JPH0614800A - Detection of human hepatitis virus c and a pair of primer therefor - Google Patents

Abstract

PURPOSE:To provide the subject pair of primers, etc., exhibiting a high specificity to HCV nucleic acid and useful for specifically amplifying and detecting a very small amount of an HCV-derived nucleic acid sequence contained in a sample in the detection method by using PCR of HCV. CONSTITUTION:A pair of primers composed of a primer containing a sequence of a continuous 15 or more units in an oligonucleotide base sequence represented by (5' side) GGCGACACTCCACCATAGATCACTCCCCTG (3' side) and another primer containing a sequence of a continuous part in another oligonucleotide base sequence expressed by (5' side) GCACTCGCAAGCACCCTATCAGGCAGTACC (3' side) and useful as PCR for selectively amplifying human hepatitis virus C nucleic acid in a sample: and a detection method by using them.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a method for detecting human hepatitis C virus (HCV) by PCR (polymerase chain reaction).

[0002]

2. Description of the Related Art The recently discovered human hepatitis C virus has an extremely low blood concentration. Therefore, it can be amplified by PCR (Saiki, R, K. et al. Sci.
ence, 230: 1350-1354, 1985).

[0003]

[Problems to be Solved by the Invention] Hepatitis viruses are known to be extremely diverse even among viruses of the same species (N, Kato, et al. Proc. Natl. Acad. Sci. USA 87,9524- 95
28, 1990), when the primer pair at the time of performing PCR does not correspond to the specific base sequence in the HCV nucleic acid, a problem of false negative occurs, which is an obstacle in clinical examination. Therefore,
It is important to use an oligonucleotide having any base sequence as a primer.

[0004]

[Means for Solving the Problems] As a result of diligent research on the primer pair used in PCR for selectively amplifying HCV nucleic acid in a sample, the present inventors have reported that there is relatively little change in HCV. Area (H.Okamoto, et al
Japan.J.Exp.Med.60,3,167-177,1990) and found a base sequence suitable for detection by PCR, and completed the present invention.

That is, the present invention is a method for detecting HCV in a sample, comprising (5 'side) GGCGACACTCCACCA
A primer containing 15 or more consecutive sequences in the nucleotide sequence of the oligonucleotide represented by TAGATCACTCCCCTG (3 'side) and (5' side) GCACTCGC
AAGCACCCTATCAGGCAGTACC (3 '
The detection method includes a step of performing PCR using a primer containing 15 or more continuous sequences in the nucleotide sequence of the oligonucleotide shown in (a) to selectively amplify the HCV nucleic acid in the sample. The present invention also relates to a primer pair used in PCR for selectively amplifying HCV nucleic acid in a sample, which is (5 ′ side) GGCGACACTCCACCAT.
It is a primer containing a continuous partial sequence in the nucleotide sequence of the oligonucleotide represented by AGATCACTCCCCTG (3 ′ side). The present invention also includes (5 'side) GC
ACTCGCAAGCACCCTATCAGGCAGT
It is a primer pair consisting of a primer containing a continuous partial sequence in the nucleotide sequence of the oligonucleotide represented by ACC (3 ′ side). The present invention will be described in detail below.

The primer pair of the present invention comprises a sequence homologous or complementary to the untranslated region at the 5'end of HCV, and is a DNA consisting of about 290 bases when PCR is performed.
It amplifies the area. Primer in PCR
The paired conditions are that it contains a sequence specific to the target nucleic acid to be amplified, that it is difficult to form a three-dimensional structure in the single-stranded state, that each primer has no homology, T
Although the m values are close to each other, the primer pair of the present invention satisfies all of these conditions.

The primer of the present invention may be an oligonucleotide having the above-mentioned 30 bases or an oligonucleotide containing a part of a continuous sequence in the base sequence of the oligonucleotide. The oligonucleotide containing a continuous partial sequence has at least about 10 bases, preferably 15 bases or more, because the specificity of the partial sequence is reduced. That is, it is particularly preferable to use a continuous sequence of 15 bases arbitrarily extracted from the above-mentioned oligonucleotide having 30 bases. It should be noted that there is no problem even if each primer constituting the primer pair has a different number of bases. If the primer is too long, it causes problems such as reactivity with HCV nucleic acid.
The upper limit is preferably the oligonucleototide having about 30 bases. Among the primer pairs of the present invention, (5 'side) CTCCACCATAGATCACTC
The oligonucleotide represented by CCC (3 ′ side) and (5
'Side) GCACTCGCACAGCACCCTAT (3'
The primer pair composed of the oligonucleotide shown in (a) is most preferable in satisfying the conditions of the above-mentioned primer pair.

In the present invention, from a human biological sample such as blood,
Used in general nucleic acid extraction, for example, acidic guanidine / phenol / chloroform method (AGPC method: Chom
czynski, P. et al Analytical Biochem. 162: 156-159,198
7) and Putotease K / phenol method (Keller, GHet
al. Biochem. 170, 441-450, 1988) and the like are used as samples. However, the RNA and the like thus extracted are poor in stability, and therefore, they are converted to DNA by the action of reverse transcriptase on them, and then P
Use for CR.

The composition of the reaction solution and the concentration of each composition in PCR may be the same as in ordinary PCR, and it is not necessary to use a special reagent other than the primer pair. As the primer pair, an oligonucleotide having the above-mentioned base sequence is used, and it is preferable to use the concentration in the range of about 0.1 to 0.5 μM.

PC using a primer pair of this sequence
The temperature and reaction time of each step of R are 92 to 96 in the denaturing step.
C., preferably 94 to 95.degree. C. for 10 seconds to 2 minutes, preferably 30 seconds to 1 minute. The annealing step of the primer is carried out at 45 to 70 ° C., preferably 55 to 65 ° C. for 10 seconds to 2 minutes, preferably 30 seconds to 1 minute. Primer
The extension reaction step is 70 to 75 ° C., preferably 72 to 73.
The temperature is 10 seconds to 2 minutes, preferably 30 seconds to 1 minute. In addition, in the so-called shuttle PCR method in which the annealing step and the extension reaction step are performed at the same temperature, 60 ° C. to 75 ° C.
C., preferably 65 to 70.degree. C., for 10 seconds to 2 minutes, preferably 30 seconds to 1 minute.

By repeating this series of steps (1 cycle) 15 to 50 times, preferably 25 to 45 times, the concentration of the HCV nucleic acid molecule can be amplified if it exists in the sample. . The amplified HCV nucleic acid molecule can be detected by, for example, a method by dot blot hybridization, a method of subjecting to electrophoresis and staining with ethidium bromide or the like to confirm the size of a DNA fragment, or a Southern blot hybridization method. . In addition, PCR is performed in the presence of an intercalating fluorescent dye, and then the relative fluorescence intensity of the whole is measured without opening the lid of the reaction vessel, and the determination is based on the value (Japanese Patent Application No. No. 313616), detection is possible while avoiding the problem of secondary contamination by sample nucleic acid, which is particularly preferable.

[0012]

The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to these examples.

Example 1 A previously reported nucleotide sequence (S. Ohkoshi, et al Jpn.
J. Cancer Res. 81,862-865,1990, H.Okamoto, et al Japa
nJExp.Med.60,3,167-177,1990) and the primer pair of the present invention were prepared, and PCR was carried out to try to detect HCV. The sequences of each primer-pair are as follows.

Primer pair (S. Ohkoshi et al., Jpn. JC
ancer Res.81,862-865,1990) F: 5'-AAGTGGCGTGCTGACGACTA
-3 'R: 5'-CACGGGTGAGGGGAGTAGACC
CT-3 'primer pair (H.Okamoto et al., Japan.J.Exp.Med.60,
3,167-177,1990) F: 5'-AGATGGCTTTGTACGACGTG
-3 'R: 5'-CACAGCTAGTTTGTCAGTACG
-3 'primer pair (base sequence of the present invention) F: 5'-CTCCACCATAGATCACTCCCC
C-3 'R: 5'-GCACTCGCAAGCACCCTAT-
Serum samples from 3'4 non-A non-B hepatitis patients (a, b,
RNA was extracted from c, d). 100 to 100 μl of serum
Add μl of Reagent 1 (4M guanidine thiocyanate, 25 mM sodium citrate, 0.1M β-mercaptoethanol, 0.5% N-lauroylsarcosine sodium salt) and 10 μl of 3M sodium acetate (pH 4.7) and stir, then add 200 μl Phenol / chloroform solution (1: 1 ratio) was added and the mixture was vigorously stirred. Then, centrifuge (15000 rpm, 5 minutes) to perform 2
After separating the phases, 100 μl of the aqueous phase is placed in another container, to which 1 μl of glycogen (20 mg / ml) is added, then
After adding 100 μl of isopropanol and stirring, centrifugation was performed again (15000 rpm, 5 minutes) to precipitate RNA. The precipitate was washed with 70% ethanol, dried in vacuum and then subjected to reverse transcription reaction.

The reverse transcription reaction basically involves reverse transcription / RNA /
Using a PCR kit (manufactured by Takara Shuzo Co., Ltd.), the procedure was carried out according to the attached protocol. Reverse transcription reagent solution (composition: 5 mM magnesium chloride, 10 mM Tris-HCl buffer (pH 8.3), 50 mM potassium chloride, 2.5 μM random hexamer, 1 mM dNTP (each), 1 U / μl RNas was added to the RNA prepared above.
eInhibitor, 2.5 U / μl reverse transcriptase) 20 μl
After dissolving, add mineral oil and layer at 25 ℃.
Min, then hold at 42 ° C for 30 minutes, then at 99 ° C for 5 minutes, then
Hold at 5 ° C for 5 minutes.

For 5 μl of the reaction solution in which the reverse transcription reaction was completed
20 μl PCR solution (composition: 2 mM magnesium chloride, 10
mM Tris-HCl buffer (pH 8.3), 50 mM potassium chloride, 2.
5 U / 100 μl) was added, and mineral oil was overlaid and set on a DNA thermal cycler (Perkin Elma / Citas), and 40 cycles of PCR were performed. The denaturing step is 94 ° C for 1 minute, and the primer annealing step is 55 ° C for 1 minute.
The primer extension reaction step was carried out at 72 ° C for 2 minutes.

The result of PCR is the 40 cycles of PCR.
After the completion, 10 μl of the sample was electrophoresed, stained with ethidium bromide and photographed with an instant film.
It was determined whether a band of the target size was confirmed. As a result of the determination, the HCV nucleic acid was detected in samples a and b when the primer pair was used, and in samples a, b, c and d when the primer pair of the present invention was used. . No band of the desired size could be detected in any of the samples using the primer pair.

Example 2 RNA was prepared in the same manner as in Example 1 from serum samples obtained from 14 non-A non-B hepatitis patients and serum samples obtained from 2 healthy individuals. The prepared RNA was dissolved in 10 μl of a reverse transcription reagent solution, and a reverse transcription reaction was performed under the same conditions as in Example 1. Then, to 5 μl of the reverse transcription reaction solution,
Carrying fluorescent dye (Hoechst 33258, Hoechst)
PCR solution containing 20 μl (the same composition as in Example 1 except that it contains 1.25 μg / ml fluorescent dye) was added, and 40 cycles of PC were added.
R was done. In addition, the denaturation step was performed at 94 ° C for 1 minute with the primer
The annealing step was performed at 65 ° C for 1 minute, and the primer extension reaction step was performed at 72 ° C for 2 minutes.

After completion of the reaction, the relative fluorescence intensity of the reaction solution in the container was measured by a self-made fluorescence detector. Then Example 1
The band by electrophoresis was determined in the same manner as in. as a result,
The determination of the electrophoresis results and the determination of the relative fluorescence intensity measurement were in agreement, and HCV nucleic acid was detected in one of 14 samples from 14 non-A non-B acute hepatitis patients. When all the samples were measured for C-100 antibody indicating HCV infection (which may be undetectable in an acute case because it rises several months after infection), the measurement result of the above-mentioned 1 sample was negative. It was also possible that it was not. 14 non-A
The results for 14 samples from non-B acute hepatitis patients and 2 samples from 2 healthy individuals are shown in Table 1. In Table 1, sample numbers 1 and 2 are the results for samples from healthy individuals, and sample numbers 3 to 16 are the results for samples from non-A non-B acute hepatitis patients. Further, in Table 1, + indicates that it was determined to be HCV, and-indicated that it was determined not to be HCV.

[0020]

[Table 1]

[0021]

INDUSTRIAL APPLICABILITY By using the primer pair of the present invention in a detection method using HCV for PCR, a very small amount of HCV-derived nucleic acid sequence contained in a sample is specifically amplified,
Can be detected. Since the present invention uses a primer pair with high specificity for HCV nucleic acids, it can solve the problem of false negatives due to the diversity of HCV nucleic acids (genes).

Claims (2)

[Claims] 1. A method for detecting human hepatitis C virus in a sample, comprising (5 ′ side) GGCGACACTCCACCA
A primer containing 15 or more consecutive sequences in the nucleotide sequence of the oligonucleotide represented by TAGATCACTCCCCTG (3 'side) and (5' side) GCACTCGC
AAGCACCCTATCAGGCAGTACC (3 '
Side), PCR is carried out using a primer containing a continuous partial sequence in the nucleotide sequence of the oligonucleotide shown in (1) to selectively amplify the human hepatitis C virus nucleic acid in the sample. . 2. A primer pair used in PCR for selectively amplifying human hepatitis C virus nucleic acid in a sample, the primer pair being (5 ′ side) GGCGACACTCCACCATAG.
A primer containing 5 or more consecutive sequences in the nucleotide sequence of the oligonucleotide represented by ATCACTCCCCTG (3 ′ side) and (5 ′ side) GCACTCGCAAG
A primer pair consisting of a primer containing a part of a continuous sequence in the nucleotide sequence of the oligonucleotide represented by CACCCTATCAGGCAGTACC (3 'side).