tyr Phe Lys Gly Gln Glu Gly Val Ala Ser Glu Lys Pro Glu Gly Ile Glu Gly Leu Val Arg Val Pro Tyr Arg Gly Lys Val Met Ile Phe Gln Leu Val Ser Asp Gly Gly Val Arg Ser Ser Met Gly Gly Ala Lys Asn Ile Leu Tyr Gln Glu Leu Tyr Gln Asn AIa Glu Phe Ile Thr Ser Ala Gly Leu Val Glu 65 70 75 gp Lys Lys Ser His VaI His Gly Val Thr Lys Glu Ala Pro Asn Asp Ile - Ile Met Gly Glu Phe loo (2) INFORMATION FOR SEQ ID N0:190:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 481 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii)MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
$ (A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...481 1~
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:190:
Met Arg Ile Leu Gln Arg Ala Leu Thr Phe Glu Asp Val Leu Met Val IS Pro ArgLys SerSer ValLeuPro LysAsp ValSerLeu LysSerArg Leu ThrLys AsnIle GlyLeuAsn IlePro PheIleSer AlaAlaMet Asp ThrVal ThrGlu HisLysThr AlaIle AlaMetAla ArgLeuGly Gly IleGly IleVal HisLysAsn MetAsp IleGlnThr GlnValLys Glu IleThr LysVal LysLysSer GluSer GlyValIle AsnAspPro 2$ Ile PheIle HisAla HisArgThr LeuAla AspAlaLys ValIleThr Asp AsnTyr LysIle SerGlyVal ProVal ValAspAsp LysGlyLeu Leu IleGly IleLeu ThrAsnArg AspVal ArgPheGlu ThrAspLeu Ser LysLys ValGly AspValMet ThrLys MetProLeu ValThrAla His ValGly IleSer LeuAspGlu AlaSer AspLeuMet HisLysHis 35 Lys IleGlu LysLeu ProIleVal AspLys AspAsnVal LeuLysGly Leu IleThr IleLys AspIleGln LysArg IleGluTyr ProGluAla Asn LysAsp AspPhe GlyArgLeu ArgVal GlyAlaAla IleGlyVal Gly GlnLeu AspArg AlaGluMet LeuVal LysAlaGly ValAspAla Leu ValLeu AspSer AlaHisGly HisSer AlaAsnIle LeuHisThr 4$ Leu GluGlu IleLys LysSerLeu ValVal AspValIle ValGlyAsn Val ValThr LysGlu AlaThrSer AspLeu IleSerAla GlyAlaAsp Ala ValLys ValGly IleGlyPro GlySer IleCysThr ThrArgIle 5~. 290 295 300 Val AlaGly ValGly MetProGln ValSer AlaIleAsp AsnCysVal Glu ValAla SerLys PheAspIle ProVal IleAlaAsp GlyGlyIle Arg TyrSer GlyAsp ValAlaLys AlaLeuAla L_euGlyAla SerSer Val MetIle GlySer LeuLeuAla GlyThrGlu GluSerPro GlyAsp Phe MetIle TyrGln GlyArgGln TyrLysSer TyrArgGly MetGly Ser IleGly AlaMet ThrLysGly SerSerAsp ArgTyrPhe GlnGlu Gly ValAla SerGlu LysLeuVal ProGluGly IleGluGly ArgVal Pro TyrArg GlyLys VaISerAsp MetIlePhe GlnLeuVal GlyGly Val ArgSer SerMet GlyTyrGln GlyAlaLys AsnIleLeu GluLeu Tyr GlnAsn AlaGlu PheValGlu IleThrSer AlaGlyLeu LysGlu Ser HisVal HisGly ValAspIle ThrLysGlu AlaProAsn TyrTyr Gly (2) INFORMATIOIG FOR SEQ ID N0:191:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 204 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...204 4O (xi) SEQUENCE DESCRIPTION: SEQ ID N0:191:
Met Gln Gly Phe Leu Leu Gln Thr Gln Ser Ile Arg Asp Glu Asp Leu Ile Val His Val Leu Thr Lys Asn Gln Leu Lys Thr Leu Tyr Arg Phe ~'S 20 25 30 Tyr Gly Lys Arg His Ser Val Leu Asn Val Gly Arg Lys Ile Asp Phe Glu Glu Glu Asn Asp Asp Lys Phe Leu Pro Lys Leu Arg Asn Ile Leu 50 His Leu Gly Tyr Ile Trp Glu Arg Glu Met Glu Arg Leu Phe Phe Trp 65 70 75 . BO
Gln Arg Phe Cys Ala Leu Leu Phe Lys His Leu Glu Gly Val His Ser Leu Asp Ser Ile Tyr Phe Asp Thr Leu Asp Asp Gly Ala Ser Lys Leu ......._...~..~..~.__~..-~....__......

loo los llo Ser Lys Gln His Pro Leu Arg LeuGlu Met Tyr Ala Val Leu Val Ile Leu Asn Phe Glu Gly Arg Leu TyrAsn Ser Cys Phe Leu Cys Gln Ser Asp Ala Lys Leu Glu Arg Ser LeuAla Gln Gly Phe Ile Leu Val Ala Ala His Pro Ser Cys Leu Lys SerLeu Asp Leu Glu Lys Ile Ala Lys Gln Ala Phe Phe Arg Thr Gln IleAsp Leu Glu Thr Glu Glu Ser Thr VaI Glu Glu Leu Trp Arg Thr LeuGly Phe Leu Asn IS (2) INFORMATION
FOR
SEQ
ID
N0:192:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 82 amino acids (B) TYPE: amino acid 2~ (D) TOPOLOGY: linear (ii)MOLECULE TYPE: protein (iii)HYPOTHETICAL: YES

(vi)ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix)FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...82 (xi)SEQUENCE DESCRIPTION:
SEQ ID N0:192:

3S Met Gly Val Gly Arg Val Gly AlaLeu Leu Ala Cys Ala Gly Asn Met Pro Met Gly Ile Gly Ala Ile AlaIle Asn Gly Gly Arg Gln Ala Ile Arg Ser Arg Met Leu Val Val AspAsp Lys Arg Leu Glu Gln Asp Ile Val Gln Lys Met Leu Pro Gly ArgPro Val Thr Ala Leu Ser Asn Trp 50 _ 55 50 Trp Cys Leu Cys Ile Pro Lys AlaIle Arg Ala Arg Cys Cys Arg Gly 4S Glu Arg (2) INFORMATION
FOR
SEQ
ID
N0:193:

SO (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 67 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
S (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature IO (B) LOCATION 1...67 (xi~ SEQUENCE DESCRIPTION: SEQ ID N0:193:
Leu Ser Gly Thr Ala Val Ser Cys Arg Cys Thr Cys Arg Ile Gln Leu Val Leu Val Arg Thr Ser Ile Pro Val Val Ile Gly Cys Ser Cys Pro Phe Leu Ser Ser Ile Gly Phe Thr Thr Gly Thr His Gln Ser Pro Val 20 Lys Arg Cys Gly VaI Asn Ala Gly Lys Thr Pro Ser Lys Lys His Leu His Leu Asn ZS (2) INFORMATION FOR SEQ ID N0:194:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 114 amino acids (B) TYPE: amino acid 30 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES

(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
4O (A) NAME/KEY: misc_feature (B) LOCATION 1...114 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:194:
--- 4S Val Trp Leu Ala Ala Leu Gly Phe Leu Ile Thr Ala Val Gly Leu Pro 1 5 .0 15 Val Ile Thr Val Ile Ala Leu Ala Lys Val Gly Gly Ser Ser Thr Pro Ser Ala Ile Arg Ser Ala Gly Met Pro Ala Ala Cys Trp Arg Arg Ser Ala Thr Trp Arg Ser Ala Arg Cys Ser Pro Phe Arg Ala Pro Pro Arg Cys Pro Ser Lys Val Ser Val Val Pro Leu Leu Gly Glu Glu Ala Ala .. .~.__ _ .. .__ ..~.._ _ _...._.__.__ _.

Arg Arg Cys Ser Ser Thr Ala Trp Arg Thr Ser Ser Ser Pro Trp Pro g5 ~ 90 95 Ser Pro Ser Thr Pro Val Ala Cys Trp Thr Pro Ser Asp Ala Ser Ser S Pro Arg (2) INFORMATION
FOR
SEQ
ID N0:195:

IO (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

ZO (iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori ZS (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...20 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:195:

TATACCATGG
TGGGCGCTAA

(2) INFORMATION
FOR
SEQ
ID N0:196:

3S (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

4S (iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori SO (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...23 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:196:

(2) INFORMATION FOR SEQ ID N0:197:
S
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...22 2S (xi) SEQUENCE DESCRIPTION: SEQ ID N0:197:

(2) INFORMATION FOR SEQ ID N0:198:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double 3S (D) TOPOLOGY: circular iii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori _ 4S
(ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...23 SO (xi) SEQUENCE DESCRIPTION: SEQ ID N0:198:

(2) INFORMATION FOR SEQ ID N0:199:
_._. .... _._ _.____-_.._~._.._ _._ ...

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

1$ (A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...22 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:199:

ATATCCATGG
TGAGTTTGAT

2S (2) INFORMATION
FOR
SEQ
ID N0:200:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) 3S (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LQCATION 1...25 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:200:

ATGAATTCAA
TTTTTTATTT
TGCCA

SO (2) INFORMATION
FOR
SEQ
ID N0:201:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid WO 98/24475 PCTlL1S97/22104 (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL:' NO

(iv) ANTI-SENSE: NO

IO (vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc feature IS _ (B) LOCATION 1...21 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:201:

AATTCCATGG
TGGGGGCTAT

(2) INFORMATION
FOR SEQ
ID N0:202:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 23 base pairs 2S (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

3S (vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc feature 40 _ (B) LOCATION 1...23 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:202:

ATGAATTCTC
GATAGCCAAA

(2) INFORMATION
FOR SEQ
IL N~:203:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs SO (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

S

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...25 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:203:

IS AATTCCATGG
TGCATAACTT
CCATT

(2) INFORMATION
FOR
SEQ
ID N0:204:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular 2S (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NQ

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

3S (A) NAME/KEY: misc_feature (B) LOCATION 1...25 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:204:

AAGAATTCTC
TAGCATCCAA
ATGGA

(2) INFORMATION
FOR
SEQ
ID N0:205:

(i) SEQUENCE CHARACTERISTICS:

4S (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular S0 (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori S ( ix) FEATURE

(A) NAME/KEY: misc_feature (B) LOCATION 1...24 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:205:

ATTTCCATGG
TCATGTCTCA
TATT

(2) INFORMATION FOR SEQ ID N0:206:

IS (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

2S (iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori 3O (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...23 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:206:

ATGAATTCCA
TCTTTTATTC
CAC

(2) INFORMATION
FOR
SEQ
ID N0:207:

4O (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

SO (iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...27 S (xi) SEQUENCE DESCRIPTION: SEQ ID N0:207:

(2) INFORMATION FOR SEQ ID N0:208:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 28 base pairs {B) TYPE: nucleic acid (C) STRANDEDNESS: double 1S (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...28 3O (xi) SEQUENCE DESCRIPTION: SEQ ID N0:208:

AAGAATTCCA
CTCAAAATTT
TTTAACAG

(2) INFORMATION
FOR
SEQ
ID N0:209:

{i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double 40 (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc feature _ (B) LOCATION 1...25 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:209:

GATCATCCAT
ATGTTATCTT
CTAAT

S (2) INFORMATION
FOR
SEQ
ID N0:210:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid 1~ (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) IS (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

2~ (A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...23 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:210:

TGAATTCAAC
CATTTTAACC
CTG

(2) INFORMATION
FOR
SEQ
ID N0:211:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 27 base pairs (B) TYPE: nucleic acid 3S (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) 4O (iii) HYPOTHETICAL:-NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

4S ('~) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...27 S~ _ .

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:211:

TATACCATGG
TGAAATTTTT
TCTTTTA

(2) INFORMATION FOR SEQ ID N0:212:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) 1~
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
IS (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature 2~ (B) LOCATION 1...25 (xi) SEQG'ENCE DESCRIPTION: SEQ ID N0:212:

(2) INFORMATION FOR SEQ ID N0:213:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs 3~ (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
4O (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...24 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:213:

(2) INFORMATION FOR SEQ ID N0:214:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular $ (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

1~

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

IS (A) NAME/KEY: misc_feature (B) LOCATION 1...23 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:214:

ACTTGGGGCG
ATA

(2) INFORMATION
FOR
SEQ
ID N0:215:

(i) SEQUENCE CHARACTERISTICS:

2S (A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

4fl (A) NAME/KEY: misc_feature (B) LOCATION 1...25 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:215:

AAACCAATTA
AAACT

(2) INFORMATION
FOR
SEQ
ID N0:216:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
S (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori IO (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...23 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:216:

{2) INFORMATION FOR SEQ ID N0:217:
ZO (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
3O (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 3S (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...22 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:217:

(2) INFORMATION FOR SEQ ID N0:218:
4S (i) SEQUENCE CHARACTERTSTICS:
(A) LENGTH: 24 ...a ~e pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular SO
(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPbTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...24 IO (xi) SEQUENCE DESCRIPTION: SEQ ID N0:218:

TAGAATTCGC
CTCTAAAACT
TTAG

(2) INFORMATION
FOR
SEQ
ID N0:219:

1$

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double 20 (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

2$

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...22 3$ (xi) SEQUENCE DESCRIPTION: SEQ ID N0:219:

TTAACCATGG
TGAAAAGCGA

(2) INFORMATION
FOR
SEQ
ID N0:220:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

~O

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori _.... _..W .. .. _..._....-_-~ ~,.~. .

WO 98/24475 PCTlUS97122104 (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...23 S

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:220:

(2) INFORMATION
FOR SEQ
ID N0:221:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid IS (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) 2O (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

2S (A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...22 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:221:

ATATCCATGG
TGAGTTTGAT
GA , 3S (2) INFORMATION
FOR SEQ
ID N0:222:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) 4S (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

S~ (A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...25 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:222:

$
(2) INFORMATION FOR SEQ ID N0:223:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs {B) TYPE: nucleic acid {C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) 1$
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
2O (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
(A) NAME/KEY: misc_feature 2$ (B) LOCATION 1...23 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:223:

(2) INFORMATION FOR SEQ ID N0:224:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs 3$ (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
.__ 4$ (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylox~
(ix) FEATURE: _ (A) NAME/KEY: misc_feature $0 (B) LOCATION 1...25 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:224:

(2) INFORMATION
FOR
SEQ
ID N0:225:

(i) SEQUENCE CHARACTERISTICS:

S (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...24 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:225:

AATTTATGAA
AAAG

(2) INFORMATION
FOR
SEQ
ID N0:226:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular 3S (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori ( ix FEATURE
) 4S (A) NAME/KT;Y: misc_feature (B) LOCa_~.' JN 1. . .25 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:226:

SO TGAATTCGAA
AAAGTGTAGT
TATAC

(2) INFORMATION
FOR
SEQ
ID N0:227:

(i) SEQUENCE CHARACTERISTICS:

WO 98!24475 PCT/I1S97/22104 (A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C} STRANDEDNESS: double (D) TOPOLOGY: circular S

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

IO (iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori IS (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...19 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:227:

CCCTTCATTT
TAGAAATCG
lg (2) INFORMATION
FOR SEQ
ID N0:228:

2S (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

3S (iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori 4O (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...20 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:228:

ATTTCAACCA
ATTCAATGCG

(2) INFORMATION
FOR SEQ
ID N0:229:

SO (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
S
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori {ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION 1...20 IS (xi) SEQUENCE DESCRIPTION: SEQ ID N0:229:

(2) INFORMATION FOR SEQ ID N0:230:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double 2S (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori (ix) FEATURE:
- (A) NAME/KEY: misc_feature {B) LOCATION 1...22 4O (xi) SEQUENCE DESCRIPTION: SEQ ID N0:230:

(2) INFORMATION FOR SEQ ID N0:231:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double S0 (D} TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

S (A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...22 lO

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:231:

CTTGAATTAG
GGGCAAAGAT

IS (2) INFORMATION
FOR
SEQ
ID N0:232:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid 20 (C) STR.ANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) 2S (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

3O (A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...22 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:232:

ATGCGTTTTT
ACCCAAAGAA

4O (2) INFORMATION
FOR
SEQ
ID N0:233:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid 4S (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) SO (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

. ~. ~.~..... ~ ..._.. _ _._ __ _ __..__r...._. . _ _.. _ _ _._ (A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc feature _ (B) LOCATION 1...22 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:233:

ATAACGCCAC
TTCCTTATTG

lO

(2) INFORMATION
FOR
SEQ
ID N0:234:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 19 base pairs 1S (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

2S (vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc feature 3O _ (B) LOCATION 1...19 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:234:

CTTTGGGTAA
AAACGCATC

(2) INFORMATION
FOR
SEQ
ID N0:235:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs 4O (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) F__F~THETICAL: NO

(iv) ANTI-SENSE: NO

SO (vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc feature (B) LOCATION 1...20 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:235:

S CGATCTTTGA
TCCTAATTCA

(2) INFORMATION
FOR
SEQ
ID N0:236:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular IS (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

2S (A) NAME/KEY: misc_feature (B) LOCATION 1...19 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:236:

CTATGCTGA

(2) INFORMATION
FOR
SEQ
ID N0:237:

(i) SEQUENCE CHARACTERISTICS:

3S (A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular 40 (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

S0 (A) NAME/KEY: misc_feature (B) LOCATION 1...22 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:237:

WO 98/24475 PCTlUS97/22104 TTGAACACTT TTGATTATGC GG _ 22 (2) INFORMATION FOR SEQ ID N0:238:
S (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA_(genomic) {iii) HYPOTHETICAL: NO
IS (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 2O (ix) FEATURE:
{A) NAME/KEY: misc_feature (B) LOCATION 1..,23 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:238:

(2) INFORMATION FOR SEQ ID N0:239:
30 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
4U (iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter pylori 4S (ix) FEATURE:
(A) NAME/KEY: misc_feature {B) LOCATION 1...21 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:239:

{2) INFORMATION FOR SEQ ID N0:24.0:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double S (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...21 ZO (xi) SEQUENCE DESCRIPTION: SEQ ID N0:240:

AATGAGCGTA
AGAGAGCCTT

(2) INFORMATION
FOR
SEQ
ID N0:241:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C} STRANDEDNESS: double 3~ (D} TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A} ORGANISM: Helicobacter pylori (ix) FEATURE:

(A) NAME/KEY: misc_feature (B) LOCATION 1...18 4S (xi) SEQUENCE DESCRIPTION SEQ ID N0:241:

CTTATGGGGG
TATTGTCA

(2) INFORMATION
FOR
SEQ
ID N0:242:

SO _.

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double _..___.~-..~.____..... .~__...__ _.~._.r..

DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTS PARTiE DE CETTE DEMANDS OU CE BREVET
COMPREND PLUS D'UN TOME_ CECI EST LE TOME _ ~ DE,~
NOTE. Pour les tomes additionels, veuillez contacter le Bureau canadien des brevets 3'?a~3i~9 JUMBO APPLlCATIONSIPATENTS
THIS SECTION OF THE APPLfCATION/PATENT CONTAINS MORE
THAN ONE VOLUME
THIS IS VOLUME ,. L_ OF ~ -NOTE: For additional ~oiumes ~piease contact-the Canadian Patent Ofifice

Claims (99)

1. An isolated nucleic acid comprising a nucleotide sequence encoding an H. pylori polypeptide at least about 60% homologous to an amino acid sequence selected from the group consisting of SEQ ID NO: 98-SEQ ID NO: 194.

2. An isolated nucleic acid comprising a nucleotide sequence encoding an H. pylori polypeptide selected from the group consisting of SEQ ID NO: 98-SEQ
ID
NO: 194.

3. An isolated nucleic acid which encodes an H. pylori polypeptide, comprising a nucleotide sequence at least about 60% homologous to a nucleotide sequence selected from the group consisting of SEQ ID NO: 1-SEQ ID NO: 97, or a complement thereof.

4. The isolated nucleic acid of claim 1, comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1-SEQ ID NO: 97, or a complement thereof.

5. An isolated nucleic acid molecule encoding an H. pylori polypeptide, comprising a nucleotide sequence which hybridizes under stringent hybridization conditions to a nucleic acid molecule comprising the nucleotide sequence selected from the group consisting of SEQ ID NO: 1-SEQ ID NO: 97, or a complement thereof.

6. An isolated nucleic acid comprising a nucleotide sequence of at least 8 nucleotides in length, wherein the sequence hybridizes under stringent hybridization conditions to a nucleic acid having a nucleotide sequence selected from the group consisting of SEQ ID NO: 1-SEQ ID NO: 97, or a complement thereof.

7. An isolated nucleic acid comprising a nucleotide sequence encoding an H. pylori cell envelope polypeptide or a fragment thereof, said nucleic acid selected from the group consisting of SEQ ID NO: 63, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID
NO: 9, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID
NO: 27, SEQ ID NO: 28, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 61, SEQ ID

NO: 79, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 91, SEQ ID
NO: 94, SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID NO: 26, SEQ ID NO: 36, SEQ ID
NO: 42, SEQ ID NO: 52, SEQ ID NO: 22, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID
NO: 65, SEQ ID NO: 66, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 17, SEQ ID
NO: 18, SEQ ID NO: 19, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 38, SEQ ID
NO: 39, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 34, SEQ ID NO:
35, SEQ ID NO: 60, SEQ ID NO: 69, and SEQ ID NO: 83, or a complement thereof.

8. The isolated nucleic acid of claim 7, wherein said H. pylori cell envelope polypeptide or a fragment thereof is an H. pylori flagella-associated polypeptide or a fragment thereof comrising a nucleotide sequence of SEQ ID NO: 63, or a complement thereof.

9. The isolated nucleic acid of claim 7, wherein said H. pylori cell envelope polypeptide or a fragment thereof is an H. pylori inner membrane polypeptide or a fragment thereof encoded by a nucleic acid selected from the group consisting of SEQ
ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ
ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 38, and SEQ ID NO: 39, or a complement thereof.

10. The isolated nucleic acid of claim 9, wherein said H. pylori inner membrane polypeptide or a fragment thereof is an H. pylori polypeptide or a fragment thereof involved in transport encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 17, SEQ ID NO: 18, SEQ
ID NO: 19, SEQ ID NO: 43, and SEQ ID NO: 44, or a complement thereof.

11. The isolated nucleic acid of claim 7, wherein said H. pylori cell envelope polypeptide or a fragment thereof is an H. pylori outer membrane polypeptide or a fragment thereof encoded by a nucleic acid selected from the group consisting of SEQ
ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID
NO: 23, SEQ ID NO: 24, SEQ ID NO: 27, SEQ 1D NO: 28, SEQ ID NO: 50, SEQ ID
NO: 51, SEQ ID NO: 61, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID
NO: 85, SEQ ID NO: 91, SEQ ID NO: 94, SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID
NO: 26, SEQ ID NO: 36, SEQ ID NO: 42, SEQ ID NO: 52, SEQ ID NO: 22, SEQ ID
NO: 29, SEQ ID NO: 30, SEQ ID NO: 65, and SEQ ID NO: 66, or a complement thereof.

12. The isolated nucleic acid of claim 11, wherein said H. pylori outer membrane polypeptide or a fragment thereof is an H. pylori polypeptide having a terminal phenylalanine residue or a fragment thereof encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID
NO: 11, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID
NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 42, SEQ ID NO: 50, SEQ ID
NO: 51, SEQ ID NO: 52, SEQ ID NO: 61, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID
NO: 84, SEQ ID NO: 85, SEQ ID NO: 91, and SEQ ID NO: 94, or a complement thereof.

13. The isolated nucleic acid of claim 12, wherein said H. pylori outer membrane polypeptide or a fragment thereof is an H. pylori polypeptide having a terminal phenylalanine residue and a C-terminal tyrosine cluster or a fragment thereof encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 11, SEQ
ID NO: 26, SEQ ID NO: 36, SEQ ID NO: 42, and SEQ ID NO: 52, or a complement thereof.

14. An isolated nucleic acid comprising a nucleotide sequence encoding an H. pylori cell envelope polypeptide or a fragment thereof, wherein said polypeptide is selected from the group consisting of SEQ ID NO: 160, SEQ ID NO: 104, SEQ ID
NO:
105, SEQ ID NO: 106, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 120, SEQ ID
NO: 121, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 147, SEQ ID NO: 148, SEQ
ID NO: 158, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 181, SEQ ID NO: 182, SEQ ID NO: 188, SEQ ID NO: 191, SEQ ID NO: 102, SEQ ID NO: 108, SEQ ID NO:
123, SEQ ID NO: 133, SEQ ID NO: 139, SEQ ID NO: 149, SEQ ID NO: 119, SEQ ID
NO: 126, SEQ ID NO: 127, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 145, SEQ
ID NO: 146, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 135, SEQ ID NO: 136, SEQ ID NO: 98, SEQ ID NO:
99, SEQ ID NO: 103, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 157, SEQ ID
NO: 166, and SEQ ID NO: 180.

15. The isolated nucleic acid of claim 14, wherein said H. pylori cell envelope polypeptide or a fragment thereof is an H. pylori flagella-associated polypeptide or a fragment thereof comprising an amino acid sequence of SEQ ID
NO:
160.

16. The isolated nucleic acid of claim 14, wherein said H. pylori cell envelope polypeptide or a fragment thereof is an H. pylori inner membrane polypeptide or a fragment thereof selected from the group consisting of SEQ ID NO: 145, SEQ ID
NO: 146, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 140, SEQ
ID NO: 141, SEQ ID NO: 135, and SEQ ID NO: 136.

17. The isolated nucleic acid of claim 16, wherein said H. pylori inner membrane polypeptide or a fragment thereof is an H. pylori polypeptide or a fragment thereof involved in transport selected from the group consisting of SEQ ID NO:
145, SEQ ID NO: 146, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO:
140, and SEQ ID NO: 141.

18. The isolated nucleic acid of claim 14, wherein said H. pylori cell envelope polypeptide or a fragment thereof is an H. pylori outer membrane polypeptide or a fragment thereof selected from the group consisting of SEQ ID NO: 104, SEQ ID
NO: 105, SEQ ID NO: 106, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 120, SEQ
ID NO: 121, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 158, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 181, SEQ ID NO:
182, SEQ ID NO: 188, SEQ ID NO: 191, SEQ ID NO: 102, SEQ ID NO: 108, SEQ ID
NO: 123, SEQ ID NO: 133, SEQ ID NO: 139, SEQ ID NO: 149, SEQ ID NO: 119, SEQ
ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 162, and SEQ ID NO: 163.

19. The isolated nucleic acid of claim 18, wherein said H. pylori outer membrane polypeptide or a fragment thereof is an H. pylori polypeptide having a terminal phenylalanine residue or a fragment thereof selected from the group consisting of SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID
NO: 110, SEQ ID NO: 111, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 123, SEQ
ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 133, SEQ ID NO: 139, SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 158, SEQ ID NO: 176, SEQ ID NO:
177, SEQ ID NO: 181, SEQ ID NO: 182, SEQ ID NO: 188, and SEQ ID NO: 191.

20. The isolated nucleic acid of claim 19, wherein said H. pylori outer membrane polypeptide or a fragment thereof is an H. pylori polypeptide having a terminal phenylalanine residue and a C-terminal tyrosine cluster or a fragment thereof selected from the group consisting of SEQ ID NO: 108, SEQ ID NO: 123, SEQ ID
NO:
133, SEQ ID NO: 139, and SEQ ID NO: 149.

21. An isolated nucleic acid comprising a nucleotide sequence encoding an H. pylori cytoplasmic polypeptide or a fragment thereof, said nucleic acid selected from the group consisting of SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 86, SEQ ID
NO:
87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 92, and SEQ ID NO: 93, or a complement thereof.

22. The isolated nucleic acid of claim 21, wherein said H. pylori cytoplasmic polypeptide or a fragment thereof is an H. pylori polypeptide or a fragment thereof involved in mRNA translation, said nucleic acid selected from the group consisting of SEQ ID NO: 57 and SEQ ID NO: 58, or a complement thereof.

23. The isolated nucleic acid of claim 21, wherein said H. pylori cytoplasmic polypeptide or a fragment thereof is an H. pylori polypeptide or a fragment thereof involved in genome replication, transcription, recombination and repair, said nucleic acid selected from the group consisting of SEQ ID NO: 86 and SEQ ID NO: 87, or a complement thereof.

24. An isolated nucleic acid comprising a nucleotide sequence encoding an H. pylori cytoplasmic polypeptide or a fragment thereof, wherein said polypeptide is selected from the group consisting of SEQ ID NO: 154, SEQ ID NO: 155, SEQ ID
NO:
183, SEQ ID NO: 184, SEQ ID NO: 185, SEQ ID NO: 186, SEQ ID NO: 189, and SEQ
ID NO: 190.

25. The isolated nucleic acid of claim 24, wherein said H. pylori cytoplasmic polypeptide or a fragment thereof is an H. pylori polypeptide or a fragment thereof involved in mRNA translation selected from the group consisting of SEQ ID NO:

and SEQ ID NO: 155.

26. The isolated nucleic acid of claim 24, wherein said H. pylori cytoplasmic polypeptide or a fragment thereof is an H. pylori polypeptide or a fragment thereof involved in genome replication, transcription, recombination and repair selected from the group consisting of SEQ ID NO: 183 and SEQ ID NO: 184.

27. An isolated nucleic acid comprising a nucleotide sequence encoding an H. pylori secreted polypeptide or a fragment thereof, said nucleic acid selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 20, SEQ ID NO: 25, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 53 SEQ ID NO: 64, SEQ ID NO: 67, SEQ ID NO: 70, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 90, SEQ ID NO: 95, and SEQ ID NO: 97, or a complement thereof.

28. An isolated nucleic acid comprising a nucleotide sequence encoding an H. pylori secreted polypeptide or a fragment thereof selected from the group consisting of SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID
NO: 117, SEQ ID NO: 122, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 142, SEQ
ID NO: 143, SEQ ID NO: 150 SEQ ID NO: 161, SEQ ID NO: 164, SEQ ID NO: 167, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 178, SEQ ID NO: 179, SEQ ID NO:
187, SEQ ID NO: 192, and SEQ ID NO: 194.

29. An isolated nucleic acid comprising a nucleotide sequence encoding an H. pylori cellular polypeptide or a fragment thereof, said nucleic acid selected from the group consisting of SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 21, SEQ ID NO:
33, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 47, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56 SEQ ID NO: 59, SEQ ID NO: 62, SEQ ID NO: 68, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, and SEQ ID NO: 96, or a complement thereof.

30. An isolated nucleic acid comprising a nucleotide sequence encoding an H. pylori cellular polypeptide or a fragment thereof, wherein said polypeptide is selected from the group consisting of SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 118, SEQ ID NO: 130, SEQ ID NO: 134, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO:
144, SEQ ID NO: 151, SEQ ID NO: 152, SEQ ID NO: 153, SEQ ID NO: 156, SEQ ID
NO: 159, SEQ ID NO: 165, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 170, SEQ
ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, and SEQ ID NO: 193.

31. A probe comprising a nucleotide sequence consisting of at least 8 nucleotides of a nucleotide sequence selected from the group consisting of SEQ
ID NO:
1-SEQ ID NO: 97, or a complement thereof.

32. A recombinant expression vector comprising the nucleic acid of any of claims 1, 2, 3, 4, 5, 6, 7, 14, 21, 24, 27, 28, 29 or 30 operably linked to a transcription regulatory element.

33. A cell comprising a recombinant expression vector of claim 32.

34. A method for producing an H. pylori polypeptide comprising culturing a cell of claim 33 under conditions that permit expression of the polypeptide.

35. The method of claim 34, further comprising purifying the polypeptide from the cell.

36. A method for detecting the presence of a Helicobacter nucleic acid in a sample comprising:
(a) contacting a sample with a nucleic acid of any of claims 6 or 31 so that a hybrid can form between the probe and a Helicobacter nucleic acid in the sample; and (b) detecting the hybrid formed in step (a), wherein detection of a hybrid indicates the presence of a Helicobacter nucleic acid in the sample.

37. An isolated H. pylori polypeptide comprising an amino acid sequence at least about 60% homologous to an H. pylori polypeptide selected from the group consisting of SEQ ID NO: 98-SEQ ID NO: 194.

38. An isolated H. pylori polypeptide which is encoded by a nucleic acid comprising a nucleotide sequence at least about 60% homologous to a nucleotide sequence selected from the group consisting of SEQ ID NO: 1-SEQ ID NO: 97.

39. The isolated H. pylori polypeptide of claim 28, wherein said polypeptide is encoded by a nucleotide sequence selected from the group consisting of SEQ
ID NO:
1-SEQ ID NO: 97.

40. An isolated H. pylori polypeptide which is encoded by a nucleic acid which hybridizes under stringent hybridization conditions to a nucleic acid selected from the group consisting of SEQ ID NO: 1-SEQ ID NO: 97, or a complement thereof.

41. An isolated H. pylori polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 97-SEQ ID NO: 194.

42. An isolated H. pylori cell envelope polypeptide or a fragment thereof, wherein said polypeptide is selected from the group consisting of SEQ ID NO:
160, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 110, SEQ ID NO:
111, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID
NO: 147, SEQ ID NO: 148, SEQ ID NO: 158, SEQ ID NO: 176, SEQ ID NO: 177, SEQ
ID NO: 181, SEQ ID NO: 182, SEQ ID NO: 188, SEQ ID NO: 191, SEQ ID NO: 102, SEQ ID NO: 108, SEQ ID NO: 123, SEQ ID NO: 133, SEQ ID NO: 139, SEQ ID NO:
149, SEQ ID NO: 119, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 162, SEQ ID
NO: 163, SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 114, SEQ ID NO: 115, SEQ
ID NO: 116, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 135, SEQ ID NO: 136, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 103, SEQ ID NO: 131, SEQ ID NO:
132, SEQ ID NO: 157, SEQ ID NO: 166, and SEQ ID NO: 180.

43. The isolated polypeptide of claim 42, wherein said H. pylori cell envelope polypeptide or a fragment thereof is an H. pylori flagella-associated polypeptide or a fragment thereof comprising an amino acid sequence of SEQ ID
NO:160.

44. The isolated polypeptide of claim 43, wherein said H. pylori cell envelope polypeptide or a fragment thereof is an H. pylori inner membrane polypeptide or a fragment thereof selected from the group consisting of SEQ ID NO: 145, SEQ ID
NO: 146, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 140, SEQ
ID NO: 141, SEQ ID NO: 135, SEQ ID NO: 136.

45. The isolated polypeptide of claim 44, wherein said H. pylori inner membrane polypeptide or a fragment thereof is an H. pylori polypeptide or a fragment thereof involved in transport selected from the group consisting of SEQ ID NO:
145, SEQ ID NO: 146, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO:
140, and SEQ ID NO: 141.

46. The isolated polypeptide of claim 43, wherein said H. pylori cell envelope polypeptide or a fragment thereof is an H. pylori outer membrane polypeptide or a fragment thereof selected from the group consisting of SEQ ID NO: 104, SEQ ID

NO: 105, SEQ ID NO: 106, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 120, SEQ
ID NO: 121, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 158, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 181, SEQ ID NO:
182, SEQ ID NO: 188, SEQ ID NO: 191, SEQ ID NO: 102, SEQ ID NO: 108, SEQ ID
NO: 123, SEQ ID NO: 133, SEQ ID NO: 139, SEQ ID NO: 149, SEQ ID NO: 119, SEQ
ID NO: 126, SEQ ID NO: I27, SEQ ID NO: 162, and SEQ ID NO: 163.

47. The isolated polypeptide of claim 46, wherein said H. pylori outer membrane polypeptide or a fragment thereof is an H. pylori polypeptide having a terminal phenylalanine residue or a fragment thereof selected from the group consisting of SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID
NO: 110, SEQ ID NO: 111, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 123, SEQ
ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 133, SEQ ID NO: 139, SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 158, SEQ ID NO: 176, SEQ ID NO:
177, SEQ ID NO: 181, SEQ ID NO: 182, SEQ ID NO: 188, and SEQ ID NO: 191.

48. The isolated polypeptide of claim 47, wherein said X. pylori outer membrane polypeptide or a fragment thereof is an H. pylori polypeptide having a terminal phenylalanine residue and a C-terminal tyrosine cluster or a fragment thereof selected from the group consisting of SEQ ID NO: 108, SEQ ID NO: 123, SEQ ID
NO:
133, SEQ ID NO: 139, and SEQ ID NO: 149.

49. An isolated H. pylori cell envelope polypeptide or a fragment thereof, wherein said polypeptide is encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 63, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 61, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 91, SEQ ID NO: 94, SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID NO: 26, SEQ ID NO: 36, SEQ ID NO: 42, SEQ ID NO: 52, SEQ ID NO: 22, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 60, SEQ
ID NO: 69, and SEQ ID NO: 83.

50. The isolated polypeptide of claim 49, wherein said H. pylori cell envelope polypeptide or a fragment thereof is an H. pylori flagella-associated polypeptide or a fragment thereof encoded by a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 63.

51. The isolated polypeptide of claim 49, wherein said H. pylori cell envelope polypeptide or a fragment thereof is an H. pylori inner membrane polypeptide or a fragment thereof encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 38, SEQ ID NO: 39.

52. The isolated polypeptide of claim 51, wherein said H. pylori inner membrane polypeptide or a fragment thereof is an H. pylori polypeptide or a fragment thereof involved in transport encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 17, SEQ ID NO: 18, SEQ
ID NO: 19, SEQ ID NO: 43, and SEQ ID NO: 44.

53. The isolated polypeptide of claim 49, wherein said H. pylori cell envelope polypeptide or a fragment thereof is an H. pylori outer membrane polypeptide or a fragment thereof encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 14, SEQ
ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 50, SEQ
ID NO: 51, SEQ ID NO: 61, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 84, SEQ
ID NO: 85, SEQ ID NO: 91, SEQ ID NO: 94, SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID
NO: 26, SEQ ID NO: 36, SEQ ID NO: 42, SEQ ID NO: 52, SEQ ID NO: 22, SEQ ID
NO: 29, SEQ ID NO: 30, SEQ ID NO: 65, and SEQ ID NO: 66.

54. The isolated polypeptide of claim 53, wherein said H. pylori outer membrane polypeptide or a fragment thereof is an H. pylori polypeptide having a terminal phenylalanine residue or a fragment thereof encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID
NO: 11, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID
NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 36, SEQ ID NO: 42, SEQ ID
NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 61, SEQ ID NO: 79, SEQ ID
NO: 80, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 91, and SEQ ID NO: 94.

55. The isolated polypeptide of claim 54, wherein said H. pylori outer membrane polypeptide or a fragment thereof is an H. pylori polypeptide having a terminal phenylalanine residue and a C-terminal tyrosine cluster or a fragment thereof encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 11, SEQ
ID NO: 26, SEQ ID NO: 36, SEQ ID NO: 42, and SEQ ID NO: 52.

56. An isolated H. pylori cytoplasmic polypeptide or a fragment thereof, wherein said polypeptide is selected from the group consisting of SEQ ID NO:
154, SEQ ID NO: 155, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 185, SEQ ID NO:
186, SEQ ID NO: 189, and SEQ ID NO: 190.

57. The isolated polypeptide of claim 56, wherein said H. pylori cytoplasmic polypeptide or a fragment thereof is an H. pylori polypeptide or a fragment thereof involved in mRNA translation selected from the group consisting of SEQ ID NO:

and SEQ ID NO: 155.

58. The isolated polypeptide of claim 56, wherein said H. pylori cytoplasmic polypeptide or a fragment thereof is an H. pylori polypeptide or a fragment thereof involved in genome replication, transcription, recombination and repair selected from the group consisting of SEQ ID NO: 183 and SEQ ID NO: 184.

59. An isolated H. pylori cytoplasmic polypeptide or a fragment thereof, wherein said polypeptide is encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 92, and SEQ ID NO: 93.

60. The isolated polypeptide of claim 59, wherein said H. pylori cytoplasmic polypeptide or a fragment thereof is an H. pylori polypeptide or a fragment thereof involved in mRNA translation, said polypeptide encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 57 and SEQ ID NO: 58.

61. The isolated polypeptide of claim 59, wherein said H. pylori cytoplasmic polypeptide or a fragment thereof is an H. pylori polypeptide or a fragment thereof involved in genome replication, transcription, recombination and repair, said polypeptide encoded by a nucleic acid selected from the group consisting of SEQ ID
NO: 86 and SEQ ID NO: 87.

62. An isolated H. pylori cellular polypeptide or a fragment thereof, wherein said polypeptide is selected from the group consisting of SEQ ID NO: 112, SEQ
ID NO:
113, SEQ ID NO: 118, SEQ ID NO: 130, SEQ ID NO: 134, SEQ ID NO: 137, SEQ ID
NO: 138, SEQ ID NO: 144, SEQ ID NO: 151, SEQ ID NO: 152, SEQ ID NO: 153, SEQ
ID NO: 156, SEQ ID NO: 159, SEQ ID NO: 165, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 170, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, and SEQ ID
NO: 193.

63. An isolated H. pylori cellular polypeptide or a fragment thereof, wherein said polypeptide is encoded by a nucleic acid selected from the group consisting of SEQ
ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 21, SEQ ID NO: 33, SEQ ID NO: 37, SEQ
ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 47, SEQ ID NO: 54, SEQ ID NO: 55, SEQ
ID NO: 56 SEQ ID NO: 59, SEQ ID NO: 62, SEQ ID NO: 68, SEQ ID NO: 71, SEQ ID
NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, and SEQ
ID NO: 96.

64. An isolated H. pylori secreted polypeptide or a fragment thereof, wherein said polypeptide is selected from the group consisting of SEQ ID NO: 100, SEQ
ID NO:
101, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 117, SEQ ID NO: 122, SEQ ID
NO: 128, SEQ ID NO: 129, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 150 SEQ
ID NO: 161, SEQ ID NO: 164, SEQ ID NO: 167, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 178, SEQ ID NO: 179, SEQ ID NO: 187, SEQ ID NO: 192, and SEQ ID
NO: 194.

65. An isolated H. pylori secreted polypeptide or a fragment thereof, wherein said polypeptide is encoded by a nucleic acid selected from the group consisting of SEQ
ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 20, SEQ ID
NO: 25, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID
NO: 53 SEQ ID NO: 64, SEQ ID NO: 67, SEQ ID NO: 70, SEQ ID NO: 77, SEQ ID
NO: 78, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 90, SEQ ID NO: 95, and SEQ
ID NO: 97.

66. A fusion protein comprising an H. pylori polypeptide which comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 98-SEQ ID
NO:
194 operatively linked to a non-H. pylori polypeptide.

67. A vaccine formulation for prophylactic or therapeutic treatment of an H.
pylori infection comprising an effective amount of at least one isolated nucleic acid of any of claims 1, 2, 3, 4, 5, 6, 7, 14, 21, 24, 27, 28, 29 or 30.

68. A vaccine formulation for prophylactic or therapeutic treatment of an H.
pylori infection comprising an effective amount of at least one H. pylori polypeptide or a fragment thereof of any of claims 37, 38, 40, 41, 42, 49, 56, 59, 62, 63, 64 or 65.

69. A vaccine formulation of claim 67, further comprising a pharmaceutically acceptable carrier.

70. A vaccine formulation of claim 68, further comprising a pharmaceutically acceptable carrier.

71. A vaccine formulation of claim 69, wherein the pharmaceutically acceptable carrier comprises an adjuvant.

72. A vaccine formulation of claim 70, wherein the pharmaceutically acceptable carrier comprises an adjuvant.

73. A vaccine formulation of claim 69, wherein the pharmaceutically acceptable carrier comprises a delivery system.

74. A vaccine formulation of claim 70, wherein the pharmaceutically acceptable carrier comprises a delivery system.

75. A vaccine formulation of claim 73, wherein the delivery system comprises a live vector.

76. A vaccine formulation of claim 74, wherein the delivery system comprises a live vector.

77. A vaccine formulation of claim 75, wherein the live vector is a bacteria or a virus.

78. A vaccine formulation of claim 76, wherein the live vector is a bacteria or a virus.

79. A vaccine formulation of claim 73, wherein the pharmaceutically acceptable carrier further comprises an adjuvant.

80. A vaccine formulation of claim 74, wherein the pharmaceutically acceptable carrier further comprises an adjuvant.

81. A vaccine formulation for prophylactic or therapeutic treatment of an H.
pylori infection comprising an effective amount of at least one isolated nucleic acid encoding an H. pylori outer membrane polypeptide or a fragment thereof, said nucleic acid selected from the group consisting of SEQ ID NO: 28, SEQ ID NO: 50, SEQ
ID
NO: 24, SEQ ID NO: 11, SEQ ID NO: 52, SEQ ID NO: 42 and SEQ ID NO: 79.

82. The vaccine formulation of claim 81, wherein said nucleic acid comprises a nucleotide sequence of SEQ ID NO: 52.

83. A vaccine formulation for prophylactic or therapeutic treatment of an H.
pylori infection comprising an effective amount of at least one H. pylori outer membrane polypeptide or a fragment thereof, said polypeptide selected from the group consisting of SEQ ID NO: 125, SEQ ID NO: 147, SEQ ID NO: 121, SEQ ID NO: 108, SEQ ID NO:
149, SEQ ID NO: 139 and SEQ ID NO: 176.

84. The vaccine formulation of claim 81, wherein said polypeptide comprises an amino acid sequence of SEQ ID NO: 149.

85. A vaccine formulation of claims 81 or 83, further comprising a pharmaceutically acceptable carrier.

86. A vaccine formulation of claim 85, wherein the pharmaceutically acceptable carrier comprises an adjuvant.

87. A vaccine formulation of claim 85, wherein the pharmaceutically acceptable carrier comprises a delivery system.

88. A vaccine formulation of claim 87, wherein the delivery system comprises a live vector.

89. A vaccine formulation of claim 88, wherein the live vector is a bacteria or a virus.

90. A vaccine formulation of claim 86, wherein the pharmaceutically acceptable carrier further comprises an adjuvant.

91. A method of treating or reducing a risk of H. pylori infection in a subject comprising administering to a subject a vaccine formulation of claim 67, such that treatment or reduction of risk of H. pylori infection occurs.

92. A method of treating or reducing a risk of H. pylori infection in a subject comprising administering to a subject a vaccine formulation of claim 68, such that treatment or reduction of risk of H. pylori infection occurs.

93. A method of treating or reducing a risk of H. pylori infection in a subject comprising administering to a subject a vaccine formulation of claim 81, such that treatment or reduction of risk of H. pylori infection occurs.

94. A method of treating or reducing a risk of H. pylori infection in a subject comprising administering to a subject a vaccine formulation of claim 83, such that treatment or reduction of risk of H. pylori infection occurs.

95. A method of producing a vaccine formulation comprising: combining at least one isolated H. pylori polypeptide or a fragment thereof selected from the group consisting of SEQ ID NO: 98-SEQ ID NO: 194 with a pharmaceutically acceptable carrier to thereby form a vaccine formulation.

96. A method of producing a vaccine formulation comprising:
(a) providing at least one isolated H. pylori polypeptide or a fragment thereof selected from the group consisting of SEQ ID NO: 98-SEQ ID NO: 194;
and (b) combining at least one said isolated H. pylori polypeptide or a fragment thereof with a pharmaceutically acceptable carrier to thereby form a vaccine formulation.

97. A method of producing a vaccine formulation comprising:
(a) culturing a cell under condition that permit expression of an H.
pylori polypeptide or a fragment thereof selected from the group consisting of SEQ ID
NO: 98-SEQ ID NO: 194;
(b) isolating said H. pylori polypeptide or a fragment thereof from said cell; and (c) combining at least one said isolated H. pylori polypeptide or a fragment thereof with a pharmaceutically acceptable carrier to thereby form a vaccine formulation.

98. A chimeric H. pylori polypeptide comprising at least two H. pylori polypeptides or fragments thereof, wherein said polypeptides are encoded by nucleic acid sequences selected from the group consisting of SEQ ID NO:1-SEQ ID NO:97.

99. A chimeric H. pylori polypeptide comprising at least two H. pylori polypeptides or fragments thereof, wherein said polypeptides are selected from the group consisting of SEQ ID NO:98-SEQ ID NO:194.