AU771433B2 - Polyhydroxyalkanoate biosynthesis associated proteins and coding region in bacillus megaterium - Google Patents

Polyhydroxyalkanoate biosynthesis associated proteins and coding region in bacillus megaterium Download PDF

Info

Publication number
AU771433B2
AU771433B2 AU24949/00A AU2494900A AU771433B2 AU 771433 B2 AU771433 B2 AU 771433B2 AU 24949/00 A AU24949/00 A AU 24949/00A AU 2494900 A AU2494900 A AU 2494900A AU 771433 B2 AU771433 B2 AU 771433B2
Authority
AU
Australia
Prior art keywords
nucleic acid
acid sequence
seq
protein
sequence encoding
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
AU24949/00A
Other versions
AU2494900A (en
Inventor
Francis C. Cannon
Maura C. Cannon
Kenneth J. Gruys
Gabriel J. Mccool
Henry E. Valentin
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Massachusetts UMass
Original Assignee
University of Massachusetts UMass
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Massachusetts UMass filed Critical University of Massachusetts UMass
Priority claimed from PCT/US2000/000364 external-priority patent/WO2000040730A1/en
Publication of AU2494900A publication Critical patent/AU2494900A/en
Application granted granted Critical
Publication of AU771433B2 publication Critical patent/AU771433B2/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43595—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from coelenteratae, e.g. medusae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/62—Carboxylic acid esters
    • C12P7/625—Polyesters of hydroxy carboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nutrition Science (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Enzymes And Modification Thereof (AREA)

Description

WO 00/40730 PCT/US00/00364 POLYHYDROXYALKANOATE BIOSYNTHESIS ASSOCIATED PROTEINS AND CODING REGION IN BACILLUS MEGA TERIUM FIELD OF THE INVENTION The invention relates to nucleic acid and amino acid sequences involved in biosynthesis, and more specifically, to polyhydroxyalkanoate biosynthesis sequences isolated from Bacillus megaterium. In particular, nucleic acid sequences phaP, phaQ.
phaR, phaB, phaC, and their encoded amino acid sequences are disclosed.
BACKGROUND OF THE INVENTION This patent application is related to U.S. Provisional Application Serial Number to 60/115,092, filed on January 7, 1999. The government may own partial rights to the present invention pursuant to grant number MCB 9604450 from the National Science Foundation.
Polyhydroxyalkanoic acids (PHA) are a class of aliphatic polyesters that accumulate in inclusion-bodies in many bacteria and archaea 41). Their physiological role in the cell is that of carbon and energy reserves, and as a sink for reducing power. The most studied PHA have s1 repeating subunits of: -[O-CH(R)(CH 2 where the most common form is polyhydroxybutyrate (PHB), with R CH 3 and x 1 The PHA biosynthetic pathway has been determined for Alcaligenes eutrophus (17, 18, 44). In this organism two molecules of acetyl-Coenzyme A (CoA) are condensed by -ketothiolase (PhaA). followed by a stereospecific reduction catalyzed by an NADPH dependent acetoacetyl-CoA reductase (PhaB) to produce the monomer D-(-)-P-hydroxybutyryl-CoA. which is polymerized by PHA synthase (PhaC). These 3 pha genes are coded on the phaCAB operon. which is speculated to be constitutively expressed, but PHA is not constitutively synthesized. Alternative pathways for synthesis of the monomer in other organisms have been suggested, most notably in the Pseudomonas species where the side chain, R. is longer than CH 3 and its composition is influenced by carbon substrates in the growth medium 45). In addition to A. eutrophus, phaC has been cloned from more than twenty different bacteria (26, 43). Other genes associated with PHA synthesis, phaA, phaB, phaZ (PHA depolymerase) and genes for inclusion-body associated proteins and other low molecular weight proteins of unknown function, have also been cloned from some of these bacteria, in many cases by virtue of the fact that they are clustered with phaC.
WO 00/40730 PCT/US00/00364 -2- PHA inclusion-bodies are 0.2 to 0.5uim in diameter, but their structural details are largely unknown. They were described originally for some species of Bacillus 8, 15, 30, 47) and later for many more bacteria including Pseudomonas, Alcaligenes and Rhodococcus 11, 12, 42). Those from Bacillus megaterium were shown to contain 97.7% PHA, 1.87% protein and 0.46% lipid with protein and lipid forming an outer layer More recent reports show the presence of a 14 kDa protein (GA14) on PHA inclusion-bodies of R. ruber (36, 37), and a 24 kDa protein (GA24) with similarities to GA14 on the inclusion-bodies of A. eutrophus (48).
These proteins are not essential for PHA accumulation but have been shown to influence the size of PHA inclusion-bodies and the rate of PHA accumulation (37, 48). GA14 and GA24 have to been named "phasins" due to some similarities with oleosins, which are proteins on the surface of oil bodies in plant seeds Granule associated proteins are wide-spread in PHA accumulating bacteria (49).
The pattern of PHA inclusion-body growth and proliferation throughout the growth cycle of Bacillus megaterium has been described (32).
There exists a need for additional nucleic acid and amino acid sequences useful for the production of polymers in biological systems.
SUMMARY OF THE INVENTION This invention is the result of a study of PHA inclusion-body associated proteins from Bacillus megaterium and the cloning and analysis of their coding region. The transcription starts were identified, the functional expression of several of the sequences was confirmed in Escherichia coli and in PHA negative mutants of Bacillus megaterium and Pseudomonas putida, and PhaP and PhaC were localized to PHA inclusion-bodies throughout growth.
A nucleic acid fragment encoding proteins involved in polyhydroxyalkanoate biosynthesis was isolated from Bacillus megaterium. Nine nucleic acid sequences and their encoded amino acid sequences are disclosed. Sequences encoding PhaB and PhaC display not insignificant percent identity and similarity to known acetoacetyl-CoA reductase and polyhydroxyalkanoate synthase proteins, while sequences encoding PhaP, PhaQ, and PhaR do not display significant similarity to known sequences. YkoY is similar to known toxic anion resistance proteins; YkoZ is similar to known RNA polymerase sigma factors; YkrM is similar WO 00/40730 PCT/US00/00364 -3to known Na' -transporting ATP synthase proteins; and SspD matches the known B. megaterium spore specific DNA binding protein.
While several PHA related sequences were expressed in two organisms, it is envisioned that the sequences may be expressed in a wide array of organisms, and that the nucleic acid s sequences themselves may be modified to change the sequence and properties of the encoded proteins.
DESCRIPTION OF THE FIGURES The following figures form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by o1 reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
Figure 1. PHA inclusion-body associated proteins. SDS-polyacrylamide gel electrophoresis of proteins released from purified PHA inclusion-bodies. Lane 1, molecular weight markers in kDa, 14, 18, 29, 43, 68 and 97. Lane 2, proteins from inclusion-bodies of cells harvested at late exponential growth phase. Lane 3, same as lane 2 except this part of the gel was stained following 45 minutes transfer of proteins (seen in lane 2) to PVDF membrane.
The bands were visualized by staining with Coomassie Blue.
Figure 2 The pha sequence cluster and flanking sequences. Map of cloned fragment in pGMIO carrying the pha genes (stripped arrows), intergenic regions (igrs) and flanking genes (thick black arrows) from Bacillus megaterium. The thin arrows indicate the locations and directions of transcripts; P, indicates promoter positions. pGM1, pGM6, pGM9 and pGM7 indicate the cloned DNA fragments in these plasmids (Table Probes used to identify and clone the pha cluster are indicated by thick short lines under pGM1; n2 and n5 are degenerate probes; bmp and bmc are homologous probes to the ends of the pGM1 fragment. Ruler of sequence in base pairs is for Bacillus megaterium and B. subtilis. Map of yko, sspD and ykr region in the B. subtilis genome; genes with homology to those of Bacillus megaterium in this region are indicted by thick black arrows; non-homologous genes are indicated by thick gray arrows. Gene annotations are horizontal over each gene symbol. Relevant restriction enzyme sites are vertical.
WO 00/40730 PCT/US00/00364 -4- Figure 2 Putative promoter regions for phaRBC, -P and sspD. Curved arrows indicate transcription start -10 and -35 nucleotides. The closest resemblance to known and -35 promoter sequences are in lower case letters below putative pha promoter sequences.
Immediately downstream from the PhaP stop codon, the previously described sspD putative promoter is boxed, and putative hairpin structure is underlined.
Figure 2 Mapping of the 5' ends of the phaRBC, -Q and -P transcripts (see Example 11). Lanes G, A, T and C show the dideoxy sequencing ladders obtained with the same primers used in primer extension analysis; nucleotide sequences are complementary to the transcripts.
Lane P is the primer extension product. Lane M is a DNA molecular size marker measured in 0o nucleotides. The primer extension product is indicated by an arrowhead and the 5' end of the transcript within the sequence is indicated by a star. Only regions of the gel containing extension product bands are shown.
Figure 3: Pairwise alignment of PhaC from Bacillus megaterium (this study) and P.
oleovorans (SWISS-PROT accession no. P26494); amino acid identities are shown in black.
The Clustal method with PAM250 residue weight table was used.
Figure 4. pha::gfp fusion plasmids and precursors. Only relevant restriction sites are shown. Annotations are as Figure 2. In all fusions the c-terminus excluding the stop codon, of either phaC or phaP, is fused to the gfp gene by the pGFPuv polylinker. For more details, see Table 1.
Figure 5 Time-course analysis of Bacillus megaterium (pGM16.2) by phase contrast, green fluorescence, light image, and PHA fluorescence. Time (hours) are hours post-inoculation as indicated.
Figure 5 Growth curve for Figure 5 arrowheads indicate a decrease in PhaP::GFP fluorescence.
Figure 5 Bacillus megaterium (pGM16.2) sampled at 2 days post-inoculation. Top image is phase contrast, bottom image is GFP fluorescence.
Figure 5 Bacillus megaterium (pGM13) sampled at 2 days post-inoculation, left whole cells, right -lysed cells. Top image is phase contrast, bottom image is GFP fluorescence.
Figure 5 Bacillus megaterium (pGM13C) sampled at 9 hours post-inoculation. Top image is phase contrast, bottom image is GFP fluorescence.
WO 00/40730 PCT/US00/00364 Figure 5 Bacillus megaterium (pHPS9) showed no fluorescence at any time point.
Top image is phase contrast, bottom image is GFP fluorescence.
Figure 6: Hydrophilicity plot of PhaP protein.
Figure 7: Hydrophilicity plot of PhaQ protein.
Figure 8: Hydrophilicity plot of PhaR protein.
Figure 9: Pairwise alignment of PhaC from Bacillus megaterium (this study) and T.
violacea (SWISS-PROT accession no. P45366); amino acid identities are indicated by a star and amino acid similarities are indicated by a period below the sequences. The ClustalW method with PAM350 residue weight table was used.
Figure 10: Proposed biosynthetic pathway for the preparation of C8 copolymers.
DESCRIPTION OF THE SEQUENCE LISTINGS The following sequence listings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these sequences in combination with the detailed description of specific embodiments presented herein.
WO 00/40730 PCT/US00/00364 -6- SEQ ID NO Description 1 Bacillus megaterium 7,916 bp fragment 2 phaP nucleic acid sequence, 2566-3075 reverse complement 3 PhaP amino acid sequence, 170 amino acids 4 phaQ nucleic acid sequence, 3247-3684 reverse complement PhaQ amino acid sequence, 146 amino acids 6 phaR nucleic acid sequence, 4170-4673 7 PhaR amino acid sequence, 168 amino acids 8 phaB nucleic acid sequence, 4758-5498 9 PhaB amino acid sequence, 247 amino acids phaC nucleic acid sequence, 5578-6663 11 PhaC amino acid sequence, 362 amino acids 12 oligonucleotide probe n2, 39 bases 13 oligonucleotide probe n5, 30 bases 14 oligonucleotide probe bmp, 19 bases oligonucleotide probe bmc, 22 bases 16 oligonucleotide primer for phaP transcription start, 20 bases 17 oligonucleotide primer for phaQ transcription start, 19 bases 18 oligonucleotide primer for phaRBC transcription start, 19 bases 19 N-terminal amino acid sequence of 14 kDa protein N-terminal amino acid sequence of 20 kDa protein 21 N-terminal amino acid sequence of 41 kDa protein 22 ykoY nucleic acid sequence, 277-1089 23 YkoY amino acid sequence, 271 amino acids 24 ykoZ nucleic acid sequence, 1460-2167 YkoZ amino acid sequence, 236 amino acids 26 ykrM nucleic acid sequence, 6959-7916 (partial) 27 YkrM amino acid sequence, 319 amino acids (partial) 28 sspD nucleic acid sequence, 2419-2225 reverse complement 29 SspD amino acid sequence, 65 amino acids
DEFINITIONS
The following definitions are provided in order to aid those skilled in the art in understanding the detailed description of the present invention.
"C-terminal region" refers to the region of a peptide, polypeptide, or protein chain from s the middle thereof to the end that carries the amino acid having a free a carboxyl group (the Cterminus).
"CoA" refers to coenzyme A.
WO 00/40730 PCT/US00/00364 -7- The phrases "coding sequence", "open reading frame", and "structural sequence" refer to the region of continuous sequential nucleic acid triplets encoding a protein, polypeptide, or peptide sequence.
The term "encoding DNA" or "encoding nucleic acid" refers to chromosomal nucleic acid, plasmid nucleic acid, cDNA, or synthetic nucleic acid which codes on expression for any of the proteins or fusion proteins discussed herein.
SThe term "genome" as it applies to bacteria encompasses both the chromosome and plasmids within a bacterial host cell. Encoding nucleic acids of the present invention introduced into bacterial host cells can therefore be either chromosomally-integrated or plasmid-localized.
io The term "genome" as it applies to plant cells encompasses not only chromosomal DNA found within the nucleus, but organelle DNA found within subcellular components of the cell. Nucleic acids of the present invention introduced into plant cells can therefore be either chromosomallyintegrated or organelle-localized.
"Identity" refers to the degree of similarity between two nucleic acid or protein sequences. An alignment of the two sequences is performed by a suitable computer program. A widely used and accepted computer program for performing sequence alignments is CLUSTALW vl.6 (Thompson, et al. Nucl. Acids Res., 22: 4673-4680, 1994). The number of matching bases or amino acids is divided by the total number of bases or amino acids, and multiplied by 100 to obtain a percent identity. For example, if two 580 base pair sequences had 145 matched bases, they would be 25 percent identical. If the two compared sequences are of different lengths, the number of matches is divided by the shorter of the two lengths. For example, if there were 100 matched amino acids between 200 and a 400 amino acid proteins, they are 50 percent identical with respect to the shorter sequence. If the shorter sequence is less than 150 bases or 50 amino acids in length, the number of matches are divided by 150 (for nucleic acids) or 50 (for proteins); and multiplied by 100 to obtain a percent identity.
The terms "microbe" or "microorganism" refer to algae, bacteria, fungi, and protozoa.
"N-terminal region" refers to the region of a peptide, polypeptide, or protein chain from the amino acid having a free amino group to the middle of the chain.
"Nucleic acid" refers to ribonucleic acid (RNA) and deoxyribonucleic acid (DNA).
A "nucleic acid segment" is a nucleic acid molecule that has been isolated free of total genomic DNA of a particular species, or that has been synthesized. Included with the term WO 00/40730 PCT/US00/00364 -8- "nucleic acid segment" are DNA segments, recombinant vectors, plasmids, cosmids, phagemids, phage, viruses, etcetera.
"Overexpression" refers to the expression of a polypeptide or protein encoded by a DNA introduced into a host cell, wherein said polypeptide or protein is either not normally present in the host cell, or wherein said polypeptide or protein is present in said host cell at a higher level than that normally expressed from the endogenous gene encoding said polypeptide or protein.
The term "plastid" refers to the class of plant cell organelles that includes amyloplasts, chloroplasts, chromoplasts, elaioplasts, eoplasts, etioplasts, leucoplasts, and proplastids. These organelles are self-replicating, and contain what is commonly referred to as the "chloroplast o0 genome," a circular DNA molecule that ranges in size from about 120 to about 217 kb, depending upon the plant species, and which usually contains an inverted repeat region (Fosket, Plant growth and Development, Academic Press, Inc., San Diego, CA, p. 132, 1994).
"Polyadenylation signal" or "polyA signal" refers to a nucleic acid sequence located 3' to a coding region that directs the addition of adenylate nucleotides to the 3' end of the mRNA is transcribed from the coding region.
The term "polyhydroxyalkanoate (or PHA) synthase" refers to enzymes that convert hydroxyacyl-CoAs to polyhydroxyalkanoates and free CoA.
The term "promoter" or "promoter region" refers to a nucleic acid sequence, usually found upstream to a coding sequence, that controls expression of the coding sequence by controlling production of messenger RNA (mRNA) by providing the recognition site for RNA polymerase and/or other factors necessary for start of transcription at the correct site. As contemplated herein, a promoter or promoter region includes variations of promoters derived by means of ligation to various regulatory sequences, random or controlled mutagenesis, and addition or duplication of enhancer sequences. The promoter region disclosed herein, and biologically functional equivalents thereof, are responsible for driving the transcription of coding sequences under their control when introduced into a host as part of a suitable recombinant vector, as demonstrated by its ability to produce mRNA.
"Regeneration" refers to the process of growing a plant from a plant cell plant protoplast or explant).
"Transformation" refers to a process of introducing an exogenous nucleic acid sequence a vector, recombinant nucleic acid molecule) into a cell or protoplast in which that WO 00/40730 PCT/US00/00364 -9exogenous nucleic acid is incorporated into a chromosome or is capable of autonomous replication.
A "transformed cell" is a cell whose nucleic acid has been altered by the introduction of an exogenous nucleic acid molecule into that cell.
A "transformed plant" or "transgenic plant" is a plant whose nucleic acid has been altered by the introduction of an exogenous nucleic acid molecule into that plant, or by the introduction of an exogenous nucleic acid molecule into a plant cell from which the plant was regenerated or derived.
DETAILED DESCRIPTION OF THE INVENTION This invention was developed in the pursuit of proteins which are associated with polyhydroxyalkanoate inclusion bodies, and in the pursuit of novel nucleic acid and amino acid sequences from the bacteria Bacillus megaterium. A 7,916 base pair nucleic acid fragment was isolated and sequenced (SEQ ID NO: This fragment was found to contain nine open reading frames, five of which encode proteins suspected of being involved in polyhydroxyalkanoate biosynthesis.
Genomic fragment An embodiment of the invention is a nucleic acid segment at least about 80% identical to SEQ ID NO: 1. More preferably, the nucleic acid segment is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:1.
Alternatively, the nucleic acid segment may be a nucleic acid segment that hybridizes under stringent conditions to SEQ ID NO: 1, or to the complement thereof. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic.
The invention is further directed to nucleic acid segments, proteins, recombinant vectors, recombinant host cells, genetically transformed plant cells, genetically transformed plants, methods of preparing host cells, methods of preparing plants, fusion proteins, and nucleic acid segments encoding fusion proteins.
phaP and PhaP A nucleic acid segment may comprise a nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid sequence is WO 00/40730 PCT/US00/00364 selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about identical to SEQ ID NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:2. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The to nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:3.
An isolated polyhydroxyalkanoate inclusion body associated protein may comprise an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO:3; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3. The protein is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:3 A recombinant vector may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3; and c) a 3' transcription terminator. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:2. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, WO 00/40730 PCT/US00/00364 -11 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:3. The promoter may generally be any promoter, and more preferably is a tissue selective or tissue specific promoter. The promoter may be constitutive or inducible. The promoter may be a viral promoter. The promoter may be a CMV35S, enhanced CMV35S, an FMV35S, a Lesquerella s hydroxylase, or a 7S conglycinin promoter.
A recombinant host cell may comprise a nucleic acid segment encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid segment is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about identical to SEQ ID NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:2. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:3. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.
A genetically transformed plant cell may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about identical to SEQ ID NO:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:2 or the complement thereof; a nucleic acid sequence encoding a protein at least WO 00/40730 PCT/US00/00364 12about 80% identical to SEQ ID NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3; c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:2. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, lo 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:3.
The plant may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant.
is A method of preparing host cells useful to produce a polyhydroxyalkanoate inclusion body associated protein may comprise a) selecting a host cell; b) transforming the selected host cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about identical to SEQ ID NO:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3; and c) obtaining transformed host cells. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:2. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:3. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, WO 00/40730 PCT/US00/00364 13- Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.
A method of preparing plants useful to produce a polyhydroxyalkanoate inclusion body associated protein may comprise a) selecting a host plant cell; b) transforming the selected host plant cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about identical to SEQ ID NO:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3; c) obtaining transformed host plant cells; and d) 1i regenerating the transformed host plant cells. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:2. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:3. The plant (and plant cell) may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant.
The invention also relates to fusion proteins. A fusion protein may comprise a green fluorescent protein subunit; and a polyhydroxyalkanoate inclusion body associated protein subunit; wherein the polyhydroxyalkanoate inclusion body associated protein subunit comprises an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO:3; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3. The polyhydroxyalkanoate inclusion body associated protein subunit is WO 00/40730 PCT/US00/00364 14preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:3 A nucleic acid segment encoding a fusion protein may comprise a nucleic acid sequence encoding a green fluorescent protein subunit; and a nucleic acid sequence encoding a s polyhydroxyalkanoate inclusion body associated protein subunit; wherein the nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein subunit is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to 0o SEQ ID NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:2. The nucleic acid sequence may be obtained from a natural source, may be mutagenized, may be genetically is engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein subunit at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:3.
phaO and PhaO A nucleic acid segment may comprise a nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:4; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about identical to SEQ ID NO:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:4. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 92%, 94%, 96%, 98%, 99%. 99.5%, or 100% identical to SEQ ID WO 00/40730 PCT/US00/00364 An isolated polyhydroxyalkanoate inclusion body associated protein may comprise an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO:5; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with s SEQ ID NO:5. The protein is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID A recombinant vector may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate io inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:4; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5; and c) a 3' transcription terminator. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:4. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:5. The promoter may generally be any promoter, and more preferably is a tissue selective or tissue specific promoter. The promoter may be constitutive or inducible. The promoter may be a viral promoter. The promoter may be a CMV35S, enhanced CMV35S, an FMV35S, a Lesquerella hydroxylase, or a 7S conglycinin promoter.
A recombinant host cell may comprise a nucleic acid segment encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid segment is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:4; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about identical to SEQ ID NO:5; and a nucleic acid sequence encoding a protein that is WO 00/40730 PCT/US00/00364 -16immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:4. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:5. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.
A genetically transformed plant cell may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about identical to SEQ ID NO:4; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5; c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:4. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID The plant may generally be any plant, and more preferably a monocot, dicot, or conifer. The WO 00/40730 PCT/US00/00364 -17plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant.
A method of preparing host cells useful to produce a polyhydroxyalkanoate inclusion body associated protein may comprise a) selecting a host cell; b) transforming the selected host cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about identical to SEQ ID NO:4; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5; and c) obtaining transformed host cells. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:4. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:5. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.
A method of preparing plants useful to produce a polyhydroxyalkanoate inclusion body associated protein may comprise a) selecting a host plant cell; b) transforming the selected host plant cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about identical to SEQ ID NO:4; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:4 or the complement thereof; a nucleic acid sequence encoding a protein at least WO 00/40730 PCT/US00/00364 -18about 80% identical to SEQ ID NO:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5; c) obtaining transformed host plant cells; and d) regenerating the transformed host plant cells. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:4. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:5. The to plant (and plant cell) may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant.
The invention also relates to fusion proteins. A fusion protein may comprise a green fluorescent protein subunit; and a polyhydroxyalkanoate inclusion body associated protein subunit; wherein the polyhydroxyalkanoate inclusion body associated protein subunit comprises an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO:5; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5. The polyhydroxyalkanoate inclusion body associated protein subunit is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID A nucleic acid segment encoding a fusion protein may comprise a nucleic acid sequence encoding a green fluorescent protein subunit; and a nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein subunit; wherein the nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein subunit is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:4; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with WO 00/40730 PCT/US00/00364 19- SEQ ID NO:5. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:4. The nucleic acid sequence may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein subunit at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID phaR and PhaR A nucleic acid segment may comprise a nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid sequence is o1 selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:6; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about identical to SEQ ID NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:6. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:7.
An isolated polyhydroxyalkanoate inclusion body associated protein may comprise an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO:7; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7. The protein is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:7 A recombinant vector may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:6; a WO 00/40730 PCT/US00/00364 nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7; and c) a 3' transcription terminator. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:6. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, to 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:7. The promoter may generally be any promoter, and more preferably is a tissue selective or tissue specific promoter. The promoter may be constitutive or inducible. The promoter may be a viral promoter. The promoter may be a CMV35S, enhanced CMV35S, an FMV35S, a Lesquerella hydroxylase, or a 7S conglycinin promoter.
A recombinant host cell may comprise a nucleic acid segment encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid segment is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:6; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about identical to SEQ ID NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:6. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:7. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants WO 00/40730 PCT/US00/00364 -21such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.
A genetically transformed plant cell may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about identical to SEQ ID NO:6; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:6 or the complement thereof; a nucleic acid sequence encoding a protein at least to about 80% identical to SEQ ID NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7; c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:6. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:7.
The plant may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant.
A method of preparing host cells useful to produce a polyhydroxyalkanoate inclusion body associated protein may comprise a) selecting a host cell; b) transforming the selected host cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about identical to SEQ ID NO:6; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:7; and a nucleic acid sequence encoding a protein that is WO 00/40730 PCTIUS00/00364 -22immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7; and c) obtaining transformed host cells. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:6. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:7. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, to Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.
A method of preparing plants useful to produce a polyhydroxyalkanoate inclusion body associated protein may comprise a) selecting a host plant cell; b) transforming the selected host plant cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about identical to SEQ ID NO:6; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7; c) obtaining transformed host plant cells; and d) regenerating the transformed host plant cells. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:6. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:7. The plant (and plant cell) may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants WO 00/40730 PCT/US00/00364 -23such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant.
The invention also relates to fusion proteins. A fusion protein may comprise a green fluorescent protein subunit; and a polyhydroxyalkanoate inclusion body associated protein s subunit; wherein the polyhydroxyalkanoate inclusion body associated protein subunit comprises an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO:7; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7. The polyhydroxyalkanoate inclusion body associated protein subunit is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:7 A nucleic acid segment encoding a fusion protein may comprise a nucleic acid sequence encoding a green fluorescent protein subunit; and a nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein subunit; wherein the nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein subunit is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:6; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:6. The nucleic acid sequence may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein subunit at least about 82%, 84%. 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:7.
phaB and PhaB A nucleic acid segment may comprise a nucleic acid sequence encoding a 3-keto-acyl- CoA reductase protein, wherein the nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic WO 00/40730 PCT/US00/00364 -24acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:8. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9.
An isolated 3-keto-acyl-CoA reductase protein may comprise an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO:9; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9. The protein is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9 A recombinant vector may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; b) a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9; and c) a 3' transcription terminator. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:8. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9. The promoter may generally be any promoter, and more preferably is a tissue selective or tissue specific promoter. The promoter may be WO 00/40730 PCT/US00/00364 constitutive or inducible. The promoter may be a viral promoter. The promoter may be a enhanced CMV35S, an FMV35S, a Lesquerella hydroxylase, or a 7S conglycinin promoter.
A recombinant host cell may comprise a nucleic acid segment encoding a 3-keto-acyl- CoA reductase protein, wherein the nucleic acid segment is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:8. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably is encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.
A genetically transformed plant cell may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; b) a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9; c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate WO 00/40730 PCT/US00/00364 -26nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:8. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9. The plant may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, 0o peanut, sugarcane, switchgrass, or alfalfa plant.
A method of preparing host cells useful to produce a 3-keto-acyl-CoA reductase protein may comprise a) selecting a host cell; b) transforming the selected host cell with a recombinant vector having a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9; and c) obtaining transformed host cells. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:8. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.
WO 00/40730 PCT/US00/00364 -27- A method of preparing plants useful to produce a 3-keto-acyl-CoA reductase protein may comprise a) selecting a host plant cell; b) transforming the selected host plant cell with a recombinant vector having a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9; c) obtaining transformed host plant cells; and d) regenerating the transformed host plant cells.
More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:8. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9. The plant (and plant cell) may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant.
The invention also relates to fusion proteins. A fusion protein may comprise a green fluorescent protein subunit; and a 3-keto-acyl-CoA reductase protein subunit; wherein the 3keto-acyl-CoA reductase protein subunit comprises an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO:9; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9. The 3-keto-acyl-CoA reductase protein subunit is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9 A nucleic acid segment encoding a fusion protein may comprise a nucleic acid sequence encoding a green fluorescent protein subunit; and a nucleic acid sequence encoding a 3-ketoacyl-CoA reductase protein subunit; wherein the nucleic acid sequence encoding a 3-keto-acyl- CoA reductase protein subunit is selected from the group consisting of: a nucleic acid sequence WO 00/40730 PCT/US00/00364 -28at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:8. The nucleic acid sequence may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein subunit at least about to 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9.
phaC and PhaC A nucleic acid segment may comprise a nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein, wherein the nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO: 11.
An isolated polyhydroxyalkanoate synthase protein may comprise an amino acid sequence selected from the group consisting of: an amino acid sequence at least about identical to SEQ ID NO:11; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with SEQ ID NO: 11. The protein is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO: 1 WO 00/40730 PCT/US00/00364 -29- A recombinant vector may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO: 10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11; and c) a 3' transcription terminator. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 1i 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:I 1. The promoter may generally be any promoter, and more preferably is a tissue selective or tissue specific promoter. The promoter may be constitutive or inducible. The promoter may be a viral promoter. The promoter may be a CMV35S, enhanced CMV35S, an FMV35S, a Lesquerella hydroxylase, or a 7S conglycinin promoter.
A recombinant host cell may comprise a nucleic acid segment encoding a polyhydroxyalkanoate synthase protein, wherein the nucleic acid segment is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%. 90%, 92%, 94%, WO 00/40730 PCT/US00/00364 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:11. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.
A genetically transformed plant cell may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate 0o synthase protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO: 11; c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO: 11. The plant may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant.
A method of preparing host cells useful to produce a polyhydroxyalkanoate synthase protein may comprise a) selecting a host cell; b) transforming the selected host cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein, wherein the structural nucleic acid sequence is selected from the group WO 00/40730 PCT/US00/00364 -31 consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO: 11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11; and c) obtaining transformed host cells. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be to synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO: 11. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.
A method of preparing plants useful to produce a polyhydroxyalkanoate synthase protein may comprise a) selecting a host plant cell; b) transforming the selected host plant cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11; c) obtaining transformed host plant cells; and d) regenerating the transformed host plant cells. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence WO 00/40730 PCT/US00/00364 -32preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:11. The plant (and plant cell) may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant.
The invention also relates to fusion proteins. A fusion protein may comprise a green fluorescent protein subunit; and a polyhydroxyalkanoate synthase protein subunit; wherein the polyhydroxyalkanoate synthase protein subunit comprises an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO: 11; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11. The polyhydroxyalkanoate synthase protein subunit is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:11 A nucleic acid segment encoding a fusion protein may comprise a nucleic acid sequence s1 encoding a green fluorescent protein subunit; and a nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein subunit; wherein the nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein subunit is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO: 10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO: 11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid sequence may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein subunit at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO: 11.
PHA biosynthesis methods: phaB and phaC A method for the preparation of polyhydroxyalkanoate may comprise: a) obtaining a cell comprising: a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a nucleic WO 00/40730 PCT/US00/00364 -33acid sequence encoding a PHA synthase protein; wherein: the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is not naturally found in the cell; the nucleic acid sequence encoding a PHA synthase protein is not naturally found in the cell; the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of: a nucleic s acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9; and the nucleic acid o1 sequence encoding a PHA synthase protein is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11; and b) culturing the cell under conditions suitable for the preparation of polyhydroxyalkanoate. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein more preferably is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:8. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence encoding a 3keto-acyl-CoA reductase protein preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9. The nucleic acid sequence encoding a PHA synthase protein more preferably is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid sequence encoding a PHA synthase protein may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence encoding a PHA synthase protein preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:11. The cell may generally be any cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, WO 00/40730 PCT/US00/00364 -34- Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell. The polyhydroxyalkanoate may be a homopolymer or copolymer. The polyhydroxyalkanoate may be a polyhydroxybutyrate, polyhydroxyvalerate, polyhydroxyhexanoate, polyhydroxyoctanoate, polyhydroxydecanoate, or copolymers thereof.
A method for the preparation of polyhydroxyalkanoate may comprise: a) obtaining a plant comprising: a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a to nucleic acid sequence encoding a PHA synthase protein; wherein: the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is not naturally found in the plant; the nucleic acid sequence encoding a PHA synthase protein is not naturally found in the plant; the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9; and the nucleic acid sequence encoding a PHA synthase protein is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11; and b) growing the plant under conditions suitable for the preparation of polyhydroxyalkanoate. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein more preferably is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:8. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence encoding a 3keto-acyl-CoA reductase protein preferably encodes a protein at least about 82%, 84%, 86%, WO 00/40730 PCT/US00/00364 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9. The nucleic acid sequence encoding a PHA synthase protein more preferably is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid sequence encoding a PHA synthase protein may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence encoding a PHA synthase protein preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:11. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant. The polyhydroxyalkanoate may be a homopolymer or copolymer. The polyhydroxyalkanoate may be a polyhydroxybutyrate, polyhydroxyvalerate, polyhydroxyhexanoate, polyhydroxyoctanoate, polyhydroxydecanoate, or copolymers thereof.
PHA biosynthesis methods: phaB A method for the preparation of polyhydroxyalkanoate may comprise: a) obtaining a cell comprising: a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a nucleic acid sequence encoding a PHA synthase protein; wherein: the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is not naturally found in the cell; the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9; and b) culturing the cell under conditions suitable for the preparation of polyhydroxyalkanoate. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein more preferably is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:8.
The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, WO 00/40730 PCT/US00/00364 -36- 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9. The cell may generally be any cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.
The polyhydroxyalkanoate may be a homopolymer or copolymer. The polyhydroxyalkanoate may be a polyhydroxybutyrate, polyhydroxyvalerate, polyhydroxyhexanoate, polyhydroxyoctanoate, polyhydroxydecanoate, or copolymers thereof.
A method for the preparation of polyhydroxyalkanoate may comprise: a) obtaining a plant comprising: a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a nucleic acid sequence encoding a PHA synthase protein; wherein: the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is not naturally found in the plant; the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9; and b) growing the plant under conditions suitable for the preparation of polyhydroxyalkanoate. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein more preferably is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:8.
The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9. The plant may generally be any plant, and preferably is a tobacco, wheat, potato, Arabidopsis, high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant. The polyhydroxyalkanoate may be a homopolymer or copolymer. The WO 00/40730 PCT/US00/00364 -37polyhydroxyalkanoate may be a polyhydroxybutyrate, polyhydroxyvalerate, polyhydroxyhexanoate, polyhydroxyoctanoate, polyhydroxydecanoate, or copolymers thereof.
PHA biosynthesis methods: phaC A method for the preparation of polyhydroxyalkanoate may comprise: a) obtaining a cell comprising: a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a nucleic acid sequence encoding a PHA synthase protein; wherein: the nucleic acid sequence encoding a PHA synthase protein is not naturally found in the cell; the nucleic acid sequence encoding a PHA synthase protein is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent o1 conditions to SEQ ID NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with SEQ ID NO: 11; and b) culturing the cell under conditions suitable for the preparation of polyhydroxyalkanoate. The nucleic acid sequence encoding a PHA synthase protein more preferably is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid sequence encoding a PHA synthase protein may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence encoding a PHA synthase protein preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:11. The cell may generally be any cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell. The polyhydroxyalkanoate may be a homopolymer or copolymer. The polyhydroxyalkanoate may be a polyhydroxybutyrate, polyhydroxyvalerate, polyhydroxyhexanoate, polyhydroxyoctanoate, polyhydroxydecanoate, or copolymers thereof.
A method for the preparation of polyhydroxyalkanoate may comprise: a) obtaining a plant comprising: a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a WO 00/40730 PCT/US00/00364 -38nucleic acid sequence encoding a PHA synthase protein; wherein: the nucleic acid sequence encoding a PHA synthase protein is not naturally found in the plant; the nucleic acid sequence encoding a PHA synthase protein is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO: 10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO: 11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO: 11; and b) growing the plant under conditions suitable for the preparation of polyhydroxyalkanoate. The nucleic acid sequence o1 encoding a PHA synthase protein more preferably is at least about 82%, 84%, 86%, 88%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid sequence encoding a PHA synthase protein may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence encoding a PHA synthase protein preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:11. The plant may generally be any plant, and preferably is a tobacco, wheat, potato, Arabidopsis, high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant. The polyhydroxyalkanoate may be a homopolymer or copolymer. The polyhydroxyalkanoate may be a polyhydroxybutyrate, polyhydroxyvalerate, polyhydroxyhexanoate, polyhydroxyoctanoate, polyhydroxydecanoate, or copolymers thereof.
Methods for preparing higher polvhydroxyalkanoates Polyhydroxyalkanoate may be prepared by a method comprising: a) obtaining a recombinant host cell comprising: a nucleic acid sequence encoding a p-ketothiolase protein; a nucleic acid sequence encoding a 3-ketoacyl-CoA reductase protein; a nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; a nucleic acid sequence encoding a 3hydroxyacyl-CoA dehydrase; and a nucleic acid sequence encoding an acyl-CoA dehydrogenase protein or an enoyl-CoA reductase protein; and b) culturing the recombinant host cell under conditions suitable for the preparation of polyhydroxyalkanoate; wherein: the polyhydroxyalkanoate comprises C6, C8, or C10 monomer subunits; the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of: a nucleic WO 00/40730 PCT/US00/00364 -39acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9.
Primers, probes, and antibodies The sequences disclosed in the sequence listing may also be used to prepare primers, probes, and monoclonal or polyclonal antibodies.
SEQ ID NOS:1, 2, 4, 6, 8, 10, 22, 24, 26, and 28, and the their complementary strands to may be used to design oligonucleotide primers and probes. Primers and probes are typically at least 15 nucleotides in length, and more preferably are at least 20, 22, 24, 26, 28, 30, 40, or nucleotides in length. Contiguous nucleotide sequences from a given sequence are chosen based upon favorable hybridization conditions, including minimization of hairpin or other detrimental sequences. The identification of suitable primer or probe sequences is well known to those of skill in the art, and is facilitated by commercially available software such as MacVector (Oxford Molecular Group) and Xprimer (http://alces.med.umn.edu/rawprimer.html). Primers and probes may be used for the screening of libraries, for PCR amplification, and other routine molecular biological applications. Primers and probes may also be used for antisense applications.
SEQ ID NOS:3, 5, 7, 9, 11, 23, 25, 27, and 29 may be used for the generation of monoclonal or polyclonal antibodies. The entire sequences may be used, or antigenic fragments thereof. Alternatively, portions of the full length sequences may be synthesized and covalently attached to antigenic proteins such as keyhole limpet hemocyanin (KLH). Portions of the full length sequences may be used for the preparation of multi-antigenic peptides The generation of monoclonal and polyclonal antibodies is well known to those of skill in the art.
The following Examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
WO 00/40730 WO 0040730PCTUSOO/00364 40
EXAMPLES
Example 1: Bacterial strains and plasmids Table 1. Strains Strains Relevant characteristics'a Source or Reference E. coli DH5cx deoR endA]I gyrA 96 hsdR]17 (rk- Ink') recAlI relAlI supE44 thi-]I Clontech ,(1acZYA-argFV]69) 480lacZA3Ml5 Fk. Cloning host and for expression of pha genes B. Wild type, used to clone pha genes TC megalerium 11561 B. phaP, -B and -C deletion derivative of B. megaterium This megaerium 11561 Applicatio n P. PHA positive control
ATCC
oleovorans 29347 P. putida PHA negative mutant obtained by chemical mutagenesis (22) GPp 104 1 WO 00/40730 WO 0040730PCT/USOO/00364 -41 Table 2. Plasmids Plasmids Relevant characteristics'a Source or Referenc e pBluescriptll S Cloning vector, ColE I oriVe, Amp' Stratagen K e pGFPuv Source of gffi gene, ColE I oriV. Amp' Clontech pHPS9 Bacillus-Escherichia co/i shuttle vector, ColE I and pTA 1060 (16) oriV, Em', Cm' pSUP 104 Pseudomonas-Escherichia co/i shuttle vector, Q-type and mini 15 oriV, Em', Tcr pGM I EcoRI in phaP to HindIII in phaC, cloned into the EcoRI-HindIll This sites of pBluescriptllSK, Amp' applicatio n pGM6 PstI in phaB to EcoRI in ykrM, cloned into the Pstl-EcoRl sites of This pBluescriptllSK, Amp' applicatio n pGM7 EcoRI in phaP to EcoRl in ykrM, cloned into the EcoRI site of This pBluescriptllSK, Amp' applicatio n pGM9 Hindl 11 upstream of yko Y to PsiI in phaB, cloned into the Hindu!l This Pstl sites of pBluescriptllSK, Amp' applicatio n pGMl 0 Hindll! upstream of ykoY to EcoRI in ykrM, cloned into the This HindIII -EcoRI sites of pBluescriptllSK, Amp' applicatio n pGM7H EcoRI in phaP to EcoRI in ykrM, cloned into the EcoRl site of This pHPS9, Cm' applicatio n pC/GFP2 PhaC::GFP out-of-frame fusion plasmid. This Fragment shown in Figure 4A cloned in pBluescriptllSK, Amp T applicatio n pCIGFP3 PhaC::GFP in-frame fusion plasmid. This Fragment shown in Figure 4B cloned in pBluescriptlISK, Amp' applicatio n pGMI3 PhaC::GFP in-frame fusion plasmid. This Fragment shown in Figure 4C cloned in pHPS9, Em
T
Lm T applicatio n pGM13C GFP localization control plasmid. Part of phaB and phaC deleted. This Fragment shown in Figure 4D cloned in pHPS9, Em
T
Lm T applicatio n pP/GFP3 PhaP::GFP in-frame fusion plasmid. This shown in Figure 4E cloned in pBluescriptllSK, Amp' applicatio WO 00/40730 PCT/US00/00364 -42n pGM16.2 PhaP::GFP in-frame fusion plasmid. This Fragment shown in Figure 4F cloned in pHPS9, EmrLmr applicatio n pGM107 EcoRI in phaP to EcoRI in ykrM, cloned as a BamHI-Sall This fragment from pGM7, into the BamHI and Sail sites of applicatio pSUP104, Cmr n pDR1 PstI in phaB to EcoRI in ykrM, cloned as a SmaI-EcoRV fragment This from pGM6 into the two DraI sites of pSUP 104 in same applicatio orientation as the Cm gene, with phaC expressed from the Cm n promoter, Tcr pGM61 Derived from pGM13. It carries an in-frame 594 bp deletion in This phaR, extending from 96 bp upstream of the phaR initiation Applicati codon through codon 144. on pGM73 Derived from pGM61. Carries a transcriptional fusion between This the promoter ofphaP and the coding region plus translation Applicati signals ofphaR. A 663 bp DNA fragment harboring phaR was on cloned into the SnaBI site in phaP in the sense orientation.
aEmr, erythromycin resistant; Lmr, lincomycin resistant; Cm', chloramphenicol resistant; Amp', ampicillin resistant; Tc', Tetracycline resistant. bATCC, American Type Culture Collection.
Origin of replication.
Example 2: Media and growth conditions Cultures were grown at 37 0 C (unless otherwise stated) in liquid media, aerated by rotation at 250 rpm in either Luria-Bertani (LB) broth (33) or M9 Minimal Salts (Life Technologies, Bethesda, MD) with 1% glucose. For growth on plates, the above media with 1.5% agar (Sigma, A4550) was used. For plasmid selections, the appropriate antibiotics were included in the media: ampicillin (200 tg/mL [AMP 200 chloramphenicol (25 p.g/mL
[CM
25 erythromycin (200 ug/mL [EM 2 00 or tetracycline (12.5 p.g/mL [TC12.5]) for plasmid selection in Escherichia coli; chloramphenicol (12 ig/mL [CM 1 2 or erythromycin (1 pg/mL plus lincomycin (25 tg/mL [LM 25 for plasmid selection in Bacillus megaterium; chloramphenicol (160 utg/mL [CM16 0 or tetracycline (30 Pg/mL [TC 30 for selection in Pseudomonas.
Example 3: Transformations Escherichia coli and Pseudomonas putida were transformed by electroporation of competent cells using an electroporator (Eppendorf) and following the manufacturers WO 00/40730 PCT/US00/00364 -43instructions. Bacillus megaterium was transformed using a biolistic transformation procedure (39).
Example 4: Microscopy For phase contrast microscopy, wet mounts of cultures were visualized at xl,000 magnification in a light microscope with phase contrast attachments (Labophot-2 Microscope, Nikon, Inc.). To view PHA inclusion-bodies, samples were heat fixed, stained with 1% (w/v) Nile Blue A (Sigma) for 15 minutes at 55 0 C, destained for 30 seconds in 8% acetic acid, water washed, air dried, and viewed at xl000 magnification under fluorescence using filters; excitation, 446/10 nm; barrier filter, 590 nm; dichroic mirror, 580 nm. To view GFP, wet o1 mounts of cultures with or without 1% agarose were viewed at x1000 magnification under fluorescence using filters; excitation, 390-450 nm; barrier filter, 480-520 nm; dichroic mirror, 470 nm.
Example 5: Codon usage in Bacillus megaterium Bacillus megaterium uses three codons as start codons in protein coding sequences.
ATG, TTG, and GTG all encode methionine when present at the start of a coding region. TTG and GTG encode leucine and valine when present within a coding region, respectively. Bacillus megaterium uses TGA, TAA, and TAG as stop codons.
Bacillus megaterium sequences starting with TTG or GTG may require mutagenesis to ATG if the sequences are to be expressed in organisms that use ATG exclusively as a start codon.
Example 6: Separation of polypeptides associated with PHA inclusion-bodies.
In an attempt to determine their relevance, proteins that co-purify with PHA inclusionbodies were separated by electrophoreses on an SDS-polyacrylamide gel (Figure 1).
Inclusion-bodies were purified (32) followed by suspension in TE buffer (10 mM Tris- HCI pH 8, 1 mM EDTA) with 2% SDS. An equal volume of 2x sample buffer (100 mM Tris-HCl (pH 4% SDS, 4 mM EDTA, 20% glycerol, 2% 2-mercaptoethanol, 0.1% bromophenol blue) was added prior to boiling for 5 minutes and samples were centrifuged for 3 minutes to pellet PHA; the supernatant was loaded on a 12% SDS-polyacrylamide gel and run at 8 mA overnight at 4°C to separate proteins. The gel was stained with Coomassie Blue for WO 00/40730 PCT/US00/00364 -44minutes prior to transfer of proteins to a polyvinylidene difluoride membrane using a semi-dry electroblotter at 400 mA for 45 minutes.
There were at least thirteen such proteins present in various quantities. Some or all of these proteins could be intrinsic structural components of PHA inclusion-bodies, enzymes involved with PHA metabolism or possibly scaffolding components involved in inclusion-body assembly. Alternatively, they could have been acquired by the inclusion-bodies during the purification procedure. The three most abundant proteins had molecular weights of approximately 14, 20 and 41 kDa.
The N-terminal amino acid sequence for the three most prevalent proteins were to determined. Membrane carrying the proteins of interest was cut for use in N-terminal amino acid sequence determination by Edman Degradation using a minimum quantity of 200 pmols of each protein. The N-terminal amino acid sequence of the 14 kDa protein was KVFGRXELAAAMKRXGL (SEQ ID NO:19), the 20 kDa protein was NTVKYXTVIXAMXXQ (SEQ ID NO:20), and the 41 kDa proteins was AIPYVQEXEKL (SEQ ID NO:21). A BLASTp search performed with NCBI Entrez database; http://www.ncbi.nlm.nih.gov/Entrez/) revealed that the 14 kDa protein was lysozyme and the other two N-terminal sequences were novel. It was concluded that the lysozyme used in the cell lysis procedure had co-purified with the PHA inclusion bodies. This result confirms that not necessarily all of the proteins that co-purify with PHA inclusion-bodies are associated with them in vivo, as was also shown for Chromatium vinosum (27).
Example 7: Cloning the pha region Purification of genomic and plasmid DNA, Southern blot, hybridization and cloning were by standard procedures To clone the DNA sequences that coded for the two most abundant proteins on purified PHA inclusion-bodies, degenerate oligonucleotide probes based on their Nterminal amino acid sequences were used. The probes were: AAYACRGTNAAATAYNNNACRGTNATYNNNGCDATGATG (n2, SEQ ID NO:12) and GCDATYCCDTAYGTNCARGAAGGHTTYAAA (n5, SEQ ID NO:13) for the 20 kDa and 41 kDa proteins, respectively (Figure 1).
Both probes, used in separate 38 0 C Southern blotting hybridization experiments, identified a 6.4 kb HindIII, a 5.2 kb EcoRI, and a 3.7 kb HindIII to EcoRI DNA fragment of WO 00/40730 PCT/US00/00364 DNA, indicating that the 5' ends of the coding regions for both of these proteins were located less than 3.7 kb apart in the genome. The three fragments were purified from agarose following electrophoresis, and cloned into plasmid pBluescriptIISK.
Positive clones were identified by hybridization to the same degenerate probes, thus yielding plasmid pGM1 containing the 3.7 kb fragment. Sequences contiguous with and overlapping this primary cloned fragment were cloned in a similar manner except that probes based on the ends of the sequenced DNA fragment were used, and hybridization was performed at 55 0 C. The probes used were GCTTCATGCGTGCGGTTTG (bmp, SEQ ID NO:14) and GGACCGTTCGGAAAATCAGCGG (bmc, SEQ ID NO: 15), yielding respectively, pGM9 and to pGM6 (Figure 2).
DNA fragments of pGM1, pGM6 and pGM9 were subcloned into pBluescriptlIISK, and sequenced, from both ends using universal primers and internally by primer walking on both strands, using dye terminator chemistry, cycle sequencing and an ABI Prism 377 sequencer (Applied Biosystems). Sequence assembly and analysis was performed using Lasergene (DNAStar, Inc.), and Gapped BLAST and PSI BLAST The 3.7 kb fragment contained 5 ORFs (Figure whose predicted amino acid sequences encode PhaP (20 kDa protein), PhaQ, PhaR, PhaB and PhaC (41 kDa protein). The 20 and 41 kDa proteins were identified by their N-terminal amino acid sequences. Since the C-terminus for each of these two proteins extended beyond the boundaries of pGM1, the remaining sequence were obtained from plasmids pGM6 and pGM9.
Example 8: The pha locus.
The 7,916 bp region (SEQ ID NO:1) containing pha genes from Bacillus megaterium was cloned, sequenced and characterized. It was shown to carry 8 complete and 1 incomplete open reading frame (Figure 2, Tables 3 and Coding sequences in this region were assigned on the basis of homology to known sequences, N-terminal amino acid sequences, putative ribosome binding sites and operon location. The complement and arrangement of genes flanking the pha genes in Bacillus megaterium are very similar to a region of Bacillus subtilis 168 (Figure This strain is negative for PHA and no known pha genes or sequences occur in its genome, for which the complete sequence is available In place of pha genes in this region of B.
WO 00/40730 PCT/US00/00364 -46subtilis are ykrl, ykrK and ykrL, which, respectively, code for putative proteins similar to two unknown proteins, and a probable heat shock protein.
Table 3: Sequence analysis results Sequence Number of amino acids Mol mass Daltons Isoelectric point ykoY 271 29,996 6.89 ykoZ 236 27,662 9.36 sspD 65 7,027 8.58 phaP 170 19,906 5.29 phaQ 146 16,686 5.09 phaR 168 19,150 5.10 phaB 247 26,098 7.39 phaC 362 41,463 8.31 ykrM 318a ND ND aPartial protein.
WO 00/40730 PCT/US00/00364 -47- Table 4: Sequence homologies Sequen Homologies to known and Identit Similarit Function or putative function ce putative genes (accession y y no.) a ykoY YkoY, B. subtilis 64% 73% Toxic anion resistance (Z99110) protein (24) ykoZ YkoZ, B. subtilis 57% 74% RNA polymerase sigma (Z99111) factor (24) sspD SspD, Bacillus 100% Spore specific, DNA binding megaterium (P10572) protein SspD, B. subtilis (P04833) 73% 87% phaP None PHA inclusion-body structure, shape and size (49) phaQ None Unknown phaR None Unknown phaB FabG, Synechocystis 50% 66% Fatty acid biosynthesis (23) (D90907) 48% 64% 3-ketoacyl-CoA reductase PhaB, C. vinosum D 47% 67% (28) (P45375) Fatty acid biosynthesis FabG, B. subtilis (P51831) phaC PhaC, T. violacea 38% 59% PHA synthase (29, 23, 28) (P45366) 37% 56% PhaC, Synechocystis 35% (D90906) PhaC, C. vinosum (P45370) ykrM YkrM, B. subtilis 55% 71% Na' -transporting ATP (Z99111) synthase (24) A 1 c^ Accession numbers are WISS-rKu i, EBIVIIL or DUUDJ; None known sequences.
Example 9: The pha nucleic acid and encoded protein sequences INo uiscerible simiI1Idat Lu The deduced amino acid sequence of PhaP shows a 20 kDa extremely hydrophilic product with no obvious similarity to known sequences (Figure Inclusion-body associated low molecular weight proteins (phasins) have been described in many bacteria but where sequences were available no similarities of identifiable significance with PhaP of Bacillus megaterium were found.
to Low molecular weight, PHA inclusion-body abundant proteins play an important role in PHA producing cells, since they are involved in determining inclusion-body size and shape, and are present in quantities up to 5% of total protein in the case of PHA producing A. eutrophus WO 00/40730 PCT/US00/00364 -48- It is an interesting observation that the amino acid sequences of phasin proteins are so dissimilar, even in closely related bacteria. Some similarity between such proteins would be expected in closely related bacteria, were they to have a role in inclusion-body biogenesis, however, conservation of sequence would be entirely unnecessary should they have a role as storage proteins.
The deduced amino acid sequences of PhaQ and PhaR also revealed small hydrophilic proteins with no significant identifiable similarity to known proteins (Figures 7 and Figure 1 (lane 2) shows that purified inclusion-bodies have proteins represented by bands of the approximate sizes of PhaQ (17 kDa) and PhaR (19 kDa), but the roles of these proteins are to unknown. They may be non-orthologous replacements for the small putative gene products, whose roles are also unknown, coded in known pha gene clusters. The deduced amino acid sequence of PhaB, is similar in size and amino acid sequence to known phaB and fabG gene products (Table The deduced amino acid sequence of PhaC shows that while it has low homology overall to known PhaC proteins, it is most similar to that of T. violacea, Synechocystis 1i and C. vinosum. PhaC proteins from these three bacterial strains, respectively, have 355, 378, and 355 amino acids while PhaC from Bacillus megaterium has 362 amino acids. All other PhaC proteins studied are larger in size, and range from 559 amino acids for that of P.
oleovorans (22) to 636 amino acids for that of Rhizobium etli Alignment studies of sequences of all previously known PhaC proteins show that the synthases are either large single subunit enzymes (PhaC) or smaller two subunit enzymes (PhaC and PhaE). The Bacillus megaterium PhaC protein aligns poorly with large, single subunit enzymes such as the P.
oleovorans PhaC (Figure 3).
Example 10: Functionality of the pha gene cluster It has been demonstrated that the phaP, -B and -C gene cluster can complement a deletion mutant of B. megaterium. This mutant PHA05 was constructed by a gene substitution technique. A plasmid (based on pGM10) in which the pha genes were substituted by the erythromycin gene, was propagated in B. megaterium 11561. Selection on erythromycin allowed isolation of the PHA05 mutant that was negative for PHA synthesis. Complementation with the phaP, -B and -C gene cluster was obtained when pGM7H or pGM13 was introduced into the PHA05 strain.
WO 00/40730 PCT/US00/00364 -49- Experiments introducing a phaR deletion of pGM13 (pGM61) into PHA05 suggests that the presence of phaR may be preferred for PHA synthesis. This result was confirmed by the recloning of phaR into pGM61 (pGM73) as it was isolated from PHA05(pGM61) strain, followed by the introduction of pGM73 into PHA05. Accumulation of PHA in PHA05(pGM73) confirmed the preference for phaR. It has been previously demonstrated that the small type PhaCs (see Example 17) is not sufficient for PHA synthesis; another peptide, PhaE of approximate size 30 kDa, is also required These complementation studies suggest that it is preferable to combine PhaC of B. megaterium (also a small type PhaC) and phaR (19 kDa), however there is no sequence similarity between phaR of B. megaterium and phaE of other organisms.
Example 11: Mapping transcription starts The transcription start points were mapped in the region from the EcoRI restriction site in phaP to the HindIII site in ykrM by primer extension analysis, using the Promega system for primer extension on RNA templates. DNA oligonucleotide primers, 17 to 20 nucleotides in length, were synthesized to match target sequences, initially at approximately 500 base pair intervals and subsequently at about 50 to 250 nucleotides down-stream from the predicted transcription start points. The 32 P 5' end-labeled primers were extended with reverse transcriptase using total RNA (10 pg per reaction) purified from Bacillus megaterium The fragment length initially, and transcription start nucleotides subsequently, were determined by running the cDNA on a 8% denaturing polyacrylamide gel along-side the products of sequencing reactions, which were generated using the same 5'-end labeled primers. The primers used to identify the transcription start nucleotides for the phaP, phaQ, and phaRBC promoters were, respectively, CCCCTTTGTCCATTGTTCCC (SEQ ID NO:16); CCATGTAGATTCCACCCTC (SEQ ID NO:17); and CTCCATCTCCTTTCTTGTG (SEQ ID NO:18).
Primer extension products showed a single band from each reaction, indicating one transcript, while control reactions in which RNA was omitted showed no bands. The extension products run alongside sequencing reaction products obtained with the same primer (Figure 2C), identified the 5' ends of the transcripts thus allowing the putative promoter sequences at approximately -10 and -35 -bp for phaP, -Q and -R to be identified. The arrangement of genes in the pha cluster of Bacillus megaterium is unique among those already published and phaA is WO 00/40730 PCT/US00/00364 notably absent. The phaP, -B and -C genes were shown to be in a 4,104 -bp region, with phaP and -Q transcribed in one orientation, each from a separate promoter, while phaR, -B and C were divergently transcribed from a promoter in front of phaR. The putative promoters responsible for transcription of phaQ and phaR, phaB and phaC show strong similarity to both Bacillus subtilis Sigma A type (34) and Escherichia coli, Sigma 70 type promoters which can express constitutively. This is in keeping with previous data for Alcaligenes eutrophus showing thatphaC is constitutively synthesized, but PHA is not constitutively accumulated (19).
The third putative promoter in this region, the phaP promoter, resembles a Sigma D (SigD) type promoter known to control the expression of a regulon of genes associated with flagellar o0 assembly, chemotaxis and motility (13, 20, 46). In Bacillus subtilis Sigma D is expressed in the exponential phase and peaks in late exponential phase of growth. This parallels the pattern of PHA accumulation previously described for Bacillus megaterium 11561 However, further experiments are required to test the hypothesis that PHA accumulation in regulated by sigma D or products of its resulting transcripts. The phaP gene has 18 -bp duplicate sequences that could base-pair to form a rho-independent terminator close to its translational stop codon (Figure 2B).
The fact that the -35 promoter region of sspD is within this putative hairpin structure, suggests that transcription ofphaP and sspD could be mutually exclusive, thus allowing the expression of phaP to play a regulatory role in the expression ofsspD (spore specific storage protein).
Example 12: Expression of Bacillus megaterium pha genes in Escherichia coli and Pseudomonas putida Functionality of the Bacillus megaterium putative pha gene cluster was tested in Escherichia coli, which is naturally PHA negative, and Pseudomonas putida GPpl04, a phaCmutant. Plasmids carrying one or more of these genes were introduced and the resulting transformants were tested for PHA accumulation following growth on LB or M9 medium with various carbon sources and the appropriate antibiotic for plasmid selection.
Triplicate 500 mL cultures, were grown in 2 liter flasks at 30 0 C, rotating at 250, using 1% inocula of 16 hour cultures, which had been grown in LB, centrifuged and resuspended in equal volumes of 0.9% saline. At 48 hours samples were removed for microscopy and cells were harvested, washed once in dH20 and lyophilized. For PHA extraction, lyophilized cells were suspended in 10 volumes of 5% bleach, shaken at 65 0 C for 1 hour and centrifuged. The pellet was resuspended in 10 volumes of 5% bleach and centrifuged followed by sequentially WO 00/40730 PCT/US00/00364 -51 washing in water and 95% ethanol. The amount of PHA is expressed as percent PHA per mass of vacuum dried cells Escherichia coli carrying pGM7 or pGMO1 accumulated low levels of PHA while Escherichia coli carrying pGM1 or pGM6 accumulated no PHA. Fluorescence microscopy of Nile Blue A stained cells showed approximately 1 cell in 20 had one or several inclusion-bodies and the quantity of PHA produced was approximately 5% of cell dry weight. Since Escherichia coli does not have PhaA, a low level or no PHA is the expected result. However, in Pseudomonas where PhaA is not known to be required, Pseudomonas putida GPpl04 (pGM 107) accumulated PHA on rich as well as minimal medium with various carbon sources to >50% of to cell dry weight, and 90 to 100% of cells appeared full of PHA (Table The positive control P.
oleovorans, (equivalent to wild-type Pseudomonas putida) accumulated PHA only when grown on longer chain carbon sources, and not on LB. No PHA was accumulated by the negative control or by Pseudomonas putida carrying phaC alone (pDR1). These results showed that this Bacillus megaterium gene cluster is functional in both Escherichia coli and Pseudomonas putida.
It is not known if the negative results obtained with pDR1 was due to PhaC alone being insufficient to complement PhaC- Pseudomonas putida or to synthesize PHA in Escherichia coli, or if the expression ofphaC on pDR1 was not successful in producing protein.
WO 00/40730 PCT/US00/00364 -52- Table 5: Cells with PHA as a percent' of total cells following growth on different carbon sources Substrates Source of Positive Negative phaP"QRBC phaC: (no. C atoms) genes: control: control, vector only: Bacillus P. Pseudomona Pseudomona Pseudomona megaterium oleovorans s putida s putida s putida GPp104 GPp104 GPp 104 (pSUP104) (pGM107) (pDR1) LB 100 0 0 90 0 LB/Glucose, 100 0 0 92 0 1% M9/Caproate, no growth 88 0 100* 0 12 mM (C6) M9/Octanoat no growth 90 0 92 0 e, 12 mM (C8) S100%, PHA in all cells; no PHA in any cell; data averaged from >5 fields of each of 3 different cultures, error less than "N-terminus only present. Cell shape distorted by large quantity of PHA.
These results suggest that the B. megaterium gene cluster, phaP, and is functional in both E. coli and P. putida in so far as accumulation of PHA polymer. It is not known if the negative results obtained with pDRI were due to PhaC alone being insufficient to complement the PhaC mutant of P. putida or to synthesize PHA in E. coli.
o1 Example 13: Localization of PhaP and PhaC proteins Proteins associated with purified PHA inclusion-bodies may not accurately reflect the localization of the these proteins within the growing cell. Visualization ofpha::gfp gene product fusion proteins in living cells throughout culture growth is a useful method for determining both the localization of the pha gene products and their comparative levels in growing cells. PhaP and PhaC, as fusion proteins (Figure localized to PHA inclusion-bodies at all time points tested throughout growth of Bacillus megaterium 11561. The negative control (pHPS9) showed no fluorescence at any time point. The localization control (pGM13C) showed non-localized green fluorescence at all time points. The profiles of PHA accumulation in these two control strains were similar to that of the wild-type, where the quantity of PHA decreased during the lag phase, increased during exponential phase, and continued to increase at a lower steady state rate in stationary phase growth (32).
WO 00/40730 PCT/US00/00364 -53- At time 0, cultures of Bacillus megaterium carrying, pGM16.2, pGM13, pGMI3C or pHPS9, grown in LB with LM 25 EM' for 24 hours at 351C, were inoculated v/v) into 75 mL of fresh media of the same composition, in 300 mL Naphelco flasks, and growth was continued at 27°C, 250 rpm. Optical densities of cultures were monitored and samples were removed for microscopy at time points starting at time 0, for up to 24 hours. One part of each sample was immediately observed for green fluorescence by embedding in 1% low melting point agarose for viewing in phase contrast and under fluorescence for GFP, magnification x1 000. Another part of each sample was stained for PHA and viewed under light microscopy and by fluorescence for PHA inclusion bodies, magnification x 1000. Images were recorded using identical parameters for all samples to allow comparison of fluorescence and light intensities (f-stop, 1/15; brightness, 0.6; sharpness, 1.0; contrast, 0.8; color, 0.3; see also methods and materials). Results are shown in Figure 5 PhaP, monitored as a PhaP::GFP fusion protein in pGM16.2 (Figures 5A and decreased significantly during the first half (2 hours) of lag phase growth, increased during late lag phase and early to mid-exponential phase, decreased in mid to late exponential phase and increased during stationary phase growth. A possible explanation for the rapid decrease of PhaP in lag phase is that PhaP may be a storage protein that is degraded as a source of amino acids.
The profile of PHA accumulation in these cells (carrying pGM 16.2) followed a similar pattern to that of PhaP except that PHA decreased only in the lag phase and continued to accumulate throughout other phases of culture growth. This data is consistent with PHA inclusion-bodies being a source of carbon, reducing equivalents and amino acids when the organism is first provided with fresh medium. Possible explanations as to why the level of PhaP and not PHA decreased at mid to late exponential phase are that either PhaP was synthesized at a slower rate than that of PHA, or PhaP was used as a source of amino acids at this phase of growth or both scenarios may apply.
PhaC, monitored as a PhaC::GFP fusion protein in pGM13 showed a similar profile of expression to that of PhaP with one exception: PhaC did not reduce in level during lag phase growth. It did, however, reduce in level in mid to late exponential phase growth, as did PhaP.
The profile of PHA accumulation in these cells carrying PhaC::GFP was similar to that of cells carrying PhaP::GFP, except that the PHA level did not reduce during lag phase growth. The increased quantity of PhaC in the cell is a likely explanation since PhaC remained functional in WO 00/40730 PCT/US00/00364 -54the fusion protein PhaC::GFP. This was indicated by the fact that Escherichia coli (pC/GFP3) and Escherichia coli DH5a (pGM7) accumulated PHA to equivalent low levels, while the host strain alone, or carrying pGFPuv accumulated no PHA, as visualized by fluorescence microscopy of Nile Blue A stained cells. The reduction in level of PhaC in mid to s late exponential phase, as was also seen with PhaP, is consistent with both PhaC and PhaP being synthesized at a slower rate than that of PHA.
In cells of all growth phases, inclusion-bodies were rarely visible under light in stained heat fixed cells while larger inclusion-bodies were visible in phase contrast of living cells (Figure In older cultures (2 days and older) some cells were lysed, and showed PhaP::GFP and to PhaC::GFP localized to free PHA inclusion-bodies (Figure 5D). Both free and intracellular inclusion-bodies had doughnut shaped localization of GFP at some focal planes while at other focal planes the same inclusion-bodies appeared completely covered in GFP. We interpret this data as a difference in quantity of GFP that is visible when viewed through the edge or the center of the inclusion-bodies.
Example 14: Analysis of Bacillus megaterium 3-ketoacvl-CoA reductase PhaB Stereospecificity assays were conducted on the Bacillus megaterium reductase using various chain length enoyl-CoA esters (C4-C8, Table The assay was done using crotonase from Sigma (L-hydroxy acids) or hydratase from Rhodosprillum rubrum (D-hydroxy acids) to form the 3-hydroxyacyl-CoA compounds from the enoyl-CoA esters. Acetoacetyl-CoA reductase activity was monitored spectrophotometrically as the reduction of NADP while 3-hydroxyacyl- CoAs were oxidized. Based on the assay results (Table 6) the Bacillus megaterium reductase is a D-specific enzyme with a preference for C6 carbon chains. Enzyme reactions using NADH as electron donor for 3-ketoacyl-CoA reduction did not indicate significant enzyme activity with this cofactor.
WO 00/40730 PCT/US00/00364 Table 6: Analysis for stereo-specificity of the Bacillus megaterium 3-ketoacyl-CoA reductase.
Clone #a D-stereoisomer Spec. act. Clone L-stereoisomer Spec. act.
(hydratase) U/mg __(crotonase) U/mg B1-30 Crotonyl CoA 0.155 B1-30 Crotonyl CoA 0.014 B1-30 C5 0.15 B1-30 C5 0.009 C6 0.39 Bl-30 C6 0.017 B1-30 C8 0.014 Bl-30 C8 0.039 B5-20 Crotonyl CoA 0.077 B5-20 Crotonyl CoA 0.004 B5-20 C5 0.074 B5-20 C5 0.01 B5-20 C6 0.219 B5-20 C6 0.012 B5-20 C8 0.003 B5-20 C8 0.001 Negative Crotonyl CoA 0.02 Negative Crotonyl CoA 0.001 Negative C5 0.011 Negative C5 0.003 Negative C6 0.006 Negative C6 0.008 Negative C8 0.033 Negative C8 0.003 a Clone B1-30 contains pMON48213; clone B5-20 contains pMON48214.
Example 15: Verification of the Bacillus megaterium 3-ketoacvl-CoA reductase for PHA accumulation The functionality of the Bacillus megaterium sequence for PHA accumulation in a recombinant system was assayed. Escherichia coli DH5a harboring either pMON48222 (phaARe, phaBBm, phaCRe) only, or two of the following plasmids: pJM9238 AAB (phaA and phaB deleted by FseI digest and religation) or pJM9117 AAB (phaA and phaB deleted by Fsel digest and religation) and pMON48220 (phaARe, phaBBm,) was grown in LB mannitol in to concentrations of 1 or 2 respectively. Cultures were induced for PHA accumulation at
OD
600 0.6. Percentage PHA (Table 7) and enzyme activity (Table 8) were determined.
Plasmid pMON48213 contains the same pha sequences as pMON48220, but was constructed with pSE380 (Invitrogen, Carlsbad, CA), a high level expression vector. Plasmid pMON48221 contains the same pha sequences as pMON48220, but lacks a small fragment of the multicloning site between phaARe and phaBBm.
3-Ketoacyl-CoA reductase was monitored in a total volume of 1 mL containing 100 mM potassium phosphate buffer pH 7.0, 50 pM acetoacetyl-CoA and 150 IM NADPH. The reaction mixture contained between 5 and 50 upL cell extract. Assays were monitored spectrophotometrically at 340 nm.
WO 00/40730 WO 0040730PCTUSOO/00364 56 Table 7: Application of the Bacillus megaterium 3-ketoacyl-CoA reductase for PHA formation in Escherichia coi Vectors PHA Standard deviation pMON48222-4 pMON48222-8 19.2 _____Average 16.1 pJM9238 AAB pMON48220 23.7 pJM9238 AAB pMON48220 18.9 Average 21.3 3.4 pJM9238 AAB Average 1.5 pJM9ll7 AAB pMON48220 12.5 pJM91 17 AAB pMON48220 3.9 _____Average 8.2 6.1 pJM9II7 AAB ____Average 0.7 0.1 Table 8: Enzyme activity of the Bacillus megaterium 3-ketoacyl-CoA reductase using pMON4822O and pMON48213 Vector acetoacetyl-CoA reductase[U/mg] Negative control 0.08 pMON48220-2 0.24 0.15 pMON48220-9 0.22 0.23 Average 0.21 0.04 pMON48213 Table 9: Verification of the Bacillus megaterium -3 -ketoacyl-CoA reductase functionality WO 00/40730 PCT/US00/00364 -57- E. coli DH5a containing plasmids Relevant genotype PHB content CDW pJM9238AAB, pMON34610 phaCRe nd pJM9238AAB, pMON34575 phaCR,, phaAR, 1.2 0.4 pJM9238AAB, pMON48221 phaCRe, phaARe, phaBBm 22.2 4.7 nd not detectable Example 16: Additional sequences in genomic fragment The 7,916 base pair genomic fragment (SEQ ID NO:1) additionally contained three complete open reading frames and one incomplete open reading frame encoding proteins in Saddition to PhaP, PhaQ, PhaR, PhaB, and PhaC. As indicated in Tables 3 and 4, sequence comparisons suggest that ykoY (SEQ ID NO:22) encodes toxic anion resistance protein YkoY (SEQ ID NO:23), ykoZ (SEQ ID NO:24) encodes RNA polymerase sigma factor protein YkoZ (SEQ ID NO:25), and ykrM (SEQ ID NO:26) encodes a portion of the Na -transporting ATP synthase protein YkrM (SEQ ID NO:27). Sequence sspD (SEQ ID NO:28) matches the known io Bacillus megaterium sequence 10) encoding SspD (SEQ ID NO:29). While the activity of the proteins is identified by their similarity to other known proteins, it is possible that the proteins may have additional functionality involved in polyhydroxyalkanoate biosynthesis.
These nucleic acid and amino acid sequences may be used in nucleic acid segments, recombinant vectors, transgenic host cells, and transgenic plants.
is Example 17: One and two subunit PHA synthase proteins PHA synthases have been identified to be either one or two subunit enzymes Single subunit enzymes have only the PhaC protein, while two subunit enzymes have PhaC and PhaE protein subunits. Nucleic acid sequences encoding PhaE subunits have been found to be located adjacent to the nucleic acid sequences encoding PhaC.
WO 00/40730 PCT/US00/00364 -58- Table 10: One and two subunit PHA synthases Source organism (Reference) Subunits PhaC Amino acids T violacea (P45366, D48376) 2 355 C. vinosum (P45370, S29274) 2 355 T. pfennigii (WO 96/08566) 2 357 Synechocystis sp. PCC6803 (50, 2 378 D90906, S77327) P. oleovorans (22, A38604) 1 559 P. aeruginosa (S29305) 1 559 R. ruber (S25725) 1 562 R. eutropha (A34371) 1 589 A. caviae (D88825) 1 594 P. denitrificans (JC6023) 1 624 R. etli U30612) 1 636 B. megaterium (SEQ ID NO:11) 362 Based on the number of amino acids in the deduced sequence and homology to known PhaC proteins, the B. megaterium would be expected to be part of a two subunit synthase.
However, the nucleic acid sequences adjacent to phaC in the 7,916 base pair genomic fragment show no significant similarity to a phaE sequence. Upstream of phaC is phaB, and downstream is ykrM, a suspected Na transporting ATP synthase (Table In combination with the observation that the B. megaterium sequences were able to complement P. putida GPpl04 to accumulate PHA, this suggests that the B. megaterium phaC may encode a novel class of PHA synthase, i.e. a single subunit synthase with a molecular weight in the range of two subunit PhaC lo proteins.
Example 18: Pathway for the production of C4/C6/C8/C 10 PHA copolymers Figure 10 outlines a proposed biosynthetic pathway for the production of PHA copolymers incorporating C4 and/or C6 monomer units. Produced polymers may include C4-co- C6, C4-co-C8, C4-co-C6-co-C8, C6-co-C8, C6, and C8. A recombinant host cell or plant may be constructed to contain the nucleic acid sequences encoding the required enzymes.
The P-ketothiolase is preferably BktB (53, WO 98/00557). The p-ketothiolase can condense two molecules of acetyl-CoA to form acetoacetyl-CoA. This product may be reduced to 3HB-CoA by the Bacillus megaterium 3-keto-acyl-CoA reductase protein. 3HB-CoA may be WO 00/40730 PCT/US00/00364 -59converted to crotonyl-CoA by a hydratase such as that from Aeromonas caviae Subsequent reduction to butyryl-CoA is performed by a butyryl-CoA dehydrogenase such as that cloned from Clostridium acetobutylicum This product may be condensed with acetyl-CoA by the P-ketothiolase to afford 3-ketohexanoyl-CoA. This is the preferred substrate of the Bacillus megaterium reductase, leading to the production of 3-hydroxyhexanoyl-CoA. This product may be incorporated into C6 polymers or copolymers C4-co-C6) by a PHA synthase having a broad substrate specificity An additional round of condensation may lead to production of the C8 monomer, allowing the introduction of C8 into PHA polymers or copolymers. A further additional round of condensation may lead to production of the to monomer, allowing the introduction of C10 into PHA polymers or copolymers.
Example 19: Nucleic acid mutation and hybridization Variations in the nucleic acid sequence encoding a protein may lead to mutant protein sequences that display equivalent or superior enzymatic characteristics when compared to the sequences disclosed herein. This invention accordingly encompasses nucleic acid sequences which are similar to the sequences disclosed herein, protein sequences which are similar to the sequences disclosed herein, and the nucleic acid sequences that encode them. Mutations may include deletions, insertions, truncations, substitutions, fusions, shuffling of subunit sequences, and the like.
Mutations to a nucleic acid sequence may be introduced in either a specific or random manner, both of which are well known to those of skill in the art of molecular biology. A myriad of site-directed mutagenesis techniques exist, typically using oligonucleotides to introduce mutations at specific locations in a nucleic acid sequence. Examples include single strand rescue (Kunkel, T. Proc. Natl. Acad. Sci. 82: 488-492, 1985), unique site elimination (Deng and Nickloff, Anal. Biochem. 200: 81, 1992), nick protection (Vandeyar, et al. Gene 65: 129-133, 1988), and PCR (Costa, et al. Methods Mol. Biol. 57: 31-44, 1996). Random or non-specific mutations may be generated by chemical agents (for a general review, see Singer and Kusmierek, Ann. Rev. Biochem. 52: 655-693, 1982) such as nitrosoguanidine (Cerda-Olmedo et al., J. Mol.
Biol. 33: 705-719, 1968; Guerola, et al. Nature New Biol. 230: 122-125, 1971) and 2aminopurine (Rogan and Bessman, J. Bacteriol. 103: 622-633, 1970), or by biological methods such as passage through mutator strains (Greener et al. Mol. Biotechnol. 7: 189-195, 1997).
WO 00/40730 PCT/US00/00364 Nucleic acid hybridization is a technique well known to those of skill in the art of DNA manipulation. The hybridization properties of a given pair of nucleic acids is an indication of their similarity or identity. Mutated nucleic acid sequences may be selected for their similarity to the disclosed nucleic acid sequences on the basis of their hybridization to the disclosed sequences. Low stringency conditions may be used to select sequences with multiple mutations.
One may wish to employ conditions such as about 0.15 M to about 0.9 M sodium chloride, at temperatures ranging from about 20'C to about 55°C. High stringency conditions may be used to select for nucleic acid sequences with higher degrees of identity to the disclosed sequences.
Conditions employed may include about 0.02 M to about 0.15 M sodium chloride, about 0.5% to about 5% casein, about 0.02% SDS and/or about 0.1% N-laurylsarcosine, about 0.001 M to about 0.03 M sodium citrate, at temperatures between about 50'C and about 70'C. More preferably, high stringency conditions are 0.02 M sodium chloride, 0.5% casein, 0.02% SDS, 0.001 M sodium citrate, at a temperature of Example 20: Determination of homologous and degenerate nucleic acid sequences Modification and changes may be made in the sequence of the proteins of the present invention and the nucleic acid segments which encode them and still obtain a functional molecule that encodes a protein with desirable properties. The following is a discussion based upon changing the amino acid sequence of a protein to create an equivalent, or possibly an improved, second-generation molecule. The amino acid changes may be achieved by changing the codons of the nucleic acid sequence, according to the codons given in Table 11.
WO 00/40730 PCT/US00/00364 -61 Table 11: Codon degeneracies of amino acids Amino acid One letter Three letter Codons Alanine A Ala GCA GCC GCG GCT Cysteine C Cys TGC TGT Aspartic acid D Asp GAC GAT Glutamic acid E Glu GAA GAG Phenylalanine F Phe TTC TTT Glycine G Gly GGA GGC GGG GGT Histidine H His CAC CAT Isoleucine I Ile ATA ATC ATT Lysine K Lys AAA AAG Leucine L Leu TTA TTG CTA CTC CTG CTT Methionine M Met ATG Asparagine N Asn AAC AAT Proline P Pro CCA CCC CCG CCT Glutamine Q Gin CAA CAG Arginine R Arg AGA AGG CGA CGC CGG CGT Serine S Ser AGC AGT TCA TCC TCG TCT Threonine T Thr ACA ACC ACG ACT Valine V Val GTA GTC GTG GTT Tryptophan W Trp TGG Tyrosine Y Tyr TAC TAT Certain amino acids may be substituted for other amino acids in a protein sequence without appreciable loss of enzymatic activity. It is thus contemplated that various changes may be made in the peptide sequences of the disclosed protein sequences, or their corresponding nucleic acid sequences without appreciable loss of the biological activity.
In making such changes, the hydropathic index of amino acids may be considered. The importance of the hydropathic amino acid index in conferring interactive biological function on a protein is generally understood in the art (Kyte and Doolittle, J. Mol. Biol., 157: 105-132, 1982).
It is accepted that the relative hydropathic character of the amino acid contributes to the to secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like.
Each amino acid has been assigned a hydropathic index on the basis of their hydrophobicity and charge characteristics. These are: isoleucine valine leucine phenylalanine cysteine/cystine methionine alanine glycine WO 00/40730 PCT/US00/00364 -62threonine serine tryptophan tyrosine proline histidine glutamate/glutamine/aspartate/asparagine lysine and arginine It is known in the art that certain amino acids may be substituted by other amino acids having a similar hydropathic index or score and still result in a protein with similar biological activity, still obtain a biologically functional protein. In making such changes, the substitution of amino acids whose hydropathic indices are within ±2 is preferred, those within ±1 are more preferred, and those within ±0.5 are most preferred.
It is also understood in the art that the substitution of like amino acids may be made effectively on the basis of hydrophilicity. U.S. Patent No. 4,554,101 (Hopp, issued to November 19, 1985) states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the protein. The following hydrophilicity values have been assigned to amino acids: arginine/lysine aspartate/glutamate serine asparagine/glutamine glycine threonine proline alanine/histidine cysteine methionine valine leucine/isoleucine tyrosine phenylalanine and tryptophan 3.4).
It is understood that an amino acid may be substituted by another amino acid having a similar hydrophilicity score and still result in a protein with similar biological activity, still obtain a biologically functional protein. In making such changes, the substitution of amino acids whose hydropathic indices are within ±2 is preferred, those within ±1 are more preferred, and those within ±0.5 are most preferred.
As outlined above, amino acid substitutions are therefore based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions which take various of the foregoing characteristics into consideration are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine. Changes which are not expected to be advantageous may also be used if these resulted in functional fusion proteins.
WO 00/40730 PCT/US00/00364 -63- Plant Vectors In plants, transformation vectors capable of introducing nucleic acid sequences encoding polyhydroxyalkanoate biosynthesis enzymes are easily designed, and generally contain one or more nucleic acid coding sequences of interest under the transcriptional control of 5' and 3' s regulatory sequences. Such vectors generally comprise, operatively linked in sequence in the to 3' direction, a promoter sequence that directs the transcription of a downstream heterologous structural nucleic acid sequence in a plant; optionally, a 5' non-translated leader sequence; a nucleic acid sequence that encodes a protein of interest; and a 3' non-translated region that encodes a polyadenylation signal which functions in plant cells to cause the termination of to transcription and the addition of polyadenylate nucleotides to the 3' end of the mRNA encoding the protein. Plant transformation vectors also generally contain a selectable marker. Typical 3' regulatory sequences include a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal. Vectors for plant transformation have been reviewed in Rodriguez et al. (Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston., 1988), Glick et al. (Methods in Plant Molecular Biology and Biotechnology, CRC Press, Boca Raton, Fla., 1993), and Croy (Plant Molecular Biology Labfax, Hames and Rickwood BIOS Scientific Publishers Limited, Oxford, UK., 1993).
Plant Promoters Plant promoter sequences can be constitutive or inducible, environmentally- or developmentally-regulated, or cell- or tissue-specific. Often-used constitutive promoters include the CaMV 35S promoter (Odell, J.T. et al., Nature 313: 810-812. 1985). the enhanced CaMV promoter, the Figwort Mosaic Virus (FMV) promoter (Richins et al.. Nucleic Acids Res. 8451-8466, 1987), the mannopine synthase (mas) promoter, the nopaline synthase (nos) promoter, and the octopine synthase (ocs) promoter. Useful inducible promoters include promoters induced by salicylic acid or polyacrylic acids (PR-1. Williams S. W. et al, Biotechnology 10: 540-543, 1992), induced by application of safeners (substituted benzenesulfonamide herbicides, Hershey, H.P. and Stoner, Plant Mol. Biol. 17: 679-690, 1991), heat-shock promoters (Ou-Lee et al., Proc. Natl. Acad. Sci US.A. 83: 6815-6819, 1986; Ainley et al.. Plant Mol. Biol. 14: 949-967, 1990), a nitrate-inducible promoter derived from the spinach nitrite reductase gene (Back et al., Plant Mol. Biol. 17: 9-18. 1991), hormone-inducible WO 00/40730 PCT/US00/00364 -64promoters (Yamaguchi-Shinozaki, K. et al., Plant Mol. Biol. 15: 905-912, 1990; Kares et al., Plant Mol. Biol. 15: 225-236, 1990), and light-inducible promoters associated with the small subunit of RuBP carboxylase and LHCP gene families (Kuhlemeier et al., Plant Cell 1: 471, 1989; Feinbaum, R.L. et al., Mol. Gen. Genet. 226: 449-456, 1991; Weisshaar, B. et al., EMBO 10: 1777-1786, 1991; Lam, E. and Chua, J. Biol. Chem. 266: 17131-17135, 1990; Castresana, C. et al., EMBO J. 7: 1929-1936, 1988; Schulze-Lefert et al., EMBO J. 8: 651, 1989). Examples of useful tissue-specific, developmentally-regulated promoters include the Pconglycinin 7S promoter (Doyle, J.J. et al., J. Biol. Chem. 261: 9228-9238, 1986; Slighton and Beachy, Planta 172: 356-363, 1987), and seed-specific promoters (Knutzon, D.S. et al., Proc.
Natl. Acad. Sci U.S.A. 89: 2624-2628, 1992; Bustos, M.M. et al., EMBOJ. 10: 1469-1479, 1991; Lam and Chua, Science 248: 471, 1991; Stayton et al., Aust. J. Plant. Physiol. 18: 507, 1991).
Plant functional promoters useful for preferential expression in seed plastids include those from plant storage protein genes and from genes involved in fatty acid biosynthesis in oilseeds.
Examples of such promoters include the 5' regulatory regions from such genes as napin (Kridl et al., Seed Sci. Res. 1: 209-219, 1991), phaseolin, zein, soybean trypsin inhibitor, ACP, stearoyl- ACP desaturase, and oleosin. Seed-specific gene regulation is discussed in EP 0 255 378.
Promoter hybrids can also be constructed to enhance transcriptional activity (Comai, L. and Moran, U.S. Patent No. 5,106,739, issued April 21, 1992), or to combine desired transcriptional activity and tissue specificity. A developing seed selective promoter may be obtained from the fatty acid hydroxylase gene of Lesquerella (P-lh) (Broun, P. and C.
Somerville. Plant Physiol. 113: 933-942, 1997).
Plant transformation and regeneration A variety of different methods can be employed to introduce such vectors into plant protoplasts, cells, callus tissue, leaf discs, meristems, etcetera, to generate transgenic plants.
including Agrobacterium-mediated transformation, particle gun delivery, microinjection, electroporation, polyethylene glycolmediated protoplast transformation, liposome-mediated transformation, etcetera (reviewed in Potrykus, I. Ann. Rev. Plant Physiol. Plant Mol. Biol. 42: 205-225, 1991). In general, transgenic plants comprising cells containing and expressing DNAs encoding polyhydroxyalkanoate biosynthesis proteins can be produced by transforming plant cells with a DNA construct as described above via any of the foregoing methods; selecting plant WO 00/40730 PCT/US00/00364 cells that have been transformed on a selective medium; regenerating plant cells that have been transformed to produce differentiated plants; and selecting a transformed plant which expresses the protein-encoding nucleotide sequence.
Specific methods for transforming a wide variety of dicots and obtaining transgenic plants are well documented in the literature (Gasser and Fraley, Science 244: 1293-1299, 1989; Fisk and Dandekar, Scientia Horticulturae 55: 5-36, 1993; Christou, Agro Food Industry Hi Tech, p.17, 1994; and the references cited therein).
Successful transformation and plant regeneration have been reported in the monocots as follows: asparagus (Asparagus officinalis; Bytebier et al., Proc. Nail. Acad. Sci. U.S.A. 84: 5345lo 5349, 1987); barley (Hordeum vulgarae; Wan and Lemaux, Plant Physiol. 104: 37-48, 1994); maize (Zea mays; Rhodes, C.A. et al., Science 240: 204-207, 1988; Gordon-Kamm et al., Plant Cell 2: 603-618, 1990; Fromm, M.E. et al., Bio/Technology 8: 833-839, 1990; Koziel et al., Bio/Technology 11: 194-200, 1993); oats (Avena sativa; Somers et al., Bio/Technology 10: 1589- 1594, 1992); orchardgrass (Dactylis glomerata; Horn et al., Plant Cell Rep. 7: 469-472, 1988); rice (Oryza sativa, including indica and japonica varieties; Toriyama et al., Bio/Technology 6: 1988; Zhang et al., Plant Cell Rep. 7: 379-384, 1988; Luo and Wu, Plant Mol. Biol. Rep. 6: 165-174, 1988; Zhang and Wu, Theor. Appl. Genet. 76: 835-840, 1988; Christou et al., Bio/Technology 9: 957-962, 1991); rye (Secale cereale; De la Pena et al., Nature 325: 274-276, 1987); sorghum (Sorghum bicolor; Casas, A.M. et al., Proc. Natl. Acad. Sci. U.S.A. 90: 11212- 11216, 1993); sugar cane (Saccharum spp.; Bower and Birch, Plant J. 2: 409-416, 1992); tall fescue (Festuca arundinacea; Wang, Z.Y. et al., Bio/Technology 10: 691-696, 1992); turfgrass (Agrostispalustris; Zhong et al., Plant Cell Rep. 13: 1-6, 1993); wheat (Triticum aestivum; Vasil et al., Bio/Technology 10: 667-674, 1992; Weeks, T. et al., Plant Physiol. 102: 1077-1084, 1993; Becker et al., Plant J. 5: 299-307, 1994), and alfalfa (Masoud, S.A. et al., Transgen. Res. 5: 313, 1996).
Host plants Particularly useful plants for polyhydroxyalkanoate production include those that produce carbon substrates, including tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, and alfalfa.
WO 00/40730 PCT/US00/00364 -66- Example 21: Plastid transformation Alternatively, polyhydroxyalkanoate biosynthesis enzymes facilitating the increase in oil content of plants and/or herbicide resistance discussed herein can be expressed in situ in plastids by direct transformation of these organelles with appropriate recombinant expression constructs.
Constructs and methods for stably transforming plastids of higher plants are well known in the art (Svab, Z. et al., Plant Mol. Biol. 14(2): 197-205, 1990; Svab et al., Proc. Natl. Acad. Sci. US A. 90(3): 913-917, 1993; Staub et al., EMBO J. 12(2): 601-606, 1993; Maliga et al., U.S. Patent No. 5,451,513; PCT International Publications WO 95/16783, WO 95/24492, and WO 95/24493). These methods generally rely on particle gun delivery of DNA containing a io selectable or scorable marker in addition to introduced DNA sequences for expression, and targeting of the DNA to the plastid genome through homologous recombination. Transformation of a wide variety of different monocots and dicots by particle gun bombardment is routine in the art (Hinchee et al., 1994; Walden and Wingender, 1995). The plastid may be transformed by using protoplast and PEG (polyethylene glycol) (Koop, et al., Physiol. Plant. 85: 339, 1992; is Golds et al., Bio/Technol. 11: 95-97, 1993), cocultivation of protoplasts and Agrobacteria carrying transformation vectors (De Block et al., EMBO J. 4: 1367-1372, 1985), and by electroporation (Kin-Ying et al., Plant J. 4: 737, 1996).
Nucleic acid constructs for plastid transformation generally comprise a targeting segement comprising flanking nucleic acid sequences substantially homologous to a predetermined sequence of a plastid genome, which targeting segment enables insertion of nucleic acid coding sequences of interest into the plastid genome by homologous recombination with the predetermined sequence; a selectable marker sequence, such as a sequence encoding a form of plastid 16S ribosomal RNA that is resistant to spectinomycin or streptomycin, or that encodes a protein which inactivates spectinomycin or streptomycin (such as the aadA gene), disposed within the targeting segment, wherein the selectable marker sequence confers a selectable phenotype upon plant cells, substantially all the plastids of which have been transformed with the nucleic acid construct; and one or more nucleic acid coding sequences of interest disposed within the targeting segment relative to the selectable marker sequence so as not to interfere with conferring of the selectable phenotype. In addition, plastid expression constructs also generally include a plastid promoter region and a transcription termination region WO 00/40730 PCT/US00/00364 -67capable of terminating transcription in a plant plastid, wherein the regions are operatively linked to the nucleic acid coding sequences of interest.
A further refinement in chloroplast transformation/expression technology that facilitates control over the timing and tissue pattern of expression of introduced nucleic acid coding sequences in plant plastid genomes has been described in PCT International Publication WO 95/16783. This method involves the introduction into plant cells of constructs for nuclear transformation that provide for the expression of a viral single subunit RNA polymerase and targeting of this polymerase into the plastids via fusion to a plastid transit peptide.
Transformation of plastids with nucleic acid constructs comprising a viral single subunit RNA i0 polymerase-specific promoter specific to the RNA polymerase expressed from the nuclear expression constructs operably linked to nucleic acid coding sequences of interest permits control of the plastid expression constructs in a tissue and/or developmental specific manner in plants comprising both the nuclear polymerase construct and the plastid expression constructs.
Expression of the nuclear RNA polymerase coding sequence can be placed under the control of is either a constitutive promoter, or a tissue- or developmental stage-specific promoter, thereby extending this control to the plastid expression construct responsive to the plastid-targeted, nuclear-encoded viral RNA polymerase. The introduced nucleic acid coding sequence can be a single encoding region, or may contain a number of consecutive encoding sequences to be expressed as an engineered or synthetic operon. The latter is especially attractive where, as in the present invention, it is desired to introduce multigene biochemical pathways into plastids.
This approach is more complex using standard nuclear transformation techniques since each gene introduced therein must be engineered as a monocistron, including an encoded transit peptide and appropriate promoter and terminator signals. Individual gene expression levels may vary widely among different cistrons, thereby possibly adversely affecting the overall biosynthetic process. This can be avoided by the chloroplast transformation approach.
All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the methods described herein without departing from the concept, spirit and scope of the invention. More -68specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention.
With reference to the use of the word(s) "comprise" or "comprises" or "comprising" in the foregoing description and/or in the following claims, unless the context requires otherwise, those words are used on the basis and clear understanding that they are to be interpreted inclusively, rather than exclusively, and that each of those words is to be so interpreted in construing the foregoing description and/or the following claims.
*oo go *o *oo *o*oo *ooo *•g *o• WO 00/40730 PCT/US00/00364 -69-
REFERENCES
The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.
1. Altschul, T.L. Madden, A.A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D.J.
Lipman. 1997. Gapped BLAST and PSI BLAST: a new generation of protein database search programs. Nucleic Acids Res., 25: 3389-3402.
2. Anderson, A. and E.A. Dawes. 1990. Occurrence, metabolism, metabolic role, and industrial uses of bacterial polyhydroxyalkanoates. Microbiol. Rev., 54: 450-472.
lo 3. Cevallos, S. Encarnacion, A. Leija, Y. Mora, and J. Mora. 1996. Genetic and physiological characterization of a Rhizobium etli mutant strain unable to synthesize poly-beta-hydroxybutyrate. J. Bacteriol., 178: 1646-1654.
4. Connors, J.M. Mason, and P. Setlow. 1986. Cloning and nucleotide sequencing of genes for three small, acid soluble proteins Bacillus subtilis spores. J Bacteriol., 166: Is 417-425.
deSmet, G. Eggink, B. Witholt, J. Kingma, and H. Wynberg. 1983. Characterization of intracellular inclusions formed by Pseudomonas oleovorans during growth on octane.
J. Bacteriol., 154: 870-878.
6. Dunlop, W. and A.W. Robards. 1973. Ultrastructural study of poly-p-hydroxybutyrate granules from Bacillus cereus. J. Bacteriol., 114: 1271-1280.
7. Eggink, P. de Waard, and G.N.M. Huijberts. 1992. The role of fatty acid biosynthesis and degradation in the supply of substrates for poly(3-hydroxyalkanoate) formation in Pseudomonasputida. FEMSMicrobiol. Rev., 103: 159-164.
8. Ellar, D.G. Lundgren, K. Okamura, and R.H. Marchessault. 1968. Morphology of poly-p-hydroxybutyrate granules. J. Mol. Biol., 35: 489-502.
9. Fliss, A.C. Loshon, and P. Setlow. 1986. Genes for Bacillus megaterium small, acid-soluble spore proteins: Cloning and nucleotide sequence of three additional genes from this multigene family. J. Bacteriol., 165: 467-473.
Fliss, E.R. and P. Setlow. 1984. Bacillus megaterium spore protein C-3: nucleotide sequence of its gene and the amino acid sequence at its spore cleavage site. Gene, 167-172.
WO 00/40730 PCT/US00/00364 11. Fuller, J.P. O'Donnell, J Saulnier, T.E. Redlinger, J. Foster, and R.W. Lenz. 1992.
The supramolecular architecture of the polyhydroxyalkanoate inclusions in Pseudomonas oleovorans. FEMS Microbiol. Rev., 103: 279-288.
12. Gerngross, P. Reilly, J. Stubbe, A.J. Sinskey, and O.P. Peoples. 1993.
Immunocytochemical analysis of poly-P-hydroxybutyrate (PHB) synthase enzyme at the surface of PHB granules. J. Bacteriol., 175: 5289-5293.
13. Gilman, J.L. Wings, and M.J. Chamberlin. 1981. Nucleotide sequence of two Bacillus subtilis promoters used by Bacillus subtilis sigma-28 RNA polymerase. Nucleic Acids Res., 9: 5991-6000.
o1 14. Gitt, L.F. Wang, and R.H. Doi. 1985. A strong sequence homology exists between RNA polymerase sigma factors of Bacillus subtilis and Escherichia coli. J. Biol. Chem., 260: 7178-7185.
Griebel, Z. Smith, and M. Merrick. 1968. Metabolism of poly- P-hydroxybutyrate. 1.
Purification, composition, and properties of native poly-P-hydroxyburyrate granules from Bacillus megaterium. Biochem., 7: 3676-3681.
16. Haima, D. van Sinderen, H. Scholting, S. Bron, and G. Venema. 1990. Development of P-galactosidase c-complementation system for molecular cloning in Bacillus subtilis.
Gene, 86: 63-69.
17. Haywood, A.J. Anderson, L. Chu, and E.A. Dawes. 1988. The role of NADH- and NADPH-linked acetoacetyl-CoA reductases in the poly-3-hydroxybutyrate synthesizing organism Alcaligenes eutrophus. FEMS Microbiol. Lett., 52: 259-264.
18. Haywood, A.J. Anderson, L. Chu, and E.A. Dawes. 1988. Characterization of two 3-ketothiolases in the polyhydroxyalkanoate synthesizing organism Alcaligenes eutrophus. FEMS Microbiol. Lett., 52: 91-96.
19. Haywood, A.J. Anderson, and E.A. Dawes. 1989. The importance of PHBsynthase substrate specificity in polyhydroxyalkanoate synthesis by Alcaligenes eutrophus. FEMS Microbiol. Lett., 57: 1-6.
Helmann, J.D. 1991. Alternative sigma factors and the regulation of flagellar gene expression. Mol. Microbiol., 5: 2875-2882.
21. Huang, A.H.C. 1992. Oil bodies and oleosins in seeds. Annu. Rev. Plant Physiol. Plant Mol. Biol., 43: 177-200.
WO 00/40730 PCT/US00/00364 -71 22. Huisman, E. Wonink, R. Meima, B. Kazemier, P. Terpstra, and B. Witholt. 1991.
Metabolism of poly(3-hydroxyalkanoates) (PHAs) by Pseudomonas oleovorans. J. Biol.
Chem., 266: 2191-2198.
23. Kaneko, T. et al. 1996. Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC6803. II. Sequence determination of the entire genome and assignment of potential protein-coding regions. DNA Res., 3: 109- 136.
24. Kunst, N. et al. 1997. The complete genome sequence of the Gram-positive bacterium Bacillus subtilis. Nature, 390: 249-256.
to 25. Lauzier, R.H. Marchessault, P. Smith, and H. Chanzy. 1992. Structural study of isolated poly(p-hydroxybutyrate) granules. Polymer, 33: 823-827.
26. Lee, S.Y. 1995. Bacterial polyhydroxyalkanoates. Biotechnology Engineering, 49: 1-14.
27. Liebergesell, B. Schmidt, and A. Steinbtichel. 1992. Isolation and identification of granule-associated proteins relevant for poly(hydroxyalkanoic acid) biosynthesis in Chromatium vinosum D. FEMS Microbiol. Lett., 99: 227-232.
28. Liebergesell, M. and A. Steinbiichel. 1992. Cloning and nucleotide sequences of genes relevant for biosynthesis of poly(3-hydroxybutyric acid) in Chromatium vinosum strain D. Eur. J. Biochem., 209: 135-150.
29. Liebergesell, M. and A. Steinbtichel. 1993. Cloning and molecular analysis of the poly (3-hydroxybutyric acid) biosynthetic genes of Thiocystis violacea. Appl. Microbiol.
Biotechnol., 38: 493-501.
Lundgren, R.M. Pfister, and J.M. Merrick. 1964. Structure ofpoly-phydroxybutyric acid granules. .1 Gen. Microbiol., 34: 441-446.
31. Magni, P. Marini, and D. de Mendoza. 1995. Extraction of RNA from gram-positive bacteria. Biotechniques, 19: 882-884.
32. McCool, T. Fernandez, N. Li, and M.C. Cannon. 1996. Polyhydroxyalkanoate inclusion-body growth and proliferation in Bacillus megalerium. FEMS Microbiol. Lett., 137: 41-48.
33. Miller, J.H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY: WO 00/40730 PCT/US00/00364 -72- 34. Moran, C.P. Jr., N. Lang, S.F.J. LeGrice, G. Lee, M. Stephens, A.L. Sonnenshein, J.
Pero, and R. Losick. 1982. Nucleotide sequences that signal the initiation of transcription and translation in Bacillus subtilis. Mol. Gen. Genet., 186: 339-346.
Morbidoni, D. de Mendoza, and J.E. Cronan. 1996. Bacillus subtilis acyl carrier protein is encoded in a cluster of lipid biosynthesis genes. J. Bacteriol., 178: 4794-4800.
36. Pieper-Furst, M.H. Madkour, F. Mayer, and A. Steinbiichel. 1994. Purification and characterization of a 14-kilodalton protein that is bound to the surface of polyhydroxyalkanoic acid granules in Rhodococcus ruber. J. Bacteriol., 176: 4328-4337.
37. Pieper-Furst, M.H. Madkour, F. Mayer, and A. Steinbtchel. 1995. Identification of the region of a 14-kilodalton protein of Rhodococcus ruber that is responsible for the binding of this Phasin to polyhydroxyalkanoic acid granules. J. Bacteriol., 177: 2513- 2523.
38. Sambrook, E.F. Fritsch T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual., 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
39. Shark, F.D. Smith, P.R. Harpending, and J.L. Rasmussen. 1991. Biolistic transformation of a procaryote, Bacillus megaterium. Appl. Environ. Microbiol., 57: 480- 485.
Simon, Priefer, U. Pijhler, A. 1983. In A. Pifhler Molecular genetics of the bacteria-plant interaction. Springer, Berlin. p. 98-106.
41. Steinbiichel, A. 1991. Polyhydroxyalkanoic acids. p. 123-213. In D. Byrom Biomaterials, novel materials from biological sources. Macmillan Publishers Ltd., Basingstoke, England.
42. Steinbiichel, K. Aerts, W. Babel, C. Follner, M. Liebcrgesell, M.H. Madkour, F.
Mayer, U. Pieper-Furst, A. Pries, H.E. Valentin, and R. Wieczorek. 1995. Considerations on the structure and biochemistry of bacterial polyhydroxyalkanoic acid inclusions. Can.
J. Microbiol., 41: 94-105.
43. Steinbuchel, E. Hustede, M. Liebergesell, U. Pieper, A. Timm, and H. Valentin. 1992.
Molecular basis for biosynthesis and accumulation of polyhydroxyalkanoic acids in bacteria. FEMS Microbiol. Rev., 103: 217-230.
44. Steinbuchel, A. and H.G. Schlegel. 1991. Physiology and molecular genetics of poly(phydroxyalkanoic acid) synthesis in Alcaligenes eutrophus. Mol. Microbiol., 5: 535-542.
WO 00/40730 PCT/US00/00364 -73- Steinbuchel, A. and H.E. Valentin. 1995. Diversity of bacterial polyhydroxyalkanoic acids. FEMS Microbiol. Lett., 128: 219-228.
46. Vary, P. 1993. The genetic map of Bacillus megalerium, p. 475-481. In A.L.
Sonenshein, J.A. Hoch R. Losich Bacillus subtilis and other gram positive s bacteria. American Society for Microbiology, Washington, D.C.
47. Wang, W.S. and D.G. Lundgren. 1969. Poly-P-hydroxybutyrate in the chemolithotrophic bacterium Ferrobacillusferrooxidans. J. Bacteriol., 97: 947-950.
48. Wieczorek, A. Pries, A. Steinbuchel, and F. Mayer. 1995. Analysis ofa 24-kilodalton protein associated with the polyhydroxyalkanoic acid granules in Alcaligenes eutrophus.
1o J. Bacteriol., 177: 2425-2435.
49. Wieczorek, A. Steinbiichel, and B. Schmidt. 1996. Occurrence of polyhydroxyalkanoic acid granule-associated proteins related to the Alcaligenes eutrophus HI16 GA24 protein in other bacteria. FEMS Microbiol. Lett., 135: 23-30.
Hein, Tran, and A. Steinbtichel. 1998. Synechocystis sp. PCC6803 possesses a two-component polyhydroxyalkanoic acid synthase similar to that of anoxygenic purple sulfur bacteria. Arch. Microbiol., 170(3): 162-70.
51. Steinbiichel, Hustede, Liebergesell, Pieper, Timm, and H. Valentin.
1992. Molecular basis for biosynthesis and accumulation of polyhydroxyalkanoic acids in bacteria. FEMSMicrobiol. Rev. 103: 217-230.
52. Basak, Boudreault, Chen, Chretien, Seidah, and C. Lazure. 1995.
Application of the multiple antigenic peptides (MAP) strategy to the production of prohormone convertases antibodies: synthesis, characterization and use of 8-branched immunogenic peptides. J. Pept. Sci. 385-95.
53. Slater, K.L. Houmiel, M. Tran, T.A. Mitsky, T.B. Taylor, S.R. Padgette, and K.J.
Gruys. 1998. Multiple P-ketothiolases mediate poly(p-hydroxyalkanoate) copolymer synthesis in Ralstonia eutropha. J. Bacteriol. 180: 1979-1987.
54. Fukui, N. Shiomi, and Y. Doi. 1998. Expression and characterization of (R)-specific enoyl coenzyme A hydratase involved in polyhydroxyalkanoate biosynthesis in Aeromonas caviae. J. Bacteriol. 180: 667-6673.
55. Boynton, G.N. Bennett, and F.B. Rudolph. 1996. Cloning, sequencing, and expression of clustered genes encoding b-hydroxybutyryl-coenzyme A (CoA) WO 00/40730 PCT/US00/00364 -74dehydrogenase, crotonase, and butyryl-CoA dehydrogenase from Clostridium acetobutylicum ATCC 824. J. Bacteriol. 178: 3015-3024.
56. Liebergesell, F. Mayer, and A. Steinbijchel. 1993. Analysis of polyhydroxyalkanoic acid-biosynthesis genes of anoxygenic phototrophic bacteria reveals synthesis of a polyester exhibiting an unusual composition. Appl. Microbiol. Biotechnol. 40:292-300.
EDITORIAL NOTE APPLICATION NUMBER 24949/00 The following Sequence Listing pages 1 to 16 are part of the description. The claims pages follow on pages "75" to "78".
WO 00/40730 WO 0040730PCT/USOO/00364 1 SEQUENCE LISTING <110> McCool, Gabriel J.
Cannon, Maura C.
Cannon, Francis C.
Valentin, Henry E.
Gruys, Kenneth J.
<120> POLYHYDROXYALKANOATE BIOSYNTHESIS ASSOCIATED PROTEINS AND CODING REGION IN BACILLUS MEGATERIUM <130> MOBT212 <140> 60/115,092 1i <141> 1999-01-07 <160> 29 <170> Patentln Ver. 2.1 <210> 1 <211> 7916 <212> DNA <213> Bacillus megaterium <400> 1 aagcttaaca aaaacaactt aaacaaagtc agcaagacct aaataaactt tatggatggg cttgtgatgg tacggattag gtcgacgtat catattgtga aaaaagggct gccgttgatt cctcaaattg ggattaatta ggcctagaaa acccttgctc aaaattacgt aataaagaac gaaaatcaat gggataaaat attactgtat agtaattcag attggtaaaa tctcaaccct agtaaaagag tgtactgacg accgtttatt tgaatttagc aggacgatct tcgaaaagaa tcaaggtaag aaaggttaga aatacattta gtcattacat ttgccatatt atacaaagaa tattgctagt ctattatggt ccggtgcctt ggcagcttca agcgatatgt caggtttctg caattttggc gcggactcga ttatgcgttt cggcggcttt atccagagtt tttggattgt aaactgatct aataaaaaaa acctagttta atccgaatgt ttcaatgaag ttgagctatt gttcgtcatc gtgaagccaa attcagcaag gctaaagt tg attggtctga cttcttgcat aagcgaaatc gtagaaaggg ggc t t ttaa cttcttacgg ggagtattcc tggcaaaggt acgagagggg gctggttgca caaacattta tatttttaga agctatagga gaaaaaagac gatgacggtt cgctgtggct cggcggacaa tgctgcaact tgctattgta aggtattatt gttacttggc tgaaggctca acgcgccttc gattgtttaa tttgcttttt tttatttcag atgggttata aaaagaatgg tgctcacaaa gggataaaca tttcagctgt ttgcatttaa ttgcggaact aaacgctgct atatatcgct ttgacttatt agtaaagggg atcggctttg ctttttgtgt atttttatgg ttagaaggaa ccggaagaaa tttggttcgt gccatttact gatcatgaaa ttaaaagtag ctcgccgtta ttcttggtga tggttcgtca ggctgggtag aatgaacatt atagctgctt gagaaagaaa aatgttaatt ataaagggta cgttcatatt tttataaaca ataaaggaaa atattaacat agttcaaacg attacataat atgtaaacgt tgaagccatt tattattaaa ctataaccga ttctaactat aatgaacctt agtagcgtca ttggcataat tttattccgg atgcatcact ttttggcggc aacgcaagaa tgttcttgat tattgttcat aagtgaaaga aaatagcaga cgttgccaac t c ttcgccgg agctattaaa gagttaagtt tccctgaatc caggctggtt aagaatcgtt gaaggcgcgt aaagaattaa ctgtagagaa tatatttcaa attaaaagga ggtataaagc cctccatcgc gaaatgattc tatataagtg gaaaattaca agaagagtaa attgaaaatg aaaaggcaaa ttataaaata gggaaacctg gattatgctt taatgaggat tttgttagag ggataatgct ggcattattt ttcattttta ttccattaat agcagacgag cattgctttt aacaaatctt aggaattatg tacgcgccca agcggtctat aaaagtgtgg tctatctaaa aaaaaaaatt tttttatagg ttactgttta cagagccgtg atgtatgtta gcagagcgct aactgagtat ttgaaacgct aacaatataa aagctgacga caatccaaaa tcgactatat aaggttttat gtgaaacttc 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 WO 00/40730 WO 0040730PCTIUSOO/00364 atatattcaa gaggaaatga tgaagacatt attaacacgt tgcatctttt atcgtcaatg tcctattcgc ttgattgaaa taaatatatt atcgcgatgg tattatgtaa gaaaaaggca tttctccgcc tactgaaccg attcttgagc gatttcatat gtttatttgt tctagccatg tgtacctgta ttatttgttg taaaaaagcc cagctttcaa ttgctcaaga gactgagcaa agatacgtgt tggaattctt li ttgatgatat tgttcttgcg aaaaagctct tgtaatttat atcggcaaca gcgtttccag ttccaattca gctttccatt aaattcttgc tgttgctcaa tgcaatgttt tgtaacccct ctttactgtt gacataatca taatgaacaa aacgttaaag tcgctggttg accgtgaaat cctttaatcg ttttcttcct agggaacaac atgtcggtat aagtgaatta goccacatac gcgtgcaggt ccttcagctg ctgtctcagc gtgcggtaga ttgctgaatg agcttgtaac aaccatcaag ttttttggtg gttatctttt tcacttgatc catatgtgta atttacacct atacaggaaa aaagaacgat taaacaaaga tttagaattg atttttataa catttataat taaataaacg caaaattggt aagtgtccat attgaaagcc aacagcaaaa agtatttgat cttactgggg taaagttatt gaaatgtgct aaatatgaac atctgcacca agtaaatgta tcaatgtgga agaaaaagta tagaagcaca gcaagaaagt atgtcaaatc gttagacaaa aaacacaaga cgagttaaaa ttcaggctca gctgttagaa aatctgaagc aaaaccatca tcggagattt tataacaaca caagggggaa atttttcatg ctaaaggtat cggggcagca taaactataa cagcagtaaa gcggagaagc tattgcggtt tcgaagaaac aaaagctgcg cgcgcgaccg ttcattcaag acttacatag cgtatacaac gtggtcgtgt tatcaatatt actactcagc tgctaaagca cttatttttg ctcctaaaca aaaaagaatt aacatgtcaa ttattatatt cacgcaggtg cttaagtgag ttgctgcgtg ttatattgat attagtcatc tttcctattt agaagctggg atgacttttg ggcgcgtttt cttgctttac ttaatgcttc ctgttttacg gtttgtctgt gtgcttttaa ttgtccattg aattcctcct aagaaattcg ttaacattat cttttgattc acatgtgaaa ttaaatattg a cg tat ccc a catttccctg catgtagatt caccgctaat ccaaggtaat agatgaaaaa tttttggatt tttattttgg ttgttggtaa tgcgtttact atcactttta ccgtttcaag ggggacaata cttcaatatc ccaacaaaag gaattattag gcatctgctt aaactcgata gaaacgattc aaacaagaaa aacgctcaaa ttaactgctg acaacattac attacacgtg gaatctgcag caagctgacg tttggtcaat aagttaggtg acaacatcag tcatcaatta ggtatgctag tcaggcgcta taaggatgca aaaagataag agtaagccgg agcgggggac ccttttttta cttgagcttg cagcagtgtc ctaaaaattg tcctttttta tgcatactgg cttttttata aagagatttt cttttgctct taaagaatag atgcgtgcgg taagttttca tgcttgaagt cgtccattgc ttcccacatt tgaataattt tagttgtgtg at taggaaa c ttttgacttt aaatgaatct t tcgccggca ttgcgatgta atcaactgat ccaccctctt cgatttttct caccccttcg attgtcaaca tcgacaaaaa aaaacgtatt gtgaattgtg tagagcttct acgtacacaa catggaaaga tgaatcgtga aacaagcagt aagatgtagc aagagcaat t tgaaaaaaga aagttttatc aaaaacaaat aattagctga aaactgagca tatttacagt aaggtaaagt agcttgcttc aagcaattgt tgtcttatgt tagacattct aagaagattg ctgcgctaac ttggtcaagc gattcactaa aaattgttta aggggaaatg ctgtttttaa aaaacaattg tacgtgtatt gccatgttat ttgcaccaag agaacctaga ttctactcct gtggtacagc taatggtttg tattatttta acttgttcta tctactaatt cttgatttgc tttgtccatt actgtttttt tgttcaactg tcaatttgtt gcatcaatta ggtctggcga ataaacctaa gcagatgtac ttagaagaag aacatgtttt tctgttaatg atcaagttgt gtgaatccaa aaacttaaaa aagttgtttg aaaaaagaga ctttaaaaca gcgtcaaaaa tataatagta aaaagattta aatatgtcgc gaaaggagat cgtatatgac agaattttcc aaatgaagta aaacgttgcg tgacgatcgt tgtcactaag tcttcttgaa taaaactcaa aaagccaaag gccggctcgc aaaaatcatc agcaatcgta taatggagta aaaagaaatt agatcaagca agtaaacaat gaaaaaagta gcacctttta gggcggattt atcattagct aattaactct 1920 cagtggaagt 1980 agcggcagct 2040 aaagaaaccg 2100 taaaagacta 2160 gaaattatgt 2220 cgttttgtga 2280 gttaccccaa 2340 ggtgttaata 2400 agttcactgc 2460 caagaaagta 2520 caactgcata 2580 cgtatgcatc 2640 gtgttactac 2700 tttggttaaa 2760 cttcataaga 2820 gttgaaggtc 2880 cttttgttac 2940 tgtttccgtc 3000 ctgtatcata 3060 acagttatcg 3120 cattccgcgc 3180 tgcgtgaatc 3240 aagagctaaa 3300 gatactgttc 3360 aataaatccg 3420 ctttttcaag 3480 agctcattag 3540 gaagaaaagg 3600 aattagaggt 3660 atttgttttc 3720 ggtctttcaa 3780 aattcaaaaa 3840 catgtaggta 3900 cattatccaa 3960 ttgtcacatt 4020 ggagttttgg 4080 aaaaccgaat 4140 cagctcatgg 4200 acggggcgct 4260 tcattagtca 4320 tttgatgaat 4380 ctgaaatctg 4440 gggcagcaaa 4500 ggtgagcagc 4560 gcagaagcta 4620 aagtaaggta 4680 gctgaagaag 4740 acaggcggat 4800 aaagtagcag 4860 aaagacaacg 4920 aaacacctaa 4980 gctggaatta 5040 attgatgtaa 5100 gaatctgaag 5160 ggtcaaacaa 5220 cttgaactag 5280 WO 00/40730 WO 0040730PCTIUSOOIOO364 ctaagacagg cgtaacggtt tggcaattcc tgaagatgtt gtcacgctga agaaattgca caggacaaca gttaaacatt ttgtcggggc tgtgcttgtt gcaattcctt acgtgcaaga agttctgcaa gacgttttaa gttggattaa caccaaaaga acgccagtaa aagataacct aaaccgtata ttttggattt ggttttgacg tgtatttgct ctagatgatt atattgtaga aaatctcctg atttgtctgt gctgcattaa atgaagactt ttttcggata caggtttata gcagtagata cattcggaaa aagccaatca cgaatttcta cggtttgttg aaagctggaa ggcgaagctt atcgtcagtg gaacttgaag ttcgcggacg attgctgcta gccgtgatca gtttcaagtg aagataaaga ggtccaaaag cagtgaagga aaataaaata aagacgaggc tgatatcagt ggttcgtttt ggactgatgg gatttatgat gtcaccttct taaacatggg tgctttgaga agaaagaaga gccacaacca tggaaacgac ttacatagtg gctgttacgc aggagcaaag ttagcattta agggctgaca cctgtctcga ttttattttt caaatcggtg tttaggtaaa aaaatcggtc ccgtttatca ggattagttg actagttggc gccattattt tgcgtttttg catggtttct tacaggatct tcatttattc tttaattacg cttggagcga aacatttaaa gataagcgta gttttttctg ctgttaggag tctagcagat aagtcttggg aaggagcgga ggagtggcga gatgagcgcg atgatgttta aatgcaattt cgtgcaaaaa cgtggagttg aacggcggct aactaactac gtgggaaaaa gcgtgcatat ggttatttgg gcataaaaca aacacctgga tgactgggga ttatattcca tcttggttac gccgattaaa cggagcattc catccctcca cggc ccg tat gctaatgcaa gattcgtgac caaagtagat tattgcgatg gtataaattg aacatatcct tgagacaaaa tttgtataaa atctaatgac attttttaca aaactattag gagtaaggca ttgggtttct ttgatcgctt ctccagatac gtattggtgt tgaaggaacg atttgatgag tagggttaca ttgcttctgt cg ta tgcc ca t tggat tccc aa tt tcaat t ggggaacaat atgaatcgtt ccatgaatat tcggtgcttc gcccaggatt ttgttgcgaa tttacttagc tatacatgta taatggaatg ttaatcaaat gaaattatga aaaaagaaca ccaatcttac aacagccttg actcctgggc aaagcggcga tgcatgggcg aacttaattt ctagatgatc gagatgattg gtaacgttgg aagtgggt tg ttctatcaac ttaaaaaata ccgcatcaag ttgcaaacag tcaatcggcg gtattttagc cagacaatag aagtgagatg tggatatagc tattataatg gatgtcttca at tacttagt atttattgcc atttagtaca aatgacactc tcagctcatt aaatatttta ttttctccgt cagtgctaca tgattatttc tgtattaatt ttcgctattt cttgattctt tttttatgcg taatgagttt accgagttca tattgaaacg aattccaact aaaagacggc ataaatgctg aaagggtgtg caatgccaag caacagaagc aagcgaaatt tcgtatatgc ttgaatactt ttgaagacag aaaaggtgct gaactatgac ttatgacaag gctactttaa actttggaaa tggaccgttc ctgacggaat aaaacaaact ttaaagctaa tggcagcttt gtcacgtatc attggctaga cgaagtgaaa cgagtgatga acttctttta tattcatgta aaaaaggaat gctcaaatta attccagaag gttagtgcgg acgggctatt agtacattta atgacggacc tttattattt tattattcga acaaatgctg gtacaagtgg gaaatcaagc acgaagctaa gtgctagagc tttttccaat tcacttccta gtagggggag gaaatggtga cgtcgcttag.
gcgtacatta gccctgactt tatattcgtg tgaatataaa ggaaccggaa atatcgctat attgatcaat attaaaccgc caatatgaag gcgcacttct atctattttt tccatttgat tttagataaa caagatgtta ggaaaatcag cccatttgct aatcaatggt tattttaaac aatggacgct tgttgtattt aaaacgctct aacgaaccac ttctttatct tactaatgta acaatgagta gtcagattat ttgttacatt ctttaaggcc taagtgtaac ttttactcgt tttggatgat ataatcaatc ttgccattga gctggacaga gcttcgatat taaccgttat actatttttt cgactattat attcaggatt ccgctgccac cgttaattat gaattc 5340 5400 5460 5520 5580 5640 5700 5760 5820 5880 5940 6000 6060 6120 6180 6240 6300 6360 6420 6480 6540 6600 6660 6720 6780 6840 6900 6960 7020 7080 7140 7200 7260 7320 7380 7440 7500 7560 7620 7680 7740 7800 7860 7916 <210> 2 <211> 510 <212> DNA <213> Bacillus megaterium <400> 2 atgtcaacag ttacaaaaca caacagcaag aaagctgaat aacgctgttg taaagtatga tacagtaatt ttgcagacgg aaacaaacaa aatttgtaac aaaagcagtt tggaagacct tcaacaaaaa ccgattctta tgaagaatgg gatgcaatgt attgagcaat gaacaacttc acagttgaaa acaaaccgca gggaacaatg ggacgttaaa aagcaacaga acttacgtaa cgcatgaagc gacaaagggg agcacttgag 120 caaacaatgg 180 aacagCtgga 240 attaaataaa 300 WO 00/40730 PCTIUSOO/00364 4 ttacaagagc ttttttttaa ccaaagcaaa tcaagctatt. ctttagtaaa gcaagcgcaa 360 gaacaatatc atcaagtagt aacacaatta gtagaagagc aaaagaaaac gcgccaagaa 420 ttccaacacg fatctgatgc atacgtagaa caagtaaaat ctcttcaaaa gtcatttgct 480 cagtctcttg agcaatatgc agttgtaaaa 510 ':210> 3 <211> 170 <212> PRT <213> Bacillus megaterium <400> 3 Met Ser 1 Thr Val Lys Tyr Asp Thr Val 5 Asp Ala Met Trp Glu Gin Trp Thr Lys Gin Trp Thr Gly Leu Gin Asn Ilie Al a 25 Asp Gly Asn Lys Gin Ile Giu Val Thr Lys Leu Lys Ala Leu Giu Gin Gin Gin Glu Ala Val Giu Gin Leu Gin Ala Thr Asp Lys Gin 55 Trp Lys Ala Glu Leu Giu Asp Leu Gin Gin Lys 70 Thr Val Giu Asn Leu.
75 Arg Lys Thr Ala Gly Asn Ala Val Ala Asp Ser Tyr Giu Glu Thr Asn Arg Thr His Giu Ala Leu. Asn Tyr Ser Leu 115 Lys 100 Leu Gin Glu Leu Phe 105 Phe Asn Gin Ser Lys Ser Ser 110 Val Val Thr Val Lys Gin Ala Gin 120 Glu Gin Tyr His Gin Leu 130 Val Glu Giu Gin Lys Thr Arg Gin Phe Gin His Val Ser 145 Asp Ala Tyr Val Giu 150 Gin Val Lys Ser Leu 155 Gin Lys Ser Phe Ala 160 Gin Ser Leu Giu Gin 165 Tyr Ala Val Val <210> 4 <211> 438 <212> DNA <213> Bacillus megaterium <400> 4 ttgggatcaa gtgaaaaaga taacacctct aattcaaaca ggtgcaccaa aaaacttgat ggttcctttt cttcttttaa catggttaca agctcattca gcaactaatg agctttggat aatgtctacc gcacgctgag acagcttgaa aaagacaact acgtcagctg aaggacctgc acgccggatt tattcattaa acttagaaaa gt ttaagagg tcacatcagt tgattacatc cagatgccgg atcgattagc gtggaatcta 120 tgatcaggga 180 gcaatgggat 240 cgaacaatat 300 WO 00/40730 PCT/USOO/00364 ttaagtatgt gggctaattc acttgaacag tatcaaaaca tgttagattc attttttcac 360 atgtataccg acatgttgtt cccttttagc tcttcttctt ctaaaaagtc aaaagaatca 420 aaagaggaag aaaacgat 438 <210> <211> 146 <212> PRT <213> Bacillus megaterium <400> Met Gly 1 Ser Ser Glu 5 Lys Asp Asn Thr Ser Asn Ser Asn Asn 10 Leu Giu Lys Ser Ile Leu Ser Leu Leu Met Ser Gly Ala Pro Lys Asn Leu Met Val Pro Phe Leu Leu Ile Gin Gin Arg Gly Trp Asn Leu 40 His Gly Tyr Lys Leu Phe Gly Phe Ser Val Asp Gin Gly Asn Val Tyr Arg Thr 65 Leu. Arg Gin Leu Giu 70 Lys Asp Asn Leu Ile Thr Ser Gin Trp Thr Ser Ala Glu Gly Pro Ala Arg Arg Tyr Ser Leu Thr Asp Ala Gly Glu Gln Asn Met Leu 115 Phe Ser Ser 130 Leu. Ser Met Trp Ala 105 Asn Ser Leu Glu Gin Tyr Gin 110 Leu Phe Pro Asp Ser Phe Phe His 120 Met Tyr Thr Asp Ser Ser Ser Lys Ser Lys Glu.Ser 140 Lys Glu Glu Giu Asn Asp 145 <210> 6 <211> 504 <2i2> DNA <213> Bacillus megaterium <400> 6 atgaatcgtg caacaagcag gaagatgtag gaagagcaat ttgaaaaaag aaagttttat caaaaacaaa aaattagctg aaaactgagc aagaattzttc taaatgaagt caaacgttgc ttgacgatcg atgtcactaa ctcttcttga ttaaaactca aaaagccaaa agccggctcg ccagctcatg aacggggcgc gtcattagtc ttttgatgaa gctgaaatct agggcagcaa aggtgagcag ggcagaagct caag ggaaatgtgc tatctgcacc atcaatgtgg ttagaagcac gatgtcaaat aaaacacaag cttcaggctc aaatctgaag taaatatgaa aagtaaatgt aagaaaaagt agcaagaaag cgttagacaa acgagttaaa agctgttaga caaaaccatc ccttcaatat accaacaaaa agaattatta tgcatctgct aaaactcgat agaaacgatt aaaacaagaa aaacgctcaa WO 00/40730 WO 0040730PCTIUSOO/00364 <210> 7 <211> 168 <212> PRT <213> Bacillus megaterium <400> 7 Met Asn Arg Giu 1 Phe Ser Gin Leu Met 10 Gly Asn Val Leu Asn Met I1C Asn Leu Gin His Gin Val Tyr Gin Gin Ala Val Asn 25 Giu Val Thr Gly Arg Tyr Leu Val Ala Ser Asn Val Pro Thr Glu Asp Val Ala Leu Val Ile Asn Val Giu Lys Val Glu Leu Leu Giu Glu Gin Phe Asp Asp Arg Phe Asp Glu 70 Leu Giu Ala Gin Gin Giu Ser Ala Ser Leu Lys Lys Asp Thr Lys Leu Lys Asp Val Lys Ser Leu Asp Lys Lys Leu Gin Asp Glu 115 Asp 100 Lys Vai Leu Ser Leu Glu Gly Gin Gin Lys Thr Thr Gin Gly Leu Lys Glu Thr Gin Lys Gin Ile Giu Gin 130 Leu Gin Ala Gin Leu Leu Giu Lys Gin Glu Lys Leu Ala Glu 135 140 Lys 145 Pro Lys Ala Glu Ala 150 Lys Ser Glu Ala Lys 155 Pro Ser Asn Ala Gin 160 Lys Thr Glu Gin Pro 165 Ala Arg Lys <210> 8 <211> 741 <212> DNA <213> Bacillus megaterium <400> 8 atgacaacat gcaattacac aaagaatctg gttcaagctg gcgtttggtC aagaagttag aacacaacat atttcatcaa gcaggtatgc tacaaggtaa gtgagcttgc cagaagcaat acgtgtctta aattagacat gtgaagaaga cagctgcgct ttattggtca taggattcac agtagcaatc ttctaatgga tgtaaaagaa tgtagatcaa tctagtaaac ttggaaaaaa aacgcacctt agcgggcgga taaatcatta gtaacaggcg gtaaaagtag attaaagaca gcaaaacacc aatgctggaa gtaattgatg ttagaatctg tttggtcaaa gctcttgaac gatctaaagg cagtaaacta acggcggaga taatcgaaga ttacgcgcga taaacttaca aaggtggtcg caaactactc tagctaagac tatcggggca taacagcagt agctattgcg aacaaaagct ccgttcattc tagcgtatac tgttatcaat agctgctaaa aggcgtaacg 120 180 240 300 360 420 480 540 WO 00/40730 WO 0040730PCTUSOO/00364 7 gttaatgcaa tttgcccagg atttattgaa. acggaaatgg tgatggcaat tcctgaagat 600 gttcgtgcaa aaattgttgc gaaaattcca actcgtcgct taggtcacgc tgaagaaatt 660 gcacgtggag ttgtttactt agcaaaagac ggcgcgtaca ttacaggaca acagttaaac 720 attaacggcg gcttatacat g 741 <210> 9 <211> 247 <212> PRT <213> Bacillus megaterium <400> 9 Met Thr Thr Leu Gin Gly Lys Val Ala Ile Val Thr Gly Gly Ser Lys 1 5 10 Giy Ile Gly Ala Ala Ile Thr Arg Giu Leu Ala Ser Asn Gly Val Lys 25 Val Ala Val Asn Tyr Asn Ser Ser Lys Giu Ser Ala Giu Ala Ile Val 35 40 Lys Giu Ile Lys Asp Asn Gly Gly Giu Ala Ile Ala Val Gin Ala Asp 55 Val Ser Tyr Vai Asp Gin Ala Lys His Leu Ile Giu Giu Thr Lys Ala 70 75 Ala Phe Gly Gin Leu Asp Ile Leu Val Asn Asn Aia Gly Ile Thr Arg 90 Asp Arg Ser Phe Lys Lys Leu Gly Giu Giu Asp Trp Lys Lys Val Ile 100 105 110 Asp Vai Asn Leu His Ser Val Tyr Asn Thr Thr Ser Aia Ala Leu Thr 115 120 125 His Leu Leu Glu Ser Giu Gly Gly Arg Val Ile Asn Ile Ser Ser Ile 130 135 140 Ile Gly Gin Ala Gly Gly Phe Gly Gin Thr Asn Tyr Ser Ala Ala Lys 145 150 155 160 Ala Giy Met *Leu Gly Phe Thr Lys Ser Leu Ala Leu Glu Leti Ala Lys 165 170 175 Thr Gly Val Thr Val Asn Ala Ile Cys Pro Gly Phe Ile Glu Thr Glu 180 185 190 Met Val Met Ala Ile Pro Giu Asp Val Arg Ala Lys Ile Val Ala Lys 195 200 205.
Ile Pro Thr Arg Arg Leu Gly His Ala Giti Gii Ilie Ala Arg Gly Val 210 215 220 Val Tyr Leu Ala Lys Asp Gly Ala Tyr Ile Thr Gly Gin Gin Leu Asn 225 230 235 240 WO 00/40730 WO 0040730PCT[USOO/00364 Ile Asn Gly Gly Leu Tyr Met 245 <210> <211> 1086 <212> DNA <213> Bacillus megaterium <400> gtggcaattc aaaagttctg gaagttggat tatacgccag aataaaccgt cgcggttttg aagctagatg tctaaatctc tttgctgcat gatttttcgg aaagcagtag ttaaagccaa cagcggtttg gctggcgaag ggtgaacttg aacattgctg gctgtttcaa tttggtccaa tctaaa cttacgtgca caagacgttt taacaccaaa taaaagataa atattttgga acgtgtattt attatattgt ctgatttgtc taaatgaaga atacaggttt atacattcgg tcacgaattt ttgaaagctg cttatcgtca aagttcgcgg ctagccgtga gtgaagataa aagcagtgaa agagtgggaa taagcgtgca agaggttatt cctgcataaa tttaacacct gcttgactgg agattatatt tgttcttggt cttgccgatt atacggagca aaacatccct ctacggcccg gaagctaatg gtggattcgt acgcaaagta tcatattgcg agagtataaa ggaaacatat aaattaatca tatgaaatta tggaaaaaga acaccaatct ggaaacagcc ggaactcctg ccaaaagcgg tactgcatgg aaaaacttaa ttcctagatg ccagagatga tatgtaacgt caaaagtggg gacttctatc gatttaaaaa atgccgcat c ttgttgcaaa ccttcaatcg aatcaatgcc tgacaacaga acaaagcgaa tactcgtata ttgttgaata ggcttgaaga cgaaaaaggt gcggaactat tttttatgac atcgctactt t tgact ttgg tggtggaccg ttgctgacgg aacaaaacaa atattaaagc aagtggcagc caggtcacgt gcgat tggct aagtgaatat agcggaaccg attatatcgc tgcattgatc cttattaaac cagcaatatg gctgcgcact gacatctatt aagtccattt taatttagat aaacaagatg ttcggaaaat aatcccattt actaatcaat taatatttta tttaatggac atctgttgta agaaaaacgc 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1086 <210> 11 <211> 362 <212> PRT <213> Bacillus megaterium <400> 11 Met Ala 1 Ile Pro Tyr Val Gin Glu Trp 5 Lys Lel Ile Lys Ser Met Pro Ser Glu Ile Met Thr Tyr Lys Ser Ser Ala Arg Phe Lys Arg Ala Tyr Glu Pro Lys Glu Thr Glu Ala Glu Pro Glu Val Gly Leu Val Ile Trp Lys Lys Asn Lys Ala Lys Leu Tyr Arg s0 55 Tyr Thr Pro Val Lys Asp Asn Leu His Lys 70 Thr Pro Ile Leu Val Tyr Ala Leu Ile Asn Lys Pro Tyr Tyr Leu Leu Asn 100 Leu Asp Leu Thr Pro Gly Asn Ser Leu Val Glu Tyr Leu Leu Asp Trp Gly Thr 110 Arg Gly Phe Asp Val 105 WO 00/40730 WO 0040730PCTJUSOO/00364 Pro Gly Leu Glu Asp Ser Asn Met Lys Leu Asp Asp 115 Tyr Asp 145 Phe Thr Asp Ile Thr 225 Gin Gly Tyr Lys Ser 305 Al a Val Ile Ile Pro 130 Leu Ser Ala Ala Ser Pro Asp Arg 195 Pro Pro 210 Asn Phe Arg Phe Ile Pro Gin Gin 275 Val Asp 290 Arg Asp Val Ser Ser Val Gly Asp 355 Lys Val Leu Phe 180 Tyr Glu Tyr Val Phe 260 Asn Leu His Ser Val 340 Ala Leu Asn 165 Asp Phe Met Gly Glu 245 Ala Lys Lys Ile Glu 325 Phe Ala Gly 150 Glu Phe Asn Ile Pro 230 Ser Gly Leu Asn Ala 310 Asp Gly Lys 135 Tyr Asp Ser Leu Asp 215 Tyr Trp Glu Ile Ile 295 Met Lys Pro 120 Lys Cys Leu Asp Asp 200 Phe Val Lys Ala Asn 280 Lys Pro Giu Lys Val Leu Met Gly Pro Ile 170 Thr Gly 185 Lys Ala Gly Asn Thr Leu Leu Met 250 Tyr Arg 265 Gly Giu Ala Asn His Gin Tyr Lys 330 Ala Val 345 Arg Gly 155 Lys Leu Val1 Lys Val 235 Gin Gln Leu Ile Val 315 Leu Lys Thr 140 Thr Asn Tyr Asp Met 220 Asp Lys Trp, Giu Leu 300 Ala Leu Glu Tyr 125 Ser Met Leu Gly Thr 205 Leu Arg Trp Ile Val 285 Asn Al a Gin Thr Lys Thr Ile Ala 190 Phe Lys Ser Val Arg 270 Arg Ile Leu Thr Tyr 350 Ser Pro Ser Ile 160 Phe Met 175 Phe Leu Gly Asn Pro Ile Glu Asn 240 Ala Asp 255 Asp Phe Gly Arg Ala Ala Met Asp 320 Gly His 335 Pro Ser Ile Val Asp Trp Leu Giu Lys Arg Ser Lys 360 <210> 12 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:Synthetic WO 00/40730 WO 0040730PCTIUSOO/00364 <400> 12 aayacrgtna aataynnnac rgtnatynnn gcdatgatg <210> 13 <211> <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:Synthetic <400> 13 gcdatyccdt aygtncarga agghttyaaa <210> 14 <211> 19 <212> DNA <213> SYNTHETIC <400> 14 gcttcatgcg tgcggtttg <210> <211> 22 <212> DNA <213> SYNTHETIC <400> ggaccgttcg gaaaatcagc gg <210> 16 <211> <212> DNA <213> SYNTHETIC <400> 16 cccctttgtc cattgttccc <210> 17 <211> 19 <212> DNA <213> SYNTHETIC <400> 17 ccatgtagat tccaccctc <210> <211> <212> <213> 18 19
DNA
SYNTHETIC
WO 00/40730 WO 0040730PCTIUSOO/00364 <400:' 18 ctccatctcc tttcttgtg <210> 19 <211>' 17 <212> PRT <213> Bacillus megaterium <400>' 19 Lys Val Phe Gly Arg Xaa Glu Leu Ala Ala Ala Met Lys Arg Xaa Gly 1 5 10 Leu <210> <211> <212> PRT <213> Bacillus megaterium <400> Asn Thr Val Lys Tyr Xaa Thr Val Ile Xaa Ala Met Xaa Xaa Gln 1 5 10 <210> 21 <211> 11 <212> PRT <213> Bacillus megaterium <400> 21 Ala Ile Pro Tyr Val Gln Glu Xaa Glu Lys Leu 1 5 <210> 22 <211> 813 <212> DNA <213>' Bacillus megaterium <400> 22 atggatgcat ggaattttgg gaaaaacgca tcgttgttct tacttattgt gaaaaagtga gtagaaatag gttacgttgc gtgatcttcg gtcaagctat gtaggagtta catttccctg gcttcaggct cacttttgtt cggcggataa agaaggcatt tgatttcatt tcatttccat aagaagcaga cagacattgc caacaacaaa ccggaggaat taaatacgcg agttagcggt aatcaaaagt ggtttctatc agagtatgga tgctcttgtg attttacgga tttagtcgac taatcatatt cgagaaaaag ttttgccgtt tcttcctcaa tatgggatta cccaggccta ctataccctt gtggaaaatt taaaaataaa tgggtattgc atggctatta ttagccggtg gtatggcagc gtgaagcgat ggctcaggtt gattcaattt attggcggac attattatgc gaaacggcgg gctcatccag acgttttgga gaacaaactg tagtgctggt tggtcaaaca cctttatttt ttcaagctat atgtgaaaaa tctggatgac tggccgctgt tcgacggcgg gttttgctgc cttttgctat agttaggtat ttgtgttact atcttgaagg tgcattagaa tttaccggaa tagatttggt aggagccatt agacgatcat ggttttaaaa ggctctcgcc acaattcttg aacttggttc tgtaggctgg tattaatgaa tggcatagct ctcagagaaa 120 180 240 300 360 420 480 540 600 660 720 780 WO 00/40730 PTUO/06 PCTIUSOO/00364 gaaaaagaat cgttaaaaaa aattgaaaat caa.
<210> 23 <211> 271 <212> PRT <213> Bacillus megaterium <400> 23 Met Asp Ala Ser Leu Leu Leu 1 Val Ile Tyr Ile Tyr Lys Gly Ala Thr 145 Val Al a Al a Thr Ser 225 Ala Met Gly 50 Ser Leu Asp Phe Val1 130 Thr Ile Thr Ala Leu 210 Lys Leu Val1 Leu Phe Leu Asp Trp 115 Asp Asn Phe Trp Phe 195 Al a Val Giu Lys Al a Leu Phe His 100 Met Ser Leu Ala Phe 180 Ala His Trp 5 Gly His Gly Val Ile Giu Thr Ile Pro Gly 165 Val Ile Pro Lys Ile Leu Al a Asp 70 Ser Lys Val Leu Gin 150 Gly Lys Vai Giu Ile 230 Leu Pro Phe 55 Val Ile Vai Leu Ala 135 Ile Ile Leu Gly Leu 215 Thr Glu Al a Giu 40 Ile Trp Asn Lys Lys 120 Al a Gly Met Leu Trp 200 Gly Phe Tyr Ala 25 Giu Phe Gin His Giu 105 Val Val Gly Gly Asn 185 Val1 Ile Trp Gly Trp 10 Asp Asn Lys Arg Arg Phe Leu Gin 75 Ile Val 90 Ala Asp Giu Ile Ala Leu Leu Asp 155 Leu Ile 170 Thr Arg Gly Val Ile Asn Ile Val 235 Vai Leu Ala Leu Lys Lys Gly Ser Ala Ile Lys Arg Glu Lys Aia Asp 125 Ala Val 140 Gly Gly Ile Met Pro Gly Lys Leu 205 Giu His 220 Leu Leu Leu Val Al a Leu Gly Tyr Lys 110 Ile Thr Gin Arg Leu 190 Al a Phe Gly Val Leu Met Ala Leu Phe Phe Leu Ala Ile Val Lys Gly Ser Ala Phe Leu Pro Phe Leu 160 Phe Ala 175 Giu Thr Val Tyr Pro Giu Ile Ala 240 Ala Ser Gly Trp Phe Leu Ser Lys Asn Lys Glu Gin Thr Asp Leu Giu 245 2509C;C WO 00/40730 WO 0040730PCTIUSOO/00364 13 Gly Ser Giu Lys Glu Lys Glu Ser Leu Lys Lys Ile Giu Asn Gin 260 265 270 <210> 24 <211> 708 <212> DNA <213> Bacillus megaterium <400> 24 atgctcacaa ggggataaac gt tt cagc tg attgcattta tttgcggaac caaacgctgc gatatatcgc acttattttt tctcctaaac gaaaaagaat aaacatgtca gttattatat aagttcaaac aattacataa tatgtaaacg atgaagccat ttattattaa tctataaccg tttctaacta gtcaggcgct ataaggatgc taaaagataa aagtaagccg tagcggggga gcctccatcg tgaaatgatt ttatataagt tgaaaattac aagaagagta aattgaaaat taaaaggcaa aaaattgttt aaggggaaat gctgttttta gaaaacaatt ctacgtgtat cttgaaacgc caacaatata gaagctgacg acaatccaaa atcgactata gaaggtttta agtgaaactt aaattaactc gcagtggaag aagcggcagc gaaagaaacc ttaaaagact ttgtactgac aaccgtttat atgaatttag aaggacgatc t tcgaaaaga ttcaaggtaa catatattca t tgaagacat ttgcatcttt ttcctattcg gtaaatatat atattatg gattcagcaa tgctaaagtt cattggtctg tcttcttgca aaagcgaaat ggtagaaagg agaggaaatg tattaacacg tatcgtcaat cttgattgaa tatcgcgatg 120 180 240 300 360 420 480 540 600 660 708 <210> <211> 236 <212> PRT <213> Bacillus megaterium <400> Met Leu Thr Lys Val Gin Thr Pro Pro 1 5 Leu Giu Thr Leu Val Leu Thr Ile Gin Tyr Lys Pro Gin Gly Asp Lys Gin Leu 25 His Asn Giu Met Ile Gin Gin Lys Arg Tyr Phe Ile Ala Lys Val 40 Val Ser Ala Val Cys Ile Ser Glu Ala Glu Ala Asp Asp Giu Phe Ser Ile Gly Leu Ile Ala Phe Asn Ile Giu Asn Tyr 70 Thr Ile Gin Lys Gly 75 Arg Ser Leu Leu Ala Phe Ala Glu Leu Ile Lys Arg Arg Ile Asp Tyr Ile Arg Lys Giu Lys Arg Asn 100 Gin Thr Leu Leu Tyr 105 Asn Arg Ile Giu Asn Glu Gly 110 Phe Ile Gin Gly Lys Val Giu 115 Arg 120 Asp Ile Ser Leu Asn Tyr Lys Arg Gin 130 Ser Glu Thr Ser Tyr Ile Gin Giu Giu Met 135 140 Thr Tyr Phe Cys WO 00/40730 WO 0040730PCT/USOO/00364 Gin 145 Ala Leu Lys Leu Phe 150 Lys Leu Thr Leu Glu 155 Asp Ile Ile Asn Thr 160 Ser Pro Lys His Asp Ala Arg Gly Asn 170 Ala Val Glu Val Ala Ser 175 Phe Ile Val Gin Leu Pro 195 Asn 180 Giu Lys Giu Leu Lys 185 Asp Lys Leu Phe Leu Lys Arg 190 Ser Arg Lys Ile Arg Leu Ile Glu 200 Lys His Val Lys Val 205 Thr Ile 210 Giu Arg Asn Arg Lys 215 Tyr Ile Ile Ala Met 220 Val Ile Ile Leu Ala 225 Gly Asp Tyr Val Tyr 230 Leu Lys Asp Tyr Ile Met 235 <210> 26 <211> 957 <212> DNA <213> Bacillus megaterium <400> 26 atgccacaac ttttacatag ccaggagcaa acagggctga gtttttattt attttaggta tcccgtttat gaactagttg gatgcgtttt attacaggat attttaatta ttaacattta atgttttttc tttctagcag acaaggagcg atgatgagcg catggaaacg tggctgttac agttagcatt cacctgtctc ttcaaatcgg aaaaaatcgg caggattagt gcgccattat tgcatggttt cttcatttat cgct tggagc aagataagcg tgctgttagg ataagtcttg gaggagtggc cgatgatgtt acgagtaagg gc ttgggt tt tattgatcgc gactccagat tggtattggt tctgaaggaa tgatttgatg tttagggtta ct ttgc tt ct tccgtatgcc gattggattc taaatttcaa agggggaaca ggatgaatcg gaccatgaat tatcggtgct cagatgtctt ctattactta.
ttatttattg acatttagta gtaatgacac cgtcagctca agaaatattt cattttctcc gtcagtgcta catgattatt cctgtattaa ttttcgctat atcttgattc tttttttatg attaatgagt tcaccgagtt cagctcaaat gtattccaga ccgttagtgc caacgggcta tcagtacatt ttatgacgga tatttattat gttattattc caacaaatgc tcgtacaagt ttgaaatcaa ttacgaagct ttgtgctaga cgtttttcca tttcacttcc cagtaggggg tattgttaca agctttaagg ggtaagtgta ttttttactc tatttggatg ccataatcaa ttttgccatt gagctggaca tggcttcgat ggtaaccgtt gcactatttt aacgactatt gcattcagga atccgctgcc tacgttaatt aggaatt 120 180 240 300 360 420 480 540 600 660 720 780 840 900 957 <210> 27 <211> 319 <212> PRT <213> Bacillus megaterium <400> 27 Met Pro Gin Pro Trp Lys Arg Arg Val Arg Gin 1 5 10 Met Ser Ser Ala Gin Ile Ile Val Thr Phe Tyr Ile Val Ala Val Thr Leu Gly Phe Leu Leu 25 Leu Ser Ile Pro Glu Ala Leu Arg Pro Gly Ala Lys Leu Ala Phe Ile 40 4S WO 00/40730 WO 0040730PCTIUSOO/00364 Asp Arg Leu Phe Ile Ala Val Ser Ala Val Ser Val Thr Gly Leu Thr Pro Val Ser Val Phe Ile Phe Ile Trp Leu Ile Met 115 Leu Met Arg 130 Ala Ile Ile 145 Asp Ala Phe Ala Gly Phe Tyr Phe Val 195 Gly Phe Pro 210 Asp Lys Arg 225 Met Phe Phe Glu His Ser Tyr Ala Phe 275 Met Asn Ile 290 Met Met Phe 305 <210> 28 <211> 195 <212> DNA Thr Phe Met 100 Thr Asn Leu Leu Asp 180 Gin Val Lys Leu Gly 260 Phe Asn Pro Gin Ile Asp Ile Gly His 165 Ile Vai Leu Phe Leu 245 Phe Gin Glu Asp 70 Ile Leu His Leu Leu 150 Gly Thr Vai Ile Gin 230 Leu Leu Ser Phe Thr Gly Gly Asn Phe 135 His Phe Gly Thr Glu 215 Phe Gly Al a Ala Ser 295 Phe Gly Lys Gin 120 Ile Phe Phe Ser Val 200 Ile Ser Gly Asp Al a 280 Leu Ser Thr Ile Gly 90 Lys Ile 105 Ser Arg Ile Phe Leu Arg Ala Ser 170 Ser Phe 185 Ile Leu Lys His Leu Phe Gly Thr 250 Lys Ser 265 Thr Arg Pro Thr Thr 75 Val Gly Leu Al a Tyr 155 Val Ile Ile Tyr Thr 235 Ile Trp Ser Leu Gly Met Leu Ser Ile 140 Tyr Ser Pro Thr Phe 220 Lys Leu Asp Gly Ile 300 Tyr Thr Lys Gly 125 Giu Ser Al a Tyr Leu 205 Leu Leu Ile Giu Gly 285 Met Phe Leu Glu 110 Leu Leu Ser Thr Al a 190 Gly Thr Thr Leu Ser 270 Val Met Leu Ser Arg Val Val Trp Thr 175 His Ala Phe Thr Val1 255 Phe Ala Ser Leu Thr Gin Asp Gly Thr 160 Asn Asp Ile Lys Ile 240 Leu Phe Thr Al a Ile Gly Ala Ser Pro Ser Ser Val Gly Gly Gly Ile 310 315 <213> Bacillus megaterium WO 00/40730 WO 0040730PCTUSOO/00364 <400> 28 atggctagaa tatgaaatcg ggttcagtag ggcagcacac caaataaact attaacacca. ggagtagaac aatttttaga tcaatataaa ctcaagaatt tggggtaact ctaggttctg acactgctgc acgcagcaac gcggagaaat cacaaaacgc ttggtgcaac aagctcaagc tcacttaagc aaaaa 120 180 195 <210> 29 <211> <212> PRT <213> Bacillus megaterium <400> 29 Met Ala Arg Thr Asn Lys Leu Leu. Thr Pro 1 5 10 Gly Val Glu Gln Phe Leu Asp Gin Tyr Lys Tyr Giu Ile Ala Gin 25 Glu Phe Gly Val Thr Leu Gly Glu. Ile Thr Ser Asp Thr Ala Ala Arg Ser Asn 40 Gly Ser Val Gly Gly Lys Arg Leu Vai Gin Gin Ala Gin Ala His Leu Ser Gly Ser Thr Gin Lys

Claims (12)

1. An isolated or purified nucleic acid segment comprising a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein, wherein the nucleic acid sequence is a nucleic acid sequence at least about 80% identical to SEQ ID NO:8 that hybridizes under stringent conditions to SEQID NO:8 or the complement thereof, and encodes a protein at least about 80% identical to SEQ ID NO:9, and has 3-keto-acyl-CoA reductase activity higher for D-isomers of C6 carbon chains than for C4 carbon chains.
2. A recombinant vector comprising in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; b) a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; wherein the structural nucleic acid sequence is a nucleic acid :sequence at least about 80% identical to SEQ ID NO:8; that hybridizes under S stringent conditions to SEQ ID NO:8 or the complement thereof; and encodes a protein at least about 80% identical to SEQ ID NO:9 and that has 3-keto-acyl-CoA reductase activity higher for D-isomers of C6 carbon chains than for C4 carbon chains; and i c) a 3' transcription terminator.
3. A recombinant cell comprising a nucleic acid segment encoding a 3-keto-acyl-CoA reductase protein, wherein the nucleic acid segment is a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; and encodes a protein at least about 80% identical to SEQ ID NO:9 and that has 3-keto-acyl-CoA reductase activity higher for D-isomers of C6 carbon chains than for C4 carbon chains.
4. A genetically transformed plant cell comprising in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; b) a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; wherein the structural nucleic acid sequence is a nucleic acid sequence at least about 80% identical to SEQ ID NO:8 that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; and encodes a protein at least about 80% identical to SEQ ID NO:9 and that has 3-keto-acyl-CoA reductase activity higher for D-isomers of C6 carbon chains than for C4 carbon chains; c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence.
A genetically transformed plant comprising in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; S*i' b) a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; wherein the structural nucleic acid sequence is a nucleic acid sequence at least about 80% identical to SEQ ID NO:8 that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; and encodes a protein at least about 80% identical to SEQ ID NO:9 and that has 3-keto-acyl-CoA reductase activity higher for D-isomers of C6 carbon chains than for C4 carbon chains; 0 c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence.
6. An isolated or purified nucleic acid segment comprising a nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein, wherein the nucleic acid segment is a nucleic acid sequence at least about 80% identical to SEQ ID NO:10 that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof; and encodes a protein at least about 80% identical to SEQ ID NO:11 and that has polyhydroxyalkanoate synthase activity.
7. A recombinant vector comprising in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; wherein the structural nucleic acid sequence is a nucleic acid sequence at least about 80% identical to SEQ ID that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof; and encodes a protein at least about 80% identical to SEQ ID NO:11 and that has polyhydroxyalkanoate synthase activity; and c) a 3' transcription terminator.
8. A recombinant host cell comprising a nucleic acid segment encoding a polyhydroxyalkanoate synthase protein, wherein the nucleic acid segment is a nucleic acid sequence at least about 80% identical to SEQ ID that hybridizes under stringent conditions to SEQ ID NO:10 or the complement S: thereof; and encodes a protein at least about 80% identical to SEQ ID NO:11 and that has polyhydroxyalkanoate synthase activity.
9. A genetically transformed plant cell comprising in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; wherein the structural nucleic acid sequence is a nucleic acid sequence at least about 80% identical to SEQ ID that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof; and encodes a protein at least about 80% identical to SEQ ID NO:11 and that has polyhydroxyalkanoate synthase activity; c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence. A genetically transformed plant comprising in the 5' to 3' direction: 78 a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; wherein the structural nucleic acid sequence is a nucleic acid sequence at least about 80% identical to SEQ ID that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof; and encodes a protein at least about 80% identical to SEQ ID NO:11 and that has polyhydroxyalkanoate synthase activity; c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence.
S:
11. The nucleic acid segment, vector, or cell of claims 1, 3, 4, or wherein the nucleic acid sequence is SEQ ID NO:8.
12. The nucleic acid segment, vector or cell of claims 6, 7, 8, 9, or wherein the nucleic acid sequence is SEQ ID **o
AU24949/00A 1999-01-07 2000-01-07 Polyhydroxyalkanoate biosynthesis associated proteins and coding region in bacillus megaterium Ceased AU771433B2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US11509299P 1999-01-07 1999-01-07
US60/115092 1999-01-07
PCT/US2000/000364 WO2000040730A1 (en) 1999-01-07 2000-01-07 POLYHYDROXYALKANOATE BIOSYNTHESIS ASSOCIATED PROTEINS AND CODING REGION IN $i(BACILLUS MEGATERIUM)

Publications (2)

Publication Number Publication Date
AU2494900A AU2494900A (en) 2000-07-24
AU771433B2 true AU771433B2 (en) 2004-03-25

Family

ID=27754140

Family Applications (1)

Application Number Title Priority Date Filing Date
AU24949/00A Ceased AU771433B2 (en) 1999-01-07 2000-01-07 Polyhydroxyalkanoate biosynthesis associated proteins and coding region in bacillus megaterium

Country Status (2)

Country Link
JP (1) JP2003523170A (en)
AU (1) AU771433B2 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MY148302A (en) * 2005-03-24 2013-03-29 Kaneka Corp Microorganism accumulating ultrahigh molecular weight polyester
JP6078839B2 (en) * 2011-08-24 2017-02-15 国立大学法人東京工業大学 Mutant polyhydroxyalkanoic acid binding protein and method for producing polyhydroxyalkanoic acid using the same
CN116445440B (en) * 2022-10-26 2024-01-02 华南理工大学 Viscous polyhydroxyalkanoate and preparation and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
97TH GEN. MEETING AM SOC. MICROBIOL. 97, 288 *

Also Published As

Publication number Publication date
AU2494900A (en) 2000-07-24
JP2003523170A (en) 2003-08-05

Similar Documents

Publication Publication Date Title
US6835820B2 (en) Polyhydroxyalkanoate biosynthesis associated proteins and coding region in bacillus megaterium
US6117658A (en) Methods of making polyhydroxyalkanoates comprising 4-hydroxybutyrate monomer units
US5958745A (en) Methods of optimizing substrate pools and biosynthesis of poly-β-hydroxybutyrate-co-poly-β-hydroxyvalerate in bacteria and plants
US6091002A (en) Polyhydroxyalkanoates of narrow molecular weight distribution prepared in transgenic plants
US5959179A (en) Method for transforming soybeans
US7192753B2 (en) Modified threonine deaminase
USRE37543E1 (en) DNA sequence useful for the production of polyhydroxyalkanoates
US5849894A (en) Rhodospirillum rubrum poly-β-hydroxyalkanoate synthase
US7968325B2 (en) Methods for the biosynthesis of polyesters
US6448473B1 (en) Multigene expression vectors for the biosynthesis of products via multienzyme biological pathways
EP0958367B1 (en) Methods for the biosynthesis of polyesters
WO1999035278A1 (en) Biosynthesis of medium chain length polyhydroxyalkanoates
AU771433B2 (en) Polyhydroxyalkanoate biosynthesis associated proteins and coding region in bacillus megaterium
US6773917B1 (en) Use of DNA encoding plastid pyruvate dehydrogenase and branched chain oxoacid dehydrogenase components to enhance polyhydroxyalkanoate biosynthesis in plants
CA2337099C (en) Enzymes for biopolymer production
CA2363803A1 (en) Polyhydroxyalkanoate biosynthesis associated proteins and coding region in bacillus megaterium

Legal Events

Date Code Title Description
DA3 Amendments made section 104

Free format text: THE NATURE OF THE AMENDMENT IS: THE PRIORITY DETAILS IN REGARD TO PATENT APPLICATION NUMBER 24949/00 SHOULD READ: 60115092

FGA Letters patent sealed or granted (standard patent)