BE1021047B1 - GENETICALLY MODIFIED SUCCINOGENIC ACTINOBACILLUS AND USE THEREOF FOR THE PRODUCTION OF SUCCINIC ACID - Google Patents

Abstract

The present invention relates to genetically modified bacterial strains, more particularly strains of Actinobacillus succinogenes, which can produce increased amounts of succinic acid, while producing little or no succinic acid. 'other organic acids, including acetate, formate and lactate, and alcohols. The invention also provides methods for the production of succinic acid under anaerobic conditions using these genetically engineered bacterial strains. The invention also provides methods for genetically modifying Actinobacillus succinogenes based on natural competence and double homologous recombination.

Description

Actinobacillus succinogenes genetically modified and its use for the production of succinic acid

Field of the invention

The present invention relates to the field of metabolic engineering of bacteria. In particular, the present invention relates to genetically modified bacterial strains, more particularly strains of Actinobacillus succinogens, and their use in processes for the production of succinic acid under anaerobic conditions. The invention also provides methods for genetically modifying Actinobacillus succinogenes.

State of the art Succinic acid and its derivatives have extensive industrial applications because of their use as a precursor of convenience chemicals in the food, pharmaceutical, cosmetic, textile, detergent and polymer industries. Succinic acid is usually produced from fossil resources. However, in recent years, there is a growing interest in the production of this acid by fermentation.

The bacteria available to obtain succinate by fermentation are divided into two groups. In the first group, we find the bacteria that are known to naturally produce succinate by metabolizing glucose, such as Pasteurellaceae (Actinobacillus succinogenes and Mannheimia succiniciproducens), Anaerobiospirillum succiniciproducens and Corynebacterium glutamicum. Although the yields are interesting, the fermentation is not homo-succinic and other acids are also produced (formate, acetate, lactate). In the second group, recombinant Escherichia coli are found. Escherichia coli does not naturally produce succinate, but genetic modification strategies have been described to optimize the production of succinic acid.

In most cases and regardless of the bacterial strain, the main strategy for optimizing the production of succinic acid is to genetically modify the strain in order to block the pathways of production of secondary metabolites from the C3 pathway, namely lactate (inactivation of lactate dehydrogenase (ldh)), ethanol (inactivation of alcohol dehydrogenase (adh)) and acetate (inactivation of acetate kinase (ack) and / or phosphotransacetylase (pta)) ( WO 2011/063157, US 2008/293112, WO 2005/052135, US 2003/0175903, US 2010/0159542, KR20080031504, WO 2010/115067). On the other hand, the overexpression of one or more enzymes involved in the production of succinate via the Krebs cycle reduction pathway (TCA) is also often considered (malate dehydrogenase (mdh), fumarase (end) and fumarate reductase (frd). )) (patent applications WO 2011/063157, JP2005095169, KR20080031504). Overexpression of the pyruvate carboxylase (pc) and phosphoenol pyruvate carboxykinase (pepck) enzymes is also provided on numerous occasions to promote metabolic flow to TCA rather than to the C3 pathway (US Patent Applications 2003/0087381, JP2005095169, WO 2010/115067).

However, even by redirecting mainly the flows to the TCA, the theoretical output of production remains low because of the obligation to maintain the balance redox. As a result, different publications are devoted to solutions for balancing the redox balance. A first solution is the activation of the glyoxylate ring (US patent applications 2007/0184539, US 2010/0159543, WO 2010/115067). An alternative solution consists in blocking the cycle of glyoxylate and promoting the production of succinic acid via simultaneously the oxidative and reducing routes of TCA (patent applications WO 2011/063157). Another solution is to insert a gene coding for a heterologous "formate dehydrogenase (fdh) -NAD dependent" derived from Candida boidinii (US patent application 2003/0175903).

Finally, the modification of phosphotransacetylase (pts) and Zwischenferment (zwf) is also cited to increase the production of succinic acid (patent applications WO 2005/052135, US 2008/0305533).

Despite the attempts described above, it remains necessary in the art to improve the production of bacterial succinic acid, more particularly to increase the production of succinic acid, while maintaining the production of other organic acids and / or alcohols at a low level.

Actinobacillus succinogenes is one of the most popular natural succinate producers. Therefore and also because it uses a wide variety of substrates (including glucose, cellobiose, lactose, xylose, arabinose and fructose), and because it has a high tolerance to high concentrations of salts of succinate, it may be suitable for the industrial production of succinate. Attempts to improve succinate production by A. succinogenes have been hampered by the lack of genetic tools to modify A. succinogenes. US Patent 7,163,812 provides a means for constructing a recombinant A. succinogenes capable of overproducing succinate using a plasmid. However, it remains necessary in the art to have tools for genetically modifying A. succinogenes, more particularly tools that allow multiple modifications in a single genetic background.

Brief description of the invention

The present inventors have discovered through intensive experiments and tests a method for genetically modifying Actinobacillus succinogens on the basis of its natural ability to take DNA from its environment and to integrate DNA into its genome through a double homologous recombination. By expanding these findings, the inventors have realized that bacterial strains, in particular Actinobacillus succinogenes, can be genetically engineered to produce succinic acid at a high concentration, while producing little or no other organic acids and / or or alcohols (such as, for example, pyruvate, formate, acetate, alcohol) through the reduction of the activity of alcohol dehydrogenase (adh), lactate dehydrogenases (ldh), pyruvate formate lyase (pfl) and malate dehydrogenases (mdh), thereby treating one or more of the above-mentioned prior art problems.

The strategy of the invention differs from the strategies proposed in the art. On the one hand, the activity of the enzymes involved in the production of acetate are not modified (no knock-out of acetate kinase (ack) and / or phosphotransacetylase (pta)) and secondly, the activity of malate dehydrogenases (mdh) is reduced.

Accordingly, in one aspect the invention provides a genetically modified bacterial strain for the production of a succinate, said bacterial strain comprising reduced activity of alcohol dehydrogenase (adh), lactate dehydrogenases (ldh), pyruvate formate lyase (pfl) and malate dehydrogenases (mdh).

In a related aspect, the invention provides a method for the production of succinic acid under anaerobic conditions, wherein the genetically modified bacterial strain as taught herein is used.

Another aspect of the invention relates to a method for genetically modifying A. succinogenes comprising step a) of incubating competent A. succinogenes cells with a nucleic acid construct.

Brief Description of the Drawings FIG. 1. Schematic representation of the construction strategy of the linear DNA fragments using the cloning of the PCR fragments in the pNZ5319 vector. In short, PCRs are carried out on A. succinogenes genomic DNA in order to amplify a fragment, preferably a fragment of 1.5 kb, downstream and a fragment, preferably a 1.5 kb fragment, upstream of the target locus. These are carried out using a highly faithful polymerase and primers designed to introduce the first or the last codon of the gene to be modified and a USS (Uptake Signal Sequence) sequence which is known to intervene in the natural competence of this gene. downstream and upstream fragment, respectively. The fragments are then cloned into the pNZ5319 vector using the Swal or Pmel and Ecll36II stretch restriction sites respectively. The final engineered vector is finally restricted by the Xba sticky-end restriction enzyme to obtain the linear DNA fragment. FIG. 2. Schematic representation of the construction strategy of linear DNA fragments using assembly of PCR fragments by PCR recovery. In short, PCRs are carried out on A. succinogenes genomic DNA in order to amplify a fragment, preferably a fragment of 1.5 kb, downstream and a fragment, preferably a 1.5 kb fragment, upstream of the target locus. These are carried out using a highly faithful polymerase and primers designed to introduce the first or the last codon of the gene to be modified and the complementary sequence making it possible to perform the recovery PCR on this downstream and upstream fragment, respectively. PCR is also on the PNZ5319 vector using primers that amplify the lox66-P $ 2-Cat-lox71 cassette with the complementary sequences necessary for overlapping PCR at the edge of the fragment. The three PCR products are mixed together at equimolar concentrations and assembled by performing an overlap PCR with the edge primers. FIG. 3. Schematic representation of the replacement strategy of a target gene by the lox66-? 22-cat-lox71 cassette, which is then excised by Cre specific site recombination leaving a lox72 signature. FIG. 4. Succinic acid production curves of the wild-type Actinobacillus succinogenes 130Z strain (130Z), of the inactivated mutant strain at the adh, Idh and pfl (ALPKO) genes, of the inactivated mutant strain at the adh, Idh genes and mdh (ALMKO) and the inactivated mutant strain at the adh, Idh, mdh and pfl (ALMPKO) genes. FIG. 5. Production curves of acetic acid and formic acid of the wild strain Actinobacillus succinogens 130Z (130Z), of the inactivated mutant strain at the genes adh, Idh and pfl (ALPKO), of the inactivated mutant strain at the level of the genes adh, Idh and mdh (ALMKO) and the inactivated mutant strain at the adh, Idh, mdh and pfl (ALMPKO) genes. FIG. 6. Replacement strategy of the constitutive promoter by the P32 promoter via a double homologous recombination followed by a specific site recombination. Double homologous recombination allows insertion of the cassette (P32-lox66-Cat-lox71) in place of the constitutive promoter. Then, the specific site recombination makes it possible to remove the chloramphenicol resistance gene via the 2 lox sites. FIG 7. Schematic representation of the strategy to obtain the vector pNZP32. The lox66 site is deleted from the pNZ5319 vector by restriction with Swal and Nrul enzymes. The vector is easily religated on itself after removal of the fragment containing the lox66 site. Then, the lox66 site is reintroduced into the vector without the lox66 site (pNZLox-7) between the P32 promoter and the chloramphenicol resistance gene by PCR using primers pNZLox66f4 and pNZLox66r5. The PCR fragment obtained is ligated on itself to obtain the final vector pNZP32.

Detailed description of the invention

As used herein the singular forms "one", "one" and "the" include both singular and plural referents unless the context clearly indicates the opposite.

The terms "comprising", "includes" and "composed of" as used herein are synonymous with "including", "includes" or "containing", "contains" and are inclusive or open and do not include do not exclude additional constituents, elements or process steps not listed. The terms also include "consisting of" and "consisting essentially of". The enumeration of numerical ranges by extremes includes all subsumed numbers and fractions within the respective ranges, as well as the listed extremes.

The term "about" as used herein when reference is made to a measurable value such as a parameter, quantity, duration and the like, is meant to encompass variations of and from the specified value, in particular variations of +/- 10% or less, preferably +/- 5% or less, more preferably +/- 1% or less, and still more preferably +/- 0.1% or less of and from of the specified value, to the extent that such variations are appropriate to be realized in the disclosed invention. It should be understood that the value to which the "about" modifier refers is itself also specifically, and preferably, disclosed.

While the term "one or more", such as one or more constituents of a group of components, is clear in itself, by way of further exemplification, the term encompasses inter alia a reference to any Tun said components, or any of two or more of said components, such as, for example, any of> 3,> 4,> 5,> 6 or> 7, etc. said constituents, and up to all of said constituents.

All documents cited in this specification are incorporated herein by reference in their entirety.

Unless otherwise indicated, all terms used in the disclosure of the invention, including technical and scientific terms, have the meaning commonly accepted by those skilled in the art to which the invention belongs. As additional information, definitions of terms may be included to better appreciate the teaching of the present invention.

As mentioned above, the present inventors have realized a new strategy for obtaining a bacterial strain which produces succinic acid at a high concentration, while producing little or no other organic acids and / or alcohols (such as, for example, pyruvate, formate, acetate, alcohol) through the reduction of the activity of alcohol dehydrogenase, lactate dehydrogenases, pyruvate formate lyase and / or malate dehydrogenases.

Accordingly, a first aspect of the present invention relates to a genetically modified bacterial strain for the production of succinic acid, wherein the bacterial strain comprises or consists of a reduced activity of at least 3 enzymes selected from the group consisting of: alcohol dehydrogenase (adh), lactate dehydrogenases (ldh), pyruvate formate lyase (pfl) and malate dehydrogenases (mdh).

In preferred embodiments, the genetically modified bacterial strain comprises or consists of reduced activity of alcohol dehydrogenase (adh), lactate dehydrogenases (ldh), pyruvate formate lyase (pfl) and malate dehydrogenases (mdh) .

The term "reduced activity" is intended here to indicate the activity of a protein, in particular an enzymatic activity, which is at least a 75% reduction in the activity of the protein relative to the activity of a protein. protein in a corresponding wild-type bacterial strain. Preferably, at least 80%, 85%, 90% or 95%, such as, for example, 96%, 97%, 98%, 99%, or more preferably 100% (ie, inactivation). ) of reducing the activity of the protein are achieved. The activity of the protein can be reduced by inhibitors, by mutation (for example point mutations of critical residues) or by suppression of the expression or translation of the gene (for example the methylation of the promoter sequence) and the like . Preferably, the reduced activity of the protein is achieved through disruption of the coding gene.

Therefore, in preferred embodiments, the genetically modified bacterial strain comprises or consists of a disruption of at least 3 genes selected from the group consisting of: adh, Idh, pfl and mdh, preferably a disruption of the adh genes, Idh, pfl and mdh.

The terms "disruption", "deletion" and "downregulation" are synonymous here and refer to mutations of the gene, including coding regions as well as regulatory regions, such as, for example, the promoter, causing reduced activity, preferably the inactivation of the gene relative to the native gene, that is to say non-mutated or wild-type. The term "gene activity" should be understood herein to include transcription and translation of the gene, as well as activity of the genetic product, for example a protein. A gene may be completely (i.e., 100%) inactivated by knockout, removal or deletion of the entire genomic sequence. The use of a phase change mutation, insertion of a premature stop codon, point mutations of critical residues, deletions or insertions, and the like may inactivate completely (i.e. 100%) the genetic product.

Preferably, the coding gene is deleted. Therefore, in preferred embodiments, the genetically modified bacterial strain comprises or consists of a deletion of at least 3 genes selected from the group consisting of: adh, Idh, pfl and mdh, preferably a deletion of the adh genes, Idh, pfl and mdh.

In preferred embodiments, the bacterial strain belongs to the family of Pasteurellaceae, more preferably to the genus Actinobacillus, still more preferably Actinobacillus succinogenes.

Actinobacillus succinogenes is a Gram-negative bacterium, optionally anaerobic, pleomorphic. It belongs to the family of Pasteurellaceae which, in addition to Actinobacillus, includes the genera Mannheimia, Haemophilus, and Pasteurella.

A non-limiting example of Actinobacillus succinogenes is A. succinogenes strain 130Z, which has been isolated from bovine rumen, as available from the American Type Culture Collection (ATCC) under accession number ATCC55618. .

In preferred embodiments, the bacterial strain is A. succinogenes strain 130Z. Other embodiments relate to a genetically modified A. succinogenes strain 130Z in which at least 3 genes selected from the group consisting of: adh, Idh, pfl and mdh have been deleted, preferably a strain 130Z of A. genetically modified succinogenes in which the adh, Idh, pfl and mdh genes were deleted. Such a 130Z genetically modified A. succinogenes strain can be obtained by methods for genetically modifying succinogens as taught herein.

In preferred embodiments, the invention relates to a genetically modified A. succinogenes strain 130Z as deposited in accordance with the Budapest Treaty of the Belgian Coordinated Collections of Microorganisms (BCCM) - Laboratorium voor Microbiologie - Bacteriënverzameling, ( BCCM / LMG) (University of Ghent, KL Ledeganckstraat 35, B-9000 Ghent, Belgium) on January 11, 2013 under accession number LMG P-27390.

In other embodiments, the invention relates to a genetically modified A. succinogenes 130Z strain as deposited in accordance with the Budapest Treaty of the Belgian Coordinated Collections of Microorganisms (BCCM) - Laboratorium voor Microbiologie - Bacteriënverzameling, (BCCM / LMG) (University of Ghent, KL Ledeganckstraat 35, B-9000 Gent, Belgium) on 11 January 2013 under accession number LMG P-27388 or LMG P-27389.

Genetically engineered bacterial strains as taught herein may further include reduced activity and / or overexpression of one or more other metabolic enzymes.

The term "overexpression" is intended here to indicate the activity of a protein, in particular an enzymatic activity, which is at least a 150% increase in the activity of the protein relative to the activity of the protein in a protein. a corresponding wild-type bacterial strain.

A protein, in particular an enzyme, may be overexpressed by activators, by suppressing inhibitors, by mutation (e.g., mutations resulting in a more active form of the protein, or a form that is inhibitor-resistant), or by suppressing repressors, adding multiple copies of the gene or adding a heterologous gene, or upregulating the endogenous gene (for example by adding a strong promoter, such as for example the P32 promoter).

In the examples, the genetically modified bacterial strains as taught herein may further comprise overexpression of one or more TCA cycle enzymes, more preferably enzymes of the TCA cycle oxidative pathway, such as, for example, citrate. lyase (cil), aconitase (acn), isocitrate dehydrogenase (idh), α-ketoglutarate dehydrogenase complex (ogdc) and succinate synthase (juices). For example, the genetically modified bacterial strain may comprise or consist of reduced activity of alcohol dehydrogenase (adh), lactate dehydrogenases (ldh), pyruvate formate lyase (pfl) and malate dehydrogenase (mdh) and overexpression of citrate lyase (cil) and / or aconitase (acn) and / or isocitrate dehydrogenase (idh) and / or α-ketoglutarate dehydrogenase complex (ogdc) and / or succinate synthase ( juices).

In other examples, the genetically modified bacterial strain may further comprise overexpression of one or more glyoxylate ring enzymes such as, for example, citrate lyase (cil), aconitase (acn), isocitrate lyase (here) and malate synthase (ms), and preferably a reduced activity of one or more enzymes of the TCA cycle. For example, the genetically modified bacterial strain may comprise or consist of reduced activity of alcohol dehydrogenase (adh), lactate dehydrogenases (ldh), pyruvate formate lyase (pfl), malate dehydrogenase (mdh) and overexpression of citrate lyase (cil) and / or aconitase (acn) and / or isocitrate lyase (here) and / or malate synthase (ms), and preferably reduced isocitrate activity dehydrogenase (idh) and / or α-ketoglutarate dehydrogenase complex (ogdc) and / or succinate synthase (juices).

Another object of the invention presented here is to provide a method for culturing a mutant bacterial strain under anaerobic conditions in a reactor which makes it possible to produce succinate in high concentrations, preferably while maintaining the concentration of the other organic acids and / or or alcohols at a low level.

Accordingly, in another aspect, the present invention relates to a process for the production of succinic acid under anaerobic conditions using a genetically modified bacterial strain as taught herein.

The terms "succinate" and "succinic acid" are used interchangeably herein. Succinic acid is also called butanedioic acid (C4H6O4). Chemically, the succinate is a salt or ester of succinic acid. Therefore, succinate and succinic acid refer to the same compound, which may be present in either form depending on the pH of the solution.

Succinic acid production as taught herein can be accomplished by fermentation of a carbohydrate source. The term "fermentation" is intended here to indicate the conversion of a carbohydrate source, preferably a sugar such as, for example, glucose, fructose or sucrose, into alcohols and / or organic acids, preferably the succinic acid, using microorganisms, preferably a genetically modified bacterial strain as taught herein under anaerobic conditions.

In preferred embodiments, the process for the production of succinic acid comprises the steps of: a) cultivating the genetically modified bacterial strain as taught herein under anaerobic conditions; (b) provide a source of carbohydrates; c) let the bacterial strain metabolize the carbohydrate source; and d) isolating the succinic acid from the culture.

The genetically modified bacteria can be grown in a flask, bioreactor, batch reactor or chemostat bioreactor to obtain succinic acid.

Culture of the bacteria under anaerobic conditions can be achieved by culturing the bacteria in an anaerobic culture medium saturated with CO2. The pH can be maintained during the culture by adding to the culture medium a buffering agent, for example MgCO 3, and spraying the culture with CO2.

Preferably, the carbohydrate source is a sugar. Non-limiting examples of suitable sugars include monosaccharides, such as, for example, glucose, fructose, xylose or arabinose, or disaccharides, such as, for example, sucrose, lactose, cellobiose.

Such methods using a genetically modified bacterial strain as taught herein can ensure a high production yield of succinic acid, while the production of other organic acids and / or alcohols is kept to a minimum.

As mentioned above, the present inventors have also developed a method for genetically modifying Actinobacillus succinogenes, which is based on natural competence.

The terms "competence" and "competent" and the like here refer to the ability of a cell, preferably a bacterial cell, to take extracellular DNA from its environment. The term encompasses natural competence and artificial competence. By "natural competence" is meant the genetically specified ability of a cell, preferably a bacterial cell, to perform this DNA sampling. Natural competence can occur spontaneously in nature as well as in laboratory conditions in which natural competence can be induced or increased. "Artificial skill" is understood to mean making a cell, preferably a bacterial cell, temporarily permeable to extracellular DNA.

Accordingly, another aspect of the present invention relates to a method for genetic modification of A. succinogenes comprising step a) of incubating competent A. succinogenes cells with a nucleic acid construct.

Suitable incubation conditions, which allow the removal of the nucleic acid construct from the cells, include, for example, the incubation of competent A. succinogenes cells with between about 1 ng / ml and about 1 μg / ml. of DNA, such as about 10 ng / ml, about 50 ng / ml, about 100 ng / ml, about 200 ng / ml or about 500 ng / ml of DNA, at about 37 ° C between about 5 min and about 1 hour, preferably about 10 minutes to about 30 minutes, more preferably about 15 minutes. Preferably, the cells are shaken during incubation, such as, for example, at about 100 rpm.

The present inventors have developed a protocol for inducing natural competence in A. succinogenes. In particular, they discovered that competence can be induced by transferring exponentially growing cells into a synthetic medium that lacks many of the components necessary for sustained growth, including sugars, nucleotides and cofactors (ie say the middle of competence), such as for example the M-IV medium. The composition of M-IV medium is described in Poje and Redfield (2003, Methods Mol Med 71: 57-70), which is specifically incorporated herein by reference. Without wishing to be bound by theory, cultivating A. succinogenes in such a skill setting can halt cell division and induce the expression of genes responsible for taking DNA from cells.

In preferred embodiments of the methods taught herein, competent A. succinogenes cells can be obtained by incubating exponentially growing A. succinogenes cells in a medium of skill, preferably the M-IV medium, between about 60 min and about 120 min, preferably between about 60 min and about 100 min, such as, for example, for about 60 min, 70 min, 80 min, 90 min or 100 min, more preferably for about 100 min. Preferably, the cells are shaken during incubation, such as, for example, at about 100 rpm. Preferably, the cells are incubated at a temperature of about 37 ° C.

The nucleic acid construct to be collected by competent A. succinogenes cells is preferably a DNA construct. The nucleic acid construct may be in a linear form or in a circular form.

A non-limiting example of a circular DNA construct is a plasmid. Non-limiting examples of plasmids suitable for use in A. succinogenes include pLGZ920, pLGZ921 and pLGZ922 as described in US Pat. No. 7,163,812.

In preferred embodiments, the nucleic acid construct is linear DNA.

Linear DNA production methods are well known to those skilled in the art and may include, for example, but not limited to, cloning into a vector, such as for example a plasmid, or a polymerase chain reaction (PCR). ).

In one example, linear DNA can be obtained by cloning into plasmid pNZ5319 (Fig. 1). In another example, the linear DNA can be obtained by overlapping PCR (Figure 2).

When the nucleic acid construct has been removed by the competent A. succinogenes cells, the nucleic acid construct or a fragment thereof can be incorporated into the genomic DNA by recombination or a plasmid can be established. which results in cells of A. succinogenes that have changed phenotypes.

The term "transformation" generally refers to the process of genetic alteration of a cell resulting from the collection of exogenous DNA in its environment. In the context of the present invention, the exogenous DNA encompasses the nucleic acid construct that is incubated with competent A. succinogenes cells.

Therefore, "transformed cells" as used herein refers to A. succinogenes cells genetically altered or modified due to the removal of the nucleic acid construct as taught herein.

When suitably modified, the nucleic acid construct or a fragment thereof can be inserted into the genomic DNA (i.e., integration) of competent A. succinogenes cells which have removed said nucleic acid chimera by double homologous recombination.

The term "homologous recombination" generally refers to a type of genetic recombination in which nucleotide sequences are exchanged between two identical, similar or homologous DNA molecules. In the context of the present invention, nucleotide sequences are exchanged between the nucleic acid construct and genomic DNA, preferably chromosomal DNA, competent A. succinogenes cells that have removed said nucleic acid construct. The term "non-homologous recombination" generally refers to a type of genetic recombination between DNA molecules that do not contain any sequence homology.

Homologous recombination may be preferred because homologous recombination makes it possible to know where recombination will occur in genomic DNA.

In order for homologous recombination to occur, the nucleic construct must comprise at least one nucleotide sequence substantially homologous to a sequence of A. succinogenes genome. It will be understood by those skilled in the art that it is not necessary to have a 100% identity in order to obtain homologous recombination. A percentage identity between the nucleotide sequences of about 90% will be sufficient. For example, the nucleotide sequences may be at least 91% identical, for example at least 92% identical, preferably at least about 93% identical, for example at least 94% identical, more preferably at least about equal to about 95%, for example at least 96% identical, still more preferably at least about 97%, for example at least 98% identical, and most preferably at least 99% identical. The nucleotide sequences must also be of sufficient length to allow homologous recombination. This length must be at least about 200 bp, for example it may vary between 200 bp and 2000 bp, preferably between 1000 bp and 1500 bp.

In some embodiments, the nucleic acid construct comprises at least two of these nucleotide sequences substantially homologous to A. succinogenes genome sequences, allowing dual homologous recombination to take place.

Preferably, the nucleotide sequences are substantially homologous to A. succinogenes genome sequences flanking a target sequence. Such methods may be suitable for replacing a target sequence or for deleting a target sequence.

In preferred embodiments, the nucleic acid construct comprises a first nucleotide sequence substantially homologous to a A. succinogenes genome sequence flanking a target sequence at its 5 'side and a second nucleotide sequence substantially homologous to a sequence. A. succinogenes genome flanking said target sequence at its 3 'side, said nucleotide sequences being capable of homologous recombination with said A. succinogenes sequences when said nucleic acid construct is introduced into said A. cells. succinogenes.

As used herein, the term "target sequence" refers to a sequence present in the genome of A. succinogenes that is to be genetically modified, including replacement and deletion. The target sequence may be a functional sequence, such as, for example, a promoter or other regulatory sequence, or a coding sequence, as well as a non-functional sequence.

In preferred embodiments, the target sequence encodes an undesired functionality, such as, for example, alcohol dehydrogenase (adh), lactate dehydrogenases (ldh), pyruvate formate lyase (pfl), malate dehydrogenases ( mdh), isocitrate dehydrogenase (idh), α-ketoglutarate dehydrogenase complex (ogdc), or succinate synthase (saps), more preferably adh, ldh, pfl or mdh.

In other embodiments, the method further comprises the step of selecting the transformed cells following step a).

In order to allow the selection of transformed A. succinogenes cells, the nucleic acid construct preferably comprises an expression cassette comprising a gene encoding a selection marker and functional regulatory sequences in A. succinogenes cells which are operably linked between, such as for example flanked at its 5 'and 3' sides by, said first and second nucleotide sequences.

As used herein, the term "expression cassette" denotes a fragment of a nucleic acid construct that includes one or more genes whose expression is desired and regulatory sequences operably linked thereto. .

The term "regulatory sequence" as used herein indicates a necessary element for the expression of a sequence, for example a gene, which is operably linked thereto. The precise nature of the regulatory sequences may vary between expression environments, but typically includes a promoter and a transcription termination factor, and optionally an enhancer.

"Operational binding" as used herein is one in which regulatory sequences and sequences sought to be expressed are linked to allow said expression. For example, sequences such as, for example, a promoter and an open reading frame, may be said to be operably linked if the nature of the link between said sequences: (1) does not result in the introduction of a phase change mutation, (2) does not interfere with the ability of the promoter to direct transcription of the open reading frame, (3) does not interfere with the ability of the open reading frame to be transcribed to from the promoter sequence.

For example, the nucleic acid construct may comprise an antibiotic resistance gene conferring antibiotic resistance to transformed A. succinogenes cells. The selection of cells of A. succinogenes transformed, that is to say "transformed", can then be obtained by means of the culture of A. succinogenes cells in a selective medium comprising a culture medium to which we have added the antibiotic. Typically, the selective medium comprises the antibiotic at a concentration sufficient to kill or prevent the growth of A. succinogenes cells that have not removed the nucleic acid construct, i.e. unprocessed succinogens.

Preferably, the transformed colonies are collected, which may advantageously make it possible to verify the introduction of the nucleic acid construct or a fragment thereof into the genomic DNA, preferably chromosomal DNA, for example. by polymerase chain reaction (PCR). Therefore, in other embodiments, the methods as taught herein further include a step of collecting the transformed cells subsequent to the selection. In still other embodiments, the methods as taught herein further include the steps of collecting the transformed cells and verifying the incorporation of the nucleic acid construct or a fragment thereof. in genomic DNA, preferably chromosomal DNA, A. succinogenes cells following selection.

In preferred embodiments, the nucleic acid construct comprises the lox66-? 2-Cat-lox71 cassette of plasmid pNZ5319 between, as for example flanked at its 5 'and 3' sides, a first nucleotide sequence essentially homologous to a sequence of A. succinogenes genome flanking a target sequence at its 5 'side and a second nucleotide sequence substantially homologous to a sequence of A. succinogenes genome flanking said target sequence at its 3' side, said nucleotide sequences being capable of homologous recombination with said A. succinogenes sequences when said nucleic acid construct is introduced into said A. succinogenes cells.

As used, plasmid pNZ5319 indicates the mutagenesis vector described in Lambert et al. (2007. Appl., Microbiol., 73: 1126-1135), which is specifically incorporated herein by reference.

In other examples, the nucleic acid chimera comprises the Yyi-lox66-Cat-lox71 cassette between, such as for example flanked at its 5 'and 3' sides, a first nucleotide sequence substantially homologous to a sequence of A. succinogenes genome flanking a target sequence at its 5 'side and a second nucleotide sequence substantially homologous to a sequence of A. succinogenes genome flanking said target sequence at its 3' side, said nucleotide sequences being capable of homologous recombination with said A. succinogenes sequences when said nucleic acid construct is introduced into said A. succinogenes cells.

The terms "Cat" and "CmR" as used herein are synonymous and here denote a chloramphenicol resistance gene.

The term "P32" indicates the P32 promoter.

The lox66-Pyi-Cat-lox71 and Yyi-lox66-Cat-lox71 cassettes comprise 2 mutant variants of loxP, i.e. lox66 and lox71.

A loxP site generally indicates a nucleotide sequence of 34 bp (i.e., SEQ ID NO: 29: ATAACTTCGTATAATGTATGCTATACGAAGTTAT) which is recognized by Cre recombinase, and which comprises an 8 bp asymmetric main spacer sequence and palindromic flanking sequences of 13 bp, also called inverted repeats. Cre recombinase is a 38 kDa protein that belongs to the specific site recombinase family that are integrases. It catalyzes cofactor-independent recombination between two of its loxP recognition sites, regardless of whether or not these loxP sites are intramolecular or intermolecular. The Cre-lox system makes it possible to excise the sequences between said loxP sites.

As used herein, lox66 (i.e., SEQ ID NO: 30: T ACCGTT CGT AT AT AT GCT AT ACG AT AGTT AT) and lox71 (i.e., SEQ ID NO: 31: AT AACTT CGT AT ATG AT ATGCT AT ACG AACGGT A) indicate mutant loxP sites comprising a mutation in one of the inverted repeats. Recombination of lox66 and lox71 results in a double mutant lox72 site (i.e., SEQ ID NO: 32: TACCGTTCGTATAATGTATGCTATACGAACGGTA) which has a strongly reduced Cre binding affinity. This allows for consecutive cycles of transformation, recombination and excision, resulting in multiple changes in a single genetic background.

The selection of transformants which have taken the nucleic acid comprising the lox66-1 * 32-Cat-lox71 cassette of the plasmid pNZ5319 or the P32-lox66-Cat-lox71 cassette can be carried out by culturing the cells on a selective medium comprising chloramphenicol. .

During the transformation of A. succinogenes cells with a nucleic acid construct comprising the lox66-? 12-Cat-lox71 cassette of plasmid pNZ5319 between a first nucleotide sequence substantially homologous to a sequence of A. succinogenes genome flanking a sequence target at its 5 'side and a second nucleotide sequence substantially homologous to a A. succinogenes genome sequence flanking said target sequence at its 3' side, said target sequence may be replaced by the sequence of the nucleic acid between said first and second nucleotide sequences by dual homologous recombination, thereby leaving the lox66-? 2-Cat-lox71 cassette in the genomic DNA (Fig. 3).

Upon transformation of A. succinogenes cells with a nucleic acid construct comprising the P32-lox66-Cat-lox71 cassette between a first nucleotide sequence substantially homologous to a sequence of A. succinogenes genome flanking a target sequence at the level of its 5 'side and a second nucleotide sequence substantially homologous to a sequence of A. succinogenes genome flanking said target sequence at its 3' side, said target sequence may be replaced by the sequence of the nucleic acid construct between said first and second nucleotide sequences by double homologous recombination, thus leaving the P32-lox66-at-lox71 cassette in the genomic DNA (Fig. 6).

The nucleotide sequence between the lox sites may subsequently be excised in genomic DNA by Cre recombinase, thus leaving the lox72 double mutant site in the genomic DNA (Fig. 3).

Therefore, in other embodiments, the methods as taught herein further include the steps of: b) selecting recombinant cells by culturing the cells on a medium comprising chloramphenicol; and c) providing Cre recombinase.

Recombinant A. succinogenes cells may be endowed with Cre recombinase by transformation with a second nucleic acid construct allowing the expression of Cre recombinase. An appropriate nucleic acid construct may include a plasmid encoding Cre recombinase, such as, for example, the plasmid pGhostCre as described in Fontaine et al. (2010. Appl., Microbiol., 76: 7870-7877), which is specifically incorporated herein by reference.

In preferred embodiments, Cre recombinase is provided by transforming the recombinant cells with a Cre recombinase-encoding plasmid.

Transformation of the recombinant cells with said second nucleic acid construct coding for Cre recombinase, in particular a plasmid encoding Cre recombinase, can be carried out for example by electroporation or transformation by natural skill. Preferably, the transformation with the second nucleic acid construct coding for Cre recombinase is performed by electroporation. Transformation of A. succinogenes cells by electroporation can be accomplished by passing a high voltage discharge through a cell suspension comprising the second nucleic acid construct.

Preferably, said second nucleic acid construct coding for Cre recombinase, in particular a plasmid encoding Cre recombinase, further comprises a gene coding for a selection marker, for example an antibiotic resistance gene, in order to enable selecting cells transformed with said second nucleic acid construct. Selection of recombinant cells that have been transformed with said second nucleic acid construct may then be obtained, for example, by culturing the transformed cells on a selective medium comprising the antibiotic.

Preferably, the excision of the nucleotide sequence between the lox sites in the genomic DNA is verified in the selected transform colonies, for example by PCR, optionally combined with a sequence analysis of the amplification products.

The Cre-lox system for transformation of A. succinogenes cells with a nucleic acid chimera comprising the lox66-P22-CatAox1 cassette or the V22-lox66-Cat-lox71 cassette, the selection of the recombinant cells on the basis of their resistance Acquired chloramphenicol and excision of the nucleotide sequence between lox sites in genomic DNA with Cre recombinase allows multiple genetic modifications of multiple target sequences. Since the Cre-lox system leaves mutant A. succinogenes cells having a lox72 mutant site with reduced binding affinity for Cre recombinase in their genomic DNA, the Cre-lox system can be repeated using a second nucleic acid construct comprising the lox66-P22-Cat-lox71 cassette or a P32-lox66-Cat-lox71 cassette. By sequentially repeating steps a) through c) of the methods disclosed herein for each target sequence to be genetically engineered, multiple genetic modifications of the target sequences can be obtained.

Therefore, in other embodiments, a method is provided for genetically modifying A. succinogenes cells, wherein said genetic modification comprises multiple genetic modifications of the target sequences and wherein the method further comprises the step of ) of repeating steps a) to c) for each target sequence.

In some embodiments of the present methods, the genetic modification may comprise a deletion of a target sequence of the A. succinogenes genome. To obtain a deletion of a target sequence, A. succinogenes cells can be transformed with a nucleic acid construct comprising the lox66-P22-Cat-lox71 cassette flanked at its 5 'and 3' sides by a first one. nucleotide sequence substantially homologous to a A. succinogenes genome sequence flanking the target sequence at its 5 'side and a second target sequence substantially homologous to a de succinogenic genome sequence flanking the target sequence at its 3' side.

In some embodiments of the present methods, the genetic modification may comprise a replacement of a target sequence with the nucleic acid construct fragment between the first nucleotide sequence substantially homologous to a sequence of A. succinogenes genome flanking the sequence. target at its 5 'side and the second nucleotide sequence substantially homologous to a sequence of A. succinogenes genome flanking the target sequence at its 3' side. To obtain such replacement, the A. succinogenes cells can be transformed with a nucleic acid construct comprising the lox66-V12-Cat-lox71 cassette between a first nucleotide sequence substantially homologous to a sequence of A. succinogenes genome. flanking the target sequence at its 5 'side and a second nucleotide sequence substantially homologous to a sequence of A. succinogenes genome flanking the target sequence at its 3' side. In examples, the nucleic acid construct may further comprise a nucleotide sequence providing a desired functionality, for example a desired property or production of a desired product, between said first and second nucleotide sequences, leaving the mutant cells with said nucleotide sequence. nucleotide sequence providing a desired functionality inserted into the genomic DNA. Said nucleotide sequence providing a desired functionality may be one or more genes, including homologous genes as well as heterologous genes, and functional regulatory sequences in A. succinogenes cells operably linked thereto, or a regulatory sequence, such as as for example a strong promoter (for example the P32 promoter) and the like. The replacement of a target sequence, in particular the replacement of a promoter of a target gene by the P32 promoter, can also be obtained by transforming the A. succinogenes cells with a nucleic acid construct comprising the P32- cassette. lox66-Cat-lox71 between a first nucleotide sequence substantially homologous to a sequence of A. succinogenes genome flanking the target sequence at its 5 'side and a second nucleotide sequence substantially homologous to a sequence of A. succinogenes genome flanking the target sequence at its 3 'side.

In preferred embodiments, the genetic modification comprises deletion of the adh, Idh, pfl and mdh genes.

In some examples, the genetic modification may comprise the deletion of the adh, Idh, pfl and mdh genes and the replacement of the cil and / or acn and / or idh and / or ogdc and / or ss promoters by the P32 promoter.

In other examples, the genetic modification may comprise the deletion of the adh, Idh, pfl and mdh genes, the replacement of the cil and / or acn promoters by the P32 promoter, and the insertion of the genes here and heterologous ms, for example from B. Coagulons, and preferably the deletion of idh and / or ogdc genes and / or juices.

Examples

Example 1 Construction of the PKO Linear DNA Fragment

In order to inactivate the gene encoding a pyruvate formate lyase (pfl) by homologous recombination, a linear DNA fragment for gene exchange is constructed in the following manner, based on cloning into the vector pNZ5319 as described. in Lambert et al. (2007. Envir., Microbiol., 73: 1126-1135), which is specifically incorporated herein by reference (Fig. 1).

PCR is performed using the A. succinogenes genomic DNA as template and the primers set forth below: SEQ ID NO: 1 and SEQ ID NO: 2. The PCR fragment obtained is introduced into the vector pNZ5319 previously restricted by PmeI to give pNZ-Pl. SEQ ID NO: 1: 5'-TGTTTATTGCAGTTAACGAT-3 'SEQ ID NO: 2: 5'-ATTTGACCGCACTTTCATTGTAATACTTCCTTTG-3'

PCR is performed using A. succinogenes genomic DNA as template and the primers set forth below: SEQ ID NO: 3 and SEQ ID NO: 4. The resulting PCR fragment is introduced into the previously restricted pNZ-PFL1 vector. by Ecll3Lll to give pNZ-Pl-2. SEQ ID NO: 3: 5'- AAAGT GCGGTC AAATT AATT GGGGT AACGT AAT AA - 3 'SEQ ID NO: 4: 5'- ACCAGCGGGCGCACGCCGGC - 3'

The vector pNZ-PFL1-2 is finally restricted with the XbaI enzyme to give the PKO linear DNA fragment.

Example 2 Construction of the AKO Linear DNA Fragment

In order to inactivate the gene coding for an alcohol dehydrogenase (adh) by homologous recombination, a linear DNA fragment for gene exchange is constructed in the following manner, based on the recovery PCR (Fig. 2) .

PCR is carried out using the genomic DNA of A. succinogenes as template and the primers set forth below: SEQ ID NO: 5 and SEQ ID NO: 6. The PCR fragment obtained is introduced into the vector pNZ5319 previously restricted by Ecl 13611 to give pNZ-A2. SEQ ID NO: 5: 5'-TAAAATCCGGTGCTTGACGGG-3 'SEQ ID NO: 6: 5'-AAAGTGCGGTCAAATTAGTTAAATTTTTTCTCTACCGCG-3'

PCR is performed using the pNZ-A2 vector as a template and the primers set forth below: SEQ ID NO: 5 and SEQ ID NO: 8 to give the CmR-A2 DNA fragment SEQ ID NO: 7: 5 ' - TAAGGAAGATAAATCCCATAAGG - 3 '

PCR is performed using A. succinogenes genomic DNA as a template and the primers set forth below: SEQ ID NO: 8 and SEQ ID NO: 9 to give the Al DNA fragment. SEQ ID NO: 8: 5'- CCTTATGGGATTTATCTTCCTTACATAGTTATTCCTCCGGTTT -3 'SEQ ID NO: 9: 5'- AACCGACACCGTAGATGTTGT - 3'

Finally, the Al and CmR-A2 DNA fragments are mixed together at equimolar concentrations and assembled by performing overlap PCR with the edge primers (SEQ ID NO: 7 and SEQ ID NO: 9) to give the fragment of Linear DNA AKO.

Example 3 Construction of the LKO Linear DNA Fragment

In order to inactivate the gene encoding a lactate dehydrogenase (Idh) by homologous recombination, a linear DNA fragment for gene exchange is constructed in the following manner, based on the recovery PCR.

PCR is performed using A. succinogenes genomic DNA as template and the primers set forth below: SEQ ID NO: 10 and SEQ ID NO: 11. The PCR fragment obtained is introduced into the vector pNZ5319 previously restricted by Ecll36ll. to give pNZ-L2. SEQ ID NO: 10: 5'-GATCTTGCTCATTTACTGCCG-3 'SEQ ID NO: 11: 5'-AAAGTGCGGTCAAATTAAAGTCTGTTTATAAAAGATAAGCGG -3'

PCR is performed using the pNZ-L2 vector as a template and the primers set forth below: SEQ ID NO: 10 and SEQ ID NO: 12 to give the CmR-L2 DNA fragment. SEQ ID NO: 12: 5'- TAAGGAAGATAAATCCCATAAGG - 3 '

PCR is performed using A. succinogenes genomic DNA as a template and the primers set forth below: SEQ ID NO: 13 and SEQ ID NO: 14 to give the L1 DNA fragment. SEQ ID NO: 13: 5'-CCTTATGGGATTTATCTTCCTTACATTTTGTTACCTCTTTGTAAAAAG-3 'SEQ ID NO: 14: 5'-GTTTG AT AG ATTT ATT AAT CGTTCCG-3'

Finally, the LI and CmR-L2 DNA fragments are mixed together at equimolar concentrations and assembled by performing overlap PCR with the edge primers (SEQ ID NO: 10 and SEQ ID NO: 14) to give the fragment of Linear DNA LKO.

Example 4 Construction of MKO Linear DNA Fragment

In order to inactivate the gene coding for malate dehydrogenase (mdh) by homologous recombination, a linear DNA fragment for gene exchange is constructed in the following manner, based on the recovery PCR.

PCR is performed using A. succinogenes genomic DNA as a template and the primers set forth below: SEQ ID NO: 15 and SEQ ID NO: 16. The PCR fragment obtained is introduced into the vector pNZ5319 previously restricted by pmeI. to give pNZ-Ml. SEQ ID NO: 15: 5'-GGGGCACCCGGGTGACCGG-3 'SEQ ID NO: 16: 5'-ATTTGACCGCACTTTCATTTTTGCTCTCCTGTTGG -3'

PCR was performed using the pNZ-M1 vector as template and the primers set forth below: SEQ ID NO: 15 and SEQ ID NO: 17 to give the Ml-CmR DNA fragment. SEQ ID NO: 17: 5'-TTC ACGTT ACT AA AGGGAAT GTA -3 '

PCR is performed using A. succinogenes genomic DNA as a template and the primers set forth below: SEQ ID NO: 18 and SEQ ID NO: 19 to give the M2 DNA fragment. SEQ ID NO: 18: 5'-TACATTCCCTTTAGTAACGTGAATAAATTGTTCGTTCCCCTCTG -3 'SEQ ID NO: 19: 5'-ATCGGTGCAATAATACCGGCGG-3'

Finally, the Ml-CmR and M2 DNA fragments are mixed together at equimolar concentrations and assembled by performing overlap PCR with the edge primers (SEQ ID NO: 15 and SEQ ID NO: 19) to give the fragment of Linear DNA MKO.

Example 5 Construction of Mutant Mutant Strains of Actinobacillus sp. PKO. AKO. LKO. MKO

Actinobacillus succinogenes 130Z is plated on Brain Heart Infusion Broth (BHI) medium (Sigma-Aldrich) and cultured for 15 hours at 37 ° C. One of the colonies formed is inoculated in a liquid medium containing 10 ml of BHI and cultured for 12 hours. A fraction of this culture (1%) is removed and cultivated for 3-4 hours in a rich medium (35 ml BHI) in a sufficiently large Erlenmeyer flask (500 ml) to promote the aeration of the culture up to the optical density. about 0.2. A volume of 10 ml of the culture is taken and centrifuged for 5 min at 2000xg. The bacterial pellet is washed with 10 ml of M-IV medium (Poje and Redfield, 2003. Methods Mol Med 71: 57-70) and finally replaced by 10 ml of M-IV medium maintained at room temperature in an Erlenmeyer flask ( 250 ml). The culture is stirred at 37 ° C and 100 rpm for 100 min. At this time, the crop has reached a maximum level of competence and will maintain it for at least 1h at 37 ° C.

Depending on which gene is desired to inactivate, the corresponding linear DNA fragment constructed in Example 1 to 4 is added at a concentration of 25 ng / ml to 1 ml of competent cells. Cells are incubated with DNA at 37 ° C and 100 rpm for 15 min. This is the time required for the entry of DNA into the bacterium and its integration into the chromosome by double homologous recombination. The culture (100 μl) is finally spread on petri dishes containing either BHI (10 × 10 and 10 × 5 dilution), or BHI with chloramphenicol 5 μg / ml (1 × and 10 μ dilution). Resistance to certain antibiotics requires some time of expression. In the case of chloramphenicol, a step must be added before spreading on a dish containing 5 μg / ml of antibiotic. This consists of adding 2 volumes of BHI to the culture volume and incubating at 37 ° C for 90 min. After plating, the Petri dishes are incubated at 37 ° C. for 48 hours. The efficiency of cell competence is calculated by dividing the number of transformants / ml (calculated from the number of colonies on the boxes containing chloramphenicol) by the total number of cells / ml (calculated from the number of colonies on dishes BHI). In the case of DNA fragments obtained by cloning in a vector or by recovery PCR, a proficiency of 2.10'6 or 2.10 "4 was obtained respectively.Colamphenicol-resistant colonies are analyzed by PCR using primers. which border the region in which the gene has been replaced The amplified DNA fragment is sequenced to confirm the presence of the loxóó-Y ^ -cat-loxJl cassette in the chromosome.

In order to confirm the inactivation of the pfl gene, a PCR is carried out using the PKO mutant strain DNA as template and the primers set forth below: SEQ ID NO: 20 and SEQ ID NO: 21. A PCR is also performed on the DNA of the wild strain with these same primers as a control. SEQ ID NO: 20: 5'-GGG AT CGT CGT CGCTT GCC A-3 'SEQ ID NO: 21: 5'-TGGAATACTTCCTGACCGCC-3'

The PCR products are analyzed by agarose gel electrophoresis. The resulting PCR product for mutant strain PKO using primers SEQ ID NO: 20 and SEQ ID NO: 21 gave a band corresponding to a size of 4265 bp on agarose gel. In parallel, the PCR product obtained for the wild-type strain gives a band corresponding to a size of 5345 bp. The band having the expected size on gel, the PCR amplified DNA for mutant strain PKO is sequenced to confirm the presence of the lox66-Pi2-cat-Îox71 cassette in place of the pfl gene in the chromosome.

In order to confirm the inactivation of the adh gene, PCR is performed using the AKO mutant strain DNA as the template and the primers set forth below: SEQ ID NO: 22 and SEQ ID NO: 9. A PCR is also performed on the DNA of the wild strain with these same primers as a control. SEQ ID NO: 22: 5 '- TGCCTAAAACGGCGGCGGAGG - 3'

The PCR products are analyzed by agarose gel electrophoresis. The product resulting from the PCR for the AKO mutant strain using the primers SEQ ID NO: 23 and SEQ ID NO: 9 gives a band corresponding to a size of 4235 bp on agarose gel. In parallel, the PCR product obtained for the wild strain gives a band corresponding to a size of 4203 bp. The band having the expected size on gel, the PCR amplified DNA for the mutant AK strain is sequenced to confirm the presence of the lox66-γ-yl-cat-lox71 cassette in place of the adh gene in the chromosome.

In order to confirm the inactivation of the Idh gene, PCR is performed using the LKO mutant strain DNA as the template and the primers set forth below: SEQ ID NO: 23 and SEQ ID NO: 14. A PCR is also performed on the DNA of the wild strain with these same primers as a control. SEQ ID NO: 23: 5'- GGAAGACGGTAACAAAATTTC - 3 '

The PCR products are analyzed by agarose gel electrophoresis. The resulting PCR product for LKO mutant strain using primers SEQ ID NO: 23 and SEQ ID NO: 14 gave a band corresponding to 4203 bp on agarose gel. In parallel, the PCR product obtained for the wild-type strain gives a band corresponding to a size of 4710 bp. The band having the expected size on gel, the PCR amplified DNA for the LKO mutant strain is sequenced to confirm the presence of the lox66-P32-cat-lox 71 cassette in place of the Idh gene in the chromosome.

In order to confirm the inactivation of the mdh gene, PCR is carried out using the DNA of the MKO mutant strain as template and the primers set forth below: SEQ ID NO: 24 and SEQ ID NO: 19. A PCR is also performed on the DNA of the wild strain with these same primers as a control. SEQ ID NO: 24: 5'- CCATAATACTTCGGCAATATC - 3 '

The PCR products are analyzed by agarose gel electrophoresis. The product resulting from the PCR for MKO mutant strain using primers SEQ ID NO: 24 and SEQ ID NO: 19 gives a band corresponding to a size of 4278 bp on agarose gel. In parallel, the PCR product obtained for the wild strain gives a band corresponding to a size of 4027 bp. The band having the size expected on gel, the PCR amplified DNA for the MKO mutant strain is sequenced to confirm the presence of the loxóó-P -cat-loxJl cassette in place of the mdh gene in the chromosome.

Example 6 Construction of Multiple Mutant Strains of Fininobacillus sp. ALPKQ1 ALMKO. ALMPKO

Multiple mutant strains are constructed in stages sequentially inactivating one gene at a time and require excision of the chloramphenicol (P32-cat) resistant cassette prior to inactivation of the next gene.

To excise the selection marker (P32-cat) of the chromosome, the plasmid pGhostCre as described in Fontaine et al. (Appl. Environ Microbiol 76: 7870-7877), which is specifically incorporated herein by reference, having a thermosensitive origin of replication is electroporated into electrocompetent mutant cells previously prepared following the protocol described in Frey (1992. Res. Microbiol., 143: 263-269).

The cells of the mutant strain are plated on BHI medium and cultured for 15h at 37 ° C. One of the colonies formed is inoculated in a liquid medium containing 10 ml of BHI and cultured for 12 hours. A fraction of this culture (1%) is removed and cultured for 3-4 hours in 100 ml of BHI up to an optical density of about 0.4 to 0.6. The culture is then centrifuged for 15 min at 3100xg to collect the cells. Then, the cell pellet is washed 3x in 10 ml of a 10% glycerol solution at 4 ° C. The cells are finally concentrated in a volume of 200 μl of a 10% glycerol solution and stored at -80 ° C. Electroporation (2.5 kV / cm, 200 Ω and 50 μF) was performed with 50 μΐ of electrocompetent cells and 500 ng of plasmid in a 0.1 cm Gene Pug (Bio-Rad). After incubation for 2 h at 37 ° C. and 180 rpm, the cells (100 μl) are plated on Petri dishes containing BHI with erythromycin 50 μg / ml (dilution 1x and 10 μl). After 48h to 72h of growth, the erythromycin resistant colonies are analyzed by PCR using primers that border the region in which the gene has been replaced. The amplified DNA fragment is sequenced to confirm the excision of the marker and the presence of the double mutant site lox72.

In order to confirm the excision of the selection marker in the PKO strain, PCR is performed using the mutant strain DNA as the template and the primers set forth below: SEQ ID NO: 20 and SEQ ID NO: 21. PCR is also performed on the DNA of the wild-type strain with these same primers as a control. The PCR products are analyzed by agarose gel electrophoresis and the difference in size of the fragment of the mutant strain relative to the wild-type strain makes it possible to confirm the excision of the selection marker. The excision of the selection marker is confirmed by the fact that the product resulting from the PCR using the primers SEQ ID NO: 20 and SEQ ID NO: 21 gives a band corresponding to a size of 2442 bp on agarose gel. In parallel, the PCR product obtained for the wild strain gives a band corresponding to a size of 5346 bp. The band having the expected gel size, the PCR amplified DNA for the AKO mutant strain is sequenced to confirm the excision of the marker and the presence of the double mutant site lox72 in place of the adh gene in the chromosome.

In order to confirm the excision of the selection marker in the AKO strain, PCR is performed using the mutant strain DNA as template and the primers set forth below: SEQ ID NO: 20 and SEQ ID NO: 21. PCR is also performed on the DNA of the wild-type strain with these same primers as a control. The PCR products are analyzed by agarose gel electrophoresis and the difference in size of the fragment of the mutant strain relative to the wild-type strain makes it possible to confirm the excision of the selection marker. The excision of the selection marker is confirmed by the fact that the product resulting from the PCR using the primers SEQ ID NO: 22 and SEQ ID NO: 9 gives a band corresponding to a size of 3093 bp on agarose gel. In parallel, the PCR product obtained for the wild strain gives a band corresponding to a size of 4203 bp. The band having the expected gel size, the PCR amplified DNA for the AKO mutant strain is sequenced to confirm the excision of the marker and the presence of the double mutant site lox72 in place of the adh gene in the chromosome.

In order to confirm the excision of the selection marker in the LKO strain, PCR is performed using the mutant strain DNA as template and the primers set forth below: SEQ ID NO: 23 and SEQ ID NO: 14. PCR is also performed on the DNA of the wild-type strain with these same primers as a control. The PCR products are analyzed by agarose gel electrophoresis and the difference in size of the fragment of the mutant strain relative to the wild-type strain makes it possible to confirm the excision of the selection marker. The excision of the selection marker is confirmed by the fact that the product resulting from the PCR using the primers SEQ ID NO: 23 and SEQ ID NO: 14 gives a band corresponding to a size of 3201 bp on agarose gel. In parallel, the PCR product obtained for the wild-type strain gives a band corresponding to a size of 4710 bp. The band having the expected gel size, the PCR amplified DNA for mutant strain LKO is sequenced to confirm the excision of the marker and the presence of the double mutant site lox72 in place of the adh gene in the chromosome.

In order to confirm the excision of the selection marker in the MKO strain, PCR is performed using the mutant strain DNA as the template and the primers set forth below: SEQ ID NO: 24 and SEQ ID NO: 19. PCR is also performed on the DNA of the wild-type strain with these same primers as a control. The PCR products are analyzed by agarose gel electrophoresis and the difference in size of the fragment of the mutant strain relative to the wild-type strain makes it possible to confirm the excision of the selection marker. The excision of the selection marker is confirmed by the fact that the product resulting from the PCR using the primers SEQ ID NO: 24 and SEQ ID NO: 19 gives a band corresponding to a size of 3135 bp on agarose gel. In parallel, the PCR product obtained for the wild strain gives a band corresponding to a size of 4027 bp. The band having the expected gel size, the PCR amplified DNA for the MKO mutant strain is sequenced to confirm the excision of the marker and the presence of the double mutant site lox72 in place of the adh gene in the chromosome.

The last step to be carried out is to grow for 10 generations the mutant strain in a medium without selection pressure (erythromycin) and increasing the temperature to remove the thermosensitive plasmid pGhostCre mutant strain.

Different multiple mutants were constructed with the method described above. The inactivated mutant strain at the adh, Idh and pfl genes was named "Actinobacillus sp. ALPKO "and was filed under the accession number LMG P-27388 on January 11, 2013 in the BCCM / LMG bacteria collection at the University of Ghent. The inactivated mutant strain at the adh, Idh and mdh genes was called Actinobacillus sp. ALMKO "and was filed under accession number LMG P-273891e 11 January 2013 in the BCCM / LMG bacteria collection at the University of Ghent. The inactivated mutant strain at the adh, Idh, mdh and pfl genes was called Actinobacillus sp. ALMPKO "and was filed under accession number LMG P-27390 on January 11, 2013 in the BCCM / LMG bacteria collection at the University of Ghent.

Example 7 Fermentation Characteristics of the Actinobacillus sp. AT.PKO. ALMKO. ALMPKO

In order to examine the fermentation characteristics of the mutant strains of A. succinogenes sp. ALPKO, ALMKO and ALMPKO constructed in Example 6, the cells are cultured anaerobically and the resultant products of the reaction are analyzed by HPLC (Precolonne sugar SH-G (SHOWF6700080), Shodex and SH1011 sugar column (SHOWF6378100), Shodex)

The fermentation process comprises the following steps. The strain to be tested is spread on petri dish with BHI medium and 5 mg / l of chloramphenicol in an oven with 5% CO2, 37 ° C and 90% humidity. After 24-48 h growth on petri dish, a colony is isolated and inoculated into 2 ml of anaerobic culture medium with shaking at 200 rpm and 37 ° C. The anaerobic culture medium used is composed of 30-60 g / L glucose, 5 g / L yeast extract, 10 g / L peptone, 1 g / L (NH 4 SO 3) / L KH 2 PO 4, 1 g / L NaCl, 2 g / L CaCl2.2H2O, 0.2 g / L MgCl2.6H2O, 0.007 g / L chloramphenicol and 1% by volume of the vitamin mix (Vit B12 0.1 mg / L, Vit B8 Biotin 2 mg / ml L, Vit B9 Folic Acid 2 mg / L, Vit B Bl Thiamin 5 mg / L, Vit B2 Riboflavin 5 mg / L, Vit B3 Niacin 5 mg / L, Vit B5 Panthothenate 5 mg / L, Vit. Bx p-aminobenzoate 5 mg / L, lipoic acid (cofact) 5 mg / L, Vit K 1, naphthoquinone 10 mg / L, Hemin 50 mg / L) This medium is buffered with MgCO 2 (15 g / L) ), which is brought to the culture pH counterbalanced by CO 2 bubbling After 24-48 h of culture, the 2 ml of culture are used to inoculate a 10% flask containing 20 ml of anaerobic medium. buffered by a higher concentration of MgCC> 3 (30 g / L) which is counterbalanced by a CO2 overpressure in the headspace of the flask.After 18-24 hours of culture, the 20 ml of cultu re are used to inoculate at 10% a vial containing 200 mL of anaerobic medium. After 18-24 hours and after obtaining an optical density greater than 6, the 200 ml vial culture is used to inoculate a 2 L fermentor of anaerobic medium. In this case, the concentration of glucose in the anaerobic medium is between 30-120 g / L. Preferably, the culture medium contains 30-40 g / l of glucose at the beginning of fermentation and the substrate is then added as production progresses. The medium is buffered by a high concentration of MgCOs (100 g / l) which is counterbalanced by a constant bubbling of CO2 at a flow rate of 0.1-0.3 μm. Samples of the culture medium are regularly taken, centrifuged and the supernatant is diluted 10x with an aqueous 0.01 N H 2 SO 4 solution to allow HPLC analysis.

As shown in FIG. 4, after 48 h of culture of A. succinogenes strain 130Z and of the different mutant strains (ALPKO, ALMKO, ALMPKO), it is clear that the production of succinic acid after 48 h is clearly superior for the ALPKO mutants. and ALMPKO only for the wild strain and the ALMKO mutant. On the other hand, Figure 4 clearly shows that after 48 h, the production of succic acid by the mutant ALPKO slows down while the production of the ALMPKO mutant continues almost continuously.

The ALMPKO mutant has the most interesting metabolite profile. Indeed, this mutant does not produce formic acid and a significantly lower acetic acid production than the wild-type strain and the other mutants (Table 1, FIG. 5).

TABLE 1 Carbon balance for the Actmobaculus succinogenes 130Z wild-type strain and the ALPKO, ALMKO and ALMPKO mutants.

As shown in Table 2, the mutants ALPKO and ALMPKO have a mass yield substantially similar and much higher than those observed for the wild strain and mutant ALMKO.

Table 2: Mass yield and average productivity for the wild strain Actinobacillus succinogenes 130Z and mutants ALPKO, ALMKO, and ALMPKO.

After 48h, the mutants ALPKO and ALMPKO have a productivity that is practically similar and much higher than those observed for the wild-type strain and the ALMKO mutant (Table 2). However, the average productivity calculated over 72 hours is significantly higher for the ALMPKO mutant than for the mutants ALPKO, ALMKO and the wild-type strain.

In conclusion, there are significant differences in the mass yield and productivity of succinate as well as the concentration between the different fermentation products among the wild strain and mutants ALMKO, ALPKO and ALMPKO. The invention presented here makes it possible to produce succinic acid with little acetate without inactivating or reducing the activity of the enzymes involved in the acetate production routes.

Example 9 Construction of a mutant strain overexpressing a target gene

Overexpression of a gene is achieved by insertion of the heterologous P32 promoter. This is present on the plasmid pNZ5319 in which its role is to express the chloramphenicol resistance gene (Cat).

The P32 promoter is introduced in front of the gene to be overexpressed using a sequence replacement strategy using double homologous recombination followed by site-specific recombination (Fig. 6). Double homologous recombination allows insertion of the cassette (P1-Loxóó-Cat-lox71) in place of the constitutive promoter. Then, the specific site recombination makes it possible to remove the chloramphenicol resistance gene via the 2 lox mutant sites.

Prior to inserting the cassette (P32-lox66-Cat-lox71) the vector pNZ5319 is modified to move the lox66 site between the P32 promoter and the chloramphenicol resistance gene Cat (Fig. 7). Lox66 is deleted by restriction with Swal and Nrul enzymes. These two enzymes each recognize a unique, stretched restriction site surrounding the lox66 site. In this way, the vector can be easily religated on itself after removal of the fragment containing the lox66 site. The vector without the lox66 site (pNZLox-7) can easily be characterized by sequencing. Then, the lox66 site is reintroduced between the P32 promoter and the cat chloramphenicol resistance gene on the pNZLox-7 vector. This step is carried out with the primers SEQ ID NO: 25 (pNZLox66f4) and SEQ ID NO: 26 (pNZLox66r5) presented in Table 3. Before religuing the PCR fragment obtained, it is re-amplified by PCR using the primers SEQ ID NO: 27 (pNZP32bl) and SEQ ID NO: 28 (pNZP32b2) presented in Table 3. In this way a linker is added between the lox66 site generating a secondary structure of the RNAs transcribed from the P32 promoter and the site ribosome binding (RBS) to prevent this secondary structure from obscuring the RBS sequence. The PCR fragment obtained is ligated on itself to obtain the pNZP32 vector.

Table 3: Name and sequence of the primers used to carry out the PCRs to introduce the lox66 site into the pNZLox-7 vector. The lox66 site sequence is in bold, the ribosome binding site sequence to the chloramphenicol resistance RNA is italicized and the Start codon is underlined.

On the basis of this plasmid, the Up and Down DNA fragments that surround the constitutive promoter of the gene to be overexpressed are constructed by PCR overlap around the P32-lox66-Cat-lox71 cassette.

The strains can be transformed by natural skill and the mutants selected on chloramphenicol.

Finally, the chloramphenicol resistance gene is removed by recombination of the 2 specific sites lox66 and lox71.

Claims (17)

claims A genetically modified bacterial strain for the production of a succinate, said bacterial strain comprising reduced activity of alcohol dehydrogenase (adh), lactate dehydrogenases (ldh), pyruvate formate lyase (pfl) and malate dehydrogenases ( mdh). 2. Bacterial strain according to claim 1, said bacterial strain comprising a disruption genes adh, ldh, pfl and mdh. 3. Bacterial strain according to claim 2, wherein said bacterial strain comprises a deletion of genes adh, ldh, pfl and mdh. 4. A bacterial strain according to any one of claims 1 to 3, said bacterial strain being a strain of the family Pasteurellaceae, preferably a strain of the species Actinobacillus, more preferably a strain of A. succinogenes, still more preferably a strain 130 Z of A. succinogenes. 5. A bacterial strain according to claim 4, said bacterial strain being the strain 130 Z of A. succinogenes genetically modified deposited according to the Budapest Treaty with the Belgïan Coordinated Collections of Microorganisms (BCCM) - Laboratorium voor Microbiologie - Bacteriënverzameling, (BCCM / LMG) on January 11, 2013 under accession number LMG P-27390. A process for the production of succinic acid under anaerobic conditions, the genetically modified bacterial strain according to any one of claims 1 to 5 being used. The method of claim 6, comprising the steps of: a) culturing the genetically modified bacterial strain according to any one of claims 1 to 5 under anaerobic conditions; (b) provide a source of carbohydrates; c) let the bacterial strain metabolize the carbohydrate source; and d) isolating the succinic acid from the culture. A method of genetically modifying A. succinogenes comprising step a) of incubating competent A. succinogenes cells with a nucleic acid construct. The method according to claim 8, wherein the competent A. succinogenes cells can be obtained by incubating exponentially growing A. succinogenes cells in a medium of skill between about 60 minutes and about 100 minutes, preferably about 100 minutes. min. The method of any of claims 8 or 9, the nucleic acid construct being linear DNA. The method of any one of claims 8 to 10, the nucleic acid construct comprising a first nucleotide sequence substantially homologous to a sequence of A. succinogenes genome flanking a target sequence at its 5 'side and a second nucleotide sequence substantially homologous to a sequence of A. succinogenes genome flanking said target sequence at its 3 'side, said nucleotide sequences being capable of homologous recombination with said A. succinogenes sequence when said nucleic acid construct is introduced into said A. succinogenes cells; and preferably an expression cassette comprising a gene encoding a selection marker and functional regulatory sequences in A. succinogenes cells operably linked thereto, said expression cassette being between said first and second nucleotide sequences . 12. The method of claim 11, the target sequence coding for undesired functionality, preferably alcohol dehydrogenase (adh), lactate dehydrogenase (ldh), pyruvate formate lyase (pfl) or malate dehydrogenase (mdh). The method according to any of claims 8 to 12, the nucleic acid construct comprising the lox66-Yyl-Cat-lox71 cassette of plasmid pNZ5319 between a first nucleotide sequence substantially homologous to a flanking A. succinogenes genome sequence. a target sequence at its 5 'side and a second nucleotide sequence substantially homologous to a sequence of A. succinogenes genome flanking said target sequence at its 3' side, said first and second nucleotide sequences being capable of recombination homologous with said A. succinogenes sequence when said nucleic acid construct is introduced into said A. succinogenes cells. The method of claim 13, further comprising the steps of: b) selecting recombinant cells by culturing the cells on a medium comprising chloramphenicol; and c) providing Cre recombinase. 15. The method of claim 14, Cre recombinase being provided by the transformation of recombinant cells with a plasmid encoding Cre recombinase. The method according to any one of claims 14 to 15, the genetic modification comprising several modifications of the target sequences and further comprising step d) of repeating steps a) to c) for each target sequence. 17. The method of claim 16, the genetic modification comprising the deletions of genes adh, Idh, pfl and mdh.