CA2234877A1 - Herpesvirus vectors and their uses - Google Patents

Abstract

A process of treating a human or non-human animal cell to introduce heterologous genetic material into said cell and express said material in said cell, comprises (a) providing a recombinant herpesviral vector which is an attenuated or replication-defective and non-transforming mutant herpesvirus, and which carries heterologous genetic material, and (b) transducing human or non-human animal cells selected from: haematopoietic cells, malignant cells related to blood cells, and malignant or non-malignant CD34+ cells; by contacting said cells with said virus vector to transduce said cells and express said genetic material. Among applications of the technique is modification of haematopoietic cells by transfer of genes, e.g. to generate tumour immunogens from malignant cells.

Description

a~ D V8CtOr$ and their llsQs Field of the InL~ OI~
This inYention relates to ~ iral vectors and methods for their use, esl.ec ~lly for t~ n - le for tran~ducin~ cells, e.~ ,a-~L cells of hae~ Dpc;etio linea~e, and for inducin~ ~AI-r~ ;on of for~ign ~enetic material in Such cells. Th~
invention also telates to pha-~-~aceutical co~nposilio~-~ based on such viral ~vOctors, to pro~ ction of cells i..r/ ~l~d with such viral vectors, to pha~nla~;~ utical prepar~ionD based on such c811s, to thsir use for ~.I--,i.,i;,~,~ion to hl~mans and 1 0 non-human animals in order to expre~s forei~n ~enetic material in ViYo, and to the use of materials as d~s~,ib~d herein fot the rnanufacture of ~ ,a:a~ions for Ua~.l-nenl and other app"~ t;~ns as ~-,~.12ioned herein. M ~ JJs acco-d;llg to th~
invention c~n be used for ex~.., '~ in cancer immunulherapy.
$".ou..~1 of the IL.~ n n. c~.. Li.~dul Yiral vectors are amon~ ~e~reral known a~a~nts available for the introduction of for. ign ~enns into cells so ~hat they can be ~3A~ ..d as protein. A central ol~,.oen~ is the taryet ~ene itself under the control of a suitable l~ru..lO~t:r sequence that can function in the cell to be transduce~. ICnown t.,chnlques include non-viral ~-..JII-ods, such as simple addiLio., of the tar~et ~ene construct as free DNAi ine~lhation with cu.. ~ b,~os of tar~et DNA and specifics desi~aned for uptake of the DNA into the t~r~et cell; and incubation with tar~et DNA encersl~srvd for example in liposomes or other lipid-based t.~ lon a~en~.
A furthsr option is the use of ~~:. u-..L:.-.J,It YiruS veotors enu;"ee-e.l to contain the r~quireri targOt gene, and able to infect the tsr~3et cells and hence C8nY Into the cell the target gene in a forrn that ran be ~ ,ressed. A number of~Jirr~ nt virusns has been used for this purposs includin~ retroYiruses, adenoviruses, and adenr~a3soc;cll~Jd viruses.
sp6~iri~,al;u~. EP O 176 170 ~Institut Merleux: B n~iL.,.an~ des~;,ii~es foteign~0 ~enes inse. Io~ into a herpe~ simplex viral 5~enG.. e under the control of promoter-rc~ulatory reç1ions of th~ ~v(wllle~ thus ~-u~, " ~g a vec~or for thc eA~ul~saiou of the foreiS~n gens DNA constructs, plasmid vec~ors CG-I' ' lin~3 the constructs useful for l,A~Ivaaiull of ths foreisn ~ene, reco,..L:n~nL viruses produced with the ver,~tor, and aa~uui~L~iJ msthods are ri~ccl~sod.

Sp~ciricaLion EP 0 448 650 ~Genersl Hospital Corporation: Al ~eller, X0 Eh~dl~e~iel,~ escr~es herpes simplex virus type 1 LA~ aion vectors ca~ of in~ and being IJIupa~dldd in a non-mitotic cell. and for use in L-~ ent of neu, ~ lo~ic~l diseases, anr~ to produce animal and in vitro models of such ed ~ s ~
nc_o.)~b:naol ~iruses are known in particular for use in ~.9. corrective~
~ene thsrapy applisd to gene ~ ,r co..LliLiu~
Examples of ~enes us~d or ~rupo-~ed to be used in cor.ec~i~te gene therapy include: the ~en~ for human a~nc ~ .e d~.-.;-.ase ~ADAl, as m~olione~ in for nxsmple W0 92J10564 (KW Culver ct al: US Se_,~ld,-,r for l~G,.,.,.. ~r._e & Cellco Inc~, and W0 89J121~g & EP 0 ~20 911 ~1~ Pa~tan et alt: ths cystic fibrosis ~ene and ~~ariants das~"il.ad in W0 9110Z7~6 (~-C Tsui et al: HSC n~ _~.el~ &
univers;ly of ''I hi~an), in W0 !32f0!;273 ~FS Collins ~ JM Wilson: University of Mi ~ dll) and in W0 94/176~9 ~RJ Gregory et al; G.,.-~y,llo Corp).
l~i The prior srt of ." li( lallL tumour ll~lu:.lL includes ~tudies that have ,ht~d ths p~L~ i for Ih ~j 3utic v~cc;.-~lion against tumours usinE~
autr'~30ur ~ YIi~ll darivrdd from a patisnt'~ own tumour The ~eneral theory behind this appreaeh is that tumour cells may ex~ress one or more ~ .s or other ~ lUIll~ 'e~ that are distinct from normal healthy cells, and which mi~ht therefore be used to tar~et an immune resp~ to reco~nise and destroy the tumour cells.
These tumour tar~ets may be prcsent ~ t~ y in tumours of a certain t~jp~. A ~ood ~,.e,ll, ' of thi~ in cen~ica! cancer, where the ~reat majority oftumours e)~,ress the human ~a~ .ndfirus E~ and E7 proteins. In this case th~
2S tumour tar~et is not a self Protein, and hence its pul ial as a unique tumour-~pa~ io marknr for cancer immlJ-.otl,.,..""~ ;s clear.
There is illCl~ld~ vidanc6 thatccr~ain self pn)h.;.l5 can al~o be usr~d as tumour tar~et a~ ens. This is based on thc obat;, v~Lion that they are ex~rc,~sed consiJ~enlly in tumour cells, but not in norm~l healthy cells. ~Cdlll, 1-. of these 3C~ include the MAGE family of prù'r -i. It is e~ cl~d that m3re self pf~L~;il.s useful a~ tumour tsrç1et& remain to ~e id~--l;l;ad.
Tumour ~s~ idk d ~ , e~ and thsir role in the immu,~ 'o~r of ce~ain cenc.. :- are di~o~ ~ ' for ~x.. ~,' by P van der Bruggen et al, in Current Opinion in Immunolo~y, 4~51 (19~21 608-~;12. Other such ~"ligens, of the MAGE series, are idontified in T. Boon, Adv Cancer Res 68 ~199Z) pp 17~-210, and MZ2-E and ~ other related tumour ~ iy~ 5 are idc.. Liriod in P- van der Bru~en et al, .~ nc~
254 l1991 ) 164~-1647; tumour-~ssooi~ed mucins are me-l~ioned in PO
Livinqston. in current Opinion in Immunola~y 4 ~5) ~1932) pp 62~62gi e.~.
MUC1 as llmllLiorlal in J Burchell et al, Im J Cancer 44 ~1989) pp ~ 1-696.
Although some poL~n~i~lly use~ul tumour-speci~ic markers have thus been i~n~ii od snd cha.a-,t~r;s~d, the search for new and .~ mor~ specific Illd~ is laborio~s and time-consumin~a.
An eA~eri,oen~at in~f~(anial murine ~~ ,u."a ha~ bean d~se,iL~d as treated with a neu.u~ .,uated HSVt mutant 1716 ~BP Ran~l~u et a~, Virology 211 ~19955 pp ~4-101~, where the r~pliodlien of the mutant d~u~ d to be resl,ieled to tumour cells and not to ûccur on surrounding brain tis~ue.

A~".in;~l-,3Lion to ."a,-,n-als of ~ .es as such (i.e. as proteinl has been tried, but is often poorly t ' ~ by th~ host and i8 fr~quen~l~ as~oc;dl~ with a numbar of side-eff~ct~ includin~ nause~, bone pain and fever. (A Mire-Sluis, TlBTech vol. 11 ~ 93): MS Moore, in Ann Rev Immunol 9 ll~lS 159-91~.
Thess p~. bl~ are ~~ ~.1~ d by the dose leYels often required to .,.~i..~;., effective plasma conc~nl.ations.
It is known to mo~ f live virus vectors to contain genes ~aol~din5~ a cytokine or a tumour antigen. ~/irus vector~ have been proposed for use in cancer imm-,-,ull,t-r~lJy to proYide a means for ~ tumour immu--u-~ or,~;~rene~s. Sp~-ii eetion WO 8BJ07610 (Tr~ns~ e: MP Kieny et al) Ll ' .,~ ;on of human IL-2 in ."~ -" " ~ cells by means of a r~Cci--' ~~-IL poxviru8 cc-l-lp~ all or part of a l~NA sequence codin~ for a human IL-2 prot~in. ''peoilic~ . EP O 259 212 ~Tr~-,s~one SA: R Lathe et 81j cl;~eio~:. viral vectors of the pox, adeno or herpes types, far ~_u~ tumours, -containin~ a i~e~erl'a~ous DNA sequcnce codinq for at least the e:-~L-,Ii~,l re~3ions of a tumour-sPecific protein. Speciri,_dLion WO 88100971 ~CSIRO, Ausll~lian Natlonal Ull;1/.. ~;LY R~.. si,.,r~ et al~ .lDs~s r_CG---' ~an~ vaccine comprisin~ a pox, herpes or adeno virus vaccine voctor. e ~r _ - "y v~cc;nia, including a nuclc~ide sequence ~ ,.i"~ at Inast part of an ul.~ l;c polypeptide and a s0cond sequence c~ ,ressin~ at least part of 8 Iy,.,phoSi.-~ ~interleukin 1, 2, 3 or 4, or gamma i.,l~el~n~ which i.,~,~a:~e~ immune resuon~e~ to the ar,ti~n.c polypeptide; and spL_iric~Lion W0 9411B716 IE Paoletti et al: Vito~e,1eljc:, Corp.l descdLes attenuated recombinant vaccinia viruses containing ClNA codin3 for a cYtokine or a tumour antiaen, e.~. for use in cancer therapy.
It has been proposed to use GMCSF-transduced tumour cells as a ~I.e(~peutic vsccine a~ainst renal cancer. The p.etocol~ for co.. ~ onti;.. ~ trials involve remoYal af tumoum--at~riel from the ~laLi~ , and then trsnsduction with thc a~ru~ e immu,~ ,c,dulator ~ene. The ~-B ~~il~d cells are then to be re-introduced into the patient to stimulate a bene~i~,ial immune teSpUllDt~.
Vectors based on herpesvirus saimiri. a virus of non-human prirnates, have been descr;bed as leadin~3 to gene e.~.l.,.. ai~n in human Iymphoid cells IB
I le~ ri~ R Gras~mann, Gene 102~2) 11991i. pp 265-g). However, it has been .. ~;dL.ed o.. de~ to u8e such vectors in a clinical set~ing.

Althou~h it is ~ ,f~re known to introduce imm~no,..~d~ o~y and other ~enes into cells such as c0rtain hnds of tumour cells, existing ~ Ll .~J~ of acl.leYil~ this ara corsidara;i by the present in~.,.,Lu-~ to have l;~l~ila~ions~
~,r.l,eLl.ar th~ difficulties are ~iue to low qldn~ iYe amounts of transduction, to cc""p1~ , or to ul-de~ 'c side-effects of the systems ~.--r'J~ed.
The present inventors cons;det that it has been difficult up to now to introduce ~enes into a num~er of kinds of cell~, e.~. tumour cslls of l.ae,na~ oietic linea~o, such as leul~dt:--,;a~, or to do this ~rrician~ly, e.g. for purposus of c ~ ,Lve ~ene th~rspy or cancer immunotl~e-d~-y.
Fl~r th~ llall~re( of ~ones to such cells as t~ pro6~ani~or cells, retroviral vnctor~ htlve bnen the most widely tried vectors up to the present. It ay~J~a~D that these vectors l,ov~evar do not i~ ;y~ale and are not ex~.ressed innondividin~ cells, snd this limits their value e.~. when used with for example l,~e~n~lop~ stem cell5 ~HSCsl or primsrY cells from human haernatopoietic d. ,cies as targets for ~ene l~ of er and o..~r~ssion. In order to o~ col ne this li.lliLaliull, culture of t~r~et c811~;, a.~. HSC6. with hdellldt~ ~ic ~rowth ~actors such El5 C~ti ' -e5 has been tricd, with a view to induce th8 HSCs into cycle and ill~le....~, the .,rri.,i~n. y of retrovirus-n,e~ snR li~n~fer to these rarç~ee cells, but unfortunately the cytokin~s in tha culture media appe~r to have induced dirre~ ldLion with loss of the d~sin~d self rLIl~dl cap8city of the C811S.
Thus, adeno~ ci~-'~d Yirsl vectors haYe been ~ropo~d for use instesd ~f f~l,oYilal vectors. but it has a~edl~d that ths nfficisncy of Integration of such ~rectDrs is low.
Also, the pres~nt inv~n~urs collaider, on th~ basis o~ recent e~l~.ienca with adf~nuviral vsctors, thst th9se have limitations. Thus, while they can infect ap~f~xin~at~ly 50% of haen~at~ ; cells under certain conditions, nCVG~ Ll ,elessgene ~AIJr~aaion ;s o~ten delayed for several days. It has also been found in certain tssta ths2 trsr~ r~inn oS a h~k,r~ r us gene into acute leukaernia cellsby a l~e61~ dllL adsnovirus vector or a retrovirus vector led to sither ne91igi~1e or at best about :~% transcluctin-l yield, and that thus there can be a ~.,u; 1~ " of lo ~rrici~h~;~J of transduction yleld with such vectors.

Th~ F~ t 1- . . . ~

The present inventors consider that the prior art leaves it still ~esi~ to provid~ further ~iral vectors and pru~e~ for their use in l~ansro~";~sa human and animal cells. In parcicular, it rem- )a des;- ~ I to provide materials and me~hods to produc~ Qene lldll~e;l to human snd non-human ànimal cells with usf~ful rapidity. Also desirable is to provide ..-~L-..i ~ and methods to produce s3ene transfer with usuful efficiency. Also des;, ' '~ is the provi~hn o~ materiais and ~ Lhu~la to produce gene transfer with ~ bi~ to a useful range nf tar~et csll types, u~efully includin~ for t~.~.dl~l, ' non-dividin~ cells.

Accor.Jin~ to an aspect of the illlrG~lLiUII dsacribed herein, target c811s for trancduction by herpesviral vectors can ba chosen for t:"dl,.pla from among cells Z~i of ll~ellldl~Fc)~ u2.; from l~y-~pho i or myeloid cells, from stem cells or CC~34 ~ cclls. e.~. cell ~ a~aLiona O~ such cells. as for nX~
obtbioed or pr~psre~ in connec~ion with bone-marrow u~nsplanld~iu~; or cells of ne~ 6~ d~ 1 oriçlin, esl~e~ y rr "_ ,~"~ such cnlls, and tran~d~sd with viral vectors a~ des~.JLed her~in. In this use, it ha~ been found that certain ~ .Lhu.~s snd procedures acco,Ji"g to t~dlll,' 0~ Ihe invention can lead to ~uf~ nç~ hi~h transduc~ion err~ y.

In one ~spect the pr~s~nt i"v~,.li~n a;ms to provid~ mat~rials and methods to fd~;ilild~ the use of tumour cells as immu-,oç~ens ~nd V~CC.;~ a. In 8 furth~r aspect thc invention alms tc facllitate the transduction of cells of h .~n~a~o,~ ic iinea~e and provide useful ~.u~ u~i~ions and procedures based thereon.
The pre~cnt i~ l ~ Liun also aim~ to providel rneans for cI ealing imm~" ~os~ensand ~herapeutlc vaccines that can be used tc~ induce immune responses a~ainst tumour-specitic u~ ens, e~g. in p~Li~rl~ with pre-exi~li,.~ tumours.
The i.,.~..lion is p~rticularly ar~ 'ic~t 'e for ~x.u- ~le for ~ene t.a.,..re~ into .Y~at~ 'etic cells such as l~y~-~pl;c :l cells, that arE~ ~u~ Ssive for e~l re~s;on of late Iytic çlr~nes of he.~ irus such as herpes simplex virus.

10 Aucu,~i--u to an aspect of the invention thers is provided a p.. ~.cc:. of ~l~dlil-~ a human or non-human animal cell to introducâ heterolo~ous ~enetic material, e.g. ~naterial co~prisin~ a hel~s-.'L~ 0ne into said cell, e.g. to ~:x~ . said genetic rudl~lidl in said ccll, cOu~pda;l l~ the step~ of ~a) pn~iding a \t.CO~ ,.ther~ ivactorwhichisanstSenUstedorrepliCatiOn-der.,~Li~aand non-L- n:.to~n;n~ mutant har~Es~;fus~ and which carries h~ -- ., llS ~enetic ~ldt~idl n.g. a gene ~n~ a h..~-,r~ r--e protein and ~b) transducing hurnan or non-human animal cells ~ ~'e~d from: haemat~; lic cell~"-, "", nL CHIIs related to bloo~ cells, and ,- ~a-~L or non~ '. ~a--t CD34+ cells; by con~ Li- ,~ said cells with seid virus vector to transduce said cclls. In 20 en.bo-li-.-~nls ot thn inY~.. Lion da~cribed below said genetic materiat is then ex~r~sed in ~sid call Transduction takes place by i..t~CLion of the iive tar~et cell by the viral vecsor in per-se known manner.

Such a ~ -u~ can for ~ c.-~ ,ri~e L-- aLi--~ a human or non-human 2S animal cell to introduce l-t;l~ h,~o~ ~netic material into said cell to render sai~
ccll more hi~hly immuno~enic. con"ni~i"!a the step~ of ~a~ proYidin~ a recG- ~ ~ ' .an l h~r~ e~ al vec20r which is an attsnuated or r~pl;calion-defEtctive and non-t~a..sru,.. .9 rnutant h~r~-e;:iv;,~ls and which carries e-~a. 8 ~ene encoding a c immunnmodulatory protein _ e- ~ from cytokinss and immun ,n~_- co-stimula1:ory IY~C ~ s and chemo-~ àctctl.Ls, and (b~
transducinn ~ " li~ .~nt or non-n ~ 'i~ ~a~L ht tman or non-human ftnimal cells which can b t ~nl~ 1~2d fûr &Xa~ 'o from; Il Isnt cclts r~lated to blood cells.
haematop~:~t; cell~ lali~nm~l or non-~n ~ anl CD34~ cells by contactin~
said cells with said virus vector to transduce said ccll~ and render ssid cclls more WO 97/14808 PCT/~B96/02576 highiy immunogel.:c.
.

Pl.a-n,acoutiGal ,~ d.alions provided snd llsed accG.di..~ to certâin emLuJi~ La of the invention, for use in transducinç~ human or non-human animal cells ~el~ d from: ha~ dtL~_ ~;c cells: m~ ,nanL cells related to blood cells;
and n~ali~na..L or non~nali~-la--l CD34+ c~; can co~.p.i~ a ~CO~ ant herpesviral ver;tor which is an attenuated or .1l" lion-defective ~nd non-~ràllafo..n;ng mu~ant herpesvirus, and which carries ha~erologou~ genetic Illa~ idl~ e.~. a E~ene en~od;..g a h~l~-. Ir~ protein.
Pl.~l...ac~tical p-t.p~rc.~on6 provideci and u~;0d according to certain ...bodin~ent~ of ~he invention can cu,..~ human or non-human animal cells r~ from: ha~--.a~opoiJt;o cells rr.~ a~-a--l ceils relatod to blood cells; and mali~nant or non-malignant C1~34+ celis; sai~ cells having been infec~t:d with a ~t;.,o.. b;.. ~.. l herpes~riral vsctor which is an attenuated or ~ Dtinn-defective and non-lra..aro.... ~~ mutant herpesYirus, snd which carries e.~. a ~ene cncodin~
a l-~lt-~'ev J~ protein.

Also within thr~ inver.lion ie a process of treating a subject which is a human subject or a non-human animal subjcct in order to achieve ~ ,r~sion of a forel~n ~iene in vivo, cu...~ .i.-9 ~J...;..;~I~ri--~ to said subject a phall-lacoutiGai cc...,~,o~ ion of the kinds ll.Ehl,ii;~lled above and desc,.ii~ed herein; and a p(OC~aa of ll~n~in~ a subject which is a human subjr~ct or a non-human anirnsl subj~ct in order tu eiicit an immune ~ - ~ss, which co.--pri~es a~lo .;.,L~- i- -g to said subject a pha~n~aceu~ical c~--",oailion of the kinds .,.~ oned abo~e and d~o,iL,ed herein.

An sspect of the i.,~ention GOIlel;llla provision and use of a ~uoo inanl I,t:. ~e..~ Js vector, a.g. bas~d on â non~ aiu~ 9 harpesYiruâ, carrying a ~ene ~ncoding a protein, e.g. an immu..or.,o~lulatory p~otein, or a protein useful for ~;~,t,ssion in c.u.,nt:oliu-- with ~ane therapy: also provided by the invention is its use in transducin6~ cells to render them more highly immu..o~eniu, among th~
cells that can usefully be treated in this way are for example ~-. liand"L cells of human and non-hurnan animals, aspecially for e~d--, ' ,~, 'i~ ~ar.~ cells rr~lated to blood cells, e.~3. Ieukaemic cells, or ha~...dlopci Lic cells. including CD34+ cells, v. 1~ e~ rn ~ ~ ar\~n~ or non-m3111~nant. Thus suitable cells for treatment include for ~.~amp'e ha6.na~0~ Lic ~ro9enito~ CBIl~; such a5 healthy CD34+ cells, which when transduc~d with I~G~ S~/;fU5 vectors carryin~ a hel~r~ ous ~en~ that it is rlasirec~ to express in the treated cell, cdn carry 8 hi~3h copy number of the heterolo~ous ~ene, en~ 3 hG-I.olo~ous re-;o-- ' .alion with the ~enome of the treated cell without the nead for an i..l~g.~l~e.

Amon~ the a, ~ . of t.."bo~ b of the present invention is the ,..oliti~dlion of ,- lil Idlll h..~ eF~S t;c cells ~y the ~r~ r~. of ~enes to ,Je.-t;l--L~ tumour imm~ oy~--s. Amon~3 lhe su~slanc~ that can usefully be nerd~d in a Illodir;3d cell to function as a tumol~r immuno~en are ~;M-CSF and interleukin 2. For e~e"~ , it has been .e~,uli~d that interleukin 2 production by tumour cells bypasses T helper function in the ~,_ mldli~n of an antitumour r~,onse ~ER Fearon et al, Cell ~SO t1990~ pp 397 et seq~, and it has been reported in the casc o~ mllrine GM-CSF ~G Dranoff et al, Proc Nat Acad S~i USA
90 ~lss3) pp 3539 st ~eq.~ that vacc;ndliGn with ill~Jial~d tumour cells L.~ to secrete GM-CSF stimulates potent, specific and Ic~n~ lastin~ anti-tumour immùnity.

20 Thus, acco-,~ ~~ to elnbo~fi,.. l~ of the invention, a l~cG.. ti.. ant herpesviru~, for e~dll ~ ' 8 I~_Gll ~ ~aot HSV, can be u~ed as a vector for tronsduction of Ifor ~ ) leukaemia cells so as to produce expression of i"~ J S3enetic Ill~i idl, e.s3. a ~ene enco~ a an immunomodulatory protein or other protein relevant to cancer immu~ull~u~d~ry or gene therapy, in such cells.In particular ~xan~, l af the i--~ n, a r~cor.lbin~.-l herpe~ ~i.--p'e~- virus, ~i.h- II-er H5~/1 or HSV2, en", r.J~red to contsin a h~terolo~3u-~ gene as part of its ~ellullle~ can ~0 used to deliver the gene with ~ood e~rrio;ency to leukaemia cells, to evoke erk~ i./a ~A~ on of the hele,.'~u~ ~ene within the tumour cells, and the transducsd cells can thcn be used for eAt~ le as a cellular immuno~en such as a vaccine for cancer immuno~ a~y~ and thereby, among other eff~cts, ,J;a~ immune effects on tumour cells other than cells inre~ ,d with thn virus vector. Thus the Invention also provides useful n.~ll-ods for ~ene trar~dll~ion o~ leuka~mia cnlls amon~ other~.

Also pnJvided accordin~ to certain ~..,bocli,..an~s of the invention are methods of using a l~ --L;"el--L herpesvirus such as ~iSV, e.~. a rep'~ tion-def0ctive herpesvirus such as r~ F i'~ ~-defective HS~, whether HSVl or HSV2.
- for trsnsduction of various cell types ~ased on cells of ha~ ",d~ ic linea~e, and othcr cell types, e.g. neu.ub'~ -.a~, e.g. to introduce immuno",G,l,llatory genes, or other ~o~nes for ths purpose of gene therapy Of cancer immu~ull~e~
into such cells.

It has nl50 br~en found that transduction into leukemia cell~ u~in~ an e,.u.. -ple of a HSV-bas~d ~ o--.~ In~ vector can be a~.h a~ successfully usin~
fresh tumour cells. Thus, tumour cells, which can be cells that lprior to trancd~ nn) eitl ~r hav~ not be~n incuhated at all under cell culture cu..~ ions, or clse have not b~en inc~hat~d for more than a few hours (e.~. not rnore than about 2 or up to 4 hours, or not incubated as long as ove,..;ul~l~, e.~. freshly-s~.... , ' ' tumour c811s, can be e-l~u~rd to a .~c.,.. ,lJinan~ he-~ s vector as .nen~ono~l herein carryin~ suitable QCnetic material. This can bo Qenetic mdl~idl thst is not bein~ aic~"esse~l, or is not being SU~ n~ 1Y eA~ O~d, by the tumour cells, a.~. ~unetic .-.at~-ial encod;ng an immunomodula~ory protein such as for ex~ '~ GM-CSF, thereby to infect the cslls with the .~co...ti~.ant I-6~ D~ vec~or; and the rcsulting i-,~- ' cells csn be used for ~xsr"~' either for reinfusion into the subject from whom th~ psrent cells were ot~ d.
or fc~r le~_Lion with !eukocytes in vitro.

For a~a...ple, freshly s~ d human leukaemia colls can be e~-os~-l to a virus vector carryin~ a 8ene cncod;.. ~ human GM-CSF or inter alia one of theother imm~ omc,dulatory ~ 15 mentioned herein, snd reinfused into the patient as an immuno~nnic c~il pr~pdral;on, ~.~. usin~ some or all of the procedural stsps ~..u..lioned helow, with a useful extent of transduction of thecells. By contra~ re~iously, usin~ a uu~ n " ~~ retrovirus vnctor, it has ~ ~0 proved ~-Dc~ ~ to culture the tumour cells in ~~itro for some d~ys before they could be transduced u~efully; e.~. in order to drive cells into coll ciivision and render them s~Js~.LiLle to ~~L ov;..~l transduotion This can be a useful advantage of r~,CGIYlL ~dll~ ;rus vectors as dasc-iLed herein, since it can reducs the need for lal~ul~Lul~ manipulation of the tumour cells, can be morn rapid, with more ~,rri..;Lr.~ cell transductiorl, and can present a more viable clinic~l tr~al~--ent option.

Cytotoxic T-cells can be ~ d sndJor ~,uand~d, e.g. in vitro, e.~. for purp~es of cancer imrnL..G~ p~r, by the use of virally-transduced ~
or target cells, ~ 8~ e: ~'ly target cells o~ haen~atope;eti_ lineage, CD34+
ccll~, wherc the virus used for tran~ ction is a vector as described herein carryinç~ a ~ens ~ncodin~ an antigen ~ r---lL to th~ ~wired therapy, e.~. an anti~en encoded by EBV or HPV, and in addition, if desired, en~;, .g an immunomod~ to~ protein 8S meoli~.led harBin. An example of such use is the case of donor-cell tumours in l-~n~ patients where ths turr~our cells tJ.~r~...5, EB~ or HPV a.-l;g.z.,~. donor T-iymphocytes can be &~ led and e~.pa--de~ in relation to tar~et cells, e.~. olF types as ..tenlioned above, e,~.. ,g EBV or HPV
1 r; an~i~e.ls as 3 result of tran~ur*nn by viral vectors as des~ Ld herein ~.. ,-y;.. ~
cu..t;;.~Jor.di..~ h_~r-l~gr ~ ~enes, e.g. HPV E~ or E7 genes. rt-_cG-.~ ~ant he.~ S as ~ lion~d herein can also transduc~ other tumour cell types, such as n~u-obl-r'~ri-a cell~, wlth ~ood effici~ncy.

The l~-,u-~-b;~-d--l herpesvirus use~ as a vector acco.~ d to this In~,.,.. Liuncan contain a gene sr~_ ' Iia an imm~ on~ollulatory protein, w other protein relevant to cancer immunG~ ,y or ~ene therapy.

~3enes ~..ccjding any o~ ~everat immu..u..,e~ tnry pr~ can bc used ;!5 in this way to render tumour c~lls immuno~enic, in humans and non-human .., ).3l9. The resulting immune responses can be used in ,~--Jv~rtion and IredL,Il~..L o~ tumour ~rowth.

Immunomodulators are nJr'ur ~'e~ that can erl-d--ce or repress immuu~lc, n ' ~~s"ûnses. They include u~ es Isoluble ~IYL-OPrUL~ which initiate ur ~,--hallce activation, ~rowth and clirr~-~--Li~lh~n of immune sysrem cells).
co-stimulator~ nl3~ ~les ~structure~ present on the surface of cells within the body that i--lrr e~ Yvith immun~: cells to help stimulate immune ~t:s~ ~n~s~ andlirnmunol~ li chemo-~ll-t-uld..L ,.,rli ~r~ ~hich sen~e tO attract immun~ cells -to sites of immune or i,-fl~"""atory activity, e.~. at whTch antigens can be t~.

nlmmunomodulatin~i" or "immul-G--,odu~-~nry" protein, as re~ d to herein, includes one or more ~.vL~:.-s which can onhance a host's immune I~J~UI~ e.g. to a mutant virus, or to an antiE~en such as an immunogen ~rom a pall~os~en or source t:,cu~..ous to the virus, or to a tumour eD~ociala~i antig~n, which can for ~,..,- ~ . ' be produced by the mutant virus. The immunomodulatin~3 ~luhi..s are not those F.~ .lly used as imml..-o~en~ in ll-~,selves. The immunodulsting yl "t ' ~5 for which tll ~CGd;- ~~3 nu - _ Lide sequencQs are e.~ ssibly c:arried by viruses as d~scrii~ed herein can for ~xample usefully have sequencesnati~e to the species which is to receive vacc;nalio.. by the .-,~,r..~;na~l viruses, or which is ulh~ to r~ceive cells transduced with the rt.-,or, l~ ,an~ virusss, e.~. is is recc,~ end~d to use an imm~ ",o.~ulating protein of s~ lially human sequence for transtiucing a cell ~ -t.lion to ~e used as a human immuno~en or vaccinc, or to be used vlh_, ~'lS~ in conne~ with humans.

Any hazards aC ~Q~ -=1 with ~ ; . of such p,~.t~ s in a fully r~ nl;~-y virus are r 1~ ~-i--dt..d wher~ the ~rirus is a ~, ' n defocIi~/e mutant.
In certain embGJ;---t---L~, the plot6;ns can be ~lr~ to ~nhance the effect of the mutant virus a~ an immuno~en or vaccine in the context in which it is employed.

i_Aa~ll. I of use~ul immu~,o-no~ atinE1 prul~ include c~tLui~i..os for interleukins 1 to 15 ~IL1 to IL15), i--~ n~ns alpha, i~ts or gamma, tumour n~clOsi~ factor ~TNF~, granulocyte-ma~ruph~e colony stimulating factor ~GM-~SF), m~ofo~l-du~ coiony ~timulatin~ faetor ~M-CSF;, ~ranulocyte colony stimulstin~ facwr (G-CSF), ~ ' ~ss such as neutrophil actiYating protein ~NAP), ...z~,ropha~e ~;ilt;llledLL-d.,l~llt and ac~iv~,Li.-g factor ~MCAF), RANTES, rnacropha~ anlnldLulypeplidosMlp-1aandMlp-lb~c~ nLc~"pone"l~
and their ra~.ep~ors, ~ccess~. ~ m~.lec~ s such as one of the B7 family of T cell co-stimulator~ such a~ E~7.1 or B7.2, ICAM-1. 2 or 3, C~X40 li~and and cytokine plu.~. Where nllcl-~,lidc sequences encGdi--~ more than one immu...J---o~-Jlating protein are il.~t;.1 d, they n-ay c~ rise more than one cytokine or may be a co.. ' ~~Lion of cytokin~(s) snd aGc~n~y m~ (s~.

M~ny further kind5 of immunomodulatory pro~;. ~5 an~ ~enes can bc useful in thisim_,n~io~

Cxa., ~ of particularly useful irnmunomodulator~r protsins inclucle ~3MCSF; IL2; IL4; IL7; 1~12; B7.1; Tl'JF-alpha; inl.,.fer~ amma; C:D~OL: and lyn)pholaclin~

The ~enetic ~ L.,ri~l encodTI-~ an irnmlJ,-v"-od.Jlstar~r protein can be carried in ths mutant viral ~no-"a as an e~.r~ '~ open readin~ frame encLd;, .çla hybrid or fusion protein which c~ ri 1~6 a polypeptlde region havinç~ homologyto ~nd ful-~Lion81ity of an innm~ u--,o~ nry prot2in. Iinked to a pol~Ju~ e region having another ho,., Ic"-~ and opliQn ~y dn~ll-~r functionality. For eAall~F~-, tha immu-.o--.oclulstory protein can b~, comprise, or cctl~s,vond in func~;on~ to the ~p34 protein i~ iriad as a bindin~ partner to human OX-40 (see W Gadfrey et al, J Exp M0d 180(2? 1994 pp 757-7~i2, and rcfer~nces cited therein, including S Miura et al, Mol Cell i3iol 1113~ 1991, pp 1313-1325). ~he version of this protein fu~ y that can be en.,o;~d in the mutant viral ~no~ can ~;c,..~spon~ to the na~ural 5~p34 seqllence itself, or to 8 r.~tl."O,.
thereof, or to a hybrid e.~ 3~ic,n product e.9. based on the ~ Ie....i.,al~
~I.c,e.J~ (b- ~Ji--~) domain of ~p~4 fused to an~ther protein, e.g. to the O~l~5lal)~ re~3ion of an immuno-JIn~ n heavy chain such as human I~G1, e.g. withthe e~-~r~ ' domain of nP34 la type 2 membranc protein? fused at its N-t~ al to the C-terminal of the imml."~ lin eurl;~l~a~ll dornain.

Others of the imm~."~",od~latory ~J.uL~,;.l~ can also be carried and e,.~ ~J in ~iull.,i.y~ or othor derivative and hybrid forrns. It is also un~er~ood tha$ mutations of the d...i.-o~cid sequenc0s of such immu"oi"oJulator,~ proteins can ba i~ or~led~ Included here are ~ ~ul~
havin~ mutated seguencss s~ch that ~hey remain hom~!D~Qus, e.,q. in sequence, 3Q function, and ~."Ls3en.r characle~, with a protein havin~ the co.,~ ,on~' ~y parant ssquenc~. Such mutati~ns can ~--.Iu.~ for exe.. ,~1 be mutations i~ ulvi~y conservative ar.;--oac,;J ul-,~ e~, e ~. chan~es bt-lt.t.0n ~ c3~;d~ of broadly simi~ar ".t ' ~ prvp~. ~;e~. F~r ~xamplt3, ;- llerchan~ea within the aliphatic ~roup alanine, valine, laucin~ anr~ ~ie~;rine can be ~.u-~ider~ct as cun~ n~ e So,.,~ttirr,o~, substitution of ~Iycine for one of these can also ba conside,td consar~ative. I,)L~,~I-d.,ges wi~hin the 'i, IdLic ~roup aspa~Ldk: and ~lutamatecan also be considered as conservative. I..ll ..I.dn~as within the amide group a~p~.d~;..c and ~lutamine can also be Coftsid~ d a~ conservative. I..~v.cha,.geswithin the hydroxy group serin~ and ll~.c,o.,;-le can also be .. ul,sidL~ as con~ervative Interchae~e~ within the a-u. I~dliC group ~ nine, tyrosinc andtry~-Lupl-a-- can also oe cor~;dervd as consurvative. I..~,cl~anyv~ within the basic group Iysinc ar~;, IG and l.;~ e can also ~e con:-i t~-L.d conservative.
Interul-d-,ges within the sulphur co-~, , ~9 ~roup ~~-~"I,' r;.-~ and cysteine can slso be cel)side~ ~.on~ v. Someli--,~ sub~titution within the ~roup neli.;cj,.;.,e and laucine can also be cùn~idero~ conservative. rrete l~d ~o~ e.~id~iJe substitution ~roups are as~ .LdLt:-glLIL~ sl~; aspa.v-yi--e-~tut~mine;
vnlin~-leucine-~ L~ine; alanino vvlL,e; phe--f'~ ,i..a tyrosine; and Iysine-c,-~;";"e. In other Iv~pLvL~, mutated sequences can co".~rist, insL~Lion andfor 1 5 ~ s.

Particular useful e~d.~" ~ - of derivative and hybrid forms include ~,ui ,s with sequences havin~ deleted tl.e.~ur,, any of; a t-d.-s,-,e-,-bra..e s~J".ent an illL~ sequ~nce portion. an N-L-;."~ ,l ar C-term;.-dl sequance e.ç~. a 2~ s~quence of from 1-5 a.";.,od~ s upwards; andfor s~quences havin~ added thereto any of e.g. an N-Lt~ ;U3l or C-tern-i-,al seq~ence. e.g. a sequence of from 1-~ all-illOaa~vlS UF~'J~a.lla, or a further f~J.Ictional sequence e.g. as des~dbod atjove.

Suitably the immu.,u.. csv~latin~ ptotein can cc~.. plis~ a cytokine, e.y.
~ranulocyte ...a.,.-,pha~e colony stirnulating fscTor IGM-CSFJ. Nlurine GM-CSP
gene, for e~ll.>~e~ enGodes a poly~ de of 141 amino acids, tha mature LclesL~d ~Iycoprotein having a ~"~ie~ w0iSaht of between 14k-30k daltons ~la"sn~ on the de~ree of S~lyCOS~ Liu-,. GM-CSF is a r ~e."ber of the haa.oat~ . growth factor family and was first defin~d and ideoLirit,d by its abiiityto stimulato ;n vitro colony fu....&lion in h.2~."~p~ p-~ ..iLolY. ~M-CSF is a potent activatcr of ne~J..oph ', eos;..ophils and n~ac-upha~e~nonocyt~
function, ~nhanc~ ;y,~ion, phagocytosis, major histoco",r ' 'it~ cc..,, ' IMHC~ e~ s;on. ar;.i ;r,iLidli.lg a ~cad~ of b,oa-,L;~ n.cl~_u'~s which further Wo 97/14808 PCT/GB96/0~576 stimulate tha immune system. Human GM-CSF iFA' currently b~ing evsluated in the clinic for the treaunent of neuL.upenia following U~ IG~ PY and aoA sn adjuvant in cancer therapy. The h~tetol~ous nucleolide sequence e.--p'~
may comprise a heterolo~ous ~ene, gene r. ~ n~l~ or combination of gene~.

The inY~,.-Iiu-- is al80 aF'p' ~ e to co... ~Li~e ~ene therapy, to improve tho tar~et cell's uscfulness or viability. For .:Aal., ', normal CD34+ cells can be trat~fu~Rd with Yiral Yector as cles-_-ii ed hsrein encodi~g a DNA repair e..~y...~
such as O~ eLi~yl~Aanine DNA methylL~dr~re-ase (MGMT~, for i3rU~6~ on of target cells c.~i. dunn~ ch~.~-uU.~.~py e.~. with nitrosout~a, s~e T Morit~ et al, Cancer i~es 55tl2) ~19~5~ pp 2608-2614; R Mszf et al, Proo NLiat Acad Sci USA
g3~l~ 1996 206-210: or apA~inst ~a~liàlion cid..-age. Other ~enes for corn~Live gene therapy, of the kinds ~ nLioneci abov0, ms~ also b~ transduced as L.~ns ir- r-dd to tar~et colls.
ttr~ JSA~o~s DNA. e.g. further DNA, can u30fully be introducud into the virus vactor for other purposes, e.~. to encode e~ ~ssiiJI'1 an i--l~ c,su such as one that is known to bs abl0 to act to inle~r~L~ Yimi vcctor DNA into the host ~enG~.,e so that the vector DNA b~LlJ.i._~5 prora~ets~ when host cell mitosis :~0 occurs; and for other purposes.

Furthnrmore, dccur~Jin~ to ~r..bodi,..ents of the inventic~n, there sre provided ll~al~liAl~A snd l~elbods to insert ~ c-ive or lethai ~enetic material to destroy or modulate ~ dlll, blast cells. This can be done for example by th~3 ~5 e~ ss;on in the tarEIat cell, by means of th~ herpesviral vector ~ ll ~ods des...iLad herein, of d,~Li~-:-.se RNA or ribozyme se~uences c~ spondtn~ to ~enetlc lndle~idl e-,~od~A by 1:he vector: for ex~mple as in " : ~ in D ~arcol~ et al, 'Antise..st; Apprud-,h~s to Cancer Gene Therapy', Cancer ~iene Ther 2 ~199 pp 47 et seq.
Techniqu0s for use of anlis~ A0 polynucleuliJes ars knoum per ~e, and ar0 raadily ~-~a~ to the A~.~uiri~iL-f naeded for thr~ present a~pl ~ Lion by using suitsble n~ e: ti~e sequences, e.~3. of at least about 12 nucleotides ccn~ ntary in sequence to the rAequence o~ e chosen tar~et: by ch~cisi.. ~

CA 02234877 l998-04-l5 from smon~ known ~ lulul~ suitablc tQ the cellular ~n~i.or~ment in which the~
are to be effective, snd other measures well known per se.

For G--d~ Iln;~les for use of ,i..ti. ~nse RNA to disrupt ~ DDion o~ a tar~et gene are i- ~ 'nd lin co- .. .e-,lion with a ~ c~ ~ene~ in :~JGc;r;~dLion WO 94~26~08 IG~ -It~L~h: TG Wamer et al~. Techniques for usinS
a~is~n~e oli~onu~'E~Iid~s capable of bindin~ iSi~--,lly to mRNA ,. ~le 1' :98re also i-, ~ t~ d in s,~ecitic.~l;ion W0 9412~34~ (La Jolla Cancer na~Bar~;h Fo~,.dal.an and the ~(egents of the l.tniversity of M;~ d--: R Sawada ~t al~ (inparticular co----e-.lion with mRNA Gln~oJi-l~ human lamp-derived pol~y~.J.3ptid~s~.
TLChnC, ~95 for a~)lis~7n:-~ oligonuclcotides col).~' IlGllld.y to tar~Qt RNA are i--Jicdl~d in s~,6. iri~dLion W0 g4J29111 ~Depallll~ent of Health and Human 5c. ~?ices. B Ensoli and R Gallo) (as applied to basic fibrobl~st ~rowth factor RNA~.
Tecill. l~c for usin~ anlise~ls~ oligonuclao~i~as havin~ a ~;equen~:e suL~LJ..Iially cu.. , ' .,enLd,y to an mRNA ~vhich is in tum co.nr' nentary to a taraDet nucleic acid, in order to inhibit the ~unction or expressiûn of the tsr~et, are i~ l.,d in WO g4~24864 (General llo~t~iLal Co.,uu.aLien. HE 81um et all, (as appli~d to ;bilio.. of hG~JalLiLis B viral ~vpli~lion~. A review of a,.rise~ tachr, _!es is~iven by ~ Mercola and JS Cohen, ch.7 pp 77-89 in in RE Sobol and KJ S~.al-lon ~eds.) 'internet Book of Gene Therapy: Csncer Therapeutics' ~Ap~l t~n ~ Lan~
S~d...ford, Co~necticut, 1995). Applications to oth~r tar~t spG~iri~i~ies are rea~ily __ ''~ by ad~pt~.oll.

Te~l .r.:~:P~ for usin~ riboz~,rmes to disrupt ~ene e.~ Dl.;on are also known per se. For e,~ ucbl.. q.Jes for makin~ and a~lll-in;,~,in~ ribazymes ~or a~ z oligonu~,lealid~s) in order to cleave a tar~et mRNA or otherwiss disrupt ths e~-~,--,Dsi~n of a target g~ne 8ra i--~l;c~eci in speoir;eal;o~ WO 94/137g3 (Apollon; CJ Pachuk st all ~as applied to ribozymes th,~t targst certain mRNAs relèvant to lelJkemias~. A raYiew of ribozyrns luchrl~ es is gi~en in M Kashani-Sabet an~i KJ Scanlon, ch. 8 pp 91-~01 in RE Sobol and KJ Scanlon (eds.) ' Intemet Book of G~n~ Therapy: Cancer Therapeutic5' ~ ten & LanE~e, St~ lll(o.~J, Connecticut, 19951. Here also. ar p! lions to other tar~et ~pecificiLies are readilv acces~ by ~d~ ion.

lB
A lethel ~ene can also be in~~. lad into the Yector to destroy the transduce~ cell; for ~ "pli~ a ~ene that is lethal in con~ ;l,on with an ~clu-i"i;.l~-~d phd~ ar~uti~ , as doscn~ed in e.~. sp~-,i(ic~lion YV0 95/14100 ~Wcllr~--e Fou..dalion: C nichar~s et al~ in~ a ~ene e.,L;u~lil,~ cytosine~dlll- Ia~ CDA) undnr control of a CEA p.u~ , which when introduced into a cell is lethal in connection with ad~"i";;,l.alion of 5-fluorocytosine, Irdll~ru~ ed by the CDA into toxic 5-fluorouracil.

~he r.~ul" ~ L hnrpesvirus used to carry a gene ~ncodin~ an immunomodulstor~ protein or other ~enetic matcfi~l as di~cu~sed her~:in, is f,.~I~r~Lly an attenuat~d andlor n r~ n~defective herpesvirus.

The mutant he-~-e~v;.~Js can usefully be a mutant of any ~uitabla herpesvirus; e.~. a non-t,t...sro"";~ mutant of a mammaiian he.~e~;.u~; e.~.
a mutant of a non-t~ a~u~l,i"g human 1~6., ~ 15, ~5~e~ f for exan1r coated or ~ rpel mutant herpesvirus. ~x~ rles of he~pesviruses of whlch rnutsnts are p-.J~id~ snd can be used as vectors acco~J;,)~ to ~,..t.od;.~ents of the inve,)liu~ include herpes sirnplex virus of t~tpe 1 IHSV-1 ) or type 2 IHSV-2~
ahumsnoranimalc~rlu" ~ JStCMV),e.~.human~ ",e~ ~cvi.usIHCMV), varicella zoster virus I~ZVl, andlor human ~ SJ;.~S 6 and 7. EBV is less .le~ Lle, except in the fonn of a non-t-~ nll,i.,~ mutant~ ~c~us~ of its .G~--. 'Iy t-~ rur,l ~ prope.Les. Animal viruses of which mutants are l.l~vi~ d .cco~ to ~.nbod;"~ ts olF the invontio~. include pseudoral~ies virus IPRY), equine and bovine herpesvirus including EHV and E~H~ types such ~s IBRV, and Marek's disease virus ~MDV) and relatcd viruses.

The ~lulllbl-uldL-Jre o~ the ~enes of h.., e,J~;rlJses and their many cofr~a~,G--di--~ hom~'- Jes is diYerse, and where the context admits, nlt~ ion of a ~ene in conn~ Lion with a herpesvirus includes refe~ e, in connection with other herpesviruses poc~ a ho.- ol~ IR of that gene, to the cor ho~nvlGu~)e.

S~it~ he~,a~ ses to be used as a basis for l~r c....ti.,c~ion to produce a vector ~ tr~ for use according to the pre~nt invention inc~ude defectiYr~

W O 97/14808 PCT/GB96/02~76 h0rpesviruses c.,r"u~ with thr~ general or spocific diruuliuns in specification WO 92/05~63 ~In~lis et al: Immunolo~y Limited~ lthe ~ rlos~)re of which is incor~-~r~Led herein by rt:r_r~nee) which des-;-ibes for ex~",~'~ the use a~ an - immuno~en or vaGcine Of a mutant virus whose gonome is d~fective in resp0ct of a s~en~ ~s~--Li.-l for the procluction of ;.. ~e~Liou~ virus, such thatthe virus can in~ect normal ho~t cells and under~o r~FIic ion and ~A,~.r~s~;on of viral antiç~en genos in such cells but canneLn~ produce i~(s~v~ious virl~s. W0 92f052~i3 particularly dua~libt:~ an HSV viru5 which is rli ' bV the delation o~ a gene encoding the e~ Li~l ~Iycopro~ ~ H (gH~ which is required for virus il~fe~ liviLy ~A rG,,~ r et ~I J Virol ~3B 11g~}2l 3~1-348) In the aLa~......... oe of ~H protr~in .u~;on non-infeotious virus pa. Ii~ pruvidil,~ almost thc co... -pl-_le ~ ~pc~ lu:.
o~ vjral l~rota;ns are produced. These pro~eny pdlLi~ ., however, are not abl~
to infect host calls and sprcad of the virus within the host is pru~,e.-l~.d. Such a virus has b~en shown to be sn ~rr ,~ re immunogen and vaccine in animal model systems IFarrell ~ al, J Virol 68 11Q94) 927-932; McLaan et al ... 1 Infect ~is, 170 1 994) 1 1 O{) 9) Such mutsnt viruses can be cultured in a cell line which t~ .r~i5es the ~ene product in respect of which the mutant ~irus is del~cLi~re.
Th0 literature also dc ~ ., iLes cell lines e~ ra~ ,9 proteins of herpes r~ ~cvirUs: the~B~l~cop~ i.,ICaietal inJ~firol61 11987)714-721),the ~D glyco~fole~ LiS~as and Johnson, in J Virol 62 11388) 1486) and the Immediate Early protein ICP4 ~Deluca et al, in J Virol 56 (19851 558~. These toohave besn shown capablc of SIJIJPO~ Lin~ replir~tinn of viruses inaotivatcd in respect of th~ ondi.-~ ~enes.

Co"..' or suLa~.lial sequencs tats has bsen puh' ''.3~ for several viruses such as human cytume~alovirus CM~ ~Weston and Barrell in J Mol Biol ~ 30 192 11986) 177-200. varicella zoster virus VZV fAJ Davison and Scott, in J Gen Virol 67 ~1~86) 759-816~ and herpes simplex viru~ HSV ~ r~:~'n et ai, in J.
Gen. Virol. ~i9 (1988) 1531-1574 and further lef~rdnce:. cited below~. Ths ~H
~p.~L~i.. is known to have homol~Du~s in CMY and V~Y IDessi ot al. in J
Gcn Virol 69 ~1 988) 1 147).

S-~itable e~drnplr~s of ~uch ~en~s sre ~enes for es~ential viral ~Iycol r~ ~ ,s, ~.~. llatel us!;enlial viral gly~u~lui .s such as ~hi, gL, ~D, snd/or ~B, and other assenlial ~en~s. C~. . .Li~l and other ~enes of human 1-~ iruses are ic-erllit ~~ 'e from C~J M~r~orll, 'The Geno.-les of the Human l l~ v;~uses', in Ann P~ev Microbiol 4~ ~ t 989) pp 235-265; DJ McGeoch et al, Nucl Acids Res 14 ~1986) 1727-1745; DJ Mc~ieoch et al. J mol Biol 181 ~198g) 1-13, for data and rtir~re:nces cited therein. Il-,f~.a,.ce is also made to data for homolo~ues of ~H ~Iycopratein in for ex~-. ' CMV and YZV, publishsd e.~. in Desai ~t al, J
Ci~n ~Jirol 69 l1988~ 1 147).
Also useful as virus vectors in the present invention ara for ~xample the mutants suoh ~s H5V-1 mutant (in1814) unable to trans-induee ill-n~eciid~t: early ~ene e,~ rassion, and essent;-'1y avirulent when iltj9 :tl. ~1 into mice, ~t:aL.~iL~d by Cl Ace et al, J Virol 63~5~ 1989 pp 226~2269. Sp~;ri~&tio~ W0 91~02788 1~ ~CM Pr~ston & Cl Ace: Un;1r~,r~ r of ~lass30w~ d._s~.il,es useful HSV1 mutants includinS~ inl814 capable of ~Jt L' h ~~ Iatent i..reoliol~ in a neuronal host celi ~nd of cau~in~ eA~.r~ssion of an i--se, led Ihe.a~eutic ~ene. Further exan . ' ~s of virus vectors useful in the i~ e.~ n are based on a mutation in a ll~ ;.US
i-n-ne~l;d~ early ~ene, e.~. a gene CG~, ondin~ to ICP0, ICP4, ICP22 and ~o ICP27. Mutations can be used in com~ .~lion, e.~. as ~ ,.. 1 in W0 96J0~395 ~P Speck: Lynxvale~, iua~llJCI~Lad by Ivf~,ence. Also suitable as viru~ vectors for use in the pres~nt invention are such neu.ualh,nuated HS\~1 mutants as mutant 1716 ~BP Ra~ ~O et al, Viroiogy 211 ll~gg5~ pp ~3~101).

2S For ha.,ue.. ~;.. Jses ~f~lt.nce is further made to data published for t~ plE~
in r~spect of human cyL~..a!O 'c~/;.us CMV ~Westcn and Barrell in J Mol Biol 1 g2 ~1 g8ffl 177-208~, and varicella zostor ~ s VZV (AJ t:)avison et al, in J Gen Virol 67 ~1 g8~ 759-81 6).

Accor li.-~ to certain examPles of the pressnt invention as de-~-iL~ in further detail balow, a ~er~t; ~ inactivsted viru~ immuno~en such a~ a vaccine proYides an us~ful carrier for gnnes ~l~codi--l3 immtJ-,s--~ tory pluL~in2.. The virus vaccine can infect cells of the ~,ac- irl..t~d host lea~ing to i..tl~..aell~ r ~c~n~ o~ the immunomodulatory p.o- )s. If the ~e.. t; "y inactivated =

19 ..
vaccine is also actin~ as a vector for deliYety of for~ign antiS3enS~ then the immune .~a~Jons~ aS3ainst the forei~n anti~en may be enhanced or al~ered.

~ Since the~e replit~tion defectiv~ viruses can under~o only a single cycie S of ~ ion in calls of th~ c.,i~ ed host, and fail to produc~ infectious new virus par~icles, prodnction of the immun~ ocluhtory plUL~:..s i~ Lor.~i-le~l to the sitn of Y~ aLion, in corlll~Dl to the situation with a I, li~ lion c~r..~ nt virus, whQre i~fecLion may spread. h,.~ ..l.u~z, the oYerall amounts of immunomodulatory protsin producerl, thou~h locally sufficient to stimulate a vigorous immune re~l ol~e, will be less thsn tha~ produced by a .. . ' ~ Li~n Culllp~t~ virus, and less lik~ly to produce adverse systernic rebpo~

In such a ~r~ e...bG~Ji...~..l, thB hE~I 'agous n~ tidc sequcnce, usuaily co~nptis;n~ a 9enQ enco~ immu.l~l..o~ tory or other protein, is ~i 5 i~ - L~J into the ue~~ul1l~ of thB mutant virus 8T the locus of the deleted ef,5erilial ç~ens, and mo~t pr~r~r~l~ly, the h_t~rel~gous nU~ oti~tp ~equence con r ~ ~
r~place~ the s3nne which is deleted in its entirety. In thi~ way. even if any unwanted l~ol~ nalion eYent takes place, and results in the la;nse. IiO.. of th~deleted ç~en0 from a wild sourcs into the mutant virus, it would bs mQst likely to elin~;-~le the inse.le~ L~I ' 9_ 1~ n~ lide sequence. Thi5 would avoid the ~4-~ih;liLy that a r~ n cc,n~t,lenL viral carrier for the hetern~ngo nucle~lde sequenc~ wouid be produced. Such a recombina~ion event would b~
~,..llt:...~ly rare, but in this t:l- ~ ~ '' .l~n~, th~ hs mful effects of such an occurrence would be ... ~-i:.ed.
iS.~ I~lidla and l..~LI.ods ~-c~ dilld to the invention can bo used to evoke imm~u~lcL e~r~ LJr l~l~o~ 5 ~oti~fa~ed by cellular immunogcns such as eutic vacc;i-les, in particular to evoke spacific cytotoxic T Iylll~hocyte~
(~TLsl d;.~cL~d a~ainst tar~e~ anli~ens. Such CTL~ can exert a bt n~r;~ ffcet by tendin~ to Ivco~-l;sa and destroy tumour cslls. and can also bc used ex-vivo in a variet~f of dia!JIlG~lic andJor ~ eutic ~ llods.

Where there are ~nlisan ,, diffe~nces between tumour cells and normal c~lls, they can be r~cG~l.i3ad by the immune s~nitem, provided that the tumour-CA 02234877 l998-04-l5 ~e~iric a~ n~ ar~ available in the correct form to stimulate an immune ons~. This avoids the need to identify tumour specific ma-l~arb.

CTLs destroy cells on tl-e basis of antigen r~ ilion in coniunction with host major h-s~ocon)patibility ~u---~' lMHC) anli~ens; ~ A5 ~encrated from the ~ tsr~et within the C'~rlùp6~ of the host cell form a cornplex with host M~C me' ~ules and are L~d~ lad to the cell surface, where they can be I~CO9";_~ d by receptors on the 5urface of CTLs.

l O One method of usin~3 ths vectors, p.u~ Jed by this invention, is Ll.Erefore to prepare a cellular immuno~en ~uch as a vaccine from tumour ~--dL~ridl dsrivedfrom one or more individualc ~nd to ~t~ ~.i..is~er this as an immuno~acn or vaccine for ~rt;.l~-lelll 0~ other subj8ct~, e.~. palients. If a CTL ~~ onse ayainst thetumour cells iS desired, hov~ r, for the ressons outlined above, Ihe target 1 5 dl~ should be ~ L--d in the con~ L of the correct MHC r~cl2 ~ '~s. An immunoç~en or vaccine ~lrepa,~e~l from a tumour of one individual may not alwaysU.~ rur~ be a~propridl~ for another individual with a .lilrt ~-n-l MHC type. Since MHC ...~' ~u'~ vary from individual to individual, it is ,J~er~'ly ne~r~- - y, in order to activate CTL ~ uS~sS a~ainst the tar~et allliyans, to present the r~levant tar~et anti~en to the immune sy~tem in the correct MHC context. Thus for u~e 3S an immuno~3sn such as a thsrapeutic vaccine, in ~eneral it is cor- .;dered that th~ selP~ct~d tar~et anti~en is b~st Intro~uced into the treated sut)ject's or patient's own cells in order tû 5~llt;laL-t an ~p,~-~pria~e CTL .u~pons~.

It carl Lhe~bsole be ec~e: 1~, useful to base the tumour immuno~en or vaccine on a patient's own tumour cells, a procedure known as autclo~ u~
vacci"at;on. A further major sdvanta~e of this way of USB i8 that it cen taks sdvantas3e of anli~}e-~ tarye1:s that may ba unique to a particular tumour; it is considered that the deregulatec~ cell cycle control that ifi th~ basis of tumourgrowth can, over a period of time, lead to the accumulatk~n of ~enetlc chall~s ,. 7~ir~ dasnewa-~ ,L~ Inthi~c~--n~ ion,thelast-",~ ioned en~bo~ of the presunt invention can avoid or fiOl'Ve a prcbl~n. ~ith a~-i In~usY,~ .i--al;onproce~ure, namelythatautolo~oustumourcellsarepoorly immunogAnic.

Procedures accordil ~ to exc-, I ~F ' ~ s of the inYentlcn can involve introduction of a sargct gene into tumour cells r~moved from a subiect~ by labaratory procedures after which ~he cells so treated arc f~: ~l.ocl.lced into a subject to be treated ~ex-vivo Irual~nen-). An allQn~a~ re procedure a- ~_u,-li-,-J to cersainex~d.. F'-~ of the invention is to introducs the tar~et gene directly into tumour cells of ~e patient ~in viyo ~ nL). The à~l~'dlltd~le of an in-YiVo proc~dur~is that no laL,~r.,L~ manipulation of the patient's tumour cells is requir~d. A
dla~La..l~ can be that effectivu g0ne transduction may be mor~ difficult to schieve in YiVo, or more difficult to achieve to a d~sired degree. Other. non-tumour, calls can also usefully bQ l~ -sr~-,Led with ths virus vsctors.

In a particular ~d~ r . i _ ~ th~ rt~o~ ~ ~L;~ ~a~ ~ L h~r~ ,u~:a~ US iS basE~d on a d ~ ' l e d form of the herpes simplex virus carryin~ a ~ ,lion in the gl~o~ru~,.in H ~3H~
~ene, a prûtein present on the surface of the virus particle that is involved inentry of virus into sus rl -' ~ cells. This virus can only bB ~-, "C ~w~d In a producer cell line that ~on,, 3..~ a the ~2.~..li..1 ~unction missin~ in the viral .,.o: a usefui ~Aa--, ' of a .~._c,~ a-~l ~ur., 1~ ~enting cell line is one which has been ~:lly;.lee.~d to express stably the same H5~/ ~H ~ene as was deleted from the virus YuCtOr. The virus ~en~ra~d from the producer cell line ~cquires thc c011~ oded gH E~ene product as part of its structure and is infectious. ThisYirus pr.,pa,dlion can inf~ct normslcclls in the ssme manner as wild type virus Once in the cell, the viru~ ~enG.,.e can be inLra~ ly r~JI;caled, and genes carried by the ~e..o~ can bs e,~.r~s~ad as prosein. I h...,l~-,r the abs6nce of a f~ cLi~l.dl gH protein when the dafe-,ti~ vims infects a nomnal G~ll results in failure to ~~e.,e~ate new int~;-,liou~ virus, ~ s. The ~,~eleted virus i~
~,uu~l~ler~cl to be safe to a~ as a vacdne or a ~ene delivery vehicle.
-It i5 iJ~i5~ 9 that a vsctor such âS â HSV vector for cancer imm,...uU-~-au~ is fully d ' ~d and unable to spread within the treated host. A
~ 30 use~ul vsctor can, however, be based on any HSV virus that is d~e."ed s-.rrici~.-lly saf~ to bH u~ed in a clinical settin~. It ix abo ~ that h~ r ' ~ 5u~ ~enes i..c(Jr~ u---Lt:J into such a ~H-deleted HSV ~enor"e are ins~rted at th~ locus from which the gH ~ans was r~..,ovcd, to ",i"i.-,;se the risk of r~r of the he~etolo~o.ls s~ene by homo~o~olJs ,e..u. ~ ,~.lion to wild type HSV

that mi~ht co-exist in the treated individu~l. The heterolo90us gens can howeverinstnad be inserted at any site within the vinJs ~enc,r..e.

A further a.3ap~alion of ~he method within the scope of the in~ L;~I. is to deliver the app.u~ L~ ~enetic rndt~ ial, e.g. a ~ene oncGdi~l9 arl immunomodulator~r protein, in the form of h~,. s ~jYi~al a---pli-.ons racl~a~ecl within h~ s~;ldl~d-Lile6. A---plicon DNA is DNA that cout~;.,s an ori~in of r~r';G~l;onof a herpe~viral ~eno.ee lo~ell-er with DNA sequence~ that can direct pacL;~.~;n~
o~ this DNA into virus pa- ' - Where such a,--~,lico--a are pr~sent in cell~ alon~
with corln~ol-Ji.-~ h~rpe~vi~us thelper virus~ r~ss;on of dl~ n DNA can occur along with ~x~r~:~Y;on of h~ ./iral UNA. Forei~n ~3enos can be cloned into ~uch a...plicons and thus e~.ess~d in cells i--ru~l~d with the amplicons aswell as with l~ ,Js- P'L. ~ 35 CO~ ly pd~ IF.. .~ 5 ~n be phenot~/pically equivalent to the c~ s~nJing help~r virus and hence sbl~ to infec~ thel samo host coll and are cGri~;Jel~d herein as among the defect;ive mutant herpesvirus ~ e as voctors for use in the pr~ctic~ of the invention.
Thus virally-r~ac ~ ed ~.. r'l~-,ns can al50 be used to deliver 'e ~ ~NA to desire~ cells. A---pl;_~ns and pr~lco~ s for their ~ dldli~ll th~t can be used or r~adily adapted for uso in exa~' of the pe.rur---ance of this invcntion, alon~
with further det~ils, are de~.. iLedin further detail in W0 96f2~3421 ~Efstathiou c~ al: Cantab Pllàlllla~ tioals n- ~cal(;h Ltd and Cd---blid~e University T~L.l-nical Services Ltdl.

It is ~. . r~. ~ that the HSV helper virus used for p~ckaoing the &r .~I:c ~.~s is, by itself, not harmful to the host, and so a ~ d virus with an ~s~n~ial çlene duleted, such as the ~H-deleted vir~s d~ ,ril,ed ~bove provides an ideal helper virus as cle~ ed in WO ~321()5263 and other rolated .~r..~noes cited horein. Other useful helper viruses can, howov~r, be ba~ed on l-efp~ J~
xurri~ attenuated or d ~ l to be used in a clinic~l setting, not nacassàlily onc that is entirely .~lplit~'; n-defecbve.

The invention de~c- il~ed here can be usod to deliver chosen geneti~
r,.dL~ l, e.~. DNA e"~ 5 a chos~n protein such as an immunu,nodel~tory protein, to tumour ~ells for the purposes o~ thorapY. Th~ ran~Q of ~enes that can be delivered for the purposu ot stimulatin~ an immune res~onse includ~s E~enes ~ for u~llvl~ a, immunostimulators, Iy,- Il.huL~Lill, CD40, OX40, OX4Q li~and, and other genetic material m~--Lioned herein, which can be included in the vector assin~le genes or multiple ~enes, or multiple copies of one or more genes.

In ~...t~ .nts of the present invention, for ~AL.--,~'a using vectors ~nd tar~st cells as particularly dosc~ ed herein below, narm81 and n~aliy--d,-L lluman h33matopo:et;c p.~geniL-J- c8113 can be rapidly transducsd with ~f~ic.;_nc;~
ranging from 60'~ to 100'~; the levels of tran~rtinrl and ~ene ~A~ ion that have been ach ~ued are cons;~Je.~d to ru~ru~hnl hi~h ~ric;~.. c-,~, particularly for these taryets.

C~lku~ L:. of thc present invsntion can also produ~e useful rapidity of iun of a ~-_r,~r~ d ~ns. For e.~d.. F' under condi~ions as ~ iric~lly desc,i~ed herein. positivity for ~U~ of the l.an~r~--~J gene has becn obtained in 80~6 to 1 0Q9~ of Ct)34~ cells as well as AML and ALL blasts within 24 hours after exposure to thn vector It has also been found that eo,Lud;...c5-.lzi of ths invention can provide a p~CJ,Ud~dliUII of tranduced cells that produc~, and for e.~a.n, 1: release, the product of the l-..nsrefred gene for at least 7 days at a level propo~iooal to the MOI ~m~ of i"t~-;liOf" usually reckoned in plaqus-formin~ units ~pfu)~cell~ for t:A~II, Ir at MOI in th~ ran~e 0.05-20, e.~. in the case of GM-CSF produced in human primary leukaernic cells by e~ essiu.- o~ the co.~ v, " .~ gene ~-nll~r~ d by e ~H~ .d--L h~-~,u~ l vector.

Acco-. ~yl~, it is seen that a.~ od;.. ,_.-~ of the present i.. ~.. lion enable the production of immuno~ens, e.g. human leukaemis immuno~e.ls, in ca~;e~
whr~re rhe produc2ion of ~,u..~:.pondin~ immuno~3ens has ~ ..L,d lo~istic problems up eo now. ~AIthou~h in the case of leukaemic blasts, ~or ~ , 12 mi~ht be or become ~ to obtain hi~ah levelc of cy~okine production with r~trovirai or adenoviral vectûrs in cer2ain S~JS ~ ~ i t ' ' ~A~ 1~ S of ceils, embod;---~ of the present i..~c...lion have been found to enahle cons;"l~nLI~
~chi~ '' useh~l hi~h P-~ ;UII~ of leukaemic blasts to be transducsd from all paliG~ so far teste~, thus prt.sLr~in~ useful adYanta~e in clinical work.) CA 02234877 l998-04-l5 The present inv~ntion i~ further des~ d below by the help of .,Aall ~'e~
of procedures and products and OT parts of procedures and products ~iven by way of example only snd not of ~ Lali~n~

5The construction of c~Jita~l~ vectors is illustratec non l~ lati~ely by re~erence to the accompanyin~ dna~ , in which:

Fig~-,res 1 to ~ are di~E ~Ills i~lusltalin~ the construction of pl&~l~lids plMMB45, plMMB56, pllAM''~, plMC14, plMR1 snd plMR3, ,t~spe~ ly.
10These vcctors are referred to in the descli~.lion below Fi~ures 7 and 8 show results of transducing cel~s, in accordanc~ Wittl particular ell~tJo li.-l~ of the invention, with ~Jer~ ca 5y 'i '~' h~il.es.~ ,sconstructed as descliLad below.

15The d~ JLiun nf vactors and their construction given below is by way of ~-x~ .'- only. The constn.~ction and prop~,Lias of s~H-d~fecti~re vinis and suitable cG--lple l,~ntin~ cell lines is i--di~l.,d in s~ciricdLiul-s WC~ 92105~63 snd WO g4/21807 ICantsb Pharmaceuticals n~a~ ,h Limited: SC In~lis et al) ~hereby ilIC~ JOIc~t~i by re~ llcej, in r~ e~ter etal, 1992 J. Virol. 66, pp 341 etseq, 20and in CS McLean et al, _1 Infoct Clis 170 l~i994) pp 1100 et ssq. Further, all ~anutic manipulation procsdures can be carrisd out acCGI, ' l~ to s~aodal d e~llo.l~ a~ lu~u-iLl~d in "Mi~.~3c ~ Cloning" A t at~u-dluly Manuat, ecis.
Sambrook, Fntsch and Maniatis, Cold Spring Harbor Lab6rc~lory Press 1 Y8~.

25Delivery o~ the vectors into cells such as haell~ tic stem cell~, and ~n~rdfl~n~aL of cells into 8 p~itient to be treated ll~ , can be c~rried out by ready a~ dL;oll of t~:- I,n;u.l~s per-se well-kno~lvn in the field. For e~alllF~e~
~n~L~ ds as indi~l..d in MK C,~l,li3r et al. Cold Sprin~ Harbor Syrnposi3 in QuanLildl;~e E~iolo5~ vol LIX ~1 g!~4l, pp 691-6~7, or in ...~ur~nce~ cited therein, 30or in MK Bl~.nn~r et al, Lancet 34Z ~6 Nov 1 gg3~ pp 1134-1137, or in r~felt",~es cited therein. can be readily applied and ada~d.

Construotion of gH-d~letnd HSV1 and ~I~-d~leted HSVZ ~ur~ss;ey GM-CSF
The ~H-deleted HSV1 virus and ~I-deleted HSV2 virus are propn~ .l in -the comple~nenling cell lines. Thess cell lines havs been engi.,ac.~d to e..~
th0 HSV-1 ~H ç~en~ or the HS~t-2 S3~ ~ne ,~_,J4c~ ely. Such c~ll iines can be constructed as desL~ib2d in W094~Q5207 and W094121 8Q7 and r.lrer~,nce . cited the-ein. The follo~ section proYides a further dtda~.d~,lion of the constructionof suitable cell linss, and stans with the construtJtion of ccrtain plas~ Js.
Source of virus ~NA:
Where HSV viral DNA i~ retluired, ;t can be made for cxan ~l ~in the case of HSVZ) from 1:he strain HG52 by the method of WallJo~,ne":. and Ter Sch~yget ( 19761 Virolo~y 74, 256-258, or by suit~ble ~h~l;c~ns of that m~thod An elite stock o~ the H~352 strain is kept at the Institute of ~irology, MRC Virolo~3y Unit, Church Street, Glasgow, Scotl8nd, UK. The DNA of other HSV-2 strain~ i5 likely to be very similar in this re~ion, ~nd strains G and MS for exd~"~le can be ol~l ~e-l ~rom the ATCC, Rockville, Maryland, USA.

Construction of Dlaxmid DIMC:05 A 4.8kb Sst-1 f,d~",~r.l eocod;.,~ ths HSV-l ~HFEM) ~ ~ene an~
u~,;.L,.,~... HSV-1 gC~ promoter ~- 3~2 ~o + 11 ) was excised from the plasmid p~rgH (rv,.~aL~- et 8i., Op. cit.), and clonedinto pUC119 (Vieira ~ M~ssing, 1987~ to produce plasmid pUC11 9ç~H. A Not 1 site was introduced into plasmid pUC11gs~H by site-directed m~ anGs;s, 87 bp du~ allualll of the gH stop codon. Thn resultin~ plasmid, plMC03, was used to ~ene,a~e a Not 1-Sst 1 r,~ .nnt which was te~- ~,d snd 1i~3ated into th~ uucaryotic e,~,u,~ n v~ctor pRclCMV ~Invitrogen CGI~JU~l;On~, pre~ with r~Jot 1 and Nru 1 to remove the CMV IE pru~ r. Ths resultin~ ', plMC05, conl. ;,-~ the HS~f-1 gH
2~ gene under th~ k~- .s.,.i~LiG,~al control of the viru~ inducible ~D ~u~u~r snd BGH
~Bavine Growth I llj" "one) poly A. It also co.,~ . ,s the neomycin ~ ance gene for r-~- .ion of G418 ~t:aial~llt stable cell lines.

Construction of ~3H de d ~SV-1 con~ .Li..~ c~ll line The plasmid plMC05 Yvas Uaf~stt:~,k-d into ~Jero ~ATCC no. 88020401~
colls usin~ the calcium pho~ph~te l~,I.n:__e ~S--..bro~k, Frit6ch & A~ . A
LdLGl~oto~ ~r Manual. Cold Spring l-tsrhor Lal~oralo- ~r Press 1~8~. Cell~ were by dilution clonin~ in thn presence of G418 and 8 ctonal ccll line W8~;
k.~ r~ e~Jdr,~;on and ~,ee~ a, c~lls were soeded into 24 well plates and testsd for their ability to support the ~rowth of ~H-neç~ative virus, by infaction with SC1~ ~del)~H ~rorl~aler etal, op. cit~ atO.1pfufcell. Virus p'a~lues were observed 3 days post inf0ction confi--n;n~ e.~ s:-ion of the gH gene.

Construction of 8HIC TK- cell line These cells were produced by l.a-~rf,c~ion of plasmid plMC05 into li~ ,iline kinase ne~dLi~e ~TK-) RHK cells ~ECACC No. 85011423) ;n the sam~ mannar as that ~ iLed for ~H-doleted HSV-1 and ~H-deletcd HSV-2 cu..., ' I~Ghlc~ry cells.

Construction of ~lasmid PIMC08 rl~s,n;d p~ r~4 cr~ ir .q the HSV-2 ~H gene is constructed from two ~djaC~ BamHI rla~ nt~ of HSV-2 ~rain 25766. The plssmids are dc~iyllal~d pTW49, ~,U~ 9 the app---xi,--ately 348~ base pair BamHI R fr~gl"~;"L, and pTW54, corl ,;"~ the appro~dmdlt~ly 3311 base pair BamHI S r,~,~".~,.t. bosh clon~d into the 3amHi sits of pBR322. Equivalent pla ~ i ds can be cloned easilyfrom many available strains or cllnical isolates of HSV-2, The 5' und of the HSV-Z Elene is excised ~rom pTW54 usin~ BsmHI and Kpnl, to produce a 2620 base pair r...ç~ nt which is ~el-purified. The 3' end of the HSV-2 gH ~ene is excised from pTW49 usin~ B~mHI and Sall, to produce a 870 base pair l~ t which is also ~el-purified. Th~ two r.a~ r,u are cloned into pUC1 1 g which had bs~n di~ ed with S~IHI and Kpnl. This plasmid now c~illldil-s the entin3 HS~-2 ~H gene.
Plssmid plr"~o~ COI ~ ~ ~i..9 the HSV-2 [strain 25766~ ~H gene was constructod as follows. Plasmid plMMB24 was ~ 1i~ with Ncol and BstXI and the r-d~ l conr~ .;n~ the central portion of the gH s~ene was purif;ed from an aS~ar~s~ s3el- ~he 5' end of the gene was l~oonsu~cted from two oligonu~ Lid~ C:E39 and CE40 which form a linicin5~ sequence bound~d by ~indlll nnd Ncol sites.
Thu 3' snd of the ~ene was ,~cunsL-ucted from two oligonucleo id~s CE37 and CE38 which form a linking sequence bounded by 8stX1 anct Notl sites.

CE3~ ~i' AGCTTAGTACTGACGAC 3' C:E40 5' CAT13GTCGTCAGTACTA 3' CE37 5' GTGGAt~A{:GCGP.ATA~TCt~CGAGC 3' w o 97/14808 PCT/G ss6/02s76 CE38 5' G G CC G CTC~ C~ Al-rAl-rc G C~ C C A C A A A A 9~

The two oligonu. IL~Lide linksrs 8nd the purified Ncol-BstXI 91t fras~msnt wers cloned in a triple li~ation into Hindlll-Notl di~e~,l d plMC05, thus rsl~lacing ths HSV-l ~H ~7en~ by th~ HSV-2 ~H ~ene. The rssultant pla~ ;J was dGs;~..ated plMC08.

Canstruction of ~H-d~leted HSV-2 cc~mp'~r~eal-3,~r cell line ~CR2~
Th~ plasmid plMC08, cc,. Ia the HSV-2 gH s~Qne under the l~ans~ipLional comrol of the Yirus inducible 9~ promoter and BGH (Bovine (;rowth Horrnone) poly A. It ~Iso contai~s the neomycin ~ a~ce ~ene for .. of G418 ~c si~Ld..t stsbls cell lines. The plasmid plMC08 ~vas ~a"sr~ d into Vero IATC~ no. 88020~01J cQlls usin~ the calcium phosphate l~:chn . e ~Samorook, Fritsch 81 Mahialis~ A L~botd~ Manual Cold Sprin~ Harbor Lab~-t,t4. y Pre~, l 989). Cells wsrs l'e _: ~ by dilution clonin~ in the pfe:~nce of G418 and a clonal c811 iine was Icoln~d r~ e~ans;on and freezin~
these cells, dLD;.Jn~led C~2 cells. wer~ seeded into 24 well plates, and i.~ ,d ~ith the ~3H deleted HSV-1 (SC16 ~dell~H~ at 0.1pfu/cell. ~irus pla~;ues wera obsnrv~d 3 d~ys post infection col~rll~ expression of the ~H gens.
~on$truction of .~e~".bin~t;nn p~asmids a~ plMMB5~;t plr~l~q~5~+ is a ~fector with a lac2 c~ssel~-- flanked by HSV-2 sequsnces from either side of the ~H ~ene. It is mdde8s f~ ws; the two PCR r~ay"~ L . made by oligos M 8g7-M B96 and by oli~os MB57-MB58 are d;~Jle~ with the ,w,.l,iL.Liun anzymes a~ ~-ol-lidL~ ta ~he sites that have been included In the PCR
oliçlonudeotid~s. The ME~97-M89~; ~ra~ment i~ d;~DLud with Hindlll and Hpal.
The MB57-MB58 f,au.,~enl i5t~ i with Hpal and EcoRI These t~d~nsr~ls are then ligated into th~ vnctor pUt:ll9 whioh has been ~ e~ with ~indlll and EcoRI. The resultant pla5mid is called plMhl84~ (Fi~ 1).
The oli5~onu~'~~L'~s used for PCR arn ~hown below-Hindlll MB97: 5' TCGAA~iCrrCAGG~iAGTGGCGCAGC 3' Hpal MB~: 5' TCAB~T~ACG&ACAGCAT~CCAGGTCAAG 3' ~pal M1357: 5' TCAGTT~ACGC~_ I C I Ci I I CC I I IL~:CTTC3' EcoRI
~B58 S' TCAGAATTCGAGCA~I~l ~ATGTTC~AC 3' ~o allow for easy detecli~n of the firs~ slage ~ o~ i.,a-,ts, the E.coli beta-e ~ene, under tl-e control of an SV40 pru...ule:-, jc i~ ed into ~JIM~1D~'15. The SV40 ~ron.ut~. plus beta-~ -~,LI~".~ e ~ene is excised from the10 ~l~s.-l: ' pCH110 (Pharmaci~) usin~ B~mi~l and Tth lll 1. The ends are filled in using the Klenow r-~...en~ of DNA ~olyll.u~d~. The ~ n)e~lL is ~el-purified.
The pl~s.rl' ' pll~ 4$ is ~ st~ with Hpal, ~Jhospl---ld~d with Calf Int~s~ al Alkaline Pl-o~hatase ~CiAPI to abolish self li~ation, and ~el-Purified~ The ~el-purified rr~vmen~ are then li~t~d to~eli-er to produc~ the plasmid plMMB56+
15 ~see Fig 2).

b~ plMMB46 plMMB46 .;o"i -ls sequences flankin~ the HSV-2 ~H ~ene, with a central unis:7ue Hpal sit~. Any ~ene cloned into thls site can be ill3e.led by reco~ rw~i"" into 20 the HS~-2 aenc,~ at the ~H locus. If the Yirus is a TK-n~y~l;is ~ neç~atiYe virus, ~for t~X~lllF~ made .uYin~ ths pl~l~.lG~ li+ plasmid de .cdLed above) then the pl~smid will replacs the 3' end of the TK ~ene, thus ~~u-i--~ TIC activity and ; 'k~ for TK-positive virus.
Th8 twa PCP~ f-dy-ll~,lL~ mad~ by oligos MBg4M810!~ and by oli~os 25 M~57-ME~108 ars di~3Q6tecl with th~ ~u~ tion enzymes a~-u~ to the sitos that have beon included in thc PCR oli~onl-~labtides. The MR~ lB109 fra~ment is dinested with Hindlll and Hpal. The MB57-MB108 ~-d~",en~ is d;5~esL.~.~ with Hpal and EcoRI. The~e r~ a~n ~e. ~1~ are then ligated into the vector pUC 1 ~ 9 which has been diS~ d ~Hith Hindlll and ~cofli. The resultant plasmid i~ c~lled 30 plMMB~S ~see Fi~ 3~. Th~ oli~onucl~otides u~ed are as follows:

Hpal MB57: 5' TCAGrrAACGCCTC I la I I CC I I 1 C,l_~ 1 11; 3' EcoRI
-Wo 97/14808 PCT/GB96/02576 MB1 08: 6' TCAGAA I I C~j I I (~C~iGGA~;CAGt;Ct;TGGA 3' H;ndlll M~g4; 5' TCAAAGCTTATGGCIICICACG~C~GCCAA 3' Hpal MB109: ~' TCAGTTAACT~CACTAGTTTTAATTAATACGTATG 3 ci plMC1 4 Ths plasmid pRc/CMV ~Inv;l~o~en Col~ordliGnl was ~J;dested with the ,.,~lli.,~ion enzymes Nrul, Pvull snd Bsml and a 1 066 bsse pair Nrul-P~rull ~lay,ll~ was i~:n~te~l frorn an a~arose gel. Th~ was cloned into H~al di~este~ plMMBU3 ~sse Fig 4). The resultant is named plMC14.
Tihe pRc/CM\~ rr~ e~,l cu. -~ the c~v~o-d~ us major i~ le¢JiaLt:
early ,~rc,~ er ~CMV-IE p~n~ol~) and the hoYine~rowth hormone ~BGH~ pol'~ A
add.tiol) site. This plasmid, plMC14, is a ~eneral .e~o."~ .~"t plasmid with 1~ uniqu~ sites for the i.. ~ ;on of foreign 3enes which can then be ra_oo,b;,-~Li into an HSV-2 ~-deieted DISC vector.

d) plMR1 The plasmid plMR1 is a rcco~' nc-tion ~,rector for the inse.lion of the murine GM-CSF ~ene. under the control of the CMV-IE plo.l.uL~., into a DISC
HS~-2 Yector. plMC14isrl~e~L~ with Xbal,phospha~ d with CIAP, ~el purified and the o~,l.d"~;.,g ends made flush with IClenow pol~",~l~..e. The murine GM-CSF ~ene is sxcised from the plasmid pGM 3.2FF ~ref~"ed to as pGM:3.2 in Gou~h et at. EMB0 Joumal 4, 6~-6!i3, 1 985l ~or from the equivalent ~JIa~ .i ' constructed as doscribed below;, by a Iwo sta~e procedure. F;rst~ pGM3.2FF i~; di~sted with EcoRI and a 1048 base pair f,~ is gel-purifisd. This (~3me~L is then d;~ d with Hinfl and S~ul. The 4g5 base pair frs~l"ent is gel-purlfied and the ends r~F ~d with Klenow pOIy-l~e.d~6. Thi5 rla~lllent iS then cloned into muiti t:loning 5ite of plMC14, pl~lJdl~:J as d~.wt-L,ed aboYe. The resultin~ plasmid is d~ .,d plMR1 ~see Fi~
An alternative plasmid equivalent tn pGM:~.2, can be construoted as - follow~.
A library of cDNA clones i5 consuucted frorn 8 clone~ T Iy",phocyte line (from a B~LB/c atrain of mouse), such as LB3 lKel~o et al, J Immunol. 132, 293Z, 1984) in which the synthesis of GM-CSF is Inducible by concandvalin A.
The library is s~arcl,t:-l by colony hyl"idisa~io,~ with 8 sequence speci~ic to the murine GM-CSF ~ene ~see Gough et al, EMBCI J, 4, B45, 1985 for s13quence).
A axa~ le of an oligon~J~,13.,L~le usable in this case is 5' TGGATGACAT
G~ CACA TTGAATGA-4G AGGTAGAAGT 3'. Clones o~ oYer 1 kb are pi~ksd snd sequenced to check th~t they are GM-CSF. Thes~ op~ ions can be carried ~ut as ~l~a~liL~J in ~Mol ~ Clonin~3: A Labor.,lu-y Manual~, by Sa".blool~, Fritech and Maniatis, Cold Spring Hart~or. Such an op~r;a~ion res~l~ in a clone ~o~ 'rhe cc-~ GM-C5~ sequence which can be excised with Hin~l and ~tul as de~ ibe.J for pGM3.;2.

e~ pllYlR:~
In the plasmid plMP~1 the open reading frame for thc GM~CSF ~ene is pr~cadod by a shor~ open re;ading frame ~ORF) of 15 base pairs. Reca~~se it is ~ v that this mi~aht i--t~,.f~.re with the e~ aa;;~n of GM-CSF, the pl~s---id plMR1 was altered so that this srnall readin~ ~rame was removed. plMR1 was dl~est~d with Notl and PpuMI. Thc ",~ voctor was ,~ hualJh~ ed with calf intesL;nal alkaline phosph~tasc IC3AP~ and ~el-purified. The sequencss ~ .,r~en the two ..,~ Jn enzyme sites were .~th,_ed by a short piece of double~-20 stranded DNA ~3ene~alecl by ths annealin~ of two oligonu 1~ s CE55 and CE56:

CE~ G&ccGcTcGAAcATGGcccAc~AGAGAAAGGc~AAG
CE56 GACCTTAGCGIIIClClB~l~G~CCATGTTCGAGC
Tho ûli~onuc._alid~ srH constructed so as to have ove-l.t-.-~;.-~ end~
CGIllpP.~ with the l~lotl ancl PpuMI ends 9ene(all:lJ by the di~e~lio.l of plMR1.
The two olieonuclootides ar~ aur~ d, phosPhorylated, and lisâted to the Notl-PpuMI~ ge-~d plNlR1. The resultant vector was de~ n~ plMR3. Th~
sequences in th~ r~lwan~ re~aion are shown below:
plMR1 TTAATACGACTCACTATA~G GAGACCGGAA GCTTGBTACC&AGC~CGGAT

~CA~;:TA~:3TAA CGGC~;~iCCAG T~TGCTGGAA l~:T~iCAGAT A1 CCATCACA

CTGG~ GC~G CTCGAGC~ CATCTAGCCT I l IGACTAt A ~GCCCACt~;
NOtl Short ORF Start Of GM-CSF
AGA GA~AGt;CTAA GGTCCTG
PpuMI

DlMR3 rrAATACt3AC TCACT~T~C;;~; ~;AGACcGGAA Gl; TTGGTACC G~3CTC;GGAT
C~ACTA~;TAA CGGCC~C(:AG T5;TGCTGII;AA rrC:TGCAGAT ATCCATt~ACA

~::TGGCGGCCG CTCGAACATG Gccl::~r~ GAAAGGiCTAA ~iGTl:;CTG
Not I S~srt PpuMI
To make an HSV-1 DISC ~irus eiA~ the GM-CSF protsin, a cl;rtL.-5.. L
set of ~k.~ is rnade:

f) plhJlMB34 This is a racor~ t nalion YeCtOr con; ~ ~in9 sequencOEs rld~ld"~ the HSV-1 gH gene. The IHft S;de flankin~ sequences inactiyate TK 9ene Wh;Ch lleS aJ;a.,6r.t ~C~ the ~H ~ene. The tWO PC;R r~d~ ent made by olisos MB97-MB100 and by O~ OS MB~1-MB58 are d~ d with the .~::.L-i~lion enzymes a~p.u~cli~lG tO the sites that have been included In the PCR oligonuGleotides. The MB97-MB100 r-a~.-)ent is ~;g~L~d with Hindlll and Hpsl. The MBffl-MB58 fla,J.. G.. L is ~;~ested wiSh Hpal and EccRI. ThGse r.~ ~ are then l;~ated into the vector pUt::l 19 which has been ~ JoCt~~1 with Hindlll and EcoRI. Th~ resultant pla-.".id is câlled plMMB34. The oli~onucl~olid~5 u~;ed are as f~lle~l/D

Hindlll MB97: 6' TCGAAGCTTCAG iGAG~GGCGCAGC :~' Hpal MB100 5' TCAGTTAACGGCCAGCATAGCCAGGiTCAAG 3' Hpal MB61: ~' TCAGTTAACAGCC~_u;~ I I&C 1 1 I CC~CTC 8 EcoRI
MB58: 5' TCAGAATTCGAtiCAG~ 1~,~1 CA I ti I I ~AC 3' 81 plMMB55 +
To allow for easy det~cliv~ . of th~ first sta~e recombinants, the E coli beta-u~ du~r gene, under the control of an SV40 p,u.. u~t:- is illPe"~ d into plMMB34. The SV40 ~ llolL. plus beta-~n'~c~osidase gene is excisnd from the plasmid pCH110 (Pharmacia~ using BamHI snd Tth lll 1. The ends are ~illed in usin~ the Klenow rla~",ent of DNA polymerass. Ths i,at~.. ,enl is gel-pllriflsd.
Tho piasmid plMMr334 is din~ e~ with Hpai, ~I)o .~,l...ld~~d with Cal~ l"~e:.li-.al A~ e ~I,os~hatase ICIAP) to abolish sel~ liyation. and ~el-purified. The ~el-putified ~ta~ments are then li~ated t~YLI ,~, to produce the ptasmid plMME~5~i + .

h) plM~ 3 plMME~63 i& made frc~m HSV-1 strain KOS ~m~ DNA. pll~lP,~B~3 c~ i--s sequencos flankin~ the HSV-1 ~H E3ene, with a central unique Hpal site. Any ~ene cloned into this site can be i~l~oll~d by ~ lLillalion intc~ the HSV-1 ~eno...e at the 911 locus. If the virus is a TK-neS~ative virus (for example made 20 usin~ the p3Mr~'R55 + plasmid do~_fibed above~ then thc plasmid will replace the 3' end of the TK gene, thus rt:Sluril~ TIC aetivity and allowing ~ l.r~n for TK-positive vims.
Th0 two PCR tra~ments made by oliE3os MB98-MB63 and by oligos MB61-ME158 are di~ested with the r~_Slri~Liu(l en~ymes a~ JpriaLe to the sites that h~ve 25 been iffcluded in the PCR oli~onu~ id~s~ Ths hln~8 M~IG3 kag,--~"l is ~e~led with Hindlll and Hpal. The MB61-MB58 lla~lllen~ is le~,,e ' wi~h Hpal and EcoRI. Th~tse r~d~l~ln~ arethenligatedintothe vector pUC11~which has been J withHindllland~coRI. Theresul~ntplasmidiscalledplMM863. The di~on~ ide~ussdarsasfolle~.
Hindlll MB98: 5' TCAAAGCTTATGGCTTCGTACCCCTGCCAT3 Hpal MB63: 5' TCA~iTTAACGr~r~CCGIC~lAACCCACG 3' Hpal MB61: 5' T~A(iiTTAACAGCCCC 1~ iC1 ~ I CCCTC 3' EcoRI
MB68: 5' TCAAArr~GAGCAGC~CC~CATGTTCGAC 3' i~ plMX1.0 This plasmid is a ~eneral ~~u~ stion plasmid with unique sites ~or the ~ e-lion of foreiQn gsnes which can then be recombined into an HSV-1 ~H-deleted DISC vector. The piasmid pRc~CMV was 'i~ : ~ with Nru~ and Pvull and a 1066 bp ~aun~enl, which co.. ~~ ~s CMV IE promoter and a polyA si~nal, wasblunt ended with Klenow poiymerase and inserted into the unit7ue Hpal site of ~.las" :~ plMMB63. This plssmid is named plMX1Ø The rnultipls cloning site con~ ~ed between the CMV IE pror..~t~r and the polyA signat is ideal for cloningother ~enes into the plasmici and their s~s~qu~nt introduction into DISC HSV-1 j) plMX3.0 The plasmid plMX3.0 is a ,eco---Li--~,lion vectof for the i--~e. liun of murine GM-CSF, under che control of CMV IE pt~nlGt-,r, into the deleted gH re~iion of type I DISC HSV. This plasmid was constructed by inae~ the rnurine C;M-CSi-ZO which wa~ excised out from plasmid pGM~.2~F ~op. cit.~ with Smal and Dral, into the unique Bsai31 site of plMX1Ø This plasmid, plMX3.Q, is the HSV-1 oquivalent of plMFt3.

Construc~on of ~ dnt vin~s neco.~ sn~ ~irus eh~.~sa;ll~ GM-CSF was made in two stages. In the first stsç~e the ~H ~iene, and part of the TK gene are laijle_~:d by e ~lacZ
~a~s~Uen, cons;s~in~ of the SV40 prc~ ler drivinç~ the E.coli IacZ ~ene. This virus has a TK minus phsnotype and also ~ives blue plaques when ~irown undsr an o~erlay L~ol~ -a the colourigenic substrate X-gal. This 18CO~nl~illalll viruscan now be conveniently used for the insetliun of foreis~n s3enes at ~he ~3H locus.
Genes sre inse. l-:d ;n conjunction ~ith the missin~ part of the TK gene. At thessme tirne the lac2 ~a~etle is removed. ThBse viruses csn be 3el~cL~ d on the basis of a TK-positive phenotype, and a white coiour under X-gal.

WO 97/14808 pcT/Gs96/o2576 a) Construction of first sta~3c reLombinant ~rvith SV4C~1acZ cassE~ttr~ repla._;..g gH.
n~co,-lt;.-dnt virus was constructed by L.~r,~feciL,on of viral l)~lA with the plasmid plMrl~_G~ ~for HSV-2) or plMME355+ ~for Hsv~ Viral DNA is purified on 8 sodium iodide ~r_ " ~t as desc.ibed in WalLoon,e,~ & Ter Scl.eg~et~I976~ Virolo~3y 74, 256-:~513.

Rrwombination is carried l~ut as follows;
a~ First stage A l~a~ u~Lion mix is pr~pared by mixin~ 5~g of virai ONA, 0.5,u~ of 1 0 ~;"~ d ~ld:-l u;J DNA ~1 , 9~ i3Gd by ~ I -J~ ion with the rt;~ ion .~ " ,e Scat~
in Iml of HEE~S buffer tl37mM NaCI, 5mM KCI, 0.7mM Na2~1P04, 5.5m~1 ~lucose, 2~mM 110pss, pH 7.05). 70f~1 of 2M CaCIz is added dropwise, and mixed gently. The medium is removed from a sub-confluent ~icm dish of CRI or CR2 cnll~ ~SJI I ~ .ressin,J Yero cells) and 500~1 of the l,~.~r~.,~,on mix is added to uach o~ two dishss. The cells are inCllh~t~ t 37~C for 40 minutes, when 4ml of growth modium cor,t ' ~ 59~ foetsl calf serum (FCS) are added. 4 hours after addinç~ the t,ansfecL;ou mix, the medium is ,-:---ov- ' snd the cells washed with serum-free medium. The cells are then 'sl~ 6d' with 500~1 per dish of 15% ~Iyoerol fur 2 minutes. The glycerol is !emowd, the cells washed twics with s~rum-free medium snd ~rowth medium containing ~5% Ff'S i~ added.
A~ter ~7 days, when a full viral c~t~u~ c effect ~CPE) is obs~ d, the cells are s~ dd into the rncdium, spun down at 2500rpm for 5 minutes at 4~C, and rss~ ndad in I ~O~l of Eagles minimal es~ dl rnodium IEMEM~ . rhis i5 now a crude virus stock cc..l~;l- .~ wild-type and ~eco~. t na..L viru~. The stock :25 is froznn, thawed an~ so.);.,c-L~d snd sc~ent;d for r~lcQslll~ina~ on CRI cells at rsn~e of dilutions. The m~dium cu.: ,~ 1 O,u~lml of acyclovir, to select for TK-minus virus. Aft~r addiLion of the virus dilution~. the cells are overlaid with medium co-~ I % low-~elling i~ ldL~lre agdros~. After the a,~-pea-tlnce of viral pl-~ues at about 3 days, a s0cond overlay of ~y~,.use contai-.;,-g 330/~/ml of X~3al as wcll as 10~1ml acyclovir, i5 sdded. Blue plaque6 are pick~d, within 48 hour~i. and tl d. I.-r~ d t~ ~4-well dishes ~1 cm2 per w011~ cor. - .-~ CR 1 cclls.
The p~ ueC are allowed to ~3row to full CPE and harves~ed by scrapin~ into thn m0dium Multiple rounds ot plaque-p~-iri~ation are carri~d out until a pure stock o~ vinus ls ot~ d.

wo 97/l 4808 pcT/Gs96lo2576 The structure of tha first ~ta~e rscon,b;.,d.~ is corfir,.,ed as ~ollow~.
Sodium iodids purified viral DNA i5 pre~Jdl~-l as b0for~, snd (~i~ested with BamHI.
This digest is s~p~la~ud on an a~arose gel and transr6r-~d to a nylon membrane.
- This is probed with a radiol~b~ 'l~ DNA f-- 5l,.~,nt hom~l~gcuc to the sequences either &ide of the ~H ~en~.

b) Second st~ge.
G~ iridLi~rl is carried out as before usin~ ~rir~l DNA from the first sta~e r~ CG~ IL~ and the plasmid plMR~ ~for HSV-21 or plMX3.0 ~for HSV-1). After the initial harvest of virus, ~K PG ~ Y~ recombinanr viruses are ~ ' by ~rowth on BHK ~H-positivc TK-ne~ative cells, in the pr~s~n..e of 0.6~M
lrLl~dlt:, 15,uM Tl-t~ lin~, 9.5,ul~ Qlycine, 4.~iuM Adenosine and 4.7~uM
Gl-d- IOS;~ . Three rounds of this ~e! ~ n are carried out in 6-Hrall dishes (1 Ocm2 per w~:ll). At each stags the i-~ od cells are harvested ~y s~ into the medium, ~.;.,n ng dawn and resus~ in 200~1 of EMEM. After s-J--iGdlion, 5~1 of this is added to fresh BHK ~H-positive TK-ne~ative cells, and the ~ jGn continu~d.
After the final ~e~e~t~n the virus i..r~ d cells are harvested as b~fore and sclooned on gH-deleted HS~/1 C~ G~ e~ cells. Overtays are added as beft~re and whit~ plaques are s o luc tcd in the 1,. L:.l5nl,~ of X~al. Plaques are pickud as before and plaque-purified three times on said ~H-deleted HSV1 CG~IIF'~ cell~.
The structure of the viral DNA is analyssd as before.

~31vl-CSF assay Cos 1 cells ~ECACC No. 88C~31701) are Ir;~n~t~ d with plasmid DNA
using DEAE dextran as d~ ~iLad in Gene Transfer and Es~ulo;.siou, A l~bora~ory Manual, Michael Krie~ler. Su~ ern~l~.nts from ~ re~.~d Cos 1 cells or i-lfe-,t~dCR2 cells are s~ aAad for ~;M-C:SF acffvity ~y b ~3~SSd~. An IL-3~GM-C;SF
~ ;ve murine 1l3~ alOpO;_ti~; cell line d~ lad C2GM was ol~l~ined from Dr. E. Spo~ ce,~, Pd~ Instituta for Cancer r.~ l., Christie Hospital, UK.
The ce~l line C2t;M is m~ a~ d in ~i~ch~.~ rnsdia with 20% hor~e serum, ~S6 glutamine and 10~6 conditioned cell media. The conditioned cell media is aL~dil,ed from ex~-ol-d.~lially ~rowin~ culturas ~f Wehi 3L cells ~ECACC No.

86013003) which secrete murine IL-3 into the media. Wehi 3b cnlls are ."~ ~t- ~edinRPMI 1640media, 1096 FcSand 1% glutsmine.

~he above de~ .lion particularly ensbles oonstruction of HSV- 1 snd HSV-2 mutants which are ~H-negative and Which expruss GM-C:SF, etc.
The skilled pt~rson can readily sdapt the present t~301 1;~ ~5a to t~e dld~ of other mutant virus~s which sre defective in re~pect of a first ~ene oss~n~isl for the production of i..re ~ious virus, such that tha virus can infect normal cells and undsrgo raF"~ ~tion and e,.y,.;~ n of viral anti~en in these cell~
10 but cannot produc~ named i~r~-Li~us virus and which also ~ 5~ a l.t,l~.,Jla~a ~ nu-'~lida sequence which t~ncodes an immu"o,--odulating protein or other g0netic material as n,t:,-liul-~J herein.
Many other mutant viruses c~n b~ made on the basis of d41et;u.- or other inactivation ~for exannple) of the f~ ;..9 ess6nlial ~enes in the following viruses 15 and virus types;-ln herpes simPIex viruses, ~ --lidl Renes such as ~B, ~D, ~L, ICP~, ICP8 and/or ICP27 can be d~leted or o~ inactivated as well es or inste~d of the ~H gen~ used in the above ~dl F' s~ In other he.pesvi,us, knov~rn ~ Lifil ~enes, sLIch as any known t;L ~ hG~lt;lOa 1~5 ta the ~B, ~D, gL, ~H, I~P4, 20 ICP8 and/or ICP27 genes of HSV, can be ~ L~ for dul~itsn or other inactivation. C~ e~alovirus can e.g. be ~etleti-.dlly di~ by d~lt C-~n or r~ e ac~ivatin~ ~3ene~ Joll ' 'e for ~e-nye;-al-lro ~ ~sili~.e mutations, for cxample as idcnlirJdblc from Dion et al, Vi~rolo~y 15811987) 228-230.

25 Use of the vector3 for tr~n~dlwt'7~ of celk:
A procedure which c~n be ada~.t 3d to the production of a number of useful eJct.r"ptes accoo~i..g to the present invention i~ as follows.
A .~.,o-- ' ~a--t HSV-2 ~irus with a ~c' ~ir ~ in the ç~H ~ene, and Oa~lyi~l9 at the locus of thR delete~ ysne a f~ liondl copy of the cho~en ~3ene, 30 constructed as de.. c-iLed above, is cultured as daDG~ d and stocks are prep.. -~d with a titra of d~pr~ ateiy 10~8 pfuJml.
To carry out the tran~duction procedure on leukemia cells, blood Sdlll, '~5 ar~ obtained from leukaemia palien~ and cell8 are isolated li-ereI-o~.. by densi~
S~ t centrifu~ation. in all~fl.ali~re embodi,--an~, cell line~ can be derived from cancr r pauents by biopsy or Oll~ e and can be used directly ~r following culture in vitro. Cells from pdLi~--L~ With solid tumours can be obtained followin~
surgical removal of the tumour or of mel~ , or from biop6y material from the tumour or ~ Tumour 1; ;~ _ or ro se-l~d ,--alari~-l can be used to preparo sinç~le cell ~u~ensions either by ~echb.. ~ ' or enz~mic disa~ure~ation or by other well known n~ell.o~ls.
I~,fe~ n/transduction c~ tumour cells or cell lines with the ~cGIllb;.)al~L
de~ective HSV v~ctor Od~ a ~ene of choice le.g.~ M-CSF) can be carried out in vitro by ~ i--g aliquots of a sin~le-cell s~.s~ siun into suit~bl~3 tissue culture vessels such as 2~well plates orftasks. A suitabln cell conce.. l,aliorl can be 0.5 ~o 2 0x10~i cellslwell in 1 or 2 ml of medi~m. Virus can then be ~dded at a multiplicity of In~eclio~ for eA~..., ' in the ran~e 0.01-20, for ur.t~ le 0.05 to 0.1 pfu/cell, or up to 1 or up to about 5 pfu~csll, and the culture is incubsted for 2 h ~o allow the virus to enter ~he cell. Excess virus is then ~lall~ away in 15 s~ d~lel. The cells can be used for immu,-uU-~-u~autic and ather purpo~ns as ~-- .lion~d herein either directly or E~fter culture in fresh medium for varyinS~ len~ths of time, e.~. for up to 1 to 7 days. For test purposes, as in the te~it e~eri...~n~s described below, cultur~ was cs!ried out for ~ to 7 days ~ of the cells ;ntec~d by the virus vector can be t:~a~ nd for 2~ 0~r~sbn of the h~te. e~ us ~ene carried within the virus vector. For ~xsmple, ceils inf~ d with a Ihl::OI~ll'li. .ant der~ iY~ HSV vector co..t~ thn lac 2 ~ene can be tested for the ~ ,e of ~-~a~ct~d~c activity eithcr by UsinQ an Libs~ or antiserum pncpa(dLion directed a~ainst B ~ d~t~, or by usin~3 â ~ Ja l - L~ substrate 5e.~. Fiwrepo~k:~ ~TMI) which upon cleava~q by ~-l3diaclo~ la~ ~ives a flUG.~,~c~.. l pruduct. The fluo.- SL~ product or antibody can then be d~ ,L~d by fluG........ scenca e u ~ or by flow cytometry. ~he proponian l~6) of cells showing fluo-. .~-~ce, i" ' ~' s the ~- u~u- Li.Jn ex~re~;"g the ~ene produt:t and can be ~ J'~tnd from the results of the dete~Lion step.

T-_ ' ' n und ~ . s;~n of lacz In m~llgnsnt and narmsl colls:
A s~ ''P test system to te~t and illustrate the effec~iveness of - transduction in accordance wi~h the present invention. usin~ a r~uo--,~;"d"t virus vector, is as ~ollows, and c~n be ~ d to other exan, ' of h~.l es~ s vector. The vcctor used in the test desc. iL ed here co..L.;..s a lacz repo. I~r gen~:

Wo 97/14808 PCT/GB96/02576 g~ r "y a different Yector having a ~eno encodin~ an immunornodula~ory protein ar oth~r prot~in, ar other genetic ~ dal as ~,8nliune.l hurein, in place o~ the reporter ~ene lar in addition to it) is used in the p....;Lc6 of the ;nvention.
A lac~ deleted HSV mutant wa~ construcled as dea~;l iLad herein above, with r~fer~nce to the 'first st~a' mutant virus. This fir5t 5taç~e in the production of thn vector cort.Jin;l)g the ~ene for the immunomodutatory protein Is a s~ ' 'g test vector used in the test pr~cedure d6 ibed below. Alternatively, such mutants can alsD b~ constructed as dc~c.ib~d in specifi~ali~n W0 94~!1807, cG~ Jing with th~ 'first sta~e' .~.,~s.. ' ' ~a.~L m6.-l10nad in W0 g4f~1807,constnuction of which is des~,nl~dd on paga 28 line 28 to pagu 29 line 2B with a~aor,;aL~d des~ .lion Ihereb~ incor~,oraLe~ by ,~rurence~. The lacZ ~ene is used h~re ~ a tsst and rnarker gene. Usin~ tho l~chr~ ues dea- l iLed he-ein an~ in th~
mantioned speoiricdlions, other useful genes csn readily be i---.ts-~Jurated in the plac~ of the lacz or as well as the lacz çlene.
The ability of the r~cG.n~,riat)t der~ iv~ HSV Yirus vector H5V-lac Z to induce e,.~,r-,J;.i- n o~ thc 13 ~t,la~o~idase marker ~ene has been studbd by way o~ al~ P in the followin~ dir~e-e-)l tumour cell types:-A: Two in~lepen~..l ccll line~ derived from acute Iymphol~la~Li.
leul~ae--,ias IALL); IAD and RS human prs-~leukaemie cell lines ''~ hed at St Jude Children's Res_ ~,I- llospital, 1~ TN from clinical samp!es and cult~red in RPMI 1~40 ~r'-u l-ill~ker) SL'~ ont8d with 10% FC5 (Bicwi.iu~ker, Walh~la~i", MD), 1001U/ml peni~ " ~ and 100mu-glml strsptomycin ~; ..I-i ' ~, snd 2 mmol/l L-~lutamine~l;
Z5 B: Three i--d n.i~ cell lin~s derived from na-~o~la~lu--,a IN9);
C; Primary cells freshly isol0ted from four p~Lit -lla with ALL;
C): Primary cells derived from three pdlit~--la with acute leukaemia ~AML~; and E: Primary cells derived from two pt~Lidn-s with NB.
LPL' lljC~ blast cells were isolat~d from pa~i~-,la with >80% blsst c~lls by Ficoll s~Ji...r,a~alion a~ pe.;~heral blood or bone marrow mononuclear cells.My~ kl~s~ can be m~ t ~ J in liquid cultùre in RPMI supplern~"lud as above lBiowllilLcll;~r). Lymphoblasts c3n be r~ d in tiquid culture or wher~

..~c~s~ r on allo~eneic skin fibrobl~sts as stromal support.

Cnll lines or freshly isolated cells, r~epectiYely, Yvere platsd out as single cell SUS~el)S;U11:3 in 24 well plates at 5 x 10~5 to ~ x 10~6 cellsfwell in 1 or 2m~
af mQ~ium. Th~ recombinant de~ctive HSV virus vector HSY-lac Z was added at a multiplicity of 0.05 to 0. l pfuJcell and cultures were incu~ated at 37 de~ C
for 2h. Excess virus W~8 removed, ~resh medium sdded anc~ the cultures incubated at 37 de~ C for varying lengths of time. Successful transfection was d6L..n- ~ed by flow cytometry, and meas--- ~-enL~ were made on days 2 and 7 after i~lfe~lion~ The ;-~ d cells were stained ~x~ai and :.ldnds J fl~oroc~r~"e and cl.ecl~ed for production of lacz.
The (~ reeults were o~~ For both of the ALL cell lines, transdnction erri~;~...;y for the B-a~ ~e~osi~ gsnE~ carrie~ by the vector was 100~ on both days 2 and 7.
Of th~ primary ALL cell san. two wcre 100% po:.ili~o for ~la ;~o~id~ ~a e. pr ,~sion and th0 other two showed more than 80% tran~uction ~rr --~nc~ on day 2. ~These cells do not survive in culturc ~n the al~s~". ~ of stroma, an~ hencz~ tiley could not be tested at day 7.1 Two of the thr~e primary AML sao. ~ ~I-ow~d tran~duction efficiencies of more than 80%; these fi~ures in-_~oas~d further ~y day 7.
The third sample :-hov:~d a sornewhat lower er~ (42~6 on da~ 2 and 54% on day 7).
On day 2, ths three NB cell lines gave 25%, 72% and 74% tran~duction _rri~;anci6s rL;.~.e~ sly, while the two primar~ N~3 cell san ~1 5 ~ LOd 65% andlW% tran~d~ctinn.
These results demu. .~ L~ high capacity of the . ~,_o- ~al~t cJ~rt:~Li~a HSV
vector for transduction of the he~._.ol~!~ous ~ene into cells which previouely proved difficult to transduce by other means. For ALL snd AML. retro~rirus transduction requires the ~eneration of cell lines, and ev0n then, the ~ri-_;ar,cy of ~ene ud~sfol has ~ene. 'Iy been found to be very low j C 5~). Fresh cells or cell lines derived from A' I and AML arc co,.iid~lad to ~e e~ ly r..~i$l~L to ~d~.~~uJilus tranr~llnt~or~, The ~ecombin~nt defactive HSV vector has also shown a surprisingly hiQh capacisy for transduction of fresh NB cells end NB ce31 lines. The transduction ;

efficiency for two of the thre~ INB c811 lines was ~ 70~, and for ths frssh isolatss it was 65% and 1S)0% respectively.
These resuits are summansed as follows:-Oay 2 ~ay 7 Cell type %positive %via~le Xposit1ve %~iable ALL cell line - ADlG0 30 100 5S
A~L cell line - RS100 31 1~0 53 Fresh ALL - Lr 100 77 Fresh ALL - SP 100 81 Fresh ALL BR 91 87 Fresh ALL RU 85 100 Fresh AML - RE 80 ~0 95 40 Fresh AML - 8A 86 62 86 91 Fresh AML - TE 42 90 54 20 N~ l i ne - MC 72 lQ~
N~ cell l~ne JF 74 10D
NB cell line - Nlt~5 100 Fresh NB - RE 55 100 Fresh NB - HI 100 ND
Transduction and ~ ression of lac in primary bone l~dllUcells was carried ous as follows:
Bone marrow was ~JLi Icd from n~ro normal donors. The mononu~lear ~rsction ~y Ficoll sed;.~ Lion~ was pass{~d down en anti-CD34 column z5 (Cellpro, Seattle, WA~ ta enrich tho CD34~ ~ ersi~r celt popu'~tion. Thesec~lls were then a~l o~ 1 to the lacz-anccs.Ji"~ ' ' ' herp~svirus ~J-s,.-~ ed above at a numb~r of ~3;rture,.l mulLil,liui~i.3s of i"rt:~lion ~101), ranging from 0.0~-20 ~p~ulcell~. After 2 hours F~Yrosure, the cells w~re divided into two portlons and could be ~ i,.L~ ed ~ither in stromal support cultures or in culture :~0 with C~ a5 as ,--~"Liu"~d below. The strom~l support cultures with 8x1 0~5~sq.cm of surFace area were e~ldl~ hod in Fisher's medium (Life Technclo~i~Q. Grsnd Island, NY), with 15% horse ~erum and 5% fetal calf serum lFCS: Summi~ u~ v~r~ Ft Collins, C0), 1x10~-6 moUI ~ydrocG-Li~c,re ~Abbott, Chica~o, 111.), lt}A-4 molll ~ne~a~ulu~Ll,Dnol ~Si~ma, St Louis, M01 and ~15 400 mu-llml l.~.. ,.r~ Life T~cl~rlc,., ~s). Cells w~re cultured in :Z5-ml tissue culture flasks (Nunc, Roskilde, DK~ at 37 de~.C. Evury 2 weeks half of th~ spent medium was leplaced by fr~sh medium until the stromal layer was fully hli~hed. Stromal cells were then t:)" '~yad as feeder layers and r~,~aa~ed with transduced C~34+ cell~ obtained as described above. An alk~ ve culture methodl for a portion ot ~he transduced cells is to grow them in liquid rnedia ~l~rr'9 ~-o~-ted with foetal bovine serum, IL3 and stem cell factor. The other of the ~olLions was rnixffd in methylcell ~Inse and ~rown in tissue culture dishes at a density of 1 0~5Jml.

After ~, 7 and 14 days, cells from the liquid culture wer~ snalyzed by flow 10 c)Lo.. -eLI~ tusin~ the Fluoreporter systeml~ while cells from the ~n~l~,t'es"~l:s~
plates were e,cc." ~ed by x-~al stainin~ of individual colonies and by fluG~ ce flow c~lu~ tly!. In the fluol~aut lu.~ studies, all cells were dual stained with the FIUG.LPGI L~r reagcnt and with fluore~cent anti-~:D34 antibody, Thc results :.howed that 3~100% of CD34+ cells were positive for the marker ~ene, with the p. up~- .ion of positive cMlls inc~a~ as the M01 feds~J. By day 14, a snnaller pn~p~s. Ii--. . o~ the cells and c 1~ ~ were posib'Ye t2-5Q% ~, impiyin~ th~t ex,~ . 5 ~ iC :~ of the L- d~ ~rn- ~ ~d ~ene was L ~ t in Dome ceUa. Since cells and individual c.l in so.n;s,,' ' ~ .;lh~ s ) cultures were also positiYe, while the methylcellulose itself is flu~.c_cen-_~ ne~ative, th~
siQnal ~lel~ d is not du~ to ~CIldl~ of protein frorn transdlJced ~ell~ to non-tran~iuc0d cell~, but ~eprea~l . hiçlhly ~tric;~.-l trar sduction of norrnal haLn,a~ tiG ~)fO~ i h~r cells, in the al~se. .- ~ of any growth stimulstory si~nals.
In further teb-ts, it was found that high-efficiency of e~ aDiun was OLLa;ll~t'~at for t:.~Cdll~l_'9 48 hours after transduction, r~ach;n~ a peak by about 24 tO 48 hours.
The methods dasc~ibed above for transduction and e~ resaiun of lacz are readily sda~JLable to the e,~ b~;on of odler desired pr~e ~s and ~enetic ~
by thc use of dl~ virus vector~ c~-.ri.lg ccfrt~ ,on-Jing other ~enetic materi~l in place of lacz a~ de~c~il,ed above.
~o ... - ' of l;M-CSF by ~ector-~ ~ns~c . ~ humnn ALL and other c~lls:
Dsta have baen obtained, ~ in~ that an ea~.~ F~E of a di~h!~3~
herpesviral vector csrryin~ 8 ~ene ~ncoJi.,~ a cytokine (GM-CSF) I~H-~ ~nt HSV vector encoding GM-CSF), constructEd ~ d~scnL,~J above, can induce CA 02234877 l998-04-l5 4~
proriu~ tion of the encoded cytokine in transduced cells of human acute Iy,llphocytic leukaemis ~ALL~, as well ~s in murine l-yu"~h~lastic leukaemia ~MLL~
and human neu.oblsc~",a cell lines.
Gell lines were transduced in ;ll~n~la~d manner, and at day~ 1. 3 and 7 af~er trar~duction, thsy were testcd for GNI-CSF sec,~iun by a co~ lly-available imm~--oa~5~y (C~d~GIIh Figure 7 shows bar chsrts e~JIL~ results of tests for GM-CSF ~ ~ ~retio.. by dirrt~ t transduced cell ~ines at dirrt - e-nL MC~I
Imultiplicity of i..reclion: ratio of viral pfu to cell count). The contiguous bar~ in nach set of three re~er to the production at 1, 3 and 7 days res~~LLi-tely under tO a ~iven in~ ~at~d set of .,onJilio"s Icell type, MOI~. The vertical axis i.-d;c~,t~s scale of GM-CSF prorluctiort pcr ~x10-5 cell~ per 24 hours.
''~cr.,~ian has been seen to occur for at least 7 days, and the result~
appcar not to bs due mQrel~ to ~f~i .L~.nc~ of pro~ein e..~ a~ed earlier. Low m~ lie5 of i~r~:tiun (e.~3. in the ranS~a from about 0.05 to about 1, 5 or lO~
can thus be ~rec~ for human tumour cells. Mouse tumour cells, u~ed tor comparison, were about 2~old less readily tran~uc~d than human colls.

Ea~ Cn of GM-CSF by CD34~ prlmaly bone ~ C11ll8:
Rgure 8 is a FACS plot sllov~ing the result of a succes5ful tran~dur,tion o~
CD34 ~ primary bonn marrow cells Ihaematcp :' ~ p, u~nilor cells) from a norrnai adult human souurce.
8One marrow cells wer~ ~,a..~ul,.,ed usin~ the d;__h'r~ herpesviral vector c0rying a gune ahcc,din~ a cy ~u~ 3 ~GM-CSQ I~H-d~ 'e Ld. Il. HSY vec~or e. ~~.odin~
GM-CSF~. The cells were purified in ~La"-ld--J manner by C~34 selsction and :~!5 stained in ~u~nda~ manner ~w CD~4 antigen. In a similar way, other CD34+cells, e.s~. thosa sl.o~i.;"~ In~ ,3ri.."Lp.u~.~ies, can betransduc0d and ~ ert~r used, e ~. reinfused as immu--OQeni~ era~,eutic vaccine into thc p~tient from whom tile ~ cells were derivrld, or use~ in-VitrQ/ex-vivo to prim~ or stimulate l~y,n~l,G~l~tes.
The ex~ s and er.,bod;.,~ents describ4d herein are for illuslrdli.JI. and not lirnitation: vsriations and ."o.liri..~Liol1s will be ~,up~-~nl in the li~ht of this dl,_u.i~lion to pe~sons skilled in the field, and are included within the scope of the inven~io.,. This dio~ ellre and invention extend to CorY~ a~iGI-~ and -subcom~inaLiunsofthefeatur~slne~ u~ andthe present~i~rlosllreincludes thu documentscited herein, which are herebyincorporated byreference.

Claims (20)

CLAIMS:

1. Use of a recombinant herpesviral vector which is an attenuated or replication-defective and non-transforming mutant herpesvirus, and which carriesheterologous genetic material, in the manufacture of a preparation for transducing human or non-human animal cells selected from: haematopoietic cells, malignant cells related to blood cells, and malignant or non malignant CD34+ cells.

2. Use according to claim 1, wherein the heterologous genetic material comprises a gene encoding an immunomodulatory protein or other gene product useful in tumour therapy, immunotherapy or gene therapy.

3. Use according to claim 1 or 2 wherein said human or non-human animal cells are selected from: cells that (prior to transduction) have not been incubated at all under cell culture conditions. cells that have not been thus incubated for more than about 2 hours, cells that have not been thus incubated for more than about 4 hours, and cells that have not been thus incubated as long as overnight,e.g. freshly-sampled tumour cells.

4. Use according to claim 1, 2 or 3 wherein the resulting transduced cells are subjected to a further step selected from (a) reinfusion of said cells into the subject from whom the parent cells were obtained, and (b) reaction of said cellswith leukocytes in vitro.

5. Use according to any of claims 1 to 4 wherein said human or non-human animal cells are treated ex-vivo and wherein said transduction is carried out with an efficiency of at least 42%.

6. Use according to claim 5 wherein said human or non-human animal cells are treated ex-vivo and wherein said transduction is carried out with an efficiency of at least 65%.

7. Use according to claim 6 wherein said human or non-human animal cells are treated ex-vivo and wherein said transduction is carried out with an efficiency of more than 80%.

8. Use according to any of claims 1 to 7 wherein said human or non-human animal cells are treated ex-vivo and said transduction step (b) is carried out at a multiplicity of infection (MOI) of from 0.05 to 20.

9. Use according to any of claims 1 to 8, wherein said replication defective mutant virus is a mutant virus whose genome is defective in respect of a gene essential for the production of infectious virus, such that said gene has been deleted and the virus can infect normal host cells and undergo replication and expression of viral genes in such cells but cannot produce infectious virus.

10. Use according to claim 9, wherein said gene that is essential for the production of infectious virus has been deleted and and said gene encoding a heterologous protein is inserted into the genome of the mutant virus at the locus of the deleted essential gene.

11. Use according to any of claims 1 to 10 wherein said viral vector is a mutant of HSV.

12. Use according to any of claims 1 to 11, of a recombinant herpesviral vector which is an attenuated or replication-defective and non-transforming mutant herpesvirus, and which carries heterologous genetic material comprising a gene encoding a immunomodulatory protein selected from cytokines and immunological co-stimulatory molecules and chemo attractants, in the manufacture of a preparation for transducing human or non-human animal cells selected from: haematopoietic cells, malignant cells related to blood cells, andmalignant or non malignant CD34+ cells of human or non-human animal origin to introduce a heterologous gene into said cells to render said cells more highly immunogenic.

13. Use according to any of claims 1 to 12, wherein the viral vector encodes a gene encoding a heterologous immunomodulatory protein selected from cytokines. immunological co-stimulatory molecules, and immunological chemo-attractants.

14. Use according to claim 13, wherein the viral vector used to transduce said cells is a vector encoding a cytokine selected from GMCSF, IL2. IL12, CD40L, B7.1 and lymphotactin.

15. Use of cells which have been transduced by a process according to any of claims 1 to 14, for activating and/or expanding cytotoxic T cells by exposingT cells to said transduced cells.

16. Use according to claim 15, wherein the transduced cells are malignant cells, and/or CD34+ cells.

17. A pharmaceutical composition for use in transducing human or non-human animal cells selected from: haematopoietic cells: comprising cells related to blood cells; and malignant or non-malignant CD34+ cells; comprising a recombinant herpesviral vector which is an attenuated or replication-defective and non-transforming mutant herpesvirus, and which carries heterologous genetic material e.g. a gene encoding a heterologous protein.

18. A pharmaceutical preparation comprising human or non-human animal cells selected from: haematopoietic cells; malignant cells related to blood cells; andmalignant or non- malignant CD34+ cells; said cells having been infected with a recombinant herpesviral vector which is an attenuated or replication-defectiveand non-transforming mutant herpesvirus, and which carries heterologous genetic material. e.g. a gene encoding a heterologous protein.

19. Use of a composition according to claim 17 or to claim 18 in the manufacture of a medicament for use in treating a subject which is a human subject or a non-human animal subject in order to achieve expression of a foreign gene in vivo.

20. Use of a composition according to claim 18 in the manufacture of a medicament for use in treating a subject which is a human subject or a non human animal subject in order to elicit an immune response.