AT940U1 - QUALITY-ASSURED MEDICINE, CONTAINING ONE OR MORE PLASMA DERIVATIVES - Google Patents

Description

AT 000 940 Ul

The invention relates to a medicament containing one or more plasma derivatives as active substance or auxiliary, quality-assured starting material for the production of such medicaments, and methods for producing these medicaments. The invention also relates to a method for producing quality-assured starting materials, in particular quality-assured plasma pools.

Human plasma is of extraordinary clinical importance as a pharmaceutical preparation or as a starting material for the production of plasma derivatives, in particular for substitution therapy in the case of congenital or acquired deficiency in plasma components. When using human plasma, however, care must be taken to ensure that it does not contain any infectious agents that can be transferred with the pharmaceutical preparation or with the plasma derivatives. Infectious agents that may be present in the blood include, above all, viruses that are transmissible through blood (haematogenic viruses), e.g. HI viruses or hepatitis viruses (hepatitis A, B, C or non-A-non-B), but also parvovirus.

Due to the great need for drugs containing plasma derivatives, the economical production of these drugs is only possible on an industrial scale.

Plasma is obtained from donors and pooled for the manufacture of pharmaceutical preparations. The size of a common pool is approximately 2000-6000 single plasma donations. There is a risk that the entire plasma pool will be contaminated by a single virus-contaminated plasma donation.

Although it was possible to make human albumin by heating a virus-safe preparation by heating at the end of the first half of the 20th century, this was initially not possible with all other drugs that could be obtained from plasma because of their sensitivity to heat. To date, with millions of uses of adequately produced albumin, infections with viruses that occur in humans in the blood have never occurred. 3 AT 000 940 Ul

In contrast to this, viral infections, in particular with hepatitis viruses, have been reported time and again in many other medicinal products made from plasma and, since the 1980s, infections with the AIDS virus have also been widespread.

Around 1980 heat treatments were carried out for the first time on appropriately stabilized factor VIII concentrates, with the intention of thereby inactivating virus contaminants. First, however, a large loss of factor VIII activity had to be accepted or the actual inactivation potential was initially unknown.

Improvements in heat inactivation methods and other new inactivation methods ultimately made it possible to produce drugs from plasma that in most cases did not lead to virus infections in the recipient. This development also went hand in hand with the improvement in the selection of donors and donations with the aim of excluding those donors and donations who suspected viremia and thus a virus-containing plasma.

For some time now, either antigen detection or antibody detection by or against a certain virus in the blood has been attempting to exclude donations that give a positive result and not to introduce them into a larger plasma pool that is to serve as the starting material for the production of blood products . In the case of individual donors who show no disease symptoms or pathological examination results in all the examinations, but nevertheless can harbor certain viruses in their blood even in high concentrations for long periods of time, the occurrence of such viremias by a specific virus can now be clearly demonstrated using an amplification method.

By pooling plasma units a single plasma donation contaminated with viruses is naturally diluted, but the detection of viral genome sequences with the aid of amplification reactions is so sensitive that even in the dilutions virus genomes or their sequences can be clearly determined and 4 AT 000 940 Ul if as mentioned above, they fall below a certain limit of determinability and then no longer have clinical relevance in terms of the possibility of infection.

The EC directive in accordance with the " EEC Regulatory Document Note for Guidance ", Guidelines for Medicinal Products Derived from Human Blood and Plasma (Biologicals 1992, 20: 159-164) proposes a quality assurance system for the control of plasma donors or plasma donations. Accordingly, each plasma donation must be tested with validated tests for the absence of virus markers, such as hepatitis B antigen, HIV-1 and HIV-2 antibodies, since these are indicative of a corresponding viral infection of the plasma donor. Exclusion tests Determination of a hepatitis C infection should also be carried out.

According to the European Pharmacopoeia, it is described that special tests for the determination of hepatitis B surface antigen, for hepatitis C virus antibodies and for HIV antibodies should be carried out on every donation. (European Pharmacopoeia, 2nd edition, Part II, 1994, pages 853 to 853-4).

An FDA guideline dated March 14, 1995 provides for PCR testing on an end product (immunoglobulin product) as an additional safety factor.

Despite the proposed tests, the EC directive emphasizes that the safety of individual plasma donations is not sufficient only by checking these virus markers. Even if the absence of the markers mentioned is confirmed in a plasma sample, viremia of the donor cannot be ruled out. Viral antigens and corresponding antibodies cannot be detected immediately after infection, the first markers for viral infection often only appear after weeks or months after contact with infectious material. This critical period after infection and before the appearance of antibodies is commonly referred to as " window period " designated. However, the time after infection at which the first viral markers can be detected differs from virus to virus. 5 AT 000 940 Ul

In addition, it was also known that for some medicinal products made from plasma, viruses are depleted or inactivated as part of the manufacturing process and that such products are inherently virus-safe to a high degree.

Although virus inactivations of plasma derivatives have been carried out extremely successfully on an industrial scale, transmission of haematogenic viruses such as AIDS, hepatitis A, B, C virus has nevertheless occurred in rare cases, which means that it must be assumed that manufacturers use a few production batches despite the use of a consistent production method virus contaminated products (Lancet 340, 305-306 (1992); MMWR 43 (28), 505-509 (1994); Thromb.Haemost. 68, 781 (1992). The reason for this is likely to be an excessive contamination of certain batches Since only indirect methods for the exclusion of virus-contaminated plasma donations are available when the plasma is obtained and there is a possibility that the starting material is so heavily contaminated that the otherwise successfully applicable virus inactivation and virus depletion methods are no longer sufficient to produce virus-safe end products .

The human infectious dose is not known for HIV, HCV and HBV and is currently not determinable. The determination of the infectious dose in tissue cultures (TCIDS0: tissue culture infectious dose) or in the animal model (CIDS0: chimpanzee infectious dose) therefore only gives an approximation of the human infectious dose. In addition, in some cases people are not infected despite being exposed to HIV, HCV or HBV. A human infectious dose of such a virus is therefore not necessarily infectious.

Piatak et al. (Science 1993, 259: 1749-1754) determined the TCID50 of HIV with 1 TCIDso / 104 copies of HIV RNA. Shimizu, Y-K. et al. (PNAS. Natl. Acad. Sci. USA 1993, 90: 6037-6041) determined the CIDg0 of an HCV starame with 1 CIDS0 / 1 copy RNA.

By Eder et al. (The Role of the Chimpanzee in Research, Symp. Vienna 1992, 156-165) could be shown that 20 copies HBV 6 AT 000 940 Ul DNA / ml plasma correspond to a CIDg0 of 1.

In the case of a plasma pool or other plasma starting materials, particular care must be taken to ensure that the virus load is as low as possible, so that, if necessary, additional virus inactivation steps or measures to deplete viruses reduce the ».

Virus load can be reduced at least to below the infectious dose. A viral load in a starting material in which the copy number of the viral nucleic acid is already below the infectious dose for chimpanzees would be desirable.

The object of the present invention is to provide a medicament containing one or more plasma derivatives which can no longer have the risk of contamination with reproductive haematogenic viruses due to excessive contamination of certain starting batches.

The narrower task is to provide a quality-assured raw material or intermediate product, the virus load of which must not exceed a predetermined maximum value.

The object is achieved according to the invention by a medicament containing one or more plasma derivatives as active substance or auxiliary, in which the starting material or the intermediates obtained in the production of the plasma derivatives has no or a virus load on one or more reproductive haematogenic viruses which does not exceed a defined limit value, where the non-existent virus load for certain reproductive haematogenic viruses is determined by an excess of virus-neutralizing antibodies in the starting material or in the intermediate product or by a protective immunity in the plasma donor at the time of the plasma donation, otherwise the genome equivalents of the respective virus of interest in the starting material or in the 7 AT 000 940 Ul product by a quantifiable, controlled and non-inhibited method for the detection or determination of nucleic acids t, the quality-assured starting material or intermediate product for the production (the finished plasma derivative is subjected to at least one further essential virus depletion or virus inactivation step), and the quality-assured finished plasma derivative obtained is processed into a medicament using methods known per se.

The solution to the problem involves determining the extent of the contamination or virus load in the starting material, which virus load can no longer be eliminated by a method for inactivating or depleting the viruses. The problem is therefore solved, in a starting material, to determine the potential virus contamination and not to process these starting materials for as long or to exclude them from processing as this high degree of contamination exists.

For this purpose, each starting material used for the plasma derivatives and possibly also the intermediate products resulting from the production of the plasma derivatives, which are to be subjected to a virus depletion or virus inactivation step, and " Finished plasma derivatives are examined and treated in such a way that it is ensured in a secure manner that medicinal products produced from blood plasma can no longer transmit sporadically haematogenic reproductive viruses. The starting material is to be examined with the aid of selected amplification techniques in order to determine the upper limit of a possible viral load for a starting material or intermediate product which is subjected to at least one essential virus inactivation or virus depletion step in order to arrive at a drug which does not Transmission of haematogenic viruses.

The target nucleic acids to be detected in the determination of the Gemon equivalents can be determined in the blood, in the plasma, in 8 AT 000 940 ul by various ampiification methods according to the present invention

Serum or plasma fractions are amplified, but preferably the polymerase chain reaction (PCR) or special types of PCR are used as detection or Bestiromungsverfahren. For the detection of specific viral genome sequences, the amplification process must be selective for the nucleic acid sequence to be amplified. The amplification of nucleic acids in the plasma pools according to the invention can be carried out by a number of amplification processes described in the literature.

The amplification of specific viral genome sequences requires knowledge of the genome of each very different virus in order to reproduce and make it detectable.

Different amplification methods for nucleic acids are based on the PCR. The PCR amplification process was first described in 1983 by Mullis et al. (US 4,683,195 and US 4,683,202). Viral genome sequences can also be determined by " nested PCR " (Mullis et al Methods Enzymol. 1987, 155: 335-350) or by RT-PCR (Powell, L.M., et al. Cell 1987, 50: 831-840; Kawasaki, et al.

Proc. Natl. Acad. Be. USA 1988, 85: 5698-5702). For the amplification and detection of RNA, the RNA must first be transcribed into the DNA. This method is described in WO 91/09944 using the reverse transcriptase as a so-called RT-PCR.

The amplification products can be analyzed by using labeled nucleotides or oligonucleotide primers in the elongation process and the subsequent hybridization or gel electrophoretic separation of the products.

Alternative methods to PCR have also been described.

One of these methods for nucleic acid amplification is the LCR (ligase chain reaction) according to EP 0 320 308, EP 0 336 731 and Wu and Wallace (Genomics 1989, 4: 560-569).

Other enzymatic processes are the NASBA (nucleic acid sequence 9 AT 000 940 Ul based amplification), the 3SR (self-sustained sequence replication) according to EP 0 310 229 and Guatelli, J.C. et al. (Proc. Natl. Acad. Sci. USA 1990, 87: 1874-1878) or the TAS (transcription-based amplification system) according to EP 0 373 960 and Kwoh, D.Y. et al. (Proc. Natl. Acad. Sci. USA 1989, 86: 1173-1177). In these methods, a series of enzymes are used either simultaneously or stepwise in the amplification, e.g. a DNA polymerase or an RNA polymerase.

Other amplification processes are based on the use of the replicase of the RNA bacteriophage Qβ according to EP 0 361 983 and Lizardi et al. (TIBTECH 1991, 9: 53-58).

Another method describes signal amplification using branched DNA oligonucleotides instead of the extracted nucleic acid (branched DNA signal amplification) according to Urdea, M.S. et al. Nucleic Acids Res. Symp. Ser. 24 Oxford 1991, Pachl, C.A. et al. XXXI1 Interscience Conference on Antimicrobial Agents and Chemotherapy. Anaheim, October 1992 (abstract 1247).

EP 0 590 327 A2 describes an analysis method for blood samples in which the determination of viral RNA or DNA of, for example, hepatitis C virus, HIV or hepatitis B virus is provided. The detection limit for a test to determine the hepatitis B virus genome is 1,500 copies (150,000 copies / ml) if the evaluation is carried out electrophoretically after staining the gel. The blood samples are partly dried blood stains. After the analysis has been completed, no further processing of the samples is planned.

Processes for producing hyperimmunoglobulin preparations against certain viruses are based on blood or plasma which comes from donors who are actively immunized or have already survived a disease and therefore have protective immunity. Plasma donors that have been vaccinated against pathogenic viruses contain an appropriate antibody titer in their blood. These antibodies are in contrast to antibodies which indicate viremia, e.g. HIV antibodies, desired. 10 AT 000 940 Ul

The quality-assured starting material or intermediate product used for the production of the pharmaceuticals according to the invention thus contains either an excess of virus-neutralizing antibodies against a virus of interest or no detectable or below a limit amount of genomes or genome fragments of possibly occurring haematogenic reproducible viruses.

The plasma derivatives can be contained in the drug both as an active substance and as an auxiliary. Active substances include, for example, coagulation factors, immunoglobulins, fibrinolysis factors, enzyme inhibitors or other enzymes or zymogens present in the plasma, as well as mixtures thereof. Excipients include albumin or other stabilizers, various inhibitors, cofactors, etc.

In principle, any material that is at the beginning of a certain manufacturing process, for example a plasma pool, a cryopoor plasma or a Cohn II + III paste, is to be regarded as the starting material. A number of possible starting materials are cited in an article by Heide et al (" Plasma Protein Fractionation " in " The Plasma Proteins ", Frank W. Putnam, ed. Academic Press New York, San Francisco, London 1977, p. 545 -597).

Intermediates are products derived from the starting material in a certain manufacturing process, which are obtained through the intended manufacturing steps, e.g. a prothrombin complex in the production of factor IX with plasma or cryopoor plasma as a starting material.

The product-specific manufacturing process uses intermediate products to produce a finished plasma derivative from the starting material, which is processed into a drug using routine confectioning measures. In this workup, two or more finished plasma derivatives can of course also be combined with one another.

Preferably, the non-existent virus load or the virus load 11 AT 000 940 Ul not exceeding the defined limit value exists for at least two viruses, preferably selected from the group HIV, HAV, HBV and HCV, in particular HIV and HCV.

Of course, the present invention is not limited to the viruses mentioned above, but the virus load that does not exist or does not exceed a defined limit value can be determined for each haematogenic virus, i.e., e.g. also for parvovirus, hepatitis non A non B virus and for viruses that are newly discovered, can be transmitted through blood or blood-derived products and are found to be risky for humans. Preferably, the non-existent or not exceeding a defined limit value is determined for all known haematogenic viruses, as long as the presence of these viruses in the drug would pose a risk to the patient.

The limit: the permissible level of reproductive haematogenic viruses, which should in any case be undercut, depends primarily on the potential of the detection reaction and on the effort that is expedient when assessing the starting material or intermediate product. The detection limit depends, for example, on the volume of sample used for the detection reaction. If, for example, a viral genome equivalent cannot be detected in a 20 μΐ sample of a single donation and the detection method used is able to detect a single genome equivalent in the sample, it can be concluded that the maximum load on the individual donation is less than 50 genome equivalents per ml plasma lies. If a further 20 μΐ sample is tested with a negative detection result and again no viral genome equivalent is detected, it can be concluded that the maximum load on the individual donation is less than 25 genome equivalents per ml plasma.

Values of a maximum of 500 genome equivalents, in particular a maximum of 200 genome equivalents, preferably 100 genome equivalents, preferably 100 genome equivalents, per ml of starting material or intermediate product have been found to be suitable limit values for the permissible load on reproductive haematogenic viruses that are suitable for practical work. 12 AT 000 940 Ul

In a preferred starting material or intermediate product secured according to the invention, virus inactivation or virus depletion is achieved by means of at least one method with a reduction actuator of at least 4 in the manufacture of the medicament from this quality-assured starting material or intermediate product. I.

The plasma protein-containing medicament according to the invention has the advantage that, due to the secured limited virus load on one or more reproductive haematogenic viruses in the starting material of the plasma protein, a protein-friendly method for virus inactivation or virus depletion is sufficient to obtain the plasma protein in a virus-safe form. A protein-friendly process with a reduction factor of max. 4 carried out in order to inactivate or eliminate any existing virus load on reproductive haematogenic viruses. A protein-sparing process enables the activity and integrity of a plasma protein to be maintained to the greatest possible extent. A method is considered to be gentle on the protein, in which the (specific) activity of the protein to be obtained is maintained at 50% or more, preferably 80% or more. Even a single virus inactivation or virus depletion in the course of the manufacturing process for the medicament according to the invention is sufficient to completely inactivate or eliminate any viruses that may be present.

It has been shown that in the case of a starting material or intermediate product used for the production of plasma derivatives or pharmaceuticals, to which a test virus has been added, the virus load can be greatly reduced by a virus depletion before a planned virus inactivation step (for example EP-A-0 506 651 ). The depletion can be carried out by known methods such as nanofiltration, precipitation reactions, dialysis, centrifugation, chromatographic purification steps, etc. A number of physical, chemical or chemical / physical methods are known for inactivating viruses which, for example, involve heat treatment, e.g. according to EP-A-159 311 or EP-A-0 637 451, a hydrolase treatment according to EP-A-0 247 998, a 13 AT 000 940 Ul

Radiation treatment or treatment with organic solvents and / or surfactants, e.g. according to EP-A-0 131 740. Further suitable virus inactivation steps in the production of plasma fractions and medicaments are described in EP-A-0 506 651 or in WO94 / 13329. An analysis of various inactivation measures can be found in document Eur.J. I.

Epidermal. 3: 103-118 (1987); the ECIII / 8115/89-EN directive of the EC is available for the reduction factor.

The measures according to the invention enable a pooled starting material, in particular a plasma pool, or an intermediate product of excellent quality with increased safety.

Those plasma donors are preferably selected for the production of the quality-assured plasma pool according to the invention which are actively immunized or immune to one or more of the viruses, and which therefore have protective immunity, for example by means of an appropriate vaccination. The plasma donors are preferably vaccinated against a hepatitis virus, in particular hepatitis A virus, in order to rule out a corresponding infectivity of the plasma.

If plasma is the starting material, preferred embodiments of the quality assurance according to the invention are that the determination of the genome equivalents of all viruses of the group HIV, HBV, HCV, Parvovirus and HAV, the determination of the genome equivalents of all viruses of the group HIV, HBV, HCV and Parvovirus, as well as the detection of an excess of HAV antibodies, the determination of the genome equivalents of all viruses of the group HIV, HBV and HCV, and the detection of an excess of HAV and parvovirus antibodies, the determination of the genome equivalents of all viruses of the group HIV, HBV and HCV , as well as the determination of an excess of HAV antibodies, 14 AT 000 940 Ul the determination of the genome equivalents of all viruses of the group HIV, HBV and HCV, as well as the determination of an excess of parvovirus antibodies, the determination of the genome equivalents of all viruses of the group HIV, HBV and HCV, the determination of genome equivalents te all viruses of the group HIV and HCV, or the determination of the genome equivalents of all viruses of the group HIV and HCV, as well as the detection of an excess of HBV antibodies.

The plasma pool, which is quality-assured according to the invention, can also be obtained, for example, by selecting plasma donors which have been vaccinated against hepatitis A and hepatitis B viruses and which, because of their anti-infectious immunity, can therefore have an antibody titer in their blood. These antibodies have been generated as a result of active immunization and are therefore not indicative of viremia. The plasma donations are examined individually for the absence of markers that indicate a corresponding viremia. For this purpose, for example, a test for the determination of hepatitis C virus and possibly HIV antibodies is carried out using a validated ELISA test system. Certain liver values are also considered markers for hepatitis C virus, e.g. ALT and GPD values. If the absence of the viral markers in the donor plasma is confirmed, proof of the absence of a genome or genome fragment from AIDS viruses (HIV-1) and possibly hepatitis C virus in a plasma pool of single plasma donations is provided as a further selection criterion. This procedure is recommended despite confirmation that this plasma donation contains no antibodies against HIV, which are indicative of a viral infection. The time from the infection with an HIV virus to the possible detection of corresponding antibodies can extend over months, especially with these viruses. A plasma pool that was only tested for the absence of HIV antibodies, 15 AT 000 940 U1, cannot therefore be demonstrated to be made available as a controlled plasma pool that contains no reproductive, infectious viruses or those that are below a defined limit.

One of the measures according to the invention for securing the limited »

In addition to 1. the quantifiable, controlled and non-inhibited method for the detection or determination of nucleic acids, exposure to reproductive haematogenic viruses includes the detection of virus-neutralizing antibodies in the plasma pool according to the invention. Validated test systems should also be used to determine the antibody titer, for example corresponding enzyme immunoassays. The samples used for the method can optionally be lyophilized and then reconstituted.

In addition to plasma pools, cryoprecipitates or other early intermediate products are also suitable as starting materials for this invention. Early intermediates are those derived from human plasma in the manufacture of drugs that are still undergoing virus depletion or inactivation. The statements made here regarding the plasma pool also apply - as far as possible - according to the invention also to other starting materials, in particular the possibility of combining smaller amounts of the same type to larger ones. According to the invention, the mixing of similar quality-assured starting materials or intermediate products into a larger quality-assured starting material or intermediate product pool is therefore provided.

Such high quality criteria for a raw material or intermediate product have not yet been met. On the one hand, it was not considered necessary to completely rule out viremia due to a plasma pool contaminated with virus. Plasma pools are mainly used for the production of plasma derivatives, i.e. pharmaceutical products based on plasma proteins. In this production, an additional measure for inactivating and / or depleting potentially existing viruses must be carried out, which reduces the risk of transmission of the pathogenic viruses by the finished products many times over, so that the prescribed according to the prior art 16 AT 000 940 Ul usual examinations are considered sufficient.

According to the invention, only those starting materials or intermediate products are used for the further product preparation which have an excess of virus-neutralizing antibodies or secured limited exposure to viral genome sequences. Starting material which does not meet the requirements according to the invention is not suitable for further processing into medicaments in the context of the present invention, but nevertheless cannot be proven to be infectious, because the amount of genome equivalents determined using a nucleic acid amplification method is only the upper limit for indicates the level of reproductive viruses. The determined amount of genome equivalents therefore only gives the " true value " the burden of reproductive viruses on 'when all genome equivalents come from active viruses.

A larger amount can be obtained from several starting materials secured according to the invention by mixing, which corresponds to the same safety criteria.

In the case of a plasma pool, this can be made available as a small pool, which is made up of around 2 to 20 individual plasma donations. At least 10 small pools can be combined into a mini pool of approximately 20 to 200, preferably approximately 200, single plasma donations. The next order of magnitude is a macro pool with a size of approximately 200 to 2000, preferably approximately 2000, single plasma donations, which is optionally produced by mixing at least 10 mini pools. Several macro pools can be combined to form a multi macro pool up to a size of 200,000 individual donations.

Evidence for viral genomes or genome fragments can be provided according to the invention for each of these pool sizes. By testing the small pools and then combining the controlled small pools into a larger pool, for example a mini pool, a quality that has never been described before is also obtained from a larger pool. 17 AT 000 940 Ul

A particular embodiment of the invention therefore consists of a plasma pool which is obtained by mixing mini pools, which preferably consist of approximately 200 individual donations, into a macro pool, which preferably consists of approximately 2000 individual donations.

A further preferred embodiment consists in a plasma I. pool, which is characterized in that a macro pool is combined by mixing with any number of other macro pools to form a multi-macro pool of up to 200,000 individual donations.

A further preferred embodiment consists in a plasma pool in which the mini pools are obtained by mixing small pools consisting of two to about 20 individual donations.

When choosing a starting material for the fractionation of blood plasma for the production of plasma fractions or finished plasma derivatives and drugs, a relatively large amount is preferable for reasons of economy. So far, however, no plasma pool of the size of a macro pool or a multi-macro pool has been available that could be considered non-virus contaminated by the detection of viral genomes or genome fragments. It is not enough to provide evidence for a multi-macro pool alone, because mixing up more than 2,000 individual plasma donations results in an excessive dilution effect and the number of genomes to be detected is very often less than the detection limit of a test procedure. By testing small subunits and then combining them into larger units, this problem of detectability is overcome and an economically interesting amount is obtained.

The quality-assured starting material according to the invention is outstandingly suitable for the production of fractions containing plasma proteins as intermediate products or for the production of finished medicaments.

The measures provided for the starting material, in particular plasma pools, can of course be applied analogously to all types of plasma fractions. According to a further aspect, the present invention therefore also relates to quality-assured finished plasma derivatives with limited exposure to reproductive haematogenic viruses which are ensured by using quality-assured starting material.

Furthermore, the present invention naturally also relates to finished plasma derivatives which are obtained by a production process from a quality-assured starting material according to the invention or from one or more intermediate products assured according to the invention.

The pharmaceuticals prepared from finished plasma derivatives according to the invention by pharmaceutical formulation are also encompassed by the present invention.

Furthermore, the present invention relates to a method for producing a medicament containing one or more plasma derivatives from a quality-assured starting material or from a quality-assured intermediate product obtained during the production of the plasma derivatives, the quality-assured starting material or intermediate product indicating no or a virus load that does not exceed a defined limit value has one or more reproductive haematogenic viruses and the defined limit in the case of determining the genome equivalents of the respective virus is selected by a quantifiable controlled and non-inhibited method for the detection or determination of nucleic acids according to one or more of the following criteria:

Limit of detection (des) of the nucleic acid amplification method (s) of at least 10,000 copies of selected nucleic acid sequences; certain number of genome equivalents, in particular a number below 500 genome equivalents, preferably below 200 genome equivalents, more preferably below 100 genome equivalents, particularly preferably below 50 genome equivalents, per ml of starting material or intermediate; 19 AT 000 940 Ul

According to the invention, other permissible selection criteria with regard to the limit values are a limit value determined using a cell culture test, preferably one TCIDS0 per ml, or the genome equivalents contained in this quantity, a limit value determined using an animal model, preferably a CIDS0 per ml, or those contained in this quantity Genome equivalents

These limit values are preferred because of their practical relevance (depending on the detection potential of an examination method) and their biological relevance (especially the TCID and CID values).

The highly sensitive method of PCR has the disadvantage that even the slightest impurities that can get into the test material are also amplified, so that false positive results can occur.

A preferred embodiment of the method according to the invention is characterized in that more than one detection or determination system for nucleic acids is used, the detection or determination systems preferably being selected such that one system excludes false positive results and another system false false results .

At least two different PCR methods are preferably used, at least one method being used for screening and at least one method for confirmation (confirmation).

In DTS-PCR (Dual Targeting-Southern Blot-PCR), after amplification of the extracted nucleic acids, the synthesized nucleic acids are separated by agarose gel electrophoresis and then Southern blot after hybridization with a digoxigenin (DIG) -labeled probe. The evaluation is carried out via a densitometric determination of the band intensity. To exclude false negative results, which can be caused by mispriming between PCR primers and template due to sequence heterogeneity, the nucleic acid extracts in a second PCR with other, different from the first pair of primers, 20 AT 000 940 Ul

Primers amplified and analyzed again. By adding a synthetic nucleic acid as an internal standard, the DTS-PCR is controlled and false negative results are excluded.

For example, in order to additionally verify the results obtained in DTS-PCR, LIF-PCR (laser-induced fluorescence PCR) is preferably used as a further method.

By using non-radioactively labeled primers (preferably fluorescent dye-labeled primers are used), the PCR products can be detected by LIF-PCR. However, the detection of the amplification products can also be simplified by incorporating non-radioactive labeled nucleotide analogs into the newly synthesized nucleic acids during the elongation reaction. In LIF-PCR, the nucleic acid is amplified in the presence of fluorescence-labeled primers and the amplification products are subsequently separated by PAGE. With each sample preparation of the LIF-PCR, additional negative and positive controls are carried out. The detection and quantification of the PCR products is carried out using a gene scanner. With the help of the internal double standardization of LIF-PCR, false negative results in particular are excluded and positive results secured.

According to the invention, false positive or false negative results can be excluded by using positive and negative controls. The described combination of two different PCR methods, in particular DTS-PCR and laser-induced fluorescence PCR (LIF-PCR) enables the testing of large numbers of samples in routine control and thus the exclusion of primarily false negative results and the avoidance of false positive results.

An additional aspect of the invention lies in the fact that the test samples are concentrated and thus even lower loads on viral genome sequences can be detected. The sensitivity of the method according to the invention can be increased by additional measures by concentrating the plasma samples or the genome equivalents contained therein, 21 AT 000 940 μl being preferred to increase the sensitivity 10 to 100 times.

In a preferred embodiment of the method according to the invention, the samples from the starting materials (e.g.

Individual donations or sample pools) or intermediate or the first genome equivalents contained therein, preferably by lyophilization, adsorption or centrifugation.

According to the invention, a method is used which enables a quantifiable, controlled and non-inhibited method for the detection or determination of genome sequences. When determining the limited load on reproductive viruses in the plasma pool by the detection of viral genomes or genome sequences, however, it may happen that certain inhibitors of the detection method are present in the samples, so that an uninhibited amplification is not possible from the outset.

It has been found that the virus load on a plasma pool can certainly be underestimated using a PCR method. Factors can be present in the plasma pool which can significantly impair the sensitivity of a PCR determination method (Nucleic Acids Research 16 (21), 10355 (1988)). In the method according to the invention, these so-called inhibitors of the PCR reaction are removed before the detection reaction or excluded by using a genome standard during the detection reaction. If the internal standard can be amplified and detected in the pool at the corresponding rate, the presence of such inhibitors is excluded.

It is known that substances found in plasma, such as heparin, high salt concentrations and polyethylene glycol, can inhibit PCR (BioTechniques 9 (2), 166 (1990) and Journal of Clinical Microbiology 29 (4) 676-679 (1991)).

A preferred embodiment of the method according to the invention is therefore characterized in that any inhibitors of amplification present in the samples are removed or depleted from the individual donations or in the sample pools. 22 AT 000 940 Ul

These additional methods of removing or neutralizing blood, plasma or serum amplification inhibitors include e.g. the ultracentrifugation of the samples and the decanting of the supernatant with inhibitors contained therein and the extraction of the nucleic acid, as well as the treatment of the samples with heparinase, polyamines or the pre-cleaning of the nucleic acids by means of HPLC. I.

The increased purity of the nucleic acids ensures unrestricted amplification of the nucleic acid.

According to a preferred method variant, specific primer pairs are used for several viruses in the amplification test, so that the presence of several virus types can be examined simultaneously. In a particularly preferred test, two or more viruses selected from the group HIV, HAV, HBV and HCV are examined.

RNA viruses in particular are subject to a large mutation rate, which means that variants or subtypes of a known strain can occur very quickly which differ more or less strongly in their genome sequence from the wild type sequences. With a sensitive amplification method such as However, PCR requires a particularly high amplification efficiency for the detection and quantitative determination of a very small number of copies of a viral genome sequence in order to determine the copies actually present in a sample. Inadequate pairing of the primers with the template reduces their efficiency.

Appropriate care must therefore be taken when selecting the primers.

Preferred pairs of primers are selected so that they code for conserved genome sequences of the individual haematogenic viruses to be examined, the suitability of the primers on corresponding samples of a representative sample cross section of the viruses to be examined being determined.

By selecting the primers for the amplification reaction, not only the previously identified, known genome sequences of HIV, HCV and HBV, but also their subtypes can be determined. This is solved according to the invention in that the primers used are selected from a highly conserved genome region of the respective virus. For the selection of the starting material or intermediate according to the invention by means of LIF-PCR and DTS-PCR, therefore, only primers are used, the specificity of which is checked for all relevant subtypes. As part of an epidemological surveillance, emerging virus strains of the target viruses are examined to determine whether they contain the appropriate templates against which the primers used are directed. Based on determined changes within a known group of virus strains, new primers for the quantitative detection of existing copies of a new virus strain can then be synthesized accordingly. The newly synthesized primers should deliver at least as good a sensitivity of the test as that of previously tested primers. Appropriate new primers for conserved nucleic acid sequences have to be developed for newly emerging target viruses.

To control the method for the detection or determination of nucleic acids in a sample, one or more internal standards or reference preparations are preferably added to the sample before or during the implementation of the method, the standards simultaneously being present in one and with viral genomes or genome sequences which may be present be determined or verified in the same test vessel.

This procedure offers the possibility of an even more precise quantification of the content of viral nucleic acids or an even better estimate of the detection limit of the amplification process, in particular if the internal standard or standards are used in an amount that is close to the detection limit of the respective amplification reaction.

The individual donations combined according to the invention into a quality-assured plasma pool can be combined with other similar quality-assured plasma pools, so that a quality-assured mini pool, macro pool or multi-macro pool is made available 24 AT 000 940 U1. The benefits of a larger pool made from quality assured smaller pools have been adequately described.

According to a further aspect, the present invention relates to a method for producing a plasma pool as a quality-assured starting material with a secured limited load of reproductive viruses from two or more individual donations, which is characterized by the following steps:

Taking samples from n individual donations,

Combine the individual donation samples into m sample pools and detect the amount of viral genomes or genome sequences present in these sample pools by means of a quantifiable, controlled and non-inhibited method for the detection or determination of nucleic acids, after which those individual donations (ng) of which the detected amount of viral genomes or genome sequences in the sample pool is below a certain limit, are combined into a secured plasma pool and those individual donations (na), of which the detected amount of viral genomes or genome sequences in the sample pool is greater than or equal to the limit, one Further treatment are added or excreted and where n and m are positive integers. Individual donations can be further processed, for example, by depleting “viral genome equivalents” or by adding virus-neutralizing antibody-containing fractions.

In a further process step, samples can also be taken again for further treatment of the excreted na individual donations and these individual donation samples can be combined to form mQ sample pools, na and ma being positive integers, ma > 2 and the ratio ma: na is greater than the ratio m: n, and the amount of viral genomes or genome sequences are again detected in these sample pools by means of a quantifiable, controlled and non-inhibited method for the detection or determination of nucleic acids, after which those individual donations, of which the detected amount of viral genomes or genomic sequences in the sample pool is below a certain limit, are combined to form a secured plasma pool and 25 AT 000 940 Ul those individual donations of which the detected amount of viral genomes or genome sequences is larger or equal to the limit; is: to undergo further treatment or to be eliminated. This process can be repeated until the number of individual donations to be processed or eliminated has reached or fallen below a specified number.

This provides a simple process which allows a plasma pool of almost any size to be excreted, with just a few tests, for existing single plasma donations with an impermissibly high load of reproductive viruses. On the other hand, suitable individual donations, which have been eliminated with previous methods together with a virus-contaminated individual donation, if they have been analyzed together, are identified with simple process steps and can be processed into a finished plasma derivative.

A further aim of the invention can thus be achieved, namely to find out a single contaminated donor from a large plasma pool in a simple and cost-saving manner, in order to exclude him from further donations and to send him medical help immediately. This increases the security of the donor colony.

The number of individual donations which the plasma pool subjected to the process according to the invention comprises is generally 2 to 200,000 (n = 2 to 200,000) and preferably 20 to 20,000, particularly preferably 200 to 2000, in particular 200. The number m is above all between 1 and 100,000, preferably between 2 and 1000. The specified number of individual donations to be processed or eliminated is practically 100, preferably 10, particularly preferably 1. In the latter case, the virus-contaminated individual donation is identified as such. In practice, however, this is only indicated for the sake of identifying the plasma donor, so the specified number will usually be between 10 and 100.

If necessary, the sample pools can be tested for virus-neutralizing antibodies against the viruses to be examined for the detection or determination of nucleic acids.

As a rule, the corresponding I will be used for those sample pools in which antibodies against viruses have been found.

Single donations combined and used again. Those individual donations, of which no antibodies were found in the sample pool, are then sent for further treatment or excreted.

Furthermore, the present invention relates to the quality-assured starting material or intermediate product, in particular plasma pool, produced as part of the method according to the invention, and to the quality-assured finished plasma derivative, which has preferably been examined again for viral genome equivalents or the presence of virus-neutralizing antibodies.

The present invention also encompasses a pharmaceutical composition which can be obtained from a quality-assured finished plasma derivative from human plasma by pharmaceutical formulation steps.

According to a further aspect, the present invention relates to a method for the production of medicaments containing one or more plasma derivatives which are free from various reproductive haematogenic viruses, which is characterized by the following method steps:

Providing a starting material or an intermediate product obtained in the production of the plasma derivatives derived from human plasma,

Quality assurance of the starting material or intermediate product by detecting the non-existent or a certain limit value of a viral load on reproductive haematogenic viruses, the non-existent viral load for certain 27 AT 000 940 Ul reproductive haematogenic viruses due to an excess of virus-neutralizing antibodies in the starting material or intermediate or is determined by a protective immunity in the plasma donor at the time of the plasma donation, I .. otherwise the genome equivalents of the respective virus of interest in the starting material or intermediate product are determined >

Subjecting the quality-assured starting material or intermediate product in this way to at least one further essential virus depletion or virus inactivation step and

Processing of the quality-assured finished plasma derivative obtained using methods known per se to form a pharmaceutical.

In a preferred method for the production of pharmaceuticals from human plasma, at least one intermediate product is used in the course of the production process, a quality assurance step.

According to a preferred embodiment, the quality assurance step is carried out in the intermediate product, which is subjected to an essential virus depletion or virus inactivation step. Most preferred is the quality assurance of each intermediate product which is to be subjected to an essential virus depletion or virus inactivation step.

The invention is illustrated by the following examples, to which, however, it should not be restricted.

Examples:

1. General principle of the PCR 28 AT 000 940 Ul 1.1. General principle of DTS-PCR (Dual Targeting Southern Blot)

Nucleic acids are amplified with PCR using a first specific pair of primers, the PCR products are then electrophoresed on an agarose gel and blotted onto a filter. The filter-bound PCR products are hybridized with a digoxigenin (DIG) -labeled probe, which binds within the amplified genome sequence, and detected after a development reaction. The band intensity is quantitatively determined densitometrically. In a further PCR, the nucleic acid is amplified using a second pair of primers, which is different from the first primer, and is likewise detected by Southern blot analysis. The PCR of two different regions of a genome sequence and their visualization by means of hybridization can reduce false negative results and positive results can be verified. 1.2. General principle of L1F-PCR (laser-induced fluorescence-labeled)

Nucleic acids of different origins were analyzed using PCR. Use of primers which have fluorescent groups amplified. The analysis and quantification of the amplified products obtained were carried out using an automatic DNA sequencer with a laser-induced fluorescence measuring device (DNA sequencer 373A with Gene Scan® software from Applied Biosystems). This instrument is able to separate the fluorescence-labeled PCR products by means of gel electrophoresis in a polyacrylamide gel under denaturing conditions and to quantify their quantity. The number of copies of certain sequences in the sample is determined on the basis of the intensities obtained from the PCR products of the nucleic acid to be quantified and at least two internal standards. 1.2.1. Extraction of the DNA of viral particles 500 μΐ of the sample are centrifuged for 20 min at 70,000 rpm in an ultracentrifuge. The pellet is dissolved in 500 μΐ 10 mM Tris / HCl 29 AT 000 940 Ul pH 8.0 and 10 μΐ proteinase K (Boehringer Mannheim, 20 mg / mlj, and 10 μΐ 20% SDS. After incubation overnight at 37eC or for A certain amount of standard nucleic acid is added for 4 h at .56 ° C., the sample is extracted successively with phenol and chloroform and 10 μl glycogen (Boehringer Mannheim, 20 mg / ml) is added, followed by precipitation with ethanol, centrifugation. 1. yaw, the pellet washed and finally dissolved in water.

1.2.2. Extraction of residual viral DNA 500 μΐ of the sample are dissolved in 5 μl 10 mM Tris / HCl pH 8.0 and 10 μl Proteinase K (20 mg / ml). After incubation overnight at 37 eC or for 4 h at 56 ° C, a certain amount of standard nucleic acid is added, the sample is extracted successively with phenol and chloroform and 10 μl glycogen (20 mg / ml) is added. It is then precipitated with ethanol, centrifuged, the pellet washed and finally redissolved in water.

1.2.3. Extraction of the RNA for the PCR 1 ml of plasma or plasma diluted with PBS is centrifuged at 70,000 rpm for 20 min. The supernatant was removed by suction.

The pellet was taken up in 1 ml guanidium isothiocyanate solvent (RNAzol ^ from Biotex) and 5 μl 1 mg / ml t-RNA from yeast and a predetermined amount, e.g. 20 μΐ, standard RNA added. A predetermined number, e.g. 400 and 1200 copies of the minus and plus RNA standards added and vortexed. The solution is heated at 70eC for 10 min, then 1/10 volume of chloroform is added and incubated on ice for 10 min. Then it is centrifuged for 5 min in a table centrifuge and the supernatant is transferred to new tubes. 500 μΐ isopropanol are added and the temperature is set to -80 ° C. for 15 min. The mixture is then centrifuged for 10 min, washed twice with 70% ethanol and the pellet is taken up in 50 μl of water. 5 μΐ were used for the RT-PCR.

1.2.4. PCR for the detection of DNA

The PCR approach contains, in a known manner, an aliquot of the extra nucleic acid, PCR buffer (Boehringer Mannheim), MgCl2, dNTPs, primer, tag polymerase (Boehringer Mannheim, 5.0 U / μΙ) and Water. The PCR is carried out in accordance with the manufacturer's instructions for buffer and enzyme or in accordance with customary working instructions (Mullis et al. Methods in Enzymology 155: 335, 1987).

1.2.5. RT-PCR for the detection of HIV-RNA

The RT-PCR approach contains, in a known manner, an aliquot of the extracted nucleic acid in RT buffer from Perkin-Elmer, MgCl2, dNTPs, the RT primer and rT.th. polymerase (Perkin-Elmer, 2.5 U / μΙ) and water. The RT is carried out in a PCR apparatus (GeneAmp PCR System 9600 from Perkin-Elmer) in accordance with the manufacturer's instructions for buffer and enzyme or in accordance with customary working instructions (Mullis et al. Methods in Enzymology 155: 335, 1987). MgCl2, a chelate buffer and the second primer are added for the PCR. Then the PCR is carried out according to the information described above. 1.2.6. Analysis of the products For the determination and quantification of the PCR products, 0.5 to 1.0 μΐ are taken from the PCR solution and analyzed in a 373 A instrument from Applied Biosystems according to the manufacturer's instructions. 1.3. Southern blotting and detection of DTS-PCR products

Agarose gels were prepared for the gel electrophoretic separation of the PCR products with a concentration determined for the respective product. The gel run was carried out in 1 x electrophoresis run buffer. The PCR product samples were mixed with Ficoll / bromophenol blue in 0.5 x running buffer and the prepared gel pockets were loaded. After the gel run, the PCR products were denatured by incubating the gel in 0.5 M NaOH / l, 5M NaCl for 1 h and then neutralized. The DNA was transferred to filters (Duralon ™, Stratagene, La Jolla, California) and the nucleic acid was bound to the membrane by UV cross linking. The membrane was incubated for 31 hours at 68 ° C. in prehybridization buffer (6 × SSC, 0.5% SDS, 5 × Denhard-ts, 100 pg / ml denatured DNA) at 31 AT 000 940 μl. The hybridization was carried out with a dioxigenin-labeled DNA probe and subsequent visualization of the bands by immunostaining using alkaline phosphatase-conjugated antibodies, nitro-blue-tetrazolium (NBT) and 5-bromo-l-chloro-3-indolphosphate (BCIP). The I.

The blots were evaluated densitometrically. 1.4. Primers used for the LIF-PCR are in Table 1.1. And Table 1.2. summarized.

The primers used in the DTS-PCR are for HIV: SK38, SK 39, SK145 and SK431 (Ratner et al. 1985), for HCV: 32, R3, CHAA, RI, ConAl, ConaA2 and ConA (available from Chiron) and for HBV: HBVla and HBVlb (Kaneko et al. 1989), as well as HBV4a and HBV4b (Carman et al. 1989).

Table 1: Primers and standard plasmids used for LIF-PCR and DTS-PCR Table 1 32 AT 000 940 Ul

Tab.1.1. Primers for the amplification and detection in the LIF-PCR OGgonukleotidaeaiciinang orientation sequence (& · &) Virus position SK38 (+) ATAATCCACCTATCCCAGTAGGAGAAAT HIV-1 1551-1578 * SK39 (-) TTTGGTCCTTGTCTTATGTCCAGAATGC HIV-1 1665-1638 * HCV32 CTGTGAGGAACTACTGTCTT HCV 45-64® HCVPT4 CGGTTCCGCAGACCACCTATG HCV 158-139® + 1780B CATTGATCCTTATAAAGAATTTGGAGC HBV 1780-1806 * -1950B CCAGCAGAGAATTGCTTGCCTGAG HBV 1973-1950 b Numbering according to Rainer et al. (Nature 313: 277-284, 1985) * Numbering according to Han et a «. (PNAS 88: 1711-1715, 1991) " Numbering according to Fujiyama et al. (Nudeic Acids Res. 11: 4601-4610.1983) 33 AT 000 940 Ul

Tab. 1.2. Standard plasmids for LIF-PCR

Name Oeletion / Insertion Virus pgagl 1. HIV-1 pgag -15 del. 1593-1607 * HIV-1 pgag +12 ins. + 12bp pos. 1593b HIV-1 pHCV-wt HCV pHCV -7bp de !. 126-135 ° HCV pHCV + 8bp ins. + 8bp pos. 126 ° HCV pHBV-wt HBV pHBV -9bp del. 1868-1876 ° HBV pHBV + 12bp ins. +12 pos. 1868d HBV " Numbering according to Ratner et ai. (Nature 313: 277-284, 1985) e numbering according to Han et al. (PNAS 88: 1711-1715, 1991) 4 numbering according to Fuiyama et al. (Nucteic Acäds Res. 11: 4601-4610, 1983)

Example 2:

2.1. Quantification of HIV RNA in donor piasm samples by LIF-PCR and DTS-PCR

A plasma donation was taken from HIV seronegative, healthy volunteers and HIV seronegative, p24 antigen positive primary infected volunteers. Plasma samples from the donors were tested using LIF-PCR and DTS-PCR. The sample testing by means of DTS-PCR was carried out with the primer pairs SK145 / 431 (primer pair 1) and SK38 / 39 (primer pair 2) (Tab. 1.1); Samples with positive hybridization signals were further tested with the LIF-PCR. For the quantification by means of LIF-PCR, the primers SK38 and SK39 (Tab. 1.1.) Were used, which bind in the cDNA sequences of HIV-1 and result in a 115 bp PCR product of the wild-type RNA by RT-PCR . Pgagl, pgag -15 and pgag +12 (Table 1.2.) Were used as standard plasmids, the RT-PCR products with a length of 115 bp (pgagl), 100 bp (pgag-15) and 127 bp (pgag + 12) surrender. The standard plasmids were co-amplified with the sample and co-analyzed on the gene scan and the copy number / ml was determined. The results of the quantitative evaluation are summarized in Table 2. 34 AT 000 940 Ul

Table 2

Subjects LIF-PCR copies / ml DTS-PCR PCR / Pxiaexpaar 1 hybridization signal PCR / Priaexpaar 2 1 hybridization signal | HIV-sero- / p24 positive # 1 3.4 x 10s + I + HTV-sero- / p24 positive # 2 2i8 x 10s + + HIV-sero- / p24 positive # 3 2/7 x 10 * + HIV-sero - / p24 positive # 4 1.7 x 107 + + HIV-sero- / p24 positive # 5 5/5 x 10s + + HIV-sero- / p24 positive * 6 8.6 x 10 * + HIV-sero- / p24 positive # 7 2.3 x 107 + + HIV-sero- / p24 positive # 8 4.7 x 105 + +

The minimum exposure to HIV-seronegative, p24 antigen positive plasma donors was found to be 2.8 x 105 and the maximum to 2.3 x 107 Koplen / ml.

2.2. Quantification of HCV RNA in donor plasma samples by LIF-PCR and DTS-PCR

A plasma donation was taken from HCV seronegative, healthy probes and HCV primary infected subjects. Plasma samples from the donors were tested using LIF-PCR and DTS-PCR. DTS-PCR was used to test the samples with the primer pairs 32 / R3 (primer pair 1) and CHAA / Rl (primer pair 2) (Chiron); Samples with positive hybridization signals were further tested with the LIF-PCR. For the quantification by means of LIF-PCR, the primers HCV32 and HCVPT4 (Tab. 1.1.) Were used, which bind in the cDNA sequences of the HCV and give a 114 bp product of the wild-type RNA by RT-PCR. The standard plasmids were pHCVwt, pHCV-7 and pHCV + 8 (Table 1.2.), The RT-PCR products with a length of 114 bp (pHCVwt), 107 bp (pHCV-7) and 122 bp (pHCV + 8) surrender. The standard plasmids were co-amplified with the sample and co-analyzed on the gene scan and the copy number / ml was determined. The results of the quantitative evaluation are summarized in Table 3. 35 AT 000 940 Ul

Table 3

Test part LIF-PCR copies / ml DTS-PCR PCR / Prin »erpa.ar 1 hybridization signal PCR / Prinerpaajc 2 | Hybridization signal HCV-sero - / # 1 1.3 x 10s + + HCV-sero - / # 2 3.8 x 10 * + + HCV-sero - / # 3 1.6 x 10 * + + HCV-sero - / # 4 2.2 x 10 * T + HCV-sero - / # 5 8.2 x 10 * + + HCV-sero - / # 6 6.2 x 10s + +. HCV-sero - / # 7 9.4 x 10 * + + HCV-sero + / # 8 2.3 xlO2 +. +

The minimum exposure to HCV seronegative, primary infected plasma donors was found to be 2.2 x 104 copies / ml and the maximum was 1.6 x 10® copies / ml.

2.3. Quantification of HBV DNA in donor plasma samples by LIF-PCR and DTS-PCR

A plasma donation was taken from HBV-seronegative, healthy volunteers and primarily infected, HBsAg-positive, anti-HBsAg-seronegative and HBsAg-positive, anti-HBsAg-seropositive volunteers. Plasma samples from the donors were tested using LIF-PCR and DTS-PCR. DTS-PCR was used to test the samples with the primer pairs HBVla / HBVlb (primer pair 1) and HBV4a / HBV4b (primer pair 2) (Carman et al. 1989); Samples with positive hybridization signals were further tested with the LIF-PCR. For the quantification by means of LIF-PCR, the primers HBV + 1780B and HBV-1950B (Tab. 1.1.) Were used, which bind in the cDNA sequences of the HBV genome and a 182 bp size of the wild-type RNA by RT-PCR PCR product result. PHBVwt, pHBV-9 and pHBV + 12 (Table 1.2.) Were used as standard plasmids, the RT-PCR products with a length of 182 bp (pHBVwt), 173 bp (pHBV-9) and 194 bp (pHCV + 12) surrender. The standard plasmids were co-amplified with the sample and co-analyzed on the gene scan and the copy number / ml was determined. The results of the quantitative evaluation are summarized in Table 4. 36 AT 000 940 Ul

Table 4

Subjects LIF-PCR copies / ml DTS-PCR PCR / Primexpair 1 hybridization signal PCR / Primexpair 2 hybridization * signal HBV-sero- / HBsAg positive # 1 1.4 x 105 + + HBV-sero- / HBsAg positive # 2]. 2.8 x 105 + + KBV-sero- / HBsAg positive # 3 3.5 X 10s + + HBV-sero- / HBsAg positive # 4 1.3 x 10 * + + HBV-sero- / HBsAg positive # 5 1 , 9 x 10s + + H3V-sero / HBsAg positive # 6 2.3 x 10 * + + HBV-sero + / HBsAg positive # 7 5.6 x 10 * + +

The minimum exposure to HBV seronegative primary infected plasma donors was found to be 1.4 x 10s copies / ml and the maximum was 1.3 x 108 copies / ml.

Example 3:

3.1. Testing plasma pools of various sizes for HIV-1 RNA

Plasma samples from 10, 50, 100, 500, 1000 and 2000 HIV seronegative, p24 antigen-negative, healthy single donors were mixed to 37 AT 000 940 μl in a sample pool. The individual pool sizes were each with a plasma sample of an HIV-infected person with a high load of 2.3 x 107 copies / ml (sample 1) determined according to Example 1, of an HIV-infected person with a minimal load of 2.8 determined according to Example 1 x 105 copies / ml (sample 2) and as a control with a defined preparation of HIV RNA mixed with 1 I x 104 copies / ml (sample 3) and 1 x 103 copies / ml (sample 4). The quantifiable viral copy number / ml was determined for the respective pool size using LIF-PCR. The results of the PCR evaluation are in Table 5.1. summarized.

Result:

Table 5.1. shows that in a plasma pool of 10, 50, 100 and 500 individual donations both one viral contamination, with a primary infected anti-HIV seronegative, p24 antigen positive single donation with a high (2.3 x 107 copies / ml) than can also be detected with a minimal (3.8 x 105 copies / ml) exposure using PCR. With a sample pool of 1,000 and 2,000 individual donors, contamination caused by a donation that was highly contaminated with HIV-RNA could also be detected; however, contamination with a minimally charged donation could no longer be detected in these pool sizes. In the case of HIV-RNA contamination, caused by contamination with 1 x 104 copies / ml in the individual donation, detection up to a pool size of 10 individual donations was possible. Detection of viral genome sequences with a contamination of - 1 x 103 copies / ml in the single donation was not possible in any of the pool sizes tested. 38 AT 000 940 Ul

Table 5.1. Quantification of HIV-RNA using LIF-PCR in different pool sizes c c o m > 0 V cH c o V H 1 o Oi e O S1 «H s« · * -1 c e 0 «X α o M -W • • • < o C Oi 00 Ό • o Ό Η O * H 0 • Pi < N ö «Ci C c C C G 0 O > O • o H c 0 V H o Οι E ö Λ © \ H 3 H C e «« X β O Η «H • •« «1 o C 0 · V • o • σ Η O • Η O P < lH «« H c c c c c 0 n > 0 * 0 H c o «H 4 0 Ol 6 O © V H H 3 * h e E« «X X« N H «« «o e ο · CO * 0 * o Η O Tl o Ol tfl« Hi CO m c c e c p H > «• a H 0 0« H »<» 0 Οι E o o Pi © '--- H rH 3 H C E «« X X «I N -H • •« 1 o C 0i a Ό V Η O • H 0 Ol T-l H «H CM c c C C p M > V V H c 0 «H 0 α E o 04 © \ n rH 3 H C O B V V H X m N M •. Λ C Oi X un V Ό rH O • Η O Oi in ö Hi ιΛ c c C C 0 u > V V H c 0 «rl p Ir o Οι E O o Pi Q \ rH rH 3 • -I c © E 4) 0 X X rH © N -H. id G Oi O vO X ~ o rH o -H 0 · ». V Ol rH a «CM CM rH c r» «n O O _ rH rH r > H CM CO © ^ T O X X rH rH 0 Φ Φ 0) Φ Λ jQ < r > ja oo Λ X Xi x 0 0 * o - O o u M Cd U IN M rH U rH Oi CU - CU - · CU CU - 39 AT 000 940 Ul 3.2. Increasing sensitivity through sample concentration

In order to increase the sensitivity in the pool sizes in which no HIV-RNA copies could be detected, samples of the pooled plasmas concentrated 10 times were used for the PCR reaction. For this purpose, the tenfold volume of that in Example 3.1. used sample volume of samples 2, 3 and 4 of the individual plasma pools concentrated by centrifugation, resuspended in buffer with 1/10 of the initial volume and used for the PCR reaction. The results of the PCR evaluation are in Table 5.2. summarized.

Due to the 10-fold concentration of the initial sample volume for the PCR, the minimal load of a pool of 2000 individual donors with a primary HIV-infected donation (2.8 x 105 copies / ml) could be detected. The sensitivity of the detection in plasma pools of 50 and 100 individual donations with a viral contamination of 1 x 104 copies / ml could also be increased in a single donation. Viral contamination with 1 x 103 copies / ml in a single donation could only be detected in the smallest pool size of 10 individual donors.

In a further experiment, in order to improve the detection of viral genomes in the next higher pool size, 100 times that in Example 3.1. used starting volume of samples 3 and 4, resuspended in buffer with 1/100 of the starting volume and used for the PCR. The results of the PCR evaluation are in Table 5.3. summarized.

Due to the 100-fold concentration of the plasma sample, a viral HIV genome load of 1 x 104 copies / ml could still be detected in a single donation in a plasma pool of sizes 500, 1000 and 2000 individual donations. 40 AT 000 940 Ul

Table 5.2. Quantification of HIV-RNA using LIF-PCR in various pool sizes according to θ'c 3 UiΦ * H Ul 4Jc 03 N l ~ * δx: Ul 03u 03 «uio

c c o u > «* 0 H 0 o« 1 H 0 ft e o 0 < «^ H s H C 6 •« X, m o N -H • • «o C Ol 3 3 Η O Ti O Ol C < X X H C c C o 0 > «D H 0 o *« d 1 o ft £ o Ol e ^ H $ H c £ «« X o N Ti • • fl O 0 ft r- 3 3 Η O Ti 0 «Ol < -l XX CM CC e C pw > ü 3 H C O > O ft £ o Oi «H § h e £« «X α N Ti« m fl o 0 ft CO 3 3 ° -rl 0% • Bi IO X X m c C C C p > «I 3 H c o • H« 1 o ft £ © O a • < H H * 4 C g «« X X tt Η - »I • A o C ft vo σ» 3 Η O Η O V Ol «H X X CM CO C C G 0 M > 41 3 i-4 G o «1 Η 0 ft £ o o ft« \ r-4 «H £ r-i C £« «X X Q N Ti * A G ft m CO 3 Η O Ti O 0i in X X m C c c o u > «1 3 H c 0 Φ H r > 0 ft £ o o ft fl s. H i-C > AHC o £ «« XXH «0 K Ti« G ft r- in X «-4 OMO CU tH XX CM cn H« Λ © H n CM mo ^ o X »-u H 0 0) φ < u Λ XI CO XX JQ X 0 o - oou M < MU 1-4 Oi CU ^ ÖU * - CU c 3 Ui ω HN < -1 «M ΛO (0 cc < v« a = 0 u ö > i-4o 0 cu c 03 c 03 * Ö 03 τ-i X3 υ w Ui ο > c -M cdu 041 diM • 3 0J HΦ-M 4-1e§ ccI > Üo > c 03 3σ nm < u ωΛ 03e- <

Nco Ui < υ x; υ 03 «Ul o o θ 'c 3 Ui 0) *« - i Ui 4-1 C σ > 03 Plasma pool of 2000 individual donors copies / ml fl o i — 1 X cv n.d. c c 0 »1 > 41 - 3 «H C O« H fl ο ο, e o ft n ^ t-H 3 «HC £ 4) 41 X n O N -H •« o c ft 3 * H O 0 Oi < H H di < Ti c c c o u > 0 3 HC 0 Φ «H · * O ft £ o ft« ^ H af rl CE «01 X nn * h • fl OC ft CD 3 • Η Ο -H 0« fc Oi wx «C _ flp • -I cn o • r? O H * - (< u CJ < U Λ ja x ja x o o M M 1-4 o-H Oi O. - Oj ^ 41 AT 000 940 Ul

Example 4:

4.1. Testing plasma pools of various sizes for HCV RNA

Plasma samples from 10, 50, 100, 500 and 1000HCV seronegative, healthy single donations were mixed into a sample pool. The individual pool sizes were each with a sample from a plasma donation of an HCV-primary infected person with a high load of 1.6 x 106 copies / ml determined according to Example 1 (sample 1), of a primary infected person with a minimal load of 2 determined according to Example 1, 2 x 104 copies / ml (sample 2) and mixed as controls with a defined preparation of HCV with 1 x 103 copies / ml (sample 3) and 5 x 102 copies / ml (sample 4). The number of copies / ml quantifiable in the respective pool size was determined by means of PCR. The results of the PCR evaluation are in Table 6.1. summarized.

Result:

Table 6.1. shows that in a plasma pool consisting of 10, 50, 100, 500 and 1000 individual donations a viral contamination with a primary infected donation with a high load of 1.6 x 106 copies / ml can be detected. In the pool sizes of 100, 500 and 1000 individual donors, HCV-RNA, caused by a single, minimally stressed donation (2.2 x 104 copies / ml), could no longer be detected. Detection of HCV genome equivalents is possible with a load of 2.2 x 104 copies / ml in a single donation up to a pool size of 10 and 50 donors. Viral genome equivalent exposure with a lower HCV copy number of approximately 1 x 103 or 5 x 102 copies / ml in a single donation could not be detected in any of the pool sizes tested. 42 AT 000 940 Ul

Table 6. Different * quantification of HCV-RNA using LXF-PCR in different pool sizes c e o H > 'SHC o «1 d * o A eo ft 4' '», dH 5 d C e «« X «o N d •« • 4 OC ft in • o • σ T3 d O d 0 v * • (k « - < H (4 H c CC c C pu > 0 • o H c 0 «dt» o ft e O a «^ H 4 d C a 0 0 X tt M d« «•« OC ft in XI * D Ό d O d O ft Kl WK CM c CC cp δ > «1 * σ H co« do ft e O 04 ^ H 4 d C 6 0 0 XQN d • • • 4 OC ft co TJ " 0 T3 d O d O «ft d W» 4 H cc C ccp X > 0 • odc O 0 dd O ft 6 O oft 4 H dH 4 d Üe 0 0 XX m H d • • tt C ft r- dH Ό • 0 H od 0 • ft m W 14 CM cc C cou> 0 * 0 H c 0 0 d 0 ft e OO ft »\ dH 9 d C e 0 0 XX n N d •« 4 C ft dH - o • 0 dod O ft d W 14 dH CM cc O ♦ o O dH dH di CM dH CM CO oo XX dH dH 4 Φ Φ Φ < u Λ Xi \ D Xi CM X X X X 0 o - O - o o H U dH U CM V * dH i-ι in ft Cu - CU CU - cu - 43 AT 000 940 Ul 4.2. Increasing the Sensitiv! Tat: by sample concentration

In order to increase the sensitivity in the pool sizes in which no HCV-RNA copies could be detected, 10-fold concentrated samples of the pooled plasmas were used for the PCR reaction. For this purpose, the tenfold volume of that in Example 4.1. used sample volume of samples 2, 3 and 4 of the individual plasma pools concentrated by centrifugation, resuspended in buffer with 1/10 of the initial volume and used for the PCR reaction. The results of the PCR evaluation are in Table 6.2. summarized.

Due to the 10-fold concentration of the initial sample volume for the PCR, the minimum load of a pool of 10, 50 and 500 individual donations with a primary HCV-infected donation (2.2 x 104 copies / ml) could be detected. Likewise, the sensitivity of the detection of viral contamination with 1 x 103 or 5 x 102 copies / ml in a single donation to plasma pools of 10 individual donors could be increased.

In a further experiment, in order to increase the detection of viral genomes in the next higher pool size, 100 times that in Example 4.1. used starting volume of samples 3 and 4, resuspended in buffer with 1/100 of the starting volume and used for the PCR. The results of the PCR evaluation are in Table 6.3. summarized.

Due to the 100-fold concentration of the plasma sample, a viral HCV genome load with 1 x 103 and 5 x 102 copies / ml could be detected in a single donation in a plasma pool the size of 100 individual donors. 44 AT 000 940 Ul

Table 6.2. Quantification of HCV RNA. using LXF-PCR in various pool sizes after 10-fold concentration

Sample plasma pool of 10 single donor copies / ml plasma pool of 50 single donor copies / ml plasma pool of 100 individual donor copies / ml plasma pool of 500 individual donor copies / ml sample 2 (2/2 xlO4) 2.0 x 10 '4.1 x 10J 2, 1 x IO " 1 4.0 x 10 " Sample 3 (1 x 103) 9.5 x 10 " n.d. n.d. n.d. Sample 4 (5 x 102) ΤΊΓχϊο2 n.d. ”D n.d.

Table 6.3. Quantification of HCV-RNA using LIF-PCR in different pool sizes after 100x concentration

Sample plasma pool from 100 single donation copies / ml plasma pool from 500 single donation copies / ml plasma pool from 1000 individual donor copies / ml plasma pool from 2000 single donation copies / ml sample 3 (1 x 103) 9.5 x 10 “1 n.d. n.d. n.d. Sample 4 (5 x 102) 4.7 x 102 n.d. n.d. n.d. 45 AT 000 940 Ul

Example 5:

5.1. Testing plasma pools of various sizes for HBV DNA

Plasma samples from 10, 50, 100, 500, 1000 and 2000 HBV seronegative, healthy single donors were mixed into a sample pool. The pool was each with a sample from a plasma donation of a HBV primary infected person with a high load of 1.3 x 108 copies / ml (sample 1) determined according to Example 1, a primary infected person with a minimum load of 1.4 determined according to Example 1 x 104 copies / ml (sample 2) and as a control with a defined preparation of HBV mixed with 5 x 103 copies / ml (sample 3) and 1 x 103 copies / ml (sample 4). The number of copies / ml quantifiable in the respective pool size was determined by means of PCR. The results of the PCR evaluation are in Table 7.1. summarized.

Table 7.1. shows that in a plasma sample pool of 10, 50, 100, 500, 1000 and 2000 individual donations, viral contamination with a HBV-primary infected donation with a high genome load can be detected. With the pool sizes of 500, 1000 and 2000 individual donors, HBV-DNA caused by a single, minimally stressed donation (1.4 x 104 copies / ml) could no longer be detected. Detection of HBV genome equivalents with a load of 5 x 103 copies / ml in a single donation was only in the pool sizes of 10 and 50 donors and with a load of 1 x 103 copies / ml in a single donation up to a size of 10 donors possible. 46 AT 000 940 Ul

Table 7.1. Quantification of HBV-DNA using LIF-PCR in different pool sizes e c o P > • • o rH e o o 2.Ί * O B4 «> *. H g ^ c C «41 X CQ O Μ -H • •« Λ O C P < CO Ό • σ XI -1 O H 0 * •. · • Pi C4 «« «n C c c C c o P > 41 * 0 • H 6 o «H o Pl ß > Pi fl 'S * o -1 c H i • · X e o N • • • < J o C Pi CM • σ XJ XJ Η O Η O * «• Pl r-l H K H c c c C e 0 P > «1 * 0 e 0 4» H 1 o Pi e O 04 «H * HC e • · X fl N -H •» • Λ OC 0 «· * τ · • o xj • c Η O -P o • • Pi m «K CM eccce 0 P > 41 • o c o 41 1-f 0 0 Oi e © o Pl a v H tH H c g «« X X fl N -rl «* * o c p. H CM XJ XJ Η O • H 0 V CM fH «« H H c C C c 0 P > «1 tj H c 0 * d 0 Qi e 0 O o Pl β \ o H rH IH c H g 41 41 XXX n N -H • < d C Pi tH U-5 O xj rH O • rt OV * * Pi in W "CM CM H cc C 0 P > 41 T3 «H c 0 41 H 0 0. E O O Pl * 1 'v. io rH tH H C rH g 41 41 X X X o CO N Ή rH c p < CM CO 00 X Η O * H 0 * * * Pl r-l w tt H r-1 < T rH m «Λ O O H rH rx H CM co o Ό · © X X r— < rH 41 Φ Φ 0) < D yes yes < n yes * · Λ X nx 0 o · »o ^ oop 1-1 tH U rH u tn Pi 04 - '04 - 04' 04 · - '47 AT 000 940 ul 5.2. Increasing sensitivity through sample concentration

In order to increase the sensitivity in the pool sizes for which no HBV DNA copies could be detected, samples of the pooled plasmas concentrated 10 times were used for the PCR reaction. For this purpose, the tenfold volume of that in Example 5.1. used sample volume of sample 2, 3 and 4 of the individual plasma pools by centrifugation, resuspended in buffer with 1/10 of the initial volume and used for the PCR reaction. The results of the PCR evaluation are in Table 7.2. summarized.

Due to the 10-fold concentration of the initial sample volume for the PCR, the minimal load of a pool of 500 individual donors with a primary HBV-infected donation with 1.4 x 104 copies / ml could be detected. Likewise, the sensitivity of the detection of viral contamination of a single donation of 5 x 103 copies / ml in plasma pools of 100 and 500, and with contamination of a donation of 1 x 103 copies / ml in a pool size of 50 and 100 individual donations could be increased. In a further experiment, in order to increase the detection of viral genomes in the next higher pool size, 100 times that in Example 5.1. used starting volume of samples 3 and 4, resuspended in buffer with 1/100 of the starting volume and used for the PCR (Table 7.3.).

Result:

Due to the 100-fold concentration of the plasma sample, it was still possible to dispense 500 and 1000 individual donors in a plasma pool. A viral HIV genome load of a single donation of 1 x 103 copies / ml can be detected. 48 AT 000 940 Ul

Table 7.2. Quantification of HBV-DNA using LIF-PCR in different pool sizes after 10x concentration I c c 0 Ul > «• 0 H c OVH 0 ft e 0.« x * s HG tü «fl)« 0 N -W • • • «0 G ft • 0 TJ TJ HO • H 0 • • ft N ca xccce G p U > 0 • 0 r- | c 0 0 H M 0 ft E O CU 0 -X. H s H G C O 0 X «0 N H • *« 0 G ft CO TJ • 0 Η O Η O * • ft ri ca x H c c e G p H > fl) • 0 HG 0 <) HM 0 ft EO 0 p, «\ H flH HC ε fl) (1 XXBH τ | • < d 0 C ft VD O TI Η O • Η O xx • ft m ca« CM H cce 0 ui > fl) • 0 * -1 c 0 41 H - > NI 0 AE O 0 ft «\ H H H C ü fl) 4) X X n N H« 0 G ft H m m 0 • H 0 «t x • CU iH ca t4 tH TT TJ c c 0 Ul > flj TI ri c 0 fl) H 0 AE 0 ft PS N «H« HC ίϊ 4) «IX n NH • • ta C ft ja -Q 0« Η O • H 0 • • X CU W ca xcc CM u * OH n 0 CM < T > 0 0 * «—4 H V 4) 0) n -Ω ^ yes x yes x 0 0 - 0 0 Ul U rH U in M fl — 1 CU CU ^ Oj O» -

JO < CCC O) tpo J-l σι r-Hoo 0-1c Φc O) T3 CD o m u 0) > c CCu & I ΙΪ4 u-i. -4 W H oa -H e < 1 σ '> c na ac ϋί ο c * H 0 i- · > c σ > 0 c N 3 c * 0) £ -Ή l-l • H 0 r- s TJ / · - U-l O 13 O O t-1 < u JO fO E-i

Plasma pool of 2000 individual donors copies / ml s | 0 H X CM CM 6 c c c - O Ul > flj TJ HC 0 fl) H 0 Aß O ft B X- t — 4 5 HC 6 0 «1 X« a 0 κ h B 0 c ft in • -i Ο -Η OX «cu h ca ta TP TJ cc OM > fl »TJ ri C 0 fl) HM .J 0 ft EO 0 ft« I -XH «I HC EV 0 X >: PI N Ti b 0 e ft m CO Η Ο -H 0 V ft in ca« σι » “4« n CO O τρ Ö tH < D < D yes yes x yes x 0 0 0 uu tn U | i — l Cu cu ^ CU - 49 AT 000 940 Ul

Example 6:

Testing plasma pools of various sizes for HIV and HCV RNA

Plasma samples from 10, 50, 100, 500, 1000 and 2000 HIV and HCV seronegative, healthy single donations were mixed into a plasma sample pool. The respective pool size was determined with a sample from a plasma donation from an HIV-infected primary and an HCV primary infected with one according to Examples 2.1 and 2.2. determined high exposure of HIV with 2.3 x 107 copies / ml and HCV with 1.6 x 106 copies / ml (sample 1), with a according to Example 2.1. and 2.2. determined minimal contamination of HIV with 2.8 x 105 copies / ml and of HCV with 2.2 x 104 copies / ml (sample 2) and as a control with a defined preparation of HIV with 1 x 104 copies / ml and HCV with 1 x 103 copies / ml (sample 3) and a preparation of HIV mixed with 1 x 103 copies / ml and HCV with 2 x 102 copies / ml (sample 4). The respective pool sizes were tested for the presence of HIV or HCV-specific nucleic acid using LIF-PCR using the primers specific for HIV or HCV. HIV and HCV-specific genome sequences could be detected in a contamination with a maximum exposure of 2.3 x 107 HIV copies / ml and 1.6 x 106 HCV copies / ml through a single donation up to a pool size of 1000 individual donations. HIV genome equivalents were still found in a pool size of 500 individual donations when contaminated with a low-burden donation, whereas HCV genome equivalents could only be found in a pool of 50 individual donors. The sensitivity for the detection of HCV genome sequences in the tested pools is therefore one log level below that for HIV genome sequences. 7. Evidence of the neutralizing effect of a HAV-immunized donation on the HAV virus load in a pool

The neutralizing potential of a plasma donation from a HAV-immunized donor can be demonstrated by in vitro neutralization tests.

To demonstrate the neutralizing effect of HAV antibodies on hepatitis A viruses present in the plasma, a plasma pool of 100 pre-immunized HAV donors with a protective immunity was tested and the pool with HAV (titer of 10 ^ * ^ 50 AT 000 940 Ul TClD50 / ml) mixed. After an hour's incubation at 37eC, the HAV titer was determined. The HAV infectivity could be increased by > 4.6 log levels can be reduced. This shows that protective antibodies present in the plasma of immunized donors neutralize the virus load in a larger plasma pool I. can. 51

Claims (32)

AT 000 940 Ul Claims: 1. Medicament containing one or more plasma derivatives as active substance or auxiliary, characterized in that the starting material or the intermediate products obtained in the production of the plasma derivatives have no or a virus load on one or more reproductive haematogenic viruses which does not exceed a defined limit value The non-existent virus load for certain reproductive haematogenic viruses is determined by an excess of virus-neutralizing antibodies in the starting material or intermediate or by a protective immunity in the plasma donor at the time of the plasma donation, otherwise the determination of the genome equivalents of the respective virus of interest in the starting material or in the intermediate product by means of a quantifiable, controlled and non-inhibited method for the detection or determination of nucleic acids, which is such a pain itity-assured starting material or intermediate product for the production of the finished plasma derivative is subjected to at least one further essential virus depletion or virus inactivation step, and the quality-assured finished plasma derivative is processed into a medicament by methods known per se. 2. Medicament according to claim 1, characterized in that there is no viral load for at least two viruses or the defined limit of the viral load is not exceeded, preferably selected from the group HIV, HAV, HBV, and HCV, in particular HIV and HCV. 3. Medicament according to claim 1 or 2, characterized in that the defined limit of the virus not to be exceeded 52 AT 000 940 Ul exposure of the starting material or intermediate product to reproductive haematogenic viruses to a maximum of 500 genome equivalents, in particular a maximum of 200 genome equivalents, preferably 100 genome equivalents , particularly preferably 50 genome equivalents, per ml of starting material or intermediate is limited. 4. Medicament according to one of claims 1 to 3, characterized in that the virus inactivation or virus depletion is carried out by means of at least one method with a reduction factor of at least 4 in the manufacture of the medicament from the quality-assured starting material or quality-assured intermediate. 5. Quality-assured starting material for a medicament according to one of claims 1 to 4, characterized in that it is a quality-assured plasma pool, optionally by mixing quality-assured mini pools, which preferably consist of approximately 200 individual donations, to a quality-assured macro pool, which preferably consists of approximately 2000 individual donations exist. 6. Quality-assured starting material according to claim 5, characterized in that a quality-assured macro pool has been combined by mixing with a number of other quality-assured macro pools to form a quality-assured multi-macro pool of up to 200,000 individual donations. 7. Quality-assured starting material according to claim 5 or 6, characterized in that quality-assured mini pools are obtained by mixing quality-assured small pools consisting of two to about 20 individual donations. 8. Quality-assured starting material for a medicinal product ^ j ^^, ^ according to one of claims 1 to 7, characterized in that the / '^ not available ^ or. A virus exposure not exceeding a defined limit value by determining the genome equivalents of all viruses of the group HIV, HBV, HCV, Parvovirus and HAV, 53 AT 000 940 Ul, the determination of the genome equivalents of all viruses of the group HIV, HBV, HCV and Parvovirus, and the determination an excess of HAV antibodies, the determination of the genome equivalents of all viruses of the group HIV, HBV and HCV, and the detection of an excess of HAV and parvovirus antibodies, the determination of the genome equivalents of all viruses of the group HIV, HBV and HCV, and the Detection of an excess of HAV antibodies, determination of the genome equivalents of all viruses of the group HIV, HBV and HCV, as well as determination of an excess of parvovirus antibodies, determination of the genome equivalents of all viruses of the group HIV, HBV and HCV, determination of the genome equivalents all viruses of the group HIV and HCV, or the genome equivalents of all viruses from the HIV and HCV groups are determined, and an excess of HBV antibodies is determined. 9. Medicaments which are produced by formulation from two or more finished plasma derivatives according to claim 1. 10. A process for the production of a medicament containing one or more plasma derivatives from a quality-assured starting material or from a quality-assured intermediate product obtained in the production of the plasma derivatives, the quality-assured starting material or intermediate product having no or a virus threshold at one or more reproductive levels which does not exceed a defined limit value - 54 AT 000 940 Ul capable haematogenic viruses, characterized in that the defined limit in the case of the determination of the genome equivalents of the respective virus is selected by a quantifiable, controlled and uninhibited method for the detection or determination of nucleic acids according to one or several of the following criteria: detection limit (des) of the nucleic acid amplification method (s) of at least 10,000 copies of selected nucleic acid sequences; certain number of genome equivalents, in particular a number below 500 genome equivalents, preferably below 200 genome equivalents, more preferably below 100 genome equivalents, particularly preferably below 50 genome equivalents, per ml of starting material or intermediate. 11. The method according to claim 10, characterized in that more than one detection or determination system for nucleic acids is used, wherein the detection or determination systems are preferably selected such that one system excludes false positive and another false negative results. 12. The method according to claim 11, characterized in that at least two different PCR methods are used, wherein at least one method is used for screening and at least one method for confirmation. 13. The method according to any one of claims 10 to 12, characterized in that the starting material or the intermediate or the genome equivalents contained therein are concentrated, preferably by lyophilization, adsorption or centrifugation. 14. The method according to any one of claims 10 to 13, characterized in that any inhibitors of amplification present in the starting material or intermediate are removed or depleted. 15. The method according to any one of claims 10 to 14, characterized in 55 AT 000 940 Ul records that for several viruses specific primer pairs are used in the amplification, so that the presence of several different viruses can be examined simultaneously. 16. The method according to any one of claims 10 to 15, characterized in that the primer pairs are selected so that they code for conserved genomic sequences of the individual haematogenic viruses to be examined, and their suitability is determined on corresponding samples of a representative sample cross section of the viruses to be examined becomes. 17. The method according to any one of claims 10 to 16, characterized in that one or more internal standards or reference preparations of the sample are added to control the method for the detection or determination of nucleic acids in a sample before or during the implementation of the method, the standards are determined or detected simultaneously with any viral genomes or genome sequences that may be present in one and the same test vessel. 18. A method for producing a plasma pool as a quality-assured starting material with a secured limited load on one or more reproductive haematogenic viruses from two or more individual donations, characterized by the following steps for determining the genome equivalents: taking samples from n individual donations, combining the individual donations Samples to m sample pools and detection of the amount of viral genomes or genome sequences present in these sample pools by means of a quantifiable, controlled and non-inhibited method for the detection or determination of nucleic acids, after which those individual donations (ng) of which the detected amount is viral genomes or genome sequences in the sample pool is below a certain limit, are combined into a quality-assured plasma pool and those individual donations 56 AT 000 940 Ul (na), of which the detected amount of viral genomes or genome sequences in the sample pool is greater than or equal to the limit: is passed on to further treatment or is excreted and where n and m are positive integers. 19. The method according to claim 18, characterized in that I. further samples are taken for further treatment of the excreted na single donations and these single donation samples are combined to ma sample pools, where na and ma are positive integers, raa > _ 2, and the ratio ma: na is greater than the ratio m: n, and in these sample pools again the amount of viral genomes or genome sequences by means of a quantifiable, controlled kUr. and non-inhibited method for the detection or / or determination of nucleic acids is detected, according to which those individual donations, of which the detected amount of viral genomes or genome sequences in the sample pool is below a certain limit value, are combined to form a quality-assured plasma pool and those individual donations of for which the detected amount of viral genomes or genome sequences is greater than or equal to the limit value, undergo further treatment or are excreted and the process is repeated until the number of individual donations to be further treated or eliminated has reached or fallen below a specified number. 20. The method according to claim 18 or 19, characterized in that n is 2 to 200,000, preferably 20 to 20,000, particularly preferably 200 to 2000, in particular 200, m between 1 and 100,000, preferably between 2 and 1000, and the fixed number finally, individual donations to be eliminated in accordance with claim 11 are 100, preferably 10, particularly preferably 1. 21. The method according to any one of claims 18 to 20, characterized in that the individual donations combined to a quality-assured plasma pool are combined with further quality-assured 57 AT 000 940 ul plasma pools, so that a quality-assured mini pool, macro pool or multi-macro pool is provided. 22. The method according to any one of claims 18 to 21, characterized in that the sample pools are additionally tested for the detection or determination of nucleic acids for virus-neutralizing antibodies against the viruses to be examined and those individual donations, of which no virus-neutralizing antibodies against corresponding viruses in the sample pool are detectable, undergo further treatment or are eliminated. 23. The method according to claim 22, characterized in that the individual donations are analyzed again in smaller subgroups for further treatment analogous to claim 19. 24. Quality-assured starting material or intermediate, obtainable by a process according to one of claims 10 to 23. 25. Quality-assured plasma pool, obtainable by a process according to one of claims 18 to 23. 26. Quality-assured finished plasma derivative, obtainable from a quality-assured starting material or intermediate according to claim 24 by an essential virus depletion or. Virus inactivation step, wherein the plasma derivative has preferably been examined again for viral genome equivalents or virus-neutralizing antibodies. 27. Medicines obtainable from a quality assured finished plasma derivative from human plasma by pharmaceutical formulation steps. 28. A process for the production of medicaments containing one or more plasma derivatives which are free from various reproductive haematogenic viruses, characterized by the following process steps: 58 AT 000 940 μl Providing a starting material or an intermediate product obtained in the production of the plasma derivatives, derived from human plasma , Quality assurance of the starting material or intermediate product by detecting the non-existent or a certain limit value of a viral load on reproductive haematogenic viruses, the non-existent viral load for certain reproductive haematogenic viruses by an excess of virus-neutralizing antibodies in the starting material or intermediate product or by a protective immunity is determined at the plasma donor at the time of the plasma donation, otherwise the determination of the genome equivalent of the respective person of interest n Viruses occur in the starting material or intermediate, subjecting the quality-assured starting material or intermediate of this type to at least one further virus depletion or virus inactivation step until it is completed, and processing the quality-assured finished plasma derivative obtained using known methods to form a medicament. 29. The method according to claim 28, characterized in that the quality assurance of each intermediate product which is to be subjected to an essential virus depletion or virus inactivation step is carried out. 30. Quality-assured starting material or intermediate product, obtainable by mixing quality-assured starting materials or intermediate products for a medicament 59 AT 000 940 Ul according to one of claims 1 to 4 before further processing to a quality-assured starting material or quality-assured intermediate product pool. 31- Medicament according to claim 1 or 2, characterized in that the virus inactivation or virus depletion by means of a 1. * protein-friendly process with a reduction factor of max. 4 is carried out in order to inactivate or eliminate the possibly present reproductive haematogenic viruses. 32. Medicament according to claim 31, characterized in that a single virus inactivation or virus depletion is sufficient to inactivate or eliminate the possibly present reproductive haematogenic viruses. 60