BRPI0509598B1 - cholesterol-producing yeast strain, process of cholesterol production, isotopic mixture thereof, one of its metabolic intermediate salts, or a 13c or 14c labeled sterol mixture and use of an organism for the production of said cholesterol - Google Patents

Abstract

cholesterol-producing yeast strains and their applications. The present invention relates to the production of cholesterol in fungi kingdom organisms. but particularly, the present invention relates to genetically modified fungus that autonomously produce cholesterol from a single carbon source. The present invention also relates to the use of fungus according to the invention for the production of unlabeled and labeled cholesterol.

Description

Patent Descriptive Report for "CHOLESTEROL PRODUCING Yeast CEPA, CHOLESTEROL PRODUCTION PROCESS, ITSOTOPIC MIXTURE, ONE OF ITS METABOLIC INTERMEDIATE SALTS, OR A MIXTURE OF STEROLS MARKED ON 13C OR 14C AND USE AN ORGANISM FOR THE PRODUCTION OF SUCH CHOLESTEROL ". The present invention relates to the production of cholesterol in Fungi kingdom organisms. Cholesterol (as shown in Figure 1) is the most important animal sterol. It is a fundamental component of cell membranes, from which it controls fluidity, and is present in all animal tissues and particularly in nervous tissue. Cholesterol is an important industrial inert product. Thus, it is commonly used in the cosmetic industry. It is also used in the pharmaceutical industry, for example in drug delivery as well as in the cell column. Cholesterol is thus used in the industrial synthesis of vitamin D3. This vitamin is then used to supplement human food ( in dairy products, for example) and animal cholesterol is also advantageously used as a feed additive, notably in feed for farmed shrimp.

Today, the vast majority of commercial cholesterol is extracted from animal tissue (a tiny amount is produced by chemical synthesis). Two great starting sources are used for cholesterol extraction: the bovine spinal cord and the lanolin which is the natural fat of sheep's wool. The use of animal tissue as a starting product is not without problems. Thus, the recent problems associated with the transmission of the microorganism responsible for sheep tremor in cattle (disease called bovine spongiform encephalopathy) in cattle) reminded the need for caution when using animal tissue as a raw material. However, despite the measures taken, the risk of pathogen transmission cannot be completely excluded. It would therefore be extremely advantageous to have a source of cholesterol not from animal tissue. The purpose of the present invention is to provide an abundant and healthfully safe source of cholesterol. The inventors have surprisingly shown that it is possible to divert natural production of ergoesterol in Fungi to produce cholesterol.

General Description of the Invention A first aspect of the invention relates. to an organism of the kingdom of Fungi, autonomously producing cholesterol.

A second aspect of the invention relates to an organism of the Fungi kingdom as defined above, characterized in that the latter is genetically modified.

A third aspect of the invention relates to an organism of the Fungi kingdom, as defined above, characterized in that the latter produces cholesterol from a simple carbon source. The invention also relates to a Fungi kingdom organism as defined above expressing the enzymes 7-dehydrocholesterol reductase and 3β-hydroxyester A24-reductase. More particularly, the invention relates to an organism as defined above in which the sterol 24-C-methyltransferase enzyme has been inactivated and / or the C-22 sterol desaturase enzyme has been inactivated.

Another aspect of the invention relates to an organism of the Fungi kingdom as defined above, characterized in that the expression of the enzymes 7-dehydrocholesterol reductase and 3β-hydroxy cholesterol Δ24-ductase is obtained by transformation of the organism. The invention also relates to a Fungi kingdom organism as defined above, characterized in that the inactivation of the enzyme sterol 24-C-methyltransferase is carried out by gene inactivation and / or inactivation of enzyme C-22 sterol desaturase. performed by gene inactivation.

Another aspect of the invention relates to an organism of the Fungi kingdom, as defined above, characterized in that it is chosen in the Ascomycete division, more particularly in the Saccharomycotin sub-division, even more particularly in the Saccharomycetes class. or schizosaccharomycetes, even more particularly in the order of saccharomycetales or schizosaccharomycetales, even more particularly in the family of Saccharomycetaceae or schizosaccharomyceta-ceae, even more particularly in the genus Saccharomyces or schizosac-charomyces.

Another aspect of the invention relates to an organism of the kingdom of the Fungi as defined above, characterized in that it is a yeast of the species Saccharomyces cerevisiae or schizosaccharomyces pombe. The invention also relates to a non-animal cholesterol production process comprising culturing an organism as defined above. More particularly, this process is characterized by the fact that the organism's culture step is followed by a cholesterol extraction step. Preferably, the cholesterol is extracted by a non-water miscible solvent.

More particularly, the process as above is characterized by the fact that a saponification step is performed prior to cholesterol extraction. Even more particularly, the process as defined above is characterized by the fact that a mechanical milling step of the cells is performed prior to saponification or cholesterol extraction.

Another aspect of the invention relates to the use of a Fungi kingdom organism as defined above for the production of cholesterol, or one of its metabolic intermediates, or a 13C or 14C labeled sterol mixture. The invention also relates to a process for producing cholesterol or one of its metabolic intermediates or a 13C or 14C labeled sterol mixture comprising the following steps: culturing an organism of one of the Fungi, such as defined above on a 13C or 14C labeled substrate; and extracting this cholesterol, or one of its metabolic intermediates, or the sterol mixture. The invention also relates to a process for manufacturing an isotopic mixture of cholesterol, cholesterol intermediates or metabolites, labeled at different positions with the aid of isotopic markers, comprising culturing an organism from the kingdom of Fungi, as defined above on a labeled substrate, then on an unlabeled substrate, the substrate culture durations being chosen to obtain a defined isotopic profile. The invention also relates to a sample of cholesterol molecules, intermediates or cholesterol metabolites labeled at different positions with the aid of isotopic markers having a defined isotopic profile and capable of being obtained by this manufacturing process. The invention also relates to a composition containing, as a traceability marker, an isotopic mixture of cholesterol, cholesterol intermediates or metabolites, labeled at different positions with the aid of isotopic markers and having a defined isotopic profile. . More particularly, this composition is intended for the domain of human or animal nutrition or therapy.

Detailed Description of the Invention The present invention relates to the production of cholesterol in Fungi kingdom organisms. In Fungi, no cholesterol is found in its natural state, this being an animal sterol. The major sterol of the cell membranes of these organisms is ergoesterol. The present invention allows for the synthesis of cholesterol by Fungi multiplication in the presence of a single carbon source. The method proposed by the present invention therefore allows a large amount of cholesterol to be obtained at low cost, since the process utilizes the culture of organisms from the kingdom of Fungi and the addition of a simple, readily available commercial carbon source.

By simple carbon source according to the present invention is meant carbon sources usable by the skilled person for the normal growth of a fungus and notably a yeast. Notably, the various assimilable sugars, such as glucose, ga-lactose or sucrose, or molasses, or by-products of such sugars, are meant. A particularly preferred simple carbon source is ethanol and glycerol. The fact that the production is done autonomously means that there is no need to add substrates to obtain cholesterol, but that the body can only produce it from the source carbon source. It is also believed that the strain can produce cholesterol by the use of an upstream substrate in the metabolic pathway, as the organism strain according to the present invention contains all the genes necessary for complexing the metabolic pathway. cholesterol production. The invention notably relates to a genetically modified fungus organism (a fungus) that autonomously produces cholesteroi from a single carbon source.

A number of genetic modifications of the fungus can be made in order to divert the natural metabolic pathway from ergost-rol to cholesterol production. The present invention thus relates to a genetically modified Fungi-kingdom organism expressing the enzymes 7-dehydrocholesterol reductase and 3β-hydroxystomer I A24-reductase. The strain of the Fungi kingdom organism thus modified produces cholesterol. The applicant was able to model, thanks to the results obtained (according to the example part of the present application), leading the metabolic pathway to ergo-sterol and certain of its derivatives (according to figure 2). Expression of the enzymes 7-dehydrocholesterol reductase and 3β-hydroxycholesterol A24-reductase in S. cerevisiae fungus may allow the production of cholesterol by diverting a part of the ergoesterol biosynthesis pathway. The enzyme 7-dehydrocholesterol reductase carries the EC number: 1.3.1.21 in the international enzyme classification (Enzyme Classification). It is also called delta-5,7-sterol-delta-7-reductase, 7-DHC reductase or Sterol delta-7-reductase and will also be called Delta-7 sterol reductase, Delta-7Red, Delta 7 Reductase or A7-reductase. following this document. This enzyme catalyzes in the natural state in plants, for example the delta-dependent NADPH reduction of delta 5,7-cholestadiene in delta 5 colestaenol or the reduction of 7-8 double bond sterolic intermediates (Taton and Rahier, 1991). ). The gene coding for the enzyme 7-dehydrocholesterol reductase was first isolated in the Arabidopsis thaliana plant, isolation of the corresponding gene and expression of this enzyme in the Saccharomyces cerevisiae lipid is described in EP 727 489. The sequences of this gene and protein are accessible at the following accession number: U49398 (Lecain et al, 1996).

A number of homologues of this gene have been described in other species. This is, for example, the homologous gene in man (whose nucleotide sequence is accessible to Gen Bank number AF034544, the protein sequence to GenBank number: AAC05086) (Moebius ef al, 1998). From rat homologue gene Rattus norvegicus (whose nucleotide sequence is accessible to GenBank number: AB016800, the protein sequence to GenBank number: BAA34306). Homologous genes have also been identified in Gallus gallus chicken under GenBank reference BM490402 or Xe-nopus laevis under GenBank reference BI315007 or Danio rerío zebrafish under GenBank reference BQ132664. A gene encoding a delta 7 sterol reductase activity in plants such as Oryza sativa rice under GenBank CA753545, Solanum tuberosum under GenBank BF342071 is also found. This gene encoding a delta7 sterol reductase activity can also be found on the Mastigomoeba balamuthi protist under GenBank BE636562. The technician can easily isolate other homologous genes encoding the enzyme 7-dehydrocholesterol reductase in other organisms. It may notably refer to the cloning method described in EP-Example 1 of EP 727 489, which describes a cloning method for isolating a cDNA encoding a protein having a delta-5,7-sterol-delta-7 activity. -reductase. The artisan can also readily determine the 7-dehydrocholesterol reductase activity of the corresponding proteins notably by using the activity test also described in example 1 of EP 727 489. The expression of the enzyme 7-dehydrocholesterol reductase in an organism of the Fungi kingdom According to the invention, it can be obtained by any means known to the person skilled in the art. This may in particular be the transformation of the organism by a construct comprising an expression cassette consisting of a transcriptional promoter, preferably homologous, of the open reading frame encoding the enzyme 7-dehydrocholesterol reductase and a terminator adapted according to the usual rules known to the technician. As homologous promoter; A suitable promoter will generally be used to allow sufficient and functional expression of the heterologous protein. The promoter may be, for example, the PGK promoter, the ADH promoter, the CYC1 promoter, the GAL10 / CYC1 promoter, the TDH3 promoter or the TPI promoter. The terminator may be, for example, the phosphoglycerate kinase (PGK) gene terminator. Such an expression cassette may be integrated in the form of one or more copies into the host nuclear or mitochondrial genome, or carried by a yeast artificial chromosome-like (YAC) structure, or carried by an episomal genetic element such as a plasmid. To perform this type of expression Yarrowia lipolitica, Kluyveromyces lactis or Pi-chia pastoris type yeasts can, for example, be used.

Preferably, the expressed 7-dehydrocholesterol reductase enzyme is the enzyme of the Arabidopsis thaliana plant (an example of mode of expression of this enzyme in Saccharomyces cerevisiae yeast is described in EP 727 489). It may, however, be any homologous or unnatural enzyme, natural or artificial, which has the same enzymatic activity. Enzyme 3 β-hydroxycholesterol A24 reductase, also called DHCR24 or 24-dehydrocholesterolesterol reductase, catalyses in the natural state the reduction in desmoesterol (cholester 5.24 dienol) or lanesterole derivatives having a double bond in 24 -25 on the side chain (eg 14-demethyl-lanoesterol, zymolesterol or cholesta 7, 24 dienol), notably necessary reduction in human cholesterol biosynthesis (Waterham HR. Et al., 2001). This enzyme will also be referred to as delta 24- (25) sterol reductase, delta 24 sterol reductase or A24-reductase following this document. The gene coding for the enzyme and 3β-hydroxycholesterol Δ24 reductase was first isolated in man, isolation of the corresponding gene, and expression of this enzyme in the Saccharomyces cerevi-siae yeast is described in Waterham HR. et al., 2001. The sequences of this gene and protein are accessible to the following GenBank accession numbers: NM_014762 and NP_055577.

A number of homologues of this gene have been described in other species. This is, for example, the rat homolog gene (Mus musculus) (whose nucleotide sequence is accessible to GenBank number: NM_053272, the protein sequence to GenBank number: NP_444502). Homologs have been described in the Caenorhabditis elegans worm and notably a complementary DNA under GenBank reference AF026214. Homologous sequences have also been described in plants such as Gossypium hirsutum cotton under GenBank AAM 47602.1, Orysa sativa rice under GenBank AAP53615, Pisum satinum under GenBank AAK15493. The technician can easily isolate other homologous genes coding for 3β-hydroxyester delta 24-reductase enzyme in other organisms. It may notably refer to the cloning method described in Waterham HR. et al., 2001. The skilled artisan can also readily determine the 3β-hydroxyester A24-reductase activity of the corresponding proteins notably, using the activity test also described in the publication (Waterham et al., 2001). The expression of the 3β-hydroxyester A24-reductase enzyme in a Fungi kingdom organism according to the invention can be obtained by any means known to the person skilled in the art. This may in particular be the means described above for the expression of the enzyme 7-dehydrocholesterol reductase.

Preferably, the expressed 3β-hydroxyester A24-reductase enzyme is the human enzyme. An example of isolation of the corresponding gene and expression of this enzyme in Saccharomyces cerevisi-ae is described in Waterham HR. et a /., 2001. However, they may be any homologous or unnatural enzyme, natural or artificial, having the same enzymatic activity.

Advantageously, the organisms of the Fungi realm according to the present invention express the enzymes 7-dehydrocholesterol reductase and 3β-hydroxyester A24-reductase and furthermore have an inactivation of the enzyme sterol 24-C-methyltransferase. Sterol 24-C-methyltransferase carries the number EC-2.1.1.41 in the International Enzyme Classification (Enzyme Classification). It is also called ERG6p, Delta (24) methyltransferase, Delta (24) cholesterol methyltransferase, Zymosterol-24 methyltransferase, S-adenosyl-4-methionine: sterol delta (24) methyltransferase, SMT1, 24-sterol C- methyltransferase, S-adenosyl-L-methionine: delta (24 (23)) - sterol methyltransferase or Phytosterol methyltransferase. This enzyme catalyzes in the natural state of C-24 methylation of zymoesterol, leading to the formation of fecoesterol. The gene coding for the sterol 24-C-methyltransferase enzyme was named Erg6 in the Saccharomyces cerevisiae language. The sequence of this gene is accessible to the following GenBank accession number: NP_013706 (Bowman etal., 1997), (Goffeau et al., 1996).

A number of homologues of this gene have been described in other Fungi. This is, for example, the homologous gene in Schizosaccharomyces dove (whose nucleotide sequence is accessible to GenBank number Z99759, the protein sequence to GenBank number: CAB16897) (Wood et al., 2002). The homologous gene in Neurospora crassa (whose nucleotide sequence is accessible to GenBank number: NCB24P7, the protein sequence to GenBank number: CAB97289). The homologous gene in Candida albicans (whose nucleotide sequence is accessible to GenBank number: AF031941, the protein sequence to GenBank number: AAC26626) (Jensen-Pergakes et al, 1998). Genes encoding an ERG6 homologous enzyme have also been described in Candida lusitaniae under GenBank A-A0219365.1 and also in Pneumocystis carinii (Kaneshiro et al, 2002) or Kluveromyces lactis (Ozier-Kalogeropoulos etal, 1998). The technician can easily isolate other Erg6 homologous genes in the organisms of the Fungi kingdom. The technician can also easily determine the sterol 24-C-methyltransferase activity of the corresponding proteins, notably by using the functional complementation of a disrupted yeast strain for these genes. Completion is then attested by the formation of branched sterols in position 24 in particular of sterol-type sterols carrying a methylene group in position 24-28. The presence of an ERG6 type sterol 24-C-methyltransferase biological activity will also be determined in vitro thanks to the techniques developed by (McCammon et al, 1984) or by Taylor et Parks (Taylor and Parks, 1978). On the other hand, the sterols produced and substrate of the enzyme ERG6 will be separated by gas chromatography, according to the technique developed by Nes in (Methods in Enzyme Steroids and Isoprenoids Volume 111 part B, 1985 "A comparison of Methods for the Identification ofSteroIs "(pp3-37). The strain of the Fungi kingdom organism according to the present invention expressing the enzymes 7-dehydrocholesterol reductase and 3β-hydroxycholesterol A24-reductase and further showing an inactivation of the sterol 24-C-methyltransferase enzyme produced by cholesterol. The applicant was able to find that, surprisingly, the inactivation of the enzyme sterol 24-C-methyltransferase blocks the upstream ergo-sterol biosynthesis pathway and allows for increased cholesterol production by the fungus strain (as shown in example of this application). Expression of the enzymes 7-dehydrocholesterol reductase and 3β-hydroxyesterol A24-reductase is performed as described above. Inactivation of the sterol 24-C-methyltransferase enzyme may be performed by any means known to the person skilled in the art. This may in particular be the introduction by mutagenesis of a nonsense mutation, insertion or deletion, causing a change in reading frame in the gene encoding this protein.

It may also be the expression of an antisense RNA complementary to the messager RNA encoding that protein or the known gene extinction system under the name of small interfe-ring RNAi and associated enzyme systems, if these are not. naturally exist in the host. Mutagenesis can be done either in the coding sequence or in a non-coding sequence in order to inactivate the coded protein or to prevent its expression or translation. Mutagenesis may be done in vitro or in situ by deletion, substitution, deletion and / or addition of one or more bases in the gene under consideration or by gene inactivation.

This may in particular be the introduction of an exogenous DNA into the coding or promoter sequence (for example a homologous promoter and / or terminator expression cassette and a heterologous coding moiety). The expression cassette advantageously allows expression of a selection marker. It is also possible to modify the gene promoter in order to reduce the level of expression. For Fungi, inactivation is also done by interrupting the coding sequence by the coding sequence of a heterologous or homologous marker gene. The main techniques for disrupting a Fungi gene are described in the article by Johnston et al (2002) (Methods in Enzymology Volume 350 Edited by Christine Guthrie and Gerry Fink; "Gene Disruption"; M. Johnston, L. Riles, J. Hegemann pp 290-315).

Advantageously, the organisms of the Fungi realm according to the present invention express the enzymes 7-dehydrocholesterol reductase and 3β-hydroxyester A24-reductase and furthermore have an inactivation of the enzyme C-22 sterol desaturase. The enzyme C-22 sterol desaturase is also called ERG5p, Cyp61, cytochrome p-45061, sterol delta22 desaturase. This enzyme catalyzes in the natural state the conversion of the ergosta-5,7,24 (28) -trienol to ergosta-5,7,22,24 (28) -tetraenol by adding a double bond at position C22 (as in figure 2). The gene coding for the enzyme C-22 sterol desaturase was named Erg5 in the Saccharomyces cerevisiae yeast. The sequence of this gene is accessible to the following GenBank accession number: U34636. The corresponding protein sequence is accessible to the following GenBank accession numbers: AAB06217 (Skaggs et al., 1996) or P54781 (Bowman et al., 1997).

A number of homologues of this gene have been described in other Fungi. This is, for example, the homologous gene in Schizosaccha-romyces pombe (whose nucleotide sequence is accessible to Gen-Bank number Z98974, the protein sequence to GenBank number: CAB11640) (Wood et al., 2002). The homologous gene in Symbiotaphrína buchnerí (whose nucleotide sequence is accessible to GenBank number: AB086896, the protein sequence to GenBank number; BAC01142) (Noda and Koizumi, 2003). The homologous gene in Symbiotaphrine Kochii (whose nucleotide sequence is accessible to GenBank number: AB086890, the protein sequence to GenBank number: BAC01139) (Noda and Koizumi, 2003). The homologous gene in Candida albicans (whose nucleotide sequence is accessible to GenBank number: AL033396, the protein sequence to GenBank number: CAA21953) (Tait et al., 1997). The ERG5 gene has also been described in Candida lusitaniae under GenBank reference AAO48601. The technician can easily isolate other ErgS homologous genes in the organisms of the Fungi kingdom. The technician will also be able to easily determine the C-22 sterol desaturase activity of the corresponding proteins notably by using the activity test described by Skaggs, BA, et al., 1996. This activity may also be evidenced by functional complementation of a lipid. S. cerevisiae previously disrupted at the erg5 gene level. This complementation will be attested by the presence in the complemented strain of ergosta 5, 7, 22 trienol. C-22 sterol desaturase activity can be measured in vitro using the method described by Kelly and Baldwin et al JBC (1997) after lysis of the yeasts (Kelly et al., 1997). The strain of the Fungi kingdom organism according to the present invention, expressing the enzymes 7-dehydrochol sterol reductase and 3β-hydroxycholesterol A24 reductase and, furthermore, having an inactivation of the enzyme C-22 sterol desaturase cholesterol product. The applicant was able to determine that inactivation of the enzyme C-22 sterol desaturase advantageously blocks the conversion of cholesterol to cholester 5, 22 dieneol and allows stabilization of cholesterol production (as in the example part of the present application). conversion level of 5.7 dienol, a precursor of cholesterol to cholesta 5, 7, 22 trienol, a precursor of cholest 5.22 dienol. Surprisingly, the enzyme C-22 sterol desatürase accepts, in effect, as a substrate the cholesterol she converts to cholesta 5, 22 dieneol. This parasitic reaction can be eliminated by inactivation of the enzyme-22 sterol desatürase, as could be determined by the applicant. Expression of the enzymes 7-dehydrocholesterol reductase and 3β-hydroxyesterol A24-reductase is as described above. Inactivation of the enzyme C-22 sterol desatürase may be performed by any means known to the person skilled in the art. These may in particular be the methods described above regarding inactivation of the enzyme sterol 24-C-methyltransferase.

Advantageously, the organisms of the kingdom of the Fungi according to the present invention express the enzymes 7-dehydrocholesterol reductase and 3β-hydroxyesterol A24-reductase and, in addition, have an inactivation of the enzyme C-22 sterol desaturase and an inactivation of the sterol 24- C-methyltransferase. These strains have the cumulative advantages of both inactivations and are cholesterol-producing strains. Expression of the enzymes 7-dehydrocholesterol reductase and 3β-hydroxyesterol A24-reductase and inactivation of the enzymes C-22 sterol desaturase and sterol 24-C-methyltransferase are performed as described above.

In one embodiment, cholesterol is present in the organism strain according to the present invention in a proportion greater than 20%, preferably 35%, most preferably 50% or more of the total sterols produced by the strain according to the present invention. the invention (notably the synthesis intermediates).

Preferably, the organisms of the kingdom of the Fungi according to the present invention are chosen from the Ascomycetes division, more preferably from the Saccharomycotina sub-division, even more preferably from the Saccharomycetes class or even more preferably schizosaccharomycetes are chosen in the order of Saccharomycetales or schizosaccharomycetates, even more preferably they are chosen from the family of Saccharomy-cetaceaa or schizosaccharomycetaceae, even more preferably they are chosen from the genus Saccharomyces or schizosaccharomycas, entirely Preferred organisms of the kingdom of the Fungi according to the invention belong to the species Saccharomyces cerevisiae or schizosaccha-romyces pombe. The present invention also relates to a non-animal cholesterol production process comprising the following steps: - an organism from the kingdom of Fungi is cultured as described above; - The cholesterol produced by this organism is extracted. Extraction is based on the treatment of fungus by a preferably non-water miscible cholesterol solvent. Such treatment may preferably be associated with any method of mechanical cell milling. More preferably the fungus will be treated prior to solvent extraction by a saponification mixture designed to release cholesterol eventually bound to other cellular components such as fatty acids. Such a saponification mixture may be comprised of a base for example ammonia, soda, potash dissolved in water or more preferably in a water miscible organic solvent such as methanol or ethanol, or a solvent-water mixture. Saponification may be carried out without or preferably with heating at a temperature of 60-120 ° C, atmospheric pressure or underpressure. Extraction by the non-miscible solvent in water may be replaced by solid phase extraction over a hydrophobic resin. A method of sterol extraction is described by L. Parks et al. (1985) (Methods in Enzymology 111 Edited by L. Rilling, L. Parks, C. Bottema, R. Rodriguez and Thomas Lewis pp 333-339). The crude cholesterol thus obtained may be purified by any methods known to the artisan in particular that described by Bosel-LiE, Velazco V, Caboni Mf et Lercker GJ Chromatogr A. 2001 May 11; 917 (1-2): 239-44 .

Other methods may also be applied as described for extracting cholesterol from sheep wool. The artisan may notably refer to the methods described in US 2,688,623 or US 2,650,929 or GB690879, GB646227 or GB613778.

Another aspect of the invention relates to the use of the strains according to the present invention to obtain cholesterol or one of its metabolic intermediates or a labeled sterol mixture. The metabolic intermediate of cholesterol is understood to be sterols, as specified in Figure 2. These may be notably cholester 8,24 (25) dienol, cholester 7, 24 (25) dieneol, cholester 5, 7,24 ( 25) trieneol, colesta 5.24 (25) dieneol, colesta 5.22 dieneol. The principle of obtaining a labeled cholesterol is described in Figure 10. This manipulation consists initially of increasing the fungus strain on a fully labeled substrate. The cells are then cultured on an unlabeled substrate. There is thus a change in isotopic labeling of the carbon source, followed by de novo synthesis of metabolic intermediates, after sterol, including cholesterol and with a progressive labeling change. It is therefore a complex profile, more perfectly determinable! experimentally, which represents a unique isotopic signature which depends at the same time on: - the labeling protocol and, in particular, the durations and culture conditions on labeled and unlabelled substrate; - the precise genetic structure of the strain used; - the precise time to stop crops.

Once the culture is stopped (for example by cell lysis or by stopping the culture in the presence of sublethal concentration of cytotoxic or cytostatic antifungal products), the labeled cholesterol or one of its metabolic intermediates, or a mixture of labeled sterols is extracted and purified as described above. The isotopic profile of labeled cholesterol or one of its metabolic intermediates or labeled sterol mixture has several unique properties: - It is modulable at will, acting on the culture conditions, the strain used and the sterol chosen. A single marker record can therefore be produced; - is combinable, namely that several isotopic signatures corresponding to several unique sterols marked by isotopic profiles, themselves modulable can be combined to form a "molecular alphabet" - is reproducible and easy to determine experimentally - it corresponds to an easy tracer molecular mixture isolating, stable, colorless and odorless, non-volatile, non-toxic and incorporable into food, medicine, additives or other human-assimilable products - it is unfalsifiable, unless it has the specific recombinant strains and very precise labeling, culture and extraction Moreover, knowledge of the isotopic signature does not allow us to go back to the parameters that allowed us to produce it.

Thus, an unfalsifiable "isotopic alphabet" of general use and incorporable into any type of consumable products can be readily obtained thanks to the present invention. The "isotopic words" constituted from this alphabet are almost unlimited in number, while taking advantage of the marking profiles and the different types of sterols. Incorporating such signatures into the widest variety of products therefore constitutes a unique method of unfalsifiable labeling, unlike, for example, reproducible DNA signatures once known. On the other hand, the signature can be read non-destructively, for example by laser ionization followed by mass spectrometric analysis (MALDITOF or assimilated). The use of 13 C-labeled substrate in place of the unlabelled carbon sources for the fungus strains culture according to the invention allows the synthesis of sterols and in particular very strongly labeled cholesterol (comprising at least 95% carbon dioxide 13C). Preparation of sterols and 14C radioactive cholesterol is also possible by the same approach. The process can also be incorporated into yeast strains producing steroids and notably hydrocortisone (as per WO 02/061109) to produce 13C or 14C labeled steroids for example for RIA tests.

Legend of the figures Figure 1: Chemical formula of cholesterol, as well as the nomenclature generally used for the numbering of different carbons and the name of the different cycles. The four cycles of the cholesterol molecule are respectively named A, B, C and D and the carbons are numbered 1 to 27.

Figure 2: Simplified schematic of the late part of the biosynthesis pathway of ergosta- and cholestatic sterol-type lobes. The scheme is not exhaustive, but allows defining the steps by intervening the enzymes mentioned in this document. ERG2p, ERG3p, ERG5p and ERG6p proteins are fungus or yeast proteins, while Delta 24- (25) Red (Delta 24- (25) sterol reductase) proteins are Delta-7Red (Delta-7- (25) sterol reductase) proteins. heterologous sources of mammalian or plant origin.

Figure 3. HPLC profile with UV detection at 206 nm of free sterols from BMA64-derived strains and identification of these sterols. The strains studied are as follows: WGIF01 (strain BMA64 disrupted in the erg6 gene (as in example 1)), WGIF02 (strain BMA64 disrupted in the erg6 gene and expressing A24-reductase, Example 12), WGIF03 (strain BMA64 disrupted in the erg6 gene and expressing Δ7 reductase, Example 13), WGIF04 (disrupted strain BMG64 in the erg6 gene and expressing A7 reductase and A24 reductase, Example 14). C5: cholester 5 eneol (cholesterol): C5.22: cholester 5.22 dieneol; C5.24: Collects 5.24 dieneol (desmoesterol); C8.24: cholester 8.24 dieneol (zymolesterol); G5,7.22: cholester 5,7,22 trienol; C5.7.24: cholester 5,7,24 trienol; C5.22.24: Collects 5.22.24 trine! C5,7,22,24: cholester 5,7,22,24 tetraenol; lan: lanoesterol.

Figure 4. Compared HPLC profile with UV detection at 206 nm of free sterols of strain WGIF04 (strain BMA64 disrupted in the erg6 gene and expressing Δ 7 reductase reductase and A24 reductase, example 14) after 0.2, 4,8,24 hours of galactose induction. Delta: strain WGIF01 (Example 1). For the WGIF04 strain, withdrawals are made 0, 2,4,8 and 24 hours after the oscillation of the carbon source in galactose. The profile of strain BMA64 carrying the erg6 disruption (WGIF01) shown is that obtained immediately after oscillation in galactose. This profile remains virtually unchanged during induction (0-24 hours). The absorption signal at 206 nm corresponds to varying absorption coefficients from one sterol to another. C5: cholester 5eneol (cholesterol); C5.22: basket 5.22 dieneol C5.24: basket 5.24 dieneol (dismosterol); C8.24: basket 8.24 dieneol (Zymosterol); C5,7.22: basket 5,7,22 trienol; C5.7,24: cholester 5,7,24 trienol; C5.22.24: cholester 5.22.24 trienol; C5,7,22,24: cholester 5,7,22,24 tetraenol; lanoesterol.

Figure 5: Compared HPLC profile with electron-pray detection with positive ionization (mass spectrometry) of free WGIF04 strain sterols (Example 14) after 0.2,4,8,24 hours of galactose induction. Δ: strain WGIF01. C5: 5eneol basket (cholesterol): C5.22: 5.ene dieneol basket; C5.24: cholester 5.24 dieneol (demoesterol): C8.24: cholester 8.24 dieneol (zymosterol). HPLC profiles are similarly to tests as to those in figure 4.

Figure 5A (left): m / z detection = 367, Figure 5B (right) m / z = 369.

Ordered: number of computed ions / second. Abscess: purification duration in minutes.

Figure 6: HPLC m / z = 369 profile detail for the three strains: WGIF01, CA10 carrying the expression plasmid for delta 24 sterol Reductase and for WGIF04, cholesterol is injected as internal standard. The amounts of total sterols injected for the three strains correspond to extractions made from the identical culture quantities measured by absorbance at 600 nm.

Figure 7: Comparative profiles of total sterols (free and ester) in gas phase chromatography of strains WGIF01 (erg6 deletion), WGIF02 (erg6 deletion with A24-reductase expression), WGIF03 (erg6 deletion with A7-reductase expression) ), WGIF04 (deletion of erg6 with expression of A24-reductase and A7-reductase) and CA10 pYESJMa24 (genetic background FY1679, deletion of expression of A24-reductase, Δ-7 reductase, ergone). Response scales (flame ionization currents) are arbitrary. Profiles should only be qualitatively compared from one strain to another. The retention time scale is however the same for all strains (retention times are expressed in minutes). Sterols are identified according to the criteria described in this application.

Figure 8. Quantitative breakdown of the major free sterols in the yeast strains (BMA64 (Figure 8A), WGIF01 (Figure 8B), WGIF02 (Figure 8C) and WGIF03 (Figure 8D) evaluated on the basis of the UV spectra. % of all species shown in the figure that are the only ones detectable in appreciable quantities In the absence of a standard for several of the intermediate sterols, quantitation is made on the basis of the UV spectra associated with each of the HPLC chromatogram peaks, using the coefficients The following absorption coefficients are given below (as shown in Table 1, the absorption coefficients are expressed in mM per liter and cm) To do this, the absorption coefficients corresponding to the unsaturated structural motifs present in the structure of a given sterol are found in Table 1. and eventually added (if multiple motifs are present in the same molecule) to provide an evaluation of the extinction coefficient The assessment is made using the values of 280 nm if at least one absorbing motif at that wavelength is present, in the absence of absorption at this wavelength 206 nm is used to evaluate the concentrations of each of the sterols from the respective absorption signals on HPLC.

Figure 9. Quantitative breakdown of major free steroids in the WGIF4 yeast strain evaluated on the basis of UV spectra. Quantifications are made as described in figure 8.

Figure 10. Principle of isotopic labeling of sterols by carbon source substitution.

Figure 11. Evaluation of isotopic labeling profiles of cholesterol produced in strain WGIF04, after 4.8 and 24 hours of induction. Free sterols are extracted and separated by HPLC as described. A mass spectrum between m / z 300 and m / z = 450 is acquired every 0.2 seconds during purification. These spectra are then median placed in 1.8 second windows, then subjected to a multilinear regression, using as a regression base a set of 24 vectors representing the theoretical distributions of labeled cholesterol mass for random take-up incorporation. carbon 13 at each of the 27 positions of the molecule with a marking probability on each carbon ranging from 0 to 1 according to the vector considered. The marking probabilities of the different vectors used as base are chosen such that the cross-correlation coefficient of the distributors of two consecutive vectors of the base is 0.92, the base activating with a vector corresponding to a presence probability of 100. % at all positions for carbon 12.0 Multilinear adjustment is made on the basis of a smaller squared statistical criterion, nullifying the non-diagonal terms of the Gauss method partial derivatives (maximum numerical filtering) matrix. After analysis, the mass spectra are then reconstructed on the optimized base. Therefore, the curves represented in the figures represent the result of optimal filtered reconstruction after normalization of the maximum amplitude to 100.

For each induction time the two curves represent two independent profiles corresponding to purification times other than 1.8 seconds and corresponding to spectra located in the central zone of the cholesterol purification peak. The figure demonstrates the great reproducibility of the analysis.

Figure 12. Example of different isotopic signatures at the level of different sterols or different induction times. Same calculation and representation as for figure 11, but for different sterols and different induction time. The RT value indicates the range of retention time spent for the calculation (in minutes). The values of this range are as follows: Figure 12A: RT = 12.25 -12.42 Figure 12B: RT = 12.2 -12.7 Figure 12C: RT = 12.25 -12.35 Figure 12D: RT = 13 .13.6 The induction times are 8 or 24 hours.

The m / z values indicate the left and right limit of m / z. The lowest m / z value for each frame corresponds to m / z for the fully carbon skid 12.

Figure 13: Comparative profiles of total (free and ester) sterols in gas phase chromatography of strains YIM59 / plM303 (part A of the figure) and strain YIM59 / plM331 (part B of the figure) (as example 18). Response scales are arbitrary. The retention time scale is the same for both strains (retention times are expressed in minutes). Sterols are identified according to the criteria described in this application. The present invention is illustrated with the aid of the following examples, which should be considered as illustrative and not limiting.

The molecular biology techniques used are described by Au-subel et al., Certain manipulations of the yeasts are described by Adams et al (Adamsand Holm, 1996).

Example 1: Production of a disrupted S. cerevisiae yeast strain on the erg6 gene (WGIF01 strain): The S. cerevisae WGIF01 yeast strain whose ERG6 gene is disrupted by the TRP1 gene was obtained by transformation of the BM64 strain by a PCR product carrying a functional TRP1 gene contoured by homologous ends an ERG6 gene. The BM64 strain (genotype MATa \ ura3-52; irp 1Δ2; / eu2-3_112; / ws3-11; acfe2-1; can1-100) is a derivative of the S. cerevisiae W303 ΜΑΤα ligand strain by full deletion of the 7RP1 gene . The BMA64 strain and the W303 ΜΑΤα strain are described in the publication of Baudin-Baillieu et al (Baudin-Baillieu etal. 1997).

To isolate the 7IRP1 gene, the TIRP1 gene from plasmid pFL44 (Bonneaud et al., 1991) was amplified using Z-Taql (a DNA dependent DNA polymerase) provided by Takara (Pan Vera LLC 501 Charmany Drive Madison, W1 53179 USA). The attraction binary used allows amplification by the DNA polymerase of the TRP1 gene bypassed sequences corresponding to the ERG6 gene. The sequence of these attractions is as follows: OERG6trp1 (CCTAGCGACGAAAAGCATCATTGGAGTGAATAACTTGGACTTACCAttctt agcattttgacg) 3 '(SEQ ID NO: 1). OERG6trp2: (GCATAAGAGTGAAACAGAATTGAGAAAAAGACAGGCCCAATTCAaattcgg gtcgaaaaagaaaagg) 3 '(SEQ ID NO: 2). The PCR (polymerase Chain Reaction) product thus obtained is purified by electropurification of the expected size fragment and used to transform the BM64 strain by the lithium chloride technique as described by (Gietz etal., 1995).

After transformation, the treated yeasts are measured in a minimal medium that does not contain tryptophan (Gietzetal., 1995). This yields 41 prototrophic transformed BM64 colonies for tryptophan. These 41 colonies are then tested for three of their properties: sensitivity to nystatin, genomic structure of the TRP1 gene insert, gas phase chromatography profile of the total sterols they produce.

For this, the 41 colonies are transferred on a minimum medium containing respectively 10, 20 or 50 pg / ml nystatin, a dozen colonies are able to grow on the medium containing a dose of 50 μΓη / ιηΙ of nystatin. These resistant solutions are selected to verify their gene structure as well as their sterol compositions. The insertion of the 7RP1 gene into the EPG6 gene is verified by PCR using a pair of oligonucleotides spanning the junction between the functional TRPt gene and the disrupted ERG6. This pair of oligonucleotides is as follows: OERG6trp3: AGGGCCGAACAAAGCCCCGATCTTC (SEQID # 3) and OERG6trp4: GGCAAACCGAGGAACTCTTGG (SEQ ID No. 4).

Some strains have the expected PCR profile, that is, an 800 base pair fragment corresponding to the expected size for a TRP1 insertion into ERG6.

In order to verify that the ERG6 gene is well inactivated in these strains, an analysis of the sterol compositions of these strains by gas chromatography and high pressure liquid chromatography was performed (Duport etal., 2003; Szczebara et al., 2003). .

These analyzes confirm the absence of ergoesterol synthesis and the accumulation of abnormal sterols compatible with the expected disturbances of the biosynthetic pathway in the disrupted strain.

One strain was more particularly selected and named WGIF01.

Example 2: Production of CA10, CA14 and CA23 strains.

The CA10 strains (genotype: MATa, rho +, GAL2, ura3-52, trpl-Δ63, his3-A200, erg5 :: HYGROr, ade2 :: GAL10 / CYC1 :: A7Reductase :: PGK1, LEU2 :: GAL 10 / CYC1 :: matADR :: PGK1), QA14 (genotype: MATa, rho *, GAL2, ura3-52, trp1-A63, his3-A200, erg5 :: HYGR <f atf2 :: G4lf, a-de2 :: GAL10 / G YC1 :: A 7reductase :: PGK1, LEU2 :: GAL10 / CYC1 :: matADR :: PGK1) and CA23 (genotype: MATa, rho +, GAL2, ura3-52, trpi-A63, his3-Δ200, erg5 :: HYGR <f, sand :: G418R, are2 :: HIS3, ade :: GAL10 / CYC1 :: A7Reductase :: PGK1, LEU2 :: GAL10 / CYC1 :: matADR :: PGK1) are described in the reference Duport et al, whose technical content with respect to the production of such strains is incorporated by reference to the present application.

The strains produce and contain in their membranes unnatural sterols (as described in European patent application EP 0727 489) and in particular ergosta-5-enol (campesterol).

These three strains do not express the non-functional ERG5 gene product by insertion into its coding sequence for the hygromycin resistance gene. In addition, these strains express the cDNA encoding the plant Δ7 reductase (European patent application EP 0727 489 notably described cloning the Δ7 reductase from the Arabidop- $ 1 thaliana plant, which is incorporated by reference to the present application, GenBank access number of this string is ATU49398). The CA14 strain is derived from the CA10 strain by disruption of the ATF2 gene. The product of that gene leads to pregnenolone acetylation at position 3 (as described in patent application WO99 / 40203). The CA23 strain is a strain derived from the CA10 strain by deletion of the AREI and ARE2 genes, the two proteins Arelp et Are2p are responsible for esterification of ergoesterol (Sturley, 2000) and eventually cholesterol, as they are homologous to the enzyme responsible for esterification. of cholesterol in mammals (ACAT).

Example 3: Production of human Δ24-25 reductase expression plasmid (plasmid pYES_Delta24). The production of this plasmid has been described by Waterham et al. 2001. Production consisted of placing cDNA encoding Delta 24 sterol reductase under the control of the pGAL1 promoter and tCYC1 terminator in the pYES2 vector (Invitrogen SARL, Cergy Pontoise, France). This E.coli / S cerevisiae "navette" plasmid contains a 2 micron origin of replication and a URA3 gene, allowing its replication in the yeast and the selection facilities of the yeast transformed by this plasmid. The GAL1 promoter is furthermore inducible by galactose.

Example 4: Production of Plasmid pAG1 Expressing A.Thaliana Δ7 Reductase A plasmid was produced specifically for the expression of Delta 7 Reductase a and A. thaliana on a monocopy vector. Plasmid pAM1 was used for this construct. Such a plasmid whose construction is described in PCT application W002 / 061109 (as per example 9.b of that application, which is incorporated by reference to the present application) is an e.coli / S "navette" plasmid. cerevisiae based on an autonomous one centromere replication sequence (ARS CEN). The selection marker is the ADE2 gene. This plasmid is compatible, and can therefore replicate at the same time as a plasmid based on a 2 micron origin of replication. Such a plasmid has, in particular, a unique Notl site, allowing cloning of expression cassettes as described in the above PCT application.

This site was used to clone an A.Thaliana delta7 reductase expression cassette from the CA10 strain. Indeed, this expression cassette is very effective and allows the CA10 strain, which is furthermore disrupted to ERG5, to produce campestrol (ergosta-5-enol) as a major sterol (Duport et al., 1998). The CA10 genomic DNA fragment containing the delta7 reductase gene is amplified as an aid to the following attractions: OSA 72 5 '(TATATAGCGGCCGCTTTCGCTGATTAATTACCCCAG) 3' (SEQ ID NO: 5) ID No. 6} Amplification is performed on CA10 strain genomic DNA prepared by the rapid phenol / chloroform extraction technique, as described by Adams et al (Adams and Holm, 1996).

Fifty nanograms of CA10 genomic DNA is used as a template for amplification with the aid of OSA72 and OSA77 attractions. Taq DNA polymerase and enzymatic conditions came from Stratagene. The amplification conditions were as follows. Initial denaturation of 5 minutes at 95 ° C, then thirty cycles are performed consisting of a denaturation of 30s at 95 ° C, a hybridization of 30s at 50 ° C, then a one minute elongation at 72 ° Ç. The reaction is completed for 10 minutes at 72 ° C. The PCR fragment is then digested by the Notl enzyme and purified on agarose gel, then classically cloned at the single Notl site level of plasmid pAM1. The plasmid thus obtained was named pAG1.

It is a monocopy vector allowing the expression of A. thaliana Delta7 Reductase in the lipid, the delta7 Reductase gene being placed under the control of the GAL10 / CYC1 promoter (Lecain et al, 1996).

Example 5: Extraction of free and esterified sterol in the lid for analysis: 1) Extraction conditions of free and esterified sterol in the lid (procedure 1) a) Free sterol extraction: The cell residue is washed twice with 500 μΙ deionized and filtered water in a glass tube.

The cells are then resuspended in 500 μΙ of water containing 0.5 mm glass beads corresponding to 150 μΙ of liquid in the tube.

Extraction is performed twice with 2 ml of 1,2 dichloroethane with vigorous vortexing for ten minutes. After the first extraction, the mixture cells, glass beads, solvent is centrifuged for 5 minutes at 1500 g in order to separate the two phases.

The two organic fractions from the two successive extractions are pooled and dried under a stream of nitrogen for a few hours. The sterolic extract is suspended in 100 μ acet acetonitrile for analysis by high performance liquid chromatography (HPLC) (Szcze-bara et al, 2003) or in 100 μ hex hexane for gas chromatography (GC) analysis (Duport et al. there, 2003). (b) Total sterol extraction conditions: saponification and esterified sterol extraction, qualitative analysis Procedure 1: Cell residue is suspended again in 500 μΙ of purified water. To this suspension is added 2 ml of 10% potassium hydroxide KOH in methanol. The mixture is heated for one hour at 60 ° C in closed tubes. After incubation and once the tubes return to room temperature, the mixture is extracted three times with 2 ml of hexane. Between each extraction, the two phases are separated by a 5 minute centrifugation at 1500 g. After each extraction, the organic phase is transferred into a new tube, then the three organic phases are combined, then dried under a stream of nitrogen. The sterolic residue is resuspended in 100 μΙ 100% acetonitrile for analysis by high performance liquid chromatography (HPLC) (Szczebara et al, 2003) or in 100 μΙ hexane for gas chromatography (GC) analysis. ) (Duport et al, 2003). 2) Free and esterified stereol extraction conditions in the yeast for qualitative analysis (procedure 2).

The strains are grown in rich medium (10 g of bacteropeptone per liter and 10 g of yeast extracts per liter) with 2% glucose as carbon source to obtain 500 mg of lyophilized cells. These dried cells are taken up in three ml of 100% methanol containing 1 g of KOH and a trace of pyrogallol, then the mixture is incubated for 45 minutes at 90 ° C. After return to room temperature, sterols are extracted with 5 ml of hexane. The organic phase is separated into three samples of the same volume and dried under a stream of air. Two of the extracted sterol samples are taken up in 100 μΙ hexane for analysis by gas chromatography (GC) and gas chromatography coupled to GC / MS mass spectrometry and the third sample is taken up in 150 μΙ methanol for high performance liquid chromatography (HPLC) studies.

Example 6: Analyzes of free and esterified sterols in the lipid by gas chromatography (GC). 1) gas chromatography (GC) with FID detection (flame ionization) Sterolic extract (free or total) suspended in hexane is prepared according to procedure 1 (as per example 5 1) a) and b)). An injection test is added to the sterol mixture, in general or cholesterol at a concentration of 10 to 50 ng / μΙ.

Then 1 to 3 μΙ of samples are injected onto a gas chromatography apparatus under the following conditions. 1 to 3 μΙ were injected onto an Alltech SE3Q type column (column reference: 30mX0.32 mm IDX 0.25 pm). The vector gas is helium. Split ratio is between 50 and 80. The head pressure of the column is 207 kPa (30 psi). The injector is set at 280 ° C. The initial column temperature is 130 ° C for 0.5 min. It rises at 230 ° C at 40 ° C / min, after 230 ° C at 280 ° C at 3 ° C / min. The column is then kept at 290 ° C. The detector temperature is 310 ° C. 2) gas chromatography (GC) with FID detection (flame ionization) coupled with mass spectrometry (GC / MS). The sterolic extract suspended in hexane is prepared according to procedure 2. The GC used is equipped with a classic split split less injector with a classic DB5 column with a length of 30 meters and a diameter of 0.25 mm. The injection is performed at 230 ° C with, as a vector gas, helium at a flow rate of 2 ml / min. The column goes from 130 to 290 ° C in 4 steps. The column is maintained at 130 ° C before injection, then rises to 230 ° C with a 40 ° C / min ramp, after 230 ° C to 280 ° C with a 3 ° C / min ramp after 280 ° C ° C to 290 ° C with a ramp of 30 ° C / min. The column remains for 5 minutes at 290 ° C.

Upon leaving the gas chromatography column, the molecules are then analyzed by vaporization mass spectrometry in an ionization chamber, such as that of a Perkin Elmer turbo-type apparatus. The molecules are fragmented by a beam of energy electrons. The different fragments are separated on a quadripolar filter, then detected on an ion detector. Each mass located on the ion current graph corresponds to a mass spectrum that groups the masses of all M + ion fragmentation products. This mass spectrum obtained at a given column retention time is compared to fragmented product libraries as well as those described by the sterols by Quail and Kelly. (Methods in Molecular Biology Vol53 Yeast Protocols Edited by Evans; M. Quail and S. Kelly, The Extraction and Analysis of Sterols from Yeast "pp 123-131 (1996)).

Thus, the effect of the deletion of the ERG6 gene on the WGIF01 strain can be highlighted, notably the absence of ergosta 8,24 (28) dienol and the presence of cholester-type sterol that has a double bond in 24 (25). ).

Example 7: Analysis of free and esterified sterols in the lipid by high performance liquid chromatography (HLPC) with UV detection or mass spectrometric detection. 1) HLPC analysis UV detection: 10 to 30 μΙ of sterolic extract (suspended in acetonitrile or methanol and prepared according to procedure one or two (according to example 5)) are injected onto a RP18, 4.6X1 ground X type column Omm (Waters, Milford, MA01757 USA). The separation is made over a gradient composed of water containing 0.02% TFA (trifluoroacetic acid) (buffer A) and pure acetonitrile (buffer B). The column is maintained at 60 ° C during analysis. The HPLC apparatus used is a "Waters 600 E System Controller" type (Waters, Milford, MA01757 USA). Diode bar UV detection spanning wavelengths from 206 to 350 nm. The column was equilibrated with 20% (v / v) buffer A (acetonitrile) and 80% buffer B (water containing 0.02% TFA (trifluoroacetic acid)). A linear gradient is made from a solution containing 50% Buffer A and 50% Buffer B. After 10 minutes, the purification buffer composition is 25% Buffer A to 75% Buffer B. A new gradient is applied so that at 30 minutes the gradient reaches 100% in Buffer B. This value is maintained for 5 minutes to clear the column. 2) HPLC analysis mass spectrometric detection (H-PLC / MS): In the case of mass spectrometric analysis, the sample is kept at 30 ° C, and the column is kept at 60 ° C during the analysis. The HPLC apparatus used is of the "Alliance HT Waters 2790" type, coupled to a "Waters MicroMass ZQ" mass detector. Unlike the preceding detection method, purification buffer A does not contain TFA, but both buffers A and B contain 0.01% (v / v) formic acid. The column was equilibrated with a buffer containing 80% buffer A '(water containing 0.01% (v / v) formic acid) and 20% buffer B' (acetonitrile containing 0.01% (v / v) formic acid). The injection is triggered with a buffer containing 50% of these two buffers. A linear gradient with two ramps is made from a solution containing 50% buffer A 'and 50% buffer B'.

After 10 minutes, the purification buffer composition is from 25% buffer A 'to 75% buffer B'. The gradient ramp is then modified to reach 12.5% Buffer A 'and 87.5% Buffer B' after 25 minutes of analysis, then 100% Buffer B with 30 minutes. This value is kept for 5 minutes to regenerate the column. The "Waters MicroMass ZQ" mass detector is set to scan electrospray positive ionization at m / z values ranging from 295 to 450. A continuous acquisition mode is chosen for scanning. On the other hand, a "SIR" mode signal extraction is done in parallel to all expected masses in natural isotopic abundance for the sterols to be analyzed. The detector is set to resolve completely without interference from molecules differing by 1 unit m / z. All acquisitions are parameterized so that the total acquisition duration corresponding to the scan and the total acquisition time of the CRS set is still less than 2 seconds.

Example 8: Cultivation of yeast strains for analysis of 13C-labeled or unlabelled sterol content: The strains to be analyzed were grown in a 50 ml volume of Kappeli medium (Kappeli et al., 1985) containing 2% D -glucose or D-glucose-U-13C6 (for labeling experiments, as shown in figure 10). The optical density of the starting culture is 0.1 to 600 nm. This culture is incubated for 72 hours at 30 ° C under shaking at 200 rpm.

The cells are then recovered by centrifuging the medium at 600 g for 10 minutes. Cell residue is then analyzed directly by the analysis techniques given in example 5 (for studies that do not require galactose induction).

However, for delta 7-reductase and A24-reductase expression induction kinetics studies (strains transformed by plasmid pYESjMa24 and / or pAG1), the residue is resuspended in 50 ml of fresh Kappeli medium containing 2% galactose. (unlabelled 13C).

This culture is incubated at a temperature of 30 ° C under shaking at 200 rpm. 10 ml of culture is recovered after 0 hour, 2 hours, 4 hours, 8 hours and 24 hours of cultures.

These culture samples are centrifuged at 800 g for 10 minutes, the cell residue is frozen and stored at -20 ° C prior to sterol extraction by the methods described in example 5.

Example 9: Identification of sterols present in the analyzed strains: Identification of sterols is based on the combination of the following principles: - Comparison of behavior in GC, HPLC, GC / MS and H-PLC / MS with authentic standards for campesterol (ergosta 5, eneol), ergoesterol (ergosta 5,7,22 trienol), colestrol; (colesta 5-eneol), desmoesterol (colesta 5.24 dieneol), colesta 5.22 dieneol and zytester-rol (colesta 8.24 dieneol): - HPLC absorption spectrum analysis and UV bar detection diodes (according to example 7-1)): This method allows unambiguous identification of the spectral base 5 sterol classes: 1) class SA1: no conjugated diene system, 2) class SA2: presence of a 5,7-diene system; 3) SA3 class: presence of a 22.24 (25) dienic system; 4) class SA4: presence of a 8.14 dienic system; 5) class SA5: presence of a 22,24 (28) dienic system. Classes SA3 and SA5 cannot coexist for structural reasons. Classes SA2 and SA4 cannot coexist for biosynthesis reasons, class SA2 can be associated with structural motifs of classes SA1, SA3, SA5 to form additive composite spectra. - analysis of GC and HPLC retention times on the basis of an approximate additivity of retention time offsets associated with each unsaturation type and the presence of an upright and colesta structure. This criterion is not absolute, it is used as an identification aid and to raise ambiguities, but presents a risk of error if used alone. Therefore it is only used in combination with the other criteria; GC / MS analysis (as per example 6-2) providing molecular weight and fragmentation profile that can be compared to spectrum libraries; - HPLC / MS analysis (as in Example 7-2) on electrospray which provides, in the case of 3-hydroxysterols, a major signal at molecular mass -17 (protonation (+1) and loss of one water molecule (-18) ); - analysis with the above systems of the composition in sterols of different reference yeast strains disrupted at different points of biosynthesis; - analysis of the variations in the sterol composition of the complementation by different biosynthesis enzymes and the kinetics of this complementation upon induction of such complementation; - analysis of the marking profile of the different sterols by carbon isotope 13; - UV spectrum analysis of sterols separated by HPLC at a determined retention time.

The two conjugate double bonds 5, 7 have a typical spectrum with two absorption peaks between 265 and 280 nm, while the two conjugate double bonds 22, 24 have an absorption peak at 235 nm. The last conjugated double bond at 8.14 is identifiable by an absorption peak at 245 nm.

Example 10: Identification of BMA64 strain sterols: BMA64 strain is grown in a 50 ml volume of Kappeli medium containing 2% D-glucose for quantitative and comparative sterol analysis. The optical density of the starting culture is 0.1 to 600 nm. This culture is incubated 72 hours at 30 ° C under shaking at 200 rpm.

The cells are then recovered by centrifuging the medium at 600 g for 10 minutes, the cell residue is analyzed by the techniques in example 5. The different analyzes described allowed to identify the sterols produced by this strain.

It was thus determined that this strain accumulates more than 80% of its free sterols in the form of ergoesterol (ergosta 5,7,22 trienol) (as shown in figure 8). Two other detectable minority sterols are produced by this strain: ergosta 5,7 dieneol (substrate of the ERG5 gene product) (12%) and zlmoesterol (ergosta 8,24 dieneol) (5%). No trace of cholesterol is detectable (the detection limit of the method is approximately 0.5% of observable sterols). Small amounts of lanester are also detectable (only at the level of total sterol analysis).

Example 11: Identification of sterols present in strain WGIF01: - strain WGIFQ1 (according to example 1) was grown in a 50 ml volume of Kappeli medium (Kappeli et al, 1985) containing 2% D-glucose for quantitative analysis and comparative of sterols. The optical density of the starting culture is 0.1 to 600 nm. This culture is incubated 72 hours at 30 ° C under shaking at 200 rpm.

The cells are then recovered by centrifuging the medium at 600 g for 10 minutes, the cell residue is analyzed by the techniques shown in example 5. The different analyzes described allowed to identify the sterols produced by this strain. The chromatogram for ergost 5,7,22 trienol (ergoesterol) or ergost 5,7 dieneol is negative (less than 0,5% of the value obtained from BMA64) on HPLC coupled with mass spectrometry. At the level of free sterols, the strain accumulates for 50% of the total zymolesterol (8.24 dieneol colesta), substrate of the ERG6 gene product, and for 30 and 20% respectively of the 5.7.24 trienol colesta and colesta. 5,7,22,24 tetraenol probably resulting from a synthesis mechanism identical to that which leads to the erythema 5,7 dienol and the erythema 5,7,22 trienol in the parenteral strain (as shown in figures 3 and 8). This shows well that the biosynthesis pathway is blocked at the erg6 level, as the enzyme ERG6p (S-adenosylmethionine delta24 sterol C-methyl transferase) transforms the 8.24 (25) dieneol basket into ergosta 8, 24 (28) dieneol (as in figure 2). This accumulation clearly indicates that the WGIF01 strain has no functional copy of the erg6 gene. The results also indicate that the normal biosynthetic pathway of ergoesterol in the lidum, and in particular sterol 8,7-isomerase, sterol 5-desaturase and sterol delta 22-desaturase, are capable of converting cholestan-type substrates with an activity. that remains important.

Example 12: Production of the WGIF02 strain and identification of the sterols present in that strain: The WGIF02 strain was obtained by transformation of the WGIF01 strain by plasmid pYES2 carrying the Δ24 reductase expression cassette (pYES_delta24, as per example 3). The clones were selected on a medium free of uracil and the presence and expression of the Δ24 reductase cDNA is verified by analyzing the sterols of these transformers by procedure 1 (see example 5-1).

A clone named WGIF02 was selected because it had a different sterolic profile than the WGIF01 strain, and the supplemental sterol had a retention time close to that of cholesterol (see Figure 7). The WGIF02 strain is grown in a 50 ml volume of Kappeli medium (Kappeli etal., 1985) containing 2% D-glucose for quantitative and comparative sterol analysis. The optical density of the starting culture is 0.1 to 600 nm. This culture is incubated for 72 hours at 30 ° C under shaking at 200 rpm.

The cells are then recovered by centrifuging the medium at 600 g for 10 minutes, the cell residue is analyzed by the techniques shown in example 5. The different analyzes described allowed to identify the sterols produced by this strain.

The two profiles of WGIF01 strain and WGIF02 strain steroid extracts are similar, except for the emergence of a new peak identified by their mass, retention time, and their conjugated double bonds as the colene 5,7,22 trieneol (Figures 2, 3). 3 and 7). The presence of this compound indicates the expected presence of a 24-25 sterol reductase activity on the 24 (25) double bond of the colesta 5,7,22,24 (25) tetraenol. In addition, the amount of basket 5, 7, 24 trienol is decreased with the appearance of basket 5, 7,22 trienol in strain WGIF02 (Figures 7 and 8). Enzyme activity is highlighted by the conversion of the 5,7,24 trienol basket representing 30% in the WGIF01 strain and only 12% in WGIF02, the difference being 18% being wholly in the form of the basket 5,7, Trienol in strain WGIF02. This is an unexpected result as the conversion product of colesta 5.7, 24 by delta 24 reductase is colesta 5.7, which is absent in WGIF02, therefore quantitatively converted to colesta 5, 7, 22. This highlights another unexpected result, namely that colesta 5.7 is a substrate of sterol 22 desaturase, whereas cholesta 5,7,24 is from the sterol profile of the WGIF01 strain a poor substrate.

Example 13: Production of strain WGIF03 and identification of sterols present in strain WGIF03 was obtained by transformation of strain WGIF01 by plasmid pAG1. This "navette" plasmid between E.coli and S.cerevisiae carries an expression cassette for Δ7 reductase, the corresponding cDNA of which is under the control of the GAL10 / CYC1 promoter. The WGIF01 strain was transformed by the lithium chloride technique and the transformants were selected on medium containing no adenine. Delta7 reductase expression was verified by the appearance in the sterolic profile of the good 5,24 (25) dienol cholester clones. A clone matching these criteria was most particularly selected and named WGIF03. The WGIF03 strain was grown in a volume of 50 m! Kappeli medium (Kappeli et al, 1985) containing 2% D-glucose for quantitative and comparative sterol analysis. The optical density of the starting culture is 0.1 to 600 nm. This culture is incubated 72 hours at 30 ° C under shaking at 200 rpm.

The cells are then recovered by centrifuging the medium at 600 g for 10 minutes, the cell residue is analyzed by the techniques shown in example 5. The different analyzes described allowed to identify the sterols produced by this strain. The expression of delta7 sterol reductase in strain WGIF01 (to give strain WGIF03), contrary to the expression of delta24 sterol reductase, leads to a profound change in the sterol profile of the strain with almost total disappearance of the tetraenol 5,7,22,24 of the 7.24 dieneol samples and of the 8.24 dienol samples.

This activity is also marked by the appearance of a major peak identified as previously described as cholesta 5, 24 dieneol or desmoesterol. The amount of 8.24 dieneol basket increases from 12 to 48%. Cholesterol 5,7,24 trieneol detected increases from 30 to 3% and cholest 5,7,22,24 tetraeneol detected from 23 to 4%, respectively for strains WGIF01 and WGIF03. These observations unexpectedly indicate that sterol delta 7-reductase reduces colens 5,7 dienol almost independently of the nature of the sterol side chain unsaturation. This result is opposite to that observed with sterol delta 24-reductase. Unexpectedly, the expression of sterol delta 7-reductase also leads to the accumulation (12%) of a co-migrating molecule with colene 5,7 dieneol. However, it seems unlikely, although it is not excluded that this molecule belongs to the 5.7 dieneol colesta, whose theoretical level should decrease rather than increase under these conditions. The appearance of a small amount of trienol 5,22,24 (8%) is also of interest. The latter sterol is the expected product of the action of sterol 22-desaturase on 5.24 dienol major sterol (60%) in the WGIF03 strain (resulting from reduction of cholester 5,7,24 trienol by sterol delta 7-reductase). The small accumulation of the 5,22,24 trienol basket unexpectedly indicates that the 5,24 diene basket! It is not a good substrate for sterol 22 desaturase. Thanks to the results obtained in strain WGIF02 (as in example 12), it can be deduced that the presence of an unsaturation at 24 (colesta 5, 24 dienol or colesta 5,7,24 trienol) makes sterols difficult to metabolize by sterol 22- desaturase. The action of the enzyme ERG6p, transforming the unsaturated cholests in 24 to erect, leads, therefore, to transform from bad substrates of the ERG5 (22-desaturase) gene into good substrates.

Example 14: Production of strain WGIF04 and identification of sterols present in strain WGIF04 was obtained by transformation of strain WGIF02 by plasmid pAG1 by the lithium chloride technique and transformants were selected on medium containing neither adenine nor uracil. Good transformants were then confirmed on the basis of detection of cholesterol accumulation. A clone matching these criteria was most particularly selected and named WGIF04. A sample of the strain was deposited with the Nationale Collection of Microorganism Cultures (CNCM) Institut pasteur, 25 rue du Docteur Roux 75724 Paris Cedex 15, France, on April 22, 2004 under registration number I-3203.

Indistinguishable strains of WGIF04 can also be obtained by transforming strain WGIF03 by pYES_Delta24 and applying the same selection. The WGIF04 strain was grown in a 50 ml volume of Kappeli medium containing 2% D-glucose for quantitative and comparative sterol analysis. The optical density of the starting culture is 0.1 to 600 nm. This culture is incubated 72 hours at 30 ° C under shaking at 200 rpm.

The cells are then recovered by centrifuging the medium at 600 g for 10 minutes, the cell residue is analyzed by the techniques presented in example 5. The different analyzes described allowed to identify the sterols produced by this strain. Cholesterol represents 25% of the free sterols of the WGIF04 strain (as in figure 9). Cholesterol formation in this strain is independently demonstrated in GC and HPLC by co-migration with an authentic standard and confirmed at the same time in GC / MS and H-PLC / MS. Cholesterol is undetectable (<0.5% of total sterols) in all strains that do not simultaneously express delta 7-reductase and delta 24-reductase.

Strains that are not disrupted for the erg6 gene can produce cholesterol, however, it represents less than 5% of total free sterols. Thus, the BMA64-pYES_Delta24-pAG1 strain obtained from BMA64 co-transformed by pYES_Delta24 and pAG1 could be constructed. This strain produces cholesterol, which represents some% of total sterols. The CA10 strain was transformed by plasmid pYES_Delta24. This strain also produces cholesterol, which represents some% of total sterols. On the other hand, it can be shown that the formation of cholesterol; greatly requires the induction of delta 7-reductase and A24-reductase promoters (see Figures 4 and 5). Strains containing these genes do not produce cholesterol in the absence of induction; Figure 5 indicates that the maximum cholesterol level is reached after approximately 24 hours of induction. Parallel to the formation of cholesterol (cholester 5-eneol) also occurs the formation of cholester 5,22 dieneol. Analysis of Figure 4 and Figure 5 indicate that the formation of this compound occurs more rapidly after induction than cholesterol formation and begins just before induction (see Figure 5A: m / z = 367). However, this compound is completely absent if the strain does not carry both plasmids pAG1 and pYES_Delta24. The formation of 22-dehydrocholesterol is therefore a faster process than that of cholesterol formation, but this process implies a precursor that quickly disappears after induction leaving room for cholesterol formation. Cholesterol can be formed from colony 5.24 through Δ 24 reductase or from colony 5.7 through Δ7 reductase. However, it has been shown that the 5.7 dienol colesta cannot accumulate due to its immediate conversion to the 5,7,22 trienol colesta. The source of cholesterol is, therefore, the 5.24 dienol cholesta which is absent at the time of induction and accumulates for 4 to 8 hours of induction before decreasing to 24 hours (Figure 5). This explains the late onset of cholesterol, as prior synthesis of 5,24 dieneol cholesta is required. In contrast, the two possible precursors of colesta 5,22 dieneol are colesta 5,7,22 trienol and colesta 5,22,24 trienol. This is absent at the beginning of induction (Figure 4), while the former is present, then decreases rapidly in parallel with the stabilization of the 5,22 dienol basket formation. It can be concluded from this that the source of cholesterol is the reduction of 5.24 dieneol by Δ 24 reductase, whereas the formation of the 5.22 dienol cholesta results from the reduction of 5,7,22 trienol by A7reductase. Cholesterol 5.22 dienol formation by A22-desaturase action on cholesterol is not entirely excluded, but it appears to be a minority process on the basis of preferential cholesterol accumulation over cholester 5.22 dieneol at long (24h) time. kinetics (Figures 4 and 5).

Example 15: Optimization of the cholesterol biosynthesis pathway Role of A22-desaturase: For 24-hour induction durations of the WGIF04 strain the 5.22 dieneol basket accumulation represents approximately 50% of that of the cholesterol at the level of free sterols (Figure 4). Disruption of the A22-desaturase gene is an option for optimizing cholesterol production. Production of a double disrupted strain at the Δ22-desaturase level is an option for optimizing cholestrol production. The production of a double disrupted strain at the level of delta 22 desaturase (erg5 gene) and the erg6 gene and expressing A7 reductase and A24 reductase is perfectly considerable. One strain carrying the subset: Δ 22-desaturase disruption, A7-reductase expression and A24-reductase expression was performed.

This strain was obtained by transformation of strain CA10 by plasmid pYES_Delta24 by the lithium chloride technique and by selection for uracil prototrophy. The strain obtained was named CA10 / Δ24. The CA10 strain expressing the Δ24 sterol reductase produces a relatively small amount of cholesterol (as shown in Figures 6 and 7) and accumulates to a greater extent 5-eneol and, in an intermediate manner, eries 5.7 dieneol. The 5.7 dienol basket accumulation is very small in this strain, indicating that disruption of the erg6 gene is indispensable for the significant accumulation of colesta series derivatives. A24-reductase activity is therefore unexpectedly uncompetitive with that of the erg6 gene product. It can therefore be concluded from these results that simultaneous disruption of the erg5 and erg6 genes is important in order to optimize cholesterol production. Disruption of the erg5 gene into the WGIF04 strain would allow the technician to considerably increase cholesterol production. The way to achieve this strain is established by the production of strains WGIF04 and CA10 / Δ24 and the fact that this strain is just an obvious genetic combination of producing two previous strains. Data from WGIF04 indicate the rapid disappearance of cholesta 5,24 when expressing Δ 24 reductase (comparing the results obtained with WGIF03 and those obtained with WGIF04). This allows us to predict very effective synthesis of cholesterol in a strain disrupted simultaneously by the erg5 and erg6 genes, and co-expressing A7 reductase and A24 reductase, cholesterol being the only terminal sterol.

In conclusion, the minimum required for cholesterol production within 20% or more of total sterols is disruption of the erg6 gene, expression of A7 reductase and A24 reductase. Complementary disruption of Δ 22-desaturase would improve cholesterol productivity and eliminate parasite formation of 5, 22 dieneol as terminal sterol.

Example 16: Isotopic Cholesterol Labeling and Definition of Isotopic Signatures The principle of obtaining a labeled cholesterol is described in Figure 10. This manipulation initially consists of growing the fully labeled 13C glucose lipid during 72 hours of culture at 30 ° C. .

The cells are then recovered by centrifuging the medium at 600 g for 10 minutes. The cell residue is then suspended in 50 ml fresh Kappeli medium containing 2% 13C unlabelled galactose. Cultures are stopped 2 hours, 4 hours, 8 hours or 24 hours after galactose passage, sterols are extracted, then analyzed (as per example 7). Glucose passage in galactose induces the GAL10 / CYC1 promoters while controlling the A7-reductase gene and that of the A24-reductase. Simultaneously, there is change of isotopic marking of the carbon source. This is followed by the de novo synthesis of metabolic intermediates, after sterol, including cholesterol and a progressive labeling change. This marking change can be characterized by the mass profile of each intermediate sterol. Indeed, the incorporation of each 13C atom yields a mass offset of one atomic mass unit (UMA). Thus, for example, cholesterol appears with a molar mass ranging from 386 to 413 Daltons, depending on the level of labeling. In HPLC mass analysis using positive electrospray ionization this corresponds to m / z (mass / charge) ranging from 369 to 396 (M + H + -H2O ion, M + 1-18 = 385-17 = 369). The retention time of sterols on HPLC is not detectable depending on the level of labeling. The mass spectrum of an HPLC peak corresponding to a single "X" sterol corresponds to a mass distribution which is therefore the superposition (the sum) of the mass distributions of the sterol "X" synthesized at different times after marking. It is therefore a complex but perfectly experimentally determinable profile (Figure 11), representing a unique isotopic signature which depends at the same time on: 1) the labeling protocol and in particular durations and culture conditions in 12 C and 13 C galactose; 2) the precise genetic structure of the strain used; 3) Precise time to stop crops.

This isotopic profile has several unique properties: - It is modulable at will, acting on the culture conditions, the strain used and the sterol chosen. A single marker record can therefore be produced; It is combinable to know that several isotopic signatures corresponding to several unique sterols marked by modulable isotopic profiles themselves can be combined to form a "molecular alphabet"; - It is reproducible and easy to determine experimentally (cf Figures 11 and 12), double or triple traces indicating the reproducibility of the profiles; - It is an easy-to-isolate, stable, colorless and odorless, non-volatile, non-toxic and incorporable traceable molecular mixture into foods, medicines, additives or other assimilable products. - It is unfalsifiable except that it has specific recombinant strains and very precise labeling, cultivation and extraction conditions. Moreover, knowledge of the isotopic signature does not allow to rise to the parameters that allowed to produce it.

In short, a falsifiable "isotopic alphabet" of general use and incorporable into any kind of products, including consumables, was invented. The "isotopic words" constituted from this alphabet are almost unlimited in number while taking advantage of the marking profiles and the different types of sterols. The incorporation of such signatures into a variety of products is therefore a unique method of unfalsifiable labeling, unlike, for example, reproducible DNA signatures once known. On the other hand, the signature can be read non-destructively, for example by laser ionization followed by mass spectrometric analysis (MALDI-TOF or assimilated).

Example 17: Production of 13C-highly labeled non-animal cholesterol. The use of 13C galactose or 13C glucose or ethanol in place of unlabelled carbon sources for the WGIF04 strain culture under the conditions described above for sterol analysis allows the synthesis of sterols and in particular very markedly labeled cholesterol (comprising at least 95% carbon 13C). The preparation of sterols and 14C radioactive cholesterol is also by the same approach. The process can also be incorporated into yeast strains producing steroids and notably hydrocortisone (as per WO 02/061109) to produce 13C or 14C labeled steroids, for example for RIA tests.

Example 18: Production of a strain producing mostly cholesterol. The strain CDR07 kills is described in patent application published under number W002061109 and has been filed with the Nationale Collection of Microorganism Cultures (CNCM), 25 rue Docteur Roux, 75724 Paris Cedex 15, France, in accordance with the provisions of the Budapest treaty at CNCM on January 24, 2001, with order number 1-2616. The CDR07 MATa strain (pertinent markers: a- de2 :: GAL10 / CYC1p :: A7; erg5 :: PGK1p :: hygroR; ERG6) was crossed with strain WGIF01 described in example 1 (pertinent markers: ERG5; erg6 :: TRP1 ).

Following diploid sporulation, the sterol composition of the spurs is determined to find desmoesterol-producing spurs that is the precursor of cholesterol as described in example 6. Thus a desmoesterol-producing spore having a functional TRP1 gene carrying the cDNA was identified, Δ7 reductase of Arabidopsis thaliana, as indicated by PCR analysis. In addition, this strain, called YIM59, is hygromycin sensitive, indicating that the ERG5 gene is functional.

A sterolic preparation prepared as described in Examples 6 and 9 has shown that this strain YIM59 produces sterols having the same retention time as zymoesterol and desmoesterol. The YIM59 strain has also been shown auxotrophy by adenine, leucine, uracil and histidine. The presence of demosterol demonstrates that this strain expresses sterol Δ7 reductase and that it carries a non-functional ERG6 allele.

In order to improve the level of human DHCR24, the nucleotide sequence of the DHCR24 cDNA has been modified; In order to improve translation at primer ATG level, the promoter controlling DHCR24 expression was also modified. The new promoter chosen is the cytochrome C1 promoter CYC1 in place of the inducible promoter GAL1 of plasmid pYES_delta24 (as per example 3). The sequence corresponding to NH2 ends! of the DHCR24 reductase in fusion with the CYC1 promoter was modified as follows: Below is the nucleotide sequence of the CYC1 promoter, then the AttB1 recombination sequences, then an AAAA sequence preceding the initiator ATG. The sequence of the first two codons was also modified (GAA-CCT sequence after the ATG starter codon). The final plasmid carrying the DHCR24 cDNA under control of the CYC1 promoter, as well as the S. cerevisiae 2μ origin of replication and the URA-3-d selection marker was named plM331. Its equivalent without the DHCR24 cDNA was called plM303. The YIM59 strain was independently transformed by the plasmids plM303 and plM331 and two transformers carrying the plasmid plM303 (strain YIM59 / plM303) or plM331 (strain YIM59 / plM331) are more particularly selected.

These strains are grown in a rich Kappeli reconstituted medium for 72 hours at 28 ° C to reach an absorbance of 40 to 600 nm. Total sterol extracts (esterified sterols and free sterols) of strain YIM59 / plM303 (not bearing DHCR24 cDNA) and strain YIM59 / plM331 (bearing ο cDNA of DHCR24) are performed in the presence of methanolic potash (as examples 5 and 6) . These two strains are tested for their ability to produce cholesterol. A portion of the results (GC) is shown in Figure 13. The retention times given are given in minutes on both chromatograms. It could thus be shown that the strain that does not carry the DHCR24 expression vector (strain YIM59 / plM303) does not produce cholesterol (part A), but mainly desmoesterol (part A). In contrast, the strain carrying the DHCR24 cDNA (cepaYIM59 / plM331) produces a sterol having cholesterol retention time (part B). It could be demonstrated by gas chromatography techniques coupled to an electronic impact mass spectrometer (as described in example 6) that this sterol is well cholesterol. Using the surfaces of each of the sterol peaks, the amount of cholesterol produced by the YIM59 / plM331 strain could be estimated at 57% of sterols.

Deposit of biological material The following organisms were deposited on April 22, 2004 with the Nationale Collection of Microorganism Cultures (CNCM), 25 rue du Docteur Roux, 75724 Paris Cedex 15, France, according to the provisions of the Budapest Treaty, - strain WGIF04 filed under registration number I-3203. All publications and patents cited are incorporated herein by reference.

Reference Listing - Adams, A.K., and C. Holm. 1996. Mol CelIBiol. 16: 4614-20. - Ausubel Fred M., Brent Roger, Robert E. Kingston, David D. Moore, Seidman J.G., John A. Smith, Struhl Kevín (Editeurs). Current Protocols in Molecular Biology, published by Jobn Wiley & Sons Inc. Current Protocols Cus-tomer Service, 605 Third Avenue, 9th Floor New York, NY10158 USA (de-edition mise à jour de Mars 2002). Baudin-Baillieu, A., E. Guillernet, C. Cullin, and F. Lacroute. 1997. Yeast 13: 353-6. - Bonneaud, N., 0. Ozier-Kalogeropoulos, G.Y. Li, M. Labouesse, L. Min-vielle-Sebastia, and F. Lacroute. 1991, Yeast. 7: 609-15. - Bowman, S. et al. 1997. Nature. 387: 90-3. - Duport, C., B. Schoepp, E. Chatelain, R. Spagnoli, B. Dumas, and D. Pompon, 2003. Eur J Biochem. 270: 1502-14. Gietz, R.D., R.H. Sochiestl, A.R. Willems, and R.A. Woods. 1995. Yeast. 11: 355-60. Goffeau, A., et al., 1996. Science. 274: 546.563-7. - Jensen-Pergakes, K.L., M.A. Kennedy, N.D. Lees, R. Barbuch, C. Koegel, and M. Bard. 1998. Antimicrob Agents Chemother. 42: 1160-7. Kaneshiro, E.S., J.A. Rosenfeld, M. Basselin-Eiweida, J.R. Stringer, S.P. Keely, A.G. Smulian, and J.L. Giner. 2002. Moi Microbio! 44: 989-99. Kappeli, O., M. Arreguin, and M. Rieger. 1985. JGen Microbiol. 131: 1411-6. - Kelly, S.L., D.C. Lamb, B.C. Saldwin, A.J. Corran, and D.E. Kelly 1997. J BiolChem. 272: 9986-8. Lecain, E., X. Chenivesse, R. Spagnoli, and D. Pompon. 1996. J Biol Chem. 271: 10866-73. McCammon, M.T., M.A. Hartmann, C.D. Bottema, and L.W. Parks. 1984. J Baderíol. 157: 475-83. - Moebius, F.F., B.U. Fitzky, J.N. Lee, Y.K. Paik, and H. Glossmann. 1998. Proc NatlAcad Sci USA. 95: 1899-902. - Noda, H., and Y. Koizumi. 2003. Insect Biochem Mol Biol. 33: 649-58. Ozier-Kalogeropoulos, O., A. Malpertuy, J. Boyer, F. Tekaia, and B. Dujon. 1998. Nucieic Acids Res. 26: 5511-24. - Skaggs, B.A., J.F. Alexander, C.A. Pierson, K.S. Schweitzer, K.T. Chun, C. Koegel, R. Barbuch, and M. Bard. 1996. Gene. 169: 105-9. - Sturley, S.L. 2000. Biochim BiophysActa. 1529: 155-63. Szczebara, F.M., et al. 2003. NatBiotechnol. 21: 143-9. - Tait, E., M.C. Simon, S. King, A: J. Brown, N.A. Gow, and D.J. Shaw. 1997. Fungai GenetBiol. 21: 308-14. - Taton, M., and A. Rahier. 1991. Biochem Biophys Res Comrnun. 181: 465-73. Taylor, FR., And L.W. Parks. 1978. J. Bacteriol. 136: 531-7. - Waterham, H.R., J. Koster, G.J. Romeijn, R.C. Hennekam, P. Vreken, H.C. Andersson, D.R. FitzPatrick, R.I. Kelley, and R.J. Wanders. 2001. Am Hum Genet. 69: 685-94. - Wood, V., etal. 2002. Nature. 415: 871-80.

Table I: Evaluation of the spectral contributions of sterling unsaturations (extinction coefficients nM-1cm-1) CLAIMS

Claims (15)

1. A yeast strain characterized by the fact that it produces cholesterol autonomously from a single carbon source and expresses the enzymes 7-dehydrocholesterol reductase and 3p-hydroxyester A24-reductase, in which the sterol 24- C-methyltransferase was inactivated. Yeast strain according to claim 1, characterized in that the enzyme C-22 sterol desaturase has been inactivated. Yeast strain according to claim 1 or 2, characterized in that the expression of the enzymes 7-dehydrocholesterol reductase and 3β-hydroxyester A24-reductase is obtained by transformation of the organism. Yeast strain according to any one of claims 1 to 3, characterized in that the inactivation of the enzyme sterol 24-C-methyltransferase is carried out by gene inactivation. Yeast strain according to claim 2, characterized in that the inactivation of the enzyme C-22 sterol desaturase is performed by gene inactivation. Yeast strain according to any one of claims 1 to 5, characterized in that it is chosen from the genus Saccharomyces or Schizosaccharomyces. 7. Saccharomyces cerevisiae yeast strain, characterized by the fact that it is the WGIF04 strain deposited with the Nationale Collection of Cultures of Microorganisms (CNCM) on April 22, 2004 under registration number I-3203. Process for producing cholesterol of non-animal origin, characterized in that it comprises cultivating an organism as defined in any one of claims 1 to 7. Process according to Claim 8, characterized in that the organism's cultivation step is followed by a cholesterol extraction step. Process according to Claim 9, characterized in that the cholesterol is extracted by a non-water miscible solvent. Process according to Claim 9 or 10, characterized in that a saponification step is carried out prior to cholesterol extraction. Process according to Claim 9, 10 or 11, characterized in that a step comprising mechanical milling of the cells is performed prior to saponification or extraction of cholesterol. Use of an organism as defined in any one of claims 1 to 7, characterized in that it is for the production of cholesterol, or one of its metabolic intermediate salts, or a 13C or 14C labeled sterol mixture. Process for producing cholesterol, or one of its salts of metabolic intermediates, or a 13C or 14C-labeled sterol mixture, characterized in that it comprises the following steps: - culturing an organism as defined in any of one of claims 1 to 7 on a 13C or 14C labeled substrate; and extracting said cholesterol, or one of its metabolic intermediates, or the mixture of sterols. Process for the manufacture of an isotopic mixture of cholesterol, cholesterol intermediates or metabolites, labeled at different positions with the aid of isotopic markers, comprising the cultivation of an organism as defined in any one of claims 1. 7 on a labeled substrate, then on an unlabeled substrate, the cultivation times on each of these substrates being chosen to obtain a defined isotopic profile.