CA2191475C - A drug, containing one or more plasma derivatives - Google Patents

Abstract

The invention describes a drug containing one or more plasma derivatives as active substance or inactive ingredient, wherein the starting material or the intermediates incurred at the preparation of the plasma derivatives is not contaminated by one or more of various hematogenous viruses capable of reproduction, or has a virus load not exceeding a defined limiting value. The thus quality-assured starting material or intermediate, respectively, for the preparation of the finished plasma derivative is subsequently subjected to at least one further substantial virus depletion or virus inactivation step, respectively. The invention furthermore describes methods for the preparation of this drug as well as for the preparation of quality-assured starting materials or intermediates, respectively.

Description

The invention relates to a drug, containing one or more plasma derivatives as active substance or inactive ingredient, and to a starting material of assured quality for the preparation of such drugs, as well as to a method for preparing these drugs. The invention also relates to a method for the preparation of starting materials of assured quality, particularly of plasma pools of assured quality.
Human plasma is of exceptional clinical importance as a pharmaceutical preparation or as a starting material for the preparation of plasma derivatives, respectively, particularly for substitution therapy in the case of a congenital or acquired deficiency of plasma components. However, when human plasma is used, care must be taken that no infectious agents are contained, which can be transferred with the pharmaceutical preparation or with the plasma derivatives, respectively.
Infectious agents, which can possibly occur in blood, include above all viruses which can be transferred through blood (hematogenous viruses), such as HI viruses or hepatitis viruses (hepatitis A, B, C or non-A-non-B), but also parvovirus, which can be transmitted by blood.
Because of the great need for drugs containing plasma derivatives, the economical preparation of these drugs is possible only on an industrial scale.
Plasma is obtained from donors and pooled for the production of pharmaceutical preparations. The size of a conventional pool is about 2,000 to 6,000 individual plasma donations. There is a risk that the entire plasma pool gets contaminated by a single, virus-contaminated plasma donation.
Although as early as the late first half of the 20th century human albumin was successfully made into a virus-free preparation by heating. This at first was not possible for all other drugs, which could be obtained from plasma, because of their heat sensitivity. Up to now, adequately prepared albumin has been used on millions of occasions; nevertheless, there have never been infections attributable to human blood-borne viruses.
In contrast, virus infections, particularly those due to hepatitis viruses and, since the 1980s, on a large scale also those due to the AIDS virus, have been reported for many other drugs prepared from plasma.

{

Around 1980, heat treatments were carried out for the first time with appropriately stabilized Factor VIII concentrates with the intention of inactivating virus contaminants. At first, however, a large loss in the activity of Factor VIII had to be accepted and the actual inactivation potential remained unknown.
By improving the heat inactivation methods and through other, new, inactivation methods, it was finally possible to produce drugs from plasma, which in most cases did not lead to virus infections in recipients. Concomitantly with this development, there was also an improvement in the selection of donors and donations with the objective of excluding those donors and donations suspected of viremia and thus of a virus-containing plasma.
For some time now, the detection of certain viral antigens or of antibodies in the blood has been used in an attempt to exclude those donations which yield a positive result, and not to introduce them in a larger plasma pool which is to be used as a starting material for the preparation of blood products. In the case of individual donors who do not have symptoms of a disease or pathological examination results in any examination, yet may nevertheless may harbor certain viruses in their blood over extended periods of time even at high concentrations, the occurrence of such viremias due to a particular virus can now be detected unambiguously with the help of an amplification method.
After pooling plasma units, a single plasma donation contaminated with viruses, is of course diluted; however, the detection of viral genome sequences with the help of amplification reactions is so sensitive that virus genomes or their sequences can be determined unambiguously even in such dilutions; and if, as mentioned above, they fall below a certain detection limit, they then no longer have clinical relevance in the sense of the possibility of an infection.
The EEC Regulatory Document Note for Guidance, Guidelines for Medicinal Products Derived from Human Blood and Plasma (Biologicals 1992, 20:159-164) proposes a quality assurance system for checking plasma donors and plasma donations, respectively. Accordingly, each plasma donation must be analyzed with validated tests for the absence of virus markers, such as hepatitis B antigen or HIV-1 and HIV-2 antibodies, since these are indicative of a corresponding viral infection of the plasma donor. Tests for excluding a hepatitis C infection should also be carried out.
According to the European Pharmacopoeia special tests should be carried out on each donation for determining hepatitis B
surface antigen and for hepatitis C virus and HIV antibodies.
(European Pharmacopoeia, 2nd Edition, Part II, 1994, pages 853 to 854).
An FDA guideline of 3-14-1995 provides for the PCR testing of an end product (an immunoglobulin product) as an additional safety factor.
Despite the proposed tests, it is emphasized in the EEC
guidelines that the safety of individual plasma donations is not assured adequately by merely checking for these virus markers.
Even if the absence of said markers in a plasma sample is confirmed, viremia of the donor cannot be excluded. Because viral antigens and corresponding antibodies cannot be detected immediately after the infection, the first markers of a viral infection frequently occur only weeks or months after contact with the infectious material. This critical period after the infection and before the occurrence of antibodies generally is referred to as the "window period". However, the point of time after infection, at which the first viral markers are detectable, varies from virus to virus.
Moreover, it has also become known that, for some drugs prepared from plasma, viruses are depleted or inactivated in the course of the production process and that such products by themselves are virus-safe to a high degree.
Although virus inactivations of plasma derivatives have been carried out extremely successfully on an industrial scale, hematogenous viruses such as AIDS, hepatitis A, B and C viruses, have nevertheless been transmitted in rare instances, and it therefore had to be assumed that the manufacturers, in spite of using a constant manufacturing method, produced a few batches of virus-contaminated products (Lancet 340, 305 to 306 (1992); MMWR
43 (28), 505 to 509 (1994), Thromb. Haemost. 68, 781 (1992).
This probably resulted from excessive contamination of certain starting batches. Since only indirect methods are available for excluding virus-contaminated plasma donations during the recovery of plasma, it is possible that the starting material is so heavily contaminated, that the otherwise successfully used virus inactivation and virus depletion methods are no longer sufficient for producing virus-safe end products.
The human infectious dose for HIV, HCV and HBV is not known and cannot be determined at present. The determination of the infectious dose in tissue cultures (TCID50: tissue culture infectious dose) or in the animal model (CID50: chimpanzee infectious dose) therefore gives only an approximation of the human infectious dose. Moreover, in some cases, people are not infected with HIV, HCV or HBV in spite of having been exposed thereto. A human infectious dose of such a virus is therefore not necessarily infectious.
Piatak et al. (Science 1993, 259:1749-1754) determined the TCID50 of HIV to be 1 TCID50/104 copies of HIV RNA. Shimizu, Y.K. et al. (PNAS. Natl. Acad. Sci. USA 1993, 90: 6037-6041) determined the CID50 of an HCV strain to be 1 CID50/1 copy of RNA.
Eder et al. (The Role of the Chimpanzee in Research, Symp.
Vienna 1992, 156 to 165) were able to show that 20 copies of HBV
DNA/ml of plasma correspond to a CID50 of 1.
In the case of a plasma pool or other plasma starting materials, it is particularly necessary to take care that the virus load (virus contamination) is as low as possible, so that, if necessary, the virus contamination can be lowered at least to below the infectious dose by additional virus-inactivation steps or by measures for depleting viruses. It would be desirable that the viral contamination of the starting material be such, that the number of copies of the viral nucleic acid already is below the infectious dose for chimpanzees.
It is the object of the present invention to provide a drug containing one or more plasma derivatives, in which there no longer is any danger of a virus contamination with hematogenous viruses capable of reproduction, resulting from excessive contamination of certain starting batches.
A more specific objective is to provide a starting material or intermediate of assured quality, whose virus load must not exceed a specified maximum value.
According to the invention, this objective is achieved by a drug containing one or more plasma derivatives as active substance or as auxiliary ingredient, for which the starting material or the intermediates incurred in the preparation of the plasma derivatives are not contaminated by virus or whose load of one or more hematogenous viruses capable of reproduction does not exceed a defined limiting value, - the absence of a virus load of certain hematogenous viruses capable of reproduction being determined by an excess of virus-neutralizing antibodies in the starting material or in the intermediate, or by a protective immunity of the plasma donor at the time of the plasma donation, - otherwise the genome equivalents of the respective viruses of interest in the starting material or in the intermediate being determined by a quantifiable controlled and non-inhibited method for the detection or determination of nucleic acids, the thus quality-assured starting material or intermediate, respectively, for the preparation of the finished plasma derivative being subjected to at least one substantial virus depletion or virus inactivation step, and the finished, quality-assured plasma derivative obtained being worked up to a drug by known methods.
The accomplishment of the objective comprises the determination of the extent of the contamination or virus load present in the starting material, which virus load can no longer be eliminated by a method of inactivating or depleting the viruses. Thus, the problem is solved by determining the potential virus contamination in a starting material and by not processing those starting materials further or to exclude them from processing, as long as this high degree of contamination exists.
For this purpose, each plasma derivative starting material and possibly also for the intermediates incurred at the preparation of plasma derivatives which are to be subjected to a virus depletion or virus inactivation step, and finished plasma derivatives are to be examined and treated in such a manner, that it is ensured in a reliable manner that such drugs, prepared from blood plasma can no longer, not even sporadically, transmit hematogenous viruses capable of reproduction. In doing so, the starting material shall be examined by the use of selected amplification techniques in order to determine an upper limit of a possible virus load, which starting material or intermediate will still be subjected to at least one substantial virus inactivation or virus depletion step, respectively, in order to arrive at a drug which will not result in the transmission of hematogenous viruses.
According to the invention, the target nucleic acids which are to be detected during the determination of the genome equivalents, can be amplified by different amplification methods in blood, in plasma, in serum, or plasma factions. Preferably, however, polymerase chain reaction (PCR) or special types of PCR, respectively, are used as detection or determination methods. For the detection of specific viral genome sequences, the amplification process must be selective for the nucleic acid sequence to be amplified. The amplification of nucleic acids in the plasma pools of the invention can be accomplished by a series of amplification processes described in the literature.

The amplification of specific viral genome sequences requires a knowledge of the genome of the individual, yet very different viruses, in order to reproduce them and make them detectable.

In another aspect, the invention relates to a method of preparing a plasma pool which is quality-assured with respect to the contamination by hematogenous viruses capable of reproduction ("quality-assured plasma pool") comprising the steps of: (a) determining the absence of contamination of an individual plasma donation by hematogenous viruses capable of reproduction by the absence of markers which indicate a corresponding viremia, or by an - 6a -excess of virus-neutralizing antibodies in the starting material, or by a protective immunity of the plasma donor at the time of the plasma donation, and (b) determining the genome equivalents of hepatitis C virus (HCV) by taking samples from n individual donations, combining the individual donation samples to m sample pools and detecting the amount of viral HCV genomes or HCV genome sequences present in these sample pools by means of a method for the detection or determination of nucleic acids by polymerase chain reaction (PCR) using an internal standard, whereupon those individual donations (ng), whose detected amount of viral genomes or genome sequences in the sample pool lies below a defined limiting value, are combined into a quality-assured plasma pool, and those individual donations (na), whose detected amount of viral genomes or genome sequences in the sample pool is larger than or equal to said defined limiting value, are subjected to a further treatment or are eliminated, n and m being positive integers, and n is between about 2,000 to about 200,000.

In another aspect, the invention relates to a method for the preparation of a drug containing one or more plasma proteins which is quality-assured with respect to the contamination by hematogenous viruses capable of reproduction ("quality-assured plasma product drug") comprising the steps of providing a plasma pool obtained by a method as described above, and processing this plasma pool to a quality-assured plasma product drug by including in said processing at least one further virus depletion or virus inactivation step.

- 6b -Different amplification methods for nucleic acids are based on PCR. The PCR amplification method was first described in 1983 by Mullis et al. (US patents 4,683,195 and 4,683,202). Viral genome sequences can also be amplified by "nested PCR" (Mullis et al, Methods Enzymol. 1987, 155: 335-350) or by RT-PCR
(Powell, L.M., et al. Cell 1987, 50:831-840; Kawasaki, et al.
Proc. Natl. Acad. Sci. USA 1988, 85:5698-5702).
For the amplification and detection of RNA, the RNA must first be transcribed into DNA. This method is described in WO
91/09944 as so-called RT-PCR and involves the use of reverse-transcriptase.
The amplification products can then be analyzed by using labeled nucleotides or oligonucleotide primers in the elongation process and in the subsequent hybridizing or separation of the products by gel electrophoresis.
Alternative methods to PCR have also been described.
One of these methods for amplifying nucleic acids is LCR
(ligase chain reaction) according to EP 0 320 308 and EP 0 336 731 and Wu and Wallace (Genomics 1989, 4: 560 to 569).
Other enzymatic processes are NASBA (nucleic acid sequence based amplification), 3SR (self-sustained sequence replication) according to EP 0 310 229 and Guatelli, J.C. et al. (Proc. Natl.
Acad. Sci. USA 1990, 87:1874 to 1878) or TAS (transcription based amplification system) according to EP 0 373 960 and Kwoh, D.Y. et al. (Proc. Natl. Acad. Sci. USA 1989, 86:1173 to 1177).
In these methods, a series of enzymes, such as, e.g., a DNA
polymerase or an RNA polymerase, is used either simultaneously or stepwise in the amplification.
Other amplification processes are based on the use of replicases of the RNA bacteriophage Q(3 according to EP 0 361 983 and Lizardi et al. (TIBTECH 1991, 9: 53 to 58).
A further method describes the signal amplification by branched DNA oligonucleotides instead of the extracted nucleic acid (branched DNA signal amplification) according to Urdea, M.S. et al. Nucleic Acids Res. Symp. Ser. 24 Oxford 1991, Pachl, C.A. et al. XXXII Interscience Conference on Antimicrobial Agents and Chemotherapy. Anaheim, October 1992 (abstract 1247).
The EP 0 590 327 A2 discloses an analytical method for blood samples, which provides for the determination of viral RNA or DNA of, for example, hepatitis C virus, HIV, or hepatitis B
viruses. The detection limit for a test for determining the hepatitis B virus genome is 1,500 copies (150,000 copies/ml), if the evaluation is conducted electrophoretically after staining the gel. The blood samples partly are dried spots of blood.
After the analysis, no provision is provided for further processing of the samples.
Methods for preparing hyperimmunoglobulin preparations against certain viruses depart from blood or plasma that originates from donors who have been immunized actively or have already overcome a disease and therefore exhibit a protective immunity. The blood of plasma donors who have been vaccinated against pathogenic viruses contains a corresponding antibody titer. In contrast to antibodies indicating viremia, such as HIV
antibodies, these antibodies are desirable.
The starting material or intermediate of assured quality, used to prepare the drug according to the invention thus either contains an excess of virus-neutralizing antibodies to a virus of interest or no detectable amounts or amounts below a limiting value of genomes or genome fragments of possibly present hematogenous viruses capable of reproduction.
The plasma derivatives may be contained in the drug as active substance or also as auxiliary ingredients. Active substances include, for example, clotting factors, immunoglobulins, fibrinolysis factors, enzyme inhibitors or other enzymes or zymogenes or mixtures thereof present in the plasma. Auxiliary ingredients include albumin or other stabilizers, various inhibitors, co-factors, etc.
In principle, any material from which a particular manufacturing process is started, such as a plasma pool, a cryopoor plasma, or a Cohn II + III paste is to be regarded as a starting material. A series of possible starting materials are cited in an article by Heide et al. ("Plasma Protein Fractionation" in "The Plasma Proteins", Frank W. Putnam, ed.
Academic Press New York, San Francisco, London 1977, page 545 to 597).
Intermediates are products derived from a starting material in a particular manufacturing process which have been obtained by the manufacturing steps provided, e.g., a prothrombin complex in the preparation of Factor IX with plasma or cryopoor plasma as the starting material.
A finished plasma derivative, which is worked up with routine manufacturing methods into a drug, is prepared from the starting material, optionally by way of intermediates, by the product-specific manufacturing process. Of course, two or more finished plasma derivatives can be combined together during this working up.
Preferably, the virus contamination which is not present or does not exceed the defined limiting value, exists for at least two viruses, preferably selected from the group consisting of HIV, HAV, HBV and HCV, and particularly of HIV and HCV.
Moreover, the present invention is not limited to the viruses mentioned above; rather, the virus contamination, which is not present or does not exceed a defined, limiting value, can be determined for any hematogenous virus, e. g., parvovirus, hepatitis non-A-non-B virus and for newly discovered viruses which can be transmitted by blood or by products obtained from blood and which turn out to be high risk viruses for man.
Preferably, the virus contamination which is not present or does not exceed a defined limiting value, will be determined for all known hematogenous viruses, provided that the presence of these viruses in the drug would represent a danger for the patient.
The limiting value of the permissible contamination by hematogenous viruses capable of reproduction, which in any case should not exceed this value, depends primarily on the potential of the detection reaction and on the resources, which are suitable for evaluating the starting material and the intermediate, respectively. The detection limit depends, for example, on the volume of sample used for the detection reaction. For example, if no viral genome equivalent can be detected in a 20 l sample of a single donation and the detection method used is capable of detecting a single genome equivalent in the sample, it may be concluded that the maximum contamination of the individual donation is less than 50 genome equivalents per ml of plasma. If a negative detection result is obtained and a further 20 l of sample are tested and again no viral genome equivalent is detected, it may be concluded that the maximum load of the single donation is less than 25 genome equivalents per ml of plasma.
Maximum values of 500 genome equivalents, particularly maximum values of 200 genome equivalents, preferably maximum values of 100 genome equivalents and especially maximum values of 50 genome equivalents per ml of starting material or of intermediate have proven to be practical limiting values for the permissible contamination by hematogenous viruses capable of reproduction.
For a preferred assured starting material or intermediate according to the invention, a virus inactivation or virus depletion achieved by at least one method giving a reduction factor of at least 4 is achieved in the preparation of the drug from this starting material or intermediate of assured quality.
The plasma protein-containing drug according to the invention has the advantage that, on the basis of the assured, limited contamination of the starting material of the plasma protein by one or more hematogenous viruses capable of reproduction, a protein-preserving method for inactivating or -depleting the virus is sufficient for obtaining the plasma protein in a virus-safe form. Preferably, a protein-preserving method is carried out which has a reduction factor of not more than 4, in order to inactivate or eliminate any virus load of possibly present hematogenous viruses capable of reproduction. A
protein-preserving method enables the activity and integrity of a plasma protein to be maintained to the greatest extent possible. A method is regarded as protein-preserving, in which 50% or more and preferably 80% or more of the (specific) activity of the protein to be recovered is maintained. Even a single virus inactivation or virus depletion in the course of the manufacturing process for the drug according to the invention is sufficient for completely inactivating or eliminating, respectively, any viruses possibly present.
It has been shown that, for a starting material or an intermediate, respectively, which is used for the preparation of plasma derivatives or drugs and to which a test virus has been added, the virus load can be decreased greatly by a virus depletion, which precedes a virus inactivation step provided for (for example, EP-A-0 506 651). The depletion can be carried out by known methods, such as nano filtration, precipitation reactions, dialysis, centrifugation, chromatographic purification steps, etc. For inactivating viruses, a series of physical, chemical or chemical/physical methods are known, which comprise, for example, a heat treatment, such as that of EP-A-159 311 or EP-A-0 637 451, a hydrolase treatment according to EP-A-0 247 998, a radiation treatment or a treatment with organic solvents and/or tensides, e.g. that of EP-A-0 131 740.
Further suitable virus inactivation steps during the preparation of plasma fractions and drugs are described in EP-A-0 506 651 or in WO 94/13329. Different inactivation methods are analyzed in Eur. J. Epidermal. 3 (1987), 103 - 118; the reduction factor is dealt with in the ECIII/8 115/89-EN guideline of the EC
Commission.
The inventive measures make possible a pooled starting material, particularly a plasma pool, or an intermediate, respectively, of outstanding quality with increased safety.
Preferably, plasma donors are selected for the preparation of the plasma pool quality-assured according to the invention, who have been actively immunized against or are immune to one or several of the viruses, who thus exhibit a protective immunity, for example due to an appropriate vaccination. The plasma donors preferably have been vaccinated against a hepatitis virus, particularly against the hepatitis A virus, in order to exclude a corresponding infectious potential of the plasma.
If plasma is the starting material, preferred embodiments of the quality assurance according to the invention consist in that - the genome equivalents of all the viruses of the group HIV, HBV, HCV, parvovirus and HAV are determined, - the genome equivalents of all the viruses of the group HIV, HBV, HCV and parvovirus, as well as an excess of HAV antibodies are determined, - the genome equivalents of all the viruses of the group HIV, HBV and HCV, as well as an excess of HAV and parvovirus antibodies are determined, - the genome equivalents of all the viruses of the group HIV, HBV and HCV, as well as an excess of HAV antibodies are determined, - the genome equivalents of all the viruses of the group HIV, HBV and HCV, as well as an excess of parvovirus antibodies are determined, - the genome equivalents of all the viruses of the group HIV, HBV and HCV are determined, - the genome equivalents of all the viruses of the group HIV
and HCV are determined, - the genome equivalents of all the viruses of the group HIV
and HCV, as well as an excess of HBV antibodies, are determined.
The quality-assured plasma pool according to the invention can be obtained, for example, also by selecting plasma donors, who have been vaccinated against hepatitis A and hepatitis B
viruses and who therefore, because of their anti-infectious immunity, can have an antibody titer in their blood. These antibodies have been formed due to active immunization and are therefore not indicative of viremia. The plasma donations are examined individually for the absence of markers which indicate a corresponding viremia. For this purpose, for example, a test for determining hepatitis C virus antibodies and, optionally, HIV antibodies is carried out with the help of a validated ELISA

- -test system. Certain liver values, such as ALT and GPD values, are also markers for the hepatitis C virus. If the absence of the viral markers in the donor plasma is confirmed, proof of the absence of a genome or genome fragment of AIDS viruses (HIV- 1) and, optionally, hepatitis C virus in a plasma pool of the individual plasma donations is furnished as a further criterion for selection. This procedure is recommended in spite of the confirmation that this plasma donation does not contain any antibodies against HIV, which are indicative of a viral infection. The time from infection with an HIV virus until the possible detection of corresponding antibodies may, especially for these viruses, be several months. A plasma pool which was tested merely for the absence of HIV antibodies, can therefore not be made available as a controlled plasma pool which does not contain any infectious viruses capable of reproduction or contains them below a defined limiting value.
One of the measures, according to the invention for assuring the limited contamination by hematogenous viruses capable of reproduction comprises, aside from the quantifiable, controlled and non-inhibited method of detecting or determining nucleic acids, is detection of virus-neutralizing antibodies in the plasma pool according to the invention. Validated test systems, such as, e.g., appropriate enzyme immune tests, are also to be used for determining the antibody titer. The samples used for the method can optionally be lyophilized and subsequently reconstituted.
Besides plasma pools, cryo precipitates or other early intermediates are considered as starting materials for this invention. Early intermediates are those which are obtained from human plasma in the production of drugs, which will still be subjected to virus depletion or virus inactivation. What has been stated here in connection with the plasma pool, particularly the possibility of combining like-wise assured, smaller amounts into larger ones, also applies - as far as possible - according to the invention to other starting materials. Therefore the mixing of quality-assured starting materials or intermediates, respectively, of the same kind into a larger pool of quality-assured starting materials or intermediates, respectively, is provided for according to the invention.
Such high quality criteria for a starting material or an intermediate, respectively, have not yet been met. On the one hand, it has not been considered to be necessary to exclude completely a viremia caused by a plasma pool contaminated with a virus. Plasma pools are used primarily for the preparation of plasma derivatives, that is, of pharmaceutical products on the basis of plasma proteins. In this preparation, however, an additional measure for inactivating and/or depleting viruses potentially present must be carried out, which reduces the risk of transmission of pathogenic viruses by the finished products by a multiple, so that the usual assays prescribed according to the state of the art are regarded as adequate.
According to the invention, only those starting materials or intermediates, respectively, which exhibit an excess of virus-neutralizing antibodies or an assured, limited load of viral genome sequences are used for the further working up of the product. Starting material which does not satisfy the requirements according to the invention, and it is unsuitable for further processing into drugs within the scope of the present invention, can nevertheless not be described demonstrably as infectious, since the amount of genome equivalents, determined with a nucleic acid amplification method, only gives the upper limit for the contamination by the viruses capable of reproduction. The amount of genome equivalents determined therefore gives the "true value" of the load of viruses capable of reproduction only when all genome equivalents originate from active viruses.
From several, starting materials assured according to the invention, a larger amount may be obtained by mixing, which then complies with the same safety criteria.
In the case of a plasma pool, the latter may be provided as a small pool which is composed of about 2 to about 20 individual plasma donations. At least 10 small pools can be combined into a minipool of about 20 to 200 and preferably about 200 individual plasma donations. The next order of magnitude is a macropool of about 200 to 2,000 and preferably of about 2,000 individual plasma donations, which optionally is prepared by mixing at least 10 minipools. Several macropools can be combined into a multimacropool of up to 200,000 individual donations.
According to the invention, the evidence for viral genomes or genome fragments can be furnished for each of these pool sizes. By testing the small pools and the subsequent combination of the checked small pools into a larger pool, for example, a minipool, a quality never described before is obtained even by a larger pool.
A special embodiment of the invention therefore consists in a plasma pool obtained by mixing minipools, which preferably consist of about 200 individual donations, to a macropool, which preferably consists of about 2,000 individual donations.
A further preferred embodiment consists of a plasma pool, which is characterized in that a macropool is combined by mixing with any desired number of other macropools to a multimacropool of up to 200,000 individual donations.
Yet another preferred embodiment consists in a plasma pool, the minipools of which are obtained by mixing small pools consisting of two to about 20 individual donations.
In selecting a starting material for the fractionation of blood plasma for preparing plasma fractions or finished plasma derivatives, respectively, and drugs, a relatively large amount is to be preferred for reasons of economy. Until now, however, a plasma pool of the magnitude of a macropool or of a multimacropool, which could be regarded as not contaminated by viruses due to the detection of viral genomes or genome fragments, has not been available. It is not sufficient to furnish proof only for a multimacropool, since too great a dilution effect arises from the mixing together of more than 2,000 individual plasma donations, and the number of genomes to be detected very frequently is smaller than the limit of detection of a test method. By the testing of small sub-units and the subsequent combining into larger units, this problem of detectability is overcome and an economically interesting amount is obtained.
The quality-assured starting material according to the invention is outstandingly suitable for the preparation of fractions containing plasma proteins as intermediates or for the preparation of finished drugs.
The measures provided for the starting material, particularly for the plasma pools, can of course be used analogously for plasma fractions of all types. According to a further aspect, therefore, the present invention also relates to quality-assured, finished plasma derivatives, the contamination of which by reproducible hematogenous viruses is safely limited through the use of quality-assured starting material.
Moreover, the present invention of course also relates to finished plasma derivatives obtained according to a preparation method from a starting material quality-assured according to the invention, or from one or several intermediates whose quality is assured according to the invention.
The drugs produced from the finished plasma derivatives prepared according to the invention by pharmaceutical formulation are also included in the present invention.
Moreover, the present invention relates to a method for the preparation of a drug containing one or more plasma derivatives from a quality-assured starting material or from a quality-assured intermediate obtained during the preparation of the plasma derivatives, the quality-assured starting material or intermediate not being contaminated by one or more hematogenous viruses capable of reproduction or being contaminated by an amount which does not exceed a defined limiting value, and the defined limiting value being selected in the case of the determination of the genome equivalent of the respective virus by a quantifiable, controlled and not inhibited method for the detection or determination of nucleic acids according to one or more of the following criteria:
- a detection limit of the nucleic acid amplification method(s) of at least 10,000 copies of selected nucleic acid sequences;
- a certain number of genome equivalents, particularly a number of below 500 genome equivalents, preferably below 200 genome equivalents, more preferably below 100 genome equivalents and especially preferably below 50 genome equivalents per ml of starting material or intermediate.
According to the invention, other permissible selection criteria with respect to the limiting values are:
- a limiting value determined by means of a cell culture test, preferably a TCID50 per ml or the genome equivalent contained in this amount, respectively, - a limiting value determined by means of an animal model, preferably a CID50 per ml, or the genome equivalent contained in this amount, respectively.
These limiting values are preferred because of their practical relevance (dependent on the detection potential of an examining method) and their biological relevance (particularly the TCID and CID values).
The highly sensitive PCR method has the disadvantage that even very slight amounts of certain impurities which can get into the test material, will also be amplified, which may give rise to falsely positive results.
A preferred embodiment of the method according to the invention is characterized by the use of more than one system of detection or when determination is used for nucleic acids, the systems of detection or determination preferably being selected such that the one system excludes falsely positive results and an other system, excludes falsely negative results.
Preferably, at least two different PCR methods are used, at least one method being used for screening and at least one method used for confirmation.
In the case of the DTS-PCR (Dual Targeting Southern Blot PCR), the amplification of the extracted nucleic acids is followed by a separation of the synthesized nucleic acids by agarose gel electrophoresis and subsequent Southern Blot after hybridization with a digoxigenin (DIG)-labeled probe. The evaluation is carried out by way of a densitometric determination of the band intensity. To exclude falsely negative results, which can be caused by a mis-priming between PCR
primers and template because of a sequence heterogeneity, the nucleic acid extracts are amplified and analyzed once more in a second PCR with further primers, which differ from the first pair of primers. The DTS-PCR is checked by the addition of a synthetic nucleic acid as internal standard and falsely negative results are excluded.
In order to additionally verify the results obtained, for example, in the DTS-PCR, the LIF-PCR (laser-induced fluorescence PCR) is preferably used as the further method.
By using non-radioactively-labeled primers (preferably, primers labeled with a fluorescent dye), the PCR products can be detected by LIF-PCR. The detection of the amplification products can, however, also be simplified by the incorporation of non-radioactively-labeled nucleotide analogs during the elongation reaction into the newly synthesized nucleic acids. In LIF-PCR, the nucleic acid is amplified in the presence of fluorescence-labeled primers and the amplification products are subsequently separated by PAGE. For each sample of the LIF-PCR, additional negative and positive controls are carried out. The detection and quantification of the PCR products is accomplished by means of a gene scanner. In particular, falsely negative results are excluded and positive results are confirmed by the internal double standardization of the LIF-PCR.
According to the invention, falsely positive or falsely negative results can be excluded through the use of positive and negative controls. The described combination of two different PCR methods, particularly of the DTS-PCR and the laser-induced fluorescence-PCR (LIF-PCR) enables large numbers of samples to be tested in routine controls, and thus primarily falsely negative results can be excluded and falsely positive results can be avoided.
An additional aspect of the invention resides in concentrating the test samples, whereby even lower loads of viral genome sequences can be detected. The sensitivity of the method according to the invention can be increased by additional measures, by concentrating the plasma samples or the genome equivalents contained therein, a ten-fold to one hundred-fold increase in the sensitivity being preferred.
Thus, in a preferred embodiment of the method according to the invention, the samples from the starting materials (e.g., individual donations or sample pools) or the intermediate or the genome equivalents contained therein are concentrated, preferably by lyophilization, adsorption or centrifugation.
According to the invention a method is used which allows for a quantifiable, controlled and non-inhibited procedure for detecting or determining genome sequences. However, when determining the limited load of viruses capable of reproduction in the plasma pool by detection of viral genomes or genome sequences, it may happen that certain inhibitors of the detection method are present in the samples, so that a non-inhibited amplification is not possible right away.
It has been proven that the virus contamination of a plasma pool, determined by a PCR method, may be underestimated. Factors may be present in the plasma pool which can affect the sensitivity of a PCR determination method appreciably (Nucleic Acids Research 16 (21), 10355 (1988)). These so-called inhibitors of the PCR reaction are removed by the method according to the invention before the detection reaction or are excluded during the detection reaction by the use of a genome standard. The presence of such inhibitors is excluded if the internal standard is amplifiable and detectable at the appropriate rate in the pool.
It is well known that substances occurring in the plasma, such as heparin, high salt concentrations and polyethylene glycol, can inhibit the PCR reaction (BioTechniques 9(2), 166 (1990) and Journal of Clinical microbiology 29(4) 676 - 679 (1991)).
Thus, a preferred embodiment of the method according to the invention is characterized in that inhibitors of the amplification possibly present are removed from or depleted in the samples of the individual donations or in the sample pools.
These additional methods for removing or neutralizing amplification inhibitors in the blood, plasma or serum, comprise, for example, ultracentrifugation of the samples and decanting the supernatant with inhibitors contained therein and the extraction of the nucleic acid, as well as the treatment of the samples with heparinase, polyamines or the pre-purification of the nucleic acids by means of HPLC. Unrestricted amplification of the nucleic acid is ensured by the higher purity of the nucleic acids.
According to a preferred variant of the method, primer pairs, specific for several viruses, are used in the amplification test, so that the presence of several types of viruses can be assayed simultaneously. In a particularly preferred test, two or more viruses, selected from the group of HIV, HAV, HBV and HCV are assayed.
In particular, RNA viruses are subject to a high mutation rate, as a result of which variants or subtypes of a known strain may occur very rapidly, whose genome sequence differs more or less from that of the wild type sequences. However, for a sensitive amplification method, such as, e.g., PCR, a particularly high efficiency of the amplification is a prerequisite for the detection and quantitative determination of a very small copy number of a viral genome sequence, in order to determine the copies actually present in a sample. Insufficient annealing of the primers with the template decreases their efficiency. Appropriate care in selecting the primers must therefore be ensured.
Preferred primer pairs are selected such that they encode conserved genome sequences of the individual hematogenous viruses to be assayed, the suitability of the primers being established on appropriate samples of a representative sample cross section of the viruses to be investigated.
Besides the previously identified, known genome sequences of HIV, HCV and HBV, their sub-types can also be detected by selecting the primers for the amplification reaction. According to the invention, this is accomplished in that the primers used are selected from a highly conserved genome region of the respective virus. Thus, only primers whose specificity for all relevant sub-types has been confirmed will be used for the selection of the inventive starting material or intermediate by means of LIF-PCR and DTS-PCR.
Within the scope of epidemiological monitoring, newly occurring viral strains of the target viruses are assayed to see whether they contain the corresponding templates, against which the primers used are directed. On the basis of changes found within a known group of viral strains, it will then be possible to synthesize appropriate new primers for the quantitative detection of existing copies of a new viral strain. Therein, the sensitivity of the assay with the newly synthesized primers should be at least equal to that of the primers already tested.
Appropriate, new primers for conserved nucleic acid sequences must be developed for newly occurring target viruses.
To check the method of detecting or determining nucleic acids in a sample, one or several internal standards or reference preparations are added to a sample, preferably before or while the method is carried out, the standards being determined or detected simultaneously with any viral genomes or genome sequences which may be present, in one and the same assaying vessel.
This procedure offers the possibility of an even more exact quantitation of the content of viral nucleic acids or even better estimation of the detection limit of the amplification method, particularly if the internal standard(s) is (are) used in an amount close to the detection limit of the respective amplification reaction.
The individual donations, combined according to the invention into a quality-assured plasma pool, can be combined with further, like-wise quality-assured plasma pools, so that a quality-assured minipool, macropool or multimacropool is provided. The advantages of a larger pool, prepared from quality-assured smaller pools, have already been sufficiently described.
According to a further aspect, the present invention relates to a method of preparing a plasma pool as a quality-assured starting material with an assured, limited contamination by viruses capable of reproduction, from two or more individual donations, which is characterized by the following steps:
- taking samples from n individual donations, - combining the individual donation samples to m sample pools and - detecting the amount of viral genomes or genome sequences present in this sample pool by means of a quantifiable, controlled and non-inhibited method for the detection or determination of nucleic acids, whereupon those individual donations (ng), whose detected amount of viral genomes or genome sequences in the sample pool lies below a certain limiting value, are combined into a quality-assured plasma pool, and those individual donations (na), whose detected amount of viral genomes or genome sequences in the sample pool is larger than or equal to the limiting value, are subjected to further treatment or are eliminated, n and m being positive integers. A further treatment of the individual donations can be carried out, for example, by depleting viral genome equivalents or by admixing virus-neutralizing, antibody-containing fractions.

In a further method step, also for the further treatment of the eliminated na individual donations, samples may again be taken, and these individual donation samples may be combined to ma sample pools, na and ma being positive integers with ma- 2 and the ratio of ma:na being larger than the ratio of m:n. The amount of viral genomes or genome sequences in this sample pool may again be detected by means of a quantifiable, controlled and non-inhibited method for the detection or determination of nucleic acids, whereupon those individual donations, whose detected amount of viral genomes or genome sequences in the sample pool lies below a certain limiting value, are combined into a quality-assured plasma pool and those individual donations, whose detected amount of viral genomes or genome sequences is equal to or larger than the limiting value, are subjected to a further treatment or are eliminated. This method can be repeated until the number of individual donations which are to be further treated or eliminated has reached, or fallen below, a fixed number.
By these means, a simple method is provided to permit any potential individual plasma donation with an impermissibly high load of viruses capable of reproduction to be eliminated with a few tests from an almost infinitely large plasma pool. On the other hand, suitable individual donations, which have been eliminated by the methods used until now, together with a virus-contaminated individual donation, if analyzed jointly, are recognized by simple method steps and can be processed to a finished plasma derivative.
Thus, a further objective of the invention can be reached, i.e. to discover a single infected donor even in a large plasma pool in a simple and cost-saving manner in order to exclude him from further donations and to pass him on immediately to medical help. With that, the safety of the donor colony is increased.
The number of individual donations comprised by the plasma pool subjected to the method of the invention, usually amounts to 2 to 200,000 (n = 2 to 200,000) and preferably to 20 to 20,000, more preferably to 200 to 2,000, and especially to 200.
The number m lies above all between 1 and 100,000, and preferably between 2 and 1,000. The number fixed for the individual donations that are to be treated further or eliminated practically amounts to 100, preferably to 10 and particularly preferably to 1. Thus, in the last case, the virus-contaminated individual donation is identified as such. In practice, however, this is indicated only for reasons of identifying the plasma donor; the number is therefore usually fixed between 10 and 100.
If necessary, the sample pools can be assayed for virus-neutralizing antibodies to the viruses to be assayed in addition to the detection or determination of nucleic acids.
As a rule, with those sample pools, in which antibodies to viruses have been found, the respective individual donations are combined and used further: Those individual donations, from which no antibodies have been detected in the sample pool, are then passed on to further treatment or eliminated.
Moreover, the present invention relates to the quality-assured starting material or intermediate, in particular the plasma pool, prepared within the scope of the method according to the invention, as well as to the quality-assured finished plasma derivative, which preferably has been assayed once more for viral genome equivalents or for the presence of virus-neutralizing antibodies, respectively.
The present invention also comprises a drug obtainable from a quality-assured, finished plasma derivative from human plasma by pharmaceutical formulation steps.
According to a further aspect, the present invention relates to a method for the preparation of drugs containing one or more plasma derivatives, which are free of various hematogenous viruses capable of reproduction, which method is characterized by the following method steps:
- providing a starting material or an intermediate incurred during the preparation of the plasma derivatives and derived from human plasma, - assuring the quality of the starting material or intermediate by demonstrating the absence of viral contamination by hematogenous viruses capable of reproduction or by determining that such contamination is present in an amount which does not exceed a particular limiting value, - the absence of contamination by certain hematogenous viruses capable of reproduction being detected by an excess of virus-neutralizing antibodies in the starting material or intermediate, respectively, or by a protective immunity of the plasma donor at the time of the plasma donation, - otherwise the genome equivalents of the respective viruses of interest being determined in the starting material or in the intermediate, respectively, - subjecting the thus quality-assured starting material or intermediate, respectively, to at least one further substantial virus depletion or virus inactivation step before the finishing of the plasma derivatives and - working up the quality-assured, finished plasma derivative thus obtained by methods known per se into a drug.
In a preferred method for preparing drugs from human plasma, a quality-assurance step is employed for at least one intermediate in the course of the production process.
According to a preferred embodiment, the quality assurance step is carried out on the intermediate, which is subjected to a substantial virus depletion or virus inactivation step. Most preferred is the quality assurance of each intermediate, which is to be subjected to a susbtantial virus depletion or virus inactivation step.
The invention will be described by the following examples, to which it shall not be limited.
Examples:
1. General Principle of PCR
1.1 General Principle of the DTS-PCR (Dual Targeting Southern Blot) Nucleic acids are amplified with PCR by means of a first specific primer pair, the PCR products are subsequently separated electrophoretically on an agarose gel and blotted on a filter. The filter-bound PCR products are hybridized with a digoxigenin (DIG)labeled probe, which binds within the amplified genome sequence, and detected after a development reaction. The band intensity is determined quantitatively by means of a densitometer. In a further PCR using a second primer pair differing from the first primer, the nucleic acid is amplified and also detected by Southern blot analysis. Due to the PCR of two different regions of a genome sequence and their visualization by means of hybridization, falsely negative results can be reduced and positive results can be verified.
1.2. General Principle of LIF-PCR (Laser-Induced Fluorescence Labeled) Nucleic acids of various origins were amplified by means of PCR using primers which have fluorescent groups. The analysis and quantitation of the amplified products obtained was carried out with the help of an automatic DNA sequencer with laser-induced fluorescence measuring equipment (DNA Sequencer 373A
with Gene Scan software from Applied Biosystems). This instrument is able to separate the fluorescence-labeled PCR
products according to size by means of gel electrophoresis in a polyacrylamide gel under denaturing conditions and to determine their amount quantitatively. The copy number of certain sequences in the sample is determined on the basis of the intensities obtained for PCR products of nucleic acids, which are to be quantified, and of at least two internal standards.
1.2.1. Extraction of the DNA of Viral Particles 500 l of the sample were centrifuged for 20 minutes at 70,000 rpm in an ultracentrifuge. The pellet is dissolved in 500 l of 10 mM Tris/HC1, pH 8.0, and 10 l of proteinase K
(Boehringer Mannheim, 20 mg/ml) as well as 10 l of 20% SDS.
After an overnight incubation at 37 C or a 4-hour incubation at 56 C, a known amount of standard nucleic acid is added, after which the sample is successively extracted with phenol and chloroform, and 10 l of glycogen (Boehringer Mannheim, 20 mg/ml) are added. Subsequently, the product is precipitated with ethanol, centrifuged, and the pellet is washed and finally re-dissolved in water.
1.2.2. Extraction of Residual Viral DNA
500 p,l of the sample are dissolved in 5 l of 10 mM
Tris/HC1, pH 8.0, and 10 l of proteinase K (20 mg/ml). After an overnight incubation at 37 C or an incubation for 4 hours at 56 C, a known amount of standard nucleic acid is added, the sample is successively extracted with phenol and chloroform, and i1 of glycogen (20 mg/ml) are added. Subsequently, the product is precipitated with ethanol, centrifuged, and the pellet is washed and finally re-dissolved in water.
1.2.3. Extraction of the RNA for the PCR
1 ml of plasma or plasma diluted with PBS is centrifuged for 20 minutes at 70,000 rpm. The supernatant was removed by suction. The pellet was taken up in 1 ml of guanidium isothiocyanate solution (RNAzol of Biotex) and 5 Rl of 1 mg/ml of tRNA from yeast and a predetermined amount, such as 20 l, of standard RNA were added. A specified number, such as 400 and 1,200 copies, of the minus RNA standard and the plus RNA
standard are added and vortexed. The solution is heated for 10 minutes at 70 C, after which 1/10 volume of chloroform is added and the mixture incubated on ice for 10 minutes. This is followed by 5 minutes of centrifuging in a table-top centrifuge, and the supernatant is transferred to new tubes. 500 l of isopropanol are added, and the temperature is maintained at -80 C for 15 minutes. This is followed by 10 minutes of centrifuging, washing twice with 70% ethanol, and the pellet is taken up in 50 l of water. For the RT-PCR, 5 Rl were used.
1.2.4. PCR for the Detection of DNA
The PCR formulation contains in a known manner an aliquot of the extracted nucleic acid, PCR buffer (Boehringer Mannheim), MgC12, dNTPs, primer, Taq*polymerase (Boehringer Mannheim, 5.0 units/ l) and water. The PCR is carried out according to the instructions of the manufacturer of the buffer and the enzyme, and according to conventional procedures, respectively (Mullis et al., Methods in Enzymology 155: 335, 1987)_ 1.2.5. RT-PCR for the Detection of HIV RNA
The RT-PCR formulation contains, in the usual manner, an aliquot of the extracted nucleic acid in RT buffer from Perkin-Elmer, MgC12, dNTPs, the RT primer and rT.th. polymerase (Perkin-Elmer, 2.5 units/ l) and water. The RT is carried out according to the instructions of the manufacturer of the buffer and the enzyme, and according to conventional procedures, respectively (Mullis et al., Methods in Enzymology 155: 335, 1987) in a PCR apparatus (GeneAmp PCR System 9600 of Perkin-Elmer).
For the PCR, MgC12, a chelate buffer and the second primer are further added. The PCR is then carried out as described above.
1.2.6 Analysis of the Products For determination and quantification of the PCR products, 0.5 to 1.0 Rl are taken from the PCR solution and analyzed in an *Trade-mark Applied Biosystems 373 A instrument in accordance with the instructions of the manufacturer.
1.3. Southern Blotting and Detection of the DTS-PCR
Products Agarose gels were prepared for the gel electrophoretic separation of the PCR products at a concentration intended for the respective product. The gel run was carried out in lx running buffer for electrophoresis. The PCR product samples were mixed with Ficoll*/bromophenol blue in 0.5 x running buffer and the prepared gel slots were charged. After the gel run, the PCR
products were denatured by incubation of the gel in 0.5 M
NaOH/1.5 M NaCl for 1 hour and subsequently neutralized. The DNA
was transferred to the filter (DuralonTM, Stratagene, La Jolla, California), and the nucleic acid was bound to the membrane by UV cross linking. The membrane was incubated for 1 hour at 68 C
in pre-hybridization buffer (6 x SSC, 0.5% SDS, 5 x Denhardt's, 100 Rg/ml of denatured DNA). The hybridization took place with a dioxigenin-labeled DNA probe and subsequent visualization of the bands by immune staining was achieved by means of alkaline phosphatase-conjugated antibody, nitro blue tetrazolium (NBT) and 5-bromo-l-chloro-3-indole phosphate (BCIP)_ The blots were evaluated by densitometry.
1.4. Primers Used The primers used for the LIF-PCR are summarized in Tables 1.1_ and 1.2.
The primers used for DTS-PCR, are SK38, SK39, SK145 and SK431 (Ratner et al., 1985) for HIV; 32, R3, CHAA, Rl, ConAl, ConaA2 and ConA (obtainable from Chiron) for HCV; and HBVla and HBVlb (Kaneko et al., 1989), as well as HBV4a and HBV4b (Carman et al., 1989) for HBV.

*Trade-mark Table 1: Primers and Standard Plasmids Used for LIF-PCR and DTS-PCR Table 1 Table 1.1: Primers for the Amplification and Detection in LIF-PCR
----------------Name of Oligo-nucleotide Orientation Sequence(5'-3') Virus Position SK38(+) ATAATCCACCTATCCCAGTAGGAGAAAT HIV-1 1551-1568b SK39(-) TTTGGTCCTTGTCTTATGTCCAGAATGC HIV-1 1665-1638b HCVPT4 CGGTTCCGCAGACCACCTATG HCV 158-139c +1780B CATTGATCCTTATAAAGAATTTGGAGC HBV 1780-1806d b numbering according to Ratner et al. (Nature 313: 277-284, 1985) C numbering according to Han et al. (PNAS 88:1711-1715, 1991) d numbering according to Fujiyama et al. (Nucleic Acids Res.
11:4601-4610,1983) Table 1.2.: Standard Plasmids for LIF-PCR

Name Deletion/Insertion Virus pgagl HIV-1 pgag-15 del. 1593-1607b HIV-1 pgag+12 ins.+l2bp Pos. 1593b HIV-1 pHCV-wt HCV
pHCV -7bp del. 126-1350 HCV
pHCV +8bp ins. +8bp Pos. 126c HCV
pHBV -wt HBV
pHBV -9bp del. 1868-1876d HBV
,pHBV +12b ins.+l2Pos.1868d HBV
b numbering according to Ratner et al. (Nature 313: 277-284, 1985) C numbering according to Han et al. (PNAS 88:1711-1715,1991) d numbering according to Fujiyama et al. (Nucleic Acids Res. 11:
4601-4610, 1983) Example 2:
2.1. Quantitating HIV RNA in Plasma Samples from Donors by LIF-PCR and DTS-PCR
A plasma donation was taken from HIV seronegative, healthy test subjects and HIV seronegative p24 antigen-positive primary infected test subjects. Plasma samples of the donors were tested by means of LIF-PCR and DTS-PCR. Sample testing by means of DTS-PCR was carried out with the primer pairs SK145/431 (primer pair 1) and SK38/39 (primer pair 2) (Table 1.1); samples with positive hybridization signals were further tested by means of LIF-PCR. For quantitation by means of LIF-PCR, the primers SK38 and SK39 (Table 1.1.) were used which bind in the cDNA sequences of HIV-1 and give a 115 bp PCR product by means of RT-PCR of the wild type RNA. The standard plasmids, pgagl, pgag-15 and pgag+12 (Table 1.2.) were used, resulting in 115 bp (pgagl), 100 bp (pgag-15) and 127 bp (pgag+12) RT-PCR products. The standard plasmids were coamplified and coanalyzed on the Gene Scans and the copy-number/ml determined. The results of the quantitative evaluation are summarized in Table 2.
Table 2 Test Subjects LIF-PCR DTS-PCR
Copies/ml PCR/Primer PCR/Primer pair 1 pair 2 Hybridization Hybridization Signal Signal HIV-sero-/ 24 positive #1 3.4x105 + +
HIV-sero-/p24 positive #2 2.8x105 + +
HIV-sero-/p24 positive #3 2.7x106 + +
HIV-sero-/p24 positive #4 1.7x107 + +
HIV-sero-/p24 positive #5 5.5x105 + +
HIV-sero-/p24 positive #6 8.6x106 + +
HIV-sero-/p24 positive #7 2.3x107 + +
HIV-sero-/p24 positive #8 4.7x105 + +
With HIV seronegative, p24-antigen-positive plasma donors, the minimum contamination was determined to be 2.8 x 105 and the maximum 2.3 x 107 copies/ml.

-2.2. Quantitation of HCV RNA in Plasma Samples from Donors by LIF-PCR and DTS-PCR
A plasma donation was taken from HCV-seronegative, healthy test subjects and from HCV primary infected test subjects.
Plasma samples from the donors were tested by means of LIF-PCR
and DTS-PCR. The DTS-PCR testing of the samples was carried out with the primer pairs 32/R3 (primer pair 1) and CHAA/R1 (primer pair 2) (Chiron); samples with positive hybridization signals were further tested by means of LIF-PCR. For quantitation by LIF-PCR, the primers HCV32 and HCVPT4 (Table 1.1.) were used, which bind in the cDNA sequences of HCV and provide a 114 bp product derived from the wild type RNA by RT-PCR. As the standard plasmids, pHCVwt, pHCV-7 and pHCV+8 (Table 1.2.) were used, which result in RT-PCR products 114 bp (pHCVwt), 107 bp (pHCV-7) and 122 bp (pHCV+8) in length. The standard plasmids were coamplified with the sample and coanalyzed on the Gene Scans and the number of copies/ml was determined. The results of the quantitative determination are summarized in Table 3.
Table 3 Test Subjects LIF-PCR DTS-PCR
Copies/ml PCR/Primer PCR/Primer Pair 1 Pair 2 Hybridization Hybridization Signal Signal HCV-sero-/#l 1.3x105 + +
HCV-sero-/#2 3.8x105 + +
HCV-sero-/#3 1.6x106 + - +
HCV-sero-/#4 2.2x104 + +
HCV-sero-/#5 8.2x104 + +
HCV-sero-/#6 6.2x105 + +
HCV-sero-/#7 9.4x104 + +
HCV-sero+/##8 2.3x102 + +
With HCV-seronegative, primary infected plasma donors, the minimum contamination was determined to be 2.2 x 104 copies/ml and the maximum contamination 1.6 x 106 copies/ml.

2.3. Quantitation of HBV DNA in Plasma Samples from Donors by LIF- PCR and DTS-PCR
A plasma donation was taken from HBV seronegative, healthy test subjects and primary infected, HBsAg positive, anti-HBsAg seronegative and HBsAg positive, antiHBsAg seropositive test subjects. Plasma samples of the donors were assayed by means of LIF-PCR and DTS-PCR. The sample testing by means of DTS-PCR was carried out with the primer pairs HBVla/HBVlb (primer pair 1) and HBV4a/HBV4b (primer pair 2) (Carman et al. 1989); samples with positive hybridization signals were further tested by means of LIF-PCR. For quantitation by LIF-PCR, the primers HBV+1780B
and HBV-1950B (Table 1.1) were used, which bind in the cDNA
sequences of the HBV genome and provide a 182 bp PCR product derived from the wild type RNA by RT-PCR. The standard plasmids, pHBVwt, pHBV-9 and pHBV+12 (Table 1.2.) were used, which provide 182 bp (pHBVwt), 173 bp (pHBV-9) and 194 bp (pHCV+12) RT-PCR
products. The standard plasmids were co-amplified with the sample and coanalyzed on the Gene Scan , and the copy-number/ml was determined. The results of the quantitative evaluation are summarized in Table 4.

Table 4 Test Subjects LIF-PCR DTS-PCR
opies/ml PCR/Primer PCR/Primer Pair 1 Pair 2 Hybridization Hybridization Signal Signal HBV-sero-/HBsAg positive #1 1.4x105 + +
HBV-sero-/HBsAg positive #2 2.8x105 + +
HBV-sero-/HBsA positive #3 3.5x105 + +
HBV-sero-/HBsAg positive #4 1.3x108 + +
HBV-sero-/HBsAg positive #5 1.9x105 + +
HBV-sero-/HBsA positive #6 2.3x106 + +
HBV-sero+/HBsAg positive #7 5.6x104 + +
With HBV-seronegative, primary infected plasma donors, the minimum contamination was determined to be 1.4 x 105 copies per ml, and the maximum contamination 1.3 x 106 copies per ml, respectively.

Example 3:
3.1. Assaying Plasma Pools of Different Sizes for HIV-1 RNA
Plasma samples from 10, 50, 100, 500 1,000 and 2,000 HIV
seronegative, p24 antigen-negative, healthy individual donors were mixed into a sample pool. Each individual pool size was mixed with one plasma sample from a donor with a primary HIV
infection with a high virus load of 2.3 x 107 copies/ml (sample 1) determined as in Example 1, with one plasma sample from a donor with a primary HIV infection with a minimum contamination of 2.8 x 105 copies/ml (sample 2) determined as in Example 1, and, as the controls, with a defined preparation of HIV RNA with 1 x 104 copies/ml (sample 3), and 1 x 103 copies/ml (sample 4).
The quantifiable, viral copy number/ml for the respective pool size was determined by means of LIF-PCR. The results of the PCR
evaluation are summarized in Table 5.1.
Result:
Table 5.1. shows that a viral contamination with a primary infected anti-HIV seronegative, p24 antigen-positive individual donation having a high load (2.3 x 107 copies/ml) as well as one having a minimum contamination (3.8 x 105 copies/ml) can be detected by means of PCR in a plasma pool of 10, 50, 100 and 500 individual donations. A donation, highly contaminated with HIV-RNA could also be detected in a plasma pool from 1,000 and 2,000 individual donors; on the other hand, a donation with a minimum contamination could no longer be detected in pools of this size.
A HIV-RNA load caused by a contamination with 1 x 104 copies/ml in the individual donation could be detected in pools of up to individual donations. In none of the pool sizes tested, was it possible to detect viral genome sequences at a contamination level of 1 x 103 copies per ml in the individual donation.

- -a E ~b - ' x clUo~ c d C
cis a C:) 0 = .O x 0 0 0 r- 10 -d -d N

a 0 E
E o 0 0 0 0 00 It -d -d o 0 =~I
a ca -v w N - o E > o 2 x x o 'v 0 r. CL
0 rn r -d -d UU a^~AU^ c'i d d Gov 0 0 x a.tnSAU~
a 0 C', 10 c N .b N o 2 E > o .2 x x 2 r- CL
o`v 0 00 .o x -d U N N
c~
a ^ .-. O N O M
C) CD
D M 00 x x cd cd RS
F- Cn C/) 3.2. Increasing the Sensitivity by Concentrating the Samples In order to increase the detection sensitivity in pool sizes, in which HIV-RNA copies could not be detected, 10-fold concentrated samples of the pooled plasmas were used for the PCR. For this purpose, the 10-fold volume of the sample volume in each case of samples 2, 3 and 4 of the individual plasma pools, used in Example 3.1., was concentrated by centrifugation, resuspended in a buffer with 1/10 of the initial volume and used for the PCR. The results of the PCR evaluation are summarized in Table 5.2.
By 10-fold concentrating the initial sample volume for the PCR, it was possible to detect the minimum contamination of a pool from 2,000 individual donors with one primary HIV-infected donation (2.8 x 105 copies/ml). Likewise, it was possible to increase the sensitivity of the detection in plasma pools from 50 and 100 individual donors with a viral contamination of 1 x 104 copies/ml in a single donation. A viral contamination with 1 x 103 copies/ml in a single donation could be detected only in the smallest pool size from 10 individual donors.
In order to improve the detection of viral genomes in the next higher pool size, the 100-fold of the initial volumes of samples 3 and 4, used in Example 3.1., was concentrated in a further experiment, resuspended in a buffer with 1/100 of the initial volume and used for the PCR. The results of the PCR
evaluation are summarized in Table 5.3.
By concentrating the plasma sample 100-fold, a viral HIV-genome contamination of 1 x 104 copies/ml in a single donation could still be detected in a plasma pool from 500, 1,000 and 2,000 individual donors.

w o co C CL
o It -d =c o oo o =~ c-,AV.-~ a c a C) 4) U
o O

0 o U
V a -d cc "10 S.
Fo 8 0 o x o o o o O ~ -o -d o A U c~i d d al N O
O N
ca r E o= ' x c o -: d o O r. L
en -c -d I
A A
4.4 !' o ti a 0 -a ., ,0 En o o w Cd o .- - E o .4?
0 0 0 rn =v t~4 "" a x SAU ~ c w .~AU~i 00 d V~ a, :c-i a o 0 0 0 cn O a C r-I
cd ^p `_ cn O O co co a b 4N c o E > 0 2 X E > o =~ x >, cd o =t7 0 O v1 00 "C7 >- co . 'b 0 O It =O
-o v,SUW, a rs.:,-,~AUrn c > 0 ao, N- o N- C) C6 - .2 t- En E >o. x x E>ox Cc 0 r- L 00 "0 a .5AUc'i o~ > Lf),~AU.-44 1 ~!l N N '-' N O O cn N O O N C) C) O. 0. X 0. 0. 4) 0. 0. t].

C-i H C C- H c~

-Example 4 4.1. Testing Plasma Pools of Different Size for HCV-RNA
Plasma samples from 10, 50, 100, 500 and 1,000 HCV
seronegative, healthy individual donors were mixed into a sample pool. Each individual pool size was mixed with one plasma sample from a plasma donation of a donor with a primary HCV infection having a high contamination of 1.6 x 106 copies/ml (sample 1), which was determined as in Example 1, from a donor with a primary infection with a minimum contamination of 2.2 x 104 copies/ml (sample 2), which was determined as in Example 1, and, as the control, with a defined preparation of HCV with 1 x 103 copies/ml (sample 3) and 5 x 102 copies/ml (sample 4). The quantifiable number of copies/ml for the respective pool size was determined by means of PCR. The results of the PCR
evaluation are summarized in Table 6.1.
Result:
Table 6.1. shows that a viral contamination with a primary infected donation having a high contamination of 1.6 x 106 copies/ml can be detected in a plasma pool consisting of 10, 50, 100, 500, and 1,000 individual donations. In pools from 100, 500 and 1,000 individual donors, HCV-RNA, caused by a single, minimally contaminated donation (2.2 x 104 copies/ml) could no longer be detected. Detection of HCV genome equivalents is possible at a contamination of 2.2 x 104 copies/ml in a single donation in pools from up to 10 and 50 donors. Viral genome equivalent contaminations with a lower number of HCV copies of about 1 x 103 or 5 x 102 copies/ml, respectively, in a single donation could not be detected in any of the pool sizes tested.

- -E
o b o vn -d -v -v a.-. AV d c ~ E o - c~ -n tiN, .-=
E > o .~ x o b o o -d -b -b cs,v,,5AU c-i c c c o CIO 0.4 Cd o E -U o o o m -v -o ti a.-.EAV .~ c c c w N p rl E
-v n r- o co E E o . _' x x o o o -v -v Q cLcn,~C~ u c c U
CD C) ca W - -E > o ._ x x o o v ~- -v -v a..- E Q U c-'i c c p N p M
~p N N N- N N
a~ a a x n. X 0. -- n. --Fco c c -4.2. Increasing the Sensitivity by Concentrating the Samples In order to increase the sensitivity in pool sizes, in which HCV-RNA copies could not be detected, 10-fold concentrated samples of the pooled plasmas were used for the PCR. For this purpose, in each case the 10-fold volume of the sample volume of samples 2, 3 and 4 of the individual plasma pools, used in Example 4.1., was concentrated by centrifugation, resuspended in a buffer with 1/10 of the initial volume and used for the PCR.
The results of the PCR evaluation are summarized in Table 6.2.
By the 10-fold concentration of the initial sample volume for the PCR, it was possible to detect the minimum load of a pool from 10, 50 and 500 individual donors with one primary HCV-infected donation (2.2 x 104 copies/ml). Likewise, it was possible to increase the sensitivity of the detection of a viral contamination of 1 x 103 or 5 x 102 copies/ml, respectively, in a single donation in plasma pools from 10 individual donors.
In order to improve the detection of viral genomes in the next higher pool size, the 100-fold of the initial volumes of samples 3 and 4, used in Example 4.1., was concentrated in a further experiment, resuspended in a buffer with 1/100 of the initial volume and used for the PCR. The results of the PCR
evaluation are summarized in Table 6.3.
By concentrating the plasma sample 100-fold, a viral HCV-genome contamination of 1 x 103 and 5 x 102 copies/ml in a single donation could still be detected in a plasma pool from 100 individual donors.

-Table 6.2. Quantifying HCV-RNA by means of LIF-PCR in Pools of Different Sizes after a 10-Fold Concentration Sample Plasma Pool Plasma Pool Plasma Pool Plasma Pool from 10 from 50 from 100 from 500 Individual Individual Individual Individual Donors Donors Donors Donors Co ies/ml Copies/ml Co ies/ml Co ies/ml Sample 2 2.0x104 4.1x103 2.1x103 4.0x102 (2.2x104) Sample 3 9.5x102 n.d. n.d. n.d.
(1X103) Sample 4 4.8x102 n.d. n.d. n.d.
(5x102) Table 6.3. Quantifying HCV-RNA by means of LIF-PCR in Pools of Different Sizes after a 100-Fold Concentration Sample Plasma Pool Plasma Pool Plasma Pool Plasma Pool from 100 from 500 from 1000 from 2000 Individual Individual Individual Individual Donors Donors Donors Donors Copies/ml Co ies/ml Copies/ml Co ies/ml Sample 3 9.5x102 n.d. n.d. n.d.
(1X103) Sample 4 4.7x102 n.d. n.d. n.d.
(5x102) Example 5:
5.1. Testing Plasma Pools of Different Size for HBV-DNA
Plasma samples of 10, 50, 100, 500, 1,000 and 2,000 HBV
seronegative, healthy individual donors were mixed into a sample pool. The pool was mixed with a plasma sample from a donor with a primary HBV infection with a high contamination of 1.3 x 108 copies/ml (sample 1), which was determined as in Example 1, from the plasma from a donor with a primary infection with a minimum contamination of 1.4 x 104 copies/ml (sample 2), which was determined as in Example 1, and, as the controls, with a defined preparation of HBV with 5 x 103 copies/ml (sample 3) and -1 x 103 copies/ml (sample 4). The quantifiable number of copies/ml for the respective pool size was determined by means of PCR. The results of the PCR evaluation are summarized in Table 7.1.
Table 7.1. shows that a viral contamination with a primary HBV infected donation with a high genome contamination can be detected in a plasma sample pool consisting of 10, 50, 100, 500, 1,000 and 2,000 individual donations. In pools from 500, 1,000 and 2,000 individual donors, HBV-DNA, caused by a single, minimally contaminated donation (1.4 x 104 copies/ml) could no longer be detected. Detection of HBV genome equivalents was possible at a contamination of 5 x 103 copies/ml in a single donation in pools from only 10 and 50 donors and with a contamination of 1 x 103 copies/ml in a single donation in pools from up to 10 donors.

- -0 id cad E o => o.9 o b o 00 -d -d -d N .~ A U ~; c c c C
-o ' E o o.9 x oo o O (14 -d -d -d a~.~AU.-, d d d N O
V] a E
.-cd - am., y r: OL
O ~t d -d 't3 p 'C7 O
'nSAUN c c c O
ti C) 0 a a o E y õ 2 2 al b 4 E O = -' x x a CO-' d c v' 0 r J
p" y E 0 0 0 E E 0 -' x x x Gov o 0_= to o -d r AUN N
Q

cad -p_ y O O O

.H fd c 0 0 0 N M 00 X
SL~U 't w .H

p N p 4) O O O
a~ 0 0. 0. x E. O
. r-X
E-(/l C/) c/ (/) V) 5.2. Increasing the Sensitivity by Concentrating the Samples In order to increase the sensitivity in pool sizes, in which HBV-DNA copies could not be detected, 10-fold concentrated samples of the pooled plasmas were used for the PCR. For this purpose, in each case the 10-fold volume of the sample volume of samples 2, 3 and 4 of the individual plasma pools, used in Example 5.1., was concentrated by centrifugation, resuspended in a buffer with 1/10 of the initial volume and used for the PCR.
The results of the PCR evaluation are summarized in Table 7.2.
By the 10-fold concentration of the initial sample volume for the PCR, it was possible to detect the minimum load of a pool from 500 individual donors with one primary HBV-infected donation of 1.4 x 104 copies/ml. Likewise, it was possible to increase the sensitivity of detecting a viral contamination of 5 x 103 copies/ml from a single donation, in a plasma pool from 100 and 500 individual donors, and a contamination of 1 x 103 copies/ml from a single donation in a plasma pool from 50 and 100 individual donors.
In order to improve the detection of viral genomes in the next higher pool size, the 100-fold of the initial volumes of samples 3 and 4, used in Example 5.1., was concentrated in a further experiment, resuspended in a buffer with 1/100 of the initial volume and used for the PCR (Table 7.3.).
Result:
By concentrating the plasma sample 100-fold, a viral HIV-genome contamination of 1 x 103 copies/ml in a single donation could still be detected in a plasma pool from 500 and 1,000 individual donors.

o 1 4O) o y}j~ 0 o .- V
V o ~ -rv -v cs, a o o ca ^o cn C) 0 C) o b o 'ti -o -o o a C> 0 0 clSAU c ca En Ln cn a r-1 + co E o Cl) C3 '2 " o-> 0 y cd C) 0 0 M 'd =b 44;
A A
o o 0 0 r+ 00 00 E a a d N C) Cd w o o 0 E a x E o a x =v o 0 0 %0 o 0 -c U o 0 0 C14 av,--.AUc-i c p. ci,cv~AV c~ d ,- w o E o a' I C
a 4) o o ca E E > 0 .~ x x E E o o = ' x co v o 0 oo I- 0 0 W) Q a.EAU -ti ¾ AU~

E X a Cd 'L rn y ca vi y o 0 E 0 =?~ x .- x x >1 cv O -6 _0 O ,A w ~O p 0 00 4~ 1 70 44 =H+ cz 4) -P -P

N c-i p M 0 0 4) cal M^ ct [~ 4) y 4) Q) o C G -t7 4) 4) 0 O
4) a 0. x a -- a 4) o. n. - a --c~d x x cad X
F . .. C6 c c -v H V) V) V]

Example 6:
Testing Plasma Pools of Different Sizes for HIV and HCV RNA
Plasma samples from 10, 50, 100, 500, 1,000 and 2,000 HIV
seronegative and HCV seronegative, healthy individual donors were mixed into a plasma sample pool. Each individual pool size was mixed with a plasma sample from a donor with a primary HIV
infection and from a donor with a primary HCV infection with a high HIV load of 2.3 x 107 copies/ml and a HCV load of 1.6 x 106 copies/ml (sample 1), which were determined as in Examples 2.1 and 2.2, with a minimum HIV load of 2.8 x 105 copies/ml and a HCV load of 2.2 x 104 copies/ml (sample 2), determined as in Examples 2.1 and 2.2 and, as the controls, with a defined preparation of HIV with 1 x 104 copies/ml and of HCV with 1 x 103 copies/ml (sample 3) and a preparation of HIV with 1 x 103 copies/ml and of HCV with 2 x 102 copies/ml (sample 4). The respective pool sizes were tested by means of LIF-PCR using primers specific for HIV and HCV for the presence of nucleic acids specific for HIV and HCV, respectively. It was possible to detect HIV-specific and HCV-specific genome sequences at contamination with a maximum contamination of 2.3 x 107 HIV
copies/ml and 1.6 x 106 HCV copies/ml by a single donation up to a pool size from 1,000 individual donors. HIV genome equivalents were still found in pools of 500 individual donations contaminated with a slightly contaminated donation, whereas HCV
genome equivalents could be found only in a pool from 50 individual donors. The sensitivity for the detection of HCV
genome sequences in the pools tested is thus a log step less than that for HIV genome sequences.
7. Detection of the Neutralizing Effect of an HAV-Immunized Donation on the HAV Virus Contamination in a Pool The neutralizing potential of a plasma donation from a HAV-immunized donor can be shown by in vitro neutralization tests.
For the detection of the neutralizing effect of HAV
antibodies on hepatitis A viruses present in the plasma, a plasma pool from 100 pre-immunized HAV donors having a protective immunity was tested, and the pool was mixed with HAV
(titer of 106.4TCID50/ml). After a 1 hour incubation at 37 C, the HAV titer was determined. Due to the HAV antibodies present in the plasma pool, the HAV infectivity could be reduced by > 4.6 log steps. This shows that protective antibodies present in the plasma from immunized donors can neutralize the virus contamination in a larger plasma pool.

Claims (23)

CLAIMS:

1. A method of preparing a plasma pool which is quality-assured with respect to the contamination by hematogenous viruses capable of reproduction ("quality-assured plasma pool") comprising the steps of:

(a) determining the absence of contamination of an individual plasma donation by hematogenous viruses capable of reproduction by the absence of markers which indicate a corresponding viremia, or by an excess of virus-neutralizing antibodies in the starting material, or by a protective immunity of the plasma donor at the time of the plasma donation, and (b) determining the genome equivalents of hepatitis C virus (HCV) by - taking samples from n individual donations, - combining the individual donation samples to m sample pools and - detecting the amount of viral HCV genomes or HCV
genome sequences present in these sample pools by means of a method for the detection or determination of nucleic acids by polymerase chain reaction (PCR) using an internal standard, whereupon those individual donations (n g), whose detected amount of viral genomes or genome sequences in the sample pool lies below a defined limiting value, are combined into a quality-assured plasma pool, and those individual donations (n a), whose detected amount of viral genomes or genome sequences in the sample pool is larger than or equal to said defined limiting value, are subjected to a further treatment or are eliminated, n and m being positive integers, and n is between about 2,000 and about 200,000.

2. The method according to claim 1 wherein in step (b) - samples are taken once more for the further treatment of the eliminated n a individual donations and these individual donation samples are combined to m a sample pools, n a and m a being positive integers with m a >= 2, and the ratio of m a:n a being larger than the ratio of m:n and - the amount of viral HCV genomes or HCV genome sequences in these sample pools is detected once more by means of a method for the detection or determination of nucleic acids by polymerase chain reaction (PCR) using an internal standard, whereupon those individual donations, whose detected amount of viral HCV genomes or HCV genome sequences in the sample pool lies below a defined limiting value, are combined into a quality-assured plasma pool and those individual donations, whose detected amount of viral genomes or genome sequences is larger than or equal to said defined limiting value, are subjected to a further treatment or are eliminated, and the method is repeated until the number of individual donations, which are to be treated further or eliminated, has reached or fallen below a set number.

3. A method for the preparation of a drug containing one or more plasma proteins which is quality-assured with respect to the contamination by hematogenous viruses capable of reproduction ("quality-assured plasma product drug") comprising the steps of - providing a plasma pool obtained by a method according to claim 1 or 2, and - processing this plasma pool to a quality-assured plasma product drug by including in said processing at least one further virus depletion or virus inactivation step.

4. The method according to any one of claims 1 to 3, wherein, in addition to HCV, also at least one further virus, selected from the group HIV, HAV and HBV is tested in step (a) and (b).

5. The method according to any one of claims 1 to 4, wherein said defined limiting value is limited to a maximum of 500 genome equivalents per ml of starting material.

6. The method according to any one of claims 1 to 4, wherein said defined limiting value is limited to a maximum of 200 genome equivalents per ml of starting material.

7. The method according to any one of claims 1 to 4, wherein said defined limiting value is limited to a maximum of 100 genome equivalents per ml of starting material.

8. The method according to any one of claims 1 to 4, wherein said defined limiting value is limited to a maximum of 50 genome equivalents per ml of starting material.

9. The method according to any one of claims 3 to 8, wherein the virus inactivation or virus depletion is carried out by means of at least one method with a reduction factor of at least 4.

10. The method according to any one of claims 1-9, wherein the polymerase chain reaction is used with primer pairs specific for several viruses, so that the presence of several different viruses can be assayed simultaneously.

11. The method according to claim 10 wherein at least two different PCR methods are used as method for the detection or determination of nucleic acids.

12. The method according to any one of claims 1 to 9, wherein the plasma pool or the genome equivalents contained therein are concentrated.

13. The method according to claim 12, wherein said concentration is performed by lyophilisation, adsorption or centrifugation.

14. The method according to claim 1 or 2, wherein inhibitors of the method for the detection or determination, of nucleic acids are removed or depleted in the starting material or in the intermediate.

15. The method according to any one of claims 1 to 14, wherein said quality-assured plasma pool is prepared by mixing quality-assured minipools into a quality-assured macropool.

16. The method according to claim 15, wherein said quality-assured plasma minipools consist of about 200 individual donations.

17. The method according to claim 15, wherein said quality-assured plasma macropool consists of about 2,000 individual donations.

18. The method according to any one of claims 15 to 17, wherein the quality-assured macropool is combined into a quality-assured multimacropool of up to 200,000 individual donations by mixing with a number of further quality-assured macropools.

19. The method according to any one of claims 15 to 18, wherein quality-assured minipools are obtained by mixing quality-assured small pools consisting of 2 to approximately 20 individual donations.

20. The method according to any one of claims 1 to 19, wherein, in order to check the method for detecting or determining nucleic acids in a sample, before or while carrying out the method, one or several internal standards or reference preparations are added to the sample, the standards being determined or detected in one and the same test vessel simultaneously with viral genomes or genome sequences possibly present.

21. The method according to any one of claims 1 to 20, wherein n is between 2,000 and 20,000.

22. The method according to any one of claims 1 to 20, wherein m is between 1 and 100,000.

23. The method according to any one of claims 1 to 21, wherein m is between 2 and 1,000.