CA2120954A1 - Allergenic proteins and peptides from japanese cedar pollen - Google Patents

Abstract

2120954 9401560 PCTABS00030 The present invention provides isolated peptides of Japanese cedar pollen protein allergen, Cry j I. Peptides within the scope of the invention comprise at least one T cell epitope, or preferably at least two T cell epitopes of Cry j I. The invention also pertains to modified peptides having similar or enhanced therapeutic properties as the corresponding, naturally-occurring allergen or portion thereof, but having reduced side effects. The invention further provides nucleic acid sequences coding for peptides of the invention. Methods of treatment or of diagnosis of sensitivity to Japanese cedar pollens in an individual and therapeutic compositions comprising one or more peptides of the invention are also provided. The present invention also provides Jun v I
and Jun s I protein allergens and nucleic acid sequences coding for Jun s I and Jun v I allergens. Jun s I and Jun v I are protein allergens which are immunologically cross-reactive with Cry j I.

Description

W0 94/01560 2 1 2 ~ 9 ~ 4 PCI/US93/00139 ALLERGENIC PROTEI NS ~ND PEPTIDES FROM JAPANESE CE:DAEt POLLEN
S
Back~round of the Invention Genetically predisposed individuals, who make up about 10% of the population, become hypersensitized (aller~ic) to antigens from a variety of environmental sources to which ~hey are exposed. Those antigens that can induce immediate and/or delayed types of hypersensitivity are known as allergens. (King,T.P.,Adv. Immunol. 23: 77-105, (1976))~ Anaphylaxis or atopy, which includes the symptoms of hay fever, asthma, and hives. is one forrnof immediate allergy. It can be caused by a variety of atopic aller~ens, such asproducts of grasses, trees, weeds, animal dander. insects. food, dru~s. and chemicals.
- The antibodies involved in atopic allergy belong pnmarily to the I~E class of immunoglobulins. IgE binds to mast cells and basophils. Upon combination of a specific allergen with lCE bound to mast cells or basophils, ~eIgE may be cross-linked on the cell surface. resultin~ in the physiological effects ~0 of I~E-anti~en interaction. These physiological effects include the release of.
among other substances~ histamine. serotonin, heparin. a chemotactic factor for eosinophilic leukocytes and/or the leukotrienes, C4. D4, and E4~ which cause prolon~ed constriction of bronchial smooth muscle cells (Hood. L.E. et al. `
ImJmmology (2nd ed.), The Benjamin/Cumming Publishing Co.~ Inc. (1984)).
1~ These released substances are the mediators which result in allergic symptoms - caused by a combination of I~E with a specific aller~en. Throu~h them. the effects of an allergen are manifested. Such effects may be systemic or local in nature. depending on the route by which the ~nti~en entered the body and the pattern of deposition of IgE on mast cells or basophils. Local manif~stations ~0 generally occur on epithelial surfaces at the k)cation at which the aller~en entered the body. Systemic effects can include anaphylaxis (anaphylactic shock), which is the result of an I~E-basophil response to circulatin~
(intravascular) antigen.

I

j r WO 94/01560 ~ ' PCr/US93/00139 ~1~095~

Japanese cedar (Suoi: Cr~,utol71eria japonica) pollinosis is one of the most important allergic diseases in Japan. The number of patients sufferin~
t`rom this disease is on the increase an(i in some areas, more than 1()~ of the population are affected. Treatment of Japanese cedar pollinosis by ~ ¦
administration of Japanese cedar pollen extract to eft`ect hyposensitization to the aller~en has been attempted. Hyposensitization using Japanese cedar pollen extract, however, has drawbacks in that it can elicit anaphylaxis if hi~h doses are used, whereas when low doses are used to avoid anaphylaxis, treatm~nt must be continued for several years to build up a tolerance for the extract.
The major aller~en from Japanese cedar pollen has been purified and desi~nated as Su~i basic protein (SBP) Ol' Cr,~j I. This protein is reported to be a basic protein with a molecular weioht of 41-50 kDa and a pI of 8.8. There appear to be multiple isoforrns of the alleroen. app~rently due in part to differential glycosylation (Yasueda et al. (1983) J. Allerg~ Clin. Immunol. 71:
77-86; and Taniai et al. (1988) FEBS Letters 239: 329-332. The sequence of the first twenty amino acids at the N-telminal end of C ~! j I and a sixteen amino acid internal sequence have been determined (Taniai supra). - :A second allergen from Japanese cedar pollen having a molecular - wei~ht of about 37 kDa known as Cr.~ j II has also been reported (Saka~uchi et al. ( 1990) Allerg~ 45: 309-312). This aller~en was t`ound to have no immunological cross-reactivity with G~ j 1. Most patients with Japanese cedar pollinosis were found to haYe IgE antibodies to both Ct~ j I and C~
howe~er. sera from some patients reacted with only Ct~' j I or Cr~ j 11.
In addition to hyposensitization of Japanese cedar pollinosis 2s patients with low doses of Japanese cedar pollen extract. U.S. patent 4~939,239 - issued July 3, 1990 to Matsuhashi et al. discloses a hyposensitization agent i~
comprisino a saccharide covalently linked to a Japanese cedar pollen aller~en for hyposensitization of persons sensitive to Japanese cedar pollen. This hyposensitization a~ent is reported to enhance the production of I G and I~M
antibndies. but reduce production of I~E antibodies which are specific to the alleroen and responsible t`or anaphyla.Yis and aller~y. The aller,~ens use~l in the hyposensitization a~oent preferably have an NH~-terrninal amino acid sequence of wos4/01s6n ' 2~.æo~4 PCr/US93/0ol39 Asp-Asn-Pro-Ile-Asp-Sçr-X-Trp-Ar~-Gly-Asp-Ser-Asn-Trp-Ala-Gln-Asn-Arg- s Met-Lys-, wherein X is Ser, Cys. Thr~ or His (SEQ ID NO: 18). Additionally.
Usui et al. (1990) Int. A-ch. Allerg~ Appl. In1tnlll701. ~: 74-7~ reported ~hat the ability of a Su~i basic protein (i.e., C~ j l)-pullulan conju~ate to elicit the Asthus reaction was markedly reduced, about l.()()0 times lower than that of native Su~i !
basic protein and sug~ested that the Su~i basic protein-pullulan conju~ate wouldbe a good candidate for desensitization therapy acainst cedar pollinosis.
The C~y j I aller~en found in C~ ptnm~ria japot7ica has also been found to be cross-reactive with allergens in the pollen flom other species of trees, including Cllpressl~s semp~l~i)el?s~ Panzani et al. (Annals of Allelg! ~7:
26-30 (1986)) reported that cross reactivity was detected between allergens in the pollens of cupressLls semp~rvi)ens and C~ om~ria juponica in skin testin~.
RAST and RAST inhibition. A 50 kDa allerl~en isolated from Mountain Cedar (Jurliperus sabinoides, also known as Junipe)us ashei) has the NH2-terminal sequence AspAsnProIleAsp (SEQ ID NO: 25) (Gross et al, (19 î 8) Scand. J.
Immunol. 8: 437-441) which is the same sequence as the first five amino acids ofthe NH-2 terminal end of the Cry j I aller~en. The C~? j I aller~en has also been found to be allergenically cross-reactive with the following species of trees:
Cupressus a~i~onica, CI~presslls macrocaspa, Jllniperus virgiMiana, Jl~nipe)us communis, 7`huYa orientalis, and Cham~c~paris o~tusa.
Despite the attention Japanese cedar pollinosis aller ens have received. definition or characterization of the aller~ens responsible for i~s adverse effects on people is far ~'rom complete. Current desensitization therap~involves treatment with pollen extract with its attendant risks of anaphyl~xis if high doses of pollen extract are administered. or lon; desensitizatit)n times when low doses of pollen extract are administered.

Summarv of the Invention The present invention provides nucleic acid sequences codin~ for the Cl~ ptomeria japonica major pollen alles ~en Cr! j I and ~;aoments thereof.
The present invention also provides isolated Cr! j I or at least one fr;~ment thereof produced in a host cell transformed with a nucleic acid sequence codin~

WO ~4/01560 ` PCr/US93/00139 U~4 for Cry j I or at least one fragment thereof and fragments of ~rYj I prepared synthetically.
The present invention also provides Jun l~ l and Jun s I protein allergens which are immunologically cross-reactive with Cr~ j I and fragmen~s ofS J~n v 1 and Jun s I produced in a host cell transformed with a nucleic acid sequence coding for Jun s I or JuJt v I respectively and fra~ments of Jult s I and Jun v I prepared synthetically. The present invention further provides nucleic acid sequences coding for Jun v I and Jlm s I and fia~ments thereof. As used herein, a fragment of the nucleic acid sequence coding for the entire amino acidsequence of Cry j I, Jun s I or Jun v I refers to a nucleotide sequence having fewer ~ases than the nucleotide sequence codin~ for the entire amino acid sequence of CrYj I, J~m s I or Jun v I andlor rnature Cr~ j I. Jult s I or Jl/l? v I.
C~ ~ j I, Jun s I or Jun v I and fra~ments thereof are useful for dia~nosing.
treatin~, and preventint, Japanese cedar pollinosis as well as pollinosis caused by pollen from other species of trees wherein such pollen is immunolo; ically cross-reactive with Japenese cedar pollen allergen.
Peptides within the scope of the invention preferably complise at Ieast one T cell epitope, and more preferably at least two T cell epitopes of Cry j I. The invention further provides peptides comprisin~ at least two rec~ions~ each ~0 region comprising at least one T cell epitope of a Japanese cedar pollen protein allergen. The invention also provides modified peptides having similar or enhanced therapeutic properties as the correspondin~ naturally-occurrin~ ^
allergen or portion thereof, but havin~ reduced side effects. as well as modified `
peptides having improved properties such as increased solubility and stability.
2S Peptides of the invention are capable of modifying~ in a Japanese cedar pollen- ¦
sensitive individual or in an individual who is sensitive to an allergen cross-reactive with Japanese cedar pollen. to whom they are administered. the aller~icresponse of the individual to a Japanese cedar pollen aller~en or an aller~en cross-reactive with Japanese cedar pollen such dS JUI? S I or Jl~n ~ I. Methods of treatment or diagnosis of sensitivity to Japanese cedar pollen or a cross-reactive aller~en in an individual and therapeutic compositions complising one or more peptides of the invention are also provided. This in~ention is more particularly

2 1 ~ 1~ 9 ~ 4 PCl /US93/00139 described in the appended claims and is described in its preferred embodiments in the following description.

Brief Description of the Drawin~s s Fi~. la is a graphic representation of affinity purified Cn~ j I on Superdex 75 (2.6 by 60 cm) equilibrated with 10 mM sodium acetate (pH 5.0) and 0.15 M Na~1;
Fi~. lb shows an SDS-PAGE (1~.5%) analysis of the fractions from the major peak shown in Fig 1 a;
Fig. 2 shows a Western blot of isoforms of purified native Cr~
proteins separated by SDS-PAGE and probed with mAB CBF2;
Fig. 3 is a graphic representation of allergic sera titration ot different purified fractions of purified native Cr~! j I usin~ plasma from a pool of fifteen allergic patients;
Figs. 4a-b show the composite nucleic acid sequence trom the two overlapping clones JC 71.6 and pUC19JC9 la coding for Cry j I. The complete - cDNA sequence for Cr~ j I is composed of 1312 nucleotides~ including 66 nucleotides of 5' untranslated sequence~ an open readin; frame starting with thecodon for an initiatin~ methionine of 1122 nucleotides~ and a 3' untranslated re~ion. Figs. 4a-b also show the deduced amino acid sequence of C~
Fig. 5a is a graphic representation of the results of IgE bindino reactivity wherein the coatin~ antigen is soluble pollen extract (SPE) trom Japanese cedar pollen;
Fig. Sb is a graphic representation of the results of IC~E bindino 2S reactivity wherein the coating antigen is purified native C~
Fig. 6 is a graphic representation of the results of a competition ~.
ELISA with pooled human plasma (PHP) t`rom 15 patients wherein Ihe coatino anti~en is soluble pollen extract (SPE) ~om Japanese cedar pollen:
Fig. 7 is a graphic representation of the results ot a c~mpetition ELISA using plasma from individual patients (indicated by patient numbers!
wherein the coatin~ antigen is soluble pollen extract (SPE) t`rom Japallese cedapollen and the competing antigen is puritied native Cr~

WO 94/01560 , ~ PCr/US93/00139 ZlC~ o(~4 Fi~. 8a is a ~raphic representation of the results from a direct binding ELISA using plasma frc)m seven individual patients (indicated by patient numbers) wherein the coating antioen is soluble pollen extract (SPE) fi om Japanese cedar pollen;
Fig. 8b is a ~raphic representation ot' the results from a direct binding ELISA using plasma from seven individual patients (indicated by patient nurnbers) wherein the coating antigen is denatured soluble pollen extrdct which has been denatured by boiliri~ in the presence of a reducin~ agent, DTI`:
Fig. 9 is a graphic representation of a direct ELISA where the wells were coated with recombinant C~ j I (rC~ j I) and IgE bindin~ was assayed on individual patients;
Fig. lOa is a graphic representation of the results of a capture ELlSA usin~ pooled human plasma from fifteen patients wherein the wells were coated with CBF2 (IgG) mAb, PBS was used as a negative anti~en control. and `
the anti~en was purified recombinant C~ j I;
Fig~. lOb is a graphic representation of the results of a capture ELISA using rabbit anti-Amb aI and II. wherein the wells were coated with 20 - ~glml CBF2 (I~G), PBS was used as a ne~ative antigen eontrol and the anti,~en was purified recombinant Cr~
'0 - Fig. 11 is a graphic representation of a histamine release assay perforrned on one Japanese cedar pollen aller~ic patient using SPE from Japanese cedar pollen, purified native C~ j l and recombinant C~ j I as the added anti~ens; and Fig. 12 is a graphic representation of the results of a T cell ~s proli~ration assay usin~ blood from patient #999 wherein the antioen is recombinant G~ j 1 protein, puri~led native C1~ j I protein, or selected Cr~
peptides recombinant Amb a 1.1.
Fig. 13 shows valious peptides of desired lengths derived trom C~
~0 Fig. 14 is a graphic representation depictino responses of T cell lines from twenty-five patients primed in vitro with purif~ed native Cr! j I and ~;-analyzed for response to various G~ j I peptides by percent o f respons~s ,' WO 94/01~60 P~/US93/00139 (positive) with an S.I of at least two (shown over each b~r)~ the mean stimulation index of positive response for the peptide (shown over each bar in parenthesis) and the positivity index (Y ~xis).
Fig. 15 is a graphic representation of the results of a direct s binding assay of IgE to certain Cr~ j I peptides. purified native C~,~ j I and rC)~ j ;
I.
Figs. 16 shows the nucleotide sequence of Jlln s l: this sequence is a composite from the two overlapping cDNA clones pUC19JS42e and pUC19JS45a as well as the full-length clone JS53iib codin~ for Jltn s I; the complete cDNA sequence ~or Jun s I is composed of l 17() nucleotides, includin~
25 nucleotides of 5' untranslated sequence. an open reading frame of l.101 nucleotides. and a 3' untranslated region~ Fig. 16 also shows the deduced amino acid sequence of Jun s I.
Fig. i7 shows the nucleotide sequence of Jun v I: this sequence is a composite from the two overlapping cDNA clones pUCl9JV46a and pUC19JV49iia coding for Jun v I: the complete cDNA sequence for Ju11 v I is composed of 1278 nucleotides. including 35 nucleotides of 5' untranslated sequence, an open reading frame of 1,110 nucleotides. and a 3' untranslated region; Fi~. 17 also show the deduced amino acid sequence of J1~n Fi~. 18 shows various peptides of desired lengths derived t`rom C~
Figs. 19a and 19b show Northern blots of pollen-derived RNA probed with C)~ j cDNA for identification of mRNA capable of encodino Cr~ j I or a C~ j I homologue: Fig. 19a shows RNA from C. japnnica (U.S. and Japanese sources)~ J. sabinoides and J. virginiana probed with C)~ j I cDNA: Fio. l 9b shows RNA from J. sabinoides and C. ari_onica probed with the same cDNA:
the position of molecular weight standards are shown in each pal~ ot` the Fi~ure.

Detailed Description of the Invention The present invention provides nucleic acid sequenc~s coding ~or Cn j I. the major aller~en found in Japanese cedar pollen as well as nucleic acid sequences coding for Jlm 1,~ 1 and Jun s I. The nucleic acid sequence coding ~or , r Cr! j I preferably has the sequence shown in Figs. 4a and 4b (SEQ ID NO: I ).

2 ~ 4 The nucleic acid sequence coding for c~ j 1 shown in Fi~s. 4a and 4b (SE(;~ ID
NO: 1) contains a 21 iamino acid leader sequence from base 66 throu~h base 128.
This leader se~uence is cleaved from the mature protein which is encoded by basies 129 through 1187. The deduced amino acid sequence of Cr~ j I is also shown in Figs. 4a and 4b (SEQ ID NO: 2). The nucleic acid sequence of the invention codes for a protein having a predicted molecular weight of 3g.5 kDa~
with a pI of 7.8. and five potential N-linked glycosylation sites~ Utilization of these glycosylation sites will increase the molecular wei~ht ~nd affect the pI of the mature protein. The deduced amino acid sequence for the mature protein encoded by the nucleic acid sequence of the invention is identical with the known NH2-tenninal and internal amino acid sequences reported by Taniai et al.. supra. The NH2-terrninal end of C ~ j I reported by Taniai et al.. sl/pr~ has the sequence shown in SEQ ID NO: 18. The internal sequence repor~ed by Taniai et al.~ supra has the sequence lS GluAlaPheAsnValGluAsnGlyAsnAlaThrProGln`LeuThrLys (SEQ ID NO: 19).
There are sequence polymorphisms observed in the nucleic acid sequence of the invention. For example. single independent nucleotide substitutions at the codons encoding amino acids 38, 51 and 74 (GGA vs. GAA. GTG vs. ~CG. and GGG vs. CiAG. respectively) of SEQ ID #l may result in arnino acid ~0 polymorphisms (G vs. E, V vs. A. and G vs. E. respectiYely) at these sites. In addition. a single nucleotide substitution has been detected in one cDI~A clone derived from Cr~ptomeriajaponica pollen collected in Japan. This su~Stitution in the codon for amino acid 60 (TAT vs. CAT) of SEQ ID #l may result in an `
amino acid polymorphism (Y vs. H) at this site. Additional silent nucleotide ~5 substitutions have been detected. It is expected that there are additional sequence polymorphisms. and it will be appreciated by one slcilled in the art tha[ o ne or more nucleotides (up to about 1~ of the nucleotides) in the nucleic acid sequence coding for Cl,~ j I may vary amon~ individual C)~l7tom~ia j(~ nica plants due to natural allelic variation. Any and all such nucleotide ~ tions andO resultinD amino acid polymorphisms are within the scope of the in~ention.Furthermore. there may be one or more ~mily members of C~ j I. Sueh ~`amily members are defined as proteins related in function and amino acid sequence to WO 94/01560 ' 2 ~ 2 0 ~ S ~ PCI/U~93/~013~ ' C y j I but encoded by genes at separate ~enetic loci.
Fragments of the nucleic acid sequence codin~ for fragments of Cr~ j I or a cross-reactive allergen are also within the scope of the invention.Fra~ments within the scope of the invention include those coding for palts of Cnj I or a cross-reactive allergen such as Jun v I or Jun s l which induce an immune ?
response in mammals, preferably humans~ such as stimulation of minimal amounts of IgE: binding of I~E; eliciting the production of IgG and IgM
antibodies: or the elicitin~ of a T cell response such as proliferation andlor lymphokine secretion and/or the induction of T cell anergy. The foregoing ~~
fragments of C)y j I are referred to herein as antigenic fra~ments. Fra,~,ments within the scope of the invention also include those capable of hybridizinc~ with nucleic acid from other plant species for use in screening protocols to detect alleroens that are cross-reactive with C~ j I. As used herein~ a fragment of thenucleic acid sequence coding for C)y j I refers to a nucleotide sequence having ' fewer bases than the nucleotide sequence coding for the entire amino acid sequence of C~! j I and/or mature Cr~, i I. Generally. the nucleic acid sequencecoding for the fragment or fragments of C~ j I will be selected from the bases coding for the mature protein, however, in some instarlces it may be desirable to select all sr a part of a fragment or fra~ments from the leader sequence portionof the nucleic acid sequence of the invention. The nucleic acid sequence of the invention may also contain linker sequences. modified restliction endonuclease - sites and other sequences useful for clonin~ expression or purification of C~
or fra~ments thereof.
A nucleic acid sequence codin~ for Cl~ j I may be obtained from '5 C yptomeria japonica plants. However. Applicants have found that mRNA
codin~ for Cn~ j I could not be obtained from commercially available Cr~ptomeria juponica pollen. This inability to obtain mRNA from the pollen may be due to problems with stora~e or transportation of commercially a~ ailablepollen. Applicants have found that fresh pollen and staminate cones are a oood source of Cry j I mRNA. It may also be possible to obtain the nucleic acid sequence codin~ for Cl~ j I from ~enomic DN A. Cr~pt )n7~-ia japol7ic~ is a well-known species of cedar. and plant materiul may be obtained from w ild.
.

~ .... ~ ...... .

WO 94/01~60 PCI/USg3/00139 ' ~20~4 cultivated, or ornamental plants. The nucleic acid sequence codi~ r G~ j I
may be obtaine~ using the method disclosed herein or any other sui~ble techniques for isolation and cloning of genes. The nucleic acid sequence of the invention may be DNA or RNA. .
The present invention provides expression vectors and host cells transforrned to express the nucleic acid sequences of the invention. A nucleic acid sequence codin;~ for C~ j L Jurt v I or Jull s I or at least one fra~ment thereof may be expressed in bacterial cells such as E. coti, insect cells (baculovirus). yeast, or mammalian cells such as Chinese hamster ovary cells (CHO). Suitable expression vectors. promoters, enhancers. and other expression control elements may be found in Sambrook et al. Molecular Cloning: A
LaboJa~o~y Manual. second edition. Cold Sprin~ Harbor Laboratory Press. Cold Spring Harbor. New York (1989). Other suitable expression vectors. promoters, enhancers, and other expression elements are known to those skilled in the art.
Expression in mammalian, yeast or insect cells leads tO partial or complete glycosylation of the recombinant material and fo~nation ot any inter- or intra-chain disulfide bonds. Suitable vectors for expression in yeast include YepSec 1(Baldari et al. (1987) Embo J. 6: 229-234); pMFa (Kurjan and Herskowitz (1982) Cell 3n 933-943~; JRY88 (Schultz et al. (1987) Gene 54: 113-123) and pYES2 (Invitrogen Corporation~ San Diego, CA). These vectors are freely available. Baculovirus and mammalian expression systems are also available.
For example, a baculovirus system is commercially available (PharMingen. San - ~-Diego. CA) for expression in insect cells while the pMSG vector is commercially - available ~Pharmacia. Piscataway, NJ) for expression in mammalian cells.
~5 For expression in E. coli. suitable expression vectors include. among others. pTRC (Amann et al. (1988) Gene 69: 301-315): pGEX (Amrad Corp Melbourne. Australia); pMAL (N.E. Biolabs. Beverly. MA): pRlT~ (Pharrnacia.
Piscataway. NJ); pET- 1 ld (Nova~en. Madison. WI) Jameel et al.. ( l 990) J.
Vi)ol. 64:3963-3966; and pSEM (Knapp et al. (1990) BioTechrliqlt~s ~: 280-281) The use of pTRC. and pET-I ld. tor example. will lead to the expression , of unfused protein. The use of pMAL. pRIT5 pSEM and pGEX will lead to the ~ c expression of aller~en fused to maltose E binding protein (pMAL)~ protein A

10.
i WO 94/01560 PCr/US93/00139 2 1 2 0 9 ~ 4 (pRIT5). truncated B-galactosidase (PSEM), or glutathione S-transferase (pGEX). When Ct~ j I. fra~ment~ or fragments thereot i~ expressed as a fusion protein, it is particularly advantageous to introduce an enzymatic cleavage site at the fusion junction between the carrier protein and C~ j I or fra~ment thereof.
s C~ j I or fragment thereof may then be recovered from the fusion plotein through enzymatic cleavage at the enzymatic site and biochemical purification using conventional techniques for purification of proteins and peptides. Suitable enzymatic cleavage sites include those for blood clotting Factor Xa or thrombin for which the appropriate enzymes and protocols for cleava~e are commercially available from, for example. Sigma Chemical Company~ St. Louis. MO and N.E.
Biolabs, Beverly, MA. The different vectors also have different promoter re. ions allowing constitutive or inducible expression with~ for example. IPTG
induction (PRTC, Amann et al.~ (1988) supru: ~ET-1 ld, Nova~en~ Madison.
WI) or temperature induction ~pRIT5. Pharmacia, Piscataway, NJ) . It may also be appropriate to express recombinant C~ j I in different E. coli hosts that have an altered capacity to degrade recombinantly expressed proteins (e.g. U.S. patent 4,758.512). Alternatively, it may be advantageous to alter the nucleic acid sequence to use codons preferentially utilized by E. coli. where such nucleic acid alteration would not affect the arnino acid sequence of the expressed protein.
Host cells can be transformed to express the nucleic acid sequences of the invention using conventional techniques such as calcium phosphate or calcium chloride co-precipitation. DEAE-dextran-media~d -transfection. or electroporation. Suitable methods t`or transforming the host cells may be found in Sambrook et al. supra. and other laboratory textbool;s.
The nucleic acid sequences of the invention may also be synthesized using standard techniques.
The present invention also provides a method of producill~
isolated Japanese cedar pollen aller~en C~, ,j I or at least one fra~ment thereof cornprising the steps of culturing a host cell transformed with a nucleic acid sequence encodin~ Japanese cedar pollen aller~en C~ j I or at least on~ t`raoment thereof in an appropriate medium to produce a mixture of cells and medium conr~tining snid Japmese cednr pollen rller~on C~ j I or at least one trlgment !

WO 94J01560 PCr/US93/00139 , 4 thereof; and purifying the mixture to produce substantially pure Japanese cedar I ;
pollen allergen Gy j I or at least one fra~ment thereof. Host cells transformed with an expression vector containing DNA coding for C~' j I or at least one fragment thereof are cultured in a suitable mediurn for the host cell. C~
protein and peptides can be purified from cell culture medium. host cells. or both usin~ techniques known in the art for purifyin~ peptides and proteins including ~ ;
ion-exchan~e chromatography. ~el filtration chromatography~ ultrafiltratiom electrophoresis and irnmunopurification with antibodies specific for C~ j I or fragments thereof. The terms isolated and purified are used interchan~eably 0 herein and refer to peptides. protein, protein fragments~ and nucleic acid sequences substantially free of cellular material or culture medium when produced by recombinant DNA techniques~ or chemical precursors or other chemicals when synthesized chemically.
Another aspect of the invention provides preparations comprising Japanese cedar pollen aller~en G~ j I or a cross-reactive aller~en such as Ju~ v I
or Jun s I or at least one fragment thereof synthesized in a host cell transformed with a nucleic acid sequence encoding all or a portion of Japanese cedar pollen aller~en Cry j I or such cross-reactive allergen, or chemically synthesized. andisolated Japanese cedar pollen allergen C~ j I protein or a cross-reactive allergen such as Jlm v I or Jl~n s I, or at least one antigenic fragment thereof produced in a host cell transformed with a nucleic acid sequence of the invention. or chemically synthesiæd. ln preferred embodiments of the invention th~ Cr~ j I i;
protein is produced in a host cell transformed with the nucleic acid sequence coding for at least the mature G~! j I protein.
~5 Antigenic fragments as defined herein refer to any protein fra~ment or peptide which induces an immune response. Unique antigenic fra~ments as defined herein refer to any antioenic fraoment derived t`rom Cry j 1.
with the exception of the fragments consistino of amino acids 1-2() or 3 ~ .40 as sho~vn in Figs. 4a-4b. Antigenic ~;agments of an allergen from Japanese ceda pollen. or a cross-reactive allergen such as J~n v I or Ju11 s I may be obt;lined.
for example. by screening peptides recombinantly produced from the corresponding fragment of the nucleic acid sequence of the invention codin~ for WO94~01~60 '~ 2~20954 PCr/VS93/00139 such peptides or synthesized chemically using techniques known in the art. The aller~en may be arbitrarily divided into fra~ments of a desired len~th with no overlap of the peptides, or pret`erably divided into overlapping fragments ot a desired !en~th. The fra~ments are tested to deterrnine their antigenicity (e.~. the ability of the fragment to induce an immune response). If fragments of Cr~ j I
are to be used for therapeutic purposes~ then the fra~ments of C~ j 1 aller~en which are capable of elicitin~ a T cell response such as stimulation (i.e., proliferation or Iymphokine secretion) and/or are capable of inducing T cell anervy are particularly desirable and fragments of Japanese cedar pollen which 0 have minimal IgE stirnulating activity are also desirable. Minimal IgE
stimulating activity refers to IgE stimulating activity that is less than the amount of IgE production stimulated by the native Ct~ j I protein. Additionally. for therapeutic pulposes, it is preferable to use isolated Japanese cedar pollen aller~ens, e.~. Cty j I, or fra~ments thereof which are capable of elicitin~ T cell -responses and which do not bind I~E specific for Japanese cedar pollen or bind such I~E to a substantially lesser extent than the purified native Japanese cedar pollen allergen binds such IgE. If the isolated Japanese cedar pollen a}ler~en or fragment or fragments thereof bind IgE~ it is preferable that such bindin~ does not result in the release of mediators (e.g. histamines) from mast cells or basophils. Furthermore, if Jun v I or Jun s I are to be used for therapeutic purposes~ it is preferable to use Juniperl-s pollen aller~ens~ e.g. J~J7 v I or Jln7 s I
or a t`ra~ment thereof which are capable of elicitin~ T cell responses and which ~.``':3 do not bind IgE specific for pollen from the species Juniperlls or bind such I~Eto a substantially lesser extent than the purified native Juniperlls pollen aller~en '5 binds such IgE. If the isolated Jl~n v I or J~n s l or &agment or fra2ments thereof bind I~E, it is preferable that such binding does not result in the release of mediators (e.g. histarnines) from mast cells or basophils.
Isolated protein allergens from Japanese cedar pollen or pret`ened antigenic fra~ments thereof, when administered to a Japanese cedar pollell-sensitive individual, or an individual aller~ic to an aller~en cross-reactive ~vith Japanese cedar pollen allergen, such as aller~en from the pollen ot Jllni~7e) l~S
virginiana or J~mipetus sabinoides etc. (discussed previously) are capa~le o t WO 94/01~60 PC~/US93/00139 21209~4 i -~

modifying the allergic response of the individual to Japanese cedar pollen or such cross-reactive aller~en of the individual. and preferably are capable of modifying the B-cell response. T-cell response or both the B-cell and the T-cellresponse of the individual to the allergen. As used herein. modi~lcation of the allergic response of an individual sensitive to a Japanese cedar pollen aller~en or 1~ -cross-reactive aller~en can be de~lned as non-responsiveness or diminution in symptoms to the allergen. as determined by standard clinical procedures (See e.~.
Varney et al, British Medical Journal, 3()2:265-269 (1990~) includin~
dimunition in Japanese cedar pollen induced asthmatic symptoms. As refe-Ted to herein, a dimunition in symptoms includes any reduction in aller~ic response of an individual to the allergen after the individual has completed a treatment regimen with a peptide or protein of the invention. This dimunition may be subjective (i.e. the patient feels more comfortable in the presence of the allergen). Dimunition in symptoms can be determined clinically as well~ using standard skin tests as is known in the art.
The isolated C~ j I protein or fra, ments thereof are preferably tested in mammalian models of Japanese cedar pollinosis such as the mouse model disclosed in Tarnura et al. (1986) Microbiol. ~mm~moL 30: 883-89~ or U.S. patent 4,939,239: or the primate model disclosed in Chiba et al. ( 1990) Int.
Arch. Allergy Imm41nol. ~: 83-88. Initial screenin~ for I~E binding to the protein or fragments thereof may be performed by scratch tests or intradelmal skin tests on laboratory animals or human volunteers~ or in in vitro systems such as RAST (radioallergosorbent test)~ RAST inhibition~ ELISA assay~
radioimmunoassay (RlA)~ or histamine release (see Examples 7 and 8).
2s Antigenic fra~ments of the present invention which have T cell stimulating activity, and thus comprise at least one T cell epitope are palticularly desirable. T cell epitopes are believed to be involved in initiation and perpetuation of the immune response to a protein aller~en which is respol1sible for the clinical symptoms of allergy. These T cell epitopes are thou; ht to tri~er early events at the level of the T helper cell by bindin~ to an appropriate HLA
molecule on the sultace ot an anti~en presentin~ cell and stimulatin~ the relevant i-~
T cell subpopulation. These events lead to T cell prolit`eration~ lymphol;ine WO 94/01~60 2 1 2 0 9 ~ 4 PCI`/US93/00139 secretion, local inflammatory reactions, recruitment of additional immune cells to the site, and activation of the B cell cascade leading to production of antibodies. One isotype of these antibodies. IgE, is fundamentally important to the development of allergic symptoms and its production is influenced early in S the cascade of events, at the level of the T helper cell. by the nature of the Iymphokines secreted. A T cell epitope is the basic element or smallest unit of recognition by a T cell receptor, where the epitope comprises amino acids essential to receptor recognition. Amino acid sequences which mimic those of the T cell epitopes and which modify the allergic response to protein alleroens are within the scope of this invention.
Exposure of cedar pollen patients to isolated protein allergens of the present invention or to the antigenic fragments of the present invention which comprise at least one T cell epitope and are derived from protein allergens may tolerize or anergize appropriate T cell subpopulations such that they become unresponsive to the protein allergen and do not participate in stimulating an immune response upon such exposure. ln addition. administration of a protein aller~en of the invention or an antigenic fragment of the present invention which comprises at least one T cell epitope may modify the lymphokine secreuon profile as compared with exposure to the naturally-occurring protein alleroen orportion thereof (e.g. result in a decrease of IL-4 and/or an increase in IL-2).
Furthermore, exposure to such protein allergen or anti~enic fra~ment of such protein allergen may influence T cell subpopulations which normally participate in the response to the allergen such that these T cells are drawn away from the site(s) of normal exposure to the allergen ~e.g., nasal mucosa, skin~ and lun~) '5 towards the site(s) of therapeutic administration of the fragment or protein allergen. This redistribution of T cell subpopulations may ameliorate or reduce the ability of an individual's immune systern to stimulate the usual immune response at the site of normal exposure to the allerPen~ resulting in a dimunution inl aller~ic symptoms.
The isolated C~ j 1. JUJ1 ~ I or Jun s 1 protein~ and tra~m~nts or portions derived therefrom (peptides) can be used in methods of diagnosino.
treating and preventing aller~ic reactions to Japanese cedar pollen aller en or a WO 94~01560 PCr/US93/00139 cross reactive protein aller~en. Thus the present invention provides therapeuticcompositions comprising isolated Japanese cedar pollen allergen C~ j I, JIJn v Ior Jun s I or at least one fragment thereof produced in a host cell transt'ormed to express Cr ~ j I. Jun v I or Jun s I or at least one fragment thereof, and a s pharmaceutically acceptable carrier or diluent. The therapeutic compositions of the invention may also comprise synthetically prepared CrY j I. J~n v I or Jun s I
or at least one fragment thereof and a pharmaceutically acceptable carrier or diluent. Administration of the therapeutic compositions of the present inventionto an individual to be desensitized can be carried out using known techniques.
lo C~y j I. Jun v I or Jl~n s I protein or at least one fra~ment thereof may be administered to an individual in combination with, for example, an appropriate diluent~ a carrier and/or an adjuvant. Pharrnaceutically acceptable diluents include saline and aqueous buffer solutions. Pharrnaceutically acceptable carriers include polyethylene glycol (Wie et al. (1981) Int. Arch. Alle~g! Appl.
..
Immlmol. 64:84-99) and liposomes (Strejan et al. (1984) J. Neu-oimml010l 7:
27). For purposes of inducing T cell anergy, the therapeutic composition is preferably administered in nonimmuno~enic forrn, e.g. it does not contain ~` adjuvant. The therapeutic compositions of the invention are administered to Japanese cedar pollen-sensitive individuals or individuals sensitive to an allergen which is immunolo~ically cross-reactive with Japanese cedar pollen allergen (i.e.
J~miperus virginiana, or Juniperus sabinoides. etc.).
Administration of the therapeutic compositions of the present , .
invention to an individual to'be desensitiæd can be carried out using known procedures at dosa~es and for periods of time effective to reduce sensitivity (i.e reduce~ the ~allerg* response) of the individual to the allergen. Effécti~e amounts of the therapeutic compositions will vary according to t'actors such as the degree ; ~ of sensitivity of the individual to Japanese cedar pollen. the age~ sex. and ~vei~ht of the individual. and the ability of the protein or fra~ment thereof to elicit an ' ~ i antigenic response in the individual.
The active compound (i.e.~ protein or fragment thereof~ mav be administered in a convenient manner su'ch asi by injection (subcutaneous.
intravenous, etc.), oral administ~ation, inhalation~ transdermal application. or ,~
~
.
,~
, ' 16 :~:

WO 94~01560 Pcr/us93JO0139 21209~5~ `

rectal administration. Depending on the route of administration, the active compound may be coated within a material to protect the compound from the action of enzymes, acids and other natural conditions which may inactivate the compound.
For example, preferably about 1 ,ug- 3 mg and more preferably from about 20-500 ~Lg of active compound (i.e., protein or fragment thereof) perdosace unit may be administered by injection. Dosage regimen may be adjusted to provide the optimurii therapeutic response. For example, several divided doses may be administered daily or the dose may be propoltionally reduced as indicated by the exigencies of the therapeutic situation.
To administer protein or peptide by other than parenteral administration, it may be necessary to coat the protein with~ or co-administer the protein with~ a material to prevent its inactivation. For example~ protein or fragment thereof may be administered in an adjuvant~ co-administered with enzyme hibitors or in liposomes. Enzyme inhibitors include pancreatic trypsin inhibitol~ diisopropylfluorophosphate (DEP) and trasylol. Liposomes include water-in-oil-in-water CGF emulsions as well as conventional liposomes (Strejan e~ al.~ (1984) J. Ne~immunol. 7:27).
The active compound may also be administered parenterally or ~0 intraperitoneally. Dispersions can also be prepared in glycerol~ liquid polyethyline glycols~ and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to .
prevent the growth of microorganisms.
Pharmaceutical compositions suitable for injectable use includ~
~5 sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions of dispersion.
In all cases~ the composition must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manutactureand storage and must be preserved against the contaminating action of ~0 microorganisms such as bacteria and fungi. The currier can be a solvent or ~i dispersion medium containing, for example, wuter, ethanol~ polyol (t`or example, ~, glyceral, propylene glycol, and liquid polyetheylene glycol, and the like). ~j , WO 94/01560 PCr/US93/00139 .
?,~.209~ :

suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained. for example~ by the use of a coating such as licithin. by the maintenance of the required particle size in ehe case of dispersion and by the use of surfactants. Prevention of the action ot microor~anisms can be achieved by various antibacterial and antifun~al agent~s~ for example~ parabens~ chlorobutanok phenol, ascorbic acid, thirmerosal, and the like. In many cases, it will be preferable eo include isoeonic agents, for example~ su~ars. polyalcohols such asmanieol and sorbitol or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about, includin~ in thecomposition, an agent which delays absorption, for example~ aluminum monostearate and gelatin.
Sterile injectable solutions can be prepared by incorporatino active compound (i.e., protein or peptide) in the required amount in an appropriate solvent with one or a combination of inoredients enumerated above.
as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from thoseenumerated above. In the case of sterile powders for the preparation of sterile indectable solutions, the preferred methods of preparation are vacuum dryino and20 freeze-drying which yields a powder of the active ingredient ~i.eprotein or peptide) plus any additional desired ingredient from a previously sterile-filtered solution thereof.
When protein or peptide thereof is suitably protected. as described above. the protein may be orally administered. for example. with an inelt diluent ~3 or an assimilable edible carrier. The protein and other in~redients may ~Iso be enclosed in a hard or soft shell gelatin capsule. compressed into tablets. or incorporated directly into the individual's diet. For oral therapeutic administration, the active compound may be incorporated with excipients and used in the forrn of in~estible tablets, buccal tablets. troches~ capsules~ elixirs.
~0 suspensions. syrups. wafers~ and the like. Such compositions and preparali( ns should contain at least 15~ by wei~ht of active compound. The percenta_e o t` the ~.;
composition and preparations may~ of course. be v alied and may conveniently be ~.

WO 94/~1560 2 1 2 ~ 9 5 ~ PCT'/US93/00~39 between about 5 to 80% of the weight of the unit. The amount of active compound in such therapeutically useful compositions is such that a suitable dosa~e will be obtained. Preferred compositions or preparations accordin~ to thepresent invention are prepared so that an oral dosage unit contains between fromabout lO ~lg to about 200 mg of active compound.
The tablets, troches, pills~ capsules and the like may also contain the following: a binder such as gum gragacanth, acacia, corn starch or gelatin;
excipients such as dicalcium phosphate; a disinte~rating a~en~ such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose. Iactose or saccharin or a flavoring agent such as peppermint, oil of winter~reen, or cherry flavoring.
When the dosage unit forrn is a capsule~ it may contain~ in addition to materials of the above type, a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac. sugar or both. A
syrup or elixir may contain the active compound. sucrose as a sweetenino agent, methyl and propylparabens as preservative, a dye and flavoring such as cherry ororange flavor. Of course, any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non^toxic in the amounts ~0 employed. In addition. the active compound may be incorporated into sustained-release preparations and formulations.
As used herein "pharmaceutically acceptable carrier" includes any and all solvents. dispersion media. coatings. antibactelial and antifun~al a~ents.
isotonic and absorption delaying agents. and the like. The use of such media and- ~5 a~ents for phannaceutically active substances is well known in the a~t. Except insofar as any conventional media or a~ent is incompatible with the active il compound. use thereof in the therapeutic compositions is contemplated Supplementary active compounds can also be incorporated into the compositions. ~.
~0 It is especially advanta~eous to formulate parenteral compositions in dosa~e unit form for ease of administration and uniformi~y of dosa~e. Dnsa~e unit from as used herein refers to physically discrete units suited as unitary WO 94/01560 PCI`/lJS93/00139 dosa~es for the mammalian subjects to be treated; èach unit containin~ a predetetmined quantity of active compound calculated to produce the desired I -therapeutic effect in association with the required pharmaceutical carrier. The specification for the novel dosa~e unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active compound for the treatment of sensitivity in individuals. I ~
The C~ j I cDNA (or the mRNA trom which it was transcribed) or a portion thereof can be used to identify similar sequences in any variety ortype of plant and thus. to identify or "pull out" sequences which have sufficient homology to hybridize to the Cry j I cDNA or mRNA or portion thereof. for example, DNA from allergens of Juniperlls vi-ginlana, Juniperus sabinoides etc., under conditions of low stringency. Those sequences which have sufficient homology ~generally greater than 40%) can be selected for further assessment usi~ng the method de~scribed herein. Alternatively~ hi~h stringency conditions can be~used. In th~s manner, DNA of the present invention can be used to identify~ in other~types ~of plants, preferably related families, genera~ or species such as Junipcrus,~ or ~ (~préssus, sequences encoding polypeptides having amino acid 20 ~ ~ ; sequences~slmilar~to ~at of~Japanese cedar pollen allergen Cry; I~ and thus to identify allergens in other species. Thus~ the present invention includes not only `-G-~ j I, but also other aller~ens encoded by DNA which hybridizes to DNA of the present~lnvention. ~The invention further includes isolated alkrgenic proteins or fragments therèof that are if nmunolo~ically related to G~ j I or fragments 2~ ~thereof. such~as by antibody cross-reactivity wherein the isolated aller~enic proteins or~fragments thereof are capable of binding to antibodies specific for the protein~ and~;peptides~ of the invention, or by T cell cross-reactivity wherein the isolated aller~enic proteins or fragments thereof are capable ot stimulatin~ T
cells specific for the protein and peptides of this invention.
30 ~ Proteins or peptides encoded by the cDNA of the present ~ ~
- invention can be used, forexample as "pulifted" alleloens~ Such purified ~;
aller~ens are useful in the standardizadon of alleroen extracts which ale l;ey , ~ .

~o WO 94/01560 2 1 2 0 9 ~ ~ PCI`/US93/00139 reagents for the diagnosis and treatment of Japanese cedar pollinosis.
Furthermore, by usin~ peptides based on the nucleic acid sequence of Cr~
anti-peptide antisera or monoclonal antibodies can be made using standard methods. For example. an animal such as a mouse or rabbit can be immunized with an irnmunogenic from of the isolated c,~ j I protein (e.g., C~ ~ j I protein or anti~Tenic fragment which is capable of elicitin~ an antibody response).
Techniques for conferring immuno~enicity on a protein or peptide subunit include conju~ation to carriers or other techniques well-known in the art. The ', C~ j I protein or peptide therof can be administered in the presence of adjuvant.
lo The progress of immunization can be monitored by detection of antibody titers in plasma or serum standard ELISA or other immunoassay can be used with the immuno~en as antigen to assess the levels of antibodies.
Following immunization, anti-Cr~ j I antisera can be obtained and, if desired. polyclonal anti-Cry j I antibodies t`rom the serum. To produce 1~ monoclonal antibodies, antibody producing cells (lymphocytes) can be harvested from an immunized animal and fused by standard somatic cell fusion procedures with immortalizing cells such as myeloma cells to yield hybridoma cells.
Hybridoma cells can be screened immunochemically for production of antibodies reactive with the Cry j I protein or peptide thereof. These sera or monoclonal ~0 antibodies can be used to stanaaldize aller~en extracts.
Through use of the peptides and protein of the present invention.
preparations of consistent, well-defilned composition and biolo~ical activity can ;~
be made and administered for therapeutic pulposes ~e.g. to modify the aller~ic response of a Japanese cedar sensitive individual to pollen of such trees).
Administration of such peptides or protein may, for example, modify B-cell response to C~ Y j I allergen, T-cell response to G~ j I allergen or both responses.
lsolated peptides can also be used to study the mechanism ot immunotherapy of C)~ptomeria japonica aller~y and to design modified derivatives or analooues useful in immunotherapy.
Work by others has shown that hi~h doses of aller~ens generally produce the best results (i.e., best symFtom relie~). However~ many people are unable to tolerate large doses of aller~ens because of aller~ic reactions to the WO 94/01560 PCr/US93/00139 212~95~

allergens. Modification of naturally-occurring allergens can be desi~ned in such ' a rnanner that modified peptides or modified aller~ens which have the same or enhanced therapeutic properties as the corresponding naturally-occurrin~
allergen but have reduced side effects (especially anaphyl~ctic reactions) can be s produced. These can be~ for example, a protein or peptide of the present .
invention (e.~., one having all or a portion of the amino acid sequence of C~ j I), or a modified proteill or peptide, or protein or peptide analogue.
It is also possible to modify the structure of a peptide ()f the invention for such purposes as increasing solubility, enhancin~ therapeutic or preventive efficacy, or stability (e.g., shelf life ex vivo, and resistance to proteolytic degradation in vivo). A modified peptide can be produced in which the amino acid sequence has been altered. such as by amino acid substitution~
deletion~ or addition. to modify immunogenicity andlor reduce aller~enicity~ or to which a component has been added for the same purpose.
For example, a peptide can be modified so that it maintains the ability to induce T cell anergy and bind MHC proteins without the ability to induce a stron~ proliferative response or possibly. and proliferative response when administered in immuno~enic form. In this instance, critical bindin~ -residues for the T cell receptor can be determined using known techniques (e.~
substitution of each residue and determination of the presence or absence of T
cell reactivity). Those residues shown to be essential to interact with the T cell receptor can be modified by replacing the essential amino acid with another~ !',~;~;, preferably similar amino acid residue (a conservative substitution) whos~
presence is shown to enhance, diminish but not eliminate, or not affect T cell ~5 reactivity. In addition, those amino acid residues which are not essential ~r T
cell receptor interaction can be modified by bein~ replaced by another amino acid whose incorporation may enhance. diminish or not aft`ect T cell reacti~ it~but does not eliminate bindin~ to relevant MHC.
Additionally, peptides of the invention can be modified by replacinu an amino acid shown to be essential to interact with the MHC protein complex with another. preferably similar amino acid residue (conser~ ~ti\ e substitution) whose presence is shown to enhance. diminish but not elimin;l~e ol .
I

WO 94/01560 2 1 ~ Q ~ 3 4 PCI /US93/00139 not affec$ T cell activity. In addition, arnino acid residues which are not essential ~.
for interaction with the MHC protein complex but which still bind the MHC
protein complex can be modified by being replaced by another amino acid whose incorporation may enhance. not affect, or diminish but not eliminate T cell reactivity. Preferred amino acid substitutions for non-essential amino acids include, but are not limited to substitutions with alanine, ~lutamic acid, or a methyl amino acid.
In order to enhance stability and/or reactivity, the protein or peptides of the invention can also be modified to incorporate one or more polymorphisms in the amino acid sequence of the protein allergen resulting from natural allelic variation. Additionally, D-amino acids, non-natural amino acids or non-amino acid analogues can be substituted or added to produce a modified protein or peptide within the scope of this invention. Furthermore. proteins or peptides of the present invention can be modified using the polyethylene glycol (PEG) method of A. Sehon and co-workers (Wie et al. sup?a) tO produce a protein or peptide conjugated with PEG. In addition, PEG can be added during chemical synthesis of a protein or peptide of the invention. Modifications of proteins or peptides or portions thereof can also include reductionl alyklation ~Tarr in: Met~ods of Protein Microcharacteri~ation, J.E. Silver ed. Humana ~o Press~ Clifton, NJ, pp 155-194 (1986)); acylation (Tarr, sl~p-a); chemical coupling to an appropriate carrier (Mishell and Shiigi~ eds. Sel~cted M~t~10~s il7 Celfular Imn~nology, WH Freeman~ San Francisco. CA (1980): U~S. Patent 4.939.239; or mild formalin treatment (Marsh International Archi~es of AII~Jg~
and Applied Immunology, 41:199-215 (1971)).
To facilitate purification and potentially increase solubility ot proteins or peptides of the invention, it is possible to add reporter group(s) to the peptide backbone. For example, poly-histidine can be added to a peptide IO
purify the peptide on immobilized metal ion affinity chromatography (Hochuli~
E. et al.. Bio/Technolog~, 6:1321-1325 (1988)). In addition, specific ~0 endoprotease cleava~e sites can be introduced~ if desired~ between a repoltergroup and amino acid sequences of a peptide to facilitate isolation ot` peplidesfree of irrelevant sequences. In order to successfully desensitize an indi~ idual to ~ !

- .
WO 94/0156~ PCI`/US93/00139 212Q9~4 a protein antigen, it may be necessary to increase the solubility of a protein or peptide by adding functional groups to the peptide or by not including hydrophobic T cell epitopes or regions containing hydrophobic epitopes in the peptides or hydrophobic regions of the protein or peptide.
To potentially aid proper antigen processing of T cell epitopes within a peptide, canonical protease sensitive sites can be recombinantly or synthetically engineered between regions. each comprising at least one T cell epitope. For example. charged amino acid pairs, such as KK or RR, can be introduced between regions within a peptide durin~ recombinant construction of 0 the peptide. The resulting peptide can be rendered sensitive to cathepsin and~or other trypsin-like enzymes cleavage to generate portions of the peptide containing one or more T cell epitopes. In addition, such charged amino acid residues can result in an increase in solubility of a peptide.
Site-directed mutagenesis of DNA encoding a peptide or protein of the invention (e~g. Gy j I or a fragment thereof) can be used to modify the structure of the peptide or protein by methods known in the art. Such methods may~ among others, include PCR with de~enerate oligonucleotides (Ho et al Gene, 77:51-59 (1989)) or total synthesis of mutated genes (Hostomsky, Z. et al., Biochem. Biophys, Res. Comm., 161:1056-1063 (1989)). To enhance bacterial _0 expression, the aforementioned methods can be used in conjunction with other procedures to chan~e the eucaryotic codons in DNA constructs encoding protein or peptides of the invention to ones preferentially used iR E. coli. yeast~ ~`
mammalian cells, or other eukaryotic cells.
Usin~ the structural information now available. it is possible to ~5 design Cr~ j I peptides which, when administered to a Japanese cedar pollen sensitive individual in sufficient quantities, will modify the individual's alleroic response to Japanese cedar pollen. This can be done, for example. by examinin~ ' the structure of Cr~ j I, producing peptides (via an expression system~
synthetically or othen,vise) to be examined for their ability to influence B-cell ~0 and/or T-cell responses in Japanese cedar pollen sensitive individuals and selecting appropriate peptides which contain epitopes reco; nized by the c~lls. In referrin~ to an epitope~ the epitope will be the basic element or smallest unit ot WO 94/01560 2 1 2 Q 9 ~ 4 PCr~US93/00139 recognition by a receptor. particularly immuno~lobulins, histocompatibility antigens and T cell receptors where the epitope comprises amino acids essential to receptor recognition. Amino acid sequences wbich mimic those of the epitopes and which are capable of down regulating allergic response to C~
can alsobe used.
It is now also possible to design an agent or a drug capable of blocking or inhibiting the ability of Japanese cedar pollen allergen to induce an allergic reaction in Japanese cedar pollen sensitive individuals. Such a~ents could be designed, for exarnple, in such a manner that they would bind to relevant anti-Cry j I IgEs, thus preventing IgE-aller~en bindin~ and subsequent mast cell degranula~ion. Alternatively~ such a~ents could bind to cellular cornponents of the immune system, resulting in suppression or desensiti-zation of the allergic response to C~yptomeria japonica pollen allergens. A non-restrictive example of this is the use of appropriate B- and T-cell epitope 1~ peptides. or modifications thereof, based on the cDNA/protein structures of the present invention to suppress the aller~ic response to Japanese cedar pollen. This can be carried out by defining the structures of B- and T-cell epitope peptides which affect B- and T-cell function in in vitro studies with blood components from Japanese cedar pollen sensitive individuals.
- 'O Protein, peptides or antibodies of the present invention can also be used for detecting and diagnosing Japanese cedar pollinosis. For example. this could be dorie by combining blood or blood products obtained from an individual to be assessed for sensitivity to Japanese cedar pollen with an isolated antigenic peptide or peptides of Cr~ j I. or isolated C~y j I protein. under ~5 conditions appropriate for binding of components in the blood (e.g.. antibodies.
T-cells~ B- cells) with the peptide~s) or protein and determining the extent to which such binding occurs.
The present invention also provides ~ method ot producinc~ C)~ j I
or fra~ment thereof comprising culturing a host cell containing an expression vector which contains a nucleic acid sequence e.g. DNA. encodin all or at least one fra~ment of Cr \~ j I under conditions appropriate tor expressi~ of C/~ j I Ol at least one fnagment. The expressed product is then lecovered. using kno~n techniques. Altematively, Cr~ j I or fragment thereof can be synthesized usin~ ' known mechanical or chemical techniques.
The DNA used in any embodiment of this invention can be cDNA
obtained as described herein. or alternatively. can be any oligodeoxynucleotide sequence having all or a portion of a sequence represented herein. or their functional equivalents. Such oligodeoxynucleotide sequences can be produced chemically or enzymatically. using known techniques. A functional equivalent of an oligonucleotide sequence is one which is 1) a sequence capable of hybridizingtO a complementary oligonucleotide to which the sequence (or corresponding ~~
sequence portions) of SEQ ID NO: I or fragments thereof hybridizes~ or ~) the sequence (or correspondin~ sequence portion) complementary to SEQ ID NO: 1.
and/or 3) a sequence which encodes a product (e~g., a polypeptide or peptide) having the same functional characteristics of the product encoded by the sequence (or corresponding sequence portion) of SEQ ID NO: 1. Whether a functional equivalent must mèet one or both critena will depend on its use (e.~Jif it is to be used only as an oligoprobe, it need m`eet only the first or second critelia and if it is to be used to produce a Cr~ j I aller~en~ it need only meet the third cnterion).
The present invention also provides isolated peptides derived from ~0 Japanese cedar pollen protein. As used herein, a peptide or fragment of a protein refers to an amino acid sequence having fewer amino acid residues than the entire amino acid sequence of the protein from which it is derived. Peptides of the invention include peptides derived from Cr~ j 1 which comprise at least one T
cell epitope of the allergen.
~s Peptides comprising at least two regions, each re~ion comprising at least one T cell epitope of Japanese cedar pollen are also within the scope ot the invention. Isolated peptides or regions of isolated peptides~ each complisino atleast two T cell epitopes of a Japanese cedar pollen protein aller~en are particularly desirable for increased therapeutic et`tectiveness. Peptides which are immunologically related (e.~.. by antibody or T cell cross-reactivity~ to peptides of the present invention are also within the scope of the invention. ~, Isolated peptides of the invention can be produced by recombinant '6 . ~

WO 94/01560 2 ~ ~ Q 9 ~ '~ PCI/US93/00139 .

DNA techniques in a host cell transformed with a nucleic acid having a sequence encoding such peptide as discussed above. The isolated peptides of the inventioncan also be produced by chemical synthesis. With re~ard to isolated Jun 1~ I
protein or peptides. such protein or peptides may be produced by biochemically S purifying the native Jun v I proteins from Juniperus ~irginiana pollen as is known in the art. When a peptide is produced by recombinant techniques. host cells transformed with a nucleic acid having a sequence encoding the peptide or the functional equivalent of the nucleic acid sequence are cultured in a medium suitable for the cells and peptides can be purified from cell culture medium. host cells, or both using techniques known in the art for purifying peptides and proteins including ion-exchange chromatography, gel filtration chromatography, - _ ultrafiltration, electrophoresis or immunopurification with antibodies specific for the peptide, the protein allergen Japanese cedar pollen from which the peptide is derived~ or a portion thereof. lsolated peptides of the invention are substantially fr~ee of celIular material or culture medium when produced by recombinant DNA
techniques, or substandally free of chemical precursors or other chemicals when synthesized chemically.
~, To obtain isolated peptides of the present invention, C~ j I is divided into non-overlapping peptides of desired length or overlapping peptides 20 of desired lengths as discussed in Example 6 which can be produced recombinantly. or synthetically. Peptides comprising at least one T cell epitopeare capable of eliciting a T cell response. such as T cell proliferation or ~i .
Iympho~ine secretion, andlor are capable of inducing T cell anergy ~1.e.~
t olerization). T o determine peptides comprising at least one T cell epitope.
2~ ~ isolated peptides are tested by, tor example. T cell biology techniques~ todetermino whether the peptides elicit a T cell response or induce T cell anergy.Those peptides found to elicit a T cell response or induce T cell anergy are defined as having T cell stimulating activity.
As discussed in Example 6~ human T cell stimulating activity can be tested 30 by culturing T cells obtained from an individual sensitive to Japanese cedar pollen allergen~ (i.e.. an individual who has an 1E mediateti immune response to lapanese cedar pollen allergen) with a peptide derived t`rom the allergen and ~7 WO 94/01560 PCI /USg3/00~39 2~209S4 deterrnining whether proliferation of T cells occurs in response to the peptide as measured, e.g., by cellular uptake of tritiated thymidine. Stimulation indices for responses by T cells to peptides can be calculated as the maximum CPM in response to a peptide divided by the cc)ntrol CPM. A stimulation index (S.I.) equal to or greater than two times the background level is considered "positive".
Positive results are used to calculate the mean stimulation index for each peptide for the group of patients tested. Preferred peptides of this invention comprise at -least one T cell epitope and have a mean T cell stimulation index of 8reater than or equal to 2Ø A peptide having a mean T cell stimulation index of greater than or equal to 2.0 is considered useful as a therapeutic agent. Preferred peptides have a mean T cell stimulation index of at least 2.5~ more preferably at least 3.5.
more preferably at least 4.0, more preferably at least 5, even more preferably at least 7 and and most preferably at least about 9. For example, peptides of the invention having a mean T cell stimulation index of at least 5, as shown in Fi~.1~ 14, include CJ1-2, CJ1-7, CJ1-10, CJl-15. CJl-17, CJl-20, CJl-22. CJl-23.
CJl-24, CJ1-27, CJ1-31, CJl-32 and CJl-35. For example, peptides of the invention having a mean T cell stimulation index of at least 7, as shown in Fi~.14. include CJI-16, CJl-20, CJl-22, and CJl-32.
- In addition, preferred peptides have a positivity index (P.I.) of at least ~0 about 100, more preferably at least about 250 and most preferably at least about 350. The positivity index for a peptide is deterrnined by multiplyin~ the mean Tcell stimulation index by the percent of individuals. in a population of ,~
individuals sensitive to Japanese cedar pollen (e.g.. pret`erably at least 15 ~- individuals, more preferably at least 30 individuals or more), who have a T cell stimulation index to such peptide of at least 2Ø Thus, the positivity index represents both the strength of a T cell response to a peptide (S.I.) and the frequency of a T cell response to a peptide in a population of individuals s sensiti-e to Japanese cedar pollen. For example. as shown in Fi~. 14~ peptid~
; i CJi-22 has a mean S.I. of 14.5 and 60.0% of positive responses in the ~roup ot`
individuals tested resultin~ in a positivity index of X70.0(). Peptides ot` C~
havin~ a positivity index of at least about l()l) and u mean T cell stimulation index of at least about 4 include: CJ l - l fi~ CJ l- 17~ CJ I-20~ CJ I -22~ CJ l-~. CJ I -, ,~

Wo 94/01560 '- 2 1 2 0 ~ j ~ PCI/US93/00139 24, CJ 1-26, CJ 1-27, CJ 1-32 and CJ 1-35.
In order to determine precise T cell epitopes by, for example. fine mapping techniques, a peptide having T cell stimul~ ting activity and thus comprising at least one T cell epitope as determined by T cell biolooy cechniques is modified by addition or deletion of amino acid residues at either the amino or carboxy terrninus of the peptide and tested to determine a change in T cell reactivity to the modified peptide. If two or more peptides which share an area of overlap in the native protein sequence are found to have human T cell stimulatin~ activity, as determined by T cell biology techniques. additional peptides can be produced comprising all or a portion of such peptides and these additional peptides can be tested by a similar procedure. Followin~ this technique, peptides are selected and produced recombinantly or synthetically.
Peptides are selected based on various factors~ including the strength of the T cell response to the peptide (e.g., stimulation index). the frequency of the T cell 1~ response to the peptide in a popula~ion of individuals sensitive to Japanese cedar pollen, and the potential cross-reactivity of the peptide with other allergens from other species of trees as discussed earlier (e.g. Cupressus sempervirens, Cupressus arizonica, Juniperus virginiana, Juniper~s sabinoides, etc.) or ragweed (Amb a I.1) . The physical and chemical properties of these selected '0 peptides (e.g., solubility, stability) are examined to determine whether the - peptides are suitable for use in therapeutic compositions or whether the peptides require modi~lcation as described herein. The ability of the selected peptides or selected modified peptides to stimulate human T cells (e.~., induce proliferation.
lymphokine secretion) is determined.
Additionally, preferred T cell epitope-containing peptides of th~
invention do not bind immunoglobulin E (I~E) or bind IgE to a substantially lesser extent than the protein allergen trom which the peptide is derived binds IgE. The major complications of standard immunotherapy are I~E-media~d responses such as anaphylaxis. Immunoglobulin E is a mediator o~ anaphyl;lctic reactions which result from the binding and cross-linking of antigen to IgE on mast cells or basophils and the release ot mediators (e.~.~ histamine~ serotonin~
eosinophil chemotacic factors). Thus. anaphylnxis in a substantial percen~ of WO 94~01~60 PCI/USg3100139 2~2~95~
a population of individuals sensitive to Cr~ j I could be avoided by the use in immunotherapy of a peptide or peptides which do not bind IgE in a substantial percentage (e.g., at least about 75%) of a population of individuals sensitive to C~ j I allergen. or if the peptide binds lgE. such binding does not result in the release of mediators from rnast cells or basophils. The risk of anaphylaxis could be reduced by the use in immunotherapy o~ a peptide or peptides which have reduced IgE binding. Moreover, peptides which have minimal IgE stimulatin~
activity are desirable for therapeutic effectiveness. Minimal IgE stimulating activity refers to IgE production that is less than the amount of IgE productionandlor IL-4 production stimulated by the native C)~ j I protein allergen.
A T cell epitope containing peptide of the invention, when administered to a Japanese cedar pollen-sensitive individual~ is capable of modifying the aller~ic response of the individual to the allergen. Particularly, peptides of the invention comprising at least one T cell epitope of Cr~ j I or at least two regions derived from Cr~ j I, e~ch comprisins at least one T cell epitope. when administered to an individual sensitive to Japanese cedar pollen are capable of modifying T cellresponse of the individual to the allergen.
A preferred isolated peptide of the invention comprises at least one T cell epitope of the Japanese cedar pollen allergen. G~ j I and accordingly the peptide comprises at least approximately seven amino acid residues. For purposes of therapeutic effectiveness. preferred therapeutic compositions of theinvention preferably comprise at least two T cell epitopes of C~ ~ j I. and accordingly, the peptide comprises at least approximately eight amino acid residues and preferably at least fifteen amino acid residues. Additionally.
therapeutic compositions comprising preferred isolated peptides of the inventinnpreferably comprise a sufficient percentage of the T cell epitopes of the entireprotein allergen such that a therapeutic regimen of administration of the composition to an individual sensitive to Japanese cedar pollen~ results in T cells of the individual being tolerized to the protein allergen. Synthetically produced peptides of the invention comprising up to approximately forty-five amino acid residues in length, and most preferably up to approximately thirty amino acid ë .
residues in length are particularly desirable as increases in length may result in , ~0 WO 94/01560 21 2 0 9 5 4 PCr/US93/00139 dif~lculty in peptide synthesis. Peptides of the invention may also be produced recombinantly as described above, and it is preferable that peptides of 45 amino s acids or longer be produced recombinantly.
Preferred peptides comprise all or a portion of the areas of major T cell s reactivity within the Cry; I protein allergen designated herein as, Region 1.
Region 2,~Region 3, Region 4 and Region 5. Each major area of T cell activity is de~med as follows and is shown in Fig. 4 a-b. Region 1 comprises amino acid residues 1-50 of Cry; I; Region 2 comprises amino acid residues 61-120 of C
j I; Region 3 comprises amino acid residues 131-180 of Cry j I; Region 4 comprises amino acid residues 191-280 of C~ j 1: Region 5 comprises amino acid residues 291-353 of the C~ j I. Preferred areas of major T cell reactivity within each Region as shown in Fig 4 a-b and comprise: amino ~cid residues 1-40; amino acid residues 81-110; amino acid residues 15 l -180; amino acid residues 191-260; and amino acid residues 291-330.
IS Peptides derived from the Cr~ j I protein allergen which can be used for therapeutic purposes comprise all or a portion of the following peptides:
CJ 1- 1, CJl-2, C~J1-3, CJl-4, CJl-7, CJl-8, CJ 1-9~ CJl- 10, CJ1- 1 1, CJl- 12. CJ I -14,CJl-15,CJI-16,CJl-17.CJl-18,CJl-l9.CJl-20.CJl-21,CJl-22,CJl-23~
CJl-2A,CJl-25,C~1-26,CJl-27,CJl-28~CJI-30.CJl-31.CJl-32~ CJl-33, CJ l-34 and CJl-35 wherein the portion of the peptide preferably has a mean T cell stimulation index equivalent to, or greaur than the mean T cell stimulation index of the peptide from which it is derived as shown in Fi~. 14. Even more preferably peptides derived from the Cr~ j I protein aller~en which can be used for therapeutic purposes comprise all or a portion of the~followin~ peptides: CJl-2.CJl-9,CJl-10,CJl-16.CJl-17,CJl-20.CJ1-22.CJl-23.CJ1-24,CJI-25.
CJl-26.CJl-27,CJl-30,CJl-31.CJl-32 and CJl-35 as shown in Fig. 14.
Additionally, other preferred peptides derived from the Cry j I protein comprisethe following peptides: CJ1-41.CJl-41.1.CJI-41.2.CJ1-41.3.CJI-4~.CJI-4 i CJ~-42.2.CJl-43.CJl-43.1.CJI-43.6.CJ1-43.7.CJl-43.~,CJl-43.9.CJI-43.1~.CJl-43.11,CJl-43.12,CJl-45.CJl-45.1.CJl-45.2.CJl-44.CJI-44.1.CJI-44.2 and CJl-44.3. all as shown in Fi~, 18. Another preferted antigenic peptide ot`
the invonoon may comprise more than one Reoion, i.e.~ rll or a portion o~ amino ~ .

i I

WO 94/01560 PCr/US93/00139 ?,120954 ~'"

acids 151-352 of the amino acid sequence of Cry; 1~ as shown in Fig. 4a-b.
One embodiment of the present invention features a peptide or portion thereof of Cr~ j I which comprises at least one T cell epitope of the protein allergen and has a formula Xn-Y-Zm. Accordin! to the formula, Y is an amino acid sequence selected from the ~roup consisting of CJI-I.CJl-2,CJl-3.
CJI-4.C11-7.CJI-8.CJl-9.CJl-lO.CJI-ll.CJI-12.CJI-14.CJI-lS~CJl-16.
CJI-17~CJI-18,CJI-l9,CJl-20.CJI-21,CJl-22,CJl-23.CJl-24,CJl-25.CJl-- 26.CJl-27,CJl-28 CJI-30,CJl-3I,CJl-32.CJl-33~ CJ1-34 and CJ 1-35~ and preferably selected from the group consisting of CJ1-2.CJI-9~CJl-lO,CJl-16.
0 CJl-17,CJl-20,CJl-22,CJl-23,CJl-24,CJl-25~CJl-26~CJl-27,CJl-30~CJl-31~CJl-32 and CJI-35. In addition, Xn are amino acid residues contiguous to the amino terminus of Y in the amino acid sequence of the protein allergen and Zm are amino acid residues contiguous to the carboxy terminus of Y in the amino acid sequence of the protein allergen. In the forrnula. n is 0-30 and m is ;
0-30. Preferably, the peptide or portion thereof has a mean T cell stimulation index equivalent to greater than the mean T cell stimulation index of Y as shown n Fig. 14.
Another embodiment of the present invention provides peptides compnsing at least two regions, each region comprisin~ at least one T cell 20 ~ e pitope of`C)yj I~ and accordingly each re~ion comprises at least approximately seven amino acid resldues. These peptides comprisin~ at least two regions can - comprise as many arnino acid residues as desired and preferably comprise at least about 14. even more preferably about 30. and most preferably at least about 40 amino acid residues of a Cr~ j I allergen. If desired. the amino acid sequences of 2~ ~ the regions can be produced and joined by a linker to increase sensitivity to processmg by antigen-presenting cells. Such linker can be any non-epitope amino acid sequence or other appropriate linking or joining agent. To obtain preferred peptides comprising at least two regions. each complising at least oneT cell epitope. the regions are arranged in a conficuration dit'ferent from a naturally-occurring configuradon of the regions in the allergen. For example~ ;
the regions containing T cell epitope(s) can be arranged in a noncontiguous confïguration and can preferably be derived t;om the s~me protein allercen.
:

~ ~ r ' ~ ' WO 94/01560 2 I 2 D 9 ~5 ~ PCI/US93/00139 Noncontiguous is defined as an arrangement of regions con~ining T cell epitope(s) which is different than that of an amino acid sequence present in theprotein aller~en from which the regions are derived. Furtherm()re. the noncontiguous re~ions containing T cell epitopes can be arranged in a nonsequential order (e.g., in an order different from the order of the amino acids of the native protein aller~en from which the re~ion containino T cell epitope(s~
are derived in which amino acids are arran~ed from an amino terminus to a carboxy terminus). A peptide can comprise at least 15%~ at least 30~, at least 50% or up tO 100% of the T cell epitopes of Cry j I.
The individual peptide regions can be produced and tested to detennine which regions bind immunoglobulin E specific for Cry j 1 and which of such regions would cause the release of mediators (e.g.. histamine) from mast cells or basophils. Those peptide regions found to bind immunoglobulin E and cause the release of mediators from mast cçlls or basophils in greater than approximatel~
10-15% of the allergic sera tested are preferably not included in the peptide regions arranged to form preferred pep~ides of the invention.
Additionally, regions of a peptide of the invention preferably comprise all or a portion of the above discussed preferred areas of major T cellreactivity within Cr y j I ~i.e.. Regions 1-S) or the above discussed preferred areas 20 of major T cell activity within each Re~ion (i.e. amino acids from residues 1-40.
81-110~ 151-180, 191-260 and 291-330). For example. one region can comprise all or a portion of Region 1 (amino acid residues 1-5 l ) and one region can comprise all or a portion of Re~ion 2 (amino acid residues 61-120). Peptides of the~ invention can comprise all or a por~ion ot` two or more of these Rè~ions (i.e..
2~ Regions 1-5) and preferred resulting peptides do not bind I~E and cause the release of mediators from most cells or basophils. PrefelTed peptides derived from Cr~ j I comprise all or a portion of Re~ion 3~ Region 4 and Re~ion 5. and.
optionally. Region l or Region 2. Further. if one of these Regions is foulld t~) ;
bind IgE and cause the release of mediators from mast cells or basophils. then it 30 is preferred that the peptide not comprise such Re; ion. but rather comprisesvarious regions delived from such Region which d~) not bind IgE or cause rele;~
of mediators from mast cells ot basophils.

Wo 94/01~0 PCI'/US93/00139 ~1~0954 Examples of preferred regions include: CJl-l,CJl-2.CJl-3.CJl-4,CJl-7.CJI-8.CJl-9,CJl-lO,C~l-ll,CJI-12,CJl-14,CJl-lS,CJl-16,CJl-17,CJl-18.CJl-l9.CJl-20,CJl-21,CJl-22,CJl-23~CJl-24,CJl-25.CJl-2S, CJl-27,CJl-28,CJl-30,CJl-31,CJl-32,CJI-33,CJl-34.CJl-35. CJI-41, CJl-41.1.CJ1-41.2,C~1-41.3,CJl-42,CJl-42.1,CJl-42.2.CJI-43, CJ1-43.1. i`
CJ1-43.6,CJ1-43.7.CJ1-43.8,CJI-43.9.CJI-43.10.CJ1-43.11~CJ1-43.12.CJI-45,CJl-45.1,CJl-45.2,C31-44,CJl-44.1,CJl-44.2 and CJl-44.3. the amino acid sequences of such regions being shown in Fi~. 13 and Fi~. 18. or portions of said regions comprising at least one T cell epitope.
Preferred pep~ides comprise various combinations of two or more regions, each region comprising all or a portion of the above-discussed preferred areas of major T cell reactivity. Preferred peptides comprise a combination of two or more regions (each region having an amino acid sequence as shown in Fi~. 13), including: ~ -CJ1-1, CJ1-2 and CJ1-3;
CJl-l and CJl-2;
CJ1-9 and CJl-10;
CJ1-14, CJ1-15, CJ1-16 and CJ1-17;
CJ1-20, CJ1-21, CJ1-22, CJ1-23;
CJ1-20, CJ1-22 and CJ1-23;
CJ1-22 and CJ1-23;
CJ1-22, CJ1-23 and CJ1-24: i` ~
CJ1-24 and CJ1-25;
CJ1-30, CJ1-31 and CJ1-32:
2~ CJ1-31 andCJ1-32;
CJl-22. CJl-23. CJl-16 and CJl-17:
CJ1-22. CJ1-23. CJ1-31 and CJ1-32:
CJ1-16, CJ1-17. CJl-31 and CJI-32;
CJl-9, CJ1-10 and CJI-16;
CJ 1 - 16 and CJ 1- 17:
CJl-17. CJ1-22 and CJI-23;
CJ1-16, CJl-17 and CJ1-20;

:

W o 94/01560 2 1 2 0 3 S ~ P ~ /~S93/00139 CJl-31,CJl-32and CJl-20;
CJl-22. CJ1-23, CJ1-1. CJl- and CJl-3;
CJI-16.CJl-17.CJl-22 and CJl-23.CJl-31 and CJI-32:
CJl-9.CJI-lO.CJl-16.CJl-17. CJ1-22 and CJl-23;
CJI-9,CJl-lO,CJl-16, CJl-17. CJl-31 and CJl-32;
CJI-9,CJl-lO.CJl-22,CJl-23,CJl-31 and CJl-32;
CJl-9,CJl-lO,CJl-16,CJl-17.CJl-22,CJl-23.CJl-31 and CJ1-32;
CJl-l.CJl-2,CJl-16,CJl-17,CJl-22 and CJl-23;
lQ CJl-2~,CJl-23,CJl-24,CJl-9, and CJl-10;
CJl-22.CJl-23,CJl-24,CJl-9.CJl-lO.CJl-16. and CJl-17;
CJl-22,CJl-23,CJl-24,CJl-16,CJl-17.CJl-31 and CJl-32;
CJl-22,CJl-23,CJl-24.CJl-16. and CJl-17;
CJl-22, CJl-23,CJl-24,CJl-9.CJl-lO,CJl-31 and CJl-32;
CJl-22,CJl-23.CJl-24.CJl-9,CJl-lO,CJl-16.CJl-17.CJl-31 and CJl-32; and CJl-22,CJl-23,CJl-24,CJl-31, and CJ1-32.

lsolated C yj I protein or peptides of Cryj I within the scope of the invention can be used in methods of treating and preventing allergic reactions to Japanese cedar pollen. Thus, one aspect of the present invention provides therapeutic compositions cornprisin~ a peptide of Cr j 1 including at least one T ~, cell epitope. or preferably at least two T cell epitopes. and a pharrnaceutically acceptable carrier or diluent. ln another aspect. the therapeutic composition comprises a pharmaceutically acceptable carrier or diluent and a peptide comprising at least two regions. each region comprisino at least one T cell 1 epitope of Cry j I.
Preferred therapeutic compositions comprise a suft'icient percentage of the T'cell epitopes of Cr~ j I such that a therapeutic reoimen of administration of the composition to an individual sensitive to Japanese cedar pollen aller2en. resul~s in T cells of the individual being tolerized to the protein aller~en. More preferably, the composition comprises a suft'icient percenta e of the T cell WO 94/01560 PCr/US93/00139 ~12095~

epitopes such that at least abnut 40~. and more preferably at least about 60% ofthe T cell reactivity of Cr~; I is included in the composition. Such compositions can be administered to an individual to treat or prevent sensitivity to Japanesecedar pollen or to an allergen which is immunolo~ically cross-reactive with Japanese cedar pollen allergen.
In yet another aspect of the present inven~ion. a compositinn is provided comprisin~ at least two peptides (e.g., a physical mixture of at least two pep~ides). each complising at least one T cell epitope of C~j I. Such compositions can be administered in the forrn of a therapeutic composition with 0 a pharmaceutically acceptable camer of diluent. A therapeutically effective amollnt of one or more of such compositions can be administered simultaneously or sequentially to an indiv;dual sensitive to Japanese cedar pollen.
Preferred compositions and preferred combinations of peptides which can be administered simultaneously or sequentially (comprising peptides havina~ -amino acid sequences shown in Fig. 13) include the ~llowing combinations:
CJI-l,CJl-2 and CJ1-3:
CJI-1 and CJ1-2;
CJl-9 and CJl-10;
CJl-14,CJl-l5,CJl-16 and CJl-17;
CJl-20,CJl-21,CJl-22 and CJl-23;
CJl-20,CJl-22 and CJl-23;
CJl-22 and CJl-23;
CJ1-22~CJl-23 and CJl-24;
CJl-24 and CJl-25;
CJl-30. CJl-31 and CJl-32;
CJl-31 and CJl-32;
CJl-22,CJl-23.CJl-16 and CJI-17;
CJl-22.CJl-23.CJl-31 and CJl-32:
CJl-16.CJl-17. CJl-31 and CJl-32;
CJl-9.CJl-10 and CJl-16;
CJI-16 and CJl-17; i ' CJ1-17.CJl-22 and CJl-23;

W O 94/01560 2 1 ~ ~ 9 .S ~ PCT/U~93/00139 CJl-16.CJl-17and CJl-20:
CJl-31.CJl-32and CJl-20;
CJl-22.CJl-23.CJl-l~CJl-2 and CJl-3;
CJI-16,CJl-17,CJl-22.CJI-23.CJl-31and CJl-32;
CJl-9,CJl-lO,CJl-16,CJl-17.CJl-22and CJl-23; ;
CJl-9.CJl-lO.CJI-16.CJl-1'.7. CJl-31 and CJl-32:
CJl-9,CJI-lO.CJI-22, CJ1-23, CJl-31 and CJl-32;
CJl-9.CJl-lO,CJl-16.CJl-17.CJl-22,CJl-23.CJl-31 and CJI-32;
lo CJl-l,CJl-2.CJl-16,CJl-17.CJl-22 and CJl-23.
C31-22,CJl-23.CJl-24,CJl-9. and CJl-10, CJ1-22, CJl-23. CJl-24, CJl-9,CJl-10. CJ1-16. and CJl-17;
CJl-22,CJl-23,CJl-24,CJl-16~CJl-17~CJl-31 and CJl-3~;
CJl-22,CJl-23,CJl-24.CJl-16~ and CJl-17; ~;
CJl-22.CJl-23,CJl-24, U l-9.CJl-lO,CJl-31 and CJl-32;
CJl-22,CJl-23,CJl-24,CJl-9,CJl-lO.CJl-16.CJl-17,CJl-~l and CJl-32; and CJl-22,CJl-23,CJl-24,CJl-31,and CJl-32.

The invention is further illustrated by the followino non-limi~in~
examples. -~

Example I
25 Purification of Native .~apanese ~ar Po~len Aller~en (Crv i I ) The following is a description of the work done to bi~)chemicall~
purify the major allergen, C~ j I in the native form. The purification was modified from published procedures (Yasueda et al.. J. Allerg! Clin. Imm~n 7 1 :17, 1983).
100~ of Japanese cedar pollen obtained from Japan (Hollister- t Stier, Spokane, WA) was defatted in I L diethyl ether three times, the pollen ~ as collccted after filtration and the ether was dried off in a vacuum.

~7 WO 94/01~60 PCI/US93/00139 21~Q9~
The defatted pollen was extracted at 4C overnight in 2 L
extraction buffer containin~ 50 mM tris-HCL, pH 7.8, 0.2 M NaCI and protease inhibitors in final concentrations: soybean trypsin inhibitor (2 ,u~/ml). leupeptin g/ml), pepstatin A (1 llg/ml) and phenyl methyl sulfonyl fluoride (0.17 mg/ml). The insoluble material was reextracted with 1.2 L extraction buffer at 4C overnight and both extracts were combined to~ether and depigmented by batch absorption with Whatman DE-52 DEAE cellulose (200 ~ dry weight) equilibrated with the extraction buffer.
The depigmented rnaterial was then fractionated by arnmonium sulfate precipitation at 80% saturation (4C), which removed much of the lower molecular weight material. The resultant partially purifled G~ j I was either dialyzed in PBS buffer and used in T cell studies (see Example 6) or subjected to further purification (biochemically or by monoclonal affinity chromatography) as described below.
The enriched C)y j I material was then dialyzed against S0 mM Na-acetate, pH 5.0 at 4C with 50 mM Na-acetate, pH 5.0 with protease inhibitors. The sample was next applied to a 100 ml DEAE cellulose column (Whatman DE-52) - equilibrated at 4C with 50 mM Na-acetate pH 5.0 with protease inhibitors. Th~unbound material (basic proteins) was then applied to a 50 ml cation exchan~e column i~Whatman CM-52) which was equilibrated at 4C with 10 mM Na-ace~ate~
pH 5.0 with protease inhibitors. C~y j I was eluted in the early fractions of a lin~ar gradient 0.3 M NaCl. The enriched C~ j 1 material was lyophilized and was th~n purified by FPLC over a 300 ml Superdex 75 column (Pharmacia) at a flow rate o~`30 ml/h in 10 mM Na-acetate, pH 5.0 at 25C.
The purified Cr~ j I was further applied to FPLC S-Sepharose 1611(:) column chromatography (Pharmacia) with a linear gradient of 0 - 1 M NaCI at ~S~C.
Cr~! j I, eluted as the major peak, was subjected to a second gel filtration chromatography. FPLC Superdex 75 column (2.6 by 60 cm)(Pharmacia~
Piscataway, NJ) was eluted with a downward tlow of 10 mM Na-acetate, pH 5.() with 0.15 M NaCl at a flow rate of 30 mUh at 25C. Fi~. la shows the chromatography on ~el filtration. Only C~ j I was detected (Fig. Ib. Iane 2 to Iane S). CJ~ j I was fractionated into 3 bands us analyzed by SDS-PAGE using sil~er ~X

WO 94/01560 2 1 2 0 9 j ~ PCI/US93/00139 staining (Fig. Ib) As shown in Fig. lb. SDS PAGE (12.5%) analysis of the fractions from the major pealc shown in Fi~. la was performed under reducing conditions.
The gel was silver stained using the silver staining kit from Bio-Rad. The samples in each lane were as follows: Lane 1, prestained standard proteins (Gibco BRL) including ovalbumin (43,000 kD). carbonic anhydrase (29,000 kD). anà cx-lactoglobulin (18,400 kD); lane 2, ~raction 36; lane 3 fraction 37; lane 4 fraction 38; lane 5 fraction 39; lane 6 fraction 41. Iane 7 fraction 43: and lane 8 fraction 44.
All fractions are shown in Fig. la.
These proteins were also analyzed by Western blo~ting usin~ mouse monoclonal antibody CBF2 (Fig. 2). As shown in Fig. 2. an aliquot of fraction 36(lane 1), fraction 39, (lane 2) and fraction 43 (lane 3) purified from the Superdex 7 - as shown in Fig. 1 was separated by SDS-PAGE. electroblot~ed onto nitrocelluslose and probed with mAB CBF2. Biotinlylated goat anti-mouse I~ was used for the second antibody and bound antibody was revealed by 125I-streptavidin. The monoclonal CBF2 was raised ag,ainst ragweed allergen Amb a I by Dr. D. Klapper (Chapel Hill, NC~. Because of the homology between the Amb ~ I and C~
sequences, a number of antibodies raised against Amb a I were tested for reactivity with Cry j I. The results showed that CBF2 recognized denatured C~ J I as detected by ELISA and Western blotting. In addition, Western blotting also demonstrated that no other bands were detected by CBF2. other than Cn j I in the expected molecular weight range (Fig. 2). These results were consistent with the findin~sfrom protein sequencing. When fraction 44 and fraction 39 (Fig I b) were subjected to N-terrninal sequencing, only C~ j I sequence was detected.
In summary, three C~yj I isoforms of different molecular wei~ht were purified from pollen extract. The molecular weights estimated by SDS-PAGE
ranged from 40-35 kD under both reducing and non-reducing conditions. The isoelectric point of these isoforms is approximately 9.5-8.6~ with an avera~ge pl ot 9Ø The N-terrninal 2() amino acid sequence was the same in these 3 bands and was identical to previously published C ~ j I sequence (Taniai et al~ suprw). The 3 isoforrns are all recognized by monoclonal antibody CBF2 as shown in the allervi~
sera titration of dit`ferent purified subfractions of Cry j I usin~ a pool of fiftee allergic patient plasma~ They all bind aller~gic patient IgE (Fi~ 3)~ The difteren~e in WO 94/01560 PCr/US93/00139 21209~
`

molecular wei~ht and isoelectric point in these isotorms might in part be due to post-translational modifica~ion. e.g. glycosylation~ phosphorylation or lipid content. The possibility that t~ese different isoforms mioht be due to protease de~radation ~:annot be ruled out at present even though it is unlikely due to the fact that ~our different protease inhibitors were used durin~ extraction and purification. The other possibility could be due tO polymorphism in the cene or altemate splicing in themRNA though only one major form of C ~ j I protein has been detected in cDNA
cloning studies (see Example 4).
Another approach which may be used to purify native CJY j I or recombinant C ~ j I is immunoaf~lnity chromatography. This technique provides a very selective protein purification due to the specificity of the interaction between monoclonal antibodies and antigen. For the purpose of producino C~
I-reactive monoclonal antibodies. female BalbVc mice were obtained from Jackson Labs. Each mouse was initially immunized intraperitoneally with 70-10C) llg purified native C~y j I. (>99% purity lower band. as shown in Fig. 1 b)~
emulsified in Freund's complete adjuvant. One further intravenous injection of 10 ~g purified native Cr~j I in PBS was given 54 days after the initial injection.
The spleen was removed 3 days later and myeloma t`usion was conducted as described (Current Protocols in Immunoloj~y. 1991. Coligan et al. eds.) using the myeloma line SP2Ø The cells were cultured in 105~ fetal calf serum tHybrimax), hypoxanthine and azaserine and wells containing colonies of hybridoma cells were screened for antibody production using anti~en-binding ELISA.
Cells from positive wells were cloned at threè-tenths cell/well in 10'~
2~ fetal calf serum (Hybrimax). hypoxanthine and positive clones were subcloned one more time in hypoxanthine medium . Capture ELISA (see Example 7) was used ~;)r secondary and tertiary screening This assay oft`ers the advantage that a clone th;lt reco~nizes the native protein may be selected and thus may be useful tor imrnunoaffinity purification. For example. two monoclonal antibodies (4B 11. ~B I I ) were ~enerated. These antibodies were pulified by Gammabind G. Sepharose (Pharmacia~ Piscataway. NJ) accordinn to rnanutacturer's procedures and were immobilized to cyanogen bromide - activated Sepharose 4B (Pharmacia. Piscat~ a! .
I

~ 21209~4 WO 94/01560 PCl /US93/00139 NJ) according to the procedures describe~ ~y Pharmacia. The ammonium sulphate prepara~ion containing C~ j I was applied to the resin and unbound material was washed extensively with PBS. C~y j I was eluted with 2 column volumes of 0.1 M
glycine, pH 2.7. Silver staining of the eluate fractions run on SDS PAGE showed that Cryj I was purified almost to homogeneity. These fractions did not contain detectable levels of Cry j Jl. Other methods to immobilize MAb 8B l l were also tested. Similar results were obtained usin~ puri~led MAb 8B l l covalently cross-linked to Gammabînd G Sepharose by dimethylpimelimidate (Schneider C., et al. J.Biol. Che~ (1982) volume 257:10766-10769). However, experiments using purified MAb 8B11 covalently cross-linked to Af~l-gel 10 (Biorad. Richmond. CA) showed that althou~h greater than 90% of the monoclonal antibody was covalently coupled to Affi-gel 10, the yield of Cr.~ j I purified over this resin was si~nificantly less than that purified from MAb 8B11 cross-linked to cyanogen bromide-acti~atedSepharose 4B ~data not shown). Nevertheless, the puri~led Cr~ j I from these monoclonal antibodies immobilized on dit`ferent resins is still intact and can be recognized by MAb 8B l l and 4B 11 by capture ELISA. Thus, these MAbs will provide a useful tool in purification of Cr~ j I from pollen extracts. Similarly~
monoclonal antibodies that bind to recombinant C~y j I can also be used for immunoaf~lnity chromatography. In addition. the monoclonal antibodies ~enerated may be useful for diagnostic pUlpOSeS. It may also be possible to raise diff`erent MAbs that show some specificity towards these different isoforms of C-y j I and thus would provide a useful tool to characterize these isoforms.

Example 2 Attempted Extraction of RNA From Japanese Cedar Pollen Multiple attempts were made to obtain RNA from commerciall~-available. non-defatted. Cryptome-ia japol7ica (Japanese cedar) pollen (Hollister Stier. Seattle. WA). Initially, the method of Sambrook et al.. Molecul~r Cl0ni A Laborator~ Manual, Cold Sprin~ Harbor Laboratory Press. Cold Sprin~

WO 94/0156û PCr/US93/00139 209~4 Harbor. New York (1989) was used in which the sample was suspended and lysed in 4 M guanidine buffer. ~round under liquid nitro~en, and pelleted throu~h 5.7 M cesium chloride by ultracentrifu~ation. Various arnounts (3. 5 and 10 g) of pollen in varying arnounts of ~uanidine lysis buffer (10 and 25 ml)s were tned. Centrifugation through cesium resulted in viscous matenal in the bottom of the tube. from which it was not possible to recover an RNA pellet.
Although it was possible to obtain RNA from defatted Ambrosia artemisi~olia (ragweed) pollen (Greer Laboratories. Lenior. NC) using this protocol. defattingthe Cr~ptomeria japonica pollen with acetone before guanidine extraction also did not yield any RNA, as determined by absorbance at A~60.
An acid phenol extraction of RNA according to the method in Sambrool. et aL, supra was attempted from C .~ ptomeria japonica pollen. The pollen was ground and sheared in 4.5 M guanidine solution. acidified by additionof 2 M sodium acetate, and extracted with water-saturated phenol plus ls chloroform. After precipitation, the pellet was washed with 4 M lithium chloride,~redissolved in 10 mM TrislS mM EDTA/1% SDS, chloroform extracted, and re-precipitated with NaCI and absolute ethanol. It was possible to extract Ambrosia artemisiifolia but not G~ptomeria japonica RNA with this ~- procedure.
~ Next, 4 g of Cryp~ome~ia japonica pollen was suspended in 10 ml extraction buffer (50 mM Tris, pH 9.0~ 0.2 M NaCl. 10 mM Mg acetate and diethylpyrocarbonate (DEPC) to 0.1%), ground in a mortar and pestle on dry ice transferred to a centrifuge tube with l~o SDS. 10 mM EDTA and 0.5% N-lauroyl sarcosine, and the mixture was extracted five times with war~m phenol.
23 The aqueous phase was recovered after the final centrifu~ation. 2.5 vol. absolute ethanol was added, and the mixture was incubated overnight at 4C. The pellet was recovered by centrifugation. resuspended in 1 ml dH20 by heatin~ to 65C.
and reprecipitated by the addition of 0.1 vol. 3 M Na acetate and 2.0 vol. of ethanol. No detectable RNA was recovered in the pellet as judged by absorbance at A260 and ~el electrophoresis.
Finally, 500 mg of Gyptont~ia jap->ni~a pollen was ~round by mortar and pestle on dry ice and suspended in S ml of 5~) mM Tris pH 9.0 with : 1, -~ 212û95~
WO 94/01560 PCr/US93/00139 0.2 M NaCI, 1 mM EDTA~ lYo SDS that had been treated overni~ht with 0.1%
DEPC, as previously described in Frankis and Mascarhenas (1980) Ann. Bot. 4~:
595- 599. After five extractions with phenoVchloroform/isoamyl alcohol (mixed at 25:24:1), material was precipitated from the aqueous phase with 0.1 volume 3 s M sodium acetate and 2 volumes ethanol. The pellet was recovered by centrifu~ation, resuspended in dH20 and heated to 65C to solubilize the precipitated material. Further precipitations with lithium chloride were not done.
There was no detectable RNA recovered. as determined by absorbance at A260 and gel electrophoresis.
In summary. it has not been possible to recover RNA from the commercial pollen. It is not known whether the RNA has been de~raded durin~
stora~e or shipment~ or whether the protocols used in this example did not allowrecovery of extant RNA. However. RNA was recovered from fresh C)Yptom~ia japonica pollen and staminate cone samples. (See Example 3.) Example 3 Extraction of RNA From Japanese Cedar Pollen and Staminat~ Cones and Clor~ing of C y j I
Fresh pollen and staminate cone samples. collected from a sin~le ~yptomeria japonica (Japanese cedar) tree at the Arnold Arboretum (Boston.
MA), were frozen immediately on dry ice. RNA was prepared from 500 m~ of each sample~ essentially as described by Frankis and Mascarenhas. supra. The - ~ samples were ~round by mortar and pestle on dry ice and suspended in S ml of 2s ~ 50 mM Tris pH 9.0 with 0.2 M NaCl. 1 mM EDTA. 1~ SDS that had been treated overnight with 0.1% DEPC. After five extractions with phenoVchloroform/ isoamyl alcohol (mixed at 25:24~ the RNA was precipitated from the aqueous phase with 0. l volume 2 M sodium acetate and 2 ~, volumes ethanol. The pellets were recnvered by centrifugation. resuspended in dH20 and heated to 65C for 5 min. Two ml ot 4 M lithium chloride were added to the RNA preparations and they were incubated overni~ht at ()C. The RNA
pellets were recovered by centrifugation. resuspended in l ml dH20. and a~ain 1 ~s WO 94/01~60 PCr/US93/00139 21~09S~ . .
precipitated with 3 M sodium acetate and ethanol overni~ht. The final pellets were resuspended in 100 ,ul dH20 and stored at -~0C.
First strand cDNA was synthesized from 8 ~1~ flowerhead and 4 ~ pollen RNA usin~ a commercially available kit (cDNA synthesis systems kit.
s BRL, Gaithersburg, MD) with oligo dT primino accordin~ to the method of 5ubler and Hoffman (1983) Cene 25: 263-2~9. An attempt was made to amplify cDNA encoding C)y j I using the degenerate oligonucleotide CP- I (which has the sequence 5'-GATAATCCGATAGATAG-3'. wherein T at p~sition 3 can also be C; T at position 6 can also be C; G at position 9 can also be A,T. or C; A atposition 12 can also be T, or C; T at position 15 can also be C; A at position 16 can also be T; and G at position 17 can also be C: SEQ ID NO: 3) and primers EDT and ED. Primer EDT has the sequence 5'-GGAAl~CTCTAGACTGCA-GGlmm~l m-3'(SEQ ID NO: 24). Primer ED has the sequence ~'-GGAATTCTCTAGACTGCAGGT-3' (SEQ ID NO: 23). CP-l is the de~enera~e oli~onucleotide sequence encoding the first six amino acids of the amino terminus (AspAsnProIleAspSer, amino acids 1-6 of SEQ ID NO: 1) of C~yj I.
EDT will hybridiæ with the poly A tail of the gene. All oligonucleotides were synthesized by Research Genetics, Inc. Huntsville. AL. Polymerase chain reactions (PCR) were carried out using a commercially available kit (GeneAmp DNA Amplification kit, Perkin Elmer Cetus. Norwal}c, CT) whereby 10 ,ul lOx buffer containing dNTPs was mixed with I ~1 of CP- 1 and 1 ,u~ of EDtEDT
pnmers (ED:EDT in a 3:1 M ratio), cDNA (3-5 111 of a 20 ~1 first strand cDNA -reaction mix), 0.5 ~1 Amplitaq DNA polymerase, and distilled water to 100 ~1.
The samples were amplified with a pro~rammable thermal 2S controller (MJ Research. Inc., Carnbrid~e. MA). The first 5 rounds ofampli~1cation consisted of denaturation at 94C for I minute. annealing of primers to the template at 45C for 1.5 minutes, and chain elonoation at 70C for 2 minutes. The final 20 rounds of amplification consisted of denaturation as above. annealing at 55C for 1.5 minutes, and elon~ation as above. Five percen (5 ~11) of this initial amplification was then used in a secondary amplificationwith 1 llg each of CP-2 (which has the sequence 5'- GGGAATlCAAl-rGGGC- ~ `
GCAGAATGG-3' wherein T at position I I can also be C; G at position 17 can WO 94/OlS60 21 2 D 9 ~ ~ Pcr/US93/ool39 also be A, T, or C; G at position 20 can also be A; T at position 23 can also be C;
and G at position 24 can also be C) (SEQ ID NO: 4). a nested primer, and ED. as above. The se~uence 5'-GGGAAl-rC-3' (bases 1 through ~ of SEQ ID NO: 4) in primer CP-2 represents an Eco Rl site added for cloning purposes: the s remaining degenerate oligonucleotide sequence encodes amino acids 13-18 of Ctyj I (AsnTrpAlaGlnAsnArg, amino acids 13 through 18 of SEQ ID NO: 1).
Multiple DNA bands were resolved on a 1% GTG agarose gel (FMC, Rockport.
ME), none of which hybridized with 32p end- labeled probe CP-3 (SEQ ID NO:
S) in a Southern blot performed according to the method in Sambrook et al.
supra. Therefore, it was not possible to select a specffic CJY j I DNA band and this approach was not pursued. CP-3 has the sequence 5'- CTGCAGCCATT-TTCIACATTAAA-3' wherein A at position 9 can also be G; T at position 12 can also be C; A at position 18 can also be G; and A at position 21 can also be G) (SEQ ID NO: 5). Inosine (I) is used at position 15 in place of G or A or T or C
to reduce degeneracy (Knoth et al. (1988 j Nucleic Acids Res. 1~: 10932). The sequence 5'-CTGCAG-3' (bases 1 through 6 of SEQ ID NO: 5) in primer CP-3 represent a Pst I site added for cloning purposes; the remaining degenerate oligonucleotide seguence is the non-coding strand sequence corresponding to codin_ strand sequence encoding amino acids PheAsnValGluAsnGly (amino acids 327 through 332 of SEQ rD NO: 1) from the internal sequence of Cr~ j I.
A primary PCR was also performed on first-strand cDNA usino CP-1 (SEQ ID NO: 3) and CP-3 (SEQ ID NO: 5). as above. A secondary PCR -was perforrned using 5% of the primary reaction using CP-2 (SEQ ID NO: 4) and CP-3 (SEQ ID NO: 5). Again, multiple bands were observed, none of which could be specifically identified in a Southern blot as Cr~ j I, and this approach was also not pursued.
Double-stranded cDNA was then synthesized from approximatel 4 llo (pollen) or 8 11~ (flowerhead) RNA using a commercially available kit (cDNA Synthesis System kit, BRL. Gaithersbur . MD)~ After a phenol extraction and ethanol precipitation, the cDNA was blunted with T4 DNA
polymerase (Promega, Madison, WI)~ and li~ated to ethanol precipitated, self-annealed, AT ~SEQ ID NO: 20) and AL (SEQ ID NO: 22) oli~onucleotides fo l`"i L~,~

- .
WO 94/01560 PCr/U~93/00139 9S~

use in a modified Anchored PCR reaction. according to the method in Rafnar et al. (1991) J. Biol. C~e~ 266: 1229-1236; Frohman et al. (1990) Proc. Na~l.
Acad. Sci. U~A 85: 89g8-9002; and Roux et al. (1990) BioTech. 8: 48-57.
Oligonucleotide AT has the sequence 5'^ GGGTCTAGAGGTACCGTC-CGATCGATCATT-3'(SEQIDNO:20) (Rafnar et al. sup~a ). Oligonucleotide AL has the sequence 5'-AATGATCGATGCT-3'(SEQIDNO:22)(Rafnar et al.
Supra. The amino terminus of C)y j I was amplified from the linkered cDNA ~3 ul from a 20 111 reaction~ with 1 llg each of oligonucleotides AP (SEQ ID NO:
21 ) and degenerate Cry j I primer CP-7 (which has the sequence 5'-0 TI~CATICGAl'rCTGGGCCCA-3' wherein G at position 8 can also be T; A at position 9 can also be G; C at position 12 can also be T; and G at position 15 can also be A, T, or C)(SEQ ID NO: 6). Inosine (I) is used at position 6 in place ofG or A or T or C to reduce degeneracy (Knoth et al. supra). The de,~enerate oligonucleotide CP-7 (SEQ ID NO: 6) is the non-coding strand sequence corTesponding to coding strand sequence encoding amino acids 14-20 (TrpAlaGlnAsnAr~MetLys) from the amino terminus of C~ j I (amino acids 14-20 of SEQ ID NO: 1). Oligonucleotide AP has the sequence 5'-GGGTCTA-GAGGTACCGTCCG-3' (SEQ ID NO: 21).
The primary PCR reac~ion was carried out as described herein.
Five percent (5 111) of this initial amplification was then used in a secondary amplification with 1 ,ug each of AP (SEQ ID NO: 21 ) and degenerate C)y j I
primer CP-8 (SEQ ID NO: 7) an internally nested C~ j I oligonucleotide primer, as described herein. Primer CP-8 has the sequence 5'-CCTGCAGCGATTCT-GGGCCCAAAl-r-3' wherein G at position 9 can also be T: A at position 10 can also be G; C at position 13 can also be T; G at position 16 can also be A, T~ or C;
and A at position 23 can also be G)(SEQ ID NO: 7). The nucleotides 5'-CCTGCAG-3' (bases 1 through 7 of SEQ ID NO: 7) represent a Pst I restriction site added for cloning purposes. The remaining de~enerate oligonucleotide sequence is the non-coding strand sequence colTesponding to codin~ strand sequence encoding amino acids 13-18 of Ct~; I (AsnTrpAlaGlnAsnArg, amino acids 13-18 of SEQ ID NO: 1) from the amino terminus of C~ j 1. The ~.
dominant amplified product was a DNA band of approximately 193 base pairs.

4~

WO 94/01560 21 2 0 9 ~ 4 PCI`/US93/00139 as visualized on an ethidium bromide (EtBr)-stained 3~ GTG a~arose ~el.
Amplified DNA was recovered by sequential chloroform, phenol, and chloroform extractions. followed by precipitation at -20C with 0.5 volumes of 7.5 ammonium acetate and 1.5 volumes of isopropanol. After precipitation s and washing with 70% ethanol, the DNA was simultaneously digested with Xba I and Pst I in a 15 !ll reaction and electrophoresed through a preparative 3%
GTG NuSieve low melt gel (FMC, Rockport, ME). The appropliate sized DNA
band was visualized by EtBr staining, excised, and ligated into appropriately di~ested M 1 3mp 18 for sequencing by the dideoxy chain termination method ~-(Sanger et al. (1977) Proc. Natl Acad Sci. USA 74: 5463-5476) usin~ a commercially available sequencing kit (Sequenase kit, U.S. Biochemicals, Cleveland, OH). It was initially thought that li~atable material could only be derived from starninate cone-derived RNA. However, upon subsequent examination, it was shown that li&atable material could be recovered from PCR
product oenerated from pollen-derived RNA, and from staminate cone-derived RNA.
The clone desi~nated JC7 1.6 was found to contain a partial sequence of C~y j I. This was confirrned as an authentic clone of C~y j I by having complete identity to the disclosed NH2-terminal sequence of C7.~' j I
(Taniai et al. sup)a). The amino acid at position 7 was determined to be cysteine (Cys) in a~reemen~ with the sequence disclosed in U.S. patent 4, 939,239.
Amino acid numberinc is based on the sequence of the mature protein: amino acid 1 corresponds to the aspartic acid (Asp) disclosed as the NH2-terminus of C~ j I (Taniai et al. sup)a) The initiating methionine was found to be amino acid -21 relative to the first amino acid of the mature protein. The position ofthe initiating methionine was supported by the presence of upstream in-frame- -stop codons and by 78% homology of the surrounding nucleotide sequence with the planl consensus sequence that encompasses the initiating methionine, as reported by Lutcke et al. (1987) EMBO J. 6:43-48.
The cDNA encodin~ the remainder of C~ ene was cloned ~;orn the linkered cDNA by usin~ oligonucleotides CP-9 (which has the se4uenc~
5'-ATGGATTCCCCTTGCTTA-3')(SEQ ID NO: 8) and AP (SEQ ID NO: 21) in ~7 z~ ~
WO 94~01560 PCr/US93/00139 ~,l2,09S~ '' ' the primary PCR reaction. Oligonucleotide CP-9 (SEQ ID NO: 8) encodes amino acids MetAspSerProCysLeu of Cr~ j I (amino acids -21 throu~h -16 ot SEQ ID
NO: 1) from the leader sequence of C~; I. and is based c)n the nllcleotide sequence determined for the partial Cr~ j I clone JC76. 1.
s A secondary PCR reaction was performe~i on 55~ of the initial amplification mixture~ with 1 ~Lg each of AP (SEQ ID NO: 21) and CP-I() ~which has the sequence 5'-GGGAAl-rCGATAATCCCATAGACAGC-3')(SEQ
ID NO: 9), the nested primer. The nucleotide sequence 5'-GGGAAl~C-3' ot primer CP- 10 (bases 1 throu~h 8 of SEQ ID NO: 9) represent an Eco RI
restriction site added for cloning purposes. The remainino oli_onucleotide sequence encodes amino acids 1-6 of C~y j I ~AspAsnProlleAspSer) (amino acids 1 through 6 of SEQ ID NO: 1). and is based on the nucleotide sequence determined for the partial Cr~ j I clone JC76. 1. The amplified DNA product was purified and precipitated as above, followed by digestion with Eco RI and Xba 1 and electrophoresis through a preparative lq~ low melt ~el. The dominant DNA
band was excised and ligated into M13mpl9 and pUCl9 for sequencing. A~ain~
ligatable material was recovered from cDNA generated from pollen-derived RNA. and from staminate cone-derived RNA. Two clones. desi~nated pUC19JC9la and pUC19JC9ld, were selected for full-len~th sequencing. They were subsequently found to have identical sequences.
DNA was sequenced by the dideoxy chain termination method (Sanger et al. supra) usin~ a commercially available kit (sequenase kit (U.S.
Biochemicals. Cleveland. OH). Both strands were completely sequenceà usin~
M13 forward and reverse primers (N.E. Biolabs. Beverly. MA) and internal sequencing primers CP-13 (SEQ ID NO: 10). CP-14 (SEQ ID NO~ CP-15 (SEQ ID NO: 12). CP-16 (SEQ ID NO: 13)~ CP-18 (SEQ ID NO: 1~). CP-19 (SEQ ID NO: 16). and CP-20 (SEQ ID NO: 17). CP-13 has the sequence 5'-ATGCCTATGTACATTGC-3' (SEQ ID NO: 10). CP-13 (SEQ ID NO: 1~)) encodes amino acids 82-87 of C~,~ j I (MetProMetTyrlleAI~ amino acids 82 throu~h 87 of SEQ ID NC): 1). CP-14 has the sequence 5'-GCAATGTACATAGGCAT-3' (SEQ ID NO: 11 ) and ct)rresponds to the non-coding strand sequence of CP- 13 SEQ ID NO: 1()). CP- l~ h~s the sequence ~'-4~

WO 94/01~60 2 1 2 ~ 9 ~ ~ PCI/US93/00139 TCCAAl~CTI`CTGATGGT-3' ((SEQ ID NO: 12) which encodes amino acids 169-174 of C~ I (SerAsnSerSerAspGly. amino acids 169 through 174 of SEQ
ID NO: 1). CP-16 has the sequence 5'- ~GTCAAl~GAGGAGT-3' (SEQ
ID NO: 13) which is the non-coding strand sequence which corresponds to S coding strand sequence encoding amino acids 335-340 of C~
(ThrProGlnLeuThrLys, amino acids 335 through 340 of SEQ ID NO 1). CP- 18 has the sequence 5'-TAGCAACTCCAGTCGAAGT-3' (SEQ ID NO: 15) which is the non-coding strand sequence which substantially corresponds to codin(r strand sequence encoding amino acids 181 through 186 of Cr~ j I
o (ThrSerThrGlyValThr, amino acids 181 through 186 of SEQ ID NO: 1) except that the fourth nucleotide of CP-18 (SEQ ID NO: 15) was synthesized as a C
rather than the correct nucleotide~ T. CP- 19 which has the sequence 5'-TAGCTCTCATITGGTGC-3' (SEQ ID NO: 1~) is the non-coding strand sequence which corresponds to coding strand sequence encodin~ amino acids 270 through 275 of C7y j I (AlaProAsnGluSerTyr, amino acids 270 throuoh 275 of SEQ ID NO: 1). CP-20 has the sequence 5'- TATGCAAl-rGGTGGGAGT-3' (SEQ ID NO: 17) which is the coding strand sequence for arnino acids 251-256 of Cr,~ j I (TyrAlaIleGlyGlySer~ amino acids 251 through 256 of SEQ ID NO:
1). The sequenced DNA was found to have the sequence shown in Fics. 4a and 4b (SEQ ID NO: 1). This is a composite sequence from the two overlappin~
clones JC 71.6 and pUC19J9la. The complete cDNA sequence for Cn j I is composed of 1312 nucleotides~ including 66 nucleotides of 5' untranslated sequence~ an open reading frame startin~ with the codon for an initiatin~
methionine~ of 1122 nucleotides~ and a 3' untranslated re~ion. There is a consensus polyadenylation signal sequence in the 3' untranslated region 25 nucleotides 5' to the poly A tail (nucleotides 1279-1283 of Fig 4 and SEQ. ID
NO: 1). Nucleotides 1313-1337 of Fi; . 4 and SEQ. ID NO: 1 represent vector sequences. The position of the initiatin~ methionine is confirmed by the presence of in-frame upstream stop codons and by 785~ homolo~y with the plant consensus sequence that encompasses the initiatino methionine (AAAAAUGGA
(bases 62 throu~h 71) of SEQ ID NO~ ound in Cr.~ j I compared with the AACA~!~iGC consensus sequence fol plzmts, ~tcke et al. (19~7) EMBO J. ~: ¦

4,~ .

WO 94/01~60 PCr/US93/00139 ~;J,.2~95i~ ' 43-48). The open reading f~ame encodes a protein of 374 amino acids of which the first 21 amino acids comprise a leader sequence that is cleaved from the mature protein. The amino terrninus of the mature protein was identified by comparison with the published NH2-terminal sequence (Taniai et al. (1988) sl~pra) and with sequence deterrnined by direct amino acid analysis of purified native Cr~; I (Example l ). The deduced amino acid sequence of the mature protein, comprised of 353 arnino acids has complete sequence identity with the published protein sequence for C~ j I (Taniai et al. s~lpra), includin~ the first twenty amino acids for the NH2-terrninal and sixteen contiguous internal amino acids. The mature protein also contains five potential N-linked ~lycosylation sites corresponding to the consensus sequence N-X-S/T.

Example 4 i Extraction of RNA from Japanese Cedar Pollen Collected in Japan Fresh pollen collected from a pool of Cryptomeria japonica (Japanese cedar) trees in Japan was frozen immediately on dry ice. RNA was prepared from 500 m~ ~f the pollen, essentially as described by Frankis and Mascarenhas Ann. Bot. 45:595-599. The samples were ~round by mortar and pestle on dry ice and suspended in S ml of 50 mM Tris pH 9.0 with 0.2 M NaCl.
1 mM EDTA. 1% SDS that had been treated overnight with 0.1% DEPC. After five extractions with phenol/chloroforrn/isoamyl alcohol ~mixed at 25:24:1), theRNA was precipitated from the aqueous phase with O. l volume 3 M sodium acetate and 2 volumes ethanol. The pellets were recovered by centrifu~ation.
resuspended in dH~0 and heated to 65C for 5 minutes. Two ml of 4 M lithium chloride were added to the RNA preparations and they were incubated overnioht at 9C. The RNA pellets were recovered by centritugation~ resuspended in l ml dH20. and again precipitated with 3 M sodium acetate and ethanol overnight.
The final pellets were resuspended in 100 ~l dH20 and stored at -81)"C.
Double stranded cDNA was synthesized trom 8 ug pollen RNA
using the cDNA Synthesis Systems kit (BRL) with oligo dT priming according ~() Wo 94/01560 2 12 D 9 3 4 PCr/US93/00~39 to the method of Gubler and Hoffman (1983) Gene 25:2~3-269. Polymerase chain reactions ~PCR) were carlied out usin~ the GeneAmp DNA Amplification kit (Perkin Elmer Cetu~) whereby 1(3 ~l lOx buffer containing dNTPs was mixed with 100 pmol each of a sense oli~onucleotide and an anti-sense S oli~onucleotide, ( 10 ~11 ot` a 40() ~I double stranded cDNA reaction mix)~ ().5 Amplitaq DNA polymerase. and distilled water to 100 ~
The samples were amplified with a pro~rammable therrnal controller from MJ Research~ lnc. (Camblidge. MA). The filrst 5 rounds of amplification consisted of denaturation at 94C for 1 minute, annealing of lo primers to the template at 45C for 1 minute~ and chain elongation at 72C for I
- minute. The final 20 rounds of amplification consisted of denaturation as above~
annealing at 55C for 1 minute, and elongation as above~
Seven different Cr!~j I primer pairs were used to amplify the double stranded cDNA as follows: CP-9 (SEQ. ID #8) and CP-17 (SEQ. ID #14). CP-lO(SEQ.ID#9) and CP-17 (SEQ. ID #14). CP-lO(SEQ.ID#g) and CP-16 (SEQ.ID#13),CP-lO(SEQ.ID~9) and CP-19 (SEQ.ID #16). CP-10 (SEQ.ID
#9) and CP-18 (SEQ. ID #15). CP-13(SEQ.ID#10) and CP-17 (SEQ. ID#14).
dCP-13(SEQ.ID#10) and CP-19 (SEQ.ID#16). CP-17 (SEQ. ID#14)has the sequence~5'- CCTGCAGAAGCTTCATCAACAACG~AGA-3' and corresponds to non-coding strand sequence that corresponds to codin~ strand sequence encoding amino acids SKRC* (amino acids 350-353 and the stop codon o~ SEQ.ID#1). The nucleotide sequence 5'-CCTGCAGAAGCTI-3' (bases 1 throu~h 13 of SEQ.ID#14) represents Pst I and Hin dIlI restriction sites added for clonin~ purposes. The nucleotide sequence 5'-TCA-3' (bases 13 2s ~ through 15 of SEQ.ID#14) correspond to the non-coding strand sequence of a stop codon. All of the amplifications yielded p[oducts of the expected size when viewed on ethidium bromide (EtBr)-stained a~arose gels. Two of these primer pairs were used in ampli~lcations whose products were cloned into pUCl9 for full-length sequencin~n The PCR reaction with CP~10 (SEQ. ID #9) and CP-16 (SEQ. ID #13) on the double stranded cDNA yielded a band of approximately 1.1 kb, and was ~:alled JC13û. A separate t`irst strand cDNA
reaction was done with 8 llg pc)llen RNA as described above and amplit`ied with WO 94/01~60 PCr/US93/0013~
?.,~æo9~4 oli~onucleotide primers CP-10 (SEQ. ID #9) and CP-17 (SEQ. ID ~14). This amplification yielded a full-length cDNA. named ~Cl35~ from ~he arnino terrninus of the mature protein to the stop codon.
Amplified DNA was recovered by sequential chloroform. phenol, and s chloroform extractions, followed by precipitation at -20C with 0.5 volumes of 7.5 ammonium acetate and l.5 volumes of isopropanol. After precipitation and washing with 70% ethanol. the DNA was blunted with T4 polymerase followed by digestion with Eco RI, in the case of JC 130 . or simultaneously digested with Eco RI and Ps~ I, in the case of JC135, in a 15 111 reaction and electrophoresedthrou~h a preparative 1% SeaPlaque low melt gel (FMC). Appropriate sized DNA bands were visualized by EtBr staining. excised. and ligated into appropriately digested pUCl9 for dideoxy DNA sequencin~ by the dideoxy chain termination method (Sanger et al. (l977? P-oc. Na~l. Acad. Sci. USA
74:~463-5476) using a commercially available sequencing kit (Sequenase kit~
U.S. Biochemicals, Cleveland, OH).
Both strands were sequenced using M13 forward and reverse primers (N.E.
Biolabs, Beverly, MA) and internal sequencing primers CP-13 (SEQ. ID #10).
CP-1~ (SEQ. ID #12), CP-16 (SEQ ID #13), CP- 18 (SEQ. ID #15), CP- 19 (SEQ. ID #16) and CP-20 (SEQ. ID #17). Two clones from amplification JC 130 (JC130a and JC130b) and one clone from amplification JC135 (JC135g) were found to be C--.Yj I clones upon sequencing. The nucleotide and deduced amino acid sequences of clones JC130a and JCl35g were identical to previously l;nown .:;
C)~j I sequence (SEQ. ID ~1). Clone JC130b was found to contain a sin~le nucleotide difference from the previously known Cr~j I sequence (SEQ. ID #l).
Clone JC130b had a C at nucleotide position 306 of Seq. ID #l. This nucleotide change results in a predicted amino acid change from a Tyr to a His at amino acid 60 of the mature Cr~ j I protein. This polymorphism has not yet been confirmed in an independently-derived PCR clone or by direct amino acid sequencing. However~ such polymorphisms in primary nucleotide and amino acid sequences are expected.

5~

WO 94/01560 ~ 1 2~ Pcr/US~3/00139 Example 5 Expression of C y j I
Expression of C yj I was performed as follows. Ten ~1 of pUC 19JC9 l a was digested with Xba I. precipitated, then blunted with T4 polymerase. BclmH I
linkers (N.E. Biolabs. Beverly, MA) were blunt^end ligated to pUC19JC9la overnight and excess linkers were removed by filltration throu,o~h a NACS ion exchange minicolumn (BRL, Gaithersbur~. MD). The linkered cDNA was then digested simultaneously with EcoR I and BamH I. The Gy j I insert (extendin~
from the nucleotides encoding the amino terminus of the mature protein throu~h the stop codon) was isolated by electrophoresis of this digest throuoh a 1%
SeaPlaque low melt agarose gel. The insert was then ligated into the appropriately digested expression vector pET-l ld (Nova~en, Madison. WI:
Jameel et al. (1990) J. Virol. 64:3963-3966) modified to contain a sequence lS encoding 6 histidines (His 6) immediately 3' of the ATG initiation codon followed by a unique EcoR I endonuclease restriction site. A second EcoR I
endonuclease restriction site in the vector, along with neighboring Cla I and Hind III endonuclease restriction sites. had previously been removed by digestion with EcoR I and Hind ~I. blunting and religation. The histidine (HiS6)sequence was added for affinity purification of the recombinant protein (Cr~ j I) on a Ni2+ chelatinp, column (Hochuli et al. ( 1987) J. Chrornatog. 41 1:177-184:Hochuli et al. (198&) Bio~rech. 6:1321-1325.). A recombinant clone was used to transforrn Escherichia coli strain BL2 1-DE3 which harbors a plasmid that has anisopropyl-~-D-thiogalactopyranoside (IPI G3-inducible promoter precedin~ the ~ene encoding 17 polymerase. Induction with IPTG leads to high levels of T7 polymerase expression. which is necessary for expression of the recombinant protein in pET-lld~ which has al7 promoter. Clone pET-lld~ HRhis6JC9la.d was confirmed by dideoxy sequencino (Sanoer et al. Supra) with CP-14 (SEQ.
ID #l 1) to be a Cryj I clone in the correct readino t`rame for expression.
' Expression of the recombinant protein was confirmed in an initial small culture (50 ml). An overni&ht culture of clone pET- I ld~HRhis6JC9 la.d was used to inoculate 50 ml of media (Brain Heart Infusion Media. Difco) containino ampicillin (200 ,ug/ml). ~rown to an A6 ~ = l.0 Imd then induced with IPTG (l WO 94/01560 PCr/US93/00139 2~,09S~ ~ ' mM, final concentration) for 2 hrs. One ml aliquots of the bacteria were collected before and after induction. pelleted by centrifugation, and crude cellIysates prepared by boiling the pellets ~or S minutes in 50 mM Tris HCh pH 6.8, 2 mM EDTA, 1% SDS. 1% ~-mercaptoethanol, 10~h glycerol. 0.25%
bromophenol blue (Studier et al., (1990) Methods in En~.Ymology I 85:60-89).
Recombinant protein expression was visualized as a band with the predicted molecular weight of approximately 38 kDa on a Coomassie blue-stained SDS- ~
PAGE gel, according to the method in Sambrook et al.~ sl~pra, on which 40 ~1 of the crude Iysate was loaded. A negative control consisted of crude lysates from uninduced bacteria containing the plasmid with C~ j I and an induced Iysate from bacteria carrying no plasmid.
The pET-l ld~ HRhis6JC91a.d clone was then grown on a large scale for ,recombinant protein expression and purification. A 2 ml culture bacteria containing the recombinant plasmid was grown for 8 hr, then streaked onto solid media (e.g. 6 petri plates (100 x 15 mm) with 1.5% agarose in LB medium (Gibco-BRL, Gaithersburg, MD) containing 200 llg/ml ampicillin), grown to confluence overnight, then scraped into 9 L of liquid media (Brain Heart Infuslon media. Difco) containing ampicillin (200 ~g/ml). The culture was grown until the A600 was 1.0, IPTG added ( 1 mM final concentration)~ and the 2 o culture grown for an additional 2 hours.
Bacteria were recovered by centrifugation (7.930 x g~ 10 min), and Iysed - - ~; in 90 ml of 6M Guanidine-HCI. 0.1M Na2HPO4, pH 8.0 for I hour with vigorous shaking. Insoluble material was removed by centrifugation ~11,0()() x g, 10 min, 4 C). The pH of the lysate was adjusted to pH 8Ø and the Iysate ~ ~ '5 applied to an 80 ml Nickel NTA a~arose column (Qiagen) that had been - - equilibrated with 6 M Guanidine HCI, 100 mM Na2HP04. pH 8Ø The column was sequentially washed with 6 M Guanidine HCI, 100 mM Na2HP04 10 mM
Tris-HCl, pH 8.0, then 8 M urea, 100 mM Na2HPO4. pH 8Ø and finally 8 M
urea. 100 mM sodium acetate, 10 mM Tris-HCI. pH 6.3. The column was washcd with each buffer until the flow through had an A280~ 1).05.
The recombinant protein, C~ was eluted with 8 M urea~ 1()(1 mM
- sodium acetate, 10 mM Tris-HCI, pH 4.5. and collected in 1() ml aliquots. The WO 94/01~60 212 D !3 ~ 4 PCI~/US93/00139 protein concentration of each fraction was deterrnined by absorbance at A280 and the peak fractions pooled. An aliquot of the collected recombinant protein was analyzed on SDS-PAGE according to the method in Sarnbrook et al.. Sllpl W.
The first 9 L prep. JCpET- I. yielded 30 mg of Cr~ j I with approximately s 78~o purity, as determined by densitometry (Shimadzu Flying Spot Scanner.Shimadzu Scientific Instruments. Inc.. Braintree. MA) of the Coomassie-blue stained SDS-PAGE gel. A second 9 E prep prepared the same way. JCpET-2 yielded 41 mg of Cr~j I with approximatel~7 77~ purity.

Example 6 lapanese Cedar Pollen Aller~ic Patient T Ce~l Studies with Crv j I - the Primarv Cedar Pollen Anti~en.
Synthesis of Overlapping Peptides Japanese cedar pollen Cr~ j I overlapping peptides were synthesized using standard Fmoc/tBoc synthetic chemistly and purified by Reverse Phase HPLC. Figure 13 shows Cryj I peptides used in these studies. The peptide names are consistent throughout.

T Cell Responses to Cedar Pollen Antigen Peptides Peripheral blood mononuclear cells (PBMC) were purified by Iymphocyte separation medium (LSM) centrifugation of 60 ml of heparinized 2~ blood from Japanese cedar pollen-aller~ic patients who exhibited clinicalsymptoms of seasonal rhinitis and were MAST andJor skin test positive for Japanese cedar pollen. Long term T cell lines were established by stimulation of? X 106 PBL/ml in bulk cultures of complete medium (RPMI-1640~ 2 mM L-glutamine~ 100 U/ml penicillin/streptomycim Sx10-5M 2-mercaptoethanol. and 10 mM HEPES supplemented with 5~ heat inacti-ated human AB serum) with 20 ,ug/ml of partially purified native G~ j I (755~ purity containing three bands similar to the three bands in Fig. 2) for 7 days at 37C in a humidified Sq~ CO~incubator to select for G~ j I reactive T cells. This amount of priming antigen WO 94tO1560 PCI/US93/00139 21209~4 was determined to be optimal for the activation of T cells frorn most cedar pollen allergic patients. Viable cells were purified by LSM centrifugation and culturedin complete medium supplemented with 5 units recombinant human IL-2tml and 5 units recombinant human IL-4/ml for up to three weeks until the cells no 5 lon~er responded to lymphokines and were considered "rested". The ability of the T cells to proliferate to selected peptides. recombinant C-~ j I (rCr~ j I),purified native Cryj I, or recombinantAmb a 1.1 (rAmb aI.1) was then assessed.
For assay, 2 X 104 rested cells were restimulated in the presence of 2 X 104 autolo~ous Epstein-Barr virus (EBV)-transformed B cells (prepared as described below) (gamma-irradiated with 25P00 RADS) with 2-50 ~lg/ml of rGy j 1.
purified native Cry j I or rAmb a I. 1. in a volume of 200 ,ul complete medium in duplicate or triplicate wells in 96-well round bottom plates for 2-4 days. The optimal incubation was found to be 3 days. Each well then received 1 ~lCi tritiated thymidine for 16-20 hours. The counts incorporated were collected onto~glass fiber filter mats and processed for liquid scintillation counting. Fi~. 12 shows the effect of va ying antigen dose in assays with recombinant C ~
purified~nat`ive Cry j I, and recombinant Amb a I. 1 and several anti~enic peptides synthesized~as~described above. Some peptides were found to be inhibitory at hi~h~concentrations~in thes,e assays. The titrations were used to optimize the 20 ~ dose~of peptides in T cell assays. The maximum response in a titration~of each peptidc;is expressed æ the stimulation index (S.I.). The S.I. is thè counts per minute (CPM) incorporated by cells in response to peptide. divided by the CPM
incorporated by cells in medium only. An S.I. value equal to or greater than 2 times the back~round level is considered "positive" and indicates that the peptide 25 ~ contains a T cell epitope. The positive results were used in calculating mean stimulation indices for each peptide for the, roup of patients tested. The results -" ~ shown In Flg. 12~demonstrate that patient ~999 responds well to recombinant Cr~ j I. and purified native Cr~ j I. as well as to peptides CJ 1-2~ 3. 2(1~ and 22 but not to recombinant Amb a I. l . This indicates that Cr.~ j I T cell epitopes are recognized by T cells from this particular allergic patient and that rCn j I andpeptides CJ l -2. 3. 20 and 22 contain such T cell epitopes. Fulthermc)re. the 5 epitopes were often not detected with the adjacen~ overlappin~ peptides. and :
, ~ , ~ Sfi ;-WO 94/015~0 2 1 2 0 9 5 4 PCI`/US93/0013~

therefore probably span the non-overlappin~ central residues of the reactive peptides. No si~nificant cross-reactivity was found in T cell assays using T cells primed with control antigens or with C~ j I primed T cells against other antigens.
The above procedure was followed with a number of other patients.
Individual patient results were used in calculating the mean S.I. for each peptide if the patient responded to the Cr~j I protein at an ~.I. of 2.0 or ~reater and the patient responded to at least one peptide derived from C/y j I at an S.I. of 2.0 or greater. A summary of positiYe experiments from twenty-five patients is shown in Fi~ure 14. The bars represent the positivity index. Above each bar is the percent of positive responses with an S.I. of at least two to the peptide or protein in the group of patients tested. In parenthesis above each bar are the mean stimulation indices for each peptide or protein for the group of patients tested.
All twenty-five T cell lines responded to purified native Cry j I and 68.0% of the T cell lines responded to rC)y j I. These twenty-five T cell lines also responded at a significantly lower level to rAmb a I. 1 indicating that the Amb a I allergens share a de~ree of homology with Cryj I and that "shared" T cell epitopes might exist between Gy j I and Am~ a I. This panel of Japanese cedar allergic patientsresponded to peptides CJl-l,CJl-2,CJl-3,CJl-4,CJl-7.CJl-8.CJl-9,CJl-10.
CJl-ll,CJl-12,CJl-14,CJl-lS.CJl-16,CJl-17.CJl-18,CJI-l9.CJl-20.CJl-~l.CJl-22.CJl-23,CJl-24~CJl-25.CJl-26.CJl-27.CJl-28.CJl-30,CJI-31.
CJl-32.CJl-33,CJl-34 and CJl-35indicating that these peptides contain T cell epitopes.

2~ Preparation of (EBV)-transformed B Cells for Use as Antigen Presenting Cells Autolo~ous EBV-transformed cell lines were ~y-irradiated with 25.()0() Rad'and used as antig~en presenting cells in secondary proliferation assays and secondary bulk stimulations. These cell lines were also used as a control in theimmuno-fluorescence llow cytometry analysis. These EBV-transt`ormed eell ;~
lines weR made by incubatino S X 106 PBL with I ml of B-59/8 Marmoset cell '-WO 94/01560 PCr/US93/0û139 ,o95~

line (ATCC CRL1612, American Type Culture Collection~ Rockville, MD) conditioned medium in the presence of I ~lg/ml phorbol 12-myristate 13-acetate (PMA) at 37C for 60 minutes in 12 X 75 mm polypropylene round-bottom Falcon snap cap tubes (Becton Dickinson Labware. Lincoln Park, NJ). These cells were then diluted to 1.25 X 106 cells/ml in RPMI-1640 as described above except supplemented with 10% heat-inactivated fetal bovine sen~m and cultured in 200 ~1 aliquots in flat bottom culture plates until visible colonies were detected. They were then transferred to larger wells until the cell lines were established.
Example 7 -Cry j I as the Major Cedar Pollen Allergen To examine the importance of Cr~ j I, reported as the major allergen of Japanese cedar pollen, both direct and competition ELISA assays were performed. For the direct ELISA assays~ wells were coated with either soluble pollen extract (SPE) of Japanese cedar pollen or purifled native C~ j I (assayedat 905~ purity by protein sequencing) and human IgE antibody binding to these 20~ntigens was analyzed. Pooled human plasma. consisting of an equal volume of plasma from 15 patients with a Japanese cedar pollen MAST score of 2.5 or grzater, and two individual patient plasma samples were compared in this assay.
Fig. 5 shows the results of the binding reac.ivity with these two antigens. The overall pattern of binding is very similar whether the coating antigen is SPE
(Fig. 5a~ or purified native Cr~ j I (Fig. Sb).
In the competition assay, ELISA wells were coated with Japanese cedar pollen SPE and then allergic patient IgE binding was measured ili the presence ot`
competing purified native Cryj I in solution. The source of al~ergic IgE in these assays was either the pool of plasma from 15 patients (denoted PHP) or seven individual plasma samples from patients with a Japanese cedar MAST score of '.~ or greater. The competition assay usin the pooled human plasma samples compares the competitive binding capacity of purified native C~ j I to Japanese WO 9~/01~60 21 2 ~ 9 .S 4 PCr/US93/00139 cedar pollen SPE and an irrelevant allergen source, rye ~rass SPE. Fi8. 6 shows the graphed results of the competition ELISA with pooled human plasma. The concentration of protein present in the Japanese cedar pollen SPE is approximately 170 tirmes greater at each competin~ point than is the purified native Cryj I . From this analysis it is clear that the purified native C/~ j I
competes very well for IgE binding to the whole range of proteins present in theJapanese cedar pollen soluble pollen extract. This implies that most of the anti-C)y j IgE reactivity is directed against native C)y j I . The negative control shows no specific competitive activity and the competing SPE in solution can completely remove binding to the coated wells. This assay was repeated with individual patients as a measure of the ran~e of the IgE response within the - allergic population. Fig. 7 shows this result where the competition of binding to SPE was performed with purified native C)y j I . The results demonstrate that although the patients show different dose response to Japanese cedar pollen SPE.each of the seven patients' IgE binding to Japanese cedar pollen SPE could be competed with pùrified native Cry j I. The implications of these data are that for each patient the IgE reactivity directed against C~ j I is predominant but that there is variation in this reactivity between patients. The overall conclusion is that these data support the previous findings (Yasueda et al., (1988) ~L ) that Cr~ j I is the major allergen of Japanese cedar pollen.
The reactivity of IgE from cedar pollen allergic patients to the pollen proteins is dramatically reduced when these proteins are denatured. One method -of analyzing this property is through direct binding ELISA where the coatin_ antigen is the Japanese cedar pollen SPE or denatured Japanese cedar pollen SPE
2s which has been denatured by boiling in the presence of a reducing a~ent DTT.
This is then examined with allergic patient plasma for lgE binding reactivity.
Fig. 8a. shows the direct binding assay to the SPE with seven individual plasm~
samples. In Fig. 8b. the binding results with the denatured SPE demonstrates themarked decrease in reactivity following this treatment. To determine the extent of Cr~ j I binding to the ELISA wells. C)~ j I was detected with a rabbit polyclonal antisera against the Amb a 1 & Il protein family. These ragweed proteins have high sequence identity (465~) with C-! j I and this antisera can be -~

7~ .

2.~.?.1~9S~ , used as a cross reactive antibody detection system. In conclusion, these data demonstrate a marked loss in IgE reactivity following denaturation of the Japanese cedar pollen SPE.
s Example 8 IgE Reac~vity and Histamine Release Analysis The recombinant Cryj I protein (rC~j I), expressed in bacteria and then purified (as described in Example 5), has been examined for IgE reactivity. The first method applied to this exarnination was direct ELISA where wells were coated with the recornbinant Cn~ j I and IgE binding was assayed on individual - patients. Fig. 9 is the graphic representation of this direct ELISA. The only positive signals on this data set are from the two control antisera rabbit polyclonal anti-Amb a I & II prepared by conventional means (Rabbit anti-Am~ a I & II~ and CBF2, a monoclonal antibody raised against Amb a I that cross reacts with Gyj I . By this method all patients tested showed no IgE reactivity with the recombinant Gyj I .
Another method of analysis that was applied to the examination of IgE
reactivity to the recombinant Cry j I was a capture ELISA. This analysis relies on the use of a defined andbody, in this case CBF2 to bind the antigen and allowfor the binding of antibodies to other epitope sites. The format of this captureELISA is 1) wells are coated with MAb CBF2, 2) antigen or PBS (as one type of negative control) is added and captured by specific interaction with the coated MAb~ 3) either the control antibody anti-Amb a I & II (Fi;,. lOb) or human allergic plasma (Fig. lOa) is added as the detecting antibody, and 4) detection of antibody binding is assayed. Figs. lOa and lOb are the graphed results of these assays. For the I~E analysis, the pooled human plasma (PHP) (15 patients) was used. The conclusion from these results is that there is no indication of any specit`ic binding of human allergic I~E to rC) ~ j I by this method ot' analysis.
However, the capture of rCrYj I works as evidenced by the control antibody bindin~ curve, shown in Fi~. lOb. The lacl; ot' I~E bindin~ to E. ~Q~ expressed rC~ j I may be due to absence of carbohydrate or any other post-translational ~' 212~3,;1 WO 94/01560 PCr/US93/00139 modification and/or that the majority of IgE cannot react with denatured C~ j I.RAST. competition EUSA and Western blotting data also demonstrates no specific IgE reactivity to ~he rCr~ j I (data not shown).
A histamine release assay was performed on one Japanese cedar pollen allergic patient using Japanese cedar pollen SPE. purified native C~; I and rCr~ j I as the added antigens. This assay is a measure of IgE reactivity through human basophil mediator release. The results of this assay. shown in Fig. 11.
demonstrate strong his~nine release with both purified native Cr~ j I and the Japanese cedar pollen SPE over a wide concentration range. The only point where there is any measurable histarnine release with the Cr~ j I is at the highest concentration, 50 ~/ml. Two possible explanations for this release by the rC~ j - I are: 1) specific reactivity with a very low proportion of the anti-Cr,~; I IgE
capable of recognizing the recombinant form of Cr! j I . or 2) non-specific release caused by low abundance of bacterial contaminants observed only at the hi~hest antigen concentration. Thus far, this result has only been shown in a single patient. In addition, the data shown are from single data points at each protein concentration.
It may be possible to use this recombinantly expressed Cry j I protein for irnmunotherapy as E. coli expressed material has T cell reactivity (Example 6)~
but does not appear to bind IgE from C ytpomeria japonica atopes nor cause ~-~ histamine release from the mast cells and basophils of such atopes i~i vitro.
E:~pression of rG~ j I which is capable of binding IgE could possibly be achieved in yeast, insect (baculovirus) or mammalian cells (e.g. CHO. human and mouse). A specific example of mammalian cell expression could be the use of the pcDNA VAmp mammalian expression vector (Invitro~en. San Diego. CA) e~pressing recombinant Cr~ j I in COS cells. A rC~ ~ j I capable of actively binding IgE may be important for the use of recombinant material for diagnostic purposes.
To analyze IgE reactivity to selected C~ j I peptides a direct ELISA
fo~nat was used. ELSIA wells were coated with 2~ peptides derived trom C~ j I lnd assayed for IgE binding. Fig. l5a and l5b are graphs ot these bindin~
r~sults using PHP (15 patients) as the cedar pollen aller~ic I E source. This pool fil WO 94/01~60 PCr/US93/00139 2~2~95~ -of plasma was forrnulated for enrichment of IgE that could bind to denatured SPE (as detennined by direct ELISA) and therefore increase the chance of reactivity toward the peptides. In this assay~ the peptide I~E binding capacity was compared to that of purified native Cn j I and to rCr~ j 1. The only specific IoE detected in this assay was to purified native Cr~j 1 which supports the ~inding that Japanese cedar allergic patient IgE does not bind to recombinant C~j I or the recombinant Cr}~j I peptides tested (Fig. 15).

Although the invention has been described with reference to its preferred embodiments, other embodiments, can achieve the same results. Variations and modifications to the present invention will be obvious to those slcilled in the art and it is intended to cover in the appended claims all such modification and equivalents and follow in the true spirit and scope of this invention.

Example 9 - Extraction of RNA from Juniperus sabinoides, Juniperus virgini~na andCl~pressus arizonica pollens and the cloning of Jun s I and Jun v I, homologs of GyjI.
Fresh pollen was collected from a single J~miperus virgil1iana tree at the Arnold Arboretum (Boston, MA), and was frozen immediately on dry ice;
J~ iperus sabinoides and Cupressus ari~onica pollens were purchased from Greer Laboratories, Inc. (Lenoir, NC). Total RNA was prepared from J.
~irginiana, J. sabinoides. and C arizonica pollens as described in Example 3.
Single stranded cDNA was synthesized from S llg total pollen RNA from J~
lir~iniana and 5 ~g total pollen RNA from 1. sabinoides usino the cDNA
S~ nthesis System Icit (BRL, Gaithersburg. MD). as described in Example 3.
The initial attempt at cloning C ~ j I homologue from the tw() juniper speci~s was made using various pairs of C~ specific olioonucleotides in PCR
amplifications on both juniper cDNAs. PCRs were carried out as described in E.~ample 3 The oligonucleotide primer pairs used were: CP-9JCP-17. CPl~)/CP-6~

WO94/01~60 ' 212D9.~-~ PCr/USs3/00139 ~' 17, CP-10/CP-16, CP-10/CP-l9. CP-lWCP-18, CP-13/CP-17. and CP-13/CP-19.
CP-10 was used in the majority of the reactions as the ~' primer since it has been reported by Gross et. al. (1978) Scand. 1. Immunol. 8: 437-441 that the first 5 amino-terminal amino acids of J. sabinoid~s are identical to those of C~ j I.
S These oli~onucleotides and oligonucleotide primers pairs are described in ~-Example 3.
None of the primer pairs cited above resulted in a PCR product for either juniper species when viewed on an EtBr-stained 1% a~arose (FMC Bioproducts.
Rockland, ME) minigel.
The next series of PCR amplifications attempting to clone the C~
homologues from J. sabinoides and J. virginiaMa from were made on double stranded linkered cDNA synthesized from RNA from each species. Oouble stranded cDNA was synthesized from 5 ,u~ of J. virginiana and S llg J.
sabinoides pollen RNA as described in Example 3. The double-stranded cDNA .
was li~ated to ethanol precipitated, self annealed. AT and AL olioonucleotides for use in a modified Anchored PCR as described in Example 3. A number of C~ j I primers were then used in combination with AP in an attempt to isolate the Cr~ j I homologues from the two juniper species. The sequences of AT. AL
and AP are given in Example 3. First, a primary PCR was carried out with 100 pmol each of the oligonucleotides CP-10 and AP. Three percent (3 ,ul) ot' this initial ampli~lcation was then used in a secondary PCR with 100 pmoles each of CP- 10 and 'APA, which has the sequence ~'-GGGCTCGAGCTGCAG'l l~ l~
ImTG-3'. where nucleotides 1-15 represent Pst I and Xho I
endonuclease restriction sites added for clonin~ purposes. and nucleotide 33 canalso be an A or C. A broad smear, with no discreet band. was revealed upon examination of the secondary PCR reactions on an EtBr-stained agarose gel.
Attempts to clone C~ j I homolo~ues from these PCR products were not successful. This approach would have cloned a carboxyl portion of these genes.
The~ degenerate Cn~ j I primers CP-l, CP-4. and CP-7 as described in Example 3 were then each used in primary PCRs with AP on the double stranded linl;ered J.
~ ir,~iniana and J. sabinoides cDNAs. Various plimer pair combinations were used in secondary PCRs as follows: CP-2/AP and CP-4/AP on the CP- I/AP

~,Y~ . ~

Wo 94/01560 PCr/USs3/00139 2~20954 primary PCR arnplification mixture, CP-2/AP and CP-S/AP on the CP-4/AP
primary PCR amplification mixture, and CP-8/AP on the CP-7/AP primary PCR
arnplification mixture. Only the last amplification, the CP-8/AP seeondary PCR
amplification, yielded a band upon examination on an EtBr-stained minigel; the others gave smears that could not be cloned into pUC19. Both the J. virginiana ~ t and J. sabinoides secondary PCRs with CP-8 and AP, described in Example 3 called JV21 and JS17, respectively, resulted in amplified products that were approximately 200 base pairs long. The amplified DNA was recovered as described in Example 3 and simultaneously digested with Xba I and Pst I in a 50 ~11 reaction, precipitated to reduce the volume to 10 ~1. and electrophoresed through a preparative 2% GTG NuSeive low melt gel (FMC. Rockport, ME).
The appropriate sized DNA band was visualized by EtBr staining~ excised~ and ligated into appropriately digested pUCl9 for sequencing by the dideoxy chain termination method of Sanger et al. (~) using a commercially available sequencing ki~ (Sequenase kit, U.S. Biochemicals, Cleveland, OH). Two JS17 clones (pUC19JS17d and pUC19JS17f) and one JV21 clone (pUC19JV21g) were sequenced, and found tO contain sequences homologous to the Cry j I
nucleotide and deduced amino acid sequences. The Cr~ j I homologues isolated from J. sabinoides and J. virginiana RNA were desi~nated Jun s I and Jun respectively.
The C~ j 1 primers CP-9 and CP-10 should worl; in primary and secondary PCRs, respectively, with AP to amplify the carboxyl portion of the Jlm s I and Jun v T cDNAs. The sequence of these primers are essentially identical to the sequences of Jun s I and Jlm v I, with the exception of 2 nucleotides in CP-9 (T instead of A in position 5 of CP-9. C instead of A in position 123, and 1 in CP-10 (C instead of A in position 12 for Jun s I only)~
However~ primary PCRs with CP-9 and AP and secondary PCRs with CP-10 and AP did not yield identifiable Jun s I nor Jun v I product when viewed on an EtBr-stained agarose gel.
Oligonucleotide J 1 was synthesized~ J 1 and all subsequent oligonucleotides were synthesized on an ABI 394 DNA/RNA synthesizer (Applied Biosystems, Foster City. CA)~ Primary PCRs were carried out usino ~4 WO94/01560 2 1 2 0 9 ~ ~ PCT/US93/00139 APandJl with J. virginiana and J. sabinoides cDNAs. J1 has the sequence 5'-CTAAAAATGGCl~CCCCA-3'~ which corresponds to nucleotides 20-37OfJun s I (Fig. 16) and nucleotides 30-47OfJunvI(Fig.17). A secondary PCR
amplification was performed on the pnmary Jl/AP~mplificationofJ. sabinoides S cDNA using primers J2 and AP.J2 has the sequence 5'-CGGGAATTCTAGATGTGCAATTGTATCTTGTTA-3'. whereby nucleotides 1-13 represent EcoR land Xba I endonuclease restriction sites added for cloning purposes. and the remaining nucleotides correspond to nucleotides 65-84 in the Jl~n s I sequence (Fi~. 16). The secondary arnplification from J. virginiana io cDNA was perforrned with AP and J3, which has sequence 5'-CGGGAATTCTAGATGTGCAATAGTATCTTGTTG-3' whereby nucleotides 1-13 represent EcoR I and Xba I endonuclease restriction sites added for clonin~purposes and tbe remainin~ nucleotides correspond to nucleotides 75-94 in the Jl/n 1~ I sequence ~Fig. 17). Nospecificamplified product was observed in eithersecondary reaction. The primers desi~nated ED and EDT were used at a molar ratio of 3:1 (ED:EDT) in conjunction with primers Jl, J2 and J3, as described below. EDT has the sequence 5'-GGAATICTCTAGACTGCAGG-lmmm~-3'. The nucleotides 1 throu~h 20 of EDT were added to - the poly-T track to create EcoR I. Xba I, and Pst I endonuclease restriction sites for cloning putposes. ED has the sequence 5'-GGAAl-rCTCTAGACTGCA-GGT-3'. correspondin~ to nucleotides 1 to 21 of EDT. These oli~onucleotides ,and their use have been previously described (Mor~enstern et al. ( I g9 1 ) Proc.
Natnl. Acad. Sci. USA 88:9690-9694). EDtEDT were used in primary PCRs with oli~onucleotide Jl for amplifications ~rom J. sabinoides and J. virgil7ianacDNAs, followed by secondary PCRs with oligonucleotides J2 and APA (for J.
sabinoides) or J3 and APA (for J. virginiana). No speci~lc product was identified from these amplifications. A final set of PCRs with J 1. J2 and J3 was tried with oli~onucleotide APA. APA was used in a primary PCR reaction with J l for J. sabinoides and J. vi--giniana. followed by secondary amplifications with J~ (for J. sa~inoides) or J3 (for J. virginiana) and APA. No specific product was identified from these amplifications. The dec~enerate primer CP-57 was then s~nthesized. CP-57 has the sequence 5'-GGCCTGCAGTTAACAGCG-t 6s WO 94/01560 PCI/US93/00~39 9 r 4 l~GCAGAAGGTGCA-3'. wherein T at position 10 can also be C~ T at position 11 can also be C. A at position 13 can also be G.G at position 16 can also be A.T. or C. G at position 18 can also be T, T at position 19 can also be C.
G at position 22 can also be A. T or C. C at position 23 can also be G. A at position 24 can also be C. G at position 25 can also be A. T. or C. A at position 27 can also be G. G at position 28 can also be A, T. or C. G at position 29 can also be C. T at position 30 can also be A, and G at position 31 can also be A.
The nucleotides 1 through 9 of CP-57 were added to create a Pst I site for cloning purposes, the nucleotides 10 through 12 are complementary to a stop Io codon and nucleotides 13 through 33 are complementary to coding strand sequence essentially encoding the amino acids CysSerLeuSerLysArgCys (amino acids 347 through 353 of Figure 4b, corresponding to nucleotides 1167 through 1187 of Figure 4b). This was used in a primary PCR with Jl on both J.
sabinoides and J. virginiana double stranded linkered cDNA, followed by a secondary PCRs with CP-57 and J2 for J. sabinoides and CP-57 and J3 for 3.
virginiana. No PCR products were recovered. Three additional degenerate C~ j - ~ I oligonuc~leotides were synthesized. CP-62 has sequence 5'-CCACTAAATAl-rATCCA-3', wherein A at position 3 can also be G, A at position 6 can also be G, T at position 9 can also be A or G. and T at position 12 can also be A or G: this degenerate oligonucleodde sequence is complementary to the coding strand sequence essentially encoding the amino acids ~- TrpIleIlePheSerGly (amino acids 69 through 74 of Figure 4a, corresponding to nucleotides 333 throuch 349 of Figure 4a). CP-63 has sequence 5'-GCATCCCCATCTTGGGGATG-3'. wherein A at position 3 can also be G. A at position 9 can also be G. T at position 12 can also be C G at position 1~ can also ; be A. T. or C. and A at position 18 can also be G; this degenerate oligonucleotide sequence is complementary to the sequence capable of encodin~
the arnino acids HisProGlnAspGlyAspAla (amino acids 146-152 of Fi~ure ~a.
~; corresponding to nucleotides 564 tO 583 of Figure 4a). CP-64 has the sequen~:e 5'-GTCCATGGATCATAAl~ATT-3'. wherein T at position 6 can also be C A
at-position 9 can also be G. A at position 12 can also be G~ A at position 15 can also be G. and A at position 18 can also be G: this de~enerate oli~onucleotide WO 94/01560 2 1 ~ 0 ~ ~ 4 Pcr/usg3/00l39 sequence is complementary to the coding strand sequence capable of encoding the amino acids AsnAsnTyrAspProTrpThr (amino acids 243-249 of Figure 4b.
corresponding to nucleotides 855 through 874 of Figure 4b). AP was used in a primary PCR amplification with CP-62. CP-63. CP-64 and CP-3 (described in Example 3) for both J. sabinoides and J. v;rginiana double-stranded linkered cDNA. A diagnostic PCR was performed on each primary reaction mixture. In this diagnostic PCR. 3~Q of the primary reaction was amplified as described above using AP and CP-8. For both J. sabinoides and J. virginia~la, the expectedbands of approximately 200 base pairs were observed in diagnostic PCRs from the primary PCR with AP and CP-63.
The degenerate primer CP-65 was then synthesized. CP-65 has the sequence 5'-GCCCTGCAGTCCCCATCTTGGGGATGGAC-3'. wherein A at position 15 can also be G7 T at position 18 can also be C. G at position 2 l canalso be G, A, T, or C, A at position 24 can also be G. and G at position 27 can 1S also be A, T, or C. Nucleotides 1-9 of CP-65 were added to create a Pst I
restriction site for cloning purposes, while the remaining de~enerate o ligonucleodde sequence is complementary to coding strand sequence essentially 7', ~ capable o~ encoding the amino acids ValHisProGlnAspGlyAsp (amino acids 145-151 of Figure 4a corresponding to nucleotides 561 through 580 of Fi~ure 20 ~ ~ 4a). AP was used in conjunction with CP-65 in a secondary PCR of the plimary AP/CP-63 àmplifications of J. sabinoid~s and J. virginiana desclibed above.
These reactions were designated JS42 for J. sabinoides and JV46 for J.
irgini~na. Both secondary PCRs gave bands of approximately 6~10 base pairs hen examined on 1% agarose minigels stained with EtBr. The DNA from the 2s JS42 and JV46 PCRs was recovered as described in Example 3, simultaneouslydi~ested with Xba l and Pst I in 15 ,ul reactions then electrophoresed throuoh apr~parative 2% GTG SeaPlaque low melt ~el tFMC Rockport. ME). The appropriate sized DNA bands were visualized by EtBr staining. excised. and ligated into appropriately digested pUCI9 for sequencing by the dideoxy chain t~rmination method (Sanger et al., ~) usin~ a commercially available sequencing kit (Sequenase l;it. U.S. Biochemicals. Cleveland. OH) Clones were s~quenced using M13 forward and reverse primers (N.E. Biolabs. Beverly. MA) t Wo 94/01~6~ PCr/US93/00139 2~2U95'~
and internal sequencing primer J4 for both Jun s I and Jun v I. J4 has the sequence 5'-GCTC(: ACCATGGGAGGCA-3' (nucleotides 177-194 of Fig. 16 and nucleotides 187-204 of Fig. 17), which is the coding strand sequence that essentially encodes amino acids SerSerThrMetGlyGly (amino acids 30 through 35 of Jun s I and Jun v I as shown in Figs. 16 and 17, respectively).
The sequence of the J~n s I clone designated pUC19JS42e was found to be identical to that of clones pUC19JS17d and pUC19JS17f in their regions of overlap, although they had different lengths in ~he 5' untranslated region. Clone pUC19JS17d had the longest 5' untranslated sequence. Nucleotides 1 through 141 of Fig. 16correspondtosequenceofclonepUC19JS17d. Clone pUC19JS42e corresponds to nucleotides 1 through 538 of Fig. 16.
The sequences of the Jun v I clones designa~ed pUC19JV46a and pUC19JV46b were identical to the sequence of clone pUC19JV21g in their regions of overlap, with the exception that nucleotide 83 of Figure 17 was A in clone pUC19JV21~ rather than the T shown. This nucleotide difference does not result in a predicted amino acid change. Clones pUC19JV46a, pUC19JV46b and pUC19JV21g correspond to nucleotides 1 throu~h 548. 1 through 548 and 2 through 151 of Figure 17, respectively.
The cDNAs encoding the remainder of the Jun s I and Jur1 l~ I genes were cloned from the respective linkered cDNAs by using degenerate oligonucleotide CP-66. which has the sequence 5'-CATCCGCAAGATGGGGATGC-3'~ wherein T at position 3 can also be C. G at- position 6 can also be A, T, or C, A at position 9 can also be G. T at position 12 can also be C. and T at position 18 can also be C. and AP in a primary PCR. The sequence of CP-66 is complementary 2s ~o that of CP-63. A secondary PCR was perforrned on 3~G of the initial arnplification mixture, with 100 pmoles each of AP and CP-67. which has the sequence 5'-CGGGAAl~CCCTCAAGAl'GGGGATGCGCT-3'. wherein A at position 15 can also be G, T at position 18 can also be C. T at position 24 can also be C. G ~at position 27 can also be A, T. or C, and C at position 28 can be T.
The nucleotide sequence 5'-CGGGAATTC-3' ot` primer CP-67 (bases I throu~h 9) were added to create an EcoR I restriction site t'or cloning pulposes. The - remaining oligonucleotide sequence essentially encodes amino acids ~, 6~

WO 94/01560 2 1 2 0 9 S 1 PCr/US93/00139 ProGlnAspGlyAspAlaLeu (amino acids 147 through 153 of Figure 4a, corresponding to nucleotides 567 throu~h 5~ of Fi~ure 4a). The amplified DNA products~ designated JS45 from the J. sabi~loides amplification and JV49ii from the J. virginiana amplification, were purified as described in Example 3, digested with EcoR I and Xba I (JS45) or EcoR I and Asp7 18 I (JV49ii) and electrophoresed through a preparative 1% IQW melt gel. The dominant DNA
bands, which were approximately 650 bp in length, were excised and ligated into pUC19 for sequencing. DNA was sequenced by the dideoxy chain terrnination method (Sanger et al. ~upra) using a commercially available kit ~sequenase kit.
U.S. ~iochemicals, Cleveland, OH).
Two clones, designated pUC19JS45a and pUC19JV49iia for Jun s I and Jl~n v I. respectively. were sequenced using M13 forward and reverse primers (N.E. BioLabs, Beverly, MA) and internal sequencing primers J8, J9, and J12 for Jlln s I. and J6 and J 11 for Jlm v I . J8 has the sequence 5'- , TAGGACATGATGATACAT-3' (nucleotides 690-707 of Fig. 16), which is the coding st~and sequence essentially encoding arnino acids LeuGlyHisAspAspThr o~` Jun s I (amino acids 201-206 of Fig. 16). J9 has the sequence 5'-GAGATCTACACGAGATGC-3' (nucleotides 976-993 of Fig. 16) which is the coding strand sequence essentially encoding amino acids Ar~SerThrArgAspAla of Jlm s I (amino acids 297-302 of Fig. 16). J12 has the sequence 5'-AAAACTATTCCCTTCACT-3', wherein A at position 1 can also be G~ and A at position 4 can also be T: This is the non-coding strand sequence that corresponds to coding strand sequence (nucleotides 875-892 of Fig. 16) encodin~
arnino acids SerGluGlyAsnSerPhe of Jun s I (amino acids 263-268 of Fig. 16).
J~; has the sequence 5'-l`AG(iACATAGTGATTCAT-3' (nucleotides 700-717 of Fig. 17), which is the coding strand sequence essentially encoding amino acids LeuGlyHisSerAspSer of Jun v I ~amino acids 201-206 of Fi~.17). Jl l has the sequence 5'-CCGGGATCCTTACAAATAACACA ITAT-3'. where nucleotides 1-~ encode a BamH 1 restriction site for cloning purposes and nucletides 1(~-27 correspond to noncoding strand sequence complemental~ to nucleotides 1165-1182 of Fig. 17 in the 3' untranslated region of J~J7 v I. The sequence of clonep~ C19JS45a corresponds to nucleotides 527 throuoh 117() of Fig. 16. The `~

WO 94/01560 P~/US93/00139 '' 2~,209~
sequence of clone pUC29JV49iia corresponds to nucleotides 537 through 1278 of Fig. 17.
Afull len~th clone of Jun s I was ampli~led usinC~ PCR. Oligonucleotides J7 and J10 were used in a PCR reaction as above with J. sabinoid~s double stranded, linkered cDNA. 17 has the sequence S'-CCCGAA~CATGGCrrCC-CCATGCTrA-3', where nucleotides 1-9 encode an &oR I restriction site added for cloning purposes and nucleotides 10-27 (correspondin~ to nucleotides 26-43 of Fig. 16) are the coding strand sequence that encode arnino acids MetAlaSerProCysLeu of Jl(n S I (amino acids -21 to - 16, Fig. 16). ~ 10 has the 0 sequence 5~-ccGGGATcccGlTrcATAAGcAAGArr-3~ where nucleotides 1-9 encode a BamH I restriction site dded for cloning purposes and nucleotides 10-27 are the non-codinc~ strand sequence complementary to nucleotides 1140-1157 from the 3' untranslated re~ion of JIIJ7 S I (Fi~. 16). The PCR product.
designated JS53ii. gave a band of approximately 1200 bp when examined on a 1% aga~rose minigel stained with EtBr. The DNA from the JS53ii PCR was Rcovered as described in Example 3. After precipitation and washing with 70q~
-~ EtOH, the DNA was simultaneously dioested with EcoR I and BamH I in a 15 ~11 reaction ~and electrophoresed through a preparative 1% GTG SeaPlaque low melt gel (FMC. Rockport. ME). The appropriate sized DNA band was vlsualized by ~- 20 EtBr staining. excised. and ligated into appropriately digested pUCl9 for s~quencing by the dideoxy chain termination method (Sanger et al. (1977) ~!
using ~a ~commercially available sequencing kit (Sequenase kit. U.S. q~
Biochemicals. Cleveland. OH). The resultant clone. pUC19JS53iib was partiall~
sequenced using~MI3 forward and reverse primers (N.E. Biolabs Beverly~ MA) 2~ and internal sequencing primer J4. The sequence of pUC19JS53iib that ~as - ~ determincd was identical to that obtained from clones pUC19JS17d~
pUC~19JS42e.and~pUC19JS45a. Thenucleotidesequenceofclone p~rC19JS53iib corresponds to nucleotides 26 through 1157 of Ficn 16.
The nucleotide and predicted amino acid sequences of Jut1 s I are shown in Ficn 16. Jun s I has an open reading *ame c)f 11()1 nucleotides~ correspondin~
~ - to nucleotides 26 throu~h 1126 of Fig. 16~ that can encode a protein of 367 ~;
- ~ arnino acids. Nucleotides 1-25 and 1130-117n of Fio. 16 are untranslated S' and , ~

, WO 94/01560 '- 21 2 0 9 ï ~ PCI`/US93/00~39

3' regions, respectively. The initiatin~ Met, encoded by nucleotides 26-28 of Fig. 16~ has been identified through the 89% identity of nucleotides 23 throu~h 30 (AAAAATGGC) of Fig. 16 with the consensus sequence encompassin~ the initiating Met in plants ~AACAATGGC; Lutcke, supra). There is also an in-frame stop codon just 5' of the codon encodin~ the initiatin~ Met. Amino acids -21 to -1 of Fi~. 16 correspond to a predicted leader sequence. The amino terminus of the mature form of Jun s I was identified as amino acid 1 of Fi~. 16through direct protein sequence analysis of purified Ju11 s I (Gross et al supra).
The mature fonn of Jun s I. corresponding to amino acids 1 throu; h 346 of Fig.
16. has a predicted molecular weight of 37.7 kDa. Jun s I has three potential N-linked glycosylation sites with the consensus sequence of Asn-Xxx-Ser/Thr.
The nucleic and predicted amino acid sequences of Jun v I are shown in Fig. 17. Nucleotides 1-35and 1130-1170areuntranslatedS'and3'regions.
respectively. The initiatin~ Met, encoded by nucleotides 36-38 of Fi~. 17~ was identified throu~h the 89% identity of nucleotides 23 through 30 (AAAAATGGC) of Fig. 17 with the consensus sequence encompassing the initiatin~ Met in plants (AACAATGGC: Lutcke, supra). The nucleic acids of Jlm s I (Fig~. 16) and Jlm v I (Fig. 17) are identical in this re~ion surrounding the initiating Met. There are also 2 in-frame stop codons in the 5' untranslated region of Fig. 17. Jun v I has an open readin~ frame of 1.110 nucleotides.
corresponding to nucleotides 36 through 1145 of Fig 17, that can encode a protein of 370 amino acids. Nucleotides 1146-1148 of Fi~. 17 encode a StOp codon. Amino acids -21 to -1 of Jun v I (Fig. 17) correspond to a predicted leader sequence. The amino terminus of the mature form of Jlm v I was identified as amino acid 1 of Fi; . 17 by comparison with the sequences of C~
(Fio. 4a) and Jun s I ~Fig. 16). The mature forrn of Jun v I, correspondin~ to amino acids 1 through 349 of Fig. 17 has a predicted molecular wei~ht of 3~.() ~Da. Jl/n v I has four potential N-linked glycosylation sites with the consensussequence of Asn-Xxx-Ser/Thr.
As shown in Table I. the amino acid sequences of the mature forms of Ju~7 s I and Jun v I are 8().9~ homolo~ous t75.4~ identity and 5.5~ similarity) with each other. The amino acid sequences ot the mature forms of Jun s I and 7~ 3 WO 94/01~60 PCr/US93/00139 21~095~ `
-Gyj I are 87% homologous (80.1% identity. 6.9% similarity) and the sequences of the mature fonTls of Jl~n v I and ~j I are 80.5% homolo~ous (72.5%
identity, 8% similarity). The homologies between Cn~; I peptide sequences identified in Example 6 as containing T cell epitopes and the colTespondin~ Jun s s I and Jun v I sequences are also very hi~h. For example, peptide CJ 1-22.
corresponding to amino acids 21 1-230 of Cr~ j I (Fig. 13), contains a major T
cell epitope ~Fig. 14). CJ1-22 has 95~o identity (19/20 identical amino acids) and 85~ homolo~y (16/20 identical amino acids, 1/20 similar amino acid) with the corresponding regions of Jun s I and Jun v I. respectively (see Table I). This high degree of sequence homology suggests that an immunotherapy effective in treating aller~ic disease caused by Cr~ j I may also be effective in treatin~
aller~ic diseases caused by Cr~ j I homolo~ues. All nucleic and amino acid analyses were perforrned using software contained in PCGENE (lntelligenetics.
Mountain View, CA).
Table I
ProteinlPeptide Total Comparisons Identity Similaritv Hnmol(~v Jun s I vs. Jun v I 75.4% 5.5% 80.9%
J~nsIvs. CryjI 80.1% 6.9% 87.9~
Jl~n v I vs. Cryj I 72.5% 8.0% 80.5~7c CJl-22vs.JunsI ~ 30 95.0~ O.Oqo 95.
CJ1-22 vs. Jun v I,ll 230 80.0% 5.0% 85.0 O

Example 10 ~orthern blot analysis of C. japonica, J. sabinoides, J. virginiana and C. arizon&a RNA.
!
.~ Northern blot analysis was performed on RNA isolated flom C. jclponicu. J.
sal~inoid~s and J. virginiarla pollens. RNA frt)m C. japonica pollens colleeted in both the l;nited States tExample 3) and Japan (Example 4) were examined.

WO 94/~1560 2 1 2 0 9 ~ ~ Pcr/US93/00l39 Using essentially the method of Sambrook, supra, 15 llg of each RNA were run on a 1.2% agarose gel containing 38~o formaldehyde and lX MOPS (20X =
0.4M MOPS, 0.02M EDTA, 0. lM NaOAc. pH 7.0~ solution. The RNA samples (first precipitated with 1/10 volume sodium acetate~ 2 volumes ethanol to reducevolume and resuspended in 5.5 ~11 dH20) were run with 10 1l1 formaldehyde/formamide buffer containing loading dyes with 15.5%
t`ormaldehyde. 42% formamide, and 1.3X MOPS solution~ final concentration.
The samples were transferred to Genescreen Plus (NEN Research Products, Boston, MA) by capillary transfer in 10X SSC (20X = 3M NaCI, 0.3M Sodium Citrate)~ after which the membrane was baked 2 hr. at 80C and UV irradiated for 3 minutes. Prehybridization of the membrane was at 60C for I hour in 4 ml 0.5M NaPO4 (pH 7.2), lmM EDTA, 1% BSA. and 7% SDS. The antisense probe was synthesized by asymmetric PCR (McCabe, P.C.. in: PCR Protocols.
A Guide to Methods and Applications, Innis. M.. et al., eds. Academic Press~
Boston, (1990), pp 76-83) on the JC9la amplification in low melt agarose (described in Example 3), where 2 ,ul DNA is amplified with 2 111 dNTP mix (0.167 mM dATP, 0.167mM dl~P, 0.167mM dGTP, and 0.033mM dCTP). 2 1ll 10X PCR buffer, 10 ~ul 32P-dCTP (100 IlCi; Amersham, Arlington Hei~hts, Il)~ -1 111(100 pmoles) antisense primer CP-17, 0.5 ,ul Taq polymerase, and dH2O to ''0 ,ul; the 10X PCR buffer, dNTPs and Taq polymerase were from Perkin Elmer Cetus (Norwalk, CT). Amplification consisted of 30 rounds of denaturation at 94C for 45 sec, annealing of primer to the template at 60C for 45 sec. and chain elongation at 72C for 1 min. The reaction was stopped by addition of I()~) 1 TE, and the probe recovered over a 3cc G-50 spin column (2 ml G-50 Sephadex [Pharmacia, Uppsala, Sweden] in a 3cc syrin~e plugged with glass wool. equilibrated with TE) and counted on a 1500 TriCarb Liquid Scintillation Counter (Packard, Downers Grove, L). The probe was added to the prehybridizin~ buffer at 10~ cpm/ml and hybridization was canied out at 6()C
~; r 16 hrs. The blot was washed in high stringency conditions: 3x15 min at 65C with 0.2xSSCtl~ SDS, followed by wl~ppin~ in plastic wr~p ~nd .cposure to film at -80C. A seven hour exposure of this Nolthem blot reveale~
single thick band at approximately 1.2 kb for C. japc nica (United States) (Fi~

WO 94/OlS60 PCr/US93/00139 2~2~9~
19a. lane 1), C. japonica (Japan) ~Fi~. 19a, lane 2), J. sa~inoides (Fi8. 19a. Iane 3) and ~. Yirginiana (Fig.- l9a, lane 4) RNAs. This band is the expected size for Cry j 1. Jun s I and Jlln v I as predicted by PCR analysis of the cDNA. The different band intensities in each lane may reflect differences in the amount ofS RNA loaded on the gel. The position ot 1.6 and 1.0 kb molecular weight standards are shown on the Fi~s. I9a and l9b.
RNA isolated from ~1. sabinoides and C. ari~onica were analyzed in a separate Northern blot. Five ,ug of total RNA from 3. sabinoides and 5 ~ of total RNA from C. arizonica were probed as described. The 1.2 kb band was observed in this blot for both J. sabinoides (Fi~ure l9b, lane 1) and C. ari70nica (Figure l9b~ lane 2), indicating that C. ari~onica has a C~y j I homolo~ue.
Other, related, trees are also expected to have a C~y j I homologue.
Although this invention has been described with reference to its preferred embodiments, other embodiments can achieve the s~ne results. Variations and .
modifications to the present invention will be obvious to those skilled in the art and it is intended to cover in the appended claims all such modifications and equlvalents that follow in the true spirit and scope of the invention.

WO 94~01~60 2 1 2 0 9 ~ ~ PCr/US93/00139 SEQUENCE LISTING

(1) GENERAL INFORMATION:
(i) APPLICANT: Grif~lth. lrwin J.
Pollock, Joanne. Bond Julian (ii) TITLE OF INVENTION: Allergenic Proteins And Peptides From Japanese Cedar Pollen (iii) NUMBER OF SEQUENCES: 25 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: ImmuLogic Pharmaceutical Corporation - ~B) STREET: 610 Lincoln Street (C) CITY: Waltham (D) STATE: MA
(E) COUNTRY: USA
~o (F) ZIP: 02154 (v~ COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERAllNG SYSTEM: PC-DOStMS-DOS
(D) SOFTWARE: PatentIn Release #l.0, Version #1.25 ~i) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
: (C) CLASSIFICATION:
iii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Stacey L. Channin~
: 35 (B) REGISTRATION NUMBER: 31.095 (C) REFERENCE/DOCKET NUMBER: IPC~ 5CCC PCT
) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (617) 466-fi()0() (B) TELEFAX: ~617) 466-604() 7~

WO 94/01560 PCr/US93/00139 21209~ `

(2) INFORMATION FOR SEQ ID NO~
(i) SEQUENCE CHARACTERISTICS:
S (A) LENGTH: 1337 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA to mRNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Crytpomeria japonica (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 66..1187 .
(ix) FEATURE:
(A) NAME/KEY: mat_peptide : (B) LOCATION: 129..1187 (xi~ SEQUENCE DESCRIPTION: SEQ ID NO:l:
.GTCAATCTG CTCATAATCA TAGCATAGCC GTATAG~iAG AAATTCTACA CTCTGCTACC 6 0 .``~iA ATG GAT TCC CCT TGC TTA GTA GCA TT.. CTG GTT TTC TCT TTT 107 ~- ~ Met Asp Ser Pro Cys Leu Val Ala Leu Leu Val Phe Ser Phe -2 1 -20~ -15 -10 GT.`. ,.TT GGA TCT TGC m TCT GAT AAT CCC ATA GAC AGC TGC TGG AGA 15 5 - Val Ile Gly Ser Cys Phe Ser Asp Asn Pro Ile Asp Ser Cys Trp Arg ~ ~ ~
- C-^-.-. GAC TCA AAC TG G GCC CAA AAT AGA ATG .'- ~G CTC GCA GAT TGT GCA 2 0 3 G:. Asp Ser Asn Trp Ala Gln Asn Arg Met Lys Leu Ala Asp Cys .3,la lS 20 25 40: ~ C, GGC TTC GGA AGC TCC ACC ATG GGA GGC .'- `.G GGA GGA GAT CTT TAT 2 5 1 2' Gly Phe Gly Ser Ser Thr Met Gly Gly L ~s Gly Gly Asp Leu Tyr - ~ `._ - GTC ACG AAC TCA ,GAT GAC GAC CCT GTG .`- `.T CCT GCA CCA GGA P,CT 2 ~ c

4~ ~.r Val Thr Asn Ser Asp Asp Asp Pro Val .isn Pro Ala Pro Gly Thr ..
CG' TAT GGA GCA ACC CGA GAT AGG CCC _TG TGG ATA ATT TTC AGT 3 4, .3.rg Tyr Gly Ala Thr Arg Asp Arg Pro Leu Trp Ile Ile Phe Ser ::
, . ~
"', ~

~ ~ 76 WO 94/01560 2 1 2 0 9 5 ~ PCI/US93/00139 Gly Asn Met Asn Ile Lys Leu Lys Mee Pro Met Tyr Ile Ala Gly q~r

5 75 80 85 Lys Thr Phe Asp Gly Arg Gly Ala Gln Val Tyr Ile Gly Asn Gly Gly 90 95 100 105 `'' Pro Cys Val Phe Ile Lys Arg Val Ser Asn Val Ile Ile His Gly Leu r Leu Tyr Gly Cys Ser Thr Ser Val Leu Gly Asn Val Leu Ile Asn Glu Ser Phe Gly Val Glu Pro Val His Pro Gln Asp Gly Asp Ala Leu Thr Leu Arg Thr Ala Thr Asn Ile Trp Ile Asp His Asn Ser Phe Ser T TCT TCT GAT GGT CTG GTC GAT GTC ACT CTT ACT TCG ACT GGA GTT o 8 3 sn Ser Ser Asp Gly Leu Val Asp Val Thr Leu Thr Ser Thr Gly Val 170 ~ 175 180 185 CT ATT TCA~AAC AAT CTT TTT TTC AAC CAT CAT AAA GTG ATG TTG TTA ~81 ;Thr~Ile~ Ser~Asn~Asn Leu Phe Phe Asn His His Lys Val Met Leu Leu 35~ GGG~CAT GAT GAT GCA TAT AGT GAT GAC AAA TCC ATG AAG GTG ACA GTG 779 Gly His Asp Asp Ala Tyr Ser Asp Asp Lys Ser Met Lys Val Thr Val .'.la Phe Asn Gln Phe Gly Pro Asn Cys Gly Gln Arg Met Pro Arg Ala ;CG.~ TAT GG~ CTT GTA CAT GTT GCA AAC AAT AAT TAT GAC CCA TGG ACT 8~5 A-~Tyr~Gly Leu Val His Val Ala Asn Asn ~sn Tyr Asp Pro Trp Thr ~235~ 240 ~ 2g5 '`. TAT GCA~ATT GGT GGG AGT TCA A~T CCA .. CC ATT CTA AGT G.'A GGG 92 l8 Tvr Ala Ile Gly GIy Ser Ser Asn Pro Thr Ile Leu Ser Glu Gly .:'.T AGT TTC ACT GCA CCA AAT GAG AGC TAC .~G AAG CAA GTA ACC AT.; ^,1 ;i `.'.sn Ser Phe Thr Ala Pro Asn Glu Ser Tfr Lj~s Lys Gln Val Thr Ile ~55_GT .3.TT GGA TGC AAA ACA TCA TCA TCT TGT T^A A~T TGG GTG TG~ CA~ 1~19 Ile Gly Cys Lys Thr Ser Ser Ser C~s Ser Asn Trp Val Trp Gln . . , :~ ~

~ ~ 77 :: ~

WO 94/01560 PCr/US93/00139 ~20954 Ser Thr Gln Asp Val Phe Tyr Asn Gly Ala Tyr Phe Val Ser ser Gly 300 305 310 , A~A TAT GAA GGG GGT AAT ATA TAC ACA AAG A~A GAA GCT TTC AAT GTT 1115 Lys Tyr Glu Gly Gly Asn Ile Tyr Thr Lys Lys Glu Ala Phe Asn Val GAG AAT GGG AAT GCA ACT CCT CAA TTG ACA ~A AAT GCT GGG GTT TTA 1163 Glu Asn Gly Asn Ala Thr Pro Gln Leu Thr Lys Asn Ala Gly Val Leu ; 330 335 340 345 Thr Cys Ser Leu SeS0r Lys Arg Cys TATCTAA~TT AACATCAACA AGAAAATATA TCATGATGTA TATTGTTGTA TTGATGTCAA 1277 .3TAAAAATG TATCTTTTAC TATTAAAAAA .~AAAATGATC GATCGGACGG TACCTCTAGA 1337 - 20 ~ ~ ~

2~ INFORMATION FOR SEQ ID NO:2:
25 ~ SEQUENCE CHARACTERISTICS:
- ~A) LENGTH-: 374 amino acids (B~ TYPE: amino acid D) TOPOLOGY: linear 30~ MOLECULE TYPE: protein (xi) SEQUENCE~DESCRIPTION: SEQ ID NO:2:
Asp Ser Pro~Cys Leu Yai Ala Leu Leu Val Phe Ser Phe Val Ile G!. Ser~Cys Phe Ser Asp~Asn Pro Ile Asp Ser Cys Trp Arg Gly Asp 40~ S-- Asn Trp~Ala Gln Asn Arg Met Lys Leu Ala Asp Cys Ala Val Gly 5~ 20 25 P.~.e Gly~Ser~5er Thr Met Gly Gly Lys Gly Gly Asp Leu Tyr Thr Val 30~ ~ 35 40 sn S~er Asp Asp Asp Pro Val Asn Pro .`.la Pro Gly Thr Leu Arg 45~ 50 55 Gly ~3.1a~Thr~Arg Asp Arg Pro Leu Trp Ile Ile Phe Ser Glv .~sn -:~ 65 70 /5 - M- .isn Ile Lys Leu Lys Met Pro Met Tyr Ile Ala Gly Tyr Lys Thr 55~ ~~-.- .3Sp Gly Arg Gly Ala Gln ~al T~r Ile Gly ~sn Gly Gly Pro Cys gs lOO lO5 !~`;
~ Phe Ile Lys Arg Val Ser Asn Val Ile Ile His Gly Leu Tyr Leu :. :
.
~ ~ 7~;

~': ': , -:

;~
WO94/01560 212 0 ~ 5 ~ PCT/US93/00139 Tyr Gly Cys Ser Thr Ser Val Leu Gly Asn Val Leu Ile Asn Glu Ser Phe Gly Val Glu Pro Val His Pro Gln Asp Gly Asp Ala Leu Thr Leu Arg Thr Ala Thr Asn Ile Trp Ile Asp His Asn Ser Phe Ser Asn Ser 0160 ` 165 170 ::
:~ ~ Ser Asp Gly Leu Val Asp Val Thr Leu Thr Ser Thr Gly Val Thr Ile ~: 175 180 185 15Ser Asn Asn Leu Phe Phe Asn His His Lys Val Met Leu Leu Gly His : ~ 190 195 200 Asp Asp Ala Tyr Ser Asp Asp Lys Ser Met Lys Val Thr Val Ala Phe `~ : 205 210 215 ~: Asn Gln Phe Gly Pro Asn Cys Gly Gln Arg Met Pro Arg Ala Arg Tyr ` 22a ~ : 225 230 235 ~; Gly Leu Val His Val Ala Asn Asn Asn Tyr Asp Pro Trp Thr Ile Tyr 25`240 245 250 3.1a Ile Gly Gly Ser Ser Asn Pro Thr Ile Leu Ser Glu Gly Asn Ser 255 260 : 265 30 ~Phe Thr Ala Pro Asn Glu Ser Tyr Lys Lys Gln Val Thr Ile Arg Ile 270~ 275 280 Glv ;~ys Lys Thr Ser Ser Ser Cys Ser Asn Trp Val Trp Gln Ser Thr G_r ~sp~ V~l Phe ~Yr Asn Gly Ala Tyr Phe Val Ser Ser Gly Lys Tyr 30`~ 305 310 315 G' ~ ly Gly Asn Ile- Tyr Thr Lys Lvs Glu Ala Phe Asn Val Glu Asn 20~ ~ ' 325: 330 ~` `
: G~ ..sn Ala Thr Pro Gln Leu Thr Lys Asn:Ala Gly Val Leu Thr Cys ;335. 340 345 ~ _r _eu~Ser Lys Arg Cys:

! ` INFO~MATION ~VOR SEQ ID NO:3:
~50 :(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs ::(B) TYPE: nucleic acid C) STRANDEDNESS: single (D) TOPOLOGY: linear , :: ~
~ 7~
.
.
- :-~ ::

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
GAYAAYCCNA THGAYWS

(2) INFORMATION FOR SEQ ID NO:4: :
(i) SEQUENCE CHARACTERISTICS: ~`
: l0 (A) LENGTH: 25 base pairs -(B) TYPE: nucleic acid : (C) STRANDEDNESS: single (D) TOPOLOGY: linear ~ -l:5 xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
~ GGG.~ATTCAA~YTGGGCNCAR~AAYSG
-~ 20 25 :
: - (2) INFORMATION FOR SEQ ID NO:5:
SEQUENCE CHARACTERISTICS:
25~ (A) LENGTH: 23 base pairs (3) TYPE: nucleic acid (C)~STRANDEDNESS: single :D~TOPOLOGY: linear (ix:)~:FEATURE:
(A) NAME/KEY: modified_base (:B) LOCATION::: 15 D)~-OTHER~:INFORMATION: /mod_base= i `-~

(Xl~ SEQUENCE DESCRIPTION: SEQ ID NO:5:
-GCAGCCRT~TYTCNACRTT RAA

: ') INFORMATION FOR~SEQ ID NO:6:
: ::
SEQUENCE CHARACTERISTICS:
.: 4~ :~ (A) LENGTH: 20 base pairs : (B) TYPE: ~ucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ;" 80 ...,.., :~ ~

WO94/01560 2 1 2 0 9 .~ ,~ PCT/US93/00139 (ix) FEA~TURE:
(A) NAME/KEY: modified_base (B) LOCATION: 6 (D) OTHER INFORMATION: /mod_base= i .
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
TTCATNCKRT TYTGNGCCCA

~) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single ~ ~D) TOPOLOGY: linear (Xl) SEQUENCE DESCRIPTION: SEQ ID NO:7:
CCTGCAGCKR TTYTGNGCCC AARTT
2~
(~) INFQR~TION FOR SEQ ID NO:8:
~i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
~ GATTCCC CTTGCTTA

(^ INFORMATION FOR SEQ ID NO:9: '.
( i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 base ir~
`(B) TYPE: nucleic ac (C) STRANDEDNESS: si~A~,le (D) TOPOLOGY: linear Xl ~ .
WO94/01560 PCT/US93/~013~
21~l~95~

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

GGGAATTCGA TAATCCCATA GACAGC

(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs ~B) TYPE: nucleic acid --(C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
ATGCCTATGT ACATTGC

(2~ INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single ~D) TOPOLOGY: linear .
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:
C~ TGTACA TAGGCAT
_, . ~

'_! INFORMATION FOR SEQ ID NO:12:
( ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ~.~

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:

~' ~ 3~
W~94/~1560 P~T/US93/00139 TCCAATTCTT CTGATGGT

(2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS.
tA) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
TTTTC-TCAAT TGAGGAGT

(2) INFORMATION FOR SEQ ID NO:14:
.
(i) SEQUENCE C~ARACTERISTICS:
(A) LENGTH: 30 base ~ rs : (B) TYPE: nucleic aci (C) STRANDEDNESS: singLe (D) TOPOLOGY: linear .

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
CCTGCAGAAG CTTCATCAAC AACGTTTAGA

~ 35 (2) INFORMATION FOR SEQ ID NO:15:
: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ~ Xl ) SEQUENCE DESCRIPTION: SEQ ID NO:15:
T-.^-CP~CTCC AGTCGAAGT
1 . , ' (2) INFORMATION FOR SEQ ID NO:16:
- (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs (Ei) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
TAGCTCTCAT TTGGTGC

(2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:
TGCAATTG GTGGGAGT
1 ~i - ~ 30 ) INFORMATION FOR SEQ ID NO:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 amino acids (B) TYPE: amino acid ~; (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: N-terminal (vi) ORIGINAL SOURCE:
(A) ORGANISM: Cryptomeria japonica (i~) FEATURE:
(A~ NAME/KEY: Modified-site (B) LOCATION: 7 (D) OTHER INFOR~TION: inote= l~the amino acid a.
~-sltion WO94/01560 ~ PCT/US93/00139 7 is Ser, Cys, Thr, or His~

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:
Asp Asn Pro Ile Asp Ser Xaa Trp Arg Gly Asp Ser Asn Trp Ala Gln l 5 l0 Asn Arg Met Lys (2) INFORMATION FOR SEQ ID NO:l9:
~i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 16 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal 25 (vi) ORIGINAL SOURCE:
(A) ORGANISM: Cryptomeria japonica (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l9:
- :Glu Ala Phe Asn Val Glu Asn Gly Asn Ala Thr Pro Gln Leu Thr Lys l 5 l0 (2) INFORMATION FOR SEQ ID NO:20:
- (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20: .
GGC-TCTAGAG GTACCGTCCG ATCGATCATT

: .
2120~

(2) INFORMATION FOR SEQ ID NO:21:
(i) SEQUENCE CHAR-ACTERISTICS:
~A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:
GGGTCTAGAG GTACCGTCCG

(2) INFORMATION FOR SEQ ID NO:22:
(i) SEQUENCE CHARACTERISTICS:
tA) LENGTH: 13 base pairs -(B) TYPE: nucleic acid (C) STRANDEDNESS. single (D) TOPOLOGY: linear 2~

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:
30 ~TGATCGAT GCT

(~) _NFORMATION ~OR SEQ ID NO:23:
( i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ~xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:
45 GG:-.TTCTCT AGACTGCAGG T
2: .
(~. _NFORMATION FOR SEQ ID NO:24:

WO94/01560 2 1 2 0 ~ ~ 4 PCT/US93/00139 ti) SEQUENCE CHARACTERISTICS:- j ~A) LENGTH. 35 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:

(2) INFORMATION FOR SEQ ID NO:25:
li) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 5 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: N-terminal - (vi) ORIGINAL SOURCE:
(A) ORGANISM: Juniperus sabinoides (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:
Asp Asn Pro Ile Asp l 5 ~7

Claims (25)

Claims

1. An isolated peptide of Cry j I or an isolated portion thereof, said peptide or portion thereof comprising at least one T cell epitope of Cry j I, said peptide having an amino acid sequence selected from the group consisting of and .

2. An isolated peptide or portion thereof of claim 1 wherein said portion of said peptide has a mean T cell stimulation index equivalent to or greater than the mean T cell stimulation index of said peptide as shown in Fig. 14.

3. An isolated peptide or portion thereof of claim 1 which comprises at least two T cell epitopes.

4. An isolated peptide or portion thereof of claim 1 which, when administered to an individual sensitive to Japanese cedar pollen. induces T
cell anergy in the individual or modifies the lymphokine secretion profile of T cells in the individual.

5. A portion of an isolated peptide of claim 1 which has a mean T
cell stimulation index of at least 2Ø

6. All or a portion of an isolated peptide of claim 1 which does not bind immunoglobulin E specific for Cry j I in a substantial percentage of individuals sensitive to Cry j I, or if binding of the peptide or portion thereof to said immunoglobulin E occurs, such binding does not result in release of mediators from mast cells or basophils in a substantial percentage of individuals sensitive to Cry j I.

7. An isolated peptide of claim 1 which binds immunoglobulin E to a substantially lesser extent than Cry j I binds immunoglobulin E.

8. All or a portion of an isolated peptide of claim 1 which modifies in an individual sensitive to Japanese cedar pollen to whom it is administered, the allergic response of the individual to a Japanese cedar pollen.

9. A portion of an isolated peptide of claim 1 wherein the portion comprises at least 15 amino acid residues.

10. An isolated nucleic acid sequence having a sequence encoding all or a portion of a peptide of claim 1, or the functional equivalent of said nucleic acid sequence.

11. An isolated peptide which is immunologically cross-reactive with antibodies specific for all or a portion of a peptide of claim 1.

12. An isolated peptide which is immunologically cross-reactive with T cells reactive with all or a portion of a peptide of claim 1.

13. An isolated peptide or portion thereof of Japanese cedar pollen protein allergen Cry j I, said peptide or portion thereof comprising at least one T cell epitope of said protein allergen. said peptide having a positivity index of at least about 100 and mean T cell stimulation index of at least about 3.5 determined in a population of individuals sensitive to said protein allergen.

11. An isolated peptide or portion thereof of claim 13 wherein said population of individuals is at least twenty-five individuals.

15. An isolated peptide or portion thereof of claim 14 wherein said population of individuals is at least thirty individuals.

16. An isolated peptide or portion thereof of claim 14 wherein said mean T cell stimulation index is at least about 5Ø

17. An isolated peptide or portion thereof of claim 14 wherein said mean T cell stimulation index is at least about 7Ø

18. A peptide or portion thereof of claim 14 wherein said peptide is selected from the group consisting of: and .

19. A peptide or portion thereof of claim 17 wherein said peptide has an amino acid sequence selected from the group consisting of: and .

20. A modified peptide or a modified portion of a peptide of claim 1.

21. A modified peptide or a modified portion of a peptide of claim 20 which does not bind immunoglobulin E specific for Cry j I in a substantial percentage of individuals sensitive to Cry j I, or if binding of thepeptide or portion thereof to said immunoglobulin E occurs, such binding does not result in release of mediators from mast cells or basophils in a substantial percentage of individuals sensitive to Cry j I.

22. A modified peptide or a modified portion of a peptide of claim 20 which modifies, in an individual sensitive to Japanese cedar pollen to whom it is administered, the allergic response of the individual to a Japanese cedar pollen allergen.

23. An isolated peptide of Cry j I or portion thereof comprising amino acids 151-352 of the amino acid sequence of Cry j I as shown in Fig.
4a - b.

24. A modified peptide or a modified portion of a peptide of claim 23.

25. An isolated peptide comprising at least two regions, each region comprising at least one T cell epitope of Cry j I, said regions each comprising all or a portion of an amino acid sequence selected from the group consisting of: and .

26. All or a portion of an isolated peptide of claim 25 wherein said regions comprise an amino acid sequence selected from the group consisting of: .

27. An isolated peptide of claim 25. wherein said peptide comprises a combination of regions selected from the group consisting of:

;
and ;

and ;
and ;
and ;
and ;
and ;
and ;
and ;
and ;
and ;
and ;
and and ;
and ;
and ;
and ;
and ;
and 28. An isolated nucleic acid having a sequence encoding said isolated peptide or portion thereof of claim 1 or the functional equivalent of said nucleic acid sequence.

29. An isolated peptide produced in a host cell transformed with the nucleic acid of claim 28.

30. An isolated nucleic acid having a sequence encoding a peptide of

claim 25. or the functional equivalent of said nucleic acid sequence.
31. An isolated peptide produced in a host cell transformed with the nucleic acid of claim 30.

32. All or a portion of an isolated peptide of Cry j I, said peptide or portion thereof comprising at least one T cell epitope of said protein allergen. said peptide having the formula Xn-Y-Zm. wherein Y is an amino acid sequence selected from the group consisting of: and wherein Xn are amino acid residues contiguous to the amino terminus of Y in the amino acid sequence of said protein allergen, wherein Zm are amino acid residues contiguous to the carboxy terminus of Y in the amino acid sequence of said protein allergen. wherein n is 0-30 and wherein m is 0-30.

33. A portion of an isolated peptide of claim 32 wherein the portion comprises at least fifteen amino acid residues.

34. All or a portion of an isolated peptide of claim 32 which does not bind immunoglobulin E specific for Cry j I in a substantial percentage of individuals sensitive to the protein allergen. or if binding of the peptide or portion thereof to said immunoglobulin E occurs. such binding does not result in release of mediators from mast cells or basophils in a substantial percentage of individuals sensitive to the protein allergen.

35. An isolated peptide or portion thereof of claim 32 which binds immunoglobulin E to a substantially lesser extent than Cry j I binds said immunoglobulin E.

36. An isolated peptide of Cry j I or an isolated portion thereof. said peptide or portion thereof comprising at least one T cell epitope of Cry said peptide having an amino acid sequence comprising amino acids 20-324 or 341-353 of Cry j I as shown in Fig. 4a-b.

37. A therapeutic composition comprising at least one isolated peptide or a portion thereof of claim 1 and a pharmaceutically acceptable carrier or diluent.

38. A therapeutic composition comprising at least one isolated peptide or portion thereof of claim 13 and a pharmaceutically acceptable carrier or diluent.

39. A therapeutic composition comprising an isolated peptide or portion thereof of claim 23 and a pharmaceutically acceptable carrier or diluent.

40. Use of a composition of claim 37 for the manufacture of a medicament for treating sensitivity to Japanese cedar pollen allergen or an allergen which is immunologically cross-reactive with Japanese cedar pollen allergen en in an individual.

41. Use of a composition of claim 39 for the manufacture of a medicament for treating sensitivity to Japanese cedar pollen allergen or an allergen which is immunologically cross-reactive with Japanese cedar pollen allergen in an individual.

42. Use of at least two different compositions of claim 37 for the manufacture of a medicament for treating sensitivity to Japanese cedar pollen allergen or an allergen which is immunologically cross-reactive with Japanese cedar pollen allergen in an individual.

43. Use of at least two different compositions of claim 38 for the manufacture of a medicament for treating sensitivity to Japanese cedar pollen allergen or an allergen which is immunologically cross-reactive with Japanese cedar pollen allergen in an individual 44. A method of detecting sensitivity to Japanese cedar pollen in an individual, comprising combining a blood sample obtained from the individual with at least one peptide of claim 1. under conditions appropriate for binding of blood components with the peptide. and determining the extent to which such binding occurs as indicative of sensitivity in the individual to Japanese cedar pollen.

45. A method of claim 44 wherein the extent to which binding occurs is determined by assessing T cell function, T cell proliferation or a combination thereof.

46. A method of detecting sensitivity to Japanese cedar pollen in an individual, comprising combining a blood sample obtained from the individual with at least one peptide of claim 13. under conditions appropriate for binding of blood components with the peptide. and determining the extent to which such binding occurs as indicat??e of sensitivity in the individual to Japanese cedar pollen.

47. A method of claim 46 wherein the extent to which binding occurs is determined by assessing T cell function, T cell proliferation or a combination thereof.

48. A method of detecting sensitivity to Japanese cedar pollen in an individual, comprising combining a blood sample obtained from the individual with all or a portion of at least one peptide of claim 32, under conditions appropriate for binding of blood components with the peptide or portion thereof, and determining the extent to which such binding occurs as indicative of sensitivity in the individual to Japanese cedar pollen.

49. A method of claim 48 wherein the extent to which binding occurs is determined by assessing T cell function. T cell proliferation or a combination thereof.

50. A therapeutic composition comprising a pharmaceutically acceptable carrier or diluent and at least two peptides, said peptides each comprising at least one T cell epitope of Cry j I.

51. A composition of claim 50 wherein said peptides are selected from the group consisting of: and and wherein said composition comprises a sufficient percentage of the T cell epitopes of said protein allergen such that upon administration of the composition to an individual sensitive to a Japanese cedar pollen allergen, T cells of the individual are tolerized to said at least one protein allergen.

52. A composition of claim 5 I comprising a combination of peptides selected from the group consisting of:
and ;
and ;
and ;
and ;
and :
and ;
and ;
and ;
and ;
and ;
and ;
and ;
and ;
and ;
and ;

and ;
and ;
and ;
and ;
and ;
and ;
and ;
and ;
and ;
and ;
and ;
, and ;
, and ;
and ;
, and ;
and ;
and ; and , and .

53. Use of a composition of claim 50 for the manufacture of a medicament for treating sensitivity to Japanese cedar pollen allergen or an allergen which is immunological cross-reactive with Japanese cedar pollen allergen in an individual.

54. Use of a composition of claim 52 for the manufacture of a medicament for treating sensitivity to Japanese cedar pollen allergen or an allergen which is immunologically cross-reactive with Japanese cedar pollen allergen in an individual.

55. A therapeutic composition comprising at least one peptide of Cry j I and a pharmaceutically acceptable carrier or diluent. said composition comprising a sufficient percentage of the T cell epitopes of Cry j I such that upon administration of the composition to an individual sensitive to a Japanese cedar pollen allergen, T cells of the individual are tolerized to Cry j I.

56. A method of treating sensitivity to Japanese cedar pollen allergen or an allergen which is immunologically cross-reactive with Japanese cedar pollen allergen in an individual, comprising administering to the individual a therapeutically effective amount of a composition of claim 55.

57. A nucleic acid sequence coding for at least one fragment of Cry J
I thereof or the functional equivalent of said nucleic acid sequence.

58. A nucleic acid sequence of claim 57 wherein said nucleic acid sequence consists essentially of at least one fragment of the coding portion of the nucleic acid sequence of Cry j I as shown in Fig. 4 a-b.

59. A host cell transformed to express a peptide encoded by the nucleic acid sequence of claim 57.

60. At least one antigenic fragment of Japanese cedar pollen produced in a host cell transformed with the nucleic acid sequence of claim 57.

61. At least one antigenic fragment of claim 60 wherein said fragment does not bind immunoglobulin E specific for Japanese cedar pollen or if binding of the fragment to said immunoglobulin E occurs such binding does not result in histamine release from mast cells or basophils.

62. The isolated antigenic fragment of claim 60 wherein said isolated antigenic fragment is capable of modifying, in a Japanese cedar pollen-sensitive individual to which it is administered. the allergic response to Japanese cedar pollen.

63. A method of producing at least one isolated fragment of Cry j I
comprising the steps of:
a) culturing a host cell transformed with a nucleic acid sequence encoding at least one fragment of Cry j I in a appropriate medium to produce a mixture of cells and medium containing at least one isolated fragment of Cry j I; and b) purifying said mixture to produce at least one substantially pure fragment of Cry j I.

64. An isolated peptide of Cry j I or an isolated portion thereof, said peptide or portion thereof comprising at least one T cell epitope of Cry j I
wherein said peptide has an amino acid sequence selected from the group consisting of and .

65. An isolated peptide or portion thereof of claim 64 wherein said peptide has an amino acid sequence selected from the group consisting of and .

66. At least one modified fragment of Japanese cedar pollen allergen, which when administered to a Japanese cedar pollen-sensitive individual, reduces the allergic response of the individual to Japanese cedar pollen allergen.

67. An isolated protein allergen or antigenic treatment thereof that is immunologically related to Cry j I or fragment thereof.

68. A therapeutic composition comprising at least one isolated antigenic fragment of Cry j I and a pharmaceutically acceptable carrier or diluent.

69. A protein preparation comprising at least one fragment of Japanese cedar pollen allergen Cry j I, synthesized in a host cell transformed with a nucleic acid sequence encoding a portion of Japanese cedar pollen allergen Cry j I.

70. A method of treating sensitivity to Japanese cedar pollen allergen or an allergen immunologically cross-reactive with Japanese cedar pollen allergen in a mammal sensitive to said allergen. comprising administering to said mammal a therapeutically effective amount of said preparation of claim 69.

71. A method of detecting sensitivity in a mammal to a Japanese cedar pollen allergen comprising combining a blood sample obtained from said mammal with a purified antigenic fragment of Japanese cedar pollen produced in a host cell transformed with the nucleic acid sequence of claim 57 or chemically synthesized under conditions appropriate for binding of blood components with the fragment and determining the extent to which such binding occurs.

72. A method of detecting sensitivity of a mammal to Japanese cedar pollen allergen comprising administering to said mammal a sufficient quantity of at least one antigenic fragment of Japanese cedar pollen allergen Cry j I produced in a host cell transformed with the nucleic acid sequence of claim 57 or chemically synthesized to provoke an allergic response in said mammal and determining the occurrence of an allergic response in the individual to said antigenic fragment of Japanese cedar pollen allergen.

73. A monoclonal antibody specifically reactive with at least one antigenic fragment of Japanese cedar pollen allergen. Cry j I.

74. All or a portion of an isolated peptide of Cry j I, said peptide or portion thereof comprising at least one T cell epitope of Cry j I, said peptide having an amino acid sequence selected from the group consisting of amino acid residues 1-40, amino acid residues 81- 110, amino acid residues 151 -180, amino acid residues 191-260 and amino acid residues 291-330 of Cry j I as shown in Fig. 4a-b.

75. A method of designing antigenic fragments of Cry j I, which when administered to Japanese cedar pollen sensitive individuals in sufficient quantity will modify the individual's allergic exposure to Japanese cedar pollen comprising the steps of:
(a) recombinantly or synthetically producing peptides of Cry j I;
(b) examining said peptides for their ability to influence B cell and/or T cell responses in Japanese cedar pollen sensitive individuals; and (c) selecting appropriate peptides which contain epitopes recognized by the cells.

76. An isolated peptide of Cry j I or an isolated portion thereof. said peptide or portion thereof comprising at least one T cell epitope of Cry said peptide having an amino acid sequence selected from the group consisting of: and .

77. A therapeutic composition comprising at least one isolated peptide or portion thereof of claim 76 and a pharmaceutically acceptable carrier or diluent.

78. Use of a composition of claim 76 for the manufacture of a medicament for treating sensitivity to Japanese cedar pollen allergen or any allergen which is immunologically cross-reactive with Japanese cedar pollen allergen in an individual.

79. The use of claim 78 wherein said allergen which is immunologically cross-reactive with Japanese cedar pollen allergen is Jun s I or Jun v I.

80. A modified peptide or a modified portion of a peptide of claim 76.

81. A method of detecting sensitivity to Japanese cedar pollen in an individual, comprising combining a blood sample obtained from the individual with all or a portion of at least one peptide of claim 76, under conditions appropriate for binding of blood components with the peptide or portion thereof, and determining the extent to which such binding occurs as indicative of sensitivity in the individual to Japanese cedar pollen.

82. A composition of claim 76 wherein said peptides are selected from the group consisting of: CJ1-41, CJ1-41.1, CJ1-41.2, CJ1-41.3, CJ1-42, CJ1-42.1, CJ1-42.2, CJ1-43, CJ1-43.1, CJ1-43.6, CJ1-43.7, CJ1-43.8, CJ1-43.9, CJ1-43.10, CJ1-43.11, CJ1-43.12, CJ1-45, CJ1-45.1, CJ1-45.2, CJ1-44, CJ1-44.1, CJ1-44.2 and CJ1-44.3 and wherein said composition comprises a sufficient percentage of the T cell epitopes of said protein allergen such that upon administration of the composition to an individual sensitive to a Japanese cedar pollen allergen, T cells of the individual are tolerized to said at least one protein allergen.

83. Use of a composition of claim 76 in the manufacture of a medicament for treating sensitivity to Japanese cedar pollen allergen or any allergen which is immunologically cross-reactive with Japanese cedar pollen allergen in an individual.

84. The use of claim 83 wherein said allergen which is immunologically cross-reactive with Japanese cedar pollen allergen is Jun s I or Jun v I.

85. An isolated purified native protein or peptide of Jun v I.

86. An isolated nucleic acid having a nucleotide sequence coding for Jun s I, or at least one fragment thereof or the functional equivalent of said nucleotidesequence.
87. An isolated nucleic acid sequence of claim 86 wherein said nucleotide sequence consists essentially of the coding portion of the nucleotide sequence of Fig. 16.
88. An isolated nucleic acid sequence of claim 86 wherein said nucleotide sequence consists essentially of the nucleotide sequence of Fig. 16.
89. An expression vector comprising a nucleotide sequence coding for Jun s I, or at least one fragment thereof or the functional equivalent of said nucleotide sequence.
90. An expression vector of claim 89 wherein said nucleotide sequence consists essentially of the coding portion of the nucleotide sequence of Fig. 16.
91. A host cell transformed to express a protein or peptide encoded by the nucleic acid of claim 86.
92. Isolated Jun s I protein, or at least one antigenic fragment thereof.
produced in a host cell transformed with the nucleic acid of claim 86.
93. An isolated nucleic acid having a nucleotide sequence coding for Jun v I, or at least one fragment thereof or the functional equivalent of said nucleotidesequence.

94. An isolated nucleic acid sequence of claim 93 wherein said nucleotide sequence consists essentially of the coding portion of the nucleotide sequence of Fig. 17.
95. An isolated nucleic acid sequence of claim 93 wherein said nucleotide sequence consists essentially of the nucleotide sequence of Fig. 17.
96. An expression vector comprising a nucleotide sequence coding for Jun v I, or at least one fragment thereof or the functional equivalent of said nucleotide sequence.
97. An expression vector of claim 96 wherein said nucleotide sequence consists essentially of the coding portion of the nucleotide sequence of Fig. 17.
98. A host cell transformed to express a protein or peptide encoded by the nucleic acid of claim 93.
99. Isolated Jun v I protein, or at least one antigenic fragment thereof, produced in a host cell transformed with the nucleic acid of claim 93.
100. A method of producing Jun s I or at least one fragment thereof comprising the steps of:
a) culturing a host cell transformed with a nucleic acid sequence encoding Jun s I or fragment thereof in a appropriate medium to produce a mixture of cells and medium containing said Jun s I or at least one fragment thereof: and b) purifying said mixture to produce substantially pure Jun s I, or at lest one fragment thereof.
101. Isolated Jun s I or at least one antigenic fragment thereof.
102. A therapeutic composition comprising isolated Jun s I pollen allergen or at least one fragment thereof and a pharmaceutically acceptable carrier or diluent.
103. A protein preparation comprising Jun s I or at least one fragment thereof synthesized in a host cell transformed with a nucleic acid sequence encoding allor a portion of Jun s I.
104. A method of use of a preparation of claim 103 for the manufacture of a medicament for treating sensitivity to pollen allergen from the Juniperus species in a mammal sensitive to said pollen.
105. A method of detecting sensitivity in a mammal to Jun s I, comprising combining a blood sample obtained from said mammal with a purified Jun s I
allergen or antigenic fragment thereof produced in a host cell transformed with the nucleic acid sequence of claim 86 or chemically synthesized to provoke an allergic response in said mammal and determining the occurrence of an allergic response in the individual to said Jun s I allergen or antigenic fragment thereof.
106. A monoclonal antibody specifically reactive with Jun s I or at least one antigenic fragment thereof.
107. Isolated Jun s I or at least one antigenic fragment thereof of claim 92 wherein said allergen or fragment thereof does not bind immunoglobulin E
specific for pollen from the species Juniperus, or if binding of the Jun s I
allergen or fragment thereof to said immunoglobulin E occurs, such binding does not result in histamine release from mast cells or basophils.
108. The isolated allergen or antigenic fragment of claim 107 wherein said isolated allergen or said antigenic fragment is capable of modifying, in an individual sensitive to pollen from the Juniperus species to which it is administered, the allergic response to pollen from the Junipers species.
109. A method of producing Jun v I or at least one fragment thereof comprising the steps of:
a) culturing a host cell transformed with a nucleic acid sequence encoding Jun v I or fragment thereof in a appropriate medium to produce a mixture of cells and medium containing said Jun v I or at least one fragment thereof: and b) purifying said mixture to produce substantially pure Jun v I, or at least one fragment thereof.
111. Isolated Jun v I or at least one antigenic fragment thereof.
112. A therapeutic composition comprising isolated Jun v I pollen allergen or at least one fragment thereof and a pharmaceutically acceptable carrier or diluent.
113. A protein preparation comprising Jun v I or at least one fragment thereof synthesized in a host cell transformed with a nucleic acid sequence encoding allor a portion of Jun v I.

114. A method of use of a preparation of claim 113 for the manufacture of a medicament for treating sensitivity to pollen allergen from the Juniperus species in a mammal sensitive to said pollen.
115. A method of detecting sensitivity in a mammal to Jun v I, comprising combining a blood sample obtained from said mammal with a purified Jun v I
allergen or antigenic fragment thereof produced in a host cell transformed with the nucleic acid sequence of claim 93 or chemically synthesized to provoke an allergic response in said mammal and determining the occurrence of an allergic response in the individual to said Jun v I allergen or antigenic fragment thereof.
116. A monoclonal antibody specifically reactive with Jun v I or at least one antigenic fragment thereof.
117. Isolated Jun v I or at least one antigenic fragment thereof of claim 99 wherein said allergen or fragment thereof does not bind immunoglobulin E
specific for pollen from the species, Juniperus. or if binding of the Jun v I
allergen or fragment thereof to said immunoglobulin E occurs, such binding does not result in histamine release from mast cells or basophils.
118. The isolated allergen or antigenic fragment of claim 117 wherein said isolated allergen or said antigenic fragment is capable of modifying, in an individual sensitive to pollen from the Juniperus species to which it is administered, the allergic response to pollen from the Juniperus species.
119. A unique antigenic fragment or portion thereof of Japanese cedar pollen protein allergen, Cry j I.

120. The unique antigenic fragment or portion thereof of claim 119 comprising at least one T cell epitope of Cry j I, said unique antigenic fragment or portion thereof having a mean T cell stimulation index of at least about 3.0 determined in a population of individuals sensitive to said protein allergen.
121. The unique antigenic fragment of claim 120 wherein said population of individuals is at least twenty-five.
122. The unique antigenic fragment of claim 120 wherein said mean T cell stimulation index is at least about 5Ø