CA2270873A1 - Secreted proteins and polynucleotides encoding them - Google Patents

Abstract

Novel polynucleotides and the proteins encoded thereby are disclosed.

Description

SECRETED PROTEINS AI\rD I'OLYNU~: LEOTIDES ENCODING THEM
This application is a continuation-in-part of the following applications: Ser.
No.
08 / 7=I9,745, filed November 1;, 1996; and Ser. i v o. O8 / 867,678, filed ) une 2, l997.
FIELD OF TIDE I\ VENTION

2 0 The present invention provides novel polvnucleotides and proteins encoded by such polynucleotides, along with therapeutic, diagnostic and research utilities for these polynucleotides and proteins.
BACKGROUND OF THE INVENTION
2 5 Technology aimed at the discovery of F~rotein factors (including e.g., cytokines, such as lymphokines, interferons, CSFs and interleukins) has matured rapidly over the past decade. The now routine hvbridilation cloning and expression cloning techniques clone novel polvnucleotides "directly" in the sense that they rely on information directly related to the discovered protein (i.e., partial DNA/amino acid sequence of the protein 3 0 in the case of hybridization cloning; activity of the protein in the case of expression cloning). More recent "indirect" cloning techniques such as signal sequence cloning, which isolates DNA sequences based on the presence of a now v~~ell-recognized secretory leader sequence motif, as well as various PCR-based or low stringency hybridization cloning techniques, have advanced the state of the art by making available large numbers of 3 5 DNA / amino acid sequences for proteins that are known to have biological activity by virtue of their secreted nature in the case of leader sequence cloning, or by virtue of the cell or tissue source in the case of PCR-based techniques. It is to these proteins and the polynucleotides encoding them that the present invention is directed.

SUMMAKY OF THE INVENTION
In one embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:l;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:l from nucleotide 68 to nucleotide 430;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:1 from nucleotide l28 to nucleotide 430;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone AJ20_2 deposited under accession number ATCC 9826l;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone AJ20_2 deposited under accession number ATCC 98261;
(f) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone AJ20 2 deposited under accession number ATCC
9826l;
(g) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone AJ20_2 deposited under accession number ATCC 98261;
2 0 (h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:2;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:2 having biological activity;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (1) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in {a)-(i).
3 0 Preferably, such polynucleotide comprises the nucleotide sequence of SEQ
ID
NO:1 from nucleotide 68 to nucleotide 430; the nucleotide sequence of SEQ ID
NO:l from nucleotide 128 to nucleotide 430; the nucleotide sequence of the full-length protein coding sequence of done AJ20_2 deposited under accession number ATCC 98261; or the nucleotide sequence of the mature protein coding sequence of clone AJ20_2 deposited WO 98l21332 PCT/US97/20740 under accession number ,ATCC 98261. In other preferred embodiments, the polvnucleotide encodes the full-length or mature protein encoded by the cDNA
insert of clone AJ20 2 deposited under accession number ATCC 9826l.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID NO:1 or SEQ ID N0:3.
' In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an arr~ino acid sequence selected from the group consisting of:
(a) the amino acid sequencf~ of SEQ ID N0:2;
(b) fragments of the amino acid sequence of SEQ ID N0:2; and (c) the amino acid sequence encoded by the cDNA insert of clone AJ20_2 deposited under accession nurr~ber ATCC 98261;
the protein being substantially free from other mammalian proteins. Preferably such protein comprises the amino acid sequence of SEQ ID N0:2.
In one embodiment, the present invention provides a composition comprising an isolated polvnucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:5;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
2 0 N0:5 from nucleotide 289 to nucleotide 78();
(c) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone AR440_1 deposited under accession number ATCC 98261;
(d) a polynucleotide encoding the full-length protein encoded by the 2 5 cDNA insert of clone AR440_1 deposits=d under accession number ATCC 98261;
(e) a polynucleotide compri;~ing the nucleotide sequence of the mature protein coding sequence of clone AR440_1 deposited under accession number ATCC 98261;
(f) a polynucleotide encoding the mature protein encoded by the 3 0 cDNA insert of clone AR440_1 deposited under accession number ATCC 98261;
(g) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:6;
(h) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:6 having biological activity;

(i) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(f) above;
(j) a polynucleotide which encodes a species homologue of the protein of (gj or (h) above ; and S (k) a polynucleo6de capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(h).
Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID
N0:5 from nucleotide 289 to nucleotide 780; the nucleotide sequence of the full-length protein coding sequence of clone AR440_1 deposited under accession number ATCC
98261; or the nucleotide sequence of the mature protein coding sequence of clone AR440_1 deposited under acression number ATCC 98261. In other preferred embodiments, the polvnucleotide encodes the full-length or mature protein encoded by the cDNA
insert of clone AIZ4=10_1 deposited under accession number ATCC 98261. In vet other preferred embodiments, the present invention provides a polvnucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:6 from amino acid 1 to amino acid 160.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:5 or SEQ ID N0:4.
In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group 2 0 consisting of:
(a) the amino acid sequence of SEQ ID N0:6;
(b) the amino acid sequence of SEQ ID N0:6 from amino acid 1 to amino acid 160;
(c) fragments of the amino acid sequence of SEQ ID N0:6; and 2 5 (d) the amino acid sequence encoded by the cDNA insert of clone AR4~10_l deposited under accession number ATCC 98261;
the protein being substantially free from other mammalian proteins. Preferably such protein comprises the amino acid sequence of SEQ ID N0:6 or the amino acid sequence of SEQ ID N0:6 from amino acid 1 to amino acid 160.
3 0 In one embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:7;

(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:7 from nucleotide 76 to nucleotide 1050;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:7 from nucleotide 331 to nucleotide 567;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone AS16~_1 deposited under accession number ATCC 98261;
(e) a polvnucleotide encoding the full-length protein encoded by the cDNA insert of clone AS16-1_1 deposited under accession number ATCC 98261;
(f) a polynucleotide compri~;inl; the nucleotide sequence of the mature protein coding sequence of clone AS16-I_1 deposited under accession number ATCC 98261;
(g) a polvnucleotide encoding the mature protein encoded by the cDNA insert of clone AS16~I_1 deposited under accession number ATCC 9826l;
(h) a polynucleotide encoding ~ protein comprising the amino acid sequence of SEQ ID N0:8;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:8 having biological activity;
(j) a polynucleotide which is an allelic variant of a polvnucleotide of 2 0 (a)-(g) above;
(k) a polynucleotide which enacodes a species homologue of the protein of (h') or (i) above ; and (1) a polvnucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(i).
2 5 Preferably, such polynucleotide comprises the nucleotide sequence of SEQ
ID
N0:7 from nucleotide 76 to nucleotide 1050; the nucleotide sequence of SEQ ID
N0:7 from nucleotide 331 to nucleotide 567; the nucleotide sequence of the full-length protein coding sequence of clone AS164_1 deposited under accession number ATCC 98261; or the nucleotide sequence of the mature protein coding sequence of clone AS164_1 deposited 3 0 under accession number ATCC 98261. In other preferred embodiments, the polynucleotide encodes the full-length or mature protein encoded by the cDNA
insert of clone AS164_1 deposited under accession number ATCC 98261. In yet other preferred embodiments, the present invention provides a polvnucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:8 from amino acid 87 to amino acid 164.
Other embodiments provide the gene correspondi7g to the cDNA sequence of SEQ
ID N0:7.
In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
{a) the amino acid sequence of SEQ ID N0:8;
(b) the amino acid sequence of SEQ ID N0:8 from amino acid 87 to amino acid 164;
(c) fragments of the amino acid sequence of SEQ ID N0:8; and (d) the amino acid sequence encoded by the cDNA insert of clone AS16~1_1 deposited under accession number ATCC 98261;
the protein being substantially free from other mammalian proteins. Preferably such i 5 protein comprises the amino acid sequence of SEQ ID NO:B or the amino acid sequence of SEQ ID N0:8 from amino acid 87 to amino acid 164.
In one embodiment, the present invention provides a composition comprising an isolated polvnucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
2 0 N0:9;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:9 from nucleotide 2-I2 to nucleotide 1060;
(c) a polvnucleotide comprising the nucleotide sequence of SEQ ID
N0:9 from nucleotide 596 to nucleotide 1060;
25 (d) a polvnucleotide comprising the nucleotide sequence of SEQ ID
N0:9 from nucleotide 10 to nucleotide 373;
(e) a polvnucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone AX8_1 deposited under accession number ATCC 98261;
3 0 (f) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone AX8_1 deposited under accession number ATCC 98261;
(g) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone AX8_1 deposited under accession number ATCC
98261;

(h) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone AX8_1 deposited under accession number ATCC 98261;
(i) a polynucleotide encoding a protein comprising the arr;ino acid sequence of SEQ ID N0:10;
(j) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:10 having biological activity;
(k) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(h) above;
(1) a polynucleotide which encodes a species homologue of the protein of (i) or (j) above ; and (m) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(j).
Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID
N0:9 from nucleotide 242 to nucleotide l060; the nucleotide sequence of SEQ ID
N0:9 i 5 from nucleotide 596 to nucleotide 1060; the nucleotide sequence of SEQ ID
N0:9 from nucleotide 10 to nucleotide 3i 3; the nucleotide sequence of the full-length protein coding sequence of clone AX8_1 deposited under accession number ATCC 98261; or the nucleotide sequence of the mature protein coding sequence of clone AX8_1 deposited under accession number ATCC 9826l. In other preferred embodiments, the 2 0 polynucleotide encodes the full-length or mature protein encoded by the cDNA insert of clone AX8_1 deposited under accession number ATCC 98261. In yet other preferred embodiments, the present invention provide=s a polvnucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:10 from amino acid 1 to amino acid 4~.
2 5 Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:9.
In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
3 0 (a) the amino acid sequence of SEQ ID NO:10;
(b) the amino acid sequence of SEQ ID NO:10 from amino acid 1 to amino acid 44;
(c) fragments of the amino acid sequence of SEQ ID N0:10; and (d) the amino acid sequence encoded by the cDNA insert of clone AX~_1 deposited under accession number ATCC 98261;
the protein being substantially free from other mammalian proteins. Preferably such protein comprises the amino acid sequence of SEQ ID NO:10 or the amino acid sequence of SEQ ID NO:1() from amino acid 1 to amino acid ~.
In one embodiment, the present invention provides a composition comprising an isolated polvnucleotide selected from the group consisting of:
(a) a polvnucleotide comprising the nucleotide sequence of SEQ ID
N0:11;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:11 from nucleotide 773 to nucleotide 928;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:11 from nucleotide 8I5 to nucleotide 928;
(d) a polynucleotide comprising the nucleotide sequence of the full length protein coding sequence of clone BD176_3 deposited under accession number ATCC 98261;
(e) a polynucleotide encoding the Full-length protein encoded by the cDNA insert of clone BD176_3 deposited under accession number ATCC 9826l;
(f) a polvnucleotide comprising the nucleotide sequence of the mature 2 0 protein coding sequence of clone BD176_3 deposited under accession number ATCC 98261;
(g) a polvnucleotide encoding the mature protein encoded by the cDNA insert of clone BD176_3 deposited under accession number ATCC 9826l;
(h) a polynucleotide encoding a protein comprising the amino acid 2 5 sequence of SEQ ID N0:12;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:12 having biological activity;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
3 0 (k) a polynucleoHde which encodes a species homologue of the protein of (h) or (i) above ; and (1) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(i).

Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID
NO:11 from nucleotide 773 to nucleotide 928; the nucleotide sequence of SEQ ID
NO:11 from nucleotide 815 to nucleotide 928; the nucleotide sequence of the full-length protein coding sequence of clone BD176_3 deposited under accession number ATCC 9826l;
or the nucleotide sequence of the mature protein coding sequence of clone BD176_3 deposited under accession number ATCC 98261. In other preferred embodiments, the polynucleotide encodes the full-length or mature protein encoded by the cDNA
insert of clone BD176_3 deposited under accession number ATCC 9826l.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:11 or SEQ ID N0:13.
In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID N0:12;
1 S {b} fragments of the amino acid sequence of SEQ ID N0:12; and (c) the amino acid sequenco encoded by the cDNA insert of clone BD17Co3 deposited under accession number ATCC 98261;
the protein being substantially free from other mammalian proteins.
I'referablv such protein comprises the amino acid sequence of ~~EQ ID NO:12.
2 0 In one embodiment, the present invention provides a composition comprising an isolated polvnucleotide selected from the group consisting of:
(a) a polvnucleotide comprising the nucleotide sequence of SEQ ID
N0:14;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
2 5 N0:14 from nucleotide l74 to nucleotide 440;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:14 from nucleotide 1 to nucleotide ~'~13;
(d) a polynucleotide compri,ing the nucleotide sequence of the full-length protein coding sequence of clone BD339_1 deposited under accession 3 0 number ATCC 98261;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone BD339_1 deposite~~ under accession number ATCC 9826l;

(f) a polvnucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone BD339_1 deposited under accession number ATCC 98261;
(g) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone BD339_1 deposited under accession number ATCC 98261;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:15;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:15 having biological activity;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polvnucleotide which encodes a species homologue of the protein of {h) or (i) above ; and {l) a polvnurleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(i).
Preferably, such poiynucleotide comprises the nucleotide sequence of SEQ ID
N0:14 from nucleotide 17=1 to nucleotide 440; the nucleotide sequence of SEQ
ID N0:14 from nucleotide 1 to nucleotide 313; the nucleotide sequence of the full-length protein coding sequence of clone BD339_1 deposited under accession number ATCC 98261;
or the 2 0 nucleotide sequence of the mature protein coding sequence of clone BD339_1 deposited under accession number ATCC 98261. In other preferred embodiments, the polvnucleotide encodes the full-length or mature protein encoded by the cDNA
insert of clone BD339_1 deposited under accession number ATCC 98261. In yet other preferred embodiments, the present invention provides a polynucleotide encoding a protein 2 5 comprising the amino acid sequence of SEQ ID N0:15 from amino acid 1 to amino acid 46.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:14.
In other embodiments, the present invention provides a composition comprising 3 0 a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID N0:15;
(b) the amino acid sequence of SEQ ID N0:15 from amino acid 1 to amino acid 46;

(c) fragments of the amino acid sequence of SEQ ID N0:15; and (d) the amino acid sequence encoded by the cDNA insert of clone BD339_1 deposited under accession number ATCC 98261;
the protein being substantially free from other mammalian proteins. Preferably such protein comprises the amino acid sequence of SEQ ID N0:15 or the amino acid sequence of SEQ ID N0:15 from amino acid 1 to amino acid 46.
In one embodiment, the present invention provides a composition comprising an isolated polvnucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:16;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:16 from nucleotide 509 to nucleotide 619;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:16 from nucleotide 1 to nucleotide 580;
(d) a polvnucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone BD427_1 deposited under accession number ATCC 98261;
(e) a polynucleotide encodi:~g the full-length protein encoded by the cDNA insert of clone BD427_1 deposited under accession number ATCC 98261;
2 0 (f) a polvnucleotide compri:~ing the nucleotide sequence of the mature protein coding sequence of clone BD=1.27_1 deposited under accession number ATCC 98261;
(g) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone BD.127_1 deposited under accession number ATCC 98261;
2 5 (h) a polvnucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:17;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:17 inaving biological activity;
(j) a polvnucleotide which is an allelic variant of a polynucleotide of (a)-(g} above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (1) a polvnucleotide capable of hybridizing under stringent conditions to anv one of the polynucleotides specified in (a)-(i).

Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID
N0:16 from nucleotide 509 to nucleotide 619; the nucleotide sequence of SEQ ID
N0:16 from nucleotide 1 to nucleotide 580; the nucleotide sequence of the full-length protein coding sequence of clone BD427_1 deposited under accession number ATCC 9826l;
or the nucleotide sequence of the mature protein coding sequence of clone BD427_1 deposited under accession number A'TCC 982b1. In other preferred embodiments, the polynucleotide encodes the full-length or mature protein encoded by the cDNA
insert of clone BD427_1 deposited under accession number ATCC 98261. In yet other preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:17 from amino acid 1 to amino acid 24.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:16.
In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID N0:17;
(b) the amino acid sequence of SEQ ID N0:17 from amino acid 1 to amino acid 24;
2 0 (c) fragments of the amino acid sequence of SEQ ID NO:17; and (d) the amino acid sequence encoded by the cDNA insert of clone BD427_1 deposited under accession number ATCC 98261;
the protein being substantially free from other mammalian proteins. Preferably such protein comprises the amino acid sequence of SEQ ID N0:17 or the amino acid sequence of SEQ ID N0:17 from amino acid 1 to amino acid 24.
In one embodiment, the present invention provides a composition comprising an isolated polvnucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:18;
3 0 (b) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:18 from nucleotide 300 to nucleotide 360;
(c) a polvnucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone BL229_22 deposited under accession number ATCC 98261;

(d) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone BL229_22 deposii:ed under accession number ATCC 98261;
(e) a polynucleotide compr~.sing the nucleotide sequence of the mature protein coding sequence of clone BL229_22 deposited under accession number ATCC 98261;
(f) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone BL229_22 deposil:ed under accession number ATCC 98261;
(g) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:19;
(h) a polvnucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:19 having biological activity;
(i) a polvnucleotide which is an allelic variant of a polvnucleotide of (a)-{f) above;
(j) a polvnucleodde which f=ncodes a species homologue of the protein of (g) or (h) above ; and {k) a polynucleotide capable, of hybridizing under stringent conditions to anv one of the polvnucleotides specified in (a)-(h).
Preferably, such polvnucleotide comprises the nucleotide sequence of SEQ ID
N0:18 from nucleotide 300 to nucleotide 360; the nucleotide sequence of the full-length 2 0 protein coding sequence of clone BL229_22 deposited under accession number ATCC
98261; or the nucleotide sequence of the mature protein coding sequence of clone BL229_22 deposited under accession number ATCC 98261. In other preferred embodiments, the polynucleotide encodes the full-length or mahire protein encoded by the cDNA insert of clone BL229_22 deposited under accession number ATCC 9826l.
2 5 Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:18 or SEQ ID N0:20.
In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
3 0 (a) the amino acid sequence of SEQ ID N0:19;
(b) fragments of the amino acid sequence of SEQ ID N0:19; and (c) the amino acid sequence encoded by the cDNA insert of clone BL229 22 deposited under accession number ATCC 98261;

the protein being substantially free from other mammalian proteins. Preferably such protein comprises the amino acid sequence of SEQ ID N0:19.
In one embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:21;
{b) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:21 from nucleotide 604 to nucleotide 771;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:21 from nucleotide 1 to nucleotide 684;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone BV123_16 deposited under accession number ATCC 98261;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone BV123_16 deposited under accession number ATCC 98261;
(f) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone 8V123_16 deposited under accession number ATCC 98261;
(g) a polynucleotide encoding the mature protein encoded by the 2 0 cDNA insert of clone BV12 3_16 deposited under accession number ATCC
9826l;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:22;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:22 having biological activity;
2 5 (j) a polynucleotide which is an allelic variant of a polvnucleotide of (a)-(g) above;
(k} a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (1) a polynucleotide capable of hybridizing under stringent conditions 3 0 to anv one of the polynucleotides specified in (a)-(i).
Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID
N0:21 from nucleotide 604 to nucleotide 771; the nucleotide sequence of SEQ ID
N0:21 from nucleotide 1 to nucleotide 684; the nucleotide sequence of the full-length protein coding sequence of clone BV123_16 deposited under accession number ATCC 98261;
or the nucleotide sequence of the mature protein coding sequence of clone 8V123_16 deposited under accession number ATCC 98261. In other preferred embodiments, the polynucleotide encodes the full-length or mature protein encoded by the cDNA
insert of clone 8V123_16 deposited under accession number ATCC 98261. In yet other preferred S embodiments, the present invention provides a polynucleotide encoding a protein comprising the amino acid sequence of SEQ IL> N0:22 from amino acid 1 to amino acid 27.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:21.
In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID N0:22;
(b) the amino acid sequence of SEQ ID N0:22 from amino acid 1 to amino acid 27;
(c) fragments of the amino acid sequence of SEQ ID N0:22; and (d) the amino acid sequence encoded by the cDNA insert of clone BVl2p_16 deposited under accession number ATCC 98261;
the protein being substantially free from other mammalian proteins. Preferably such 2 0 protein comprises the amino acid sequence of SEQ ID N0:22 or the amino acid sequence of SEQ ID N0:22 from amino acid 1 to amino acid 27.
In one embodiment, the present invention provides a composition comprising an isolated polvnucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
2 S N0:23;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:23 from nucleotide 43 to nucleotide 297;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:23 from nucleotide 94 to nucleotide 297;
3 0 (d) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:23 from nucleotide 1 to nucleotide ~~79;
(e) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone CH377_1 deposited under accession number ATCC 98261;

(f) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone CH377 _1 deposited under accession number ATCC 98261;
(g) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone CH377_1 deposited under accession number ATCC 98261;
(h) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone CH377_1 deposited under accession number ATCC 98261;
(i) a polvnucleotide encoding a protein comprising the amino acid sequence of SEQ ID N0:24;
(j) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID N0:24 having biological activity;
(k) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(h) above;
(1) a polvnucleotide which encodes a species homologue of the protein of (i) or (j) above ; and (m) a polvnucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(j).
Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID
N0:23 from nucleotide 43 to nucleotide 297; the nucleotide sequence of SEQ ID
N0:23 2 0 from nucleotide 94 to nucleotide 297; the nucleotide sequence of SEQ ID
N0:23 from nucleotide 1 to nucleotide 379; the nucleotide sequence of the full-length protein coding sequence of clone CH377_1 deposited under accession number ATCC 9826l; or the nucleotide sequence of the mature protein coding sequence of clone CH377_1 deposited under accession number ATCC 98261. In other preferred embodiments, the 2 5 polynucleotide encodes the full-length or mature protein encoded by the cDNA insert of clone CH377_1 deposited under accession number ATCC 98261.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:23.
In other embodiments, the present invention provides a composition comprising 3 0 a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID N0:24;
(b) fragments of the amino acid sequence of SEQ ID N0:24; and (c) the amino acid sequence encoded by the cDNA insert of clone CH377_1 deposited under accession number ATCC 98261;
the protein being substantially free from other mammalian proteins. Preferably such protein comprises the amino acid sequence of SEQ ID N0:24.
In certain preferred embodiments, the polynucleotide is operably linked to an expression control sequence. The invention also provides a host cell, including bacterial, yeast, insect and mammalian cells, transformed with such polvnucleotide compositions.
Processes are also provided for producing a protein, which comprise:
(a) growing a culture of the host cell transformed with such i 0 polynucleotide compositions in a suitable culture medium; and (b) purifying the protein fr~~m the culture.
The protein produced according to such methods is also provided by the present invention. Preferred embodiments include those in which the protein produced by such process is a mature form of the protein.
Protein compositions of the present invention may further comprise a pharmaceutically acceptable carrier. Compositions comprising an antibody which specifically reacts with such protein are also provided by the present invention.
Methods are also provided for preventing, treating or ameliorating a medical condition which comprises administering to a mammalian subject a therapeutically 2 0 effective amount of a composition comprising a protein of the present invention and a pharmaceutically acceptable carrier.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures lA and 1B arc: schematic repre=~entations of the pED6 and pNOTs vectors, 2 5 respectively, used for deposit of clones disclo~~ed herein.
DETAILED DESCRIPTION
ISOLATED PROTEINS AND POLYNUCLEOTIDES
3 0 Nucleotide and amino acid sequences, as presently determined, are reported below for each clone and protein disclosed in the present application. The nucleotide sequence of each clone can readily be determined by sequencing of the deposited clone in accordance ~~ith known methods. The predicted amino acid sequence (both full-length and mature) can then be determined from such nucleotide sequence. The amino acid sequence of the protein encoded by a particular clone can also be determined by expression of the clone in a suitable host cell, collecting the protein and determining its sequence. For each disclosed protein applicants have identified what they have determined to be the reading frame best identifiable with sequence information available at the time of filing.
As used herein a "secreted" protein is one which, when expressed in a suitable host cell, is transported across or through a membrane, including transport as a result of signal sequences in its amino acid sequence. "Secreted" proteins include without limitation proteins secreted wholly (e.g., soluble proteins} or partially (e.g. , receptors) from the cell in which they are expressed. "Secreted" proteins also include ~~ithout limitation proteins which are transported across the membrane of the endoplasmic reticulum.
Clone "AT20 ?"
A polvnucleotide of the present invention has been identified as clone "AJ20 2"
AJ20_2 was isolated from a human adult testes cDNA library using methods which are selective for cDNAs encoding secreted proteins (see U.S. Pat. No. 5,536,637), or was identified as encoding a secreted or transmembrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. AJ2()_2 is a full-length clone, including the entire coding sequence of a secreted protein (also referred to herein as 2 0 "AJ20_2 protein") The nucleotide sequence of the 5' portion of AJ20 2 as presently determined is reported in SEQ ID NO:1. What applicants presently believe is the proper reading frame for the coding region is indicated in SEQ ID N0:2. The predicted amino acid sequence of the AJ20 2 protein corresponding to the foregoing nucleotide sequence is reported in SEQ
2 5 ID N0:2. Amino acids 8 to 20 are a predicted leader/signal sequence, with the predicted mature amino acid sequence beginning at amino acid 21, or are a transmembrane domain.
Additional nucleotide sequence from the 3' portion of AJ20_2, including the polvA tail, is reported in SEQ ID N0:3.
The EcoRI/NotI restriction fragment obtainable from the deposit containing clone 3 0 AJ20_2 should be approximately 850 bp.
The nucleotide sequence disclosed herein for Aj20_2 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and FASTA search protocols. No hits were found in the database.

Clone "AR4-IO 1"
A polvnucleotide of the present invention has been identified as clone "AR440_1".
AR440_1 was isolated from a human adult retina cDNA library using methods which are selective for cDNAs encoding secreted proteins (see U.S. I'at. No. 5,536,637), or was identified as encoding a secreted or transmembrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. AR44()_1 is a full-length clone, including the entire coding sequence of a secreted protein (also referred to herein as "AR 440_1 protein") The partial nucleotide sequence of AR4~E0_1, including its 3' end and any identified polyA tail, as presently determined is reported in SEQ ID N0:7. What applicants presently believe is the proper reading frame for the coding region is indicated in SEQ ID
N0:6. The predicted amino acid seduence of the AR440_1 protein corresponding to the foregoing nucleotide sequence is reported in SEQ ID N0:6. Additional nucleotide sequence from the 5' portion of AR440_1 is reported in SEQ ID NO:4.
The EcoRI/NotI restriction fragment obtainable from the deposit containing clone AR440_1 should be approximately 1400 bp.
The nucleotide sequence disclosed herein for AR440_1 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and Ff'1STA search protocols. Nc7 hits were found in the database. The nucleotide sequence 2 0 of AR440_1 indicates that it may contain an A:.u repetitive element.
Clone "AS164 1"
A polvnucleotide of the present invention has been identified as clone "AS164_1".
AS164_1 was isolated from a human fetal brain cDNA library usins; methods which are selective for cDNAs encoding secreted proteins (see U.S. 1'at. No. 5,536,637), or was identified as encoding a secreted or transmernbrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. AS164_1 is a full-length clone, including the entire coding sequence of a secreted protein (also referred to herein as 3 0 "AS164_1 protein") The nucleotide sequence of AS164_l as presently determined is reported in SEQ
ID N0:7. What applicants presently believe to be the proper reading frame and the predicted amino acid sequence of the AS164_1 protein corresponding to the foregoing nucleotide sequence is reported in SEQ ID NC~:8.

The EcoRI / NotI restriction fragment obtainable from the deposit containing clone AS164_1 should be approximately 1600 bp.
The nucleotide sequence disclosed herein for A5164_1 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and FASTA search protocols. AS164_1 demonstrated at least some similarity with sequences identified as H24668 (y140h10.r1 Homo Sapiens cDNA clone 160771 5'), N29757 {yw90h10.s1 Homo Sapiens cDNA clone 259555 3'), T62184 (yb96d08.r1 Homo Sapiens cDNA clone 79023 ~'), Z69706 (I--Iuman DNA sequence from cosmid COS12 from a contig from the tip of the short arm of chromosome 16, spanning 2Mb of 16p13.3.
Contains ESTs, Flanking sequences of 3' alpha globin H), and Z69890 (Human DNA sequence from cosmid RJ 14 from a contig from the tip of the short arm of chromosome 16, spanning 2Mb of 16p13.3. Contains ESTs and CpG island). The predicted amino acid sequence disclosed herein for AS16-I_1 was searched against the GenI'ept and GeneSeq amino acid sequence databases using the BLASTX search protocol. The predicted A5164_1 protein 1 S demonstrated at least some similarity to sequences identified as A20359_1 (ryanodine receptor gene product [Homo Sapiens] j and L178866 (putative arginine-aspartate-rich RNA
binding protein [Arabidopsis thaliana]). Based upon sequence similarity, AS164_1 proteins and each similar protein or peptide may share at least some activity.
The predicted AS164_1 protein seduence also contains repeated Asp-Arg RNA-binding motifs.
Clone "AX8 1 "
A polvnucleotide of the present invention has been identified as clone "AX8_1".
AX8_1 was isolated from a human adult testes cDNA library using methods which are selective for cDNAs encoding secreted proteins (see U.S. Pat. No. 5,536,b37), or was 2 5 identified as encoding a secreted or transmembrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. AX8_1 is a full-length clone, including the entire coding sequence of a secreted protein (also referred to herein as "AX8_1 protein") The nucleotide sequence of AX8_1 as presently determined is reported in SEQ ID
3 0 N0:9. What applicants presently believe to be the proper reading frame and the predicted amino acid sequence of the AX8_l protein corresponding to the foregoing nucleotide sequence is reported in SEQ ID N0:10. Amino acids 106 to 118 are a predicted ieader/signal sequence, with the predicted mature amino acid sequence beginning at amino acid 119, or are a transmembrane domain.

The EcoRI/NotI restriction fragment obtainable from the deposit containing clone AX8_1 should be approximately 2300 bp.
The nucleotide sequence disclosed herein for AX8_I was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and FASTA search protocols. No hits were found in the database. The TopPredII
computer program predicts three potential transmembrane domains within the AX8_1 protein sequence, centered around amino acids 111, 144, and 182 of SEQ ID N0:10.
Clone "BD176 3"
A polvnucleotide of the present invention has been identified as clone "BD176_3".
BD176_3 was isolated from a human fetal kidney cDNA library using methods which are selective for cDNAs encoding secreted proteins (see U.S. I'at. No. 5,536,637), or was identified as encoding a secreted or transme,mbrane protein on the basis of computer analysis of the amino acid seduence of the encoded protein. BD176_3 is a full-length clone, including the entire coding; sequence of a secreted protein (also referred to herein as "BD176_3 protein").
The nucleotide sequence of the 5' portion of BD176_3 as presently determined is reported in SEQ ID NO:11. What applicants presently believe is the proper reading frame for the coding region is indicated in SEQ 1D NO:I2. The predicted amino acid sequence 2 0 of the BD176_3 protein corresponding to the foregoing nucleotide sequence is reported in SEQ ID N0:12. Amino acids 2 to 14 are a predicted leader/signal sequence) with the predicted mature amino acid sequence beginning at amino acid 15, or are a transmembrane domain. Additional nucleotide sequence from the 3' portion of BD176_3, including the polyA tail, is reported in SEQ ID N0:13.
2 5 The EcoRI/NotI restriction fragment obtainable from the deposit containing clone BD176_3 should be approximately 1300 bp.
The nucleotide sequence disclosed herein for BD176_3 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and FASTA search protocols. BD176_3 demonstrated at least some similarity with sequences 3 0 identified as AA029679 (ze94g10.r1 Soares fetal heart NbHHI9W Homo Sapiens cDNA
clone 366690 5'), D45913 (Mouse NLRB-1 mRNA for leucine-rich-repeat protein, complete cds), R55610 (yg88h08.r1 Homo Sapiens cDNA clone 40606 5'), and T07640 (EST05530 Homo Sapiens cDNA clone HFBEM16). The predicted amino acid sequence disclosed herein for BD176_3 was searched against the GenPept and GeneSeq amino acid sequence databases using the BLASTX search protocol. The predicted BD176 3 protein demonstrated at least some similarity to sequences identified as D45913 {leucine-rich-repeat protein [Mus musculus]) and M59472 (asparagine-rich antigen Pfa55-6 [Plasmodium falciparum]). Based upon sequence similarity, 8D176 3 proteins and each similar protein or peptide may share at least some activity.
Clone "BD339 1"
A polynucleotide of the present invention has been identified as clone "BD339_1".
8D339_1 was isolated from a human fetal kidney cDNA library using methods which are selective for cDNAs encoding secreted proteins (see U.S. I'at. No. 5,536,637), or was identified as encoding a secreted or transmembrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. 8D339_1 is a full-length clone, including the entire coding sequence of a secreted protein (also referred to herein as "BD339_1 protein") The nucleotide sequence of BD339l as presently determined is reported in SEQ
ID N0:14. What applicants presently believe to be the proper reading frame and the predicted amino acid sequence of the 13D339_1 protein corresponding to the foregoing nucleotide sequence is reported in SEQ ID N0:15.
The EcoRI/Notl restriction fragment obtainable from the deposit containing clone 2 0 BD339_1 should be approximately 650 bp.
The nucleotide sequence disclosed herein for BD339_1 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLfISTN / BLASTX and FASTA search protocols. 8D339_1 demonstrated at least some similarity with sequences identified as I-I82422 (yu80d08.s1 Homo Sapiens cDNA clone 240l113), N62058 (EST53c05 2 5 Homo Sapiens cDNA clone), U21730 Human 5'-nucleotidase (CD73)), W01979 (ra30h09.r1 Soares fetal liver spleen 1NFLS Homo sapiens cDNA clone 2941l3 5'), and W02015 (za32b11.r1 Soares fetal liver spleen 1NFLS Homo Sapiens cDNA clone 294237 5'). Based upon sequence similarity, BD339_1 proteins and each similar protein or peptide may share at least some activity. The TopPredII computer program predicts three potential 3 0 transmembrane domains within the BD339_1 protein sequence,centered around amino acids 14, 46, and 76 of SEQ ID N0:15.

WO 98l21332 PCT/US97/20740 Clone "BD427 1"
A polvnucleotide of the present invent:,on has been identified as clone "BD427_1".
8D427_1 was isolated from a human fetal kidney cDNA library using methods which are selective for cDNAs encoding secreted proteins (see U.S. Pat. No. 5,536,637), or was identified as encoding a secreted or transmembrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. BD427_1 is a full-length clone, including the entire coding sequence of a secreted protein (also referred to herein as "BD427_1 protein").
The nucleotide sequence of BD427_7 a:; presently determined is reported in SEQ
ID N0:16. What applicants presently believe to be the proper reading frame and the predicted amino acid sequence of the 8D427__1 protein correspondinE; to the foregoing nucleotide sequence is reported in SEQ ID N0:17.
The EcoPI/Notl restriction fragment obtainable from the deposit containing clone 8D427_1 should be approxirnatelv 1810 bp.
1 S The nucleotide sequence disclosed herein for 8D427_1 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and FASTA search protocols. BD427_ 1 demonstrated at least some similarity with sequences identified as AA027122 (zk04a03.r1 Soares pre~mant uterus NbHPU Homo Sapiens cDNA
clone 469516 5'), N24735 (yx56b02.s1 Homo sahiens cDNA clone 265707 3'}, and W8464:1 (zd91a06.r1 Soares fetal heart NbHHI9W Homo Sapiens cDNA clone 3568l8 5').
Based upon sequence similarity, BD427_1 proteins and each similar protein or peptide may share at least some activity.
Clone "BL229 22"
2 5 A polvnucleotide of the present invention has been identified as clone "BL229 22".
BL229_22 was isolated from a human adult testes cDNA library using methods which are selective for cDNAs encoding secreted pr~tE~ins (see U.S. Pat. No. 5,S36,637), or was identified as encoding a secreted or transme:mbrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. BL229_22 is a full-length 3 0 clone, including the entire coding sequence of a secreted protein (also referred to herein as "8L229 22 protein").
The nucleotide sequence of the 5' portion of BL229_22 as presently determined is reported in SEQ ID N0:18. What applicants presently believe is the proper reading frame for the coding region is indicated in SEQ ID N0:19. The predicted amino acid sequence of the BL229_22 protein corresponding to the foregoing nucleotide sequence is reported in SEQ ID N0:19. Additional nucleotide sequence from the 3' portion of BL229 22, including the polyA tail, is reported in SEQ ID N0:20.
The EcoRI/NotI restriction fragment obtainable from the deposit containing clone BL229 22 should be approximately 870 bp.
The nucleotide sequence disclosed herein for BL229_22 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and FASTA search protocols. No hits were found in the database.
Clone "BV123 16"
A polynucleotide of the present invention has been identified as clone "BV123_16".
BV123_16 was isolated from a human adult brain cDNA library using methods which are selective for cDNAs encoding secreted proteins (see U.S. Pat. No. 5,536,637), or was identified as encoding a secreted or transmembrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. BVl2p_16 is a full-length clone, including the entire coding sequence of a secreted protein (also referred to herein as "BV123_16 protein") The nucleotide sequence of $V123_16 as presently determined is reported in SEQ
ID N0:21. What applicants presently believe to be the proper reading frame and the 2 0 predicted amino acid sequence of the BV123_16 protein corresponding to the foregoing nucleotide sequence is reported in SEQ ID N0:22.
The EcoRI/Notl restriction fragment obtainable from the deposit containing clone BVI23_l6 should be approximately 1080 bp.
The nucleotide sequence disclosed herein for BV 123_l6 was searched against the 2 5 GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and FASTA search protocols. BV123_16 demonstrated at least some similarity with sequences identified as H29610 (ym61e03.s1 Homo sapiens cDNA clone 52653 3'), H52374 (yq81b12.r1 Homo Sapiens cDNA clone 202175 5'), H66213 (yu16h10.s1 Homo Sapiens cDNA), L08092 (Homo Sapiens dystrophin (DMD) gene, intron 7, transposon-like 3 0 sequence), L35670 (Homo Sapiens (subclone H8 1 (7~5 from I'1 35 H5 C8) DNA
sequence), M62716 (Human CSP-B gene flanking sequence), N46985 (yy83a05.s1 Homo Sapiens cDNA clone 280112 3'), R94603 (yq38a04.sI Homo Sapiens cDNA clone 198030 3'), (Human chromosome 16p13 BAC clone CIT987SK-363E6, complete sequence), and (Human DNA sequence from clone J333E231). Eased upon sequence similarity, BV123_16 proteins and each similar protein or peptide may share at least some activity.
Clone "CH377 1"
A polvnucleotide of the present invention has been identified as clone "CH377_1".
CH377_1 was isolated from a human fetal kidney cDNA library using methods which are selective for cDNAs encoding secreted proteins (see U.S. Pat. No. 5,536,637), or was identified as encoding a secreted or transmernbrane protein on the basis of computer analysis of the amino acid sequence of the encoded protein. CH377_1 is a full-length clone, including the entire coding sequence of a secreted protein (also referred to herein as "CH377_1 protein") The nucleotide sequence of CH377 _1 as presently determined is reported in SEQ
ID N0:23. What applicants presently believe to be the proper reading frame and the predicted amino acid sequence of the CH377_1 protein corresponding to the foregoing nucleotide sequence is reported in SEQ ID N0:24. .Amino acids 5 to 17 are a predicted leader/signal sequence, with the predicted mature amino acid sequence beginning at amino acid 18, or are a transmembrane domain.
The EcoRI/Notl restriction fragment obi:ainable from the deposit containing clone CH377_1 should be approximately 570 bp.
2 0 The nucleotide sequence disclosed herei n for CH377_1 was searched against the GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and FASTA search protocols. CH377_1 demonstrated at least some similarity with sequences identified as AA507382 (nh73bOl.s1 NCI CGAI'__Brl.1 Homo Sapiens cDNA clone IMAGE
964105) and N7(1479 (za74f12.s1 Homo sapier~,s cDNA clone 298319 3'). Based upon 2 5 sequence similarity, CH377_1 proteins and each similar protein or peptide may share at least some activity.
Deposit of Clones Clones AJ20_2, AR440_1, AS164_l, AX8_I, 8D176_3, BD339_l, BD427_l, 3 0 8L229 22, BV123_16, and CH377_1 were deposited on November 15, 1996 with the American Type Culture Collection as an original deposit under the Budapest Treaty and were given the accession number ATCC 98261, from which each clone comprising a particular polvnucleotide is obtainable. All restrictions on the availability to the public of the deposited material will be irrevocably removed upon the granting of the patent, except for the requirements specified in 37 C.F.R. ~ 1.808(b).
Each clone has been transfected into separate bacterial cells (F.. toll) in this composite deposit. Each clone can be removed from the vector in which it was deposited by performing an EcoRI/NotI digestion (5' site, EcoRI; 3' site, NotI) to produce the appropriate fragment for such clone. Each clone was deposited in either the pED6 or pNOTs vector depicted in Fig. 1. The pED6dpc2 vector ("pED6") was derived from pED6dpc1 by Insertion of a new polylinker to facilitate cDNA cloning (Kaufman et al., 1991, Nucleic Acicls Res. 19: 4485--1490); the pNOTs vector was derived from pMT2 (Kaufman et nl., 1989, Mol. Ctll. l3iol. 9: 946-958) by deletion of the DI-iFR
sequences, insertion of a new polvlinker, and insertion of the M13 origin of replication in the CIaI site.
In some instances, the deposited clone can become "flipped" (i.e., iv the reverse orientation) in the deposited isolate. In such instances, the cDNA insert can still be isolated by dit:,estion with EcoRI and Notl. However, NotI will then produce the 5' site and EcoRI will produce the 3' site for placement of the cDNA in proper orientation for expression in a suitable vector. The cDNA may also be expressed from the vectors in which they ~nTere deposited.
E3acterial cells containing a particular clone can be obtained from the composite deposit as follo~nw:
2 0 An oligonucleotide probe or probes should be designed to the sequence that is known for that particular clone. This sequence can be derived from the sequences provided herein, or from a combination of those sequences. The sequence of the oligonucleotide probe that was used to isolate each full-length clone is identified below, and should be most reliable in isolating the clone of interest.
Clone Probe Sequence AJ20 2 SEQ ID N0:25 AK440_1 SEQ ID N0:26 AS164_1 SEQ ID N0:27 3 0 AX8_1 SEQ ID N0:28 BD176_3 SEQ ID N0:29 BD339_1 SEQ ID N0:30 BD427_1 SEQ ID N0:31 BL229_22 SEQ ID N0:32 BV123_16 SEQ ID N0:33 CH377_1 SEQ ID N0:34 In the sequences listed above which include an N at position 2, that position is occupied in preferred probes/primers by a biotinylated phosphoaramidite residue rather than a nucleotide (such as , for example, that produced by use of biotin phosphoramidite (1-dimethoxytrityloxv-2-(N-biotinyl-4-aminobutvl)-propyl-3-O-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramadite) (Glen Research, cat. no. 10-1953)).
The design of the oligonucleotide probe should preferably follow these parameters:
(a) It should be designed to an area of the sequence which has the fewest ambiguous bases ("N's"), if any;
(b) It should be designed to have a I'~, of approx. 80 ° C (assuming 2° for each A or T and ~l degrees for each C~ or C).
The olfgonucleotide should preferably be labeled with g-'~P ATP (specific activity 6000 Ci/mmole) and T-1 polynucleotide kinase using commonly employed techniques for labeling oligonucleotides. Other labeling techniques can also be used.
Unincorporated label should preferably be removed by gel filtration chromatography or other established methods. The amount of radioactivity incorporated into the probe should be quantitated 2 0 by measurement in a scintillation counter. Preferably, specific activity of the resulting probe should be approximately 4e+6 dpm/pmole.
The bacterial culture containing the pc:~ol of full-length clones should preferably be thawed and 1()0 ul of the stock used to inoculate a sterile culture flask containing 25 ml of sterile I_-broth containing ampicillin at 100 yg/ ml. The culture should preferably be 2 5 grown to saturation at 37°C) and the saturated culture should preferably be diluted in fresh L-broth. Aliquots of these dilutions should preferably be plated to determine the dilution and volume which will yield approximately 5000 distinct and well-separated colonies on solid bacteriological media containing L-broth containing ampicillin at 100 ug/ml and agar at 1.5'% in a 150 mm petri dish when grown overnight at 37°C. Other 3 0 known methods of obtaining distinct, well-separated colonies can also be employed.
Standard colony hybridization proced ures should then be used to transfer the colonies to nitrocellulose filters and lyre, denature and bake them.
The filter is then preferably incubated at 65°C for 1 hour with gentle agitation in 6X SSC (20X stock is 175.3 g NaCI/liter, 88.2 g; Na citrate/liter, adjusted to pH 7.0 with NaOH) containing 0.5°/, SDS, 100 ug/ml of yeast RNA, and 10 mM EDTA
(approximately mL per 150 mm filter). Preferably, the probe is then added to the hybridization mix at a concentration greater than or equal to le+6 dpm/mL. The filter is then preferably incubated at 65°C with gentle agitation overnight. The filter is then preferably washed in 5 500 mL of 2X SSC/0.5°/a SDS at room temperature without agitation, preferably followed by 500 mL of 2X SSC/0.1'%<, SDS at room temperature with gentle shaking for 15 minutes.
A third wash with 0.1X SSC/0.5'% SDS at 65°C for 30 minutes to 1 hour is optional. The filter is then preferably dried and subjected to autoradiography for sufficient time to visualize the positives on the X-ray film. Other known hybridization methods can also 10 be employed.
The positive colonies are picked, grown in culture, and plasmid DNA isolated using standard procedures. The clones can then be verified by restriction analysis, hybridization analysis, or DNA sequencing.
Fragments of the proteins of the present invention which are capable of exhibiting biological activity are also encompassed by the present invention. Fragments of the protein may be in linear form or they may be cyclized using known methods, for example, as described in H.U. Saragovi, et nl., Bio/Technology 10, i73-778 (1992) and in R.S.
McDowell, et nl., J. Amer. Chem. Soc. 114, 9245-9253 (l992), both of which are incorporated herein by reference. Such fragments may be fused to carrier molecules such as 2 0 immunoglobulins for many purposes, including increasing the valency of protein binding sites. For example, fragments of the protein may be fused through "linker"
sequences to the Fc portion of an immunoglobulin. For a bivalent form of the protein, such a fusion could be to the Fc portion of an IgG molecule. Other immunoglobulin isotypes may also be used to generate such fusions. For example, a protein - IgM fusion would generate a 2 5 decavaient form of the protein of the invention.
The present invention also provides both full-length and mature forms of the disclosed proteins. The full-length form of the such proteins is identified in the sequence listing by translation of the nucleotide sequence of each disclosed clone. The mature form of such protein may be obtained by expression of the disclosed full-length polynucleotide 3 0 (preferably those deposited with ATCC) in a suitable mammalian cell or other host cell.
The sequence of the mature form of the protein may also be determinable from the amino acid sequence of the full-length form.
The present invention also provides genes corresponding to the cDNA sequences disclosed herein. "Corresponding genes" are the regions of the genome that are transcribed to produce the mIZNAs from which the cDNA sequences are derived and any contiguous regions of the genome necessary for the regulated expression of such genes) including but not limited to coding sequences, 5' and 3' untranslated regions, alternatively spliced exons, introns, promoters, enhancers, and silencer or suppressor elements. The S corresponding genes can be isolated in accordance with known methods using the sequence information disclosed herein. Such methods include the preparation of probes or primers from the disclosed sequence information for identification and/or amplification of genes in appropriate genomic libraries or other sources of genomic materials.
Where the protein of the present invention is membrane-bound (e.g., is a receptor), the present invention also provides for soluble forms of such protein. In such forms part or a11 of the intracellular and transmembrane domains of the protein are deleted such that the protein is fully secreted from the cell in which it is expressed. The intracellular and transmembrane domains of proteins of the invention can be identified in accordance with known techniques for determination of such domains from sequence information.
Proteins and protein fragments of thE: present invention include proteins with amino acid sequence lengths that are at least 25%(more preferably at least 50°/,, and most preferably at least 75'ia) of the length of a disclosed protein and have at least 60°/' sequence identity (more preferably, at least 75'%> identity; most preferably at least 90 i,> or 95%
2 0 identity) with that disclosed protein, where seduence identity is determined by comparing the amino acid sequences of the proteins when aligned so as to maximize overlap and identity while minimizing; sequence gaps. Also included in the present invention are proteins and protein fragments that contain a segment preferably comprising 8 or more (more preferably 20 or more, most preferably 30 or more) contiguous amino acids that 2 5 shares at least 75°/a sequence identity (more preferably, at least 85°/~ identity; most preferably at least 95°/a identity) with any suet, segment of any of the disclosed proteins.
Species homologs of the disclosed polvnucleotides and proteins are also provided by the present invention. As used herein, a "species homologue" is a protein or polynucleotide with a different species of origin from that of a given protein or 3 0 polynucleotide, but with significant sequence similarity to the Given protein or polynucleotide, as determined by those of skill in the art. Species homologs may be isolated and identified by making suitable prolr~es or primers from the sequences provided herein and screening a suitable nucleic acid source from the desired species.

The invention also encompasses allelic variants of the disclosed polvnucleotides or proteins; that is, naturally-occurring alternative forms of the isolated polynucleotide which also encode proteins which are identical, homologous, or related to that encoded by the polynucleotides .
The invention also includes polynucleotides with sequences complementary to those of the polynucleotides disclosed herein.
The present invention also includes polynucleotides capable of hybridizing under reduced stringency conditions, more preferably stringent conditions, and most preferably highly stringent conditions, to polynucleotides described herein.
Examples of stringency conditions are shown in the table below: highly stringent conditions are those that are at least as stringent as, for example, conditions A-F; stringent conditions are at least as stringent as, for example, conditions G-L; and reduced stringency conditions are at least as stringent as, for example, conditions M-R.

StringencyPolvnucleotideHybridHybridization TemperatureWash and ConditionHybrid LengthBuffer' Temperature (bpl' and Buffed DNA:DNA _50 65-C;IxSSC-or- 65'C;0.3xSSC

-l2 C; lxSSC, 50'io formamide B DNA:DNA <a0 T~*; Ix:SSC Tr*; IxSSC

C DNA:RNA _ ~0 fi7~C; lxSSC -or- ti7 C;
0.3xSSC

-15 C; IxSSC, 50/~
formamide D DNA:RNA () T""; IxSSC T"*; lxSSC

E RNA:RNA = ~0 70 C; lxSSC -or- 70'C; 0.3xSSC

50'C; lxSSC, 50%
formamide F RNA:RNA < 50 T~"; lxSSC T~*; lxSSC

G DNA:DNA 50 65-C; 4xSSC -or- 65C; IxSSC

-k~ C; =IxSSC, 50t, formamide H DNA:DNA ;~i) T"'; -IxSSC I "*; -IxSSC_ 1 DNA:RNA ~D F,7 C; -IxSSC -or- F,7 C;
IxSSC

~~ C; -IxSSC, 50%
formamide ] DNA:RNA <50 T,*; 4xSSC: T,*; -IxSSC

K RNA:RNA 50 70C; 4xSSC -or- f,7-C;
lxSSC

50-C; =4xSSC, 50'%
formamide f, RNA:RNA <,0 T, *; 2xSSC T, *; ?xSSC

M DNA:DNA 3() 50-C; 4xSSC -or- 50 C; 2xSSC

-IO-C; 6xSSC, 50'%, formamidc \i DNA:DNA 0 T,.*; 6>;SSC T~*; 6xSSC

C7 DNA:RNA ~0 ~C; 4xSSC -or- 5~-C; 2xSSC

~2-C; 6xSSC, 50'~~
formamide I' DNA:RNA <50 T,.*; 6xSSC T,.*; 6xSSC

Q RNA:RNA 30 60- C; -IxSSC -or- 60' C;
2xSSC

~45 C; 6xSSC, 50/~
formamide 2 R RNA:RNA <50 Tu"; 4x.SSC T"*; 4xSSC

~: The hybrid length is that anticipated for the hybridized regions) of the hybridizing polynudeotides. When hybridizing a poivnucleofide to a target polvnudeotide of unknown sequence, the hybrid length is assumed to be that of the hybridizing polynucleotide. When polynucleotides of known sequence are hybridized, the 2 5 hybrid length can be determined by aligning the sequences of the poivnucleotides and identifying the region or regions of optimal sequence cornplementaritv.
': SSPE (lxSSPE is O.ISM NaCI, lOmM \aH-_,PO,, aad 1.~5mNl EDTA, pl-I 7.-1) can be substituted for SSC
(IxSSC is 0.15M NaCI and l5mM sodium citrate) in the hybridization and wash buffers; washes are performed for 15 minutes after hybridization is complete.
3 0 *Tt, - T,~: The hybridization temperature for hybrids anticipated to be less than ~0 base pairs in length should be 5-10-C less than the melting temperature (T",) of the hybrid, where Tm is determined according to the following equations. For hybrids less than 18 base pairs in length, T",(~C) _ ~(# of ;a + T bases) + 4(# of G +
C bases). For hybrids between 18 and 49 base pairs in length, T",(=C) = 81.5 +
16.6(log",[Na']) + 0.41('%>G+C) (600/N), where N is the number of bases in the hybrid, a nd [Na'] is the concentration of sodium ions in the 3 5 hybridization buffer ([Na'] for IxSSC = O.I6~ M).

Additional examples of stringency conditions for polynucleotide hybridization are provided in Sambrook, J., E.F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A
Laboratory lVlnrturtl, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, chapters 9 and 11, and Current Protocols in Moleculnr l3iolo'~ry, l995, F.M.
Ausubel et al., eds., John Wilev & Sons, Inc., sections 2.10 and 6.3-6.4, incorporated herein by reference.
Preferably, each such hybridizing polynucleotide has a length that is at least 25%(more preferably at least SO°/~, and most preferably at least 75%) of the length of the polynucleotide of the present invention to which it hybridizes, and has at least 60°/~
sequence identity (more preferably, at least 75'%~ identity; most preferably at least 90'% or 95% identity) with the polvnucleotide of the present invention to which it hybridizes, where sequence identity is determined by comparing the sequences of the hybridizing polynucleotides when aligned so as to maximize overlap and idenHtv~ while minimizing Sequence gaps.
The isolated polvnucleotide of the invention may be operably linked to an expression control seduence such as the pMT2 or pED expression vectors disclosed in Kaufman et nl., Nucleic Acids Res. 19, 4485-4490 (199l}, in order to produce the protein recombinantlv. Many suitable expression control sequences are known in the art. General methods of expressing recombinant proteins are also known and are exemplified in R.
Kaufman, Methods in Enzymology 187, 537-566 (1990). As defined herein "operably 2 0 linked" means that the isolated polvnucleotide of the invention and an expression control sequence are situated within a vector or cell in such a way that the protein is expressed by a host cell which has been transformed (transfected) with the ligated polvnucleotide/expression control sequence.
A number of types of cells may act as suitable host cells for expression of the 2 5 protein. Mammalian host cells include, for example, monkey COS cells, Chinese I-lamster Ovary (CHO) cells, human kidney 293 cells, human epidermal A43I cells, human Co1o205 cells, 3T3 cells, CV-1 cells, other transformed primate cell lines, normal diploid cells, cell strains derived from in vitro culture of primary tissue, primary explants, HeLa cells, mouse L cells, BHK, I-IL-60, U937, HaK or lurkat cells.
3 0 Alternatively, it may be possible to produce the protein in lower eukaryotes such as yeast or in prokaryotes such as bacteria. Potentially suitable yeast strains include Saccharotnaces cerez~isiae, Schizosrtccltarotrtyces pombe, Klmverornuces strains, Cartdida, or any yeast strain capable of expressing heterologous proteins. Potentially suitable bacterial strains include Escherichia coli, Bacillus subtilis, Salmonella typhimurium, or any bacterial strain capable of expressing heterologous proteins. If the protein is made in yeast or bacteria, it may be necessary to modify the protein produced therein, for example by phosphorvlation or glycosvlation of the appropriate sites, in order to obtain the functional protein. Such covalent attachments rnav be accomplished using known chemical or enzymatic methods.
The protein may also be produced by operable linking the isolated polynucleotide of the invention to suitable control sequences :in one or more insect expression vectors, and employing an insect expression system. Materials and methods for baculovirusi insect cell expression systems are commercially available in kit form from, c.~~., Invitro gen, San Diego, California, U.S.A. (the MaxBac ~~ kit), and such methods are well known in the art, as described in Summers ;md Smith, Texas Agricultural Experiment Station Bulletin No. 1 S55 (19?i7), incorporated herein by reference. As used herein, an insect cell capable of expressing a polvn,.~cleotide of the present invention is "transformed."
i 5 The protein of the invention may be prepared by culturing transformed host cells under culture conditicms suitable to express the recombinant protein. The resulting expressed protein may then be purified from s~,zch culture (i.e., from culture medium or cell extracts] using known purification processes, such as gel filtration and ion exchange chromatography. The purification of the protein may also include an affinity column 2 0 containing agents which will bind to the protein; one or more column steps over such affinity resins as concanavalin A-agarose, heparin-toyopearl ~< or Cibacrom blue 3GA
SepharoseC'; one or more steps involving hydrophobic interaction chromatography using such resins as phenyl ether, butyl ether, or propyl ether; or immunoaffinity chromatography.
2 5 Alternatively, the protein of the invention may also be expressed in a form which will facilitate purification. For example, it may be expressed as a fusion protein, such as those of maltose binding protein (MBP), glutathione-S-transferase (GST) or thioredoxin (TRX). Kits for expression and purification of such fusion proteins are commercially available from New England BioLab (Beverly, MA), Pharmacia (Piscataway, NJj and 3 0 InV itrogen, respectively. The protein can also be tagged v,~ith an epitope and subsequently purified by using a specific antilr~ody directed to such epitope.
One such epitope ("Flag") is commercially available from Kodak (New Haven, CT).
Finally, one or more reverse-phase high performance liquid chromatography (RP-HPLC) steps employing hydrophobic RP-HPL.C media, e.g., silica gel having pendant methyl or other aliphatic groups, can be employed to further purify the protein. Some or a11 of the foregoing purification steps, in various combinations, can also be employed to provide a substantially homogeneous isolated recombinant protein. The protein thus purified is substantially free of other mammalian proteins and is defined in accordance with the present invention as an "isolated protein."
The protein of the invention may also be expressed as a product of transgenic animals, e.g., as a component of the milk of transgenic cows, goats, pigs, or sheep which are characterized by somatic or germ cells containing a nucleotide sequence encoding the protein.
The protein may also be produced by known conventional chemical synthesis.
Methods for constructing the proteins of the present invention by synthetic means are known to those skilled in the art. The synthetically-constructed protein sequences, by virtue of sharing primary, secondary or tertiary structural and/or conformational characteristics ~~ith proteins may possess biological properties in common therewith, including protein activity. Thus, they may be employed as biologically active or immunological substitutes for natural, purified proteins in screening of therapeutic compounds and in immunological processes for the development of antibodies.
The proteins provided herein also include proteins characterized by amino acid sequences similar to those of purified proteins but into which modification are naturally 2 0 provided or deliberately enl;ineered. For example, modifications in the peptide or DNA
sequences can be made by those skilled in the art using known techniques.
Modifications of interest in the protein sequences may include the alteration, substitution, replacement, insertion or deletion of a selected amino acid residue in the coding sequence.
For example, one or more of the cysteine residues may be deleted or replaced with another 2 5 amino acid to alter the conformation of the molecule. Techniques for such alteration, substitution, replacement, insertion or deletion are well known to those skilled in the art (see, e.g., U.S. Patent No. 4,518,584). Preferably, such alteration, substitution) replacement, insertion or deletion retains the desired activity of the protein.
Other fragments and derivatives of the sequences of proteins which would be 3 0 expected to retain protein activity in whole or in part and may thus be useful for screening or other immunological methodologies may also be easily made by those skilled in the art given the disclosures herein. Such modifications are believed to be encompassed by the present invention.

USES AND BIOLOGICAL ACTIVITY
The polynucleotides and proteins of the present invention are expected to exhibit one or more of the uses or biological activities (including those associated with assays cited herein) identified below. Uses or activities described for proteins of the present S invention may be provided by administration o:~ use c?f such proteins or by admirustraHon or use of polvnucleotides encoding such proteins (such as, for example, in gene therapies or vectors suitable for introduction of DNA).
Kesearch Uses and Utilities The polvnucleotides provided by the present invention can be used by the research community for various purposes. The polvnucleotides can be used to express recombinant protein for analysis, characteriz,ztion or therapeutic use; as markers for tissues in which the corresponding protein is preferentially expressed (either constitutivelv or at a particular stage of tissue differentiation or development or in disease states); as molecular weight markers on Southern gels; as chromosome markers or tags (when labeled) to identify chromosomes or to map related gene positions; to compare with endogenous DNA sequences in patients to identify potential genetic disorders; as probes to hybridize and thus discover novel, related DNA sequences; as a scaurce of information to derive PCK primers for genetic fingerprinting; as a probe to "subtract-out"
2 0 known sequences in the process of discovering other novel polynucleotides;
for selecting and making oligomers for attachment to a "gene chip" or other support, including for examination of expression patterns; to raise anti-protein antibodies using DNA
immunization techniques; and as an antigen to raise anti-DNA antibodies or elicit another immune response. Where the polynucleotide encodes a protein which binds or potentially 2 5 binds to another protein (such as, for example, in a receptor-ligand interaction), the polynucleotide can also be used in interaction trap assays (such as, for example, that described in Gvuris et al., Cell 75:791-803 (1993)) tc»dentify polynucleotides encoding the other protein with which binding occurs or to identify inhibitors of the binding interaction.
3 0 The proteins provided by the present invention can similarly be used in assay to determine biological activity, including in a panel of multiple proteins for high-throughput screening; to raise antibodies or to elicit another immune response; as a reagent (including the labeled reagent) in assays designed to quantitatively determine levels of the protein (or its receptor) in biological fluids; as markers for tissues in which the corresponding protein is preferentially expressed (either constitutively or at a particular stage of tissue differentiation or development or in a disease state); and, of course, to isolate correlative receptors or ligands. Where the protein binds or potentially binds to another protein (such as, for example, in a receptor-ligand interaction), the protein can be used to identify the other protein with which binding occurs or to identify inhibitors of the binding interaction. I-'roteins involved in these binding interactions can also be used to screen for peptide or small molecule inhibitors or agonists of the binding interaction.
Anv or all of these research utilities are capable of being developed into reagent grade or kit format for commercialization as research products.
Methods for performing the uses listed above are well known to those skilled in the art. References disclosing such methods include without limitation "Molecular Cloning: A Laboratory Manual", 2d ed., Cold Spring Harbor Laboratory Press, Sambrook, J., E.F. Fritsch and T. Maniatis eds., 1989, and "Methods In Enzvmolo gy:
Guide to Molecular Cloning Techniques", Academic Press, Bergen S.L. and A.R. Kimmel eds., 1987.
Nutritional Uses Polvnucleotides and proteins of the present invention can also be used as nutritional sources or supplements. Such uses include without limitation use as a protein 2 0 or amino acid supplement, use as a carbon source, use as a nitrogen source and use as a source of carbohydrate. In such cases the protein or polvnucleotide of the invention can be added to the feed of a particular organism or can be administered as a separate solid or liquid preparation, such as in the form of powder, pills, solutions, suspensions or capsules. In the case of microorganisms, the protein or polynucleotide of the invention 2 5 can be added to the medium in or on which the microorganism is cultured.
Cytokine and Cell I'roliferation/Differentiation Activity A protein of the present invention may exhibit cytokine, cell proliferation (either inducing or inhibiting) or cell differentiation (either inducing or inhibiting) activity or may 3 0 induce production of other cvtokines in certain cell populations. Many protein factors discovered to date, including all known cytokines, have exhibited activity in one or more factor dependent cell proliferation assays, and hence the assays serve as a convenient confirmation of cytokine activity. The activity of a protein of the present invention is evidenced by any one of a number of routine factor dependent cell proliferation assays for cell lines including, without limitation, ~~2D, DA2, DA1G, T10, B9, B9/11, BaF3, MC9/G, M+ (preB M+), 2E8, RBS, DA1, l23, T1165, I-IT2, CTLL2, TF-1, Mo7e and CMK.
The activity of a protein of the invention may, among other means, be measured by the following methods:
Assays for T-cell or thymocyte proliferation include without limitation those described in: Current Protocols in Immunology, Ed by J. E. Coligan, A.M.
Kruisbeek, D.H.
Margulies, E.M. Shevach, W Strober, Pub. Creme Publishing Associates and Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function 3.1-3.19; Chapter 7 , Immunologic studies in Humans); Takai et al., J. Immunol. l37:3494-3500, 1986;
Bertagnolli et al., J. Immunol. l45:1706-l 712, l990; Bertagnolli et al., Cellular Immunology 133:327-3-11, 1991; Bertagnolli, et al., J. Immun.ol. 149:3778-3783, 1992;
Bowman et al., J.
Immunol. l52: 1756-176l, 1994.
Assays for cvtokine production and/or proliferation of spleen cells, lymph node cells or thvmocytes include, without limitation, those described in:
I'olyclonal T cell stimulation, Kruisbeek, A.M. and Shevach) E.M. In Current Protocols in Irnmunolo~n/. J.E.e.a.
Coligan eds. Vol 1 pp. 3.12.1-3.l2.14, John Wiley and Sons, Toronto. 1994; and Measurement of mouse and human Interferon ~r, Schreiber, R.D. In Current Protocols in Imnucrrnlo~~. J.E.e.a. Coligan eds. Vol 1 pp. 6.8.1-6.8.8, John Wiley and Sons, Toronto. 1994.
2 0 Assays for proliferation and differentiation of hematopoietic and lymphopoietic cells include, without limitation, those described in: Measurement of Human and Murine Interleukin 2 and Interleukin 4, Bottomly, K., Davis, L.S. and Lipsky, I'.E.
In Current Protocols in Immtmolo~~y. J.E.e.a. Coligan eds. Vol 1 pp. 6.3.1-6.3.12, John Wiley and Sons, Toronto. 1991; deVries et al., J. Exp. Med. 17 3:1205-l211, 1991; Moreau et al., Nature 2 5 336:690-692) 1988; Greenberger et al., I'roc. Natl. Acad. Sci. U.S.A.
80:2931-2938, l983;
Measurement of mouse and human interleuk.in 6 - Nordan, R. In Current Protocols in Immunology. J.E.e.a. Coligan eds. VoI 1 pp. 6.6.1-6.6.5, John Wiley and Sons, Toronto. 199l;
Smith et al., I'roc. Natl. Acad. Sci. U.S.A. 83:1857-1861, 1986; Measurement of human Interleukin 11 - Bennett, F., Giannotti, J., Clark, ;~.C. and Turner, K. J. In Current Protocols 3 0 in Immunology/. J.E.e.a. Coligan eds. Vol 1 pp. 6.l5.1 John Wiley and Sons, 'Toronto. 1991;
Measurement of mouse and human Interleukin. 9 - Ciarletta, A., Giannotti, J., Clark, S.C.
and Turner, K.J. In Current Protocols in Immunoio~y. J.E.e.a. Coligan eds. Vol 1 pp. 6.13.1, John Wiley and Sons, Toronto. 199l.

Assays for T-cell clone responses to antigens (which will identify, among others, proteins that affect AI'C-T cell interactions as well as direct T-cell effects by measuring proliferation and cytokine production) include, without limitation, those described in:
Current Protocols in ImmunologS~, Ed by J. E. Coligan, A.M. Kruisbeek, D.H.
Margulies, E.M. Sheyach, W Strober, Pub. Greene Publishing Associates and Wilev-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function; Chapter 6, Cvtokines and their cellular receptors; Chapter 7, Immunologic studies in Humans);
Weinberger et al., I'roc. Natl. Acad. Sci. USA i7:6091-6()95, l980; Weinberger et al., Eur. J.
Immun.

11:405-411, 1981; Takai et al., J. Immunol. 137:3494-3500, 1986; Takai et al., J. Immunol.
140:508-512, 1988.
Immune Stimulating or Sttppressin~ Activity A protein of the present invention may also exhibit immune stimulating or immune suppressing activity, including without limitation the activities for which assays are described herein. A protein may be useful in the treatment of various immune deficiencies and disorders (including severe combined immunodeficiency (SCID)), e.g., in regulating (up or down) growth and proliferation of T and/or B lymphocytes, as well as effecting the cvtolvtic activity of NK cells and other cell populations.
These immune deficiencies may be genetic or be caused by viral (e.g., HIV) as well as bacterial or fungal 2 0 infections, or may result from autoimmune disorders. More specifically, infectious diseases causes by viral, bacterial, fungal or other infection may be treatable using a protein of the present invention, including infections by HIV, hepatitis viruses, herpesviruses, mycobacteria, Leishmania spp., malaria spp. and various fungal infections such as candidiasis. Of course, in this regard, a protein of the present invention may also 2 5 be useful where a boost to the immune system generally may be desirable, i.e., in the treatment of cancer.
Autoimmune disorders which may be treated using a protein of the present invention include, for example, connective tissue disease, multiple sclerosis, systemic lupus erythematosus, rheumatoid arthritis, autoimmune pulmonary inflammation, 3 0 Guillain-Barre syndrome, autoimmune thvroiditis, insulin dependent diabetes mellitis, myasthenia gravis, graft-versus-host disease and autoimmune inflammatory eye disease.
Such a protein of the present invention may also to be useful in the treatment of allergic reactions and conditions, such as asthma (particularly allergic asthma) or other respiratory problems. Other conditions, in v,~hich immune suppression is desired (including, for WO 98/21332 PCT/US9?/20740 example, organ transplantation), may also be treatable using a protein of the present invention.
Using the proteins of the inv ention it m ay also be possible to immune responses, in a number of ways. Down regulation may be in the form of inhibiting or blocking an immune response already in progress or ma~~ involve preventing the induction of an immune response. The functions of activated 't cells may be inhibited by suppressing T
cell responses or by inducing specific tolerance in T cells, or both.
Immunosuppression of T cell responses is generally an active, non-antigen-specific, process which requires continuous exposure of the T cells to the suppressive agent. Tolerance, which involves inducing non-responsiveness or anergy in T cells, is distinguishable from immunosuppression in that it is generally antigen-specific and persists after exposure to the tolerizing agent has ceased, Operationally, tolerance can be demonstrated by the lack of a T cell response upon recxposure to specific antigen in the absence of the tolerizing agent.
Down regulating or preventing one or more antigen functions (including without limitation B lymphocyte antigen functions (such as , for example, B7)), e.~., preventing high level Ivmphokine synthesis by activated T cells, will be useful in situations of tissue, skin and organ transplantation and in graft-versus-host disease (GVHD). For example, blockage of T cell function should result in reduced tissue destruction in tissue 2 0 transplantation. Typically, in tissue transplants, rejection of the transplant is initiated through its recognition as foreign by T cells, followed by an immune reaction that destroys the transplant. The administration of a molecule which inhibits or blocks interaction of a B7 lymphocyte antigen with its natural ligand(s) on immune cells (such as a soluble, monomeric form of a peptide having B7-2 activity alone or in conjunction with a 2 5 monomeric form of a peptide having an activity of another B lymphocyte antigen (e. ~~., B7-1, B7-3) or blocking antibody), prior to transplantation can lead to the binding of the molecule to the natural ligand(s) on the immune cells without transmitting the corresponding costimulatory signal. Blockin,5 B lv mphocyte antigen function in this matter prevents cytokine synthesis by immune cells, such as T cells, and thus acts as an 3 0 immunosuppressant. Moreover, the lack of costimulation may also be sufficient to anergize the T cells, thereby inducing tolerance in a subject. Induction of long-term tolerance by B lymphocyte antigen-blocking reagents may avoid the necessity of repeated administration of these blocking reagents. To achieve sufficient immunosuppression or WO 98/21332 PCT/US97l20740 tolerance in a subject, it may also be necessary to block the function of a combination of B lymphocyte antigens.
The efficacy of particular blocking reagents in preventing organ transplant rejection or GVHD can be assessed using animal models that are predictive of efficacy in humans. Examples of appropriate systems which can be used include allogeneic cardiac grafts in rats and xenogeneic pancreatic islet cell grafts in mice, both of which have been used to examine the immunosuppressive effects of CTLA4Ig fusion proteins irz vivo as described in Lenschovv et al., Science 257:71i9-792 (l992) and Turka et nl., Proc. Natl. Acad.
Sci USA, 89:11102-11105 (1992). In addition, murine models of GVHD (see Paul ed., Fundamental Immunology, Raven Press, New York, 1989, pp. 846-847) can be used to determine the effect of blocking B lymphocyte antigen function its vivo on the development of that disease.
Blocking antigen function may also be therapeutically useful for treating autoimmune diseases. Many autoimmune disorders are the result of inappropriate activation of T cells that are reactive against self Hssue and which promote the production of cytokines and autoantibodies involved in the pathology of the diseases.
Preventing the activation of autoreactive T cells may reduce or eliminate disease symptoms.
Administration of reagents which block costimulation of T cells by disrupting receptor:ligand interactions of B lymphocyte antigens can be used to inhibit T
cell 2 0 activation and prevent production of autoantibodies or T cell-derived cytokines which may be involved in the disease process. Additionally, blocking reagents may induce antigen-specific tolerance of autoreactive T cells which could lead to long-term relief from the disease. The efficacy of blocking reagents in preventing or alleviating autoimmune disorders can be determined using a number of well-characterized animal models of 2 S human autoimmune diseases. Examples include murine experimental autoimmune encephalitis, systemic lupus erythmatosis in MRL/!pr/Ipr mice or NZB hybrid mice, murine autoimmune collagen arthritis, diabetes mellitus in NOD mice and BB
rats, and murine experimental myasthenia gravis (see Paul ed., Fundamental Immunology, Raven Press, New York, l989, pp. 840-856).
3 0 Upregulation of an antigen function (preferably a B lymphocyte antigen function), as a means of up regulating immune responses, may also be useful in therapy.
Upregulation of immune responses may be in the form of enhancing an existing immune response or eliciting an initial immune response. For ex<lmple, enhancing an immune response through stimulating B lymphocyte antigen function may be useful in cases of viral infection. In addition, systemic viral diseases such as influenza, the common cold, and encephalitis might be alleviated by the administration of stimulatory forms of B
lymphocyte antigens systemically.
Alternatively, anti-viral immune responses may be enhanced in an infected patient by removing T cells from the patient, costimulating the T cells in vitro ~~ith viral antigen-pulsed APCs either expressing a peptide of the present invention or together with a stimulatory form of a soluble peptide of the present invention and reintroducing the in vitro activated T cells into the patient. Another method of enhancing anti-viral immune responses would be to isolate infected cells from a patient, transfect them with a nucleic acid encoding a protein of the present invention as described herein such that the cells express all or a portion of the protein on thei r surface, and reintroduce the transfected cells into the patient. The infected cells would now be capable of delivering a costimulatorv signal to, and thereby activate, I cells i~t viva.
In another application, up regulatic;n or enhancement of antigen function (preferably B lymphocyte antigen function) may be useful in the induction of tumor immunity. Tumor cells (e.~>., sarcoma, melanoma, lymphoma, leukemia, neuroblastoma, carcinoma) transfected with a nucleic acid encoding at least one peptide of the present invention can be administered to a subject to overcome tumor-specific tolerance in the subject. If desired, the tumor cell can be transfected to express a combination of peptides.
2 0 For example, tumor cells obtained from <3 patient can be transfected es viva with an expression vector directing the expression of a peptide having B7-2-like activity alone, or in conjunction with a peptide having B7-I-lil<;e activity and/or B7-3-like activity. The transfected tumor cells are returned to the patient to result in expression of the peptides on the surface of the transfected cell. Alternatively, gene therapy techniques can be used 2 5 to target a tumor cell for transfection in viva.
The presence of the peptide of the present invention having the activity of a B
lymphocyte antigens) on the surface of l:he tumor cell provides the necessary costimulation signal to T cells to induce a T cell mediated immune response against the transfected tumor cells. In addition, tumor cells which lack MHC class I or MHC class II
3 0 molecules, or which fail to reexpress sufficient amounts of MHC class I or MHC class II
molecules, can be transfectf_d with nucleic z~cid encoding all or a portion of (e.g., a cvtoplasmic-domain truncated portion) of an MHC class I a chain protein and (3, microglobulin protein or an MHC class II a chain protein and an MHC class II
(3 chain protein to thereby express MHC class I or N1HC class II proteins on the cell surface.

Expression of the appropriate class I or class II MHC in conjunction with a peptide having the activity of a B lymphocyte antigen (c~.~~.) B7-1, B7-2, B7-3) induces a T
cell mediated immune response against the transfected tumor cell. Optionally, a gene encoding an antisense construct which blocks expression of an MHC class II associated protein, such as the invariant chain, can also be cotransfected with a DNA encoding a peptide having the activity of a B lymphocyte antigen to promote presentation of tumor associated antigens and induce tumor specific immunity. Thus, the induction of a T cell mediated immune response in a human subject may be sufficient to overcome tumor-specific tolerance in the subject.
The activity of a protein of the invention may, among other means, be measured by the following methods:
Suitable assays for thvmocvte or splenocvte cytotoxicity include, without limitation, those described in: Current Protocols in Immunology, Ed by J. E.
Coligan, A.M.
Kruisbeek, D.H. Margulies) E.M. Shevach, W Strober, Pub. Greene Publishing Associates and Wilev-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function 3.1-3.l9; Chapter 7, Immunologic studies in Humans); Herrmann et al., Proc. Natl.
Acad. Sci.
USA 78:2488-2-192, 1981; Herrmann et al.) J. Immunol. 128:1968-1974, 1982;
Handa et al., J. Immunol. 135:1564-1572, 1985; 'I-akai et al., J. Immunol. 137:3494-3500, 1986; Takai et al., J. Immunol. 1-I0:508-512, 1988; Herrmann et al., I'roc. Natl. Acad. Sci. USA
78:2488-2492, 2 0 1981; Herrmann et al., J. Immunol. 128:1968-1974, 1982; Handa et al., J.
Immunol.
135:l564-1572, 1985; Takai et al., J. Immunol. 137:3494-3500, 1986; Bowmanet al., J.
Virology 61:1992-1998; Takai et al., J. Immunol. 140:S08-512, 1988;
Bertagnolli et al., Cellular Immunology 133:327-34l, 1991; Brown et al., J. Immunol. 1S3:3079-3092, 1994.
Assays for h-cell-dependent immunoglobulin responses and isotype switching 2 5 (which will identify, among others, proteins that modulate T'-cell dependent antibody responses and that affect Th1 /Th2 profiles) include, without limitation, those described in: Maliszewski, J. Immunol. l44:3028-3033, 1990; and Assays for B cell function: In vitro antibody production, Mond, J.J. and Brunswick, M. In Current Protocols in Imrnunolo~y.
J.E.e.a. Coligan eds. Vol 1 pp. 3.8.1-3.8.16, John Wiley and Sons, Toronto.
1994.
3 0 Mixed lymphocyte reaction (MLIZ) assays (which will identify, among others, proteins that generate predominantly Th1 and CTL responses) include, without limitation, those described in: Current Protocols in Immunology, Ed by J. E. Coligan, A.M.
Kruisbeek, D.H. Margulies, E.M. Shevach, W Strober, Pub. C;reene Publishing Associates and Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function 3.1-3.19; Chapter 7, Immunologic studies in Humans); Takai et ~~1., J. Immunol. 137:3494-3500, 1986; Takai et al., J. Immunol. 140:508-5l2, 1988; Bertagnolli et al., J. Immunol.
149:3778-3783, 1992.
Dendritic cell-dependent assays (which will identify, among others, proteins expressed by dendritic cells that activate naive T-cells) include, without limitation, those described in: Guery et al., j. Immunol. 134:536-Q44, 1995; Inaba et al., Journal of Experimental Medicine 173:549-559, 1991; Macatonia et al., Journal of Immunology 154:5071-5079, l995; I'orgador et al., Journal of Experimental Medicine 182:255-260, 1995;
Nair et al., Journal of Virology 67:4062-4069, 1993; Huang et al., Science 264:961-965, l994; Macatonia et al., Journal of Experimental Medicine 169:1255-l264, 1989;
Bhardwaj et al., Journal of Clinical Investigation 94:7!a7-807) 1994; and Inaba et al., Tournal of Experimental Medicine 172:631-640, 1990.
Assays for lymphocyte survival/apo~~tosis (which will identify, among others, proteins that prevent apoptosis after superantigen induction and proteins that regulate lymphocyte homeostasis) include, without limitation, those described in:
Darzynkiewicz et al., Cvtometry 13:795-808, 1992; Gorczvca et al., Leukemia 7:659-670, 1993;
Gorczvca et al., Cancer Research 5 3:1945-l951, 1993; Itoh et ai., Cell 66:233-243, 1991;
Zacharchuk, Journal of Immunology l45:4037-4045, 1990; .Zamai et al., Cytometry 14:891-897, 1993;
Gorczvca et al., International Journal of Oncology 1:639-648, 1992.
Assays for proteins that influence early steps of 'r-cell commitment and 2 0 development include, without limitation, those described in: Antica et al., Blood 84:111-1l7, 1994; Fine et al., Cellular Immunology 155:111-122) I994; Galy et al., Blood 8S:2770-2778, 1995; Toki et aL, I'roc. Nat. Acad Sci. USA 88:7548-7551, 1991.
Hematopoiesis Re rug latin~ Activity 2 5 A protein of the present invention may be useful in regulation of hematopoiesis and, consequently, in the treatment of myeloid or lymphoid cell deficiencies.
Even marginal biological activity in support of colony forming cells or of factor-dependent cell lines indicates involvement in regulating hematopoiesis, e.g. in supporting the growth and proliferation of erythroid progenitor cells alone or in combination with other cytokines, 3 0 thereby indicating utility, for example, in treating various anemias or for use in conjunction with irradiation/chemotherapy ':o stimulate the production of ervthroid precursors and /or erythroid cells; in supporting the growth and proliferation of myeloid cells such as granulocytes and monocvtes/macrophages (i.e., traditional CSF
activity) useful, for example, in conjunction with chemotherapy to prevent or treat consequent mvelo-suppression; in supporting the growth and proliferation of megakarvocvtes and consequently of platelets thereby allowing prevention or treatment of various platelet disorders such as thrombocvtopenia, and generally for use in place of or complimentary to platelet transfusions; and/or in supporting the growth and proliferation of hematopoietic stem cells which are capable of maturing to any and a11 of the above-mentioned hematopoietic cells and therefore find therapeutic utilih~ in various stem cell disorders (such as those usually treated with transplantation, including, without limitation, aplastic anemia and paroxysmal nocturnal hemoglobinuria)) as well as in repopulating the stem cell compartment post irradiation/chemotherapy, either in-vivo or e_r-vivo {i.e., in conjunction with bone marrow transplantation or with peripheral progenitor cell transplantation (homologous or heterologous)) as normal cells or genetically manipulated for gene therapy.
The activity of a protein of the invention may) among other means, be measured by the following methods:
Suitable assays for proliferation and differentiation of various hematopoietic lines are cited above.
Assays for embryonic stem cell differentiation (which will identify, among others, proteins that influence embryonic differentiation hematopoiesis) include, without limitation, those described in: Johansson et al. Cellular Biology 15:141-151, 1995; Keller et 2 0 al., Molecular and Cellular Biology 13:473-486, 1993; McClanahan et al., Blood 81:2903-2915, 1993.
Assays for stem cell survival and differentiation (which will identify, among others, proteins that regulate lvmpho-hematopoiesis) include, without limitation, those described in: Methvlcellulose colony forming assays, Freshney, M.G. In Culture of 2 5 Hematopoietic Cells. R.I. Freshnev, et al. eds. Vol pp. 265-268) Wiley-Liss, Inc., New York, NY. 1994; Hirayama et al.) Proc. Natl. Acad. Sci. USA 89:5907-5911, 1992;
Primitive hematopoietic colony forming cells with high proliferative potential, McNiece, LK. and Briddell, R.A. In Culture of Hematopoietic Cells. R.I. Freshnev, et aI. eds.
Vol pp. 23-39, Wilev-Liss, Inc., New York, NY. 1994; Neben et aL, Experimental Hematology 22:353-359, 3 0 1994; Cobblestone area forming cell assay) Ploemacher, R.E. In Culture of Hematopoietic Cells. R.I. Freshnev, et nl. eds. Vol pp. 1-21, Wilev-Liss) Inc.., New York, NY. 1994; Long term bone marrow cultures in the presence of stromal cells, Spooncer) E., Dexter, M. and Allen, T. In Culture of Hematopoietic CeIIs. R.I. Freshney, et al. eds. Vol pp. 163-179, Wiley-Liss, Inc., New York, NY. 1994; Long term culture initiating cell assay, Sutherland, H.J. In Culture of Hematnpoietic Cells. R.I. Freshney, et nl. eds. Vol pp. 139-1C2, Wiley-Liss, Inc., New York, NY. 1994.
Tissue Growth Activity A protein of the present invention also rnay have utility in compositions used for bone) cartilage, tendon, ligament and / or nerve tlSSUe growth or regeneration, as well as for wound healing and tissue repair and replacement, and in the treatment of burns, incisions and ulcers.
A protein of the present invention, whi~~h induces cartilage and/or bone growth in circumstances where bone is not normally formed, has application in the healing of bone fractures and cartilage damage or defects in humans and other animals.
Such a preparation employing a protein of the invention may have prophylactic use in closed as well as open fracture reduction and also in the improved fixation of artificial joints. Df°
novo bone formation induced by an osteogenic agent contributes to the repair of 1 5 congenital, trauma induced, or oncologic resection induced craniofacial defects, and also is useful in cosmetic plastic surgery.
A protein of this invention may also loe used in the treatment of periodontal disease, and in other tooth repair processes. Such agents may provide an environment to attract bone-forming cells, stimulate growth of bone-forming cells or induce 2 0 differentiation of progenitors of bone-forming cells. A protein of the invention may also be useful in the treatment of osteoporosis or o~,teoarthritis, such as through stimulation of bone and/or cartilage repair car by blocking inflammation or processes of tissue destruction (collagenase activity, osteoclast activity, etc.) mediated by inflammatory processes.
2 5 Another category of tissue regeneration activity that may be attributable to the protein of the present invention is tendon/ligarnent formation. A protein of the present invention, which induces tendon/ligament-like tissue or other tissue formation in circumstances where such tissue is not normally formed, has application in the healing of tendon or ligament tears, deformities and other tendon or ligament defects in humans and 3 0 other animals. Such a preparation employing a tendon/ligament-like tissue inducing protein may have prophylactic use in preventin;~ damage to tendon or ligament tissue, as well as use in the improved fixation of tendon or ligament to bone or other tissues, and in repairing defects to tendon or ligament tissue. De novo tendon/ligament-Iike tissue formation induced by a composition of the present invention contributes to the repair of congenital, trauma induced, or other tendon or ligament defects of other origin, and is also useful in cosmetic plastic surgery for attachment or repair of tendons or ligaments. The compositions of the present invention may provide an environment to attract tendon- or ligament-forming cells, stimulate growth of tendon- or ligament-forming cells, induce differentiation of progenitors of tendon- or ligament-forming cells, or induce growth of tendon/ligament cells or progenitors ex vivo for return irt vivo to effect tissue repair. The compositions of the invention may also be useful in the treatment of tendinitis) carpal tunnel syndrome and other tendon or ligament defects. The compositions may also include an appropriate matrix and/or sequestering agent as a carrier as is well known in the art.
The protein of the present invention may also be useful for proliferation of neural cells and for regeneration of nerve and brain tissue, i.e. for the treatment of central and peripheral nervous system diseases and neuropathies, as well as mechanical and traumatic disorders, which involve degeneration, death or trauma to neural cells or nerve tissue. More specifically, a protein may be used in the treatment of diseases of the peripheral nervous system, such as peripheral nerve injuries, peripheral neuropathy and localized neuropathies, and central nervous system diseases, such as Alzheimer's, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and Shy-Draper syndrome. Further conditions which may bc: treated in accordance with the present 2 0 invention include mechanical and traumatic disorders, such as spinal cord disorders, head trauma and cerebrovascular diseases such as stroke. Peripheral neuropathies resulting from chemotherapy or other medical therapies may also be treatable using a protein of the invention.
Proteins of the invention may also be useful to promote better or faster closure of 2 5 non-healing wounds, including without limitation pressure ulcers, ulcers associated with vascular insufficiency, surgical and traumatic wounds, and the like.
It is expected that a protein of the present invention may also exhibit activity for generation or regeneration of other tissues, such as organs (including, for example, pancreas, liver, intestine, kidney, skin, endothelium), muscle (smooth, skeletal or cardiac) 3 0 and vascular (including vascular endothelium) tissue, or for promoting the growth of cells comprising such tissues. Part of the desired effects may be by inhibition or modulation of fibrotic scarring to allow normal tissue to regenerate. A protein of the invention may also exhibit angiogenic activity.
4C~

A protein of the present invention may also be useful for gut protection or regeneration and treatment of lung or liver fibre>sis, reperfusion injury in various tissues, and conditions resulting frorr~ systemic cytokine damage.
A protein of the present invention may also be useful for promoting or inhibiting differentiation of tissues described above from precursor tissues or cells; or for inhibiting the growth of tissues described above.
The activity of a protein of the invention may, among other means, be measured by the following methods:
Assays for tissue generation activity include, without limitation, those described in: International Patent Publication No. V~J095/ 16035 (bone, cartilage, tendon);
International Patent Publication No. W095/05846 (nerve, neuronal);
International Patent Publication No. W091/U7491 (skin, endothelium ).
Assays for wound healing activity include, without limitation, those described in:
Winter, )epidermal Wound Healing, pps. 71-11? (Maibach, IwII and Rovee, DT, eds.), Year Book Medical Publishers, Inc.) Chicago, as modified by Iaglstein and Mertz, J.
Invest.
Dermatol 7i:382-84 (1978).
Activin/Inhibin Activity A protein of the present invention may also exhibit activin- or inhibin-related 2 0 activities. Inhibins are characterized by their ability to inhibit the release of follicle stimulating hormone (FSH), while activins and are characterized by their ability to stimulate the release of follicle stimulating hormone (FST-I). 'Thus, a protein of the present invention, alone or in heterodimers with a member of the inhibin a family, may be useful as a contraceptive based on the ability of inhibin.s to decrease fertility in female mammals 2 5 and decrease spermatogenesis in male mammals. Administration of sufficient amounts of other inhibins can induce infertility in these n-iammals. Alternatively, the protein of the invention, as a homodimer or as a heterodimer with other protein subunits of the inhibin-~3 group, may be useful as a fertility inducing therapeutic, based upon the ability of activin molecules in stimulating FSH release from cells of the anterior pituitary.
See, for example, 3 0 United States Patent 4,798,885. A protein of the invention may also be useful for advancement of the onset of fertility in sexually immature mammals, so as to increase the lifetime reproductive performance of domestic animals such as co~~s, sheep and pigs.
The activity of a protein of the invention may, among other means, be measured by the following methods:

Assays for activin/inhibin activity include, without limitation, those described in:
Vale et al., Endocrinology 91:562-S72, 1972; Ling et al., Nature 32l:779-782, 1986; Vale et al., Nature 32l:776-779, 1986; Mason et al., Nature 318:659-663, 1985; Forage et al., Proc.
Natl. Acad. Sci. USA 83:309l-3095, l986.
Chemotactic/Chemokinetic Activity A protein of the present invention may have chemotactic or chemokinetic activity (e.g., act as a chemokine) for mammalian cells, including, for example, monocytes, fibroblasts, neutrophils, T-cells, mast cells, eosinophils, epithelial and /or endothelial cells.
Chemotactic and chemokinetic proteins can be used to mobilize or attract a desired cell population to a desired site of action. Chemotactic or chemokinetic proteins provide particular advantages in treatment of wounds and other trauma to tissues, as well as in treatment of localized infections. I'or example, attraction of lymphocytes, monocytes or neutrophils to tumors or sites of infection may result in improved immune responses against the tumor or infecting agent.
A protein or peptide has chemotactic activity for a particular cell population if it can stimulate, directly or indirectly, the directed orientation or movement of such cell population. Preferably, the protein or peptide has the ability to directly stimulate directed movement of cells. Whether a particular protein has chemotactic activity for a population 2 0 of cells can be readily determined by employing such protein or peptide in any known assay for cell chemotaxis.
The activity of a protein of the invention may, among other means, be measured by the following methods:
Assays for chemotactic activity (which will identify proteins that induce or prevent 2 5 chemotaxis) consist of assays that measure the ability of a protein to induce the migration of cells across a membrane as well as the ability of a protein to induce the adhesion of one cell population to another cell population. Suitable assays for movement and adhesion include, without limitation, those described in: Current Protocols in Immunology, Ed by J.E. Coligan, A.M. Kruisbeek, D.H. Margulies, E.M. Shevach, W.Strober, I'ub.
Greene 3 0 Publishing Associates and Wiley-Interscience {Chapter 6.12, Measurement of alpha and beta Chemokines 6.12.1-6.l2.28; Taub et al. J. Clin. Invest. 95:1370-1376, 1995; Lind et al.
APMIS 103:140-146, 1995; Muller et al Eur. J. Immunol. 25: 1744-1748; Gruber et al. J. of Immunol. 152:5860-5867, 1994; Johnston et al. J. of Immunol. 153: 1762-l768, 1994.

WO 98I21332 PCT/US97l20740 Hemostatic and Thrombolvtic Activity A protein of the invention may also exhibit hemostatic or thrombolytic activity.
As a result, such a protein is expected to be useful in treatment of various coagulation disorders (including hereditary disorders, such as hemophiliac) or to enhance coagulation and other hemostatic events in treating wound, resulting from trauma, surgery or other causes. A protein of the invention may also be useful for dissolving or inhibiting formation of thromboses and for treatment and prevention of conditions resulting therefrom (such as, for example, infarction of ca rdiac and central nervous system vessels (e.g., stroke).
The activity of a protein of the invention may, among other means, be measured by the following methods:
Assay for hemostatic and thrombolvtic activity include, without limitation, those described in: Linet et al., J. Clin. I'harmacol. 26:131-140, l986; Burdick et al., Thrombosis Res. 45:41 ~--119) 1987; Humphrey et al., Fibrinolysis 5:71-79 (1991); Schaub, Prostaglandins 1 S JJ:46~--1~-1, 1988.
Receptor/Lil;and Activity A protein of the present invention may also demonstrate activity as receptors, receptor ligands or inhibitors or agonists of receptor/ligand interactions.
Examples of 2 0 such receptors and ligands include, without limitation, cytokine receptors and their ligands, receptor kinases and their ligands, receptor phosphatases and their ligands, receptors involved in cell-cell interactions and their ligands (including without limitation, cellular adhesion molecules (such as selectins, integrins and their ligands) and receptor/ligand pairs involved in antigen presentation, antigen recognition and 25 development of cellular and humoral immune responses). Receptors and ligands are also useful for screening of potential peptide or small molecule inhibitors of the relevant receptor l iigand interaction. A protein of the present invention (including, without limitation, fragments of receptors and ligands) rnay themselves be useful as inhibitors of receptor/ligand interactions.
3 0 The activity of a protein of the invention may, among other means, be measured by the following methods:
Suitable assays for receptor-ligand activity include without limitation those described in:Current Protocols in Immunology, :Ed by J.E. Coligan, A.M.
Kruisbeek, D.H.
Margulies, E.M. Shevach, W.Strober, I'ub. Greene Publishing Associates and Wiley-Interscience (Chapter 7.28, Measurement of Cellular Adhesion under static conditions 7.28.1-7.28.22), Takai et al., Proc. Natl. Acad. Sci. USA 84:6864-6868, 1987;
Bierer et al., J. Exp. Ivied. 168:1145-1156, 1988; Rosenstein et al., J. Exp.
Med. 169:149-160 1989; Stoltenborg et al., j. Immunol. Methods 175:59-68, 1994; Stitt et al., Cell 80:661-670, 1995.
Anti-Inflammatory Activity Proteins of the present invention may also exhibit anti-inflammatory activity.
The anti-inflammatory activity may he achieved by providing a stimulus to cells involved in the inflammatory response, by inhibiting or promoting cell-cell interactions (such as, for example, cell adhesion), by inhibiting or promoting chemotaxis of cells involved in the inflammatory process, inhibiting or promoting cell extravasation, or by stimulating or suppressing production of other factors which more directly inhibit or promote an inflammatory response. Proteins exhibiting such activities can be used to treat inflammatory conditions including chronic or acute conditions), including without limitation inflammation associated with infection (such as septic shock, sepsis or systemic inflammatory response syndrome (SIRS)), ischemia-reperfusion injury, endotoxin lethality, arthritis, complement-mediated hyperacute rejection, nephritis, cytokine or chemokine-induced lung injury, inflammatory bowel disease, Crohn's disease or resulting 2 0 from over production of cytokines such as I'NF or IL-1. Proteins of the invention may also be useful to treat anaphylaxis and hypersensitivity to an antigenic substance or material.
Cadherin/Tumor Invasion Suppressor Activity Cadherins are calcium-dependent adhesion molecules that appear to play major 2 5 roles during development, particularly in defining specific cell types.
Loss or alteration of normal cadherin expression can lead to changes in cell adhesion properties linked to tumor growth and metastasis. Cadherin malfunction is also implicated in other human diseases, such as pemphigus vulgaris and pemphigus foliaceus (auto-immune blistering skin diseases), Crohn's disease, and some developmental abnormalities.
3 0 The cadherin superfamily includes well over forty members, each with a distinct pattern of expression. A11 members of the superfamily have in common conserved extracellular repeats (cadherin domains), but structural differences are found in other parts of the molecule. The cadherin domains bind calcium to form their tertiary structure and thus calcium is required to mediate their adhesion. Only a few amino acids in the first cadherin domain provide the basis for hemophilic adhesion; modification of this recognition site can change the specificity of a cadherin so that instead of recognizing only itself, the mutant molecule can now also bind to a different cadherin. In addition, some cadherins engage in heterophilic adhesion with other cadherins.
E-cadherin, one member of the cadherin superfamily, is expressed in epithelial cell types. Pathologically, if E-cadherin expression is lost in a tumor, the malignant cells become invasive and the cancer metastasizes. Transfection of cancer cell lines with polynucleotides expressing E-cadherin has reversed cancer-associated changes by returning altered cell shapes to normal, restoring cells' adhesiveness to each other and to their substrate, decreasing the cell growth rate, and drastically reducing anchorage-independent cell growth. Thus, reintroducing I:-cadherin expression reverts carcinomas to a less advanced stage. It is likely that other cadherins have the same invasion suppresser role in carcinomas derived from other tissue types. Therefore, proteins of the present invention with cadherin activity, and polvnucleotides of the present invention encoding such proteins, can be used to treat cancer. Introducing such proteins or polynucleotides into cancer cells can reduce or eliminate the cancerous changes observed in these cells by providing normal cadherin expression.
Cancer cells have also been shown to express cadherins of a different tissue type than their origin, thus allowing these cells to invade and metastasize in a different tissue 2 0 in the body. Proteins of the present invention with cadherin activity, and polynucleotides of the present invention encoding such proteins, can be substituted in these cells for the inappropriately expressed cadherins, restoring normal cell adhesive properties and reducing or eliminating the tendency of the cells to metastasize.
Additionally, proteins of the present invention with cadherin activity, and 2 5 polynucleotides of the present invention encoding such proteins, can used to generate antibodies recognizing and binding to cadherins. Such antibodies can be used to block the adhesion of inappropriately expressed tumor-cell cadherins, preventing the cells from forming a tumor elsewhere. Such an anti-cadherin antibody can also be used as a marker for the grade, pathological type, and prognosis of a cancer, i.e. the more progressed the 3 0 cancer, the less cadherin expression there will be, and this decrease in cadherin expression can be detected by the use of a cadherin-binding antibody.
Fragments of proteins of the present invention with cadherin activity, preferably a polvpeptide comprising a decapeptide of l:he cadherin recognition site, and poly-nucleotides of the present invention encoding such protein fragments, can also be used to block cadherin function by binding to cadherins and preventing them from binding in ways that produce undesirable effects. Additionally, fragments of proteins of the present invention with cadherin activity, preferably truncated soluble cadherin fragments which have been found to be stable in the circulation of cancer patients, and polynucleotides encoding such protein fragments, can be used to disturb proper cell-cell adhesion.
Assays for cadherin adhesive and invasive suppressor actiyitv include, without limitation, those described in: Hortsch et al. ) Biol Chem 270 (32): 18809-l8817, l995;
Miyaki et al. Oncogene 11: 2547-2552, 1995; Ozawa et al. Cell 63: 1033-1038, 1990.
Tumor Inhibition Activity In addition to the activities described above for immunological treatment or prevention of tumors, a protein of the invention may exhibit other anti-tumor activities.
A protein may inhibit tumor growth directly or indirectly (such as, for example, via ADCC). A protein may exhibit its tumor inhibitory activity by acting on tumor tissue or tumor precursor tissue, by inhibiting formation of tissues necessary to support tumor growth (such as, for example, by inhibiting angiogenesis), by causing production of other factors, agents or cell types which inhibit tumor growth, or by suppressing, eliminating or inhibiting factors, agents or cell types which promote tumor growth.
2 0 Other Activities A protein of the invention may also exhibit one or more of the following additional activities or effects: inhibiting the growth, infection or function of, or killing, infectious agents, including, without limitation, bacteria, viruses, fungi and other parasites; effecting (suppressing or enhancing) bodily characteristics, including, without limitation, height, 2 5 weight, hair color, eye color, skin, fat to lean ratio or other tissue pigmentation, or organ or body part size or shape (such as) for example, breast augmentation or diminution, change in bone form or shape); effecting biorhythms or caricadic cycles or rhythms;
effecting the fertility of male or female subjects; effecting the metabolism, catabolism, anabolism, processing, utilization, storage or elimination of dietary fat, lipid, protein, 3 0 carbohydrate, vitamins, minerals, cofactors or other nutritional factors or component(s);
effecting behavioral characteristics, including, without limitation, appetite, libido, stress, cognition (including cognitive disorders), depression (including depressive disorders) and violent behaviors; providing analgesic effects or other pain reducing effects;
promoting differentiation and growth of embryonic stem cells in lineages other than hematopoietic lineages; hormonal or endocrine activity; in th~~ case of enzymes, correcting deficiencies of the enzyme and treating deficiency-related diseases; treatment of hyperproliferative disorders (such as, for example, psoriasis); immunoglobulin-like activity (such as) for example, the ability to bind antigens or complement); and the ability to act as an antigen in a vaccine composition to raise an immune response against such protein or another material or entity which is cross-reactive with ;such protein.
ADMINISTRATION AND DOSING
A protein of the present invention (from whatever source derived, including without limitation from recombinant and non-recombinant sources) may be used in a pharmaceutical composition when combined with a pharmaceutically acceptable carrier.
Such a composition may also contain (in addition to protein and a carrier]
diluents, fillers, salts, buffers, stabilizers, solubilirers, and other materials well known in the art. The term "pharmaceutically acceptable" means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredient(s). The characteristics of the carrier will depend on the route of administration. The pharmaceutical composition of the invention may also contain cytokines, lymphokines, or other hematopoietic factors such as M-CSF, GM-CSF, TNF, IL-l, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8) IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IFN, TNFO, TNFl, TNF2, G-CSF, Meg-CSF, thrombopoietin, stem 2 0 cell factor, and erythropoietin. The pharmaceutical composition may further contain other agents which either enhance the activity of the protein or compliment its activity or use in treatment. Such additional factors and/or agents may be included in the pharmaceutical composition to produce a synergistic effect with protein of the invention, or to minimise side effects. Conversely, protein of the present invention may be included 2 5 in formulations of the particular cytokine, I~~mphokine, other hematopoietic factor, thrombolytic or anti-thrombotic factor, or anti-inflammatory agent to minimize side effects of the cytokine, lymphokine, other hematopoietic factor, thrombolytic or anti-thrombotic factor, or anti-inflammatory agent.
A protein of the present invention may be active in multimers (e.g., heterodimers 3 0 or homodimers) or complexes with itself or other proteins. As a result, pharmaceutical compositions of the invention may comprise a protein of the invention in such multimeric or complexed form.
The pharmaceutical composition of the invention may be in the form of a complex of the proteins) of present invention along with protein or peptide antigens.
The protein and/or peptide antigen will deliver a stimulatory signal to both B and T
lymphocytes. B
lymphocytes will respond to antigen through their surface immunoglobulin receptor. T
lymphocytes will respond to antigen through the T cell receptor (TCR) following presentation of the antigen by MHC proteins. MHC and structurally related proteins including those encoded by class I and class II MHC genes on host cells will serve to present the peptide antigens) to T lymphocytes. The antigen components could also be supplied as purified MHC-peptide complexes alone or with co-stimulatory molecules that can directly silmal T cells. Alternatively antibodies able to bind surface immunolgobulin and other molecules on B cells as well as antibodies able to bind the TCR and other molecules on T cells can be combined with the pharmaceutical composition of the invention.
The pharmaceutical composition of the invention may be in the form of a liposome in which protein of the present invention is combined, in addition to other pharmaceutically acceptable carriers, with amphipathic agents such as lipids which exist in aggregated form as micelles, insoluble monolayers, liquid crystals, or lamellar layers in aqueous solution. Suitable lipids for liposomal formulation include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponin, bile acids, and the like. Preparation of such liposomal formulations is within the level of skill in the art, as disclosed, for example, in U.S. Patent No. 4,235,871; U.S. Patent No.
4,501,728; U.S.
2 0 Patent No. 4,837,028; and LT.S. Patent No. 4,737,323, all of ~n~hich are incorporated herein by reference.
As used herein, the term "therapeutically effective amount" means the total amount of each active component of the pharmaceutical composition or method that is sufficient to show a meaningful patient benefit, i.e., treatment, healing, prevention or 2 S amelioration of the relevant medical condition, or an increase in rate of treatment, healing, prevention or amelioration of such conditions. When applied to an individual active ingredient, administered alone, the term refers to that ingredient alone. When applied to a combination, the term refers to combined amounts of the active ingredients that result in the therapeutic effect, whether administered in combination, serially or simultaneously.
3 0 In practicing the method of treatment or use of the present invention, a therapeutically effective amount of protein of the present invention is administered to a mammal having a condition to be treated. Protein of the present invention may be administered in accordance with the method of the invention either alone or in combination with other therapies such as treatments employing cytokines, lymphokines or other hematopoietic factors. When co-administered with one or more cytokines, lymphokines or other hematopoietic factors, protein of the present invention may be administered either simultaneously with the cytokine(s}, lymphokine(s), other hematopoietic factor(s), thrombolytic or anti-thrombotic factors, or sequentially. If administered sequentially, the attending physician will decide on the appropriate sequence of administering protein of the ~~resent invention in combination with cytokine(s), lymphokine(s), other hematopoietic factor(s), thrombolvtic or anti-thrombotic factors.
Administration of protein of the present invention used in the pharmaceutical composition or to practice the method of the present invention can be carried out in a variety of conventional ways, such as oral ingestion, inhalation, topical application or cutaneous, subcutaneous, intraperitoneal, parenteral or intravenous injection.
Intravenous administration to the patient is preferred.
When a therapeutically effective amount of protein of the present invention is administered orally, protein of the present invention will be in the form of a tablet, capsule) powder) solution or elixir. When administered in tablet form, the pharmaceutical composition of the invention may additionally contain a solid carrier such as a gelatin or an adjuvant. The tablet, capsule, and powder contain from about 5 to 95°/> protein of the present invention) and preferably from about 2~~ to 90'i« protein of the present invention.
2 0 When administered in liquid form, a liquid carrier such as water, petroleum, oils of animal or plant origin such as peanut oil, mineral oil, soybean oil, or sesame oil, or synthetic oils may be added. The liquid form of the pharmaceutical composition may further contain physiological saline solution, dextrose or other saccharide solution, or glycols such as ethylene glycol, propylene glycol or polyethylene glycol. When administered in liquid 2 5 form, the pharmaceutical composition contains from about 0.5 to 90°/« by weight of protein of the present invention, and preferably frorm about 1 to 50°/~ protein of the present invention.
When a therapeutically effective amount of protein of the present invention is administered by intravenous, cutaneous or subcutaneous injection, protein of the present 3 0 invention will be in the form of a pyrogen-free, parenterally acceptable aqueous solution.
The preparation of such parenterally acceptable protein solutions, having due regard to pH, isotonicity, stability, and the like, is within the skill in the art. A
preferred pharmaceutical composition for intravenous, cw:aneous, or subcutaneous injection should contain) in addition to protein of the present invention, an isotonic vehicle such as Sodium WO 98l21332 PCTlUS97I20740 Chloride Injection, Ringer's Injection, Dextrose Injection, Dextrose and Sodium Chloride Injection, Lactated Ringer's Injection, or other vehicle as known in the art.
The pharmaceutical composition of the present invention may also contain stabilizers, preservatives, buffers, antioxidants, or other additives known to those of skill in the art.
The amount of protein of the present invention in the pharmaceutical composition of the present invention will depend upon the nature and severity of the condition being treated, and on the nature of prior treatments which the patient has undergone.
Ultimately, the attending physician will decide the amount of protein of the present invention with which to treat each individual patient. Initially, the attending physician will administer low doses of protein of the present invention and observe the patient's response. Larger doses of protein of the present invention may be administered until the optimal therapeutic effect is obtained for the patient, and at that point the dosage is not increased further. It is contemplated that the various pharmaceutical compositions used to practice the method of the present invention should contain about 0.0l Pg to about 100 mg (preferably about O.lng to about 10 m~,, more preferably about 0.1 ug to about 1 mg) of protein of the present invention per k~ body weight.
The duration of intravenous therapy using the pharmaceutical composition of the present invention will vary, depending on the severity of the disease being treated and the condition and potential idiosyncratic response of each individual patient.
It is 2 0 contemplated that the duration of each application of the protein of the present invention will be in the range of 12 to 2-1 hours of continuous intravenous administration.
Ultimately the attending physician will decide on the appropriate duration of intravenous therapy using the pharmaceutical composition of the present invention.
Protein of the invention may also be used to immunize animals to obtain 2 5 polyclonal and monoclonal antibodies which specifically react with the protein. Such antibodies may be obtained using either the entire protein or fragments thereof as an immunogen. The peptide immunogens additionally may contain a cvsteine residue at the carboxyl terminus, and are conjugated to a hapten such as keyhole limpet hemocyanin (KLI-I). Methods for synthesizing such peptides are known in the art, for example, as in 3 0 R.P. Merrifield, J. Amer.Chem.Soc. 85, 21-I9-2154 (1963); J.L.
Krstenansky, et al., FEBS Lett.
211, 10 (1987). Monoclonal antibodies binding to the protein of the invention may be useful diagnostic agents for the immunodetection of the protein. Neutralizing monoclonal antibodies binding to the protein may also be useful therapeutics for both conditions associated with the protein and also in the treatment of some forms of cancer where abnormal expression of the protein is involved. In the case of cancerous cells or leukemic cells, neutralizing monoclonal antibodies against the protein may be useful in detecting and preventing the metastatic spread of the cancerous cells, which may be mediated by the protein.
For compositions of the present invention which are useful for bone, cartilage, tendon or ligament regeneration, the therapeutic method includes administering the composition topically, systematically, or locally as an implant or device.
When administered, the therapeutic composition for use in this invention is, of course, in a pyrogen-free, physiologically acceptable form. Further, the composition may desirably be encapsulated or injected in a viscous form for delivery to the site of bone, cartilage or tissue damage. Topical administration may l:~e suitable for wound healing and tissue repair. Therapeutically useful agents other than a protein of the invention which may also optionally be included in the composition a:; described above, may alternatively or additionally, be administered simultaneously or sequentially with the composition in the 5 methods of the invention. Preferably for bone and/or cartilage formation, the composition would include a matrix capable of delivering the protein-containing composition to the site of bone and/or cartila~~e damage, providing a structure for the developing bone and cartilage and optimally capable of being resorbed into the body.
Such matrices may be formed of materials presently in use for other implanted medical 2 0 applications.
The choice of matrix material is based on biocompatibility, biodegradability, mechanical properties, cosmetic appearance and interface properties. The particular application of the compositions will define the appropriate formulation.
Potential matrices for the compositions may be biodegradable and chemically defined calcium 2 5 sulfate, tricalciumphosphate, hydroxyapatite) polylactic acid, polyglycolic acid and polyanhydrides. Other potential materials are biodegradable and biologically well-defined, such as bone or dermal collagen. Furth~=r matrices are comprised of pure proteins or extracellular matrix components. Other potential matrices are nonbiodegradable and chemically defined, such as sintered hydroxapatite, bioglass, aluminates, or other 3 0 ceramics. Matrices may be comprised of combinations of any of the above mentioned types of material, such as polylactic acid and hvdroxyapatite or collagen and tricalciumphosphate. The bioceramics may be altered in composition, such as in calcium-aluminate-phosphate and processing to alter pore size, particle size, particle shape, and biodegradability.

Presently preferred is a 50:50 (mole weight) copolymer of lactic acid and glycolic acid in the form of porous particles having diameters ranging from 1S0 to 800 microns.
In some applications, it will be useful to utilize a sequestering agent, such as carboxymethvl cellulose or autologous blood clot, to prevent the protein compositions from disassociating from the matrix.
A preferred family of sequestering agents is cellulosic materials such as alkylcelluloses (including hydroxvalkylcelluloses), including methylcellulose, ethylcellulose, hydroxyethvlcellulose, hydroxypropylcellulose, hydroxypropyl-methvlcellulose, and carboxymethylcellulose, the most preferred being cationic salts of carboxvmethvlcellulose (CMC j. Other preferred sequestering agents include hyaluronic acid, sodium alginate, polv(ethylene glycol), polyoxyethylene oxide, carboxyvinyl polymer and poly(vinvl alcohol). The amount of sequestering agent useful herein is 0.5-20 wt°/~, preferably 1-10 wt'%~ based on total formulation weight, which represents the amount necessary to prevent desorbtion of the protein from the polymer matrix and to provide appropriate handling of the composition, yet not so much that the progenitor cells are prevented from infiltrating the matrix, thereby providing the protein the opportunity to assist the osteogenic activity of the progenitor cells.
In further compositions, proteins of the invention may be combined with other agents beneficial to the treatment of the bone and/or cartilage defect, wound, or tissue in 2 0 question. These agents include various growth factors such as epidermal growth factor (EGF), platelet derived growth factor (I'DGF), transforming growth factors (TGF-a and TGF-(3)) and insulin-like growth factor (1GF).
The therapeutic compositions are also presently valuable for veterinary applications. Particularly domestic animals and thoroughbred horses, in addition to 2 5 humans, are desired patients for such treatment with proteins of the present invention.
The dosage regimen of a protein-containing pharmaceutical composition to be used in tissue regeneration will be determined by the attending physician considering various factors which modify the action of the proteins, e.g., amount of tissue weight desired to be formed, the site of damage, the condition of the damaged tissue, the size of 3 0 a wound, type of damaged tissue (e.g., bone), the patient's age, sex, and diet, the severity of any infection, time of administration and other clinical factors. The dosage may vary with the type of matrix used in the reconstitution and with inclusion of other proteins in the pharmaceutical composition. For example, the addition of other known growth factors, such as IGF I (insulin like growth factor I), to the final composition, may also effect the dosage. Progress can be monitored by periodic assessment of tissue/bone growth and /or repair, for example, X-rays, histomorp:hometric determinations and tetracycline labeling.
Polynucleotides of the present invention can also be used for gene therapy.
Such polynucleotides can be introduced either in vivo or ex vivo into cells for expression in a mammalian subject. I'olynucleotides of the invention may also be administered by other known methods for introduction of nucleic acid into a cell or organism (including, without limitation, in the form of viral vectors or naked DNA).
Cells may also be cultured ex vivo in the presence of proteins of the present invention in order to proliferate or to produce a desired effect on or activity in such cells.
Treated cells can then be introduced in vivo for therapeutic purposes.
Patent and literature references cited herein are incorporated by reference as if fully set forth.

SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Jacobs) :~enneth McCoy) John M.
LaVallie, Edward R.
Racie, Lisa A.
Merberg, David Treacy, Maurice Spaulding, Vikki :':gos t ino , Michael J .
(ii) TITLE OF INVENTION: SECRETED FROTEINS AND POLYNUCLEOTIDES
ENCODING THEM
(iii) NUMBER OF SEQUENCES: 39 ( vvj CORRESPONDS=:~'v ADDR.ESS
(.y) ADDRESSE;: Genetics Institute, 1-nc.
(~} STREE_: Cami~ridgePark Drive (C) CITY: Cambridge (D) STATE: :~_A
(E) COUNTR':': U.S.A.
(F) ZIP: 0 140 (v) COMPUTER READABLt; FORM:
(r1) MEDIUI~' TYPE: Floppy disk (B) COMPUTER: T_BM FC compatible (C) OPERATI_:G SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release rrl.C, Version #1.3D
(vi) CURRENT APPLICATION DATA:
(A) i~PPLIC:~TION NUi~!BER:
(B) FILING DATE:
(C) CLASSIF'_CATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Sprunger, Suzanne ::.
(B) REGI:~TR?TION NUMBER.: 4l,323 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (o17) 498-8284 (B) TELEFAX: (6l7) 876-5851 (2) INFORMATION FOR SEQ ID NC:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 430 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D; TOPOLOGY: linear n (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION:
SEQ ID NO:1:

TAAAGATCTG TGTTCAGAGT CATACTGAAYAGAGAC'TTCTGGACTCTATA GAACCCF1CTG60 CCTCCTGATG AAGTCCCTAC TG'PTCACCCTTGCAGTTTTTATGCTCCTGG CCCAATTGGT12O

CTCAGGTAI~T TGGTATGTGA AAACGA.CGTTGGAATTTGCA AGAAGAAGTG180 AAAAGTGTCT

CAAACCTGAA GAGATGCATG TA.AAGAATGGTTGGGCAATGTGCGGCAAAC AAAGCGACTG240 CTGTGTTCCA GCTGACAGAC GTGCTr':.s'1TTATCCTGT'TTTCTGTGTCCAGA CAAAGACTAC300 AAGAr'1TTTCA ACAGTAACAG AACAACAACTTTGATGATGA CTACTGCTTC36O
CAACAACAGC

GATG':'C'_":'CG ATGGC T CCaCTCGTTGAACATTCCF,G CCTCTGTCTC42 (2) INFORMATION FOR SEQ
ID N0:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 121 amino acids (B) TYPE: amino acid (C) STRANDEDNE:SS:

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
Met Lys Ser Leu Leu Phe Thr Leu F,la Val Phe Mec Leu Leu Ala Gln Leu Val Ser Gly Asn Trp 'I'yr Val L~ys Lys Cys Leu Asn Asp Val Gly 20 .~5 30 Ile Cys Lys Lys Ly_~ Cys Lys Pro G~lu Glu Met His Val Lys Asn Gly Trp Ala Met Cys Gly Lys Gln Arg F,sp Cys Cys Val Pro Ala Asp Arg Arg Ala Asn Tyr Pro Val Phe Cys Val Gln Thr Lys Thr Thr Arg I1e Ser Thr Val Thr Ala Thr Thr Ala 'I'hr Thr Thr Leu Met Met Thr Thr WO 98l21332 PCT/US97/20740 Ala Ser Met Ser Ser Met Ala L'ro Thr Arg T'he Ser His Trp Leu Asn Ile Pro Ala Ser Val Ser C'y~ Se. Arg l15 120 (2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTT_CS:
(A) LENGTH: 112 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULr: TYPE: cDNA
(xi) SEQUENCE DESCR IPTION: SEQ ID I'0:3:
TTTCCTGNTT TNGGA'_~CCCC Gi~TTCF:TTAA AGCAANGGGG I';'T'TNAAAF~-.~~ .~iA.AAAAAAA

AAAAAAAAAA P,AAAAAAAAA AAAAAAAAAA A.AAP.AAAAAA AA.~AP,AAA.n.A AA 1l2 ( 2 ) INF ORM11TION FOR SEQ ID NO : 4 ( '~ ) SEQLJENCF CHiIRACTERT_S T ICS
(A) LENGTH: 324 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) '?'OPOLOGY: Linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRT_PTION: :
SEQ ID N0:4 TGTATTGGCG CCATCATGGC TCACTGCGGCCTCCGGCTCC"_'TGGCTCGG~~ TGATTCTCCT240 GCCTGAGCC'_~ CCCTAGTAGC_' GTGCTGTAGAAGAAAATCAC ATGATTGGTG300 TAGGACTACA

CCCTCAAAP.A ATTGGTGCCr'~. 324 CTTG

(2) INFORMATION FOR SEQ
ID N0:5:

( i ) SEQUENCE CHARr'1CTERI
STICS

(a-,) LE:JGTH: 794 base pair (3) TYPE: nucleic acid (C) STRANDEDNI?SS: double (D) TOPOLOGY: ~~.inear (ii) :~IO~ECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION:
SEQ ID N0:5:

CATTATTTCA '_"..'=.CCAGAGAAGCAAi;TAGC ATTGTGAGTC=..=~ACTATTCC6O
ATACACATGC

NAAAGCACAG ~-,'"TC ACCAA':TC~'1TCTGGAT ATCTCAC;\TNN; ~IIVl'1NNNNNNl TTAACTGATG ~~L~AAAGTF:A GCCCTTGTGG ATGT:TTCTGACGATCCTGGA 180 TGGAACAATT

GCCNATGTAT C'_'P.ACATAC:'1AAAATTTCAA GTCTGGAGA'I''_'=.AACTCAAA240 GC'I'TCAGCAA

GTATCTGAAG = :G ~~AT~F:CA CAGGA'I' CTC'~C G GAA~GCAT 3 GAGAATTAF~.t-~ AAKCATTGAT 0 AATGTCT'='AC: ~=~A.AGGCTT FuriAGAGCAAG AGGCCATTTC~_""'~TCAAGAT3 AGATAC AAAG C TTCAGGA AA.r~ICATAAACAAGAF:TTGC, AAGACATGAGG Ar'1AGCTGGT4 CACGAAGCC C '_ CAGCATTAT T ATAAC~GCAC TACTGCAGTC"_'= CAGTTAAG4 TG'~ GGATGAA 8 CAACAAGTAG : = GCTA T TGA ATTTCTGCAlI TTGAGAAACG'~CACACAAG5 TGTGAGGAGT '.GCTAAATGC AGGCTC'.CTTG F~AGTGC'I'AGAT::CAGAGAAG600 TC.?~GCATCAG

GAACTGTTr'1A =.'-.GAAAAAATmTGATTCAGC AATCTCAAGiia-.CAGAAGGAA660 AA.~GGAAGCT

ATATTGGAI~'~ :.:GTGTTTGGA C'.':AAGt~Fr,TA .-'.GTATCCGCT720 GG.~AGAAAGG AAGAGGCATT

GCAAAGCTTG ~~,Ar'~F~GAACC GCr'1:'~ITTTTAA ::C=AAGAAAGA7 AG'rGAAGGr'1T AATTCG T AGA 8 rf,AA 7 (2) INFORMF.=ION FOR SEQ
ID N0:6:

(i) SLQUENCE CHARACTERISTICS:

(=.) LENGTH: lEi4 amine acids (3) TYPE: amino acid STRANDEDNESS:

(D) TOPOLOGY: linear (ii) MO~ECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:6:

Met Glu Lys His Asn Val Leu Glu Lys Gly Phe Leu Lys Glu Lys Glu i 5 i0 15 Gln Glu Ala Ile Ser Phe Gln Asp Arg Tyr Lys Glu Leu Gln Glu Lys His Lys Gin G1u Leu Glu Asp Met Arg Lys Ala Gly His Glu Ala Leu Ser Ile T_1~~~ Val a-.sp Glv Tyr Lys Ala Leu Leu Glri Ser Ser Val Lys Gln Gln Val Glu -~la Ile Glu Lys Gln Tyr Il.e Ser Ala Ile Glu Lys Gln Ana H=s L_ ~ Cvrs C~.Lu Glu i eu l..eu Asn Ala Glr_ His Gln l:rg Leu 'gyp 90 95 Leu Glu Val Leu Asp Thr G.Lu Lys G1u Leu Leu Lys Glu Lys Ile Lys 0 'L '? 110 Glv~ Ala Leu I-_ G=n Glt: Ser Glr: Glu Gln Lys GLu I1e Leu Glu Lys 115 "~20 12'_~
Cys Leu Glu G1u :~lu Arg Gln t:rg Asn Lys Glu Ala Leu Val Ser Ala Ala Lys Leu G1,. Lys Glu Pro Val Lys Asp Ala laa Leu Lys Phe Val 145 l50 155 160 Glu Glu Glu Arg (2) INFORMATION FOR SEQ ID N0:7:
(i) SEQUENCE CHARACTERISTICS:
LENGTH: 1494 base hairs (B) TYPE: rn~cleic acid (C) STRANDEDNESS: doui~le (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE
DESCRIPTION:
SEQ ID
N0:7:

TGCAAGAGTCACCTTCTGGt'1CTGCTGCCCCCATGACr'~TCC TGGCTGGGACGCGCATGGAT 240 TTAGGAGAATGTACCAAAAT CCP,CGACTTGGCCCTCCGAGCAGATTF:TGA GF-~TTGCAAGT300 AAAGAAAGi-.GF~CCTGTTTTT TGAATTAGATGCAATG;~ATCACTTGGAGTC CTTTATTGCT360 GAATGTGATCGGAGAACTGA GCTCGCCP.tIGAAGCGGCTGGCAGAAACACF: GGrIGGAAATC420 AGTGCGGAAGTTTCTGCAAA GGCAGGAAAAGTACAT;:AGTTAAATGAAGA :yTAGGAAAA480 CTCCTTGCTAA.AGCCGAACA GCTAGGGGCTGAAGG:'.ATGTGGATGAATC CCAGAAGATT540 CTTATGGAAGTGGAAAAAG'I' TCGTGCGAAGAAAAAA CTGAGGAF,GF: ATACAGAAAT6 ~:~Ar'1G 0 TCCATGCCTGCATCCAGTTT TCAGCAGCr'1AAAGCTG'GTGTCTGCGAGGT CTGTTCAGCC660 TACCT TCCATGACl::: TGACCGTCGCCTGGC:~:~ACCACTTCGGTGG CAAGTTACAC7 TTGGGGTTCATTCAGATCCG AGAGAr'1GCTTGATCF_G'~':'GAGGAAAAG'I'~T CGCTGAAAAG780 CAGGAGAAGAGAAATCAGGA TCGCTTGAGGAGGAG=:,AGGAGAGGGAACG GGAGGAGCGT840 CTGAGCAGGAGGTCGGGA T ~' GATCG~~ G GTCF1C GCTC CCGGGATCGG9 AAGAACCAGA GC,A 0 CGTCGGAGGCC:GTCAAGATC TACCTCCCGAGAGCG=.~GGAAA'iTGTCCCG GTCCCGGTCC960 CGAGATAGACATCGGCGCC: CCGCAGCCGTTCCCGG:=,GCCACAGCCGGG~ ACATCGTCGG1020 GCTTCCCGGGF:CCGAAGTGC GAAATACAAGTA.ACT::nTCTGACTCCTTCC: '.=TAGCTGCAA1080 CCAGGAGTTC~_'CCAGF-:GAGC AGAGC~::~T~'CTGGGaGAGCG GGCGGAGCGA1140 CGGCATCCAG

GCGAGGGCCCCCGGACTGGA GGCTTGAGAGCTCCAP.;~GGGAAGATGGC"."_" CACGGAGGTC12O0 AGAAGAGAAGGAGGCCGGCG AGATCTGAACCCCTC:''~CCGGGTGC'I'GTPK ATAGTCTGAT1260 AAACGTTCF,C~CAGTCTAAA ATTACCCTTTATATT'_"'CTGAATACAAC'_'C ATCTTTTGTA1320 GTTTAAA.r.TCTATTGTTT TGGAGCTAGC': GTGAG 'I :AGAAG T G T.=, 13 T T __"TTC CAGAGTTGCT 8 CCTGTGTTCCCGGGTCATGT 'PGAGTAGGAAT AAAT T GATGC T G ~': i ~-.A'I'C TCCTGGAAAA 4 AAAAAA.~1AAAP,~~:?~AAF~AAAA rIAAAAr AP,AF:T,AAAAF, AAAA14 P,1~.~1AAAAAAA ;.AAA 9 {2) INFORMATION FOR SEQ :
ID N0:8 (i) S EQUENCE CHARACTERISTICS:

(A) LENGTH: 32~ acids amino (B) TYPE: amino acid (C) STRANDEDNESS:

(D) TOPOLOGY:
linear (ii) M OLECULE TYPE:
protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:8:
Met Ser Ala Gln Ala Gln Met Arg Ala Leu Leu Asp G-n Leu Met Gly Thr Ala Arg Asp Gly Asp Glu Thr Arg Gln Arg Va1 L_ Phe Thr Asp Asp Arg Val Cys Lys Ser His Leu Leu Asp Cys Cys Pro His Asp Ile Leu Ala Gly '.'hr Arg Met Asp Leu Gly Glu Cys Thr Lys Ile His Asp Leu Ala Leu Arg Ala Asp Tyr Glu Ile Ala Ser Lys Glu Arg Asp Leu Phe Phe Glu Leu Asp Ala Met. Asp :I is Leu Glu Ser '.:e Ile Ala Glu Cys Asp Arg Arg 'I'hr Glu Leu r.la Lys Lys Arg Leu Ala Glu Thr Gln Glu Glu Ile Ser Ala Glu Vai per Ala L,ys Ala Gly L.ys Val His Glu Leu Asn Glu Glu Ile G.Ly Lys Leu Leu Ala Lys Ala Glu Gln Leu Gly 130 l35 140 Ala Glu Gly Asn Val Asp Glu Ser Gln Lys Ile Leu r:et Glu Val Glu l45 150 155 160 Lys Val Arg Ala Lys Lys Lys G1u Ala Glu Glu Gl.u 'i'yr Arg Asn Ser 165 l70 175 Met L~ro Ala Ser Ser Phe Gln Gln Gln Lys Leu Arc 'va~~ Cys Glu Val 180 l85 190 Cys Ser Ala Tyr Leu Gly Leu His Asp Asn Asp Arg Arg Leu Ala Asp His Phe Gly G:Ly Lys Leu His Leu Gly Phe Ile Gln Ile Arg Glu Lys 2l0 215 220 Leu Asp Gln Leu Arg Lys Thr Val Ala Glu Lys G'_~r. Glu Lys Arg Asn Gln Asp Arg Leu Arg Arg Arg Glu Glu Arg Glu Arg Glu Glu Arg Leu Ser Arg Arg Ser Gly Ser Arg Thr Arg Asp Arg Arg Arg Ser Arg Ser Arg Asp Arg Arg Arg Arg Arc Ser Arg Ser Thr Ser erg Glu Arg Arg Lys Leu Ser Arg Ser Arg Ser Arg A.sp Arg His Arg Arg His Arg Ser Arg Ser Arg Ser H=.~; Ser Arg Gly H:is Arg Arg Ala Ser Arg Asp Arg Ser Ala Lys Tyr Lye (2) INFORMATION FOR SEQ TD N0:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1761 base pairs (B) TYPE: nucleic acid (C) STRANDEDNE:SS: double (D) TOPOLOGY: ~~inear (ii) MOLECULE TYPE: cDNA
(xi) :

DESCRI:PTIOTd:
S~Q
ID N0:9 CAAGGGAAGTTCTGAGGGCTGA~OAGGTTGC':'CA.TTC:GTCAGAGCGTGCTGCCCACCCTCC 60 ACCCCTGCATGGCAGAAACTGTGCAGGGGAC~AGGCCAAGGAA'PCAGGAGACCCAGAGGC 120 AGGGGTGGCCCGGAGACGG'I'GAAGAAACCAA.GACGCACGAGAGGCCAAGCCCCTTGCCTTG 180 GGTCACACAGCC~-~AAGGAGGCA(~AGCCAGAT-.CTCACAACCAGe'1TCCAGAGGCr'~ACAGGGA240 GATGAGCAAGT'_~CTTAAGGCi~CTTCACGGTCGTGGGAGACGACTACCATGCCTGGAACAT 360 ACCAGTCTCAGGCGAGGAAGGCAGAGCTGC::GCCCCTGACGTTGCCCCTGCCCCTGGCCC 480 CGCACCCAGGGCCCCCCTTGAC'rTCAGGGGCATGT'T'GAGGE'~AACTGTTCAGCTCCCACAG 540 GTTTCAGGTCATCATCATCTGC'PTGGTGGTTCTGGATGCCCTCCTGGTGCTTGCTGAGCT 600 CATCCTGGACCTGAAGATCATCCAGCCCGACAAGAA.TAAC'IATGCTGCC~:TGGTATTCCA 660 CTCATTCATCCTCGACATTGTCCTCCTGTTCCAGGA.GCACCAGTTTGAGGCTCTGGGCCT 840 WO 98/21332 PCT/i1S97/20740 TGAGAAGGAA CAAGAAATTG AAP.GACTTAA

TGAAGTGAAC

TC.~1AAAAGAA GACACTGTCT CATGGGCCTG AGAGGAACAG C'_"GCCCCTCCi140 TGCTGTCACG

r~.CCTCTGCCT

CTGGGTGGAC ACAGCCTTGT GGAAGGTCCA GAGCTGCCC=: :'CCACTCCCA126O
GTACCACCAA

CCCCACACTG TA'rCAAATG i' ATCACAT~_'TTACACTTTAGC C'_"TAATTGAA13 t~ATGAGCAAC AAAGCTGGi-iC :~,ATTGCTAGTP.TTTAATC'T_'C 1380 ':'GTATATAAA .'-.CCGAATGTA

CAGTTTTCAA ATTTCACGTG TATATTFAGG TCTGAGCATT C'_"GAAAGAAA1490 AACTGATGCA

GAAAAAGAAG CTACTTTAGC TGCCACCCCA GTCTCTTATT ':TCAAGCTGT1500 TTCTAGAAAA

TCTAAATAGC TTCGTCTCAG "_'TTCCC;~.-'~:AGGCCCCTCC ':''CTGTGTGCC1560 ,GGGGTACCC

CCAGC'.T'GCAT CAGCC'AGC'~"?' ':'.~AGG~iGCCTGCCACCT'.~ r:CAACATTTT1620 CT CCATTGTTTT

TCC :'CA.~1TTA CTGTACAACT P.CTGTATAAATACTGTATAA r aTAAACTCT16 ?:TAAAACAAC 8 C~_'C'."TTTCCC TGGAAAAAAA P~AAA~~u AAAAAAAAP~ ~AAAAAAAA1 ~ AAAAAAAAAA 7 P~,~AAAAAPLAA AAA A 17 (2) 1':FORMATION FOR SEQ ID N0:10:

(i) SEQUENCE CHARACTERI~TIC.'~:

(A) LENGTH: 273 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:

(D) TOPOLOGY: linear (ii) MOLECULE T'IPE: protein (xi) SEQUENCE DESCRT_PTIO'd: S~Q ID N0:10:
Me; Ala Thr Trp Asp Glu Lys Ala Val Thr Arg Ar~7 Ala Lys Val Ala Pro Ala Glu Arg Met Ser Lys Phe Leu Arg His Phe T::r Val Val Gly Asp Asp Tyr His Ala Trp Asn Ile Asn Tyr Lys Lys Trp Glu Asn Glu Glu Glu Glu Glu Glu Glu Glu Gln Pro Pro Pro T2:r Pro Val Ser Gly Glu Glu Gly Arg Ala Ala Ala Pro Asp Val Ala Pro Ala Pro Gly Pro Ala Pro Arg Ala Pro Leu Asp P:~_e Arg Gly Met Leu Arg Lys Leu Phe Ser Ser His Arg Phe Gln Val Ile Ile Ile Cys Leu Val Val Leu Asp_ Ala Leu Lcu Val Leu Ala Glu Lc~a I~~ Leu Asp Leu Lys Ile Ile Gln 115 120 l25 Pro Asp Lys Asn Asn Tyr Ala A-~a Met Val Phe flis Tyr Met Ser Ile Thr Ile Leu 'Jal P!:e Pt:e Met "?et :=lu I1e Iie Pue Lys Leu Phe Val i45 150 155 160 Phe Arg Leu Glu Phe Phe His :.~ ~ L,ys Phe Glu Ile Leu Asp Ala Val 165 170 l75 Val Vai Vai Vzil per Phe Iie -~u ksp _le Val Leu Leu Phe Gln Glu .80 185 190 His Gln Phe Giu A1a Lc:u Gly Leu Leu ile Leu Leu Arg Leu Trp Arg Val Ala r'1rg Ile Ile Asn Gly lie ile Ile Ser Val L.~s Thr Arg Ser 2i0 215 22C
Glu Arg Gln Leu Leu Arg Leu L,ys Sln Met Asn Val Cln Leu Ala Ala Lys Ile Gln :Iis Leu Giu Phe Ser ~ys Se_r Glu Lys Glu Gln Glu Ile Glu Arg Leu Asn L,ys Leu Lees Arg ~=~~n Ills Gly Leu Leu Gly Glu Val Asn (2) INFORMATION FOR Sc.Q ID N0:11:
( i ) SEQUENCE CFWFtACTERISTICS
(A) LENGTI-l: 928 base pairs (B) TIPS: nucleic acic (C) STRANDEDNESS: double (D) TOPOLOGY: linear ( i i ) MOLECULE "_'YP~' : cDNA

(xi) SEQUENCE
DESCRIPTION:
SEQ
ID N0:11:

AATCGGGAGTCCTGGAAAGT TAATTCCAATGTCATGACGTCAAACTTA.z.A ATGGTCGTCT60 AAAAA.ANT:.CCAC CACTCAT T AAAAAAGTATATGCAAAAAACCTCTTCAi; TCCCACTAAA42 TGAGCTGTaCCCACCACTCA TTAACCT'.VTGGGAAGGTGACAGCGAGNAF:G ACAAAGATGG480 TTTTGCAGACACCP.AGCCAA CCCAGGTNGACACATCCAGAAGGTATTACA TGTGGTAANT540 C11GAGGAT::TTTTGCTTCTG GTAGTAAGGAGCAC_'AAP.GACGTTTTTGCT'_' TATTCTGCAA600 RAGTGWCA.=~GTTGAAGACT "_'TTGTATTTT"_'GACTTTCCTAGTTTGTGGC AGAGTGGAGA660 GGACGGGTGGATATTTCAAA TTTTTTTAGTF-_TAGCGTATCGCAAGGG'_~T~' GACACGGCTG720 CCr'~.GCGATAGGCTTCCA GTCTGTGTTGGTTTTTATTCTTATCATT: TTATGATTGT7 C'='C I' 8 TATTATAT'='P.TTATTTTAT'I' TTAGTTGTTGTGCTAAACTCAATAATGC~'~ TTCTAACTAC840 AGTGCTCFu;TAAAATGATTA ATGACAGGATGGGGTTCCCCTGTGCTTTT:=. CCAGTAGCAT900 ( 2 ) ATION FOR SEQ ID :
I NFORNINO : 1 (i) S EQUENCE CHARr'1CTERISTT_CS:

(A) LENGTH: 52 cids amino a (B) TYPE: ~~mino acid (C) STRANDEDNESS:

(D) TOPOLOGY: linear (,~i) OLECULE TYPE: protein Li (xi) SEQUENCE DESCRIPTION: SEQ ID N0:12:
Met Ile Val Ile Ile Leu Leu Phe Tyr Phe Ser Cy~ Cys Ala Lys Leu Asn Asn Ala Va1 Leu Thr Thr Val Leu Asn Lys Mer Ile Asn Asp Arg Met Gly Phe Pro Cys Ala Phe Thr ~~er Ser Met ~!'hr Leu Pro Glu Ala Ile Arg Arg Lys (2) INFORMATION FOR SEQ ID N0:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 49 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) ~EQUENCE DESCFIPTION: SEQ ID N0:13:
AAA'~TAAANi~ ?.AAAAAAAAA t~A~~AAAr~~AA AAATAPAGAA t~AAAAAAi~ 49 (2) INFOR_h:ATION FOR SEQ ID N0:14:
(i) .~EQUENCE CHARACTERISTICS:
(A) LENGTH: 597 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear ( i i ) I~.OLECULE TYPE : cDNA
(xi) SEQUENCE
DESCRIPTION:
SEQ ID N0:1=:

ATTCTACAAG r.TAACTTCCCAGTACTTTAA AAAAGTCTCA AAGTCATA_:.7CAAGAAAGAA60 CTGAGGGAC: =.TTGCATATTGGAGCGATCT Ar'1AGAAGTAT GGAATTCTTG120 TACAATTTG"_' ATTAAATCCT GGACCAGCAAAAGGACATTA GTGGGA.~AAT TCATGAAATTCAAATGAGAT18O

CTTATATTGi'-. GTCAGTG Tr'1C ATTTCCTGGT GCAAGTGATT24O
r.GTTAATTGT TTTCATAFi='''' ATGTAAGGTT "_'GTTAATATTAGGAGCAGCT GGGTAAr'~GGT CTCTATACTA300 TATACAAAF~.

TTTTTGCATT ~TTTTCTGTAGTTTAAAAC ATTTTC(~AAC TAAAAAGTTGA.T~AACACATG360 A

TATTAGAGAC CATGCGTATGTGTCTCTAA TAATCT'CAAA TATATTTAAGATGATAGAAG420 GAATTCTTGA GATAGTAAAATGAAGTCACC AAA.AAACAAA CAAAGAAACaAP.ACGAAATC480 ACCAARATCT ATCAATAAATTTCAGGTAAT ACTTTTC~GCA GATTCATTCCTTTGAGATGGS40 AGTCTCACTC CCAGTCTGGG CAACGAGCGA AACTCCGTCT AAF~AAAAAA a-~AAAAA 597 (2) INFORMATION FOR SEQ ID N0:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 00 amino acids (E) TYPE: amino acid ( C ) .=TPwP.NDEDNESS' (D) TOPOLOGY: linear {ii) MOLECULE TYPE: protein (xi) ~JQUENCE DESCRIPTION: SEQ 1D N0:15:
Met Arg Se= Tyr Ile G1u Val Asn Cys 'Jal :~:~=- Val His Phe Leu Val Phe Ile Ilc A1a Ser Asp '1'yr 'Jal Arg hhe Vai Asn Ile Arg Ser Ser 2.?~ ?0 Trp V«'_ Lys '~.'al Ile Gln Lys Leu ':'yr Tt:r Ile L'he Ala Pt:e Phe Ser Val Ser Leu Lys Hi_ I'he Pro 'L'hr Lys Lys Leu L,ys Thr H.is Val Leu Glu Thr Yis F~la 'I'yr Val Ser Leu I le 1 1 a Leu Asn Il a Phe Lys Met ile Glu Gly Ile Leu Glu Ile Val Lys (2) INFORMA'='ION FOR SEQ ID N0:15:
( i ) SEQUENCE CIIARACTERIS'PICS
(A) LENGTH: 1804 base pairs (5) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SJQ ID N0:16:
GGAGTTCATT i-~.GGCCAGTGG CACTGATTT~_' TCCTTCCCAT CATAGCTATT TATTCTAGTA 60 GCCTTGAGP.A TGCACGGCAA GATCATTTAA240 AATTACAGGA TTTGT,AGGAA
TTTCAAATGG

ACATTTGP.AAAATTATTTTAAAAACCATCTAGTTTGCTTTTGGATTTTAGACATTAAAGC300 CTATGTTGTCTTGTTAACAGGGGTGGAA'rGTATAACCP.TCAGATTCAGCATGTGATTTCA360 CCTTTGAATCTGAGTATTTCTTCCCTATCTTC"_'TT(~AGTCATTTTTGGAGCAGACTGTCA420 CCAGTATTGATAACTFiAGCATTAA11GGGAAAP.GTT(~CATTGCAACTATGCr.TTGGTTTCC480 TGGAAGAACTTTTCTTTTGTTTTAGTGAATGAAGAC~GCTTGATGGGATCACTTP.CTGTAA54O

CTCCTTCTACATAAGGACCCCTTCTGCAAGCAGAAC=.CAAP..T~GAACATGC~'CAr?GGAGTA60Q

TCCCATTTTCTGGATAAATTGAAGAr?GTTTGCTAGTFv'\TGTCTTTATACTAGCGTCTTCC660 TTGTP.TCCCTTTGCTGGCAAGGGAATACFLAGGCG CCACAGATCAAnACACCCCE?7 T C, 2 =.AGA 0 CATTTGAGTGGAGTCTTAT'PTTTACTCCAF:GAGCr?GTTATTCCCTTCTAGTCTAAAATTG780 GCAGTTTTTTC'_~'_"T'"mmTTAA'1'AAAATTTTT TsAAA~CCAA.zICCAG"_'G~AACt~CAGA84 :?'~TC' 0 CACTGGCTGCAC~'TAGTACT~'C~Ar?AAGCC_'i:r?GGTC:::TTTGCACATr?TTCC.-"":':CAACCTG900 TCGAGF~1TTAGGCC T ~_ A T GGCATC~GAAGTGCATGCATC''_'CTTr'1GCTG9 CACTT AAC CCAA 1' 6 GGCr?AI1CAATTATF:CTGT?~GTTGTGATACAACACATGTGGCTTTTATTTG'::.CTGCACAT1020 ATCCACTGTACAGCCACTTGGGAGTATCGTGGTTA~~~CTTGCAGCAACTGC.C'"CTGCATT1080 TATACTGT"_""ATTGCATAT'I'CTTTTCCC Gt~AGTG.'-.e-iAGAGP,AATGTT"_'= I'CTTGTTGC114 ATTGATTACATT'~';''i~TAAATTTGCTTAGCTGGAAACi='TTGGGAr?AAGAGGC~'-'u:TT'rGTC1200 AATTGTACAACCGATTG AGCTC '_"GAATP.TT"'"'TACG T T'='AGACATTT12 TCTTTGCAAATC T A GATTGAAA TIoAATC'~Tr'1.~AGATGGTGTr?C.""~CCCAT13 CATGTAAAP.AGCAGGCACCATC~PCTAAGATGGATTT:~?TGCTCATTTTTAAGGCATATAC1380 TCAGCTTCTATTTAAAACTr?TAATTTAAAA'_~AATTCTGTACi-~r?TGAAATGGGGAATATAT1440 ATGGGAATAAATTCTATTCCATT'TATTTCAATTTGA!?TTTCCAAATTGTAATGTTTCCCT150O

GGGGAGGGCAGAGATGGAACAATGAGGGTTGTGATGATAG'I'Gr?ATAGCAAAGAGTGAATT1620 CTGTGTGTTTTTGCTGTAGCACTGAAGTGAAGAGATATTAGCTTTGGCTG':'TCACAAAAT1680 CATGTATTTGCATGCACP.AAA T AAAATTATTTGTCC TP.F~AAAAAAAFu,ANAAAAAA18 AAAp 1804 (2) INFORMATION FOR SEQ ID N0:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 37 amino acids (B) TYPE: amino acid (C) STRAhDEDNESS:
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:17:
Met Lys Arg L~~u Asp Gly Iic Thr Tyr Cys Asn Ser Phe '?'yr Ile Arg Thr Pro Ser F;la Ser Arg Thr Gin Lys Asn Met Leu Lys Glu Tyr Pro ~0 2 ~ 30 Ile Phe '='r_:~ Ie Asn ( 2 ) INFORMA'='IO:I FOR SEQ ID NO : 18 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 360 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUE~;CE
DESCRIPTION:
SEQ
ID NO:18:

TGCAAAGGGT'I.aTGACAAAA CACCAGACT~_'CATTTTACAAGTACCAGTTGCTGTAGAAGG 120 TGAAACAGAGGGATACTCAC TAGGAAACAGATTTGGGCCAGGC'='TAGTCATCTATTGGTA 300 TGGATTTATCC=~GGAGCTGG ACTGCAACCGGGAAAGGGGCATCCTGCTCAAAGCCTGTTT 360 (2) INFORMATION FOR SEQ ID N0:19:
(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:
(D) TOPOLOGY: linear (ii) r-10LECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:19:
Met Asp Le-a Ser Arg Ser Trp Trr Ala Thr Gly Lys Gly Ala Ser Cys Ser Lys Pro Val (2) INFORMATION FOR SEQ ID N0:20:
( i ) SEQL'E:~ICi~ CHARACTERT_S'_~ICS
(A> .»NGTH: 202 i~ase i~airs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) :fOLECULE TYPE: cDNA
(xl ) SEQ:;Er;CE DESCRIPTT_OI:i : S_,Q ID iVO: 20 P,~~ AAAAAAr y ~~.i :AA.~P.AAAA AAAAAAr'~AAA ~'~AAAP.AAA.A AAAAA AAAAA
?.AAAAAAAAA 6 0 A~ y A.~AF~AAAAAA P.AAAP~AAAA F~ ~.f-.r'1AFIAi~AAA AAF~lI~'11~AF~rI.%y r ~r?,AAAAAAA I 2 0 AAAAAAAAAA F =~AAANTNAA AAF~AAAAAAA ~,~-~AAAAi3AAA p,~~ A~1~~AAAAA
P,~~AAAAAAAA 18 C
p.AA<A p~~.~AAAAAAA AA 2 0 2 (2) INFORMATLON FOR SEQ ID N0:2':
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1189 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID 1A0:21:

CAAGACAGGT

ATAI'~J1TGAAC

AGAGAGAATA RATGGTAAA'I' CTTTCTTTTC AAGTGTCAGGCTATCAGTTA180 AGGTCTTTAA

ACCTCTCCTA GATCTCAGFLA :.TGCCTAGAA TGGCTACATCAATGGAAATT240 AGAGAAGTCC

CTCCACAGAT GCAA:,TTTTC TCTACAP.AAG AGAGCCACCTCAGTCTGTTG300 ATGGC'I'TTGC

TCCCTGTAGC AGCCATTTC:i:~ATTATGTCA TTTTGGGGTAAAATATTTTG360 AAGAGATATA

CAATACAAAC

TTGAATTTTC ATT'T_'CAAA11T GTTTTCCTAGCTTTTTTGTTTTATTGTAAG480 TTTTTTTTCT

TTGACAATTT ATAATTGTAT ~~AAGTATGA GATGTTATAGCTTP.AGAATA540 GGTACFi~iAGT

CAGTATGGTA TGATTAAA'PC AAGTTATTAA ACGTTAAATGCTTAAATTTT600 CCTATCCTTC

TTGATGAGAt=. CATTTCAAA I' '?"rAC'~C'='TGGAAAATC'rC:GA CCCCCCAA6 AAGGT.~A .G 6 ATT A:-~~AGCC:=. TGAAGCTGA.~i '?'TGTGCAACAF'iATGGAAGCTTGTCTTCCAG7 TCC'rC'='"_'CCl1 2 GTACF:GAACA AAI~ACAAGAC '='CATTTC~_'TCAGATGTGCF:~."FiTAATTGGCT780 ~iCCTG ~GC''I't'1A

CCTCCTTTAC TCCCTTTTTC TCTTCTA_~CA C'_"TGTGTAI-_AATGTAGATTT840 TTCATTA'I'AT

t~:CTGGACACT t'~.=iCTAAAATT '='CACAGGGTTGCC'_~"'ACTGCCTACCTACCT900 GTACCCr;TT'r GTYTTCCTAC G'I'ACCTTYTC CCCACTTTAA CATATTAAACCTCCCAAAAA960 GGAATGUATA

CYTYTTTAGA AAAATAGCCA CAGGTT'TATC GTGTTTCC!'':'AGATGVACTY1020 TGTGGCTGGT

TAAAGCTGGC TTAATAAACC TCAGTGATTG C'_~CAATCACATTTTGGTT10 AP.AC'I' I'.~, i'CIC C T 8 GTCACTGTCT '~ ACCAATTTO AAATGTAAAA C'!'A.~TTAT_~_TTTACCACA 114 TP.TTYT a:CTA T T 0 GTGCAACAGA ACTCNAAAAA AF~'~AAAAAAA iIAA.=iAAAi..~ 118 AF;AAAtl.<iAAA 9 ( 2 ) INFORNL~TION FOR SEQ ID NO:
2~~

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 56 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:

(D) TOPOLOG'i: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:2?.:

WO 98/2l332 PCT/US97/20740 Met Arg 'rhr Phe Glu Ile Tyr Ser ~:'rp Lys Va1 Lys Lys Asn Leu Arg Thr Pro Gln Ile Ly;; A1a Met Lys I~eu Asn Cys Aia Thr Ser Ser Ser Lys Trp Lys Leu Val Phe Gln Val C~ln Asn Lys Asn Lys Tizr His Phe Phe T~r Cys Leu Lys Met Cys I'):r (2) i~IFORMATION FOR SEQ ID N0:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5a:5 base pairs (B) TYPE: nucleic acid ( C ) S'PRANDEDNES S : double (D) TOPOLOGY: linear i i ) L=IOL ECULF TYPE : cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:23:

CATAACAGCG "_'CAGAGAGAA AGAACTGAC T GAAACC;TTTG: ~GTTCTCCTC6 e'1GA'rGAAGAA C

CTGATCACAG CC ATCTTGGC AGTGGCTG'I"?' GGT'PTCCCAG~ CAGGAACGA12 'I'CTCTCAAG: 0 GAAA.zAAGAA GTATCAGTGA CACJCGATGAA TTAGC'PTCAGGTTCCCTTAC18Q
Gi~TTTT'=":~~T

GATT~_'CCATG

AATT'_""_'CCTA TTCCAATACC TGAATCTGCC CCTACAF~CTCCGAAAAGTAA300 CCCTTCCTl:G

ACAAGAAGGA AAAGTCACGA TAAACCTGGT CACC'rCAAA'I'CCACTTCCTT36C
TGAAATTG,=,G

GAAGF.~TCAA A_Z1TTCCTGT'I' A_A7.'AAAAGAA GCACACAGCt:4 AAACAAATG i' AATTG AAATA 2 TTCTCTAGTC .ATATCTTTlI CTGATYTTYT T T AATAAACA~:~RAAAAAAAA4 TGRAAGC: L .-~~ 8 A,F~e~ P.~~.AAAAP~A A~~i'~AAAAAAF. AAAAAAAAAA S

(2) I:d~ORMATION FOR SEQ ID N0:24:

( i. ) SEQUENCE CIiARACTERISTICS

(A) LENGTH: f35 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:24:
Met Lys Lys Val Leu Leu Leu Ile Thr A1a I1e Lees ~.~a Val Ala Vai '_ 5 10 15 Gly Phe Pro Val Ser Gln Asp Gln Glu Arg Glu Lys f~rg Ser Ile Ser Asp Ser Asp Glu Leu Ala Ser Gly Phe Phe Val Phe Pro Tyr Pro Tyr Pro Phe Arg Pro Leu Pro Pro Ile Pro Phe Pro Arg P_~!e Pro Trp Phe Arg Arg Asn Phe Pro Ile Pro I've Pro Glu Ser Ala Pro Thr Thr Pro Leu Pro Ser Glu Lvs (2) INFORMATION FOR SEQ ID N0:25:
(i) SEQUENCE C~Ai~ACTERISTIC~:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRALIDEDNESS: single (D) TOPOLOGY: linear (ii) ~'OLECULE TYPE: other nuc eic acid (A) DESCRIPTION: idesc -- "oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:25:
ANCAGGAGGC: GTGGGTTCTA TAGAG'1'CC 29 (2) INFOR2rIATION FOR SEQ ID 1','0:26:
(i) SEQUENCE CHARACTERT_STICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:26:
7g WO 98I21332 PCTIUS97/20?40 ( 2 ) INFOR.MATIOI': FOR SEQ ID N0 : 27 (i) SEQUENCE CHARACTERISTICS:
(A} LENGTH: 2'.3 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOG'i: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: ;desc = "oligonucleotide"
(xi) SEQUE~IC~ DESCRIPTIOIJ: SEQ ID N0:21:
CNCTAGCTGTT CGGCTTTAC~ AAGGAGTT 29 (2) I:~IFORM~?TiON FOR_ SF.Q .ID N0:22:
( i ) SEQUENCL: CE'ARAC.'TERI STICS
(A) LENGTt:: 29 base pairs (c3) TYPE: nucleic acid (C) STRANDEDNE:SS: single (D) TOPOLOGY: linear (i~,) MOLECULE TYPE: other nucleic acid (A) DESCRIPTIC>N: !desc = "ol.idonuc'~eotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:28:
ANCACGCTCTG i~CGAATGAGC r'~'~CCTCTC 29 (2) INFORMATION FOR SEQ ID N0:29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) 'TYPE: nucleic acid (C) STRANDEDNE',SS: single (D) TOPOLOGY: linear (ii} MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: idesc = "oliaonucieotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:29:

(?) INFORMATION FOR SEQ ID N0:30:
(i) SEQUENCE CHARACTERISTICS:
LENGTH: 29 base pairs (2) T''PE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: aesc = "oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:30:
GN AAACCAGGF: A.~~-,TGTF.CF:C': GACACr ~'i 29 (2) INFORMATION FOF< 5EQ ID NO:~=:
( i ) EQ:)EN~CE CHt~RACT~:F;I;;TT_;;
S
(::) LENGTH: ~9 b<~se pairs (R) TYPE: nucleic aci~~
(C) STRANDEDNESS: single (ai 'TOPOLOGY: l.inea_-(ii) MOLECULE TYPE: other r~~cieic acid (?.) DESCRii'TION: idesc: _ "oligonucleotide"
(xi) SEQUENCE DESCRIPTIO_d: ;EQ ID N0:3-! .

( <' ) iNFORrI~-_TIO:~ FOR SEQ ID i;0 : 3 '::
(i} SEQUENCE CHARACTERISTT_CS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRP.NDEDNESS: sinc,le (D) TOPOLOGY: linear J
(ii) MOLECULE TYPE: other nucleic acid (~:) DESCRIPTION: desc = "oligonucleotide"
(xi) SEQUENCE DESCRIPTIOr?: SEQ ID N0:32:

(2) INFOR2JIATION FOR SEQ ID N0:33:

WO 98/21332 PCT/US97I2Q7~0 (i) SEQUET:CE CHARACTERISTICS:
(A) L NGTII: '?9 base pairs (B) '_"'!PE: nucleic acid (C) S'='T.~ANDED:~1ESS: single (D) TOPOLOGY: linear ( ii ) '~IOLECL;LE TYPE: other nucleic acid (A) DESCRIPTION: idesc = "o:L,_gonucleotide"
(xi) SEQUET1~~ DESCR.:LPTION: SEQ ID ~1O:33:
ANATTTAA GC« TT~_'AACG T Gz AGGATAGG
( 2 ) I~IFO:~MATION FOR SEQ ID DIO: 34 ( _ ; SEQLJEI~ICE C:IAF.ACTERI5TICS
(.=:) ~.~NG~_'!!: ~~) base pairs '~'IPr : nucleic acid (C) ..TRAS1DEDNESS: single W TOPOLOGY: linear I
(iij ~fO~EC~LE TYPE: other m.:cleic acid (i;) D~SCRIPTTON: ,'desc = "oliuonuc=eotide"
(xi) S~QUENC~'. DESCRIPTIOV: SEQ ID ';0:34:
TNAGAGACTGG GAAhCCAACA GCCACTGC zg

Claims (39)

What is claimed is:

1. A composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:1;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:1 from nucleotide 68 to nucleotide 430;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:1 from nucleotide 128 to nucleotide 430;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone AJ20_2 deposited under accession number ATCC 98261;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone AJ20_2 deposited under accession number ATCC 98261;
(f) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone AJ20_2 deposited under accession number ATCC
98261;
(g) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone AJ20_2 deposited under accession number ATCC 98261;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:2;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:2 having biological activity;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (1) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(i).

2. A composition of claim 1 wherein said polynucleotide is operable linked to at least one expression control sequence.

3. A host cell transformed with a composition of claim 2.

4. The host cell of claim 3, wherein said cell is a mammalian cell.

5. A process for producing a protein encoded by a composition of claim 2, which process comprises:
(a) growing a culture of the host cell of claim 3 in a suitable culture medium; and (b) purifying said protein from the culture.

6. A protein produced according to the process of claim 5.

7. The protein of claim 6 comprising a mature protein.

8. A composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
{a) the amino acid sequence of SEQ ID NO:2;
(b) fragments of the amino acid sequence of SEQ ID NO:2; and (c) the amino acid sequence encoded by the cDNA insert of clone AJ20_2 deposited under accession number ATCC 98261;
the protein being substantially free from other mammalian proteins.

9. The composition of claim 8, wherein said protein comprises the amino acid sequence of SEQ ID NO:2.

10. The composition of claim 8, further comprising a pharmaceutically acceptable carrier.

11. A method for preventing, treating or ameliorating a medical condition which comprises administering to a mammalian subject a therapeutically effective amount of a composition of claim 10.

12. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:1 or SEQ ID NO:3.

13. A composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:5;
(b} a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:5 from nucleotide 289 to nucleotide 780;
(c) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone AR440_1 deposited under accession number ATCC 98261;
(d) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone AR440_1 deposited under accession number ATCC 98261;
(e) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone AR440_1 deposited under accession number ATCC 98261;
(f) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone AR440_1 deposited under accession number ATCC 98261;
(g) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:6;
(h) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:6 having biological activity;
(i) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(f) above;
(j) a polynucleotide which encodes a species homologue of the protein of (g) or (h} above ; and (k) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(h).

14. A composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:6;
(b) the amino acid sequence of SEQ ID NO:6 from amino acid 1 to amino acid 160;
(c) fragments of the amino acid sequence of SEQ ID NO:6; and (d) the amino acid sequence encoded by the cDNA insert of clone AR440_1 deposited under accession number ATCC 9826l;
the protein being substantially free from other mammalian proteins.

15. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:5 or SEQ ID NO:4.

16. A composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:7;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:7 from nucleotide 76 to nucleotide 1050;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:7 from nucleotide 331 to nucleotide 567;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone AS164_1 deposited under accession number ATCC 98261;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone AS164_l deposited under accession number ATCC 9826l;
(f) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone AS164_1 deposited under accession number ATCC 98261;
(g) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone AS164_1 deposited under accession number ATCC 98261;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:8;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:8 hawing biological activity;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (l) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(i).

17. A composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:8;
(b) the amino acid sequence of SEQ ID NO:8 from amino acid 87 to amino acid 164;
(c) fragments of the amino acid sequence of SEQ ID NO:8; and (d) the amino acid sequence encoded by the cDNA insert of clone AS164_1 deposited under accession number ATCC 98261;
the protein being substantially free from other mammalian proteins.

18. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:7.

19. A composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:9;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:9 from nucleotide 242 to nucleotide 1060;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:9 from nucleotide 596 to nucleotide 1060;
(d) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:9 from nucleotide 10 to nucleotide 373;
(e) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone AX8_1 deposited under accession number ATCC 98261;
(f) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone AX8_1 deposited under accession number ATCC 98261;
(g) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone AX8_1 deposited under accession number ATCC
98261;

(h) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone AX8_1 deposited under accession number ATCC 98261;
(i) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:10;
(j) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:10 having biological activity;
(k) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(h) above;
(l) a polynucleotide which encodes a species homologue of the protein of (i) or (j) above ; and (m) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(j).

20. A composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:10;
(b) the amino acid sequence of SEQ ID NO:10 from amino acid 1 to amino acid 44;
(c) fragments of the amino acid sequence of SEQ ID NO:10; and (d) the amino acid sequence encoded by the cDNA insert of clone AX8_1 deposited under accession number ATCC 98261;
the protein being substantially free from other mammalian proteins.

21. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:9.

22. A composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:11;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:11 from nucleotide 773 to nucleotide 928;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:11 from nucleotide 815 to nucleotide 928;

(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone BD176_3 deposited under accession number ATCC 98261;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone BD176_3 deposited under accession number ATCC 98261;
(f) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone BD176_3 deposited under accession number ATCC 98261;
(g) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone BD176_3 deposited under accession number ATCC 98261;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:12;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:12 having biological activity;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
{k) a polynucleotide which encodes a species homologue of the protein of (h) or {i) above ; and (l) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(i).

23. A composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:12;
(b) fragments of the amino acid sequence of SEQ ID NO:12; and (c) the amino acid sequence encoded by the cDNA insert of clone BD176_3 deposited under accession number ATCC 98261;
the protein being substantially free from other mammalian proteins.

24. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:11 or SEQ ID NO:13.

25. A composition comprising an isolated polynucleotide selected from the group consisting of:

(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:14;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:14 from nucleotide 174 to nucleotide 440;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:14 from nucleotide 1 to nucleotide 313;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone BD339_1 deposited under accession number ATCC 98261;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone BD339_1 deposited under accession number ATCC 98261;
(f) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence: of clone BD339_1 deposited under accession number ATCC 98261;
(g) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone BD339_1 deposited under accession number ATCC 98261;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:15;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:15 having biological activity;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (l) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(i).

26. A composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:15;
(b) the amino acid sequence of SEQ ID NO:15 from amino acid 1 to amino acid 46;
(c) fragments of the amino acid sequence of SEQ ID NO:15; and (d) the amino acid sequence encoded by the cDNA insert of clone BD339_1 deposited under accession number ATCC 98261;
the protein being substantially free from other mammalian proteins.

27. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:14.

28. A composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:16;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:16 from nucleotide 509 to nucleotide 619;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:16 from nucleotide 1 to nucleotide 580;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone BD427_1 deposited under accession number ATCC 98261;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone BD427_1 deposited under accession number ATCC 98261;
(f) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone BD427_1 deposited under accession number ATCC 9826l;
(g) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone BD427_1 deposited under accession number ATCC 98261;
(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:17;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:17 having biological activity;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (l) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(i).

29. A composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:17;
(b) the amino acid sequence of SEQ ID NO:17 from amino acid 1 to amino acid 24;
(c) fragments of the amino acid sequence of SEQ ID NO:17; and (d) the amino acid sequence encoded by the cDNA insert of clone BD427_1 deposited under accession number ATCC 98261;
the protein being substantially free from other mammalian proteins.

30. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:16.

31. A composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:18;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:18 from nucleotide 300 to nucleotide 360;
(c) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone BL229_22 deposited under accession number ATCC 98261;
(d) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone BL229_22 deposited under accession number ATCC 98261;
(e) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone BL229_22 deposited under accession number ATCC 98261;
(f) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone BL229_22 deposited under accession number ATCC 98261;
(g) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:19;
(h) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:19 having biological activity;
(i) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(f) above;

(j) a polynucleotide which encodes a species homologue of the protein of (g) or (h) above ; and (k) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(h).

32. A composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:19;
(b) fragments of the amino acid sequence of SEQ ID NO:19; and (c) the amino acid sequence encoded by the cDNA insert of clone BL229_22 deposited under accession number ATCC 98261;
the protein being substantially free from other mammalian proteins.

33. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:18 or SEQ ID NO:20.

34. A composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:21;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:21 from nucleotide 604 to nucleotide 771;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:21 from nucleotide 1 to nucleotide 684;
(d) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone BV123_16 deposited under accession number ATCC 9826l;
(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone BV123_16 deposited under accession number ATCC 98261;
(f) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone BV123_16 deposited under accession number ATCC 98261;
(g) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone BV123_16 deposited under accession number ATCC 98261;

(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:22;
(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:22 having biological activity;
(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;
(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (l) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(i).

35. A composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:22;
(b) the amino acid sequence of SEQ ID NO:22 from amino acid 1 to amino acid 27;
(c) fragments of the amino acid sequence of SEQ ID NO:22; and (d) the amino acid sequence= encoded by the cDNA insert of clone BV123_16 deposited under accession number ATCC 98261;
the protein being substantially free from other mammalian proteins.

36. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:21.

37. A composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:23;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:23 from nucleotide 43 to nucleotide 297;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:23 from nucleotide 94 to nucleotide 297;
(d) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:23 from nucleotide 1 to nucleotide 379;

(e) a polynucleotide comprising the nucleotide sequence of the full-length protein coding sequence of clone CH377_1 deposited under accession number ATCC 98261;
(f) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone CH377_1 deposited under accession number ATCC 98261;
(g) a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of clone CH377_1 deposited under accession number ATCC 98261;
(h) a polynucleotide encoding the mature protein encoded by the cDNA insert of clone CH377_1 deposited under accession number ATCC 98261;
(i) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:24;
(j) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:24 having biological activity;
(k) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(h) above;
(l) a polynucleotide which encodes a species homologue of the protein of (i) or (j) above ; and (m) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(j).

38. A composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:24;
(b) fragments of the amino acid sequence of SEQ ID NO:24; and (c) the amino acid sequence encoded by the cDNA insert of clone CH377_1 deposited under accession number ATCC 98261;
the protein being substantially free from other mammalian proteins.

39. An isolated gene corresponding to the cDNA sequence of SEQ ID NO:23.