BG1494U1 - A method for in vitro identification of w515a/k/l/r mutations of the mpl gene in a blood specimen - Google Patents
A method for in vitro identification of w515a/k/l/r mutations of the mpl gene in a blood specimen Download PDFInfo
- Publication number
- BG1494U1 BG1494U1 BG1998U BG199811U BG1494U1 BG 1494 U1 BG1494 U1 BG 1494U1 BG 1998 U BG1998 U BG 1998U BG 199811 U BG199811 U BG 199811U BG 1494 U1 BG1494 U1 BG 1494U1
- Authority
- BG
- Bulgaria
- Prior art keywords
- mutations
- mpl
- ampoule
- dna
- buffer
- Prior art date
Links
Abstract
Description
Област на техникатаTechnical field
Полезният модел се отнася до средство за in vitro определяне на W515 A/K/L/R мутации на гена за миелопролиферативна левкемия (MPL) в кръвна проба, приложим в рутинната клинична практика с оглед навременното диагностициране на хронични миелопролиферативни заболявания при хората.The utility model relates to a means for in vitro determination of W515 A / K / L / R mutations of the myeloproliferative leukemia (MPL) gene in a blood sample applicable in routine clinical practice for the timely diagnosis of chronic myeloproliferative diseases in humans.
Предшестващо състояние на техникатаBACKGROUND OF THE INVENTION
Мутациите на човешкия MPL ген, засягащи кодона, кодиращ аминокиселинната позиция W515, са установени при група хематологични малигнени заболявания, предимно есенциална тромбоцитемия (ЕТ) и първична миелофиброза (PMF), които се характеризират с лоша прогноза и налагат адекватни медицински грижи. Ето защо достъпността на клинични маркери за ранното им установяване в кръвни проби на пациентите е от особено значение за навременно диагностициране на заболяванията и адекватната лекарска намеса.Mutations of the human MPL gene affecting the codon encoding the amino acid position W515 have been identified in a group of haematologic malignancies, mainly essential thrombocythemia (ET) and primary myelofibrosis (PMF), which are characterized by poor prognosis and medically predicted. Therefore, the availability of clinical markers for their early detection in patients' blood samples is of particular importance for the timely diagnosis of diseases and adequate medical intervention.
Заявка за патент US 2011/0020805 А1 предлага in vitro определяне на мутации в кодон 515 на гена MPL с помощта на PCR амплификация на геномна ДНК, като същевременно се описва и кит за осъществяване на мутационен анализ. Последният съдържа специфични маркирани генетични сонди, прави и обратни праймери, както и MPL генен фрагмент, включен в плазмид. Определянето на мутациите, съгласно тази заявка за патент, се основава на т. нар. тестове “Real Time” и “Light Cycler”, което, обаче е изключително трудоемко, защото изисква множество повторения на PCR амплификацията в реално време и изисква наличие на оборудване, което е достъпно само в някои молекулярно-биологични лаборатории.Patent Application US 2011/0020805 A1 proposes in vitro determination of mutations in codon 515 of the MPL gene by PCR amplification of genomic DNA, while also describing a kit for performing mutational analysis. The latter contains specific labeled genetic probes, forward and reverse primers, as well as an MPL gene fragment included in a plasmid. The determination of mutations according to this patent application is based on the so-called "Real Time" and "Light Cycler" tests, which, however, is extremely time-consuming because it requires multiple real-time PCR amplification and requires the availability of equipment , which is only available in some molecular biology laboratories.
Техническа същност на полезния моделThe technical nature of the utility model
Задача на полезния модел е да се създаде средство за in vitro определяне на W515 A/K/L/R мутации на MPL гена в кръвна проба, което да е лесно приложимо в рутинната клинична практика с оглед навременното диагностициране на хората.The object of the utility model is to provide a means for in vitro determination of W515 A / K / L / R mutations of the MPL gene in a blood sample, which is readily applicable in routine clinical practice for the timely diagnosis of humans.
По своята същност, средството за in vitro определяне на W515 A/K/L/R мутации на MPL гена в кръвна проба, съгласно полезния модел, представлява контейнер от какъвто и да е тип, съдържащ:In essence, the in vitro assay for W515 A / K / L / R mutations of the MPL gene in a blood sample, according to the utility model, is a container of any type, containing:
- ампула с ДНК амплификационна смес, включваща буфер, ДНК полимераза и два специфични за MPL олигонуклеотидни праймери, от които поне единият е маркиран с биотин;an ampoule with a DNA amplification mixture comprising a buffer, a DNA polymerase and two MPL-specific oligonucleotide primers, at least one of which is biotin labeled;
- ампула, съдържаща флуоресцентно маркирани микросфери, натоварени със специфични олигонуклеотидни сонди за детекция на мутациите MPL W515A/L/K/R;an ampoule containing fluorescently labeled microspheres loaded with specific oligonucleotide probes for the detection of MPL W515A / L / K / R mutations;
- ампула, съдържаща фикоеритрин, свързан ковалентно със стрептавидин;an ampoule containing phycoerythrin covalently bound to streptavidin;
- пет ампули с референтна ДНК, съдържащи съответно по 1 microg/microl от дивия тип MPL и от мутациите W515A, W515L, W515K и W515R;- five reference DNA ampoules containing 1 microg / microl of wild-type MPL and mutations W515A, W515L, W515K and W515R respectively;
- ампула, съдържаща хибридизационен буфер иampoule containing hybridization buffer and
- ампула, съдържаща буфер за промиване.- an ampoule containing a wash buffer.
От своя страна, специфичните олигонуклеотидни сонди за детекция на мутациите на MPL W515, свързани с флуоресцентно маркирани микросфери, които позволяват детекция с флоуцитометрична система, са представени от:In turn, specific oligonucleotide probes for detecting MPL W515 mutations associated with fluorescently labeled microspheres that allow detection with a flow cytometric system are represented by:
(а) олигонуклеотидна сонда със секвенция 5'-GAAACTGCCACCTCAGCA-3 (за дивия тип MPL) (б) олигонуклеотидна сонда със секвенция 5-GAAACTGCGCCCTCAGCA-3 (за мутацията W515 А) (в) олигонуклеотидна сонда със секвенция 5'-GAAACTGCTTCCTCAGCAG-3 (за мутацията W515K) (г) олигонуклеотидна сонда със секвенция 5-GAAACTGCAACCTCAGCAG-3 (за мутацията W515L) (д) олигонуклеотидна сонда със секвенция 5-GAAACTGCCTCCTCAGCAG-3 (за мутацията W515R).(a) oligonucleotide probe with sequence 5'-GAAACTGCCACCTCAGCA-3 (for wild-type MPL) (b) oligonucleotide probe with sequence 5-GAAACTGCGCCCTCAGCA-3 (for the W515 A mutation) (c) oligonucleotide probe GTC-CCTC with CTC-CA (for W515K mutation) (d) oligonucleotide probe with sequence 5-GAAACTGCAACCTCAGCAG-3 (for mutation W515L) (e) oligonucleotide probe with sequence 5-GAAACTGCCTCCTCAGCAG-3 (for mutation W515R).
MPL олигонуклеотидните праймери, маркирани с биотин в 5'-края, са представени от:MPL oligonucleotide primers labeled with biotin at the 5'-end are represented by:
a) олигонуклеотиден праймер със секвенция 5-TAGCCTGGATCTCCTTGGTGa) Oligonucleotide primer with sequence 5-TAGCCTGGATCTCCTTGGTG
b) олигонуклеотиден праймер със секвенция 5-AGAGGTGACGTGCAGGAAGT-3.b) an oligonucleotide primer with sequence 5-AGAGGTGACGTGCAGGAAGT-3.
В този състав средството, съгласно полезния модел, позволява осъществяване на директна хибридизация с алел-специфични олигонуклеотиди, свързани с маркирани микросфери (Luminex ТМ), така че приложено на цяла кръвна проба, окончателните резултати в клиничното диагностициране да се получат в рамките на по-малко от 5 h; то позволява бързо и точно количествено определяне на най-честите мутации, засягащи MPL гена и асоциирани с хронични миелопролиферативни заболявалия, да се провежда с аналитична чувствителност от 1 %, което е от изключително значение за диагнозата, прогнозата и назначаването на адекватно лечение на пациентите; позволява едновременното изследване на много проби в плаки, съдържащи 96 или 386 гнезда с различни проби; съставът на средството може допълнително да се допълва със сонди, микросфери и други праймери, така че да позволи едновременното откриване на всички известни или в бъдеще описани мутации, свързани с хронични миелопролиферативни заболявалия,In this composition, the agent, according to the utility model, allows direct hybridization with allele-specific oligonucleotides bound to labeled microspheres (Luminex TM), so that applied to the whole blood sample, the final results in clinical diagnosis can be obtained within a less than 5 hours; it allows the rapid and accurate quantification of the most common mutations affecting the MPL gene and associated with chronic myeloproliferative diseases to be carried out with an analytical sensitivity of 1%, which is essential for the diagnosis, prognosis and appointment of adequate treatment of patients; allows simultaneous examination of many samples in plaques containing 96 or 386 wells with different samples; the composition of the agent may be further supplemented by probes, microspheres and other primers to allow simultaneous detection of any known or future mutations related to chronic myeloproliferative diseases,
Пояснение на приложените фигуриExplanation of the annexed figures
Фигура 1 представя аналитичната чувствителност на средството;Figure 1 represents the analytical sensitivity of the agent;
фигура 2 представя прага за отделяне на положителни проби за отделните мутации.Figure 2 represents the threshold for the selection of positive samples for individual mutations.
Средството за определяне на W515A/K/ L/R мутации в човешкия MPL ген, съгласно настоящия полезен модел, се илюстрира със следните примерни изпълнения, без да ограничават неговия обем.The means for determining W515A / K / L / R mutations in the human MPL gene according to the present utility model is illustrated by the following exemplary embodiments without limiting its scope.
Пример 1.Example 1.
Средството за in vitro определяне на W515A/K/L/R мутации в човешкия MPL ген, съгласно полезния модел, представлява контейнер от какъвто и да е вид, съдържащ ампула с 5 вида флуоресцентно маркирани микросфери в разтвор (Tris EDTA буфер с pH 8,0) с обща концентрация 960 бр. за една ДНК проба, като първия вид микросфери са конюгирани с 10 pmol олигонуклеотидна сонда със секвенция 5'GAAACTGCCACCTCAGCA-3 (за дивия тип MPL). Вторият вид - олигонуклеотидна сонда със секвенция 5-GAAACTGCGCCCTCAGCA-3 (за мутацията W515А), третият вид с олигонуклеотидна сонда със секвенция 5'-GAAA CTGCTTCCTCAGCAG-3 (за мутацията W515K), четвъртият вид - с олигонуклеотидна сонда със секвенция 5'-GAAACTGCAACCTCAGCAG-3 (за мутацията W515L), и петият вид с - олигонуклеотидна сонда със секвенция 5'-GAAAC TGCCTCCTCAGCAG-3 (за мутацията W515R).The in vitro determinant of W515A / K / L / R mutations in the human MPL gene, according to the utility model, is a container of any kind containing an ampoule of 5 species of fluorescently labeled microspheres in solution (Tris EDTA buffer with pH 8, 0) with a total concentration of 960 pcs. for one DNA sample, the first type of microspheres being conjugated to a 10 pmol oligonucleotide probe with sequence 5'GAAACTGCCACCTCAGCA-3 (for wild-type MPL). The second species is an oligonucleotide probe with sequence 5-GAAACTGCGCCCTCAGCA-3 (for the W515A mutation), the third species is an oligonucleotide probe with sequence 5'-GAAA CTGCTTCCTCAGCAG-3 (for the W515K mutation) -3 (for W515L mutation), and the fifth species with an oligonucleotide probe with sequence 5'-GAAAC TGCCTCCTCAGCAG-3 (for W515R mutation).
В отделна ампула е поместена ДНК амплификационна смес, която за реакция от 25 microl включва 2,5 microl PCR буфер (Invitrogen), 1,5 U Taq полимераза (Invitrogen); 3 mM MgCl2; 0,2 тМ dNTP смес, 10 pmol MPL олигонуклеотиден праймер със секвенция 5-TAGCCTGGATCTC CTTGGTG, който е маркиран с биотин в 5'-края, и 10 pmol MPL олигонуклеотиден праймер S’AGAGGTGACGTGCAGGAAGT, който е маркиран с биотин в 5'-края.In a separate ampoule is placed a DNA amplification mixture which, for a reaction of 25 microl, includes 2.5 microl PCR buffer (Invitrogen), 1.5 U Taq polymerase (Invitrogen); 3 mM MgCl 2 ; 0.2 mM dNTP mixture, 10 pmol MPL oligonucleotide primer with sequence 5-TAGCCTGGATCTC CTTGGTG, which is labeled with biotin at the 5'-end, and 10 pmol MPL oligonucleotide primer S'AGAGGTGACGTGCAGGAAGT, which is labeled with biotin at the end-biotin .
В контейнера са поместени също ампула, съдържаща 10 pmol фикоеритрин, свързан ковалентно със стрептавидин (SAPE), пет ампули с референтна ДНК, съдържащи съответно дивия тип MPL и мутациите W515A, W515К, W515L и W515R в концентрация от по 1 microg/microl, ампула, съдържаща 150 microl разтвор за промиване (за всяка проба) и ампула с 20 microl хибридизационен буфер (Wakunaga Pharmaceuticals) (за всяка проба).The container also contains an ampoule containing 10 pmol phycoerythrin covalently bound to streptavidin (SAPE), five ampoules with reference DNA containing the wild-type MPL, respectively, and the W515A, W515K, W515L and W515R mutations at a concentration of 1 microg / microl, ampoule containing 150 µl wash solution (for each sample) and an ampoule with 20 µl hybridization buffer (Wakunaga Pharmaceuticals) (for each sample).
Действие на полезния моделUtility model action
В съд, съдържащ 20 microl ДНК амплификационната смес се добавят 100 ng плазмидна или геномна ДНК и сместа се подлага на циклична амплификация при следния температурен режим: 95°С за 5 min; 35 цикъла от по 95°С за 30 s, 58°С за 40 s, 72°С - 2 min и крайна екстензия на 72°С за 10 min. След това 5 microl от всеки PCR продукт се смесват с 20 microl хибридизационен буфер (Wakunaga Pharmaceuticals), 3 microl смес от микросфери с олигонуклеотидни сонди и 2 microl SAPE (Wakunaga Pharmaceuticals) и се извършва хибридизация на 70°С за 30 min.To a vessel containing 20 µl of DNA, the amplification mixture was added 100 ng of plasmid or genomic DNA and the mixture was cyclically amplified at the following temperature regime: 95 ° C for 5 min; 35 cycles of 95 ° C for 30 s, 58 ° C for 40 s, 72 ° C for 2 min and a final extension of 72 ° C for 10 min. Then, 5 microl of each PCR product was mixed with 20 microl hybridization buffer (Wakunaga Pharmaceuticals), 3 microl mixture of microspheres with oligonucleotide probes and 2 microl SAPE (Wakunaga Pharmaceuticals) and hybridized at 70 ° C for 30 min.
След инкубацията към всяка реакция се прибавят 75 microl буфер за промиване (Wakunaga Pharmaceuticals) и се извършва центрофугиране на 4000 rpm за 2 min. Отстранява се супернатантата и микросферите се ресуспендират в 75 microl буфер за промиване (Wakunaga Pharmaceuticals).After incubation, 75 µl of wash buffer (Wakunaga Pharmaceuticals) was added to each reaction and centrifuged at 4000 rpm for 2 min. The supernatant was removed and the microspheres were resuspended in 75 µl wash buffer (Wakunaga Pharmaceuticals).
Пробите се анализират на машина LabScan 100 (Luminex Corp.). Събират се поне 100 събития от всеки използван регион с микро- сфери. За всяка партида реакции се включва контрол на фоновата флуоресценция, т.е. проба, съдържаща само микросфери без амплификационен продукт. Стойностите за фоновия среден интензитет на флуоресценция (MFI) се изваждат от стойностите на MFI за всяка проба и получените стойности се използват за изчисляване на относителните индекси на мутанта по формулата: Индекс (мутантен алел) - [MFI (мутантен алел)/ [MFI (мутантен алел 1) + MFI (мутантен алел 2) + MFI (мутантен алел 3) + MFI (мутантен алел 4) + MFI (див тип алел)].Samples were analyzed on a LabScan 100 machine (Luminex Corp.). At least 100 events from each microsphere region used are collected. For each batch of reactions, background fluorescence control is included, i.e. sample containing only microspheres without amplification product. The values for background mean fluorescence intensity (MFI) are subtracted from the MFI values for each sample and the values obtained are used to calculate the relative indices of the mutant by the formula: Index (mutant allele) - [MFI (mutant allele) / [MFI ( mutant allele 1) + MFI (mutant allele 2) + MFI (mutant allele 3) + MFI (mutant allele 4) + MFI (wild type allele)].
Въз основа на стойностите на индекса на мутантния алел, получени от всички проби с плазмидни стандарти се построява калибрационна крива и по нея се извършва екстраполация на индекса на мутантния алел от клиничните проби (с неизвестно съдържание на мутантен алел) за количествено определяне на процента на мутантния алел в пробата. За количествено определяне на аналитичната чувствителност на средството, съгласно полезния модел, се изготвят серия разреждания на 100% мутантния плазмид със 100% див тип плазмид за генериране йй референтни проби с W515 мутантни алели при нива 100 и 20 % (фиг. 1). За определяне на праговата стойност на индекса на всеки мутантен алел тестът се извършва трикратно със стандарт от 100% за всеки алел (див тип и мутантни), като за всеки отделен тест се изчислява максималния индекс за всеки мутант измежду пробите, в които той отсъства. След това е изчислена средната от максималните стойности и праговата стойност се дефинира като средна+стандартно отклонение. Стойностите са както следва: 0,072, 0,086, 0,038 и 0,244 съответно 3aW515A,W515K,W515LHW515R (фиг. 2). При последващи тестове чувствителността е дефинирана като най-ниското съдържание на мутантен алел, което дава индекс над праговата стойност. Чувствителността не се различава за отделните мутанти и е 1,0% за всички мутанти алели (Табл. 1).Based on the values of the mutant allele index obtained from all samples with plasmid standards, a calibration curve is constructed and extrapolated from the clinical sample (with unknown content of the mutant allele) to quantify the mutant percentage allele in the sample. To quantify the analytical sensitivity of the agent according to the utility model, a series of dilutions of 100% mutant plasmid with 100% wild-type plasmid was prepared to generate its reference samples with W515 mutant alleles at 100 and 20% levels (Fig. 1). To determine the index threshold of each mutant allele, the test is performed three times with a standard of 100% for each allele (wild type and mutant), and for each individual test, calculate the maximum index for each mutant from the samples in which it is absent. The average of the maximum values is then calculated and the threshold is defined as the mean + standard deviation. The values are as follows: 0.072, 0.086, 0.038 and 0.244 respectively 3aW515A, W515K, W515LHW515R (Fig. 2). In subsequent tests, sensitivity was defined as the lowest content of the mutant allele, which gave an index above the threshold value. The sensitivity did not differ for individual mutants and was 1.0% for all mutant alleles (Table 1).
Пример 2. Изпитване с помощта на средството, съгласно полезния модел.Example 2. Test with the aid of a utility model.
Тъй като директното ДНК секвениране представлява утвърден метод за откриване на всякакъв вид мутации в геномна ДНК, чувствителността на средството, съгласно полезния модел, е сравнен с директното ДНК секвениране при използване на едни и същи плазмидни стандарти. Чрез секвениране е възможно откриването на 10% мутантен алел. Очевидно средството, съгласно полезния модел, показва по-добра чувствителност върху изкуствени плазмидни стандарти (1% мутантен алел чувствителност). Допълнително е изследвано съдържанието на W515A/K/L/R алели в ДНК проби, изолирани от периферна кръв на 25 пациенти с известни хронични миелопролиферативни заболявалия. Само една проба показа индекс на мутантния алел над гореспоменатите прагови стойности. Стойността за мутанта W515R е 0,391 и тази проба се преценява като позитивна за този мутант. След това находката е потвърдена чрез директно секвениране. Всички други проби са преценени като негативни за MPL мутация както чрез директно секвениране, така и чрез микросферовия метод.Because direct DNA sequencing is an established method for detecting any type of mutation in genomic DNA, the sensitivity of the agent, according to the utility model, is compared to direct DNA sequencing using the same plasmid standards. Sequencing allows the detection of a 10% mutant allele. Obviously, the agent according to the utility model shows better sensitivity to artificial plasmid standards (1% mutant allele sensitivity). The content of W515A / K / L / R alleles in DNA samples isolated from peripheral blood of 25 patients with known chronic myeloproliferative diseases was further investigated. Only one sample showed an index of the mutant allele above the aforementioned thresholds. The W515R mutant value was 0.391 and this sample was considered positive for this mutant. The finding was then confirmed by direct sequencing. All other samples were considered negative for the MPL mutation both by direct sequencing and by the microsphere method.
Тези резултати недвусмислено потвърждават, че средството, съгласно полезния модел позволява количествено определяне с по-добра чувствителност върху проби с геномна ДНК, изолирана от периферна кръв, в сравнение с директното ДНК секвениране.These results clearly confirm that the utility according to the utility model allows quantification with better sensitivity of samples with genomic DNA isolated from peripheral blood compared to direct DNA sequencing.
1494 Ul1494 Ul
Таблица 1: Определяне на чувствителността на микросферовия методTable 1: Determination of the sensitivity of the microsphere method
‘Стойностите на индекса на мутантния апел над определените прагови стойности са удебелени и в сиви клетки'The values of the mutant appeal index above the specified thresholds are also bolded in gray cells
Claims (1)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
BG1998U BG1494U1 (en) | 2011-05-16 | 2011-05-16 | A method for in vitro identification of w515a/k/l/r mutations of the mpl gene in a blood specimen |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
BG1998U BG1494U1 (en) | 2011-05-16 | 2011-05-16 | A method for in vitro identification of w515a/k/l/r mutations of the mpl gene in a blood specimen |
Publications (1)
Publication Number | Publication Date |
---|---|
BG1494U1 true BG1494U1 (en) | 2011-10-31 |
Family
ID=45877137
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
BG1998U BG1494U1 (en) | 2011-05-16 | 2011-05-16 | A method for in vitro identification of w515a/k/l/r mutations of the mpl gene in a blood specimen |
Country Status (1)
Country | Link |
---|---|
BG (1) | BG1494U1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112941171A (en) * | 2021-03-30 | 2021-06-11 | 迈杰转化医学研究(苏州)有限公司 | Primer probe for detecting mutations of W515L, W515S and W515A of MPL gene and application thereof |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20110020805A1 (en) * | 2007-12-07 | 2011-01-27 | Alessandro Maria Vannucchi | Mutational analysis of chronic myeloproliferative disorders |
-
2011
- 2011-05-16 BG BG1998U patent/BG1494U1/en unknown
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20110020805A1 (en) * | 2007-12-07 | 2011-01-27 | Alessandro Maria Vannucchi | Mutational analysis of chronic myeloproliferative disorders |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112941171A (en) * | 2021-03-30 | 2021-06-11 | 迈杰转化医学研究(苏州)有限公司 | Primer probe for detecting mutations of W515L, W515S and W515A of MPL gene and application thereof |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
DK2430188T3 (en) | METHOD AND KIT FOR DETECTING ANTIBIOTIC RESISTANT BACTERIA | |
CN110964814B (en) | Primers, compositions and methods for nucleic acid sequence variation detection | |
JP2018531044A (en) | Method for assessing normality of immune repertoire and use thereof | |
JP2018531044A6 (en) | Method for assessing normality of immune repertoire and use thereof | |
CN111334573B (en) | Gene detection kit for hypertension medication and use method | |
JP2019519540A (en) | Novel Mutations in Anaplastic Lymphoma Kinase to Predict Response to ALK Inhibitor Therapy in Lung Cancer Patients | |
JP2016519929A (en) | Noninvasive early detection of solid organ transplant rejection by quantitative analysis of mixtures by deep sequencing of HLA gene amplicons using next-generation systems | |
JP2019537436A (en) | Postoperative prognosis or anticancer drug compatibility prediction system for patients with advanced gastric cancer | |
DK3105324T3 (en) | NGS SYSTEM CONTROL AND PROCEDURES COMPREHENSIVE THESE | |
TW201713776A (en) | Single nucleotide polymorphism in HLA-B*15:02 and use thereof | |
AU2014279672A1 (en) | Improved NGS workflow | |
CN111118138A (en) | Kit and method for detecting polymorphism of folate metabolism ability genes MTHFR and MTRR | |
CN113913512A (en) | Primer probe composition and kit for detecting spinal muscular atrophy related genes | |
Zhong et al. | Direct quantification of fetal cells in maternal blood by real‐time PCR | |
Zhao et al. | Rapid identification of drug-resistant tuberculosis genes using direct PCR amplification and Oxford Nanopore Technology sequencing | |
CN104087672A (en) | Kit for quickly detecting number of human chromosomes 21 by multiplex real-time fluorescence quantitative PCR (polymerase chain reaction) technique | |
BG1494U1 (en) | A method for in vitro identification of w515a/k/l/r mutations of the mpl gene in a blood specimen | |
CN113999901B (en) | Myocardial specific methylation markers | |
CN115820837A (en) | PCR (polymerase chain reaction) detection kit for corneal dystrophy and application thereof | |
CN104087671A (en) | Kit used for detecting number of human chromosomes 21 | |
CN108018355A (en) | Detection kit and its preparation and purposes based on VDR gene pleiomorphism auxiliary diagnosis Huppert's diseases | |
WO2017106365A1 (en) | Methods for measuring mutation load | |
CN113755574A (en) | Detection kit and detection method for methylprednisolone metabolic marker | |
TW201408779A (en) | Method and kit for detecting a mycobacterium tuberculosis | |
US20210381032A1 (en) | Rapid PCR Methodology |