USRE37543E1 - DNA sequence useful for the production of polyhydroxyalkanoates - Google Patents
DNA sequence useful for the production of polyhydroxyalkanoates Download PDFInfo
- Publication number
- USRE37543E1 USRE37543E1 US09/570,842 US57084200A USRE37543E US RE37543 E1 USRE37543 E1 US RE37543E1 US 57084200 A US57084200 A US 57084200A US RE37543 E USRE37543 E US RE37543E
- Authority
- US
- United States
- Prior art keywords
- phag
- pha
- dna
- plant
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/62—Carboxylic acid esters
- C12P7/625—Polyesters of hydroxy carboxylic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
Definitions
- the present invention relates to DNA sequences coding for proteins useful in cell synthesis of polyhydroxyalkanoic acids (PHA). These DNA sequences can be expressed in transformed micro-organisms and plants to product polyhydroxyalkanoates (PHAs).
- polyesters belonging to the class of polymers known as polyhydroxyalkanoates has been observed in a wide array of prokaryotic organisms (Anderson and Dawes (1990) Microbiol. Rev. 54:450).
- the monomers composing the polyesters range in length from C4 (3-hydroxybutyrate) to C12 (3-hydroxydodecanoate) (Lageveen et al. (1988) Appl. Env. Microbiol. 54:2924).
- This class of polyesters has attracted much attention as a potential alternative of conventional petrochemical-derived plastics.
- PHAs are broadly characterized according to the monomers that constitute their backbone. Polymers composed of C4-C5 units are classified as short chain lengths (scl) PHAs; polymers containing monomers of C6 units and above are classified as medium chain length (mcl) PHAs. The primary structure of the polymer influences the physical properties of the polyester.
- eutrophus is classified as a scl PHA organism.
- Pseudomonas species generate a polymer composed of monomers ranging in length from C6 to C12 (Timm and Steinbüchel (1990) Appl. Environ. Microbiol. 56:3360 and Lüveen et al. (1988) Appl. Environ. Microbiol. 54:2924), and are classified as mcl PHA organisms.
- the polymerization of the hydroxyacyl-CoA substrates is carried out by PHA synthases.
- the substrate specificity of this class of enzyme varies across the spectrum of PHA producing organisms. This variation in substrate specificity of PHA synthases is supported by indirect evidence observed in heterologous expression studies (Lee et al. (1995) Appl. Microbiol. Biotechnol. 42:901 and Timm et al. (1990) Appl. Microbiol. Biotech. 33:296).
- the structure of the backbone of the polymer is strongly influenced by the PHA synthase responsible for its formation.
- Fluorescent pseudomonads belonging to the rRNA homology group I can synthesize and accumulate large amounts of polyhydroxyalkanoic acids (PHA) composed of various saturated and unsaturated hydroxy fatty acids with carbon chain lengths ranging from 6 to 14 carbon atoms (Steinbüchel and Valentin (1992) FEMS Microbiol. Rev. 103:217). PHA isolated from these bacteria also contains constituents with functional groups such as branched, halogenated, aromatic or nitrile side-chains (Steinbüchel and Valentin (1995) FEMS Microbiol Lett. 128:219). The composition of PHA depends on the PHA polymerase system, the carbon source, and the metabolic routes (Anderson and Dawes (1990) Microbiol. Rev.
- ⁇ -oxidation is the main pathway when fatty acids are used as carbon source;
- De novo fatty acid biosynthesis is the main route during growth on carbon sources which are metabolized to acetyl-CoA, like gluconate, acetate or ethanol; and
- Chain elongation reaction in which acyl-CoA is condensed with acetyl-CoA to the two carbon chain extended 13-keto product which is then reduced to 3-hydroxyacyl-CoA. This latter pathway is involved in PHA-synthesis during growth on hexanoate.
- PHA MCL synthases Due to the extended homologies of the primary structures of PHA MCL synthases to the PHA SCL synthases (Steinbüchel et al. (1992) FEMS Microbiol Rev. 103:217), which occur in bacteria accumulating polyhydroxybutyric acid such as e.g., Alcaligenes eutrophus, it seems likely that the substrate of PHA MCL synthases is (R)-3-hydroxyacyl-CoA. The main constituent of the polyester of P.
- acyl group transfer could be at a different functional group level such as 3-keto or the straight chain.
- the resulting acyl-CoA would then be converted to the 3-hydroxy level by the action of other enzymes as depicted in FIG. 1 .
- Another possibility, in addition to direct transfer, would be a 2-step process with the release of the free fatty acid by a thioesterase and the subsequent activation to the CoA derivative. This could occur at any level of acyl-ACP as illustrated in FIG. 1 .
- the isolation of phaG described herein is an example of the isolation of an enzyme that links lipid synthesis to polymer production.
- the methods employed provide a model for the isolation of such genes in bacteria.
- the present invention provides an isolated DNA fragment comprising a nucleotide sequence encoding a protein that is involved in the linkage between fatty acid biosynthesis and PHA production.
- This fragment comprises a phaG gene from Pseudomonas putida KT2440 that encodes a protein shown to be critical in the production of PHA in Pseudomonas putida KT2440 when this organisms is grown on a simple carboyhydrate substrate (e.g. gluconate).
- This gene termed “phaG”, and the PhaG protein encoded thereby, as well as biologically functional equivalents thereof, respectively, can be used in conjunction with other PHA biosynthetic enzymes in the production of novel co-polymers of PHA in both prokaryotic and eukaryotic organisms, including plants.
- Transformed bacteria and transgenic plants comprising and expressing this gene or its equivalents along with other PHA biosynthetic genes such as, but not limited to, a gene encoding a PHA synthase, will be able to form hydroxyacyl-CoA substrates from simple carbon sources via de novo fatty acid synthesis, and thereby produce novel biodegradable polyesters having physical properties similar to those of petrochemical-derived plastics.
- the present invention also provides a description of methods that would allow one skilled in the art to isolate, identify, and characterize genes that encode proteins involved in the process of converting lipid biosynthetic intermediates to PHA biosynthetic intermediates.
- methods are described for identifying genes that encode CoA-ACP acyltransferases that would be useful in the direct conversion of acyl-ACP to acyl-CoA for PHA biosynthesis.
- FIG. 1 depicts the possible reactions catalyzed by PhaG during PHA synthesis via de novo fatty acid biosynthesis.
- the thioesterase/ligase combination could potentially be active on any of the acyl-ACP forms, as is diagrammed in detail for the acyltransferase.
- FIG. 2 shows the molecular organization of the P. putida KT2440 phaG gene locus
- (a) is the partial restriction map of the E3 fragment containing the phaG gene
- (c) shows the position of the structural gene of phaG, with the promoter indicated by an arrow.
- SEQ ID NO:1 shows the nucleotide sequence of fragment E3; the coding strands of the phaG encoding DNA fragment is shown at positions 911 through 1795.
- SEQ ID NO:2 shows the deduced amino acid sequence of the PhaG protein from P. putida KT2440.
- PHAG N mutants are not defective in the PHA-synthase locus, and most probably phaG is not closely linked to the PHA synthase locus. Furthermore, phaG is not in general essential for the synthesis of PHA in P. putida KT2440, but is only required for PHA synthesis and accumulation from gluconate or other simple carbon sources (e.g., glucose, sucrose, fructose or lactose), which are catabolized to acetyl-CoA in this organism before PHA synthesis starts.
- FIG. 1 depicts the possible reactions catalyzed by PhaG, any of which, if impaired, could account for the mutant phenotype.
- Mutagenesis of P. putida KT 2440 did not yield mutants that were completely impaired in the biosynthesis of PHA from gluconate.
- CDW cellular dry weight
- All mutants contained monomer composition of the polyester typical for this pathway, as far as was detectable.
- the analysis of the generated mutants, the complementation studies, and the genomic organization of phaG revealed no indication for the existence of another protein essential for the PHA synthesis from simple carbon sources in P. putida KT 2440.
- Rhanmolipid biosynthesis proceeds by sequential glycosyl transfer reactions, each catalyzed by specific rhamnosyltransferases with TDP-rhamnose acting as a rhamnosyl donor and 3-hydroxydecanoyl-3-hydroxydecanoate or L-rhamnosyl-3-hydroxydecanoyl3-hydroxydecanoate acting as acceptors as proposed by Burger et al. (1963) J. Biol. Chem. 238:2595 and (1966) Methods Enzymol. 8:441.
- 3-hydroxydecanoate can be formed via ⁇ -oxidation or via fatty acid biosynthesis (Boulton and Ratledge (1987) Biosurfactants and Biotechnology p. 47).
- RhlA significantly enhanced the level of rhamnolipid in rhamnolipid negative mutants of P. aeruginosa PG201 when it was coexpressed with the rhamnosyltransferase (RhIB) compared with the expression of the isolated rhlB gene.
- RhIB rhamnosyltransferase
- Amino acid analysis revealed a putative signal peptide for the N terminus of RhlA. From these results, Ochsner et al. (1994) J. Biol. Chem.
- RhlR protein is involved in the synthesis or in the transport of rhamnosyltransferase precursor substrates or that RhlA is necessary for the stability of the RhlB protein in the cytoplasmic membrane.
- the N-terminal region of PhaG shares also some characteristics with signal peptides found in Gram-negative bacteria, like the polar N-domain, the hydrophobic H-domain and the less hydrophobic C-domain, but it lacks the typical second turn and a putative leader peptidase cleavage site in the C-domain. Due to the cryptic leader sequence PhaG might have originally been involved in another pathway but may have changed its function during the evolution of the organism.
- 3-Hydroxyacyl-ACP intermediates provided by fatty acid biosynthesis are presumably the common intermediates of both the PHA and the rhamnolipid biosynthesis pathways from gluconate. If the ACP derivatives do not themselves serve as substrates for PHA synthases or the enzymes involved in rhamnolipid synthesis for the condensation of two 3-hydroxydecanoyl-moieties, they must be either directly transesterified to the corresponding CoA derivatives or are transferred to CoA thioesters by the combined action of a thioesterase and a ligase. With reference to FIG.
- PhaG may be a (R)-3-hydroxyacyl CoA-ACP acyltransferase catalyzing the conversion of (R)-3-hydroxyacyl-ACP to (R)-3-hydroxyacyl-CoA derivatives, which serve as ultimate precursors for the PHA polymerization from unrelated substrates in Pseudomonads as it was proposed by Eggink et al. (1992) FEMS Microbiol. Rev. 105:759 and van der Leij and Witholt (1995) Can. J. Microbiol. 42, Supp. 1:22.
- PhaG may be a CoA-ACP acyltransferase with an acyl group specificity other than the 3-hydroxy functionality mentioned above, or have activity associated with a specific thioesterase or ligase (refer to FIG. 1 ).
- PhaG may be a protein that stabilizes or regulates a catalytic protein complex which catalyzes the acyl group transfer reaction or thioesterase or ligase activity.
- ACP refers to acyl carrier protein
- CoA refers to coenzyme A.
- CoA-ACP acyltransferase or “acyltransferase” refers to an enzyme that catalyzes acyl group transfer between ACP and CoA.
- C-terminal region refers to the region of a peptide, polypeptide, or protein chain from the middle thereof to the end that carries the amino acid having a free carboxyl group.
- DNA segment heterologous to the promoter region means that the coding DNA segment does not exist in nature in the same gene with the promoter to which it is now attached.
- DNA refers to chromosomal DNA, plasma DNA, cDNA, or synthetic DNA which encodes any of the enzymes discussed herein.
- the term “genome” as it applies to bacteria encompasses both the chromosome and plasmids within a bacterial host cell. Encoding DNAs of the present invention introduced into bacterial host cells can therefore be either chromosomally-integrated or plasmid-localized.
- the term “genome” as it applies to plant cells encompasses not only chromosomal DNA found within the nucleus, but organelle DNA found within subcellular components of the cell. DNAs of the present invention introduced into plant cells can therefore be either chromosomally-integrated or organelle-localized.
- “Ligase” refers to an enzyme that catalyzes the activation of a free fatty acid to the CoA thioester.
- microbe or “microorganism” refers to algae, bacteria, fungi, and protozoa.
- mutant refers to a mutant form of a peptide, polypeptide, or protein.
- N-terminal region refers to the region of a peptide, polypeptide, or protein chain from the amino acid having a free amino group to the middle of the chain.
- “Overexpression” refers to the expression of a polypeptide or protein encoded by a DNA introduced into a host cell, wherein said polypeptide or protein is either nor normally present in the host cell, or wherein said polypeptide or protein is present in said host cell at a higher level than that normally expressed from the endogenous gene encoding said polypeptide or protein.
- plastid refers to the class of plant cell organelles that includes amyloplasts, chloroplasts, chromoplasts, elaioplasts, eoplasts, etioplasts, leucoplasts, and proplastids. These organelles are self-replicating, and contain what is commonly referred to as the “chloroplast genome,” a circular DNA molecule that ranges in size from about 120 to about 217 kb, depending upon the plant species, and which usually contains an inverted repeat region.
- PHA biosynthetic genes and “PHA biosynthetic enzymes” refer to those genes or enzymes leading to anabolic reactions in the pathway of PHA production.
- PHA polyhydroxyalkanoate synthase
- simple carbohydrate substrate means a mono- oroligosaccharide but not a polysaccharide; simple carbohydrate substrate includes glucose, fructose, sucrose, lactose. More complex carbohydrate substrate commonly used in media such as corn syrup, starch, and molasses can be broken down to simple carbohydrate substrate.
- Thioesterase refers to an enzyme that catalyzes the hydrolysis of acyl-ACP groups to the free fatty acid plus ACP.
- E. coli was grown at 37° C. in Luria-Bertani (LB) medium. Pseudomonads were grown at 30° C. either in a complex medium of nutrients broth (NB; 0.8%, wt/vol) or in a mineral salts medium (MM) (Schlegel et al. (1961) Arch. Mikrobiol. 38:209) with 0.05% (w/v) ammonia.
- LB Luria-Bertani
- Pseudomonads were grown at 30° C. either in a complex medium of nutrients broth (NB; 0.8%, wt/vol) or in a mineral salts medium (MM) (Schlegel et al. (1961) Arch. Mikrobiol. 38:209) with 0.05% (w/v) ammonia.
- Polyester analysis To determine the polyester content of the bacteria, 3-5 mg lyophilized cell material was subjected to methanolysis in the presence of 15% (v/v) sulfuric acid. The resulting methyl esters of the constituent 3-hydroxyalkanoic acids were assayed by gas chromatography (GC) according to Brandt et al. (1988) Appl. Environ. Microbiol. 54:1977 and as described in detail recently (Timm and Steinbüchel (1990)Appl. Environ. Microbiol. 56:3360).
- GC gas chromatography
- RNA and DNA Isolation of RNA and DNA.
- Total RNA was isolated as described by Oelmüller et al. (1990) J. Microbiol. Meth. 11:73. Plasmid DNA was prepared from crude lysates by the alkaline extraction procedure (Birnboim and Doly (1979) Nucl. Acids Res. 7:1513). Total genomic DNA was isolated according to Ausubel et al. (1987) Current Protocols in Molecular Biology, John Wiley & Sons, NY, USA.
- Isolated plasmid DNA was digested with various restriction endonucleases under the conditions described by Sambrook et al. (1989) Molecular Cloning. A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. or by the manufacturer. DNA restriction fragments were isolated from agarose gels by using the Geneclean kit (Vogelstein, B. and D. Gillepie (1979) Proc. Natl. Acad Sci. USA 76:615).
- E. coli was grown aerobically in LB medium containing 20 mM MgCl 2 at 37° C.
- Component cells were prepared and transformed by using the calcium chloride procedure described by Sambrook et al. (1989) Molecular Cloning, A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Mating of P. putida KT2440 mutants (recipients) with E. coli S 17-1 (donor) harboring hybrid donor plasmids were performed by “minicomplementation”.
- Synthesis of oligonucleotides Synthetic oligonucleotides were synthesized in 0.2 ⁇ mol portions from deoxynucleoside phosphoamidites (Beaucage and Caruthers (1981) Tetrahedron Lett. 22:1859) in a Gene Assembler Plus apparatus according to the protocol provided by the manufacturer (Pharmacia-LKB, Uppsala, Sweden). Oligonucleoitdes were released from the support matrix, and the protection groups were removed by 15 h incubation at 55° C. in 25% (vol/vol) ammonia. Oligonucleotides were finally purified by passage through a NAP-5 column (Pharmacia-LKB, Uppsala, Sweden).
- DNA sequence analysis DNA sequence analysis. DNA sequencing was carried out by the dideoxy-chain terminating method according to Sanger et al. (1977) Proc. Natl Acad Sci. USA 74:5463 with single stranded or with double stranded alkali denatured plasmid DNA, but with 7-deazaguanosine 5′-triphosphate instead of dGTP (Mizusawa, S. et al. (1986) Nucl. Acids Res. 14:1319), and with [ ⁇ 35 S]-dATP using a T7-polymerase sequencing kit according to the manufacturers protocol (Pharmacia-LKB, Uppsala, Sweden).
- Synthetic oligonucleotides were used as primers and the “primer-hopping strategy” (Strauss, E. C., et all. (1986) Anal. Biochem. 154:353) was employed. Products of the sequencing reactions were separated in 8% (wt/vol) acrylamine gels in buffer (pH 8.3) containing 100 mM hydrochlorine. 83 mM boric acid, 1 mM EDTA and 42% (wt/vol) urea in a S2-sequencing apparatus (GIBCO/BRL Bethesda Research Laboratories GmbH, Eggenstein, Germany) and were visualized on X-ray films.
- the determination of the transcriptional start site was done by a nuclease protection assay.
- the hybridization conditions for the S1 nuclease protection assays were done as described in detail by Berk and Sharp (1977) Cell 12:721 and Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., and the S1 nuclease reactions were conducted by the method described by Aldea et al. (1988) Gene 65:101.
- DNA probes and dideoxynucleotide sequencing reactions for sizing the signals were performed with pBluescript SK-BH13 DNA (Tab. 1 and FIG. 1) as a template.
- the oligonucleotide (5′-GGGTATTCGCGTCACCT-3′), which was complementary to positions 887 to 871, and the oligonucleotide 5′-CCGCATCCGCGCGATAG-3′, which was complementary to positions 986 to 970, respectively, were used for [ 35 S] labeling.
- 25 ⁇ g of RNA was mixed with the labeled DNA fragments; the specific labeling rate was higher than 10 7 cpm/ ⁇ g of DNA.
- PCR Polymerase chain reaction
- heterologous primers in 5′- to 3′-direction were used for site directed mutagenesis: TTTGCGCCAGGATCCGATCATATGAGGCCAGAAATC containing artificial BamHI and NdeI sites, and GTTATAAAAAAGCTTTGTCGGCG harboring the native HindIII site downstream of phaG.
- Electrophoretical methods Sodium dodecyl sulfate (SDS)- and mercaptoethanol-denatured proteins were separated in 11.5% (wt/vol) polyacrylamine gels in Tris-glycine buffer (25 mM Tris, 190 mM glycine, 0.1% (wt/vol) SDS (Laemmli, 1970). Proteins were stained with Coomassie brilliant blue (Weber, and Osborn, 1969).
- T4 DNA ligase, and DNA modifying enzymes were obtained from Lifetechnologies GmbH (Eggenstein, Germany).
- RNase-free DNase, agarose NA, and phosphoamidites were from Pharmacia-LKB (Uppsala, Sweden).
- Formaldehyde was from Sigma Chemical Co. (Gauting, Germany); whereas formamide, ethidium bromide, and EDTA were from Serva Feinbiochemica GmbH & Co. (Heidelberg, Germany).
- Complex media were from Difco Laboratories (Detroit, USA). All other chemicals were of the highest purity available from E. Merck AG (Darmstadt, Germany).
- nitrosoguanidine mutagenesis was performed according to Miller et al. (1972). Cells were incubated for 15 min. in the presence of 200 ⁇ g N-methyl-N′-nitro-N-nitrosoguanidine per ml. Appropriate dilutions of cell suspensions were plated on mineral salts medium (MM)-agar plates containing 0.05% (w/v) ammonia and 1.5% (w/v) sodium gluconate as sole carbon source. Cells accumulating PHA were distinguished from cells of mutants not accumulating PHA due to differences in the opacity of the colonies.
- MM mineral salts medium
- mutants which were defective in the PHA synthase locus and did not synthesize PHA from either substrate and mutants which were only defective in the PHA synthesis via de novo fatty acid biosynthesis
- cells from transparent colonies were also transferred from MM-gluconate plates to MM-agar plates containing 0.3% sodium octanoate.
- Mutants, which formed transparent colonies on gluconate agar plates but opaque colonies on octanoate agar plates were referred to as PHAG N phenotype mutants. They were grown in liquid cultures for two days, and the cells were subjected to gas chromatography to analyze the content and composition of PHA.
- NK2:56 defective in PHA synthesis This study from simple carbon sources (mutant type PHAG NII ) NK:17
- NK2:3 P. putida KT2440 mutants This study NK2:8 impaired in PHA biosynthesis
- Escherichia coli BL21(DE3) hsdSgal(lc1ts857 ind1Sam7 (Studier and Moffatt (1986) J. nin5 lacUV5-T7 gene1) Mol. Biol. 189:113) S17-1 recA; harbors the tra genes of (Simon et al.
- hybrid cosmid pHP1016::PP2000 comprising the entire 7.3kpb PHA synthase locus Pseudomonas aeruginosa PAOI plus approximately 13kbp of the upstream region of this locus or by the hybrid cosmid pHP1016::PP180 comprising the phaC2 gene of P. aeruginosa PAO1 plus approximately 16 kbp of the adjacent downstream region (Timm and Setinbuüchel (1992) Eur. J. Biochem. 209:15).
- Mutant NK 2:1 harboring a plasmid containing the E3 fragment, was deposited with Deutsche Sammiung Von Mikroorganismen und ZellKulturen GmbH (DSM), Mascheroder Weg 1b, D-3300 Braunschweig, Germany, on Apr. 12, 1995 as deposit no. DSMZ 9922.
- acyltransferase activity There are a number of ways to probe for CoA-ACP acyltransferase activity.
- One method is to analyze the acylation of ACP using acyl-CoA as the starting substrate, and identify the acyl-ACP product with urea-polyacrylamide gel electrophoresis (urea-PAGE). Urea-PAGE has been demonstrated to be useful for resolving ACP pool composition (Post-Beittenmiller et al. (1991) J Biol. Chem. 266:1858; Keating et al. (196) J. Bacteriol. 178:2662).
- Detection on the gel is by coomassie staining, or, if the starting acyl-CoA is radiolabeled in the acyl group, detection is by autoradiography.
- a high throughput screen can be performed in a 96-well format.
- acyl-ACP is selectively precipitated with aqueous trichloroacetic acid (Kopka et al. (1995) Anal. Biochem. 224:51), separated using a commercially available 96-well filter plate, washed, and radioactivity in the various compartments is quantitated.
- Acyl-CoA and CoA are captured in the eluate capture plate, while precipitated ACP and acyl-ACP are trapped in the filter. Counting is done using any commercially available plate counter. The above methods should work equally well with acyl groups of various composition. That is, with a straight chain, 2,3-enoyl-, 3-hydroxy-, or 3-keto- functionality.
- An acyltransferase spectroscopic assay could be designed to monitor acyl-ACP conversion to acyl-CoA by an enzymatic coupling system that would vary depending on the acyl group functionality. For example, if the acyl group is 3-hydroxy, one could detect the formation of 3-hydroxyacyl-CoA by coupling to 3-hydroxyacyl-CoA dehydrogenase and monitoring the conversion of NAD + to NADH at 340 nm. A 3-keto functionality could be monitored in the same manner, but in the reverse direction. Similar, but extended coupling schemes could be designed for straight chain, or 2,3-enoyl acyl groups leading in the end to the 3-hydroxyacyl-CoA dehydrogenase and NAD + or NADH for detection.
- a ligase The function of a ligase is to activate a free fatty acid to the CoA thioester level, typically using a nucleotide triphosphate (NTP) as the chemical activating agent.
- NTP nucleotide triphosphate
- PPi pyrophosphate
- NMP nucleotide monophosphate
- Detection would again be spectrophotometric, monitoring NADH production or consumption at 340 nm.
- the ligase indeed utilizes an NTP as the activating agent, then one could analyze for PPi following its conversion to free phosphate using inorganic pyrophosphatase. Free phosphate can be quantitated using standard phosphate-based assays.
- the hydrolysis of an acyl-ACP by a thioesterase to form the free fatty acid and free ACP could be detected in a 96-well format using radiolabeled acyl-ACP and the filter plate technology described above. In this particular case, however, one would monitor for the appearance of free radiolabeled fatty acid in the eluent capture plate, or the remaining, unhydrolyzed radiolabeled acyl-ACP in its precipitated form in the filter plate.
- Another possible assay amenable to a 96-well format would be to detect the sulfhydryl from the phosphopantetheine group in free ACP with Ellman's reagent, 5,5′dithio-bis(2-nitrobenzoic acid) (DTNB). This reagent will react with free sulfhydryls, producing a strong yellow color with an extinction coefficient of 13.6 mM ⁇ 1 cm ⁇ 1 (Ellman, 1959).
- Using an enzymatic assay as a means to purify the enzyme allows isolation of the gene using information gained from the protein sequence. Once pure, the protein is digested with protease and fragments purified. Various fragments are sequenced using standard techniques and degenerate oligonucleotide probes produced based on the protein sequence (Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). These probes are hybridized to a genomic library produced from the organism of interest (Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). Clones that hybridize to the probes are sequenced and the amino acid sequence predicted from the DNA is compared to that determined from the protein in order to verify cloning of the correct gene.
- Detection of enzymatic activity in a bacterial lysate allows screening of randomly-generated mutants for those lacking the activity. Mutants are generated by any of the means described above and several thousand clones from each mutagenesis reaction are screened for the appropriate enzymatic activity. Alternatively, mutants can be screened for the absence of an enzyme using antibodies generated against the purified protein (Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). Any mutants identified in these screens are complemented as described above in order to identify the acyltransferase gene.
- Any enzyme, or combination of enzymes, that converts ⁇ -hydroxyacyl-ACP to ⁇ -hydroxyacyl-CoA could potentially be cloned by transforming a PHA-negative bacterium, harboring only a PHA synthase, with a genomic library constructed from an organism suspected to have the desired activity.
- the ⁇ -hydroxyacyl-CoA could be used directly as a substrate for PHA synthesis by the PHA polymerase, thus allowing screening for production of PHA from a simple carbon source as described supra.
- Any strain making PHA would then be checked to determine if PHA synthesis is due to cloning of an acyltransferase, a thioesterase plus ligase, or ⁇ -ketothiolase plus acyl-CoA reductase.
- the gene encoding the desired activity can be identified using expression libraries of DNA from the organism of interest cloned into plasmid or ⁇ phage harbored in E. coli (Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), Expressed proteins from cloned genes are assayed either using direct enzymatic assay of clones, or by screening the clones using antibodies generated against the purified proteins.
- Clones identified as encoding acyltransferase, thioesterase, or ligase are restriction mapped and subcloned to identify the relevant gene, the gene is sequenced, and the amino acid sequence predicted by the gene is compared to that derived from sequencing of the purified protein.
- Priming of cDNA synthesis can be achieved using oligo-dT primers to anneal to poly-A tails on the mRNA.
- Poly-A tails are present on at least a subset of mRNA molecules in a number of prokaryotes, and bacterial cDNA libraries have been produced using oligo-dT primers (Kushner (1996) ASM Press, Washington, D.C. p. 849; Kim et al. (1993) J. Mol. Biol. 231:960; Gopalakrishna and Sakar (1982) J. Biol. Chem. 257:2747).
- An alternative priming strategy utilizes random oligonucleotides for priming of cDNA synthesis (Kim et al.
- the probes are used in hybridization screens to identify clones from a genomic library of the organism of interest. Alternatively, the cDNA's are cloned directly. Clones identified in this screen are sequenced and compared to genes encoding various known acyltransferases and phaG in order to identify potential acyltransferases. These clones can also be used as probes to identify genomic clones containing the entire gene that encodes the mRNA from which the cDNA was generated.
- the randomly-primed cDNA's (which are unlikely to encode an entire gene) can be cloned into a suicide vector (e.g., that used by Lenz et al. (1994) J. Bacteriol. 176:4385), integrated into the genome of the source organism to produce mutants, and the mutants are analyzed for their ability to produce PHA from simple carbon sources. Any mutants affected in PHA synthesis can be complemented using genomic clones of the organism of interest, as described in example 2, supra.
- a suicide vector e.g., that used by Lenz et al. (1994) J. Bacteriol. 176:4385
- Differentially-expressed proteins can be detected directly using 2-dimensional polyacrylamide gel electrophoresis. This approach has been successfully utilized by Neidhardt and coworkers to study proteins under regulon control in E. coli (e.g., VanBogelen et al. (1996) J. Bacteriol. 178:4344). Proteins identified as being differentially regulated according to carbon source can be purified and sequenced, and the gene(s) encoding them cloned and analyzed as described above.
- the 3-kbp E3 fragment (FIG. 2) was cloned to the pBlueskript SK- vector, and the nucleotide sequence was determined by the dideoxy-chain termination method and the primer-hopping strategy by employing universal, reverse and synthetic oligonucleotides as primers.
- SEQUENCE LISTING SEQ ID NO:1 shows the nucleotide sequence of fragment E3. This fragment comprised 3,061 nucleotides with three ORF's. ORFI and ORF3 are localized only incompletely on this fragment with ORFI lacking the 5′-region and with ORF3 lacking the 3′-region. See FIG. 2 .
- ORFI The amino acid deduced from ORFI revealed significant homologies to a hypothetical, uncharacterized protein of Haemophilus influenzae (Fleischmann, R. D. et al. (1995) Science 269:496). In contrast, no significant homology was obtained for ORF3 to any other gene product whose sequence is available from the EMBL data base.
- ORF2 The only ORF which was completely localized on this fragment was the central ORF2 with 885 nucleotides, designated as phaG. It starts at position 911 and ends at position 1795. It was preceded by a tentative S/D-sequence separated by eight nucleotides. About 230 bp downstream of the translational stop codon of phaG a potential factor independent transcription terminator is located.
- ORF's were detected. However, none of them obeyed the rules of Bibb, M. J. et al. (1984) Gene 30:157 for a coding region or was preceded by a reliable ribosomal binding site.
- the phaG gene encodes a protein of 295 amino acids with a molecular weight of 33,876 Da.
- the deduced amino acid sequence is shown in Sequence Listing SEQ ID NO; 2. Sequence alignments of the amino acid sequence deduced from phaG revealed a 44% overall identity to the rhiA gene product of Pseudomonas aeruginosa PG201 (Ochsner et al. (1994) J. Biol. Chem. 269:19787). RhlA also consists of 295 amino acids and has a molecular weight of 32.5 kDa. This gene represents the 5′-terminal gene of a gene cluster consisting of the genes rhIa, rhIB, and rhIR.
- RhIA represents a transcriptional activator acting upon ⁇ 54 dependent promoters.
- RhIB represents a transcriptional activator acting upon ⁇ 54 dependent promoters.
- the rhlB gene product exhibited rhamnosyltransferase activity whereas the function of RhIA is not yet characterized but is necessary for effective rhamnolipid biosynthesis (Ochsner et al. (1994) J. Biol. Chem. 269:19787).
- the C-terminal region of RhIA and PhaG revealed high homology to a gene region (qin) of P. aeruginosa encoding the so-called “quinolone-sensitivity protein” (Tonelli, D. A., and R. V.
- PhaG has an additional, but smaller, region of homology to a group of enzymes, most of which are hydrolases active on esters such as lipids (e.g. triacylglycerol lipase; Rawadi et al. (1995) Gene 158:107; or polyhydroxyalkanoates (e.g., PHA depolymerase; Timm and Steinbuchel (1992) Eur. J. Biochem. 209:15.
- This homologous region extends from residues 208-258 of PhaG, and includes a histidine residue (residue 251 of PhaG) that is highly conserved among these proteins.
- the present invention includes not only the P. putida PhaG protein encoded by the nucleotide sequence shown in SEQ ID NO: 1, positions 911 through 1795, but also biologically functional equivalent peptides, polypeptides, and proteins.
- biologically functional equivalent peptides, polypeptides, and proteins denotes peptides, polypeptides, and proteins that exhibit the same or similar PhaG activity as the PhaG of P. putida when assayed biologically by complementation utilizing a PhaG minus mutant of Pseudomonas putida defective in PHA synthesis via growth on simple carbohydrate substrates.
- the same or similar PhA activity is meant the ability to perform the same or similar function as PhaG.
- These peptides, polypeptides, and proteins can contain a region or moiety exhibiting sequence similarity to a corresponding region or moiety of the P. putida PhaG protein disclosed herein at SEQ ID NO:2, but this is not required as long as they exhibit the same or similar PhaG activity as that of the P. putida PhaG protein.
- the PhaG protein is useful not only in the enzymatic synthesis of PHAs, but also as an antigen for the preparation of antibodies that can be used to purify or detect this PhaG protein, or possible other PhaG-like proteins.
- Peptides, polypeptides, and proteins biologically functional equivalent to PhaG protein can occur in a variety of forms as described below.
- Peptides, polypeptides, and proteins biologically functionally equivalent to PhaG protein include amino acid sequences containing amino acid changes in the fundamental P. putida PhaG sequence.
- the biologically functional equivalent peptides, polypeptides, and proteins of PhaG protein encompassed by the present invention should generally possess at least about 40% sequence similarity, preferably at least about 60% sequence similarity, and most preferably at least about 80% sequence similarity to the naturally occurring protein, or corresponding region or moiety thereof.
- sequence similarity is determined by the “Gap” or “BestFit” programs of the Sequence Analysis Software Package, Genetics Computer Group, Inc., University of Wisconsin Biotechnology Center, Madison, Wisc. 53711.
- This software matches similar sequences by assigning degrees of homology to various additions, deletions, substitutions, and other modifications. BestFit makes an optimal alignment of the best segment of similarity between two sequences. Optimal alignments are found by inserting gaps to maximize the number of matches using the local homology algorithm of Smith and Waterman (1981) Adv. Appl. Math. 2:482-489. Gap uses the algorithm of Needleman and Wunsch (1970 J Mol. Biol. 48:443-453) to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps.
- Fragments of P. putida PhaG can be truncated forms of the enzyme wherein one or more amino acids are deleted from the N-terminal end, C-terminal end, internal region of the protein, or combinations thereof, so long as such fragments retain the same or similar PhaG enzymatic activity as the naturally occurring P. putida PhaG.
- These fragments can be naturally occurring muteins of PhaG, or can be produced by restriction endonuclease treatment or Exonuclease III treatment (Heinkoff (1984) Gene 28:351) of the encoding nucleotide sequence.
- Variants of P. putida PhaG include forms of the enzyme wherein one or more amino acids in the naturally occurring amino acid sequence has(have) been substituted with another amino acid, or wherein one or more amino acids has (have) been inserted into the natural amino acid sequence.
- the variants contemplated herein retain the same or similar PhaG activity as naturally occurring P. putida PhaG.
- These variants can be naturally occurring muteins of PhaG, or can be produced by random mutagenesis of the wild-type encoding nucleotide sequence (Greener et al. (1994) Strategies 7:32-34) or by replacing domains thereof with domains of other PhaG of interest.
- the PhaG activity of such variants can be assayed by complementation as described supra.
- Fragments and variants of PhaG encompassed by the present invention should preferably possess at least about 40% sequence similarity, more preferably at least about 60% sequence similarity, and most preferably at least about 80% sequence similarity, to the natural P. putida PhaG or corresponding region or moiety thereof. Sequence similarity can be determined using the Gap or BestFit programs of the Sequence Analysis Software Package discussed above.
- the present invention encompasses not only the P. putida PhaG genomic DNA sequence shown in SEQ ID NO: 1, but also biologically functional equivalent nucleotide sequences.
- biologically functional equivalent nucleotide sequences denotes DNAs and RNAs, including genomic DNA, cDNA, synthetic DNA, and mRNA nucleotide sequences, that encode peptides, polypeptides, and proteins exhibiting the same or similar PhaG enzymatic activity as that of P. putida PhaG when assayed enzymatically or by complementation.
- Such biologically functional equivalent nucleotide sequences can encode peptides, polypeptides, and proteins that contain a region or moiety exhibiting sequence similarity to the corresponding region or moiety of the P. putida PhaG.
- nucleotide sequences of the present invention include nucleotide sequences that encode conservative amino acid changes within the P. putida PhaG amino acid sequence, producing silent changes therein. Such nucleotide sequences thus contain corresponding base substitutions based upon the genetic code compared to wild-type nucleotide sequences encoding P. putida PhaG protein.
- nucleotide sequences of the present invention also include genomic DNA, cDNA, synthetic DNA, and mRNA nucleotide sequences encoding non-conservative amino acid substitutions, additions, or deletions. These include nucleic acids that contain the same inherent genetic information as that contained in the genomic PhaG DNA of SEQ ID NO: 1, and which encode peptides, polypeptides, or proteins exhibiting the same or similar PhaG enzymatic activity as that of P. putida PhaG. Such nucleotide sequences can encode fragments or variants of P. putida PhaG.
- the P. putida PhaG-like enzymatic activity of such fragments and variants can be identified by complementation or enzymatic assays as described above.
- These biologically functional equivalent nucleotide sequences can possess at least 40% sequence identity, preferably at least 60% sequence identity, and most preferably at least 80% sequence identity, to naturally occurring P. putida PhaG genomic DNA, cDNA, synthetic DNA, and mRNA, respectively, or corresponding regions or moieties thereof.
- Mutations made in P. putida PhaG cDNA, genomic DNA, synthetic DNA, mRNA, or other nucleic acid preferably preserve the reading frame of the coding sequence. Furthermore, these mutations preferably do not create complementary regions that could hybridize to produce secondary mRNA structures, such as loops or hairpins, that would adversely affect mRNA translation.
- mutation sites can be predetermined, it is not necessary that the nature of the mutations per se be predetermined.
- site-directed mutagenesis can be conducted at the target codon (Thompson et al. (1988) Biochemistry 28:57335), and the PhaG enzymatic activity of the resulting peptide, polypeptide, or protein can be determined enzymatically or by complementation.
- nucleic acid biologically functionally equivalent to P. putida PhaG genomic DNA having the nucleotide sequence shown in SEQ ID NO: 1 include:
- DNAs originating from P. putida exemplified herein by P. putida KT2440, the length of which has been altered either by natural or artificial mutations such as partial nucleotide insertion or deletion, or the like, so that when the entire length of the coding sequence within SEQ ID NO:1, positions 911 through 1795, is taken as 100%, the biologically functional equivalent nucleotide sequence has an approximate length of about 60-120% thereof, preferably about 80-110% thereof; or
- the mutated DNAs created in this manner should preferably encode a protein having at least about 40%, preferably at least about 60%, and more preferably at least about 80%, sequence similarity to the amino acid sequence of the P. putida PhaG. Sequence similarity can be assessed by the Gap or BestFit programs of the Sequence Analysis Software Package discussed above.
- the methods that can be employed to create the artificial nucleic acid mutations contemplated herein are not specifically limited, and can be produced by any of the means conventional in the art.
- the P. putida phaG gene, cDNA, or synthetic DNA can be treated with appropriate restriction enzymes so as to insert or delete desired DNA fragments so that the proper nucleic acid reading frame is preserved.
- the digested DNA can be treated to fill in any overhangs, and the DNA religated.
- C-terminal deletions can be produced by Exonuclease III treatment of the DNA.
- various domains of the P. putida PhaG can be replaced with regions of other PhaG proteins by appropriate nucleic acid manipulations employing restriction enzymes, followed by ligation.
- Mutations can also be introduced at particular loci by synthesizing oligonucleotides containing a mutant sequence flanked by restriction sites enabling ligation to fragments of the native P. putida PhaG genomic DNA, cDNA, or synthetic DNA sequence. Following ligation, the resulting reconstructed sequence encodes a biologically functional equivalent having the desired amino acid insertion, substitution, or deletion.
- oligonucleotide-directed site-specific or segment-specific mutagenesis procedures can be employed to produce an altered DNA sequence having particular codons altered according to the insertion, substitution, or deletion required.
- Bioly functional equivalents to the genomic DNA sequence disclosed herein produced by any of the foregoing methods can be selected for by complementation or enzymatic assay of the resulting peptides, polypeptides, or proteins as described above.
- mutations can be introduced at particular loci by synthesizing oligonucleotides containing a mutant sequence flanked by reaction sites facilitating ligation to fragments of the native P. putida PhaG nucleotide sequence. Following ligation, the resulting reconstructed nucleotide sequence encodes a biologically functional equivalent form of synthase having the desired amino acid insertion, substitution, or deletion. The mutant forms so produced can be screened for P. putida like PhaG activity by complementation or enzymatic assays.
- Useful biologically functional equivalent forms of the genomic phaG DNA of SEQ ID NO:1 include DNAs comprising nucleotide sequences that exhibit a level of sequence identity to corresponding regions or moieties of the genomic phaG DNA of SEQ ID NO:1, positions 911 through 1795, of at least about 40%, preferably at least about 60%, and more preferably at least about 80%. Sequence identity can be determined using the BestFit or Gap programs discussed above.
- genetically degenerate DNA (and RNA) sequences that contain the same essential genetic information as the genomic DNA of the present invention, and which encode the same amino acid sequence as that of P. putida PhaG show in SEQ. ID NO:2, are encompassed by the present invention.
- Genetically degenerate forms of any of the other nucleic acid sequences discussed herein are encompassed by the present invention as well.
- nucleotide sequence encoding P. putida PhaG is shown in SEQ ID NO:1, positions 711 through 1795, it should be understood that other biologically functional equivalent forms of P. putida PhaG-encoding nucleic acids can be readily isolated using conventional DNA—DNA or DNA-RNA hybridization techniques.
- the present invention also includes nucleotide sequences that hybridize to SEQ ID NO:1, positions 911 through 1795, and its complementary sequence, and that code on expression for peptides, polypeptides, and proteins exhibiting the same or similar enzymatic activity as that of P. putida PhaG.
- Such nucleotide sequences preferably hybridize to SEQ ID NO:1, positions 911 through 1795, its complementary sequence under moderate to high stringency (see Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).
- Exemplary conditions include initial hybridization in 6X, SSC, 5X Denhardt's solution, 100 mg/ml fish sperm DNA, 0.1% SDS, at 55° C. for sufficient time to permit hybridization (e.g., several hours to overnight), followed by washing two times for 15 min. each in 2X SSC, 0.1% SDS, at room temperature, and two times for 15 min.
- the nucleic acid molecule is capable of hybridizing when the hybridization mixture is washed at least one time in 0.1X SSC at 55° C., preferably at 60° C., and more preferably at 65° C.
- the present invention also encompasses nucleotide sequences that hybridize to genomic DNA, cDNA, or synthetic DNA molecules that encode the amino acid sequence of P. putida PhaG, or genetically degenerate forms thereof due to the degeneracy of the genetic code, under salt and temperature conditions equivalent to those described supra, and that code on expression for a peptide, polypeptide, or protein that has the same or similar PhaG enzymatic activity as that of P. putida PhaG.
- nucleotide sequences described above are considered to possess a biologically function substantially equivalent to that of the P. putida PhaG gene of the present invention if they encode peptides, poly-peptides, or proteins having PhaG activity differing from that of P. putida PhaG by about ⁇ 30% or less, preferably by about ⁇ 20% or less, and more preferably by about ⁇ 10% or less when assayed in vivo by complementation.
- An E. coli donor strain harboring a broad host range plasmid comprising a putative biologically functional equivalent nucleic acid in cis with all regulatory elements necessary for expression can be used to conjugate the plasmid into a recipient PhaG-minus bacterial strain by triparental mating using the helper plasmid pRK2013 (Ditta et al. (1980) Proc. Natl. Acad. Sci. 77:7347).
- Resulting transconjugants can be selected on polymer-conducive medium supplemented with appropriate antibiotics. Fermentation of the transconjugants in media containing different carbon substrates and subsequent analysis of the resulting PHA provides a means of determining the functional equivalency of the nucleic acid.
- the present invention provides oligonucleotide hybridization probes useful in screening genomic and other nucleic acid libraries for DNA sequence encoding peptides, polypeptides, or proteins having enzymatic activity the same or similar to that of P. putida PhaG, which probes can be designed based on the sequences provided in SEQ ID NO:1, positions 911 through 1795.
- Such probes can range from about 20 to about 60 nucleotides in length, generally about 20 nucleotides in length, more typically about 30 nucleotides in length, preferably about 40 nucleotides in length, and more preferably about 50-60 nucleotides in length.
- these probes specifically hybridize to P.
- Such oligonucleotide probes can by synthesized by automated synthesis, and can be conveniently labeled at the 5′ end with a reporter such as a radionuclide, e.g., 32 P, or biotin.
- the library to be probed can be plated as colonies or phage, depending upon the vector employed, and the recombinant DNA transferred to nylon or nitrocellulose membranes. Following denaturation, neutralization, and fixation of the DNA to the membrane, the membrane is hybridized with the labeled probe.
- Candidate clones or PCR-amplified fragments can be verified as comprising DNA encoding P. putida-like PhaG activity or related peptides, polypeptides, or proteins having activity the same as or similar to P. putida PhaG by a variety of methods.
- the candidate clones can be hybridized with a second, non-overlapping probe, or subjected to DNA sequence analysis. The activity of the peptide, polypeptide, or protein encoded thereby can be assessed by cloning and expression of the DNA in an appropriate host such as E.
- nucleic acids encoding PhaG proteins from microorganisms other than P. putida as well as peptides, polypeptides, and proteins biologically functionally equivalent to P. putida PhaG, useful in producing PHAs, can be isolated.
- Biologically functional equivalent phaG genes from other microorganisms, or equivalent PhaG-encoding cDNAs or synthetic DNAs can also be isolated by amplification using Polymerase Chain Reaction (PCR) methods.
- PCR Polymerase Chain Reaction
- Degenerate oligonucleotide primers based on the amino acid sequence of P. putida PhaG can be prepared and used in conjunction with PCR technology employing reverse transcriptase (E. S. Kawasaki (1990). In Innis et al., Eds., PCR Protocols, Academic Press, San Diego, Chapter 3, p. 21) to amplify biologically functional equivalent DNAs from genomic or cDNA libraries of other organisms.
- the degenerate oligonucleotides can be used as probes to screen CDNA libraries in, for example, ⁇ phage vectors such as ⁇ Zap.II (Stratagene).
- the T7-polymerase expression vector pT7-7 (Tabor and Richardson (1991) Proc. Natl. Acad. Sci. USA 82:1074) was used.
- a NdeI-site was created at the start codon of phaG by PCR amplification.
- the 0.97-kbp PCR product was digested with NdeI and HindIII and ligated to the likewise digested vector.
- the sequence of this construct, which was designated pT7-G1 was confirmed and it was transformed to E. coli BL21 (DE3) (Studier and Moffatt (1986) J.
- Electropherograms of SDS-polyacrylamide gel electrophoresis revealed one major band with an estimated molecular mass of 34 kDa in the crude extract, the pellet fraction, and the inclusion body preparation obtained from cultures of E. coli BL21 (DE3) containing plasmid pT7-G1. This band was absent in the soluble fraction of pT7-G1 harboring E. coli cells, as well as in the control preparations of E. coli BL21 harboring pT7-7 without insert. The results indicated that PhaG was strongly overexpressed but only in insoluble protein aggregates.
- PhaG overexpressed by the T7 expression system can be utilized for numerous applications.
- the protein produced can be used for antibody production, X-ray crystallography studies, in vitro analysis of PhaG activity, as well as in vitro synthesis of PHA's when combined with the appropriate enzymatic activities.
- Other expression systems can also be utilized to overexpress PhaG in recombinant systems.
- the tac promoter of E. coli is a useful promoter for expression of PHaG in E. coli and other bacteria.
- Other promoters useful for the expression of PhaG in recombinant hosts are known to those skilled in the art.
- Protein expressed from the tac promoter may be suitable for in vivo production of PHA from simple carbon sources, for example, glucose, when combined with the appropriate PHA biosynthesis enzymes in a suitable host organism.
- Antibodies recognizing PhaG can be employed to screen organisms containing PhaG or PhaG like proteins. The antibodies would also be valuable for immuno-purification of PhaG and PhaG like proteins from crude extracts.
- the PhaG-encoding DNA of P. putida can be introduced into and expressed in a variety of different eukaryotic and prokaryotic cells, for example bacterial and plant host cells, to facilitate the production of PHAs therein. It should be understood that reference to the P. putida PhaG and genomic DNA encoding the same in this context includes the biologically functional equivalents thereof, respectively, discussed above.
- the advantages of this approach to the production of PHAs include decreasing the dependence on petroleum-derived monomers, and the ease with which bacteria and plants can be grown on a large scale.
- Optimal PHA synthesis via de novo fatty acid biosynthesis in bacteria and plants comprises at least two genes: PHA synthase (phaC) and phaG (disclosed herein).
- PHA synthase ⁇ C
- phaG ⁇ -ketothiolase
- Methods for incorporating PHA synthase and other PHA genes phaA ( ⁇ -ketothiolase) and phaB (D-reductase) genes into transformation and expression vector constructs and introducing these constructs into bacterial and plant host cells to produce PHAs in such cells are well known in the art.
- Poirier et al. ((1995) Bio/Technology 13:142-150) have recently provided an extensive review of progress in this area.
- vector constructs comprise assemblies of DNA fragments operatively linked in a functional manner such that they drive the expression of the structural DNA sequences contained therein.
- These vector constructs usually contain a promoter that functions in the selected host cell, along with any other necessary regulatory regions such as ribosome binding sites, transcription terminators, 3′ non-translated polyadenylation signals, etc., linked together in an operable manner, as well as selectable markers (Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, 1989, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Ausubel et al. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, Inc.).
- Such vectors can be introduced into bacterial cells, for example, by calcium chloride/heat shock treatment or electroporation.
- Transformed host cell can subsequently be selected for on selective media, cultured in an appropriate medium under conditions conducive to the production of PHA, and the PHA can then be recovered from the cells.
- Representative methods have been described by Slater et al. (1988) J. Bacterial. 170:4431-4436; Slater et al. (1992) Appl. Environ. Microbiol. 58:1089-1094; Zhang et al. (1994) Appl. Environ. Microbiol. 60:1198-1205; and Kidwell et al. (1995) Appl. Environ. Microbiol. 61:1391-1398.
- Useful hosts for PHA polymer production employing PhaG include Actinomycetes (e.g., Streptomyces sp. and Nocardia sp.); other bacteria (e.g., Alcaligenes (e.g., A. eutrophus), Bacillus cereus, B. subtilis, B. licheniformis, B. megaterium, Eschericia coli, Klebsiella sp. (e.g., K. aerogenes and K. oxytoca), Lactobacillus, Methylomonas, Pseudomonas sp. (e.g., P. putida and P. fluorescens) Nocardia sp.
- Actinomycetes e.g., Streptomyces sp. and Nocardia sp.
- other bacteria e.g., Alcaligenes (e.g., A. eutrophus), Bacillus cereus,
- Rhodospirillum sp. e.g., R. rubrum
- fungi e.g., Aspergillus, Cephalosporium, and Penicillium
- yeast e.g., Saccharomyces, Rhodotorula, Candida, Hansenula, and Pichia
- Other useful bacteria strains include those strains capable of high accumulation of lipids and strains that have high conversion rates of simple carbon sources to acetyl-CoA.
- transformation vectors capable of introducing bacterial genes involved in PHA biosynthesis can be designed.
- such vectors comprise one or more coding sequences of interest under the transcriptional control of 5′ and 3′ regulatory sequences, including a promoter, and a selectable marker.
- Typical regulatory sequences include a transcription initiation start site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal.
- Plant promoter can be inducible or constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific. Often-used promoters include the CaMV 35S promoter (Odell et al.
- Figwort Mosaic Virus FMV
- mannopine synthase mas
- nopaline synthase nos
- ocs octopine synthase
- Useful inducible promoters include heat-shock promoter (Ou-Lee et al. (1986) Proc. Natl. Acad. Sci. USA 83:6815; a nitrate-inducible promoter derived from the spinach nitrite reductase gene (Back et al. (1991) Plant Mol.
- tissue-specific, developmentally-regulated promoters include the ⁇ -conglycinin 7S promoter (Doyle et al. (1986) J. Biol. Chem. 261:9228; Slighton and Beachy (1987) Planta 172:356), and seed-specific promoters (Knutzon et al. (1992) Proc. Natl. Acad. Sci. USA 89:2624; Bustos et al. (1991) EMBO J. 10:1469; Lam and Chua (1991) Science 248:471; Stayton et al.
- Plant functional promoters useful for preferential expression in seed plastids include those from plant storage protien genes and from genes involved in fatty acid biosynthesis in oilseeds. Examples of such promoters include the 5′ regulatory regions from such genes as napin (Kridl et al. (1991) Seed Sci. Res. 1:209), phaseolin, zein, soybean trypsin inhibitor, ACP, stearoyl-ACP desaturase, and oleosin. Seed-specific gene regulation is discussed in EP 0 255 378. Promoter hybrids can also be constructed to enhance transcriptional activity (Hoffman, U.S. Pat. No.
- Representative vectors often comprise, operatively linked in sequence in the 5′ to 3′ direction, a promoter sequence that directs the transcription of a downstream heterologous structural DNA in a plant; optionally, a non-translated leader sequence; a nucleotide sequence that encodes a protein of interest; and a 3′ non-translated region that encodes a polyadenylation signal which functions in plant cells to cause the termination of transcription and the addition of polyadenylation nucleotides to the 3′ end of the mRNA encoding said protein.
- a factor to consider is the timing and intracellular localization of PhaG expression and other enzymes necessary for the biosynthesis of PHA. For example, if fatty acid biosynthesis pathways are utilized in oilseed plants such as canola, the PhaG expression should be concurrent with fatty acid biosynthesis and targeted to the seed leucoplast or leaf chloroplast.
- transgenic plants comprising cells containing and expressing P.
- putida PhaG-encoding DNA can be produced by transforming cells with a DNA construct as described above via any of the foregoing methods; selecting plant cells that have been transformed on a selective medium; regenerating plant cells that have been transformed to produce differentiated plants; and selecting a transformed plant which expresses the P. putida PhaG-encoding nucleotide sequence.
- the encoding DNAs can be introduced either in a single transformation event (all necessary DNAs present on the same vector), a co-transformation event (all necessary DNAs present on separate vectors that are introduced into plants or plant cells simultaneously), by independent transformation events (all necessary DNAs present on separate vectors that are introduced into plants or plant cells independently) or by re-transformation (transforming an already transformed line generated by a single transformation, co-transformation, or independent transformation events).
- Traditional breeding methods when applicable, can subsequently be used to incorporate the entire pathway into a single plant.
- Successful production of the PHA polyhydroxybutyrate in cells of Arabidopsis has been demonstrated by Poirier et al. (1992) Science 256:520-523, and in plastids thereof by Nawrath et al. (1994) Proc. Natl. Acad. Sci. USA 91:12760-12764.
- Particularly useful plants for PHA polymer production include those, such as potato and sugarbeet, that produce carbon substrates which can be employed for PHA biosynthesis. Cereal plants such as corn, wheat, and rice are also preferred. Other useful plants include tobacco and high oil seed plants such as soybean, canola, oil seed rape, Arabidopsis sp. and peanut. Plants that grow in desert or in mineralized soil can also be employed for the production of PHA. Polymers that can be produced in this manner include but are not limited to for example, PHB, and copolymers incorporating both short chain length and medium chain length monomers, such as PHB-co-PHC, PHC-or-PHO, PHO-co-PHD.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Nutrition Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
- Polyesters Or Polycarbonates (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
Description
TABLE 1 |
Bacterial strains plasmids, bacteriophage and DNA-fragments used in this study. |
Strains and plasmids | Relevant characteristics | Source of reference |
Pseudomonas putida | ||
KT2440 | mt-2, hsdR19r−m+), ohne | (Worsey and Williams (1975) |
TOL-plasmid | J Bacteriol. 124:7) | |
NK2:1 | P. putida KT2440 mutants | This study |
NK2:2 | defective PHA synthesis from | This study |
NK:9 | simple carbon sources | This study |
NK:18 | (mutant type PHAGNI) | This study |
NK3:2 | This study | |
NK1:30 | P. putida KT2440 mutants | This study |
NK2:56 | defective in PHA synthesis | This study |
from simple carbon sources | ||
(mutant type PHAGNII) | ||
NK:17 | This study | |
NK2:3 | P. putida KT2440 mutants | This study |
NK2:8 | impaired in PHA biosynthesis | This study |
Escherichia coli | ||
BL21(DE3) | hsdSgal(lc1ts857 ind1Sam7 | (Studier and Moffatt (1986) J. |
nin5 lacUV5-T7 gene1) | Mol. Biol. 189:113) | |
S17-1 | recA; harbors the tra genes of | (Simon et al. (1983) |
plasmid RP4 in the | Biotechnology 1:784) | |
chromosome; proA, thi-1 | ||
XL1-Blue | recA1 endA1 gyrA96 thi | (Bullock et al. (1987) Bio |
hsdR17 (rk−, mk+) supE44 | Techniques 5:376) | |
relA1, λ-, lac [F′ proAB | ||
lacIqZ∇M15, Tn10(Tet)] | ||
pVK100 | Tcr, Kmr, broad host range | (Nnauf and Nester (1982) |
cosmid | Plasmid8:45) | |
pVK100:K18 | pVK100 harboring three | This study |
genomic EcoRI fragments of | ||
P. putida KT2440. Harbors | ||
phaG | ||
pMP92 | Tcr, broad host range plasmid | (Spaink et al. (1987) Plant |
Mol. Biol. 9:27) | ||
pMPE3 | pMP92 containing the 3-kbp | This study |
E3 fragment harboring phaG | ||
pMPBH13 | pMP92 containing the 1.3 kbp | |
BamHI-HindIII subfragment | ||
of E3 harboring phaG | ||
pMPSE22 | pMP92 containing the 2.2 kbp | This study |
SalI-EcoRI subfragment of E2 | ||
harboring phaG without | ||
promoter | ||
pBluescript SK- | Apr, lacPOZ′, T7 and T3 | Stratagene |
promoter | ||
pT7-7 | φ10 promoter, Apr | (Tabor and Richardson (1991) |
Proc. Natl. Acad. Sci. U.S.A. | ||
82:1074) | ||
pT7-G1 | pT7-7 harboring phaG | This study |
SEQUENCE LISTING |
<160> NUMBER OF SEQ ID NOS: 2 |
<210> SEQ ID NO 1 |
<211> LENGTH: 3061 |
<212> TYPE: DNA |
<213> ORGANISM: pseudomonas putida |
<400> SEQUENCE: 1 |
gaattcagcc gcgtagagct ggacgagcaa ctgctgcagg ccggccgccc gg cccgctac 60 |
ctgatgctgt acaagcccac tggctgcgta acggccaccc acgatccgca ac accgtacc 120 |
gttctcgacc tgctgccagc ggcgttgcga gatgacctgc acatagccgg gc gcctggac 180 |
ttcaacacca ccggcctgat gatcctgacc aacgatggcc aatggtcacg gc ggcctgac 240 |
cagcctgcca ccaagctgcc caagcattat ctggtggaca ccgaggacga ga ttggcgag 300 |
cactatgtgg ccaagtttcg cgagggtttc tattttgcct tcgaagacct ca ccacccaa 360 |
cctgcccagc tggacatcct cggcccccac cgagcccggc tggcgatcgt cg aggggcgt 420 |
taccaccagg tcaagcgcat gttcgggcat ttcaacaaca aggtgatcgg gc tgcatcgg 480 |
gagagcatgg gggcgatccg gctggatccg gggttggcgc cgggggagta tc gtgaactg 540 |
acggccaatg agatagccac tgtctaggcc gtgacagaca gcccgtgtcg tc atacgacc 600 |
gctcagcgac aaaagtcaca ttacttaccg aacggcactt gcgcgatccc ca acccactg 660 |
cttgaatcca aatcgtcagt ctgcatgtga ctaccaagtc acacctgcag cc gatgacac 720 |
tttttgccgg ccacccaaag cctagatgcc ttggggcacg gcaaattgcc cg ccaaaaac 780 |
aataccgtcg acgcaagtgc caaggatcga cacagggccc ccggattatc tt caggcaaa 840 |
tgcctacctg tcataaagaa cgtgcaccct aggtgacgcg aatacccttt tt gcgccagg 900 |
agtcgatgac atgaggccag aaatcgctgt acttgatatc caaggtcagt at cgggttta 960 |
cacggagttc tatcgcgcgg atgcggccga aaacacgatc atcctgatca ac ggctcgct 1020 |
ggccaccacg gcctcgttcg cccagacggt acgtaacctg cacccacagt tc aacgtggt 1080 |
tctgttcgac cagccgtatt caggcaagtc caagccgcac aaccgtcagg aa cggctgat 1140 |
cagcaaggag accgaggcgc atatcctcct tgagctgatc gagcacttcc ag gcagacca 1200 |
cgtgatgtct ttttcgtggg gtggcgcaag cacgctgctg gcgctggcgc ac cagccgcg 1260 |
gtacgtgaag aaggcagtgg tgagttcgtt ctcgccagtg atcaacgagc cg atgcgcga 1320 |
ctatctggac cgtggctgcc agtacctggc cgcctgcgac cgttatcagg tc ggcaacct 1380 |
ggtcaatgac accatcggca agcacttgcc gtcgctgttc aaacgcttca ac taccgcca 1440 |
tgtgagcagc ctggacagcc acgagtacgc acagatgcac ttccacatca ac caggtgct 1500 |
ggagcacgac ctggaacgtg cgctgcaagg cgcgcgcaat atcaacatcc cg gtgctgtt 1560 |
catcaacggc gagcgcgacg agtacaccac agtcgaggat gcgcggcagt tc agcaagca 1620 |
tgtgggcaga agccagttca gcgtgatccg cgatgcgggc cacttcctgg ac atggagaa 1680 |
caagaccgcc tgcgagaaca cccgcaatgt catgctgggc ttcctcaagc ca accgtgcg 1740 |
tgaaccccgc caacgttacc aacccgtgca gcaggggcag catgcatttg cc atctgagc 1800 |
ggctcggcgc cttgtagcca atacccgcag gccacggggc gccgacaagc tt ttttataa 1860 |
cttgggcttc taattcgctg aaggttctgg taaaaagtcg agctcagatg cg ggtatagt 1920 |
ttagtggcaa aacgaaagct tcccaagctt tagttgaggg ttcgattccc tc tacccgct 1980 |
ccacatcgca gtcccgcatg gcgttccagc aacgtcatcg cagtcaaaag ga gccttggc 2040 |
tccttttttc gtttttcatc ctgccttgac ctggcccatg gccaattacc ca ccgatccg 2100 |
cttcaatgcg catcgggcct ttgcgtgcgc aagcgaaacg gcttgtggcg ga tatgctca 2160 |
ctggattcgt gaaactattc gaaaggacaa cgcatgtttc tctcccgctg gc taccgggc 2220 |
cttgccaacc tgctgcacta ccgccgtgaa tggttccacg ccgatctgca ag cgggcctg 2280 |
tcggtagccg cgatccagat tcccattgcc attgcctatg cgcagatcgt cg ggctgccg 2340 |
ccgcaatatg gcctgtacgc ctgtgtgcta ccgatgatgg tctacgcgct ga tcggtagc 2400 |
tcgcgccagc tgatggtcgg ccccgacgcc gccacctgcg cgatgatcgc cg gtgccgtg 2460 |
gcaccgctgg ccatgggtga cccgcagcgc atcgtcgaac tgtcggtgat cg tcaccgtg 2520 |
ctggtcggcg tgatgctgat tgccgcgggc ctggcgcggg ccgggttcat cg ccagcttc 2580 |
ttctcgcggc cgatcctgat cggctacctc aacggtatcg gcctgagcct ga tcgccggg 2640 |
cagctgtcca aggtggtggg cttcaagatc gagggcgacg gtttcatcct ca gcctgatc 2700 |
aacttcttcc agcgcctggg ggaaattcac tgggtcacat tgatcatcgg cc tggccgcc 2760 |
ctgggcctgc tcatctggct gccacggcgc tacccgcgcc tgcccgcagc cc tcacggta 2820 |
gtggcgctgt tcatgctgct ggttggcctg ttcggcctcg accgcttcgg cg ttgccgtc 2880 |
cttgggccgg tacctgcagg catcccgcaa ctggcctggc cacacagcaa cc tggcggaa 2940 |
atgaagagcc tgctgcggcg acgccctggg tatcgccacc gtcagcttct gc agcgccat 3000 |
gcttaccgca cgcagctttg ccgcccggca tggctatgcg atcaacgcca ac cacgaatt 3060 |
c 3061 |
<210> SEQ ID NO 2 |
<211> LENGTH: 295 |
<212> TYPE: PRT |
<213> ORGANISM: pseudomonas putida |
<400> SEQUENCE: 2 |
Met Arg Pro Glu Ile Ala Val Leu Asp Ile Gl n Gly Gln Tyr Arg Val |
1 5 10 15 |
Tyr Thr Glu Phe Tyr Arg Ala Asp Ala Ala Gl u Asn Thr Ile Ile Leu |
20 25 30 |
Ile Asn Gly Ser Leu Ala Thr Thr Ala Ser Ph e Ala Gln Thr Val Arg |
35 40 45 |
Asn Leu His Pro Gln Phe Asn Val Val Leu Ph e Asp Gln Pro Tyr Ser |
50 55 60 |
Gly Lys Ser Lys Pro His Asn Arg Gln Glu Ar g Leu Ile Ser Lys Glu |
65 70 75 80 |
Thr Glu Ala His Ile Leu Leu Glu Leu Ile Gl u His Phe Gln Ala Asp |
85 90 95 |
His Val Met Ser Phe Ser Trp Gly Gly Ala Se r Thr Leu Leu Ala Leu |
100 105 110 |
Ala His Gln Pro Arg Tyr Val Lys Lys Ala Va l Val Ser Ser Phe Ser |
115 120 125 |
Pro Val Ile Asn Glu Pro Met Arg Asp Tyr Le u Asp Arg Gly Cys Gln |
130 135 140 |
Tyr Leu Ala Ala Cys Asp Arg Tyr Gln Val Gl y Asn Leu Val Asn Asp |
145 1 50 155 160 |
Thr Ile Gly Lys His Leu Pro Ser Leu Phe Ly s Arg Phe Asn Tyr Arg |
165 170 175 |
His Val Ser Ser Leu Asp Ser His Glu Tyr Al a Gln Met His Phe His |
180 185 190 |
Ile Asn Gln Val Leu Glu His Asp Leu Glu Ar g Ala Leu Gln Gly Ala |
195 200 205 |
Arg Asn Ile Asn Ile Pro Val Leu Phe Ile As n Gly Glu Arg Asp Glu |
210 215 220 |
Tyr Thr Thr Val Glu Asp Ala Arg Gln Phe Se r Lys His Val Gly Arg |
225 2 30 235 240 |
Ser Gln Phe Ser Val Ile Arg Asp Ala Gly Hi s Phe Leu Asp Met Glu |
245 250 255 |
Asn Lys Thr Ala Cys Glu Asn Thr Arg Asn Va l Met Leu Gly Phe Leu |
260 265 270 |
Lys Pro Thr Val Arg Glu Pro Arg Gln Arg Ty r Gln Pro Val Gln Gln |
275 280 285 |
Gly Gln His Ala Phe Ala Ile |
290 295 |
Claims (26)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US09/570,842 USRE37543E1 (en) | 1996-08-13 | 2000-05-12 | DNA sequence useful for the production of polyhydroxyalkanoates |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US08/700,576 US5750848A (en) | 1996-08-13 | 1996-08-13 | DNA sequence useful for the production of polyhydroxyalkanoates |
US09/570,842 USRE37543E1 (en) | 1996-08-13 | 2000-05-12 | DNA sequence useful for the production of polyhydroxyalkanoates |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US08/700,576 Reissue US5750848A (en) | 1996-08-13 | 1996-08-13 | DNA sequence useful for the production of polyhydroxyalkanoates |
Publications (1)
Publication Number | Publication Date |
---|---|
USRE37543E1 true USRE37543E1 (en) | 2002-02-05 |
Family
ID=24814040
Family Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US08/700,576 Ceased US5750848A (en) | 1996-08-13 | 1996-08-13 | DNA sequence useful for the production of polyhydroxyalkanoates |
US09/570,842 Expired - Lifetime USRE37543E1 (en) | 1996-08-13 | 2000-05-12 | DNA sequence useful for the production of polyhydroxyalkanoates |
Family Applications Before (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US08/700,576 Ceased US5750848A (en) | 1996-08-13 | 1996-08-13 | DNA sequence useful for the production of polyhydroxyalkanoates |
Country Status (7)
Country | Link |
---|---|
US (2) | US5750848A (en) |
EP (1) | EP0920517B1 (en) |
JP (2) | JP2000516813A (en) |
AT (1) | ATE487795T1 (en) |
AU (1) | AU3982897A (en) |
DE (1) | DE69740049D1 (en) |
WO (1) | WO1998006854A1 (en) |
Cited By (38)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2005069986A2 (en) | 2004-01-20 | 2005-08-04 | Monsanto Technology Llc | Chimeric promoters for use in plants |
WO2008105890A2 (en) | 2007-02-26 | 2008-09-04 | Monsanto Technology Llc | Chloroplast transit peptides for efficient targeting of dmo and uses thereof |
WO2008112633A2 (en) | 2007-03-09 | 2008-09-18 | Monsanto Technology Llc | Method of meristem excision and transformation |
US20100112654A1 (en) * | 2008-09-10 | 2010-05-06 | Burk Mark J | Microorganisms for the production of 1,4-butanediol |
WO2010099431A2 (en) | 2009-02-27 | 2010-09-02 | Monsanto Technology Llc | Hydroponic apparatus and methods of use |
US20110003355A1 (en) * | 2009-06-04 | 2011-01-06 | Genomatica, Inc | Process of separating components of a fermentation broth |
US7947483B2 (en) | 2007-08-10 | 2011-05-24 | Genomatica, Inc. | Methods and organisms for the growth-coupled production of 1,4-butanediol |
US20110129899A1 (en) * | 2009-10-13 | 2011-06-02 | Robert Haselbeck | Microorganisms for the production of 1,4-butanediol, 4-hydroxybutanal, 4-hydroxybutyryl-coa, putrescine and related compounds, and methods related thereto |
WO2011088299A1 (en) | 2010-01-14 | 2011-07-21 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
US20110201089A1 (en) * | 2010-02-23 | 2011-08-18 | Burgard Anthony P | Methods for increasing product yields |
US20110207189A1 (en) * | 2010-02-23 | 2011-08-25 | Burgard Anthony P | Methods for increasing product yields |
EP2361986A1 (en) | 2006-05-16 | 2011-08-31 | Monsanto Technology LLC | Use of non-agrobacterium bacterial species for plant transformation |
US20110217742A1 (en) * | 2009-11-25 | 2011-09-08 | Jun Sun | Microorganisms and methods for the coproduction 1,4-butanediol and gamma-butyrolactone |
US8067214B2 (en) | 2007-03-16 | 2011-11-29 | Genomatica, Inc. | Compositions and methods for the biosynthesis of 1,4-butanediol and its precursors |
US8129169B2 (en) | 2009-06-04 | 2012-03-06 | Genomatica, Inc. | Microorganisms for the production of 1,4-butanediol and related methods |
WO2012134921A2 (en) | 2011-03-25 | 2012-10-04 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
WO2012158535A1 (en) | 2011-05-13 | 2012-11-22 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
EP2607489A2 (en) | 2008-04-07 | 2013-06-26 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
WO2013130813A1 (en) | 2012-02-29 | 2013-09-06 | Dow Agrosciences Llc | Sugarcane bacilliform viral (scbv) enhancer and its use in plant functional genomics |
WO2013158442A1 (en) | 2012-04-20 | 2013-10-24 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
WO2016154631A1 (en) | 2015-03-26 | 2016-09-29 | The Texas A&M University System | Conversion of lignin into bioplastics and lipid fuels |
WO2017040343A1 (en) | 2015-08-28 | 2017-03-09 | Pioneer Hi-Bred International, Inc. | Ochrobactrum-mediated transformation of plants |
WO2017059341A1 (en) | 2015-10-02 | 2017-04-06 | Monsanto Technology Llc | Recombinant maize b chromosome sequence and uses thereof |
US9677045B2 (en) | 2012-06-04 | 2017-06-13 | Genomatica, Inc. | Microorganisms and methods for production of 4-hydroxybutyrate, 1,4-butanediol and related compounds |
WO2018005589A1 (en) | 2016-06-28 | 2018-01-04 | Cellectis | Altering expression of gene products in plants through targeted insertion of nucleic acid sequences |
EP3275308A1 (en) | 2010-12-17 | 2018-01-31 | Monsanto Technology LLC | Methods for improving competency of plant cells |
EP3434771A1 (en) | 2012-12-19 | 2019-01-30 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
WO2019139616A1 (en) | 2018-01-12 | 2019-07-18 | The Texas A&M University System | Increasing plant bioproduct yield |
EP3587437A1 (en) | 2013-03-14 | 2020-01-01 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
EP3613280A1 (en) | 2013-03-14 | 2020-02-26 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
EP3988661A1 (en) | 2016-03-11 | 2022-04-27 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
WO2022204460A1 (en) | 2021-03-26 | 2022-09-29 | Flagship Pioneering Innovations Vii, Llc | Compositions and methods for producing circular polyribonucleotides |
WO2022204466A1 (en) | 2021-03-26 | 2022-09-29 | Flagship Pioneering Innovations Vii, Llc | Production of circular polyribonucleotides in a prokaryotic system |
WO2022204464A1 (en) | 2021-03-26 | 2022-09-29 | Flagship Pioneering Innovations Vii, Llc | Production of circular polyribonucleotides in a eukaryotic system |
WO2023077118A1 (en) | 2021-11-01 | 2023-05-04 | Flagship Pioneering Innovations Vii, Llc | Polynucleotides for modifying organisms |
US11732268B2 (en) | 2016-06-28 | 2023-08-22 | Monsanto Technology Llc | Methods and compositions for use in genome modification in plants |
WO2024052856A1 (en) | 2022-09-09 | 2024-03-14 | Friedrich Alexander Universität Erlangen-Nürnberg | Plant regulatory elements and uses thereof |
EP4414449A2 (en) | 2017-01-19 | 2024-08-14 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
Families Citing this family (37)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5750848A (en) * | 1996-08-13 | 1998-05-12 | Monsanto Company | DNA sequence useful for the production of polyhydroxyalkanoates |
WO1998036078A1 (en) * | 1997-02-13 | 1998-08-20 | James Madison University | Methods of making polyhydroxyalkanoates comprising 4-hydroxybutyrate monomer units |
US6586658B1 (en) | 1998-03-06 | 2003-07-01 | Metabolix, Inc. | Modification of fatty acid metabolism in plants |
CA2322729C (en) * | 1998-03-06 | 2010-06-15 | Metabolix, Inc. | Modification of fatty acid metabolism in plants |
US6936750B2 (en) * | 1998-03-18 | 2005-08-30 | Eduardo Blumwald | Increasing salt tolerance in plants by overexpression of a vacuolar Na+/H+ transporter[s] |
US7041875B1 (en) * | 1998-03-18 | 2006-05-09 | Eduardo Blumwald | Genetic engineering salt tolerance in crop plants |
US7442852B2 (en) | 1998-03-18 | 2008-10-28 | Eduardo Blumwald | High salt plants and uses for bioremediation |
EP2267133B1 (en) * | 1998-05-22 | 2017-07-12 | CJ Research Center LLC | Method for making poly(3-hydroxyproprionate) |
US20020173019A1 (en) * | 1998-07-30 | 2002-11-21 | Oliver P. Peoples | Enzymes for biopolymer production |
EP1700908B1 (en) * | 1998-08-18 | 2016-01-06 | Metabolix, Inc. | Transgenic microbial polyhydroxyalkanoate producers |
KR100440097B1 (en) | 1998-12-22 | 2004-07-14 | 독립행정법인농업생물자원연구소 | Sodium/proton countertransporters, DNAs encoding the same, methods for preparing thereof and transformant plants having the DNAs |
AU3266800A (en) | 1999-03-15 | 2000-10-04 | Her Majesty In Right Of Canada As Represented By The Minister Of Agriculture And Agri-Food Canada | Method for producing polyhydroxyalkanoates in recombinant organisms |
JP2003503033A (en) * | 1999-06-24 | 2003-01-28 | メタボリックス,インコーポレイテッド | Plant multigene expression construct |
DE19935088A1 (en) * | 1999-07-27 | 2001-02-01 | Inst Genomic Res Tigr Rockvill | DNA sequences that are suitable for the specific detection of Pseudomonas putida KT2440 |
US20020199218A1 (en) * | 1999-08-19 | 2002-12-26 | Daphne Goring | Proline-rich extensin-like receptor kinases |
DE60140996D1 (en) | 2000-02-11 | 2010-02-25 | Metabolix Inc | INTEIN CONTAINING MULTIGEN EXPRESSION CONSTRUCTS |
JP2001275677A (en) * | 2000-03-30 | 2001-10-09 | Canon Inc | Nucleic acid fragment primer or probe, and method for detecting, using the same, microorganism capable of synthesizing polyhydroxyalkanoate |
US7786355B2 (en) * | 2000-11-17 | 2010-08-31 | Metabolix, Inc. | Production of medium chain length polyhydroxyalkanoates from fatty acid biosynthetic pathways |
CA2364983A1 (en) * | 2000-12-13 | 2002-06-13 | John R. Coleman | Nucleic acid molecules and polypeptides for catabolism of abscisic acid |
CA2461394A1 (en) * | 2001-09-24 | 2003-04-03 | Prodigene, Inc. | Method of increasing expression of heterologous proteins in plants |
WO2003050277A1 (en) * | 2001-12-10 | 2003-06-19 | Riken | Process for producing biodegradable polyester |
KR100439123B1 (en) * | 2002-05-14 | 2004-07-05 | 윤성철 | Polyhydroxyalkanoic Acid-Producing Microorganism and Method for Manufacturing Polyhydroxyalkanoic Acid Using the Same |
US20050034191A1 (en) * | 2002-07-12 | 2005-02-10 | Eduardo Blumwald | Salt tolerant oil crops |
US8314290B2 (en) | 2004-12-21 | 2012-11-20 | Monsanto Technology Llc | Temporal regulation of gene expression by MicroRNAs |
EP3372676A1 (en) | 2004-12-21 | 2018-09-12 | Monsanto Technology, LLC | Recombinant dna constructs and methods for controlling gene expression |
US20060200878A1 (en) | 2004-12-21 | 2006-09-07 | Linda Lutfiyya | Recombinant DNA constructs and methods for controlling gene expression |
CA2600882C (en) * | 2005-03-16 | 2013-02-26 | Metabolix, Inc. | Chemically inducible expression of biosynthetic pathways |
AR053279A1 (en) * | 2005-05-19 | 2007-04-25 | Monsanto Technology Llc | POST-TRANSCRIPTIONAL REGULATION OF GENE EXPRESSION |
BRPI0617224B1 (en) | 2005-10-13 | 2024-04-30 | Monsanto Technology Llc | RECOMBINANT DNA CONSTRUCTS |
WO2008063203A2 (en) | 2006-01-27 | 2008-05-29 | Whitehead Institute For Biomedical Research | Compositions and methods for efficient gene silencing in plants |
CN101421406B (en) | 2006-02-13 | 2016-08-31 | 孟山都技术有限公司 | For producing nucleic acid construct and the method that the seed oil of change forms |
EP2059596B1 (en) | 2006-08-31 | 2017-10-04 | Monsanto Technology, LLC | Phased small rnas |
CN101802215A (en) | 2006-10-12 | 2010-08-11 | 孟山都技术有限公司 | Plant micrornas and using method thereof |
AU2008218813B2 (en) | 2007-02-20 | 2014-04-17 | Monsanto Technology, Llc | Invertebrate microRNAs |
JP5019545B2 (en) | 2008-10-24 | 2012-09-05 | 日本特殊陶業株式会社 | Ceramic joint, ceramic heater and gas sensor |
EP2565265A1 (en) | 2011-09-02 | 2013-03-06 | Philip Morris Products S.A. | Isopropylmalate synthase from Nicotiana tabacum and methods and uses thereof |
CN111849808A (en) * | 2020-07-06 | 2020-10-30 | 北京大学深圳研究院 | Enrichment culture and inoculation of marine PHA (polyhydroxyalkanoate) producing bacteria and PCR (polymerase chain reaction) gene amplification method |
Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5135859A (en) * | 1986-12-02 | 1992-08-04 | Rijks Universiteit To Groningen | Process for producing polyesters by fermentation; a process for producing optically active carboxylic acids and esters |
WO1993002194A1 (en) * | 1991-07-16 | 1993-02-04 | Zeneca Limited | Production of polyalkanoate |
US5245023A (en) * | 1987-06-29 | 1993-09-14 | Massachusetts Institute Of Technology | Method for producing novel polyester biopolymers |
WO1994011519A1 (en) * | 1992-11-06 | 1994-05-26 | Zeneca Limited | Production of polyhydroxyalkanoate in plants |
US5344769A (en) * | 1989-04-04 | 1994-09-06 | Rijksuniversiteit Te Groningen | Microbiological production of polyesters |
US5395919A (en) * | 1991-04-09 | 1995-03-07 | Kohap, Ltd. | Poly-β-hydroxy alkanoate (PHA) copolymer, method of its production, the microbe which produces it, and PHA copolymer blend |
US5480794A (en) * | 1987-06-29 | 1996-01-02 | Massachusetts Institute Of Technology And Metabolix, Inc. | Overproduction and purification of soluble PHA synthase |
Family Cites Families (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
GB9108756D0 (en) * | 1991-04-24 | 1991-06-12 | Ici Plc | Production of polyalkanoate in plants |
US5610041A (en) * | 1991-07-19 | 1997-03-11 | Board Of Trustees Operating Michigan State University | Processes for producing polyhydroxybutyrate and related polyhydroxyalkanoates in the plastids of higher plants |
US5569595A (en) * | 1991-09-27 | 1996-10-29 | Center For Innovative Technology | Production of poly-β-hydroxybutyrate in prokaryotic host cells |
US5750848A (en) * | 1996-08-13 | 1998-05-12 | Monsanto Company | DNA sequence useful for the production of polyhydroxyalkanoates |
CA2279844C (en) * | 1997-02-10 | 2010-04-27 | National Research Council Of Canada | Plant pyruvate dehydrogenase kinase gene |
-
1996
- 1996-08-13 US US08/700,576 patent/US5750848A/en not_active Ceased
-
1997
- 1997-08-13 DE DE69740049T patent/DE69740049D1/en not_active Expired - Lifetime
- 1997-08-13 JP JP10510057A patent/JP2000516813A/en not_active Withdrawn
- 1997-08-13 AT AT97937273T patent/ATE487795T1/en not_active IP Right Cessation
- 1997-08-13 EP EP97937273A patent/EP0920517B1/en not_active Expired - Lifetime
- 1997-08-13 WO PCT/US1997/014388 patent/WO1998006854A1/en active Application Filing
- 1997-08-13 AU AU39828/97A patent/AU3982897A/en not_active Abandoned
-
2000
- 2000-05-12 US US09/570,842 patent/USRE37543E1/en not_active Expired - Lifetime
-
2009
- 2009-03-13 JP JP2009060619A patent/JP2009225794A/en active Pending
Patent Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5135859A (en) * | 1986-12-02 | 1992-08-04 | Rijks Universiteit To Groningen | Process for producing polyesters by fermentation; a process for producing optically active carboxylic acids and esters |
US5245023A (en) * | 1987-06-29 | 1993-09-14 | Massachusetts Institute Of Technology | Method for producing novel polyester biopolymers |
US5480794A (en) * | 1987-06-29 | 1996-01-02 | Massachusetts Institute Of Technology And Metabolix, Inc. | Overproduction and purification of soluble PHA synthase |
US5344769A (en) * | 1989-04-04 | 1994-09-06 | Rijksuniversiteit Te Groningen | Microbiological production of polyesters |
US5395919A (en) * | 1991-04-09 | 1995-03-07 | Kohap, Ltd. | Poly-β-hydroxy alkanoate (PHA) copolymer, method of its production, the microbe which produces it, and PHA copolymer blend |
WO1993002194A1 (en) * | 1991-07-16 | 1993-02-04 | Zeneca Limited | Production of polyalkanoate |
WO1994011519A1 (en) * | 1992-11-06 | 1994-05-26 | Zeneca Limited | Production of polyhydroxyalkanoate in plants |
Non-Patent Citations (7)
Cited By (94)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2868749A1 (en) | 2004-01-20 | 2015-05-06 | Monsanto Technology LLC | Chimeric promoters for use in plants |
WO2005069986A2 (en) | 2004-01-20 | 2005-08-04 | Monsanto Technology Llc | Chimeric promoters for use in plants |
EP2361986A1 (en) | 2006-05-16 | 2011-08-31 | Monsanto Technology LLC | Use of non-agrobacterium bacterial species for plant transformation |
EP3196311A1 (en) | 2006-05-16 | 2017-07-26 | Monsanto Technology LLC | Use of non-agrobacterium bacterial species for plant transformation |
EP2803728A1 (en) | 2006-05-16 | 2014-11-19 | Monsanto Technology LLC | Use of non-agrobacterium bacterial species for plant transformation |
EP3608413A1 (en) | 2006-05-16 | 2020-02-12 | Monsanto Technology LLC | Use of non-agrobacterium bacterial species for plant transformation |
EP2371964A1 (en) | 2006-05-16 | 2011-10-05 | Monsanto Technology LLC | Use of non-agrobacterium bacterial species for plant transformation |
WO2008105890A2 (en) | 2007-02-26 | 2008-09-04 | Monsanto Technology Llc | Chloroplast transit peptides for efficient targeting of dmo and uses thereof |
EP2527453A2 (en) | 2007-02-26 | 2012-11-28 | Monsanto Technology LLC | Chloroplast transit peptides for efficient targeting of DMO and uses thereof |
EP2527452A2 (en) | 2007-02-26 | 2012-11-28 | Monsanto Technology LLC | Chloroplast transit peptides for efficient targeting of DMO and uses thereof |
WO2008112633A2 (en) | 2007-03-09 | 2008-09-18 | Monsanto Technology Llc | Method of meristem excision and transformation |
EP2450448A1 (en) | 2007-03-09 | 2012-05-09 | Monsanto Technology LLC | Methods for plant transformation using spectinomycin selection |
WO2008112645A2 (en) | 2007-03-09 | 2008-09-18 | Monsanto Technology Llc | Methods for plant transformation using spectinomycin selection |
EP2811026A2 (en) | 2007-03-09 | 2014-12-10 | Monsanto Technology LLC | Methods for plant transformation using spectinomycin selection |
US8969054B2 (en) | 2007-03-16 | 2015-03-03 | Genomatica, Inc. | Compositions and methods for the biosynthesis of 1,4-butanediol and its precursors |
US11371046B2 (en) | 2007-03-16 | 2022-06-28 | Genomatica, Inc. | Compositions and methods for the biosynthesis of 1,4-butanediol and its precursors |
US8889399B2 (en) | 2007-03-16 | 2014-11-18 | Genomatica, Inc. | Compositions and methods for the biosynthesis of 1,4-butanediol and its precursors |
US8357520B2 (en) | 2007-03-16 | 2013-01-22 | Genomatica, Inc. | Compositions and methods for the biosynthesis of 1,4-butanediol and its precursors |
US9487803B2 (en) | 2007-03-16 | 2016-11-08 | Genomatica, Inc. | Compositions and methods for the biosynthesis of 1,4-butanediol and its precursors |
US8067214B2 (en) | 2007-03-16 | 2011-11-29 | Genomatica, Inc. | Compositions and methods for the biosynthesis of 1,4-butanediol and its precursors |
US7947483B2 (en) | 2007-08-10 | 2011-05-24 | Genomatica, Inc. | Methods and organisms for the growth-coupled production of 1,4-butanediol |
US8470582B2 (en) | 2007-08-10 | 2013-06-25 | Genomatica, Inc. | Methods and organisms for the growth-coupled production of 1,4-butanediol |
EP2607489A2 (en) | 2008-04-07 | 2013-06-26 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
EP2607488A2 (en) | 2008-04-07 | 2013-06-26 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
US7858350B2 (en) | 2008-09-10 | 2010-12-28 | Genomatica, Inc. | Microorganisms for the production of 1,4-butanediol |
US8178327B2 (en) | 2008-09-10 | 2012-05-15 | Genomatica, Inc. | Microorganisms for the production of 1,4-butanediol |
US8129156B2 (en) | 2008-09-10 | 2012-03-06 | Genomatica, Inc. | Microorganisms for the production of 1,4-butanediol |
US20100112654A1 (en) * | 2008-09-10 | 2010-05-06 | Burk Mark J | Microorganisms for the production of 1,4-butanediol |
US20110159572A1 (en) * | 2008-09-10 | 2011-06-30 | Genomatica, Inc. | Microorganisms for the production of 1,4-butanediol |
US9175297B2 (en) | 2008-09-10 | 2015-11-03 | Genomatica, Inc. | Microorganisms for the production of 1,4-Butanediol |
WO2010099431A2 (en) | 2009-02-27 | 2010-09-02 | Monsanto Technology Llc | Hydroponic apparatus and methods of use |
US11401534B2 (en) | 2009-06-04 | 2022-08-02 | Genomatica, Inc. | Microorganisms for the production of 1,4- butanediol and related methods |
US9434964B2 (en) | 2009-06-04 | 2016-09-06 | Genomatica, Inc. | Microorganisms for the production of 1,4-butanediol and related methods |
US20110003355A1 (en) * | 2009-06-04 | 2011-01-06 | Genomatica, Inc | Process of separating components of a fermentation broth |
US8597918B2 (en) | 2009-06-04 | 2013-12-03 | Genomatica, Inc. | Process of separating components of a fermentation broth |
US8129169B2 (en) | 2009-06-04 | 2012-03-06 | Genomatica, Inc. | Microorganisms for the production of 1,4-butanediol and related methods |
US10273508B2 (en) | 2009-06-04 | 2019-04-30 | Genomatica, Inc. | Microorganisms for the production of 1,4-butanediol and related methods |
US8377667B2 (en) | 2009-10-13 | 2013-02-19 | Genomatica, Inc. | Microorganisms for the production of 1,4-butanediol, 4-hydroxybutanal, 4-hydroxybutyryl-CoA, putrescine and related compounds, and methods related thereto |
US20110229946A1 (en) * | 2009-10-13 | 2011-09-22 | Genomatica, Inc. | Microorganisms for the production of 1,4-butanediol, 4-hydroxybutanal, 4-hydroxybutyryl-coa, putrescine and related compounds, and methods related thereto |
US20110129899A1 (en) * | 2009-10-13 | 2011-06-02 | Robert Haselbeck | Microorganisms for the production of 1,4-butanediol, 4-hydroxybutanal, 4-hydroxybutyryl-coa, putrescine and related compounds, and methods related thereto |
US8377666B2 (en) | 2009-10-13 | 2013-02-19 | Genomatica, Inc. | Microorganisms for the production of 1,4-butanediol, 4-hydroxybutanal, 4-hydroxybutyryl-coa, putrescine and related compounds, and methods related thereto |
US8530210B2 (en) | 2009-11-25 | 2013-09-10 | Genomatica, Inc. | Microorganisms and methods for the coproduction 1,4-butanediol and gamma-butyrolactone |
US9988656B2 (en) | 2009-11-25 | 2018-06-05 | Genomatica, Inc. | Microorganisms and methods for the coproduction 1,4-butanediol and gamma-butyrolactone |
US9222113B2 (en) | 2009-11-25 | 2015-12-29 | Genomatica, Inc. | Microorganisms and methods for the coproduction 1,4-butanediol and gamma-butyrolactone |
US20110217742A1 (en) * | 2009-11-25 | 2011-09-08 | Jun Sun | Microorganisms and methods for the coproduction 1,4-butanediol and gamma-butyrolactone |
US10662451B2 (en) | 2009-11-25 | 2020-05-26 | Genomatica, Inc. | Microorganisms and methods for the coproduction 1,4-butanediol and gamma-butyrolactone |
EP3473722A1 (en) | 2010-01-14 | 2019-04-24 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
EP2982757A1 (en) | 2010-01-14 | 2016-02-10 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
EP3473721A1 (en) | 2010-01-14 | 2019-04-24 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
WO2011088299A1 (en) | 2010-01-14 | 2011-07-21 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
US8445244B2 (en) | 2010-02-23 | 2013-05-21 | Genomatica, Inc. | Methods for increasing product yields |
US8048661B2 (en) | 2010-02-23 | 2011-11-01 | Genomatica, Inc. | Microbial organisms comprising exogenous nucleic acids encoding reductive TCA pathway enzymes |
US20110212507A1 (en) * | 2010-02-23 | 2011-09-01 | Burgard Anthony P | Methods for increasing product yields |
US20110207189A1 (en) * | 2010-02-23 | 2011-08-25 | Burgard Anthony P | Methods for increasing product yields |
US8637286B2 (en) | 2010-02-23 | 2014-01-28 | Genomatica, Inc. | Methods for increasing product yields |
US20110201089A1 (en) * | 2010-02-23 | 2011-08-18 | Burgard Anthony P | Methods for increasing product yields |
EP4059342A1 (en) | 2010-12-17 | 2022-09-21 | Monsanto Technology LLC | Methods for improving competency of plant cells |
EP3275308A1 (en) | 2010-12-17 | 2018-01-31 | Monsanto Technology LLC | Methods for improving competency of plant cells |
EP2733152A1 (en) | 2011-03-25 | 2014-05-21 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
EP2733151A1 (en) | 2011-03-25 | 2014-05-21 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
WO2012134921A2 (en) | 2011-03-25 | 2012-10-04 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
EP2752490A2 (en) | 2011-05-13 | 2014-07-09 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
EP2762570A2 (en) | 2011-05-13 | 2014-08-06 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
EP2752492A2 (en) | 2011-05-13 | 2014-07-09 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
EP2752491A2 (en) | 2011-05-13 | 2014-07-09 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
EP2752489A2 (en) | 2011-05-13 | 2014-07-09 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
EP3321366A1 (en) | 2011-05-13 | 2018-05-16 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
WO2012158535A1 (en) | 2011-05-13 | 2012-11-22 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
WO2013130813A1 (en) | 2012-02-29 | 2013-09-06 | Dow Agrosciences Llc | Sugarcane bacilliform viral (scbv) enhancer and its use in plant functional genomics |
WO2013158442A1 (en) | 2012-04-20 | 2013-10-24 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
US9677045B2 (en) | 2012-06-04 | 2017-06-13 | Genomatica, Inc. | Microorganisms and methods for production of 4-hydroxybutyrate, 1,4-butanediol and related compounds |
US11932845B2 (en) | 2012-06-04 | 2024-03-19 | Genomatica, Inc. | Microorganisms and methods for production of 4-hydroxybutyrate, 1,4-butanediol and related compounds |
US11085015B2 (en) | 2012-06-04 | 2021-08-10 | Genomatica, Inc. | Microorganisms and methods for production of 4-hydroxybutyrate, 1,4-butanediol and related compounds |
EP3434771A1 (en) | 2012-12-19 | 2019-01-30 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
EP3434770A1 (en) | 2012-12-19 | 2019-01-30 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
EP3613279A1 (en) | 2013-03-14 | 2020-02-26 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
EP3587436A1 (en) | 2013-03-14 | 2020-01-01 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
EP3613280A1 (en) | 2013-03-14 | 2020-02-26 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
EP3587435A1 (en) | 2013-03-14 | 2020-01-01 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
EP3587437A1 (en) | 2013-03-14 | 2020-01-01 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
WO2016154631A1 (en) | 2015-03-26 | 2016-09-29 | The Texas A&M University System | Conversion of lignin into bioplastics and lipid fuels |
WO2017040343A1 (en) | 2015-08-28 | 2017-03-09 | Pioneer Hi-Bred International, Inc. | Ochrobactrum-mediated transformation of plants |
WO2017059341A1 (en) | 2015-10-02 | 2017-04-06 | Monsanto Technology Llc | Recombinant maize b chromosome sequence and uses thereof |
US11732269B2 (en) | 2015-10-02 | 2023-08-22 | Monsanto Technology Llc | Recombinant maize B chromosome sequence and uses thereof |
EP3988661A1 (en) | 2016-03-11 | 2022-04-27 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
US11732268B2 (en) | 2016-06-28 | 2023-08-22 | Monsanto Technology Llc | Methods and compositions for use in genome modification in plants |
WO2018005589A1 (en) | 2016-06-28 | 2018-01-04 | Cellectis | Altering expression of gene products in plants through targeted insertion of nucleic acid sequences |
EP4414449A2 (en) | 2017-01-19 | 2024-08-14 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
WO2019139616A1 (en) | 2018-01-12 | 2019-07-18 | The Texas A&M University System | Increasing plant bioproduct yield |
WO2022204460A1 (en) | 2021-03-26 | 2022-09-29 | Flagship Pioneering Innovations Vii, Llc | Compositions and methods for producing circular polyribonucleotides |
WO2022204466A1 (en) | 2021-03-26 | 2022-09-29 | Flagship Pioneering Innovations Vii, Llc | Production of circular polyribonucleotides in a prokaryotic system |
WO2022204464A1 (en) | 2021-03-26 | 2022-09-29 | Flagship Pioneering Innovations Vii, Llc | Production of circular polyribonucleotides in a eukaryotic system |
WO2023077118A1 (en) | 2021-11-01 | 2023-05-04 | Flagship Pioneering Innovations Vii, Llc | Polynucleotides for modifying organisms |
WO2024052856A1 (en) | 2022-09-09 | 2024-03-14 | Friedrich Alexander Universität Erlangen-Nürnberg | Plant regulatory elements and uses thereof |
Also Published As
Publication number | Publication date |
---|---|
ATE487795T1 (en) | 2010-11-15 |
EP0920517A1 (en) | 1999-06-09 |
DE69740049D1 (en) | 2010-12-23 |
AU3982897A (en) | 1998-03-06 |
US5750848A (en) | 1998-05-12 |
WO1998006854A1 (en) | 1998-02-19 |
EP0920517B1 (en) | 2010-11-10 |
JP2000516813A (en) | 2000-12-19 |
JP2009225794A (en) | 2009-10-08 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
USRE37543E1 (en) | DNA sequence useful for the production of polyhydroxyalkanoates | |
US5849894A (en) | Rhodospirillum rubrum poly-β-hydroxyalkanoate synthase | |
US6228623B1 (en) | Polyhydroxyalkanoates of narrow molecular weight distribution prepared in transgenic plants | |
US7192753B2 (en) | Modified threonine deaminase | |
US5942660A (en) | Methods of optimizing substrate pools and biosynthesis of poly-β-hydroxybutyrate-co-poly-β-hydroxyvalerate in bacteria and plants | |
US5958745A (en) | Methods of optimizing substrate pools and biosynthesis of poly-β-hydroxybutyrate-co-poly-β-hydroxyvalerate in bacteria and plants | |
CA2303070C (en) | Biological systems for manufacture of polyhydroxylalkanoate polymers containing 4-hydroxyacids | |
US6117658A (en) | Methods of making polyhydroxyalkanoates comprising 4-hydroxybutyrate monomer units | |
US6759219B2 (en) | Methods for the biosynthesis of polyesters | |
EP1208208B1 (en) | Transgenic systems for the manufacture of poly(3-hydroxy -butyrate -co -3- hydroxyhexanoate) | |
EP0958367B1 (en) | Methods for the biosynthesis of polyesters | |
WO1999035278A1 (en) | Biosynthesis of medium chain length polyhydroxyalkanoates | |
US6773917B1 (en) | Use of DNA encoding plastid pyruvate dehydrogenase and branched chain oxoacid dehydrogenase components to enhance polyhydroxyalkanoate biosynthesis in plants | |
KR100507127B1 (en) | Polyhydroxyalkanoate Synthase and Gene Encoding the Same Enzyme | |
US20020173019A1 (en) | Enzymes for biopolymer production | |
EP1710302B1 (en) | Biological systems for manufacture of polyhydroxyalkanoate polymers containing 4-hydroxyacids | |
AU2494900A (en) | Polyhydroxyalkanoate biosynthesis associated proteins and coding region in bacillus megaterium | |
WO2000040730A1 (en) | POLYHYDROXYALKANOATE BIOSYNTHESIS ASSOCIATED PROTEINS AND CODING REGION IN $i(BACILLUS MEGATERIUM) |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AS | Assignment |
Owner name: MONSANTO COMPANY, MISSOURI Free format text: SECURITY INTEREST;ASSIGNOR:METABOLIX, INC.;REEL/FRAME:012066/0562 Effective date: 20010511 |
|
FPAY | Fee payment |
Year of fee payment: 8 |
|
AS | Assignment |
Owner name: METABOLIX, INC., MASSACHUSETTS Free format text: RELEASE BY SECURED PARTY;ASSIGNOR:MONSANTO COMPANY;REEL/FRAME:018498/0719 Effective date: 20061106 |
|
AS | Assignment |
Owner name: METABOLIX, INC., MASSACHUSETTS Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:MONSANTO COMPANY;REEL/FRAME:018505/0713 Effective date: 20010514 Owner name: MONSANTO COMPANY, MISSOURI Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:KRUGER, NIELS;STEINBUCHEL, ALEXANDER;REEL/FRAME:018505/0768 Effective date: 19960829 |
|
FPAY | Fee payment |
Year of fee payment: 12 |
|
FEPP | Fee payment procedure |
Free format text: PAT HOLDER CLAIMS SMALL ENTITY STATUS, ENTITY STATUS SET TO SMALL (ORIGINAL EVENT CODE: LTOS); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY |
|
AS | Assignment |
Owner name: METABOLIX, INC., MASSACHUSETTS Free format text: ADDRESS CHANGE;ASSIGNOR:METABOLIX, INC.;REEL/FRAME:038665/0359 Effective date: 20160502 |
|
AS | Assignment |
Owner name: CJ RESEARCH CENTER LLC, MASSACHUSETTS Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:METABOLIX, INC.;REEL/FRAME:041066/0876 Effective date: 20160916 |
|
AS | Assignment |
Owner name: CJ CHEILJEDANG CORPORATION, KOREA, REPUBLIC OF Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:CJ RESEARCH CENTER LLC;REEL/FRAME:042522/0729 Effective date: 20161230 |