RU2621861C1 - RECOMBINANT STRAIN OF VV-GMCSF-S-Lact VACCINIA VIRUS, WITH ONCOLYTIC ACTIVITY, PRODUCING GRANULOCYTOR-MACROPHAGAL COLONY-STIMULATING HUMAN FACTOR AND SECRETED FORM OF LACTAPTIN ONCOTOXIC PROTEIN - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: characterised recombinant strain VV-GMCSF-S-Lact is constructed on the basis of the vaccinia virus L-IVP strain, containing deletions of fragments of viral thymidine kinase and growth factor genes with integrated granulocyte-macrophagal colony-stimulating factor (GM-CSF) with structure corresponding to human GM-CSF matrix RNA cDNA in the central part of the viral thymidine kinase gene; and the secreted S-Lact lactaptin gene, encoding a human cappase-casein fragment of 23-134 a.o. with "stitching" to its N-terminus of the GM-CSF signal peptide (MWLQSLLLLGTVACSIS), in the left end region of the viral genome. The human GM-CSF gene is expressed under the control of the natural promoter P7.5k of the vaccinia virus and produces the secreted form of a biologically active human GM-CSF in mammalian cells. The S-Lact gene is expressed under the control of the synthetic VACV promoter P7.5synth and produces the secreted oncotoxic protein lactaptin.

EFFECT: strain has targeted oncolytic activity against human breast cancer cells in vitro and in vivo and is deposited in SVC of viral infections pathogens and rickettsiosis of FBIS SSC VB Vector under the number V-690.

6 dwg, 1 tbl, 5 ex

Description

The invention relates to a recombinant strain of smallpox vaccine virus (VACV), producing secreted granulocyte-macrophage colony stimulating factor (GM-CSF) human and oncotoxic protein lactaptin and having oncolytic activity against human tumors, and can be used in biotechnology, in particular in genetic engineering for the development of new-generation drugs for the fight against cancer, in particular breast cancer.

The adjuvant properties of GM-CSF are well known and widely used in the development of various protective and therapeutic vaccines (Weisbart, 1985; Fleischmann, 1986; Gaudernack, 1999; Warren, 2000; Morrissey, 1987; Yoon, 2006; Somasundaram, 2015 [1-7] ) GM-CSF effectively stimulates the antitumor immune response in combination with cell, viral and DNA vaccine preparations (Somasundaram, 2015; Lai, 2011; Hellerstein, 2012; Zhang, 2015; Chen, 2014; Fowler, 2012; Zheng, 2011 [7- 13]). It has been shown that GM-CSF enhances the induction of the primary immune response due to the activation and recruitment (chemo-attraction) of antigen-presenting cells (Weisbart, 1985; Fleischmann, 1986 [1-2]). GM-CSF enhances T-cell proliferation and induces the production of both Th1 and Th2 (Morrissey, 1987; Yoon, 2006 [5-6]). GM-CSF works as a genetic adjuvant when the cytokine and antigen are co-introduced into the cell and increase the protective immune response by 25-71% (Somasundaram, 2015; Wang, 2009; Hartoonian, 2009; Encke, 2006 [7, 14-16]) .

The GM-CSF gene is widely used as a transgene in the construction of recombinant oncolytic viruses (Kochneva, 2012 [17]). In particular, the human GM-CSF gene was integrated into the genome of two VACV strains: WR (JX-963) (Thorne, 2007 [18]) and Wyeth (JX-594) (Kirn, 2010 [19]) in the region of the viral thymidine kinase gene (tk gene) under the control of the synthetic early-late VACV promoter (Merchlinsky, 1997 [20]). These strains are currently successfully undergoing clinical trials as antitumor drugs (Breitbach, 2011 [21]).

Based on the Russian VACV strain L-IVP (GenBank KP233807), we constructed a recombinant strain VV-GMCSF-S1 / 3 containing the insertion of the human GM-CSF gene in the central part of the tk gene with its simultaneous inactivation (Kochneva, 2015 [22]). The GM-CSF gene in the recombinant is expressed under the control of the natural VACV P7.5K promoter and produces a secreted form of biologically active human GM-CSF in mammalian cells at a level of 1–40 μg per ml of culture medium (Grazhdantseva, 2015 [23]).

We used the strain VV-GMCSF-S1 / 3 as a recipient for introducing an additional lactaptin transgene into the region of deletion of another VACV virulence factor gene, the virus growth factor (VGF) gene. It was shown that the combined suppression of thymidine kinase and growth factor VACV genes leads to an almost complete absence of virus replication in non-dividing cells (McCart, 2007 [24]). Lactaptin is a fragment of kappa-casein of human milk (23-134 aa), which specifically induces the death of human breast cancer cells in vitro and in vivo (Koval, 2014 [25]). The incorporation of the lactaptin gene as a transgene into the region of deletion of the VGF gene promotes both additional attenuation (attenuation) of the virus in relation to normal cells and an increase in its lytic (cytotoxic) activity in relation to breast cancer cells.

This application for the invention describes a modified form of lactaptine (S-Lact) containing the signal peptide GM-CSF in the N-terminal portion of the protein. Such a modification ensures the secretion of lactaptin into the intercellular space and the so-called “neighbor effect” (bystander effect) (Alekseenko, 2011 [26]) - the penetration of lactaptine into neighboring cells and the induction of their death, which greatly enhances the therapeutic effect.

The closest analogue of the invention (prototype) is the recombinant strain VV-GMCSF-S1 / 3 (RF Patent No. 2565544 Published October 20, 2015, Bull. No. 29 [22]), constructed on the basis of the vaccinia virus L-IVP strain containing the GM gene insert Α-CSF of human, the structure of which corresponds to the cDNA of the messenger RNA of human GM-CSF, presented in GenBank under the number M11220.1, in the central part of the viral thymidine kinase gene between positions 83665 and 83696 bp (GenBank Acc. DQ121394); the human GM-CSF gene is expressed under the control of the natural P7.5K promoter of the vaccinia virus and produces a secreted form of biologically active human GM-CSF in mammalian cells at a level of 40 μg per ml of culture medium; the strain VV-GMCSF-S1 / 3 was deposited in the State collection of causative agents of viral infections and rickettsioses FBUN SSC VB "Vector" under the number V-631.

However, the recombinant oncolytic prototype strain does not provide additional attenuation (attenuation) of the virus in relation to normal cells and an additional increase in lytic activity in relation to cancer cells due to the absence of cytotoxic genes in its construction that ensure specific death of cancer cells.

The technical result of the claimed invention is to provide additional attenuation (attenuation) of the recombinant oncolytic VACV virus against normal cells and enhance its lytic activity against cancer cells.

The specified technical result is achieved by the creation of a double recombinant strain VV-GMCSF-S-Lact, constructed on the basis of a moderately pathogenic Russian strain of L-IVP of the vaccinia virus containing deletions of fragments of viral thymidine kinase genes and growth factor, in the areas of which are integrated: granulocyte macrophage colony gene (GM-CSF) of a person whose structure corresponds to the cDNA of the messenger RNA of human GM-CSF (GenBank Acc. M1 1220.1), in the central part of the viral thymidine kinase gene between positions 81277 and 81308 bp (GenBank Acc. KP233807.1); the human GM-CSF gene is expressed under the control of the naturally occurring P7.5k promoter of the vaccinia virus and produces a secreted form of biologically active human GM-CSF in mammalian cells; secreted lactaptin S-Lact gene encoding a fragment of human kappa-casein 23-134 a.a. with “binding” to its N-terminus of the GM-CSF signal peptide (MWLQSLLLLGTVACSIS) [the nucleotide sequence is presented in the Appendix to the application], in the left end region of the viral genome between positions 7770 and 8071 bp (GenBank Acc. KP233807.1); the S-Lact gene is expressed under the control of the synthetic promoter of the vaccinia virus P7.5synth and produces a secreted oncotoxic recombinant protein lactaptin; VV-GMCSF-S-Lact strain has high oncolytic activity against human breast cancer cells both in vitro and in vivo and has been deposited in the State collection of viral infections and rickettsiosis pathogens of the Federal State Budget Scientific Center State Scientific Center "Vector" under the number V-690.

The incorporation of a secreted form of lactaptin as a gene transgene into a region of a deletion of a gene of a viral growth factor contributes, on the one hand, to attenuation (weakening) of the virus in relation to normal cells, and on the other hand, to an increase in its lytic (cytotoxic) activity in relation to breast cancer cells with additional “neighbor effect” (bystander effect) due to the secretion of lactaptine from the infected cell, which ensures the achievement of the claimed technical result.

The strain VV-GMCSF-S-Lact was constructed by single crossing over between the DNA of the strain VV-GMCSF-S1 / 3 and the plasmid DNA pVGF-Sign-FR2-PE / L-Pat (Fig. 1) in the cytoplasm of CV-1 cells, followed by selection obtained unstable construct with puromycin added to the culture medium due to the presence of a resistance gene for this antibiotic (Pat) (Kochneva, 2013 [27]) and intramolecular recombination after removal of selective conditions.

The strain VV-GMCSF-S-Lact is characterized by the following characters:

Morphological signs. The strain possesses the properties of a typical representative of VACV, but unlike the vector virus it has the phenotype TK ^- GMCSF + VGF ^- Lact + (Fig. 2A). When infected with CV-1 cells, the VV-GMCSF-S-Lact strain was shown to produce secreted forms of GM-CSF and lactaptine (Fig. 3).

Physiological and biochemical characteristics and cultural properties of the strain. The DNA of the recombinant strain VV-GMCSF-S-Lact has a length of about 200,000 bp The presence of the human GM-CSF gene insertion and the S-Lact gene insertion in its genome was confirmed by PCR (Fig. 2B) using pairs of primers on the region of the thymidine kinase gene and viral growth factor, respectively. The positions of the primers are shown in FIG. 2A. Expression of GM-CSF and lactaptin genes and protein secretion into the culture medium was confirmed by Western blot analysis of lysates and culture medium of CV-1 cells infected with the recombinant strain VV-GMCSF-S-Lact. The expression of GM-CSF was determined as described in (Grazhdantseva, 2015 [23]) (Fig. 3A). Anti-RL2 monoclonal antibodies were used to detect lactaptine (Koval, 2014 [25]) (Fig. 3B). The insertion of a gene of the secreted form of lactaptin provides high cytotoxic activity of strain VV-GMCSF-S-Lact against human breast cancer cells MCF7, the cytotoxic dose of the virus for which was 0.039 PFU / cell. The oncoselectivity of strain VV-GMCSF-S-Lact was shown by the example of a pair of cancerous / normal human breast epithelial cell cultures: MCF 10A - normal breast epithelial cells; MCF7 - epithelial cells of mammary adenocarcinoma (Fig. 4). As follows from FIG. 4 with an increase in the multiplicity of infection, the percentage of living cells in the population of normal breast epithelial cells MCF 10A decreases slightly, while their analogous cells of mammary adenocarcinoma almost completely lyse with an increase in the multiplicity of infection of recombinant strains to 10 PFU / cell. As follows from Table 1, the selectivity index of the strain VV-GMCSF-S-Lact is more than 250.

Table 1. Comparative cytotoxic activity of the recombinant strain VV-GMCSF-S-Lact on a pair of breast / normal cancer cell epithelial cell cultures.

Cell culture VV-GMCSF-S-Lact,
CTD ₅₀ *, PFU / cell MCF10A > 10 Mcf7 0.039 *** Selectivity Index ** > 250

* CTD ₅₀ - the dose of the virus that causes the death of 50% of the cells, expressed in the number of plaque forming units (PFU) per cell.

** The selectivity index was calculated as the ratio of CTD ₅₀ in normal cells to CTD ₅₀ in cancer cells for each viral strain.

*** The differences are significant at P <0.05.

Strain VV-GMCSF-S-Lact has a high in vivo antitumor activity, which was demonstrated in the SCID model of mice with xenografts of the human breast tumor MDA-MB-231 (Fig. 5). Mice treated with the recombinant strain VV-GMCSF-S-Lact showed significantly lower tumor volume and weight compared to the control (buffer solution).

The invention is illustrated by the following figures of graphic images:

- FIG. 1. Physical and genetic map of the plasmid pVGF-Sign-FR2-PE / L-Pat. L-flank - PCR fragment of the VACV genome of the L-IVP strain 944 bp in length corresponding to the nucleotide positions 6827-7770 of the L-IVP strain deposited in the GenBank (Acc. KP233807.1) located to the left of the VGF gene (the VGF gene has length 423 bp and corresponds to the positions of nucleotides 7801-8223 in GenBank Acc. KP233807.1) and flanked by recognition sites of restriction endonucleases Nsil and SalI; R-flank — PCR fragment of the VACV genome 962 bp in length corresponding to nucleotide positions 8071-9032 (GenBank Acc. KP233807.1) located to the right of the viral growth factor gene and flanked by EcoRI and PvuII restriction endonuclease recognition sites; P7.5synth (36 bp) and PE / L (41 bp) are synthetic early and early-late BOB promoters (Merchlinsky, 1997 [20]); S is a cDNA fragment of the human GM-CSF gene matrix RNA containing the signal sequence of the protein MWLQSLLLLGTVACSIS, size 81 bp; Lact - a fragment of the kappa-casein gene (23-134 a.a.) containing lactaptin with the addition of a sequence encoding a Gly-Gly-Ser-6His and a stop codon at the C-terminus and an ATG codon at the N-terminus, size 366 bp (Semenov, 2010 [28]); Pat - puromycin N-acetyltransferase gene that determines puromycin resistance; AP ^r - β-lactamase gene that determines resistance to ampicillin; ORI is the replication start area.

- FIG. 2. The structure of the recombinant strain VV-GMCSF-S-Lact. A is a genome diagram indicating the positions of the primers (signature as in FIG. 1). B - the results of PCR analysis of the recombinant strain VV-GMCSF-S-Lact using a pair of primers (TK-flank1 sense × TK-flank 2 as) to confirm the insertion of the GM-CSF gene (lanes 1-2) and a pair of primers (Up35 × Apa-L22) to confirm the insertion of the gene for the secreted form of lactaptine (lanes 3-4). MW is a molecular weight marker of 3000,1500,1000, 900,800,700 ... 100. 1 - recombinant VV-GMCSF-S-Lact (fragment 1760 bp), 2 - the original VACV strain L-IVP (fragment 414 bp); 3 - recombinant VV-GMCSF-S-Lact (fragment 791 bp), 4 - the original VACV strain L-IVP (fragment 584 bp).

- FIG. 3. Western blot analysis of gene expression of GM-CSF and S-Lact recombinant strain VV-GMCSF-S-Lact in kidney cell culture of African green monkey CV-1. A - gene expression of GM-CSF; the size of a non-glycosylated mature human GM-CSF is 14.4 kDa (lane 5, non-glycosylated human GM-CSF produced in E. coli cells); lanes 1,3 — isoforms of human GM-CSF corresponding to various degrees of protein glycosylation: 1 — culture medium of CV-1 cells infected with recombinant VV-GMCSF-S-Lact; 2 - control, culture medium of CV-1 cells infected with L-IVP; 3 - lysate of CV-1 cells infected with the recombinant VV-GMCSF-S-Lact; 4 - control, lysate of CV-1 cells infected with L-IVP; M-control of molecular weights; commercial rabbit polyclonal antibodies against human GM-CSF (PerroTech) were used as primary antibodies, and anti-rabbit IgG conjugated in phosphatase (Sigma) as secondary antibodies. B - S-Lact gene expression; K - control, lactaptin produced in E. coli cells (14 kDa); M - control of molecular weights; lane 1 — lysate of CV-1 cells infected with L-IVP; lane 2 — lysate of CV-1 cells infected with recombinant VV-GMCSF-S-Lact; lane 3 — culture medium of CV-1 cells infected with the recombinant VV-GMCSF-S-Lact; lane 4 is the culture medium of CV-1 cells infected with L-IVP. For the manifestation of the protein, monoclonal antibodies to lactaptin conjugated with horseradish peroxidase F14-HRP were used.

- FIG. 4. Oncoselectivity of the recombinant strain VV-GMCSF-S-Lact on two cultures of cells (normal and cancerous) of the epithelium of the mammary gland: MCF10A - normal epithelium of the mammary gland; MCF7 - breast adenocarcinoma. Cells were grown in 96-well plates, infected with 10-fold dilutions of the virus in a dose range of 0.001 - 10 PFU per cell, incubated for 72 hours at 37 ° C in an atmosphere of 5% CO _2, and the percentage of cell death in the photometric test was evaluated using a substrate for 2,3-bis- (2-methoxy-4-nitro-5-sulfo-phenyl) -2H-tetrazolium-5-carboxanilide mitochondrial dehydrogenases (XTT reagent). The test is based on the ability of mitochondrial dehydrogenases to convert water-soluble XTT into formazan, which crystallizes inside the cell. The translation of formazan into solution using phenazine metasulfate (PMS) and subsequent photometry allow you to accurately correlate the change in the optical density of the solution with the change in the number of viable cells. Cytotoxic activity for each virus dilution was evaluated as a percentage of living cells relative to the control. The number of living cells in the negative control (uninfected cells) was taken as 100%.

- FIG. 5. Analysis of the antitumor activity of the recombinant strain VV-GMCSF-S-Lact in vivo. We used female SCID mice, 8-10 weeks old, weight 20-26 g. Tumor - 2 × 10 ⁶ human breast tumor cells MDA-MB-231 in a mixture with Matrigel (BD Bioscience) 2: 1 were inoculated into mice subcutaneously in the left back of the body. Virotherapy was started 14 days after the formation of clearly visible tumors with a volume of 45-75 mm ³ , the introduction of the virus at a dose of 10 ⁷ PFU / mouse in a volume of 100 μl was carried out in the tumor area twice with an interval of 14 days. Control — mice were injected with a buffer solution of 0.005M TRIS-Hcl, pH 9.0 in a volume of 100 μl. A - dynamics of changes in tumor volume; Tumor volume was calculated using the formula LxW ² x0.5 (Yu, 2009 [29]). Measurements were taken every 2 weeks. The total observation period is 28 days. B - the weight of the extracted tumor in the comparison groups at the endpoint of observation (28 days).

For a better understanding of the invention, the following are examples of its implementation.

Example 1. Construction of recombinant plasmid DNA pVGF-Sign-FR2-PE / L-Pat.

Plasmid pVGF-Sign-FR2-PE / L-Pat was obtained on the basis of pXJP5.2 (Kochneva, 2015 [22]). At the first stage, the right and left TC flanks of pXJP5.2 were replaced by VACV genome fragments located to the left (L-flank) and to the right (R-flank) of the VGF gene. The VACV DNA strain L-IVP (GenBank Acc. KP233807.1) served as a template for amplification of the fragments; the amplification primers had the following structure:

                                               EcoRI

R-flank Up: 5 '- CTCCC GAATTC TCAGAAAACCCAAACACTACAACGT

                                                         PvuII

R-flank Low: 5 '- CTTCT CAGCTG GGAAACACCGATATGTGGAGGC

                                                          Nsil

L-flank Up: 5 '- UDPC ATGCAT CACCATCATATCACAGCTGGTAACTAT

                                                           Sali

L-flank low: 5 '- TTTCC GTCGAC TCAGTGTGTGTTTATGACAAGATTGGG

Sites were introduced into the primer structures recognition of restriction endonucleases for insertion into the pXJP5.2 vector.

At the second stage, the natural VACV P7.5k promoter in plasmid pXJP5.2 was replaced with the synthetic P7.5synth in order to prevent intramolecular instability of the recombinant strain VV-GMCSF-S-Lact, in which the natural promoter is used to express the GM-CSF gene. To carry out the replacement of the promoter, two oligonucleotides were synthesized, which upon annealing form the following structure:

     SalI P7.5

5 ’TCGAC GGCCAAAAATTGAAAAACTAGATCTATTTATTGCAC GCTAGC AAGCTT GGATCC G

                G CCGGTTTTTAACTTTTTGATCTAGATAAATAACGTG CGATCG TTCGAA CCTAGG CTTAA

                                                                                                                             Nhe I HindIII BamH EcoRI

The resulting duplex was built into pXJP5.2 at SalI - EcoRI restriction sites. Further, the Pat gene was inserted into the plasmid at the ClaI site under the control of the synthetic PE / L promoter (Merchlinsky, 1997 [20]). For this purpose, two oligonucleotides were first synthesized which contained the PE / L promoter sequence and recognition sites of a number of restrictase enzymes. Upon annealing, they form a duplex of the following structure:

   ClaI KpnI SpeI Nsil ClaI

CGATGGCCAAAAATTGAAATTTTATTTTTTTTTTTTTGGAATATAAAGGTACCACTAGTATGCATAT

    TACCGGTTTTTAACTTTAAAATAAAAAAAAAAAACCTTATATTTCCATGGTGATCATACGTATAGC

After embedding this duplex at the ClaI site, the Pat gene was inserted into the obtained plasmid at the KpnI - Nsil sites. The DNA fragment containing the Pat gene was obtained by PCR on a pGEM-Puro-DS-Apo matrix (Chumakov, 2013 [30]) using a pair of primers, which contain restriction enzyme recognition sites KpnI and Nsil:

                                             KpnI

Puro Up 5´- GCATC GGTACC ATGACCGAGTACAAGCCCACGG

                                        Nsil

Puro Low 5´- GCATC ATGCAT TCAGGCACCGGGCTTGCGGGTCA

The ligated plasmid DNA, designated pVGF-PE / L-Pat, contains the Pat gene under the control of the synthetic early-late PE / L promoter (for selection of recombinant VACV clones), the left and right flanks of the VGF gene for homologous recombination with viral DNA leading to the deletion of a 170 bp VGF gene fragment corresponding to nucleotide positions 7801-8071 (GenBank Acc. KP233807.1), a synthetic early-late P7.5synth promoter and the subsequent polylinker for insertion of transgenes; a selective marker is the ampicillin resistance gene.

A lacaptin gene (Lact) obtained by PCR on the plasmid DNA matrix pGSDI / RL2 (Semenov, 2010 [28]) using a pair of primers was inserted into the pVGF-PE / L-Pat plasmid at HinIII - EcoRI sites under the control of the P7.5synth promoter that ensure the presence of HindIII and EcoRI restriction sites in the amplification fragment:

                                     HindIII

FR2 For 5´ –AATCC AAGCTT ACCATGAACCAGAAACAACCAGCA

                                      EcoRI

FR2 Rev 5´ –CTATC GAATTC TTAGTGATGGTGATGGTGATGTG

The resulting plasmid is designated as pVGF-FR2-PE / L-Pat. Further, the signal sequence of the human GM-CSF gene between the P7.5synth promoter and the lactaptin gene was introduced into this plasmid with the formation of a single transcription frame for the secreted form of the protein. The signal sequence was obtained by PCR on the DNA matrix of the plasmid pXJP5.2-GM-CSF (Kochneva, 2015 [22]) using a pair of primers:

                                   Nhei

Leader F 5'- gcatc GCTAGC CCACGCGTCCGGGCTA

                                     HindIII

Leader R 5 '- gcatc AAGCTTA GAGATGCTGCAGGCCACAGT

After restriction enzyme digestion and electrophoresis on 1.5% agarose gel, a 93 bp PCR fragment encoding the GM-CSF signal sequence was isolated using the QIAquick Gel Extactionb kit (USA) and inserted into pVGF-FR2-PE DNA / L-Pat at NheI - HindIII sites. The structure of the obtained plasmid DNA, designated as pVGF-Sign-FR2-PE / L-Pat (Fig. 1), was confirmed by sequencing of the insertion region.

Example 2. Transfection of CV-1 cells with the recombinant plasmid pVGF-Sign-FR2-PE / L-Pat and obtaining the recombinant strain VV-GMCSF-S-Lact.

For transfection of plasmid DNA pVGF-Sign-FR2-PE / L-Pat was prepared in preparative quantities from 1000 ml of Luria-Bertani medium and isolated using a set of laboratory reagents for the isolation of plasmid DNA purified from endotoxins "EndoFree Plasmid Maxi Kit (Qiagen )

Recombinant VACVs were prepared using Lipofectamine ™ LTX transfection reagent, 1 ml and Plus reagent (Invitrogen). Transfection was performed on a 90% monolayer of CV-1 cells grown in six-well plates (Greiner). Cells were infected with the recipient strain VV-GMCSF-S1 / 3 (Kochneva, 2015 [22]) with a multiplicity of 0.05 PFU / cell, and after 1 hour of incubation at 37 ° C, a mixture of plasmid DNA (5 μg) + lipofectamine (20 μl) was added + Plus reagent in accordance with the manufacturer's recommendation in 1 ml of Opti-MEM medium (Invitrogen). After 1 hour of incubation at 37 ° C in an atmosphere of 5% CO₂another 2 ml of Opti-MEM medium was added to the wells and incubated under the same conditions another 24-36 hours before the development of cytopathic action (CPP). The material was frozen three times, thawed and sonicated to obtain a homogeneous viral suspension. Next, the selection of recombinants was carried out by triple passaging on a monolayer of CV-1 cells with the addition of puromycin (Sigma) in a concentration of 10 μg / ml of DMEM medium (Invitrogen). The virus was cloned by hard agar plaque method and analyzed for the presence of S-Lact gene insertion by PCR using Up35 5’- GTAAGCAAAGAATATAAGAATGAAGCGGTAATG AT-3 ′ and Apa-L22 5 ′ primers — CGAGCACAATACCGGGAGATGG-3. The positions of the primers are shown in FIG. 2A. Viral DNA for PCR was isolated using RIBO-sorb kits (CJSC Interlabservis). The size of the amplified DNA fragment of the original strain VV-GMCSF-S1 / 3 was 584 bp (Fig. 2B), and the recombinant virus with the lactaptin gene insertion - 791 bp Preservation of the insertion of the GM-CSF gene as part of the obtained recombinant was confirmed by PCR of viral DNA using a pair of primers on the region of the thymidine kinase gene TK-flank1 sense 5'-CAGAATTAATTAGACGAGTTAGACG and TK-flank 2 as 5 '- TCTCGGTTTCCTCACCCAT. The positions of the primers are shown in FIG. 2A. The size of the amplified DNA fragment of the recombinant strain with the insertion of the GM-CSF gene is 1760 bp, and the strain of L-IVP without insertion is 414 bp (Fig. 2B). Thus, the resulting recombinant strain VV-GMCSF-S-Lact contains two attachments: the GM-CSF gene in the tk gene of the virus and the S-Lact gene in the VGF gene. The selected recombinant variant of VV-GMCSF-S-Lact was double-cloned to avoid trace impurities of the original virus, it was applied to the monolayer of CV-1 cells and purified by centrifugation in a sucrose density gradient (25-40%). Virus titer was determined by plaque on a CV-1 cell monolayer stained with a crystal violet fixative solution (2 g / L crystal violet, 50 ml / L formaldehyde, 100 ml / L ethanol, water). Purified recombinant strain VV-GMCSF-S-Lact with a titer of 10⁹PFU / ml is stored in bulk at -80 ° C.

Example 3. Assessment of gene expression of GM-CSF and S-Lact recombinant strain VV-GMCSF-S-Lact.

Human GM-CSF is synthesized as a precursor protein (144 a.a.), followed by cleavage of the signal peptide (17 a.a.), thus a mature polypeptide contains 127 a.a. (14.4 kDa). The existence of 16 different isoforms of human GM-CSF produced in eukaryotic cells has been shown. These isoforms, which have different glycosylation patterns, determine the heterogeneity of natural GM-CSF and the molecular weight spread from 14.4 to 32 kDa.

A monolayer of CV-1 cells (90% of the surface) grown in a 650 ml culture mattress (Greiner) was infected with the recombinant strain VV-GMCSF-S-Lact or the original strain VACV L-IVP with a multiplicity of 1 PFU / CL. Incubated 24 hours at 37 ° C in an atmosphere of 5% CO₂, culture medium (DMEM) was harvested, cells were disrupted with lysis buffer (50mM TRIS-HClpH 7.5, 150mM NaCl, 1% Triton X-100, 5mM MgCl₂, proteases inhibitor cocktail) in a volume of 7 ml, 3 rounds of freezing-thawing were carried out, then three times sonication (20 sec at 200-300 W with 10 sec cooling after each treatment). The culture medium and cell lysates were centrifuged at 14,000 rpm, 30 min, 4 ° C, supernatants were analyzed separately in the Western blot analysis for the presence of GM-CSF (Fig. 3A) and lactaptin (Fig. 3B). Electrophoretic separation of proteins was carried out in a BioRad chamber in a 5% concentrating and 14% separating acrylamide gel at V = 100. Protein transfer from the gel was carried out in a MiniTrans-Blot cell “BioRad” chamber onto Immun-Blot TMPVDF Membrane for Protein Blotting 0.2 µm membranes at V = 100 1 hour 20 minutes. Then the membranes were washed with transfer buffer and placed in a blocking solution - TBS pH 7.4 with 5% milk (Skim Milk Powder, Biochemika, Fluka) for 1 hour at room temperature (CT) on a shaker. Membranes were washed 3 times for 5 minutes with TVS pH 7.4 on a shaker and analyzed with specific antibodies.

In the analysis of GM-CSF (Fig. 3A), rabbit polyclonal antibodies against human GM-CSF (PerroTech) were used as primary antibodies. As secondary antibodies, a conjugate of anti-rabbit antibodies with phosphatase (Sigma). The membrane was incubated for 16 hours, at + 4 ° C with primary antibodies at a working concentration of 0.2 μg / ml, in TBS pH 7.4 with 0.1% Tween-20 and 5% milk. After binding to primary antibodies, the membrane was washed 3 times for 5 minutes with TBS pH 7.4 with 0.1% Tween-20 on a shaker, then binding to secondary antibodies was carried out at a working dilution of 1: 5000 in TBS pH 7.4 with 0.1 % Tween-20 and 5% milk for 1 hour with CT on a rocking chair. After binding to the conjugate, TVS pH 7.4 was washed 3 times for 5 minutes with 0.1% Tween-20 on a rocking chair and 1 time with substrate buffer (AP buffer: 100 mMTris, 100mM NaCl, pH 9.5 with the addition of 50 mM MgCl ₂ ). BCIP (5-bromo-4-chloro-3-indolyl phosphate) and NBT (NitroBluetetrazolium) were used as a substrate. The reaction was stopped by washing the membrane in distilled water.

The results show that GM-CSF is detected only in the culture medium and lysates of CV-1 cells infected with the recombinant strain VV-GMCSF-S-Lact (Fig. 3A). In cells infected with L-IVP, GM-CSF is not detected. In the culture medium, a secreted form of GM-CSF with a high molecular weight of 25-32 kDa is presented (Fig. 3, lane 1) due to more complete glycosylation, in contrast to intracellular GM-CSF, detected in cell lysates, where a wide range of GM- isoforms are presented CSF from 18 to 32 kDa (figure 3, lane 3). As a positive control, a non-glycosylated form of GM-CSF with a molecular weight of 14.4 kDa obtained in E. coli cells was used (Fig. 3, lane 5).

In the analysis of lactaptine (Fig. 3B), monoclonal antibodies to lactaptin conjugated with horseradish peroxidase F14-HRP at a concentration of 0.2 μg / ml in TBS pH 7.4 with 0.1% Tween-20 and 0.1% BSA were used. The antibody membrane was incubated overnight, ~ 16 hours, at + 4 ° C. Then, after 3 times washing with TBS, pH 7.4 with 0.1% Tween-20 on a rocking chair was developed with DAB solution (Vector-Best CJSC). The reaction was stopped by washing in distilled water. The molecular weight of lactaptin is 14 kDa, the protein is not glycosylated in eukaryotic cells. As follows from FIG. 3B lactaptin is detected in the medium and lysates of cells infected with the recombinant strain VV-GMCSF-S-Lact, which indicates its expression and secretion in the composition of the recombinant virus.

Example 4. Evaluation of the cytolytic activity of the recombinant strain VV-GMCSF-S-Lact on two cultures of cells (normal and cancerous) of the epithelium of the mammary gland.

Cell cultures were used in the work: MCF10A - normal breast epithelium; MCF7 - breast adenocarcinoma.

The study of the cytolytic activity of the recombinant strain VV-GMCSF-S-Lact on MCF7 and MDA-MB-231 breast cell cultures was carried out by a micromethod on 96-well culture plates (Greiner) using a substrate for mitochondrial dehydrogenases 2,3-bis- (2- methoxy-4-nitro-5-sulfo-phenyl) -2H-tetrazolium-5-carboxanilide (XTT reagent) (Sigma). Tenfold dilutions of the viral suspension with an infection multiplicity of 10 to 0.001 PFU / cell were added to the wells of the tablet with a 50% monolayer of cells. (multiplicity of infection, MOI) in 100 μl of 199 medium (Biolot) supplemented with 2% fetal bovine serum (HyClone). The tablets were placed in a thermostat at a temperature of 37 ° C, 5% CO ₂ , humidity 85% and incubated for 72 hours. After incubation, 50 μl of XTT reagent and phenazine metasulfate (PMS) (Sigma) were added to each test well, which was obtained by adding 1.25 mM PMS solution to the XTT working solution with a content of: for each 1 ml of XTT - 20 μl PMS. The plate was incubated for another 3 hours, and the optical density of OD _{490/620 was determined} on a SpectraCount (Packard) _plate spectrophotometer. We plotted the dependence of OD on MOI and determined the percentage of living cells for each experimental point. The number of living cells in the negative control (uninfected cells) was taken as 100%. All calculations were performed using LabView software.

As follows from FIG. 4 with an increase in the multiplicity of infection, the percentage of living cells in the population of normal breast epithelial cells MCF 10A decreases slightly, while their analogous cells of the breast adenocarcinoma are almost completely lysed with an increase in the multiplicity of infection to 10 PFU / cell. These data indicate the high cytotoxic activity of the recombinant strain VV-GMCSF-S-Lact against tumor cells of the human breast, as well as its oncoselectivity and safety for normal cells.

Example 5. Assessment of the oncolytic activity of the recombinant strain VV-GMCSF-S-Lact in vivo in the SCID model of mice with xenografts of human breast tumors MDA-MB-231.

All work with animals was carried out on the basis of the Center for Collective Use “SPF-Vivarium” of the Institute of Cytology and Genetics SB RAS. We used 10 female SCID immunodeficient mice, age 8-10 weeks, weight 20-26 g. Tumor - 2x10 ⁶ human breast tumor cells MDA-MB-231 were inoculated into mice mixed with Matrigel (BD Bioscience) 2: 1 subcutaneously to the left rear of the body. Virotherapy was started 14 days after the formation of clearly visible tumors with a volume of 45-75 mm ³ . The mice were divided into 2 groups of 5 pieces each. The mice of the first group were injected with a virus at a dose of 10 ⁷ PFU / mouse in a volume of 100 μl into the tumor area twice with an interval of 14 days. Mice of the second group (control) were injected with a buffer solution of 0.005 M TRIS-Hcl, pH 9.0 in a volume of 100 μl. Tumor volume was calculated using the formula LxW ² x0.5 (Yu, 2009 [29]). Measurements were taken every 2 weeks. The total observation period is 28 days (Fig. 5A). Euthanasia of mice was carried out by inhalation of carbon dioxide, tumors were removed and weighed (Fig. 5B). Statistical processing of the results was carried out using t-student criterion at a significance level of 95%.

As follows from FIG. 5A and B, the size and weight of the tumors of mice treated with the recombinant strain VV-GMCSF-S-Lact are significantly lower than those for the mice of the control group, indicating a high oncolytic activity of the virus against human breast tumors.

Thus, the above results (examples 1-5) confirm the achievement of the claimed technical result, namely: created a recombinant strain VV-GMCSF-S-Lact, with targeted antitumor activity against human breast cancer cells. Moreover, the insertion of a secreted form of the lactaptin as a gene transgene into the region of the deletion of the virus of the viral growth factor gene contributes, on the one hand, to attenuation (weakening) of the recombinant oncolytic VACV virus against normal cells, and on the other hand, enhances its lytic (cytotoxic) activity against breast cancer cells with an additional “neighbor effect” (bystander effect) due to the secretion of lactaptin from the infected cell (page 6, table 1).

Sources of scientific, technical and patent information

1. Weisbart R.H., Golde D.W., Cark S.C., Wong G.G., Gassan J.C. Human granulocyte-macrophage colony-stimulating factor is a neutrophil activator. // Nature. - 1985. - V. 314. - P. 361-363.

2. Fleischmann J., Golde D. W., Weisbart R. H., Gasson J. C. Granulocyte macrophage colony-stimulating factor enhances phagocytosis of bacteria by human neutrophils. // Blood. - 1986.- V. 68 (3). - P. 708-711.

3. Gaudernack G., Gjertsen M.K. Combination of GM-CSF with antitumor vaccine strategies. // Eur. J. Cancer. - 1999. - V. 35 (Suppl. 3). - P. 33–35.

4. Warren T.L., Weiner G.J. Uses of granulocyte-macrophage colony-stimulating factor in vaccine development. // Curr. Opin. Hematol. - 2000. - V. 7. - P. 168–173.

5. Morrissey P.J., Bressler L., Park L.S., Alpert A., Gillis S. Granulocyte macrophage colony-stimulating factor augments the primary antibody response by enhancing the function of antigen-presenting cells. // J. Immunol. - 1987. - V. 15. - P. 1113–1119.

6. Yoon H.A., Aleyas A.G., George J.A., Park S.O., Han Y.W., Cho J.-G., Eo S.K. Cytokine GM-CSF genetic adjuvant facilitates prophylactic DNA vaccine against pseudorabies virus through enhanced immune responses. // Microbiol. Immunol. - 2006 .-- V. 50 (2). - P. 83–92.

7. Somasundaram C. Recent advances and current status of GM-CSF as an adjuvant in DNA vaccines for viral diseases. // J. Investig. Genomics - 2015 .-- V. 2 (3). - 00025. DOI: 10.15406 / jig.2015.02.02.00025

8. Lai L., Kwa S., Kozlowski P.A., Montefiori D.C., Ferrari G. et al. Prevention of infection by a granulocyte-macrophage colony-stimulating factor co-expressing DNA / modified vaccinia Ankara simian immunodeficiency virus vaccine. // J. Infect. Dis. - 2011 .-- V. 204 (1). - P. 164-173.

9. Hellerstein M., Xu Y., Marino T., Lu S., Yi H. et al. Co-expression of HIV-1 virus-like particles and granulocyte-macrophage colony stimulating factor by GEO-D03 DNA vaccine. // Hum. Vaccin. Immunother. - 2012 .-- V. 8 (11). - P. 1654-1658.

10. Zhang H., Qian P., Peng B., Shi L., Chen H. et al. A novel subunit vaccine co-expressing GM-CSF and PCV2b Cap protein enhances protective immunity against porcine circovirus type 2 in piglets. // Vaccine. - 2015 .-- V. 33 (21). - P. 2449-2456.

11. Chen H., Gao N., Wu J., Zheng X., Li J. et al. Variable effects of the co-administration of a GM-CSF-expressing plasmid on the immune response to flavivirus DNA vaccines in mice. // Immunol. Lett. - 2014 .-- V. 162 (1 Pt A). - P. 140-148.

12. Fowler V., Robinson L., Bankowski B., Cox S., Parida S. et al. A DNA vaccination regime including protein boost and electroporation protects cattle against foot-and-mouth disease. // Antiviral. Res. - 2012 .-- V. 94 (1). - P. 25-34.

13. Zheng Q., Fan D., Gao N., Chen H., Wang J. et al. Evaluation of a DNA vaccine candidate expressing prM-E-NS1 antigens of dengue virus serotype 1 with or without granulocyte macrophage colony-stimulating factor (GM-CSF) in immunogenicity and protection. // Vaccine. - 2011 .-- V. 29 (4). - P. 763-771.

14. Wang X., Li J., Jiang P., Li Y., Zeshan B. et al. GM-CSF fused with GP3 and GP5 of porcine reproductive and respiratory syndrome virus increased the immune responses and protective efficacy against virulent PRRSV challenge. // Virus Res. - 2009 .-- V. 143 (1). - P. 24-32.

15. Hartoonian C., Ebtekar M., Soleimanjahi H., Karami A., Mahdavi M. et al. Effect of immunological adjuvants: GM-CSF (granulocyte-monocyte colony stimulating factor) and IL-23 (interleukin-23) on immune responses generated against hepatitis C virus core DNA vaccine. // Cytokine. - 2009 .-- V. 46 (1). - P. 43-50.

16. Encke J., Bernardin J., Geib J., Barbakadze G., Bujdoso R. et al. Genetic vaccination with Flt3-L and GM-CSF as adjuvants: Enhancement of cellular and humoral immune responses that results in protective immunity in a murine model of hepatitis C virus infection. // World J. Gastroenterol. - 2006. - V. 12 (44). - P. 7118-7125.

17. Kochneva G.V., Sivolobova G.F., Yudina K.V., Babkin I.V., Chumakov P.M., Netesov S.V. Oncolytic poxviruses. // Molecular Genetics, Microbiology and Virology. - 2012. - No. 1. - S. 8–15.

18. Thorne S.H., Hwang T.H., O’Gorman W.E., Bartlett D.L., Sei S., Kanji F., Brown C., Werier J., Cho J., Lee D., Wang Y., Bell J., Kirn D.H. Rational strain selection and engineering creates a broad-spectrum, systemically effective oncolytic poxvirus, JX-963. // J. Clin. Invest. - 2007. - V. 117. - P. 3350–3358.

19. Kirn D. Oncolytic vaccinia virus cancer therapy // U.S. Patent - 2010. - No. 2010/0303714.

20. Merchlinsky M., Eckert D., Smith E., Zauderer M. Construction and characterization of vaccinia direct ligation vectors. // Virology. - 1997. - V. 238 - P. 444–451.

21. Breitbach C.J., Burke J., Jonker D., Stephenson J., Haas A.R., Chow L.Q. M., Nieva J., Hwang T., Moon A., Patt R., Pelusio A., Le Boeuf F., Burns J., Evgin L., De Silva N., Cvancic S., Robertson T., Je J., Lee Y., Parato K., Diallo J., Fenster A., Daneshmand M., Bell JC, Kirn DH Intravenous delivery of a multi-mechanistic cancer-targeted oncolytic poxvirus in humans. // Nature. - 2011. - V. 477. - P. 99–102.

22. Kochneva G.V., Sivolobova G.F., Lupan T.A., Grazhdanceva A.A., Chumakov P.M., Netesov S.V. Recombinant strain VV-GMCSF-S1 / 3 of the vaccinia virus producing secreted granulocyte macrophage colony stimulating human factor. // RF patent. - 2015. - No. 2565544. - Bull. No. 29 (prototype).

23. Grazhdantseva A.A., Sivolobova G.F., Tkacheva A.V., Gileva I.P., Kuligina E.V., Richter V.A., Kochneva G.V. Highly effective production of biologically active secreted granulocyte-macrophage colony-stimulating human factor by recombinant vaccinia virus. // Biotechnology, 2015, No. 5, C. 1-9.

24. McCart A., Bartlett D., Moss B. Combined growth factor-deleted and thymidine kinase-deleted vaccinia virus vector. // US Patent. No. 7208313. - 2007.

25. Koval O.A. et al. Lactaptin induces p53-independent cell death associated with features of apoptosis and autophagy and delays growth of breast cancer cells in mouse xenografts. // PLoS one. - 2014 .-- V. 9 (4). - e93921

26. Alekseenko I.V., Kopantsev E.P., Vinogradova T.V., Sverdlov E.D. Bicistronic vector for co-expression of the HSVtk killer gene and GM-CSF cytokine in cancer cells. // Reports of the Academy of Sciences. - 2011. - T. 439. - No. 4. - S. 551-554.

27. Kochneva G.V., Babkina I.N., Lupan T.A., Grazhdantseva A.A., Yudin P.V., Sivolobova G.F., Shvalov A.N., Popov E.G., Babkin I.V., Netesov S.V., Chumakov P.M.  Apoptin enhances the oncolytic activity of the vaccinia virus in vitro. // Molecular biology. 2013.V. 47. No. 5. P. 842-852.

28. Semenov D.V., Fomin A.S., Kuligina E.V., Koval O.A., Matveeva V.A., Babkina I.N., Tikunova N.V., Richter V.A. Recombinant analogs of a novel milk pro-apoptotic peptide, lactaptin, and their effect on cultured human cells. // Protein. J. - 2010. - V. 29. - P.174-180.

29. Yu Z., Li S., Brader P., Chen N., Yu Y.A., Zhang Q., Szalay A.A., Fong Y., Wong R.J. Oncolytic vaccinia therapy of squamous cell carcinoma // Molecular Cancer. - 2009. - V. 8. - P. 45-53.

30. Chumakov P.M., Kochneva G.V., Babkina I.N., Lupan T.A., Grazhdantseva A.A., Yudin P.V., Sivolobova G.F., Popov E.G., Netesov S.V. Recombinant plasmid DNA pGEM-Puro-DS-Apo containing the synthetic apoptin gene flanked by the genes of the vaccinia virus genome from the C10L-C12L region, and the recombinant vaccinia virus VVdGF-ApoS24 / 2 strain producing apoptin. // RF patent. - 2013. - No. 2492238. - Bull. Number 25.

application

<110> Federal State Budgetary Institution of Science Institute of Chemical Biology and Fundamental Medicine of the Siberian Branch of the Russian Academy of Sciences (IHBFM SB RAS)

<120> Recombinant strain of VV-GMCSF-S-Lact smallpox vaccine virus with oncolytic activity and producing granulocyte-macrophage colony-stimulating human factor and a secreted form of lactaptin oncotoxic protein

<160> SEQ ID NO 1

<210> 1

<211> 423

<212> DNA

<213> chimeric gene consisting of human milk kappa-casein (residues 23-134) and human GM-CSF signal peptide (MWLQSLLLLGTVACSIS) (chimeric gene consisting of a fragment of human kappa-casein (residues 23-134) and the signal peptide GM- Human CSF (MWLQSLLLLGTVACSIS)

<400> 1

atg tgg ctg cag agc ctg ctg ctc ttg ggc act gtg gcc tgc agc 45

atc tct aag ctt atg aac cag aaa caa cca gca tgc cat gag aat 90

gat gaa aga cca ttc tat cag aaa aca gct cca tat gtc cca atg 135

tat tat gtg cca aat agc tat cct tat tat gga acc aat ttg tac 180

caa cgt aga cca gct ata gca att aat aat cca tat gtg cct cgc 225

aca tat tat gca aac cca gct gta gtt agg cca cat gcc caa att 270

cct cag cgg caa tac ctg cca aat agc cac cca ccc act gtg gta 315

cgt cgc cca aac ctg cat cca tca ttt att gcc atc ccc cca aag 360

aaa att cag gat aaa ata atc atc cct acc atc ggc gga tca cat 405

cac cat cac cat cac taa 423

Claims (1)

Recombinant strain VV-GMCSF-S-Lact, constructed on the basis of the vaccinia virus L-IVP strain, containing deletions of viral thymidine kinase and growth factor gene fragments, in the regions of which are integrated: a human granulocyte-macrophage colony stimulating factor (GM-CSF) structure of a person corresponds to cDNA of human GM-CSF matrix RNA (GenBank Acc. M11220.1), in the central part of the viral thymidine kinase gene between positions 81277 and 81308 bp (GenBank Acc. KP233807.1); the human GM-CSF gene is expressed under the control of the naturally occurring P7.5k promoter of the vaccinia virus and produces a secreted form of biologically active human GM-CSF in mammalian cells; secreted lactaptin S-Lact gene encoding a fragment of human kappa-casein 23-134 a.a. with “sewing” to its N-terminus the GM-CSF signal peptide (MWLQSLLLLGTVACSIS), in the left end region of the viral genome between positions 7770 and 8071 bp (GenBank Acc. KP233807.1); the S-Lact gene is expressed under the control of the synthetic promoter of the vaccinia virus P7.5synth and produces a secreted oncotoxic recombinant protein lactaptin; the VV-GMCSF-S-Lact strain has targeted oncolytic activity against human breast cancer cells both in vitro and in vivo and is deposited in the State collection of viral infections and rickettsiosis pathogens of the Federal State Budget Scientific Center State Scientific Center WB Vector under the number V-690.

Images