BG1494U1 - A method for in vitro identification of w515a/k/l/r mutations of the mpl gene in a blood specimen - Google Patents

Abstract

The method described is intended for in vitro detection of W515A/K/L/R mutations in the MPL gene of a blood sample, it is applicable in routine clinical practice in view of timely diagnosing of chronic myeloproliferative diseases in people. The method allows to perform direct hybridization with allele-specific oligonucleotides based on marked microspheres (Luminex TM), so that when the method is applied to a whole blood sample, the final clinico-diagnostic results could be obtained in a period shorter than 5 h.

Description

Technical field

The utility model relates to a means for in vitro determination of W515 A / K / L / R mutations of the myeloproliferative leukemia (MPL) gene in a blood sample applicable in routine clinical practice for the timely diagnosis of chronic myeloproliferative diseases in humans.

BACKGROUND OF THE INVENTION

Mutations of the human MPL gene affecting the codon encoding the amino acid position W515 have been identified in a group of haematologic malignancies, mainly essential thrombocythemia (ET) and primary myelofibrosis (PMF), which are characterized by poor prognosis and medically predicted. Therefore, the availability of clinical markers for their early detection in patients' blood samples is of particular importance for the timely diagnosis of diseases and adequate medical intervention.

Patent Application US 2011/0020805 A1 proposes in vitro determination of mutations in codon 515 of the MPL gene by PCR amplification of genomic DNA, while also describing a kit for performing mutational analysis. The latter contains specific labeled genetic probes, forward and reverse primers, as well as an MPL gene fragment included in a plasmid. The determination of mutations according to this patent application is based on the so-called "Real Time" and "Light Cycler" tests, which, however, is extremely time-consuming because it requires multiple real-time PCR amplification and requires the availability of equipment , which is only available in some molecular biology laboratories.

The technical nature of the utility model

The object of the utility model is to provide a means for in vitro determination of W515 A / K / L / R mutations of the MPL gene in a blood sample, which is readily applicable in routine clinical practice for the timely diagnosis of humans.

In essence, the in vitro assay for W515 A / K / L / R mutations of the MPL gene in a blood sample, according to the utility model, is a container of any type, containing:

an ampoule with a DNA amplification mixture comprising a buffer, a DNA polymerase and two MPL-specific oligonucleotide primers, at least one of which is biotin labeled;

an ampoule containing fluorescently labeled microspheres loaded with specific oligonucleotide probes for the detection of MPL W515A / L / K / R mutations;

an ampoule containing phycoerythrin covalently bound to streptavidin;

- five reference DNA ampoules containing 1 microg / microl of wild-type MPL and mutations W515A, W515L, W515K and W515R respectively;

ampoule containing hybridization buffer and

- an ampoule containing a wash buffer.

In turn, specific oligonucleotide probes for detecting MPL W515 mutations associated with fluorescently labeled microspheres that allow detection with a flow cytometric system are represented by:

(a) oligonucleotide probe with sequence 5'-GAAACTGCCACCTCAGCA-3 (for wild-type MPL) (b) oligonucleotide probe with sequence 5-GAAACTGCGCCCTCAGCA-3 (for the W515 A mutation) (c) oligonucleotide probe GTC-CCTC with CTC-CA (for W515K mutation) (d) oligonucleotide probe with sequence 5-GAAACTGCAACCTCAGCAG-3 (for mutation W515L) (e) oligonucleotide probe with sequence 5-GAAACTGCCTCCTCAGCAG-3 (for mutation W515R).

MPL oligonucleotide primers labeled with biotin at the 5'-end are represented by:

a) Oligonucleotide primer with sequence 5-TAGCCTGGATCTCCTTGGTG

b) an oligonucleotide primer with sequence 5-AGAGGTGACGTGCAGGAAGT-3.

In this composition, the agent, according to the utility model, allows direct hybridization with allele-specific oligonucleotides bound to labeled microspheres (Luminex TM), so that applied to the whole blood sample, the final results in clinical diagnosis can be obtained within a less than 5 hours; it allows the rapid and accurate quantification of the most common mutations affecting the MPL gene and associated with chronic myeloproliferative diseases to be carried out with an analytical sensitivity of 1%, which is essential for the diagnosis, prognosis and appointment of adequate treatment of patients; allows simultaneous examination of many samples in plaques containing 96 or 386 wells with different samples; the composition of the agent may be further supplemented by probes, microspheres and other primers to allow simultaneous detection of any known or future mutations related to chronic myeloproliferative diseases,

Explanation of the annexed figures

Figure 1 represents the analytical sensitivity of the agent;

Figure 2 represents the threshold for the selection of positive samples for individual mutations.

The means for determining W515A / K / L / R mutations in the human MPL gene according to the present utility model is illustrated by the following exemplary embodiments without limiting its scope.

Example 1.

The in vitro determinant of W515A / K / L / R mutations in the human MPL gene, according to the utility model, is a container of any kind containing an ampoule of 5 species of fluorescently labeled microspheres in solution (Tris EDTA buffer with pH 8, 0) with a total concentration of 960 pcs. for one DNA sample, the first type of microspheres being conjugated to a 10 pmol oligonucleotide probe with sequence 5'GAAACTGCCACCTCAGCA-3 (for wild-type MPL). The second species is an oligonucleotide probe with sequence 5-GAAACTGCGCCCTCAGCA-3 (for the W515A mutation), the third species is an oligonucleotide probe with sequence 5'-GAAA CTGCTTCCTCAGCAG-3 (for the W515K mutation) -3 (for W515L mutation), and the fifth species with an oligonucleotide probe with sequence 5'-GAAAC TGCCTCCTCAGCAG-3 (for W515R mutation).

In a separate ampoule is placed a DNA amplification mixture which, for a reaction of 25 microl, includes 2.5 microl PCR buffer (Invitrogen), 1.5 U Taq polymerase (Invitrogen); 3 mM MgCl ₂ ; 0.2 mM dNTP mixture, 10 pmol MPL oligonucleotide primer with sequence 5-TAGCCTGGATCTC CTTGGTG, which is labeled with biotin at the 5'-end, and 10 pmol MPL oligonucleotide primer S'AGAGGTGACGTGCAGGAAGT, which is labeled with biotin at the end-biotin .

The container also contains an ampoule containing 10 pmol phycoerythrin covalently bound to streptavidin (SAPE), five ampoules with reference DNA containing the wild-type MPL, respectively, and the W515A, W515K, W515L and W515R mutations at a concentration of 1 microg / microl, ampoule containing 150 µl wash solution (for each sample) and an ampoule with 20 µl hybridization buffer (Wakunaga Pharmaceuticals) (for each sample).

Utility model action

To a vessel containing 20 µl of DNA, the amplification mixture was added 100 ng of plasmid or genomic DNA and the mixture was cyclically amplified at the following temperature regime: 95 ° C for 5 min; 35 cycles of 95 ° C for 30 s, 58 ° C for 40 s, 72 ° C for 2 min and a final extension of 72 ° C for 10 min. Then, 5 microl of each PCR product was mixed with 20 microl hybridization buffer (Wakunaga Pharmaceuticals), 3 microl mixture of microspheres with oligonucleotide probes and 2 microl SAPE (Wakunaga Pharmaceuticals) and hybridized at 70 ° C for 30 min.

After incubation, 75 µl of wash buffer (Wakunaga Pharmaceuticals) was added to each reaction and centrifuged at 4000 rpm for 2 min. The supernatant was removed and the microspheres were resuspended in 75 µl wash buffer (Wakunaga Pharmaceuticals).

Samples were analyzed on a LabScan 100 machine (Luminex Corp.). At least 100 events from each microsphere region used are collected. For each batch of reactions, background fluorescence control is included, i.e. sample containing only microspheres without amplification product. The values for background mean fluorescence intensity (MFI) are subtracted from the MFI values for each sample and the values obtained are used to calculate the relative indices of the mutant by the formula: Index (mutant allele) - [MFI (mutant allele) / [MFI ( mutant allele 1) + MFI (mutant allele 2) + MFI (mutant allele 3) + MFI (mutant allele 4) + MFI (wild type allele)].

Based on the values of the mutant allele index obtained from all samples with plasmid standards, a calibration curve is constructed and extrapolated from the clinical sample (with unknown content of the mutant allele) to quantify the mutant percentage allele in the sample. To quantify the analytical sensitivity of the agent according to the utility model, a series of dilutions of 100% mutant plasmid with 100% wild-type plasmid was prepared to generate its reference samples with W515 mutant alleles at 100 and 20% levels (Fig. 1). To determine the index threshold of each mutant allele, the test is performed three times with a standard of 100% for each allele (wild type and mutant), and for each individual test, calculate the maximum index for each mutant from the samples in which it is absent. The average of the maximum values is then calculated and the threshold is defined as the mean + standard deviation. The values are as follows: 0.072, 0.086, 0.038 and 0.244 respectively 3aW515A, W515K, W515LHW515R (Fig. 2). In subsequent tests, sensitivity was defined as the lowest content of the mutant allele, which gave an index above the threshold value. The sensitivity did not differ for individual mutants and was 1.0% for all mutant alleles (Table 1).

Example 2. Test with the aid of a utility model.

Because direct DNA sequencing is an established method for detecting any type of mutation in genomic DNA, the sensitivity of the agent, according to the utility model, is compared to direct DNA sequencing using the same plasmid standards. Sequencing allows the detection of a 10% mutant allele. Obviously, the agent according to the utility model shows better sensitivity to artificial plasmid standards (1% mutant allele sensitivity). The content of W515A / K / L / R alleles in DNA samples isolated from peripheral blood of 25 patients with known chronic myeloproliferative diseases was further investigated. Only one sample showed an index of the mutant allele above the aforementioned thresholds. The W515R mutant value was 0.391 and this sample was considered positive for this mutant. The finding was then confirmed by direct sequencing. All other samples were considered negative for the MPL mutation both by direct sequencing and by the microsphere method.

These results clearly confirm that the utility according to the utility model allows quantification with better sensitivity of samples with genomic DNA isolated from peripheral blood compared to direct DNA sequencing.

1494 Ul

Table 1: Determination of the sensitivity of the microsphere method

'The values of the mutant appeal index above the specified thresholds are also bolded in gray cells

Claims (1)

Claims 1. A means for in vitro determination of W515 A / K / L / R mutations in a MPL gene in a blood sample involving MPL specific oligonucleotides, characterized in that it is a container of any kind, containing: an ampoule with a DNA amplification mixture comprising a buffer, a DNA polymerase and two MPL-specific oligonucleotide primers, at least one of which is biotin labeled; - an ampoule containing fluorescently labeled microspheres loaded with specific oligonucleotide probes to detect W515A / K / L / R mutations; an ampoule containing phycoerythrin covalently bound to streptavidin; - five reference DNA ampoules containing 1 microg / microl of wild-type MPL and mutations W515A, W515K, W515L and W515R respectively; ampoule containing hybridization buffer and - an ampoule containing a wash buffer.