CA2363803A1

CA2363803A1 - Polyhydroxyalkanoate biosynthesis associated proteins and coding region in bacillus megaterium

Info

Publication number: CA2363803A1
Application number: CA002363803A
Authority: CA
Inventors: Maura C. Cannon; Francis C. Cannon; Gabriel J. Mccool; Henry E. Valentin; Kenneth J. Gruys
Original assignee: Individual
Current assignee: University of Massachusetts UMass
Priority date: 1999-01-07
Filing date: 2000-01-07
Publication date: 2000-07-13
Also published as: EP1141317A1; MXPA01006958A; WO2000040730A1

Abstract

A 7,916 base pair nucleic acid fragment from Bacillus megaterium is disclosed.
The fragment encodes five proteins (PhaP, PhaQ, PhaR, PhaB, and PhaC) shown or inferred to be involved in the biosynthesis of polyhydroxyalkanoate materials.

Description

POLYHYDROXYALKANOATE BIOSYNTHESIS ASSOCIATED PROTEINS AND
CODING REGION IN BACILLUS MEGATERIUM
FIELD OF THE INVENTION
The invention relates to nucleic acid and amino acid sequences involved in polyhydroxyalkanoate biosynthesis, and more specifically, to polyhydroxyalkanoate biosynthesis sequences isolated from Bacillus megaterium. In particular, nucleic acid sequences phaP, phaQ, phaR, phaB, phaC, and their encoded amino acid sequences are disclosed.
BACKGROUND OF THE INVENTION
This patent application is related to U.S. Provisional Application Serial Number ~0 60/115,092, filed on January 7, 1999. The government may own partial rights to the present invention pursuant to grant number MCB 9604450 from the National Science Foundation.
Polyhydroxyalkanoic acids (PHA) are a class of aliphatic polyesters that accumulate in inclusion-bodies in many bacteria and archaea (2, 41 ). Their physiological role in the cell is that of carbon and energy reserves, and as a sink for reducing power. The most studied PHA have ~s repeating subunits of: -[O-CH(R)(CHZ)XCO]-, where the most common form is polyhydroxybutyrate (PHB), with R = CH3 and x = 1 (45). The PHA biosynthetic pathway has been determined for Alcaligenes eutrophus (17, 18. 44). In this organism two molecules of acetyl-Coenzyme A (CoA) are condensed by (3-ketothiolase (PhaA), followed by a stereo-specific reduction catalyzed by an NADPH dependent acetoacetyl-CoA reductase (PhaB) to Zo produce the monomer D-(-)-(3-hydroxybutyryl-CoA, which is polymerized by PHA synthase (PhaC). These 3 pha genes are coded on the phaCAB operon. which is speculated to be constitutively expressed, but PHA is not constitutively synthesized.
Alternative pathways for synthesis of the monomer in other organisms have been suggested, most notably in the Pseudomonas species where the side chain, R, is longer than CH3 and its composition is z~ influenced by carbon substrates in the growth medium (7, 45). In addition to A. eutrophus, phaC
has been cloned from more than twenty different bacteria (26, 43). Other genes associated with PHA synthesis, phaA, phaB, phaZ (PHA depolymerase) and genes for inclusion-body associated proteins and other low molecular weight proteins of unknown function, have also been cloned from some of these bacteria, in many cases by virtue of the fact that they are clustered with ~o phaC.

-2-PHA inclusion-bodies are 0.2 to O.Sq.m in diameter, but their structural details are largely unknown. They were described originally for some species of Bacillus (6, 8, 15, 30, 47) and later for many more bacteria including Pseudomonas, Alcaligenes and Rhodococcus (5, 11, 12, 25, 42). Those from Bacillus megaterium were shown to contain 97.7% PHA, 1.87%
protein s and 0.46% lipid with protein and lipid forming an outer layer (15). More recent reports show the presence of a 14 kDa protein (GA14) on PHA inclusion-bodies of R. Tuber (36, 37), and a 24 kDa protein (GA24) with similarities to GA14 on the inclusion-bodies of A.
eutrophus (48).
These proteins are not essential for PHA accumulation but have been shown to influence the size of PHA inclusion-bodies and the rate of PHA accumulation (37, 48). GA14 and GA24 have to been named "phasins" due to some similarities with oleosins, which are proteins on the surface of oil bodies in plant seeds (21 ). Granule associated proteins are wide-spread in PHA
accumulating bacteria (49).
The pattern of PHA inclusion-body growth and proliferation throughout the growth cycle of Bacillus megaterium has been described (32).
is There exists a need for additional nucleic acid and amino acid sequences useful for the production of polymers in biological systems.
SUMMARY OF THE INVENTION
This invention is the result of a study of PHA inclusion-body associated proteins from Bacillus megaterium and the cloning and analysis of their coding region. The transcription starts Zo were identified, the functional expression of several of the sequences was confirmed in Escherichia coli and in PHA negative mutants of Bacillus megaterium and Pseudomonas putida, and PhaP and PhaC were localized to PHA inclusion-bodies throughout growth.
A nucleic acid fragment encoding proteins involved in polyhydroxyalkanoate biosynthesis was isolated from Bacillus megaterium. Nine nucleic acid sequences and their Zs encoded amino acid sequences are disclosed. Sequences encoding PhaB and PhaC display not insignificant percent identity and similarity to known acetoacetyl-CoA
reductase and polyhydroxyalkanoate synthase proteins, while sequences encoding PhaP, PhaQ, and PhaR do not display significant similarity to known sequences. YkoY is similar to known toxic anion resistance proteins; YkoZ is similar to known RNA polymerase sigma factors;
YkrM is similar

-3-to known Na+-transporting ATP synthase proteins; and SspD matches the known B.
megaterium spore specific DNA binding protein.
While several PHA related sequences were expressed in two organisms, it is envisioned that the sequences may be expressed in a wide array of organisms, and that the nucleic acid s sequences themselves may be modified to change the sequence and properties of the encoded proteins.
DESCRIPTION OF THE FIGURES
The following figures form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by io reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
Figure 1. PHA inclusion-body associated proteins. SDS-polyacrylamide gel electrophoresis of proteins released from purified PHA inclusion-bodies. Lane 1, molecular weight markers in kDa, 14, 18, 29, 43, 68 and 97. Lane 2, proteins from inclusion-bodies of ~s cells harvested at late exponential growth phase. Lane 3, same as lane 2 except this part of the gel was stained following 45 minutes transfer of proteins (seen in lane 2) to PVDF membrane.
The bands were visualized by staining with Coomassie Blue.
Figure 2 (A): The pha sequence cluster and flanking sequences. Map of cloned fragment in pGMlO carrying the pha genes (stripped arrows), intergenic regions (igrs) and flanking genes ao (thick black arrows) from Bacillus megaterium. The thin arrows indicate the locations and directions of transcripts; P, indicates promoter positions. pGMI, pGM6, pGM9 and pGM7 indicate the cloned DNA fragments in these plasmids (Table 1 ). Probes used to identify and clone the pha cluster are indicated by thick short lines under pGMI; n2 and n5 are degenerate probes; bmp and bmc are homologous probes to the ends of the pGMl fragment.
Ruler of Zs sequence in base pairs is for Bacillus megaterium and B. subtilis. Map of yko, sspD and ykr region in the B. subtilis genome; genes with homology to those of Bacillus megaterium in this region are indicted by thick black arrows; non-homologous genes are indicated by thick gray arrows. Gene annotations are horizontal over each gene symbol. Relevant restriction enzyme sites are vertical.

-4-Figure 2 (B): Putative promoter regions for phaRBC, -Q, -P and sspD. Curved arrows indicate transcription start (+1), -10 and -35 nucleotides. The closest resemblance to known -10 and -35 promoter sequences are in lower case letters below putative pha promoter sequences.
Immediately downstream from the PhaP stop codon, the previously described (9) sspD putative s promoter is boxed, and putative hairpin structure is underlined.
Figure 2 (C): Mapping of the 5' ends of the phaRBC, -Q and -P transcripts (see Example 11 ). Lanes G, A, T and C show the dideoxy sequencing ladders obtained with the same primers used in primer extension analysis; nucleotide sequences are complementary to the transcripts.
Lane P is the primer extension product. Lane M is a DNA molecular size marker measured in ~o nucleotides. The primer extension product is indicated by an arrowhead and the 5' end of the transcript within the sequence is indicated by a star. Only regions of the gel containing extension product bands are shown.
Figure 3: Pairwise alignment of PhaC from Bacillus megaterium (this study) and P.
oleovorans (SWISS-PROT accession no. P26494); amino acid identities are shown in black.
Is The Clustal method with PAM250 residue weight table was used.
Figure 4. pha: : gfp fusion plasmids and precursors. Only relevant restriction sites are shown. Annotations are as Figure 2. In all fusions the c-terminus excluding the stop codon, of either phaC or phaP, is fused to the gfp gene by the pGFPuv polylinker. For more details, see Table 1.
Zo Figure 5 (A): Time-course analysis of Bacillus megaterium (pGMl6.2) by phase contrast, green fluorescence, light image, and PHA fluorescence. Time (hours) are hours post-inoculation as indicated.
Figure 5 (B): Growth curve for Figure 5 (A); arrowheads indicate a decrease in PhaP::GFP fluorescence.
as Figure 5 (C): Bacillus megaterium (pGM16.2) sampled at 2 days post-inoculation. Top image is phase contrast, bottom image is GFP fluorescence.
Figure 5 (D): Bacillus megaterium (pGMl3) sampled at 2 days post-inoculation, left -whole cells, right -lysed cells. Top image is phase contrast, bottom image is GFP fluorescence.
Figure 5 (E): Bacillus megaterium (pGMl3C) sampled at 9 hours post-inoculation. Top so image is phase contrast, bottom image is GFP fluorescence.

-5-Figure 5 (F): Bacillus megaterium (pHPS9) showed no fluorescence at any time point.
Top image is phase contrast, bottom image is GFP fluorescence.
Figure 6: Hydrophilicity plot of PhaP protein.
Figure 7: Hydrophilicity plot of PhaQ protein.
s Figure 8: Hydrophilicity plot of PhaR protein.
Figure 9: Pairwise alignment of PhaC from Bacillus megaterium (this study) and T.
violacea (SWISS-PROT accession no. P45366); amino acid identities are indicated by a star (*), and amino acid similarities are indicated by a period (.) below the sequences.
The ClustalW
method with PAM350 residue weight table was used.
~o Figure 10: Proposed biosynthetic pathway for the preparation of C8 copolymers.
DESCRIPTION OF THE SEQUENCE LISTINGS
The following sequence listings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these sequences in combination with the detailed i s description of specific embodiments presented herein.

-6-SEQ ID NO Description 1 Bacillus megaterium 7,916 by fragment 2 phaP nucleic acid sequence, 2566-3075 reverse complement 3 PhaP amino acid sequence, 170 amino acids 4 phaQ nucleic acid sequence, 3247-3684 reverse complement PhaQ amino acid sequence, 146 amino acids 6 phaR nucleic acid sequence, 4170-4673

7 PhaR amino acid sequence, 168 amino acids

8 phaB nucleic acid sequence, 4758-5498

9 PhaB amino acid sequence, 247 amino acids phaC nucleic acid sequence, 5578-6663 11 PhaC amino acid sequence, 362 amino acids 12 oligonucleotide probe n2, 39 bases 13 oligonucleotide probe n5, 30 bases 14 oligonucleotide probe bmp, 19 bases oligonucleotide probe bmc, 22 bases 16 oligonucleotide primer for phaP transcription start, 20 bases 17 oligonucleotide primer for phaQ transcription start, 19 bases 18 oligonucleotide primer for phaRBC transcription start, 19 bases 19 N-terminal amino acid sequence of 14 kDa protein N-terminal amino acid sequence of 20 kDa protein 21 N-terminal amino acid sequence of 41 kDa protein 22 ykoYnucleic acid sequence, 277-1089 23 YkoY amino acid sequence, 271 amino acids 24 ykoZ nucleic acid sequence, 1460-2167 YkoZ amino acid sequence, 236 amino acids 26 ykrM nucleic acid sequence, 6959-7916 (partial) 27 YkrM amino acid sequence, 319 amino acids (partial) 28 sspD nucleic acid sequence, 2419-2225 reverse complement 29 SspD amino acid sequence, 65 amino acids DEFINITIONS
The following definitions are provided in order to aid those skilled in the art in understanding the detailed description of the present invention.
"C-terminal region" refers to the region of a peptide, polypeptide, or protein chain from s the middle thereof to the end that carries the amino acid having a free a carboxyl group (the C-terminus).
"CoA" refers to coenzyme A.

-7_ The phrases "coding sequence", "open reading frame", and "structural sequence"
refer to the region of continuous sequential nucleic acid triplets encoding a protein, polypeptide, or peptide sequence.
The term "encoding DNA" or "encoding nucleic acid" refers to chromosomal nucleic s acid, plasmid nucleic acid, cDNA, or synthetic nucleic acid which codes on expression for any of the proteins or fusion proteins discussed herein.
The term "genome" as it applies to bacteria encompasses both the chromosome and plasmids within a bacterial host cell. Encoding nucleic acids of the present invention introduced into bacterial host cells can therefore be either chromosomally-integrated or plasmid-localized.
~o The term "genome" as it applies to plant cells encompasses not only chromosomal DNA found within the nucleus, but organelle DNA found within subcellular components of the cell. Nucleic acids of the present invention introduced into plant cells can therefore be either chromosomally-integrated or organelle-localized.
"Identity" refers to the degree of similarity between two nucleic acid or protein is sequences. An alignment of the two sequences is performed by a suitable computer program. A
widely used and accepted computer program for performing sequence alignments is CLUSTALW v1.6 (Thompson, et al. Nucl. Acids Res., 22: 4673-4680, 1994). The number of matching bases or amino acids is divided by the total number of bases or amino acids, and multiplied by 100 to obtain a percent identity. For example, if two 580 base pair sequences had Zo 145 matched bases, they would be 25 percent identical. If the two compared sequences are of different lengths, the number of matches is divided by the shorter of the two lengths. For example, if there were 100 matched amino acids between 200 and a 400 amino acid proteins, they are 50 percent identical with respect to the shorter sequence. If the shorter sequence is less than 150 bases or 50 amino acids in length, the number of matches are divided by 150 (for as nucleic acids) or 50 (for proteins); and multiplied by 100 to obtain a percent identity.
The terms "microbe" or "microorganism" refer to algae, bacteria, fungi, and protozoa.
"N-terminal region" refers to the region of a peptide, polypeptide, or protein chain from the amino acid having a free amino group to the middle of the chain.
"Nucleic acid" refers to ribonucleic acid (RNA) and deoxyribonucleic acid (DNA).
so A "nucleic acid segment" is a nucleic acid molecule that has been isolated free of total genomic DNA of a particular species, or that has been synthesized. Included with the term _g_ "nucleic acid segment" are DNA segments, recombinant vectors, plasmids, cosmids, phagemids, phage, viruses, etcetera.
"Overexpression" refers to the expression of a polypeptide or protein encoded by a DNA
introduced into a host cell, wherein said polypeptide or protein is either not normally present in s the host cell, or wherein said polypeptide or protein is present in said host cell at a higher level than that normally expressed from the endogenous gene encoding said polypeptide or protein.
The term "plastid" refers to the class of plant cell organelles that includes amyloplasts, chloroplasts, chromoplasts, elaioplasts, eoplasts, etioplasts, leucoplasts, and proplastids. These organelles are self replicating, and contain what is commonly referred to as the "chloroplast to genome," a circular DNA molecule that ranges in size from about 120 to about 217 kb, depending upon the plant species, and which usually contains an inverted repeat region (Fosket, Plant growth and Development, Academic Press, Inc., San Diego, CA, p. 132, 1994).
"Polyadenylation signal" or "polyA signal" refers to a nucleic acid sequence located 3' to a coding region that directs the addition of adenylate nucleotides to the 3' end of the mRNA
i s transcribed from the coding region.
The term "polyhydroxyalkanoate (or PHA) synthase" refers to enzymes that convert hydroxyacyl-CoAs to polyhydroxyalkanoates and free CoA.
The term "promoter" or "promoter region" refers to a nucleic acid sequence, usually found upstream (5') to a coding sequence, that controls expression of the coding sequence by Zo controlling production of messenger RNA (mRNA) by providing the recognition site for RNA
polymerise and/or other factors necessary for start of transcription at the correct site. As contemplated herein, a promoter or promoter region includes variations of promoters derived by means of ligation to various regulatory sequences, random or controlled mutagenesis, and addition or duplication of enhancer sequences. The promoter region disclosed herein, and as biologically functional equivalents thereof, are responsible for driving the transcription of coding sequences under their control when introduced into a host as part of a suitable recombinant vector, as demonstrated by its ability to produce mRNA.
"Regeneration" refers to the process of growing a plant from a plant cell (e.g., plant protoplast or explant).
30 "Transformation" refers to a process of introducing an exogenous nucleic acid sequence (e.g., a vector, recombinant nucleic acid molecule) into a cell or protoplast in which that exogenous nucleic acid is incorporated into a chromosome or is capable of autonomous replication.
A "transformed cell" is a cell whose nucleic acid has been altered by the introduction of an exogenous nucleic acid molecule into that cell.
s A "transformed plant" or "transgenic plant" is a plant whose nucleic acid has been altered by the introduction of an exogenous nucleic acid molecule into that plant, or by the introduction of an exogenous nucleic acid molecule into a plant cell from which the plant was regenerated or derived.
DETAILED DESCRIPTION OF THE INVENTION
io This invention was developed in the pursuit of proteins which are associated with polyhydroxyalkanoate inclusion bodies, and in the pursuit of novel nucleic acid and amino acid sequences from the bacteria Bacillus megaterium. A 7,916 base pair nucleic acid fragment was isolated and sequenced (SEQ ID NO:1). This fragment was found to contain nine open reading frames, five of which encode proteins suspected of being involved in polyhydroxyalkanoate 1 > biosynthesis.
Genomic fragment An embodiment of the invention is a nucleic acid segment at least about 80%
identical to SEQ ID NO:1. More preferably, the nucleic acid segment is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:1.
Zo Alternatively, the nucleic acid segment may be a nucleic acid segment that hybridizes under stringent conditions to SEQ ID NO:1, or to the complement thereof. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic.
The invention is further directed to nucleic acid segments, proteins, recombinant vectors, Zs recombinant host cells, genetically transformed plant cells, genetically transformed plants, methods of preparing host cells, methods of preparing plants, fusion proteins, and nucleic acid segments encoding fusion proteins.
phaP and PhaP
A nucleic acid segment may comprise a nucleic acid sequence encoding a 3o polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid sequence is

-10-selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID N0:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
N0:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80%
identical to SEQ ID N0:3; and a nucleic acid sequence encoding a protein that is s immunoreactive with an antibody prepared using SEQ ID N0:3 as an antigen, the antibody being immunoreactive with SEQ ID N0:3. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID
N0:2. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The to nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:3.
An isolated polyhydroxyalkanoate inclusion body associated protein may comprise an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID N0:3; and an amino acid sequence that is immunoreactive with ~s an antibody prepared using SEQ ID N0:3 as an antigen, the antibody being immunoreactive with SEQ ID N0:3. The protein is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:3 A recombinant vector may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion Zo body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID N0:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
N0:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to Zs SEQ ID N0:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID N0:3 as an antigen, the antibody being immunoreactive with SEQ ID N0:3; and c) a 3' transcription terminator. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100%
identical to SEQ ID N0:2. The nucleic acid segment may be obtained from a natural source, 3o may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%,

-11-86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID
N0:3. The promoter may generally be any promoter, and more preferably is a tissue selective or tissue specific promoter. The promoter may be constitutive or inducible. The promoter may be a viral promoter. The promoter may be a CMV35S, enhanced CMV35S, an FMV35S, a Lesquerella s hydroxylase, or a 7S conglycinin promoter.
A recombinant host cell may comprise a nucleic acid segment encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid segment is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID N0:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
io N0:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80%
identical to SEQ ID N0:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID N0:3 as an antigen, the antibody being immunoreactive with SEQ ID N0:3. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID
is N0:2. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:3. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The ao bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.
Zs A genetically transformed plant cell may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80%
3o identical to SEQ ID N0:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID N0:2 or the complement thereof; a nucleic acid sequence encoding a protein at least

-12-about 80% identical to SEQ ID N0:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID N0:3 as an antigen, the antibody being immunoreactive with SEQ ID N0:3; c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA
s transcribed from the structural nucleic acid sequence. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:2. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ
ID N0:3.
The plant may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant.
Is A method of preparing host cells useful to produce a polyhydroxyalkanoate inclusion body associated protein may comprise a) selecting a host cell; b) transforming the selected host cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80%
ao identical to SEQ ID N0:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID N0:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID N0:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID N0:3 as an antigen, the antibody being immunoreactive with SEQ ID N0:3; and c) obtaining transformed host cells. More preferably, Zs the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:2. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100%
identical 3o to SEQ ID N0:3. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus,

-13-Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.
s A method of preparing plants useful to produce a polyhydroxyalkanoate inclusion body associated protein may comprise a) selecting a host plant cell; b) transforming the selected host plant cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80%
~o identical to SEQ ID N0:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID N0:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID N0:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID N0:3 as an antigen, the antibody being immunoreactive with SEQ ID N0:3; c) obtaining transformed host plant cells;
and d) ~s regenerating the transformed host plant cells. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100%
identical to SEQ ID N0:2. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 20 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID
N0:3. The plant (and plant cell) may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant.
as The invention also relates to fusion proteins. A fusion protein may comprise a green fluorescent protein subunit; and a polyhydroxyalkanoate inclusion body associated protein subunit; wherein the polyhydroxyalkanoate inclusion body associated protein subunit comprises an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID N0:3; and an amino acid sequence that is immunoreactive with 3o an antibody prepared using SEQ ID N0:3 as an antigen, the antibody being immunoreactive with SEQ ID N0:3. The polyhydroxyalkanoate inclusion body associated protein subunit is

-14-preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:3 A nucleic acid segment encoding a fusion protein may comprise a nucleic acid sequence encoding a green fluorescent protein subunit; and a nucleic acid sequence encoding a s polyhydroxyalkanoate inclusion body associated protein subunit; wherein the nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein subunit is selected from the group consisting of: a nucleic acid sequence at least about 80%
identical to SEQ ID
N0:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID N0:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to io SEQ ID N0:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID N0:3 as an antigen, the antibody being immunoreactive with SEQ ID N0:3. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:2.
The nucleic acid sequence may be obtained from a natural source, may be mutagenized, may be genetically is engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein subunit at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:3.
phaQ and PhaO
A nucleic acid segment may comprise a nucleic acid sequence encoding a zo polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID N0:4; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
N0:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80%
identical to SEQ ID NO:S; and a nucleic acid sequence encoding a protein that is zs immunoreactive with an antibody prepared using SEQ ID NO:S as an antigen, the antibody being immunoreactive with SEQ ID NO:S. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID
N0:4. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The 3o nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:S.

-15-An isolated polyhydroxyalkanoate inclusion body associated protein may comprise an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID N0:5; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID N0:5 as an antigen, the antibody being immunoreactive with s SEQ ID N0:5. The protein is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:5 A recombinant vector may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate io inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID N0:4; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
N0:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID N0:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an is antibody prepared using SEQ ID N0:5 as an antigen, the antibody being immunoreactive with SEQ ID N0:5; and c) a 3' transcription terminator. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100%
identical to SEQ ID N0:4. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be zo synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID
N0:5. The promoter may generally be any promoter, and more preferably is a tissue selective or tissue specific promoter. The promoter may be constitutive or inducible. The promoter may be a viral promoter. The promoter may be a CMV35S, enhanced CMV35S, an FMV35S, a Lesquerella Zs hydroxylase, or a 7S conglycinin promoter.
A recombinant host cell may comprise a nucleic acid segment encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid segment is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID N0:4; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
so N0:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80%
identical to SEQ ID N0:5; and a nucleic acid sequence encoding a protein that is

-16-immunoreactive with an antibody prepared using SEQ ID NO:S as an antigen, the antibody being immunoreactive with SEQ ID NO:S. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID
N0:4. The nucleic acid segment may be obtained from a natural source, may be mutagenized, s may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:S. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha ~o cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.
A genetically transformed plant cell may comprise in the 5' to 3' direction:
a) a promoter is that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80%
identical to SEQ ID N0:4; a nucleic acid sequence that hybridizes under stringent conditions to Zo SEQ ID N0:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:S; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:S as an antigen, the antibody being immunoreactive with SEQ ID NO:S; c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA
Zs transcribed from the structural nucleic acid sequence. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:4. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 30 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:S.
The plant may generally be any plant, and more preferably a monocot, dicot, or conifer. The

-17-plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant.
A method of preparing host cells useful to produce a polyhydroxyalkanoate inclusion s body associated protein may comprise a) selecting a host cell; b) transforming the selected host cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80%
identical to SEQ ID N0:4; a nucleic acid sequence that hybridizes under stringent conditions to io SEQ ID N0:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:S; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:S as an antigen, the antibody being immunoreactive with SEQ ID NO:S; and c) obtaining transformed host cells. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, is 99%, 99.5%, or 100% identical to SEQ ID N0:4. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100%
identical to SEQ ID NO:S. The host cell may generally be any host cell, and preferably is a bacterial, zo fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.
Zs A method of preparing plants useful to produce a polyhydroxyalkanoate inclusion body associated protein may comprise a) selecting a host plant cell; b) transforming the selected host plant cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80%
3o identical to SEQ ID N0:4; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID N0:4 or the complement thereof; a nucleic acid sequence encoding a protein at least

-18-about 80% identical to SEQ ID N0:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID N0:5 as an antigen, the antibody being immunoreactive with SEQ ID N0:5; c) obtaining transformed host plant cells;
and d) regenerating the transformed host plant cells. More preferably, the nucleic acid sequence is at s least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100%
identical to SEQ ID N0:4. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID
N0:5. The ~o plant (and plant cell) may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant.
The invention also relates to fusion proteins. A fusion protein may comprise a green ~s fluorescent protein subunit; and a polyhydroxyalkanoate inclusion body associated protein subunit; wherein the polyhydroxyalkanoate inclusion body associated protein subunit comprises an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID N0:5; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID N0:5 as an antigen, the antibody being immunoreactive with Zo SEQ ID N0:5. The polyhydroxyalkanoate inclusion body associated protein subunit is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:5 A nucleic acid segment encoding a fusion protein may comprise a nucleic acid sequence encoding a green fluorescent protein subunit; and a nucleic acid sequence encoding a Zs polyhydroxyalkanoate inclusion body associated protein subunit; wherein the nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein subunit is selected from the group consisting of: a nucleic acid sequence at least about 80%
identical to SEQ ID
N0:4; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID N0:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to 3o SEQ ID N0:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID N0:5 as an antigen, the antibody being immunoreactive with

-19-SEQ ID NO:S. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:4.
The nucleic acid sequence may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence s preferably encodes a protein subunit at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:S.
phaR and PhaR
A nucleic acid segment may comprise a nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid sequence is ~o selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID N0:6; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
N0:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80%
identical to SEQ ID N0:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID N0:7 as an antigen, the antibody being is immunoreactive with SEQ ID N0:7. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID
N0:6. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, zo 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:7.
An isolated polyhydroxyalkanoate inclusion body associated protein may comprise an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID N0:7; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID N0:7 as an antigen, the antibody being immunoreactive with zs SEQ ID N0:7. The protein is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:7 A recombinant vector may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate 30 inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID N0:6; a

-20-nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
N0:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID N0:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID N0:7 as an antigen, the antibody being immunoreactive with s SEQ ID N0:7; and c) a 3' transcription terminator. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100%
identical to SEQ ID N0:6. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, io 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID
N0:7. The promoter may generally be any promoter, and more preferably is a tissue selective or tissue specific promoter. The promoter may be constitutive or inducible. The promoter may be a viral promoter. The promoter may be a CMV35S, enhanced CMV35S, an FMV35S, a Lesquerella hydroxylase, or a 7S conglycinin promoter.
Is A recombinant host cell may comprise a nucleic acid segment encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid segment is selected from the group consisting o~ a nucleic acid sequence at least about 80% identical to SEQ ID N0:6; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
N0:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80%
Zo identical to SEQ ID N0:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID N0:7 as an antigen, the antibody being immunoreactive with SEQ ID N0:7. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID
N0:6. The nucleic acid segment may be obtained from a natural source, may be mutagenized, Zs may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:7. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha 3o cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants

-21 -such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.
A genetically transformed plant cell may comprise in the 5' to 3' direction:
a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate s inclusion body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80%
identical to SEQ ID N0:6; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID N0:6 or the complement thereof; a nucleic acid sequence encoding a protein at least io about 80% identical to SEQ ID N0:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID N0:7 as an antigen, the antibody being immunoreactive with SEQ ID N0:7; c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA
transcribed from the structural nucleic acid sequence. More preferably, the nucleic acid is sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:6. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ
ID N0:7.
zo The plant may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant.
A method of preparing host cells useful to produce a polyhydroxyalkanoate inclusion z> body associated protein may comprise a) selecting a host cell; b) transforming the selected host cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80%
identical to SEQ ID N0:6; a nucleic acid sequence that hybridizes under stringent conditions to 3o SEQ ID N0:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID N0:7; and a nucleic acid sequence encoding a protein that is

-22-immunoreactive with an antibody prepared using SEQ ID N0:7 as an antigen, the antibody being immunoreactive with SEQ ID N0:7; and c) obtaining transformed host cells. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:6. The nucleic acid segment may be obtained s from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100%
identical to SEQ ID N0:7. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, ~o Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.
A method of preparing plants useful to produce a polyhydroxyalkanoate inclusion body is associated protein may comprise a) selecting a host plant cell; b) transforming the selected host plant cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80%
identical to SEQ ID N0:6; a nucleic acid sequence that hybridizes under stringent conditions to ao SEQ ID N0:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID N0:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID N0:7 as an antigen, the antibody being immunoreactive with SEQ ID N0:7; c) obtaining transformed host plant cells;
and d) regenerating the transformed host plant cells. More preferably, the nucleic acid sequence is at zs least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:6. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical .to SEQ ID
N0:7. The 3o plant (and plant cell) may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants

- 23 -such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant.
The invention also relates to fusion proteins. A fusion protein may comprise a green fluorescent protein subunit; and a polyhydroxyalkanoate inclusion body associated protein s subunit; wherein the polyhydroxyalkanoate inclusion body associated protein subunit comprises an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID N0:7; and an amino acid sequence that is immunoreactive .with an antibody prepared using SEQ ID N0:7 as an antigen, the antibody being immunoreactive with SEQ ID N0:7. The polyhydroxyalkanoate inclusion body associated protein subunit is ~o preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:7 A nucleic acid segment encoding a fusion protein may comprise a nucleic acid sequence encoding a green fluorescent protein subunit; and a nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein subunit; wherein the nucleic acid is sequence encoding a polyhydroxyalkanoate inclusion body associated protein subunit is selected from the group consisting of: a nucleic acid sequence at least about 80%
identical to SEQ ID
N0:6; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID N0:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID N0:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an Zo antibody prepared using SEQ ID N0:7 as an antigen, the antibody being immunoreactive with SEQ ID N0:7. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:6.
The nucleic acid sequence may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence is preferably encodes a protein subunit at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:7.
phaB and PhaB
A nucleic acid segment may comprise a nucleic acid sequence encoding a 3-keto-acyl CoA reductase protein, wherein the nucleic acid sequence is selected from the group consisting 30 of: a nucleic acid sequence at least about 80% identical to SEQ ID N0:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID N0:8 or the complement thereof; a nucleic

-24-acid sequence encoding a protein at least about 80% identical to SEQ ID N0:9;
and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ
ID N0:9 as an antigen, the antibody being immunoreactive with SEQ ID N0:9.
More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, s 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:8. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:9.
~o An isolated 3-keto-acyl-CoA reductase protein may comprise an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID N0:9; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID N0:9 as an antigen, the antibody being immunoreactive with SEQ ID
N0:9. The protein is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, is 99.5%, or 100% identical to SEQ ID N0:9 A recombinant vector may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a 3-keto-acyl-CoA
reductase protein;
b) a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence ao at least about 80% identical to SEQ ID N0:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID N0:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID N0:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ
ID N0:9 as an antigen, the antibody being immunoreactive with SEQ ID N0:9; and c) a 3' transcription Zs terminator. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:8. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 30 99%, 99.5%, or 100% identical to SEQ ID N0:9. The promoter may generally be any promoter, and more preferably is a tissue selective or tissue specific promoter. The promoter may be

-25-constitutive or inducible. The promoter may be a viral promoter. The promoter may be a CMV35S, enhanced CMV35S, an FMV35S, a Lesquerella hydroxylase, or a 7S
conglycinin promoter.
A recombinant host cell may comprise a nucleic acid segment encoding a 3-keto-acyl-s CoA reductase protein, wherein the nucleic acid segment is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID N0:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID N0:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID N0:9;
and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ
to ID N0:9 as an antigen, the antibody being immunoreactive with SEQ ID N0:9.
More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or I00% identical to SEQ ID N0:8. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably is encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:9. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a Zo tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.
A genetically transformed plant cell may comprise in the 5' to 3' direction:
a) a promoter that directs transcription of a structural nucleic acid sequence encoding a 3-keto-acyl-CoA
reductase protein; b) a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase zs protein; wherein the structural nucleic acid sequence is selected from the group consisting o~ a nucleic acid sequence at least about 80% identical to SEQ ID N0:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID N0:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID N0:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID
so N0:9 as an antigen, the antibody being immunoreactive with SEQ ID N0:9; c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate

-26-nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:8. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by s mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:9. The plant may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, io peanut, sugarcane, switchgrass, or alfalfa plant.
A method of preparing host cells useful to produce a 3-keto-acyl-CoA reductase protein may comprise a) selecting a host cell; b) transforming the selected host cell with a recombinant vector having a structural nucleic acid sequence encoding a 3-keto-acyl-CoA
reductase protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic is acid sequence at least about 80% identical to SEQ ID N0:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID N0:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID N0:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID
N0:9 as an antigen, the antibody being immunoreactive with SEQ ID N0:9; and c) obtaining Zo transformed host cells. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID
N0:8. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic.
The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, Zs 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:9. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell.
The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, 3o soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.

-27-A method of preparing plants useful to produce a 3-keto-acyl-CoA reductase protein may comprise a) selecting a host plant cell; b) transforming the selected host plant cell with a recombinant vector having a structural nucleic acid sequence encoding a 3-keto-acyl-CoA
reductase protein, wherein the structural nucleic acid sequence is selected from the group s consisting of: a nucleic acid sequence at least about 80% identical to SEQ
ID N0:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID N0:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80%
identical to SEQ ID N0:9;
and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID N0:9 as an antigen, the antibody being immunoreactive with SEQ ID
N0:9; c) io obtaining transformed host plant cells; and d) regenerating the transformed host plant cells.
More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:8. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably is encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:9. The plant (and plant cell) may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant.
zo The invention also relates to fusion proteins. A fusion protein may comprise a green fluorescent protein subunit; and a 3-keto-acyl-CoA reductase protein subunit;
wherein the 3-keto-acyl-CoA reductase protein subunit comprises an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID N0:9; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID N0:9 zs as an antigen, the antibody being immunoreactive with SEQ ID N0:9. The 3-keto-acyl-CoA
reductase protein subunit is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:9 A nucleic acid segment encoding a fusion protein may comprise a nucleic acid sequence encoding a green fluorescent protein subunit; and a nucleic acid sequence encoding a 3-keto 3o acyl-CoA reductase protein subunit; wherein the nucleic acid sequence encoding a 3-keto-acyl CoA reductase protein subunit is selected from the group consisting of: a nucleic acid sequence

-28-at least about 80% identical to SEQ ID N0:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID N0:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID N0:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ
ID N0:9 as an s antigen, the antibody being immunoreactive with SEQ ID N0:9. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:8. The nucleic acid sequence may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein subunit at least about l0 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID
N0:9.
phaC and PhaC
A nucleic acid segment may comprise a nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein, wherein the nucleic acid sequence is selected from the is group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with zo SEQ ID NO:11. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10.
The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic.
The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, zs 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:11.
An isolated polyhydroxyalkanoate synthase protein may comprise an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80%
identical to SEQ ID NO:11; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with 3o SEQ ID NO:11. The protein is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:11

-29-A recombinant vector may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein;
wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic s acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:11;
and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ
ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11;
and c) a 3' io transcription terminator. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID
NO:10. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic.
The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, is 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:11. The promoter may generally be any promoter, and more preferably is a tissue selective or tissue specific promoter. The promoter may be constitutive or inducible. The promoter may be a viral promoter. The promoter may be a CMV35S, enhanced CMV35S, an FMV35S, a Lesquerella hydroxylase, or a 7S
conglycinin promoter.
ao A recombinant host cell may comprise a nucleic acid segment encoding a polyhydroxyalkanoate synthase protein, wherein the nucleic acid segment is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to Zs SEQ ID NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10.
The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be 3o genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%,

30 PCT/US00/00364 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:11. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant s cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.
A genetically transformed plant cell may comprise in the 5' to 3' direction:
a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate io synthase protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID
NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80%
identical to SEQ ID
i s NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID
NO:11; c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence. More preferably, the nucleic acid sequence is at least about 82%, 84%, zo 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID
NO:10. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic.
The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:I 1. The plant may generally be any zs plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant.
A method of preparing host cells useful to produce a polyhydroxyalkanoate synthase protein may comprise a) selecting a host cell; b) transforming the selected host cell with a 3o recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein, wherein the structural nucleic acid sequence is selected from the group

-31-consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID
NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80%
identical to SEQ ID
NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody s prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID
NO:11; and c) obtaining transformed host cells. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100%
identical to SEQ ID NO:10. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be io synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID
NO:11. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or is Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.
A method of preparing plants useful to produce a polyhydroxyalkanoate synthase protein may comprise a) selecting a host plant cell; b) transforming the selected host plant cell with a 2o recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID
NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80%
identical to SEQ ID
as NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID
NO:11; c) obtaining transformed host plant cells; and d) regenerating the transformed host plant cells. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid 3o segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence

-32-preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:11. The plant (and plant cell) may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, s sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant. , The invention also relates to fusion proteins. A fusion protein may comprise a green fluorescent protein subunit; and a polyhydroxyalkanoate synthase protein subunit; wherein the polyhydroxyalkanoate synthase protein subunit comprises an amino acid sequence selected from the group consisting o~ an amino acid sequence at least about 80% identical to SEQ ID NO:11;
io and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID
NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11. The polyhydroxyalkanoate synthase protein subunit is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:11 A nucleic acid segment encoding a fusion protein may comprise a nucleic acid sequence is encoding a green fluorescent protein subunit; and a nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein subunit; wherein the nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein subunit is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof; a nucleic ao acid sequence encoding a protein at least about 80% identical to SEQ ID
NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ
ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11.
More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid sequence may zs be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein subunit at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:11.
PHA biosynthesis methods: phaB and phaC
3o A method for the preparation of polyhydroxyalkanoate may comprise: a) obtaining a cell comprising: a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a nucleic

-33-acid sequence encoding a PHA synthase protein; wherein: the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is not naturally found in the cell; the nucleic acid sequence encoding a PHA synthase protein is not naturally found in the cell; the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of: a nucleic s acid sequence at least about 80% identical to SEQ ID N0:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID N0:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID N0:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID
N0:9 as an antigen, the antibody being immunoreactive with SEQ ID N0:9; and the nucleic acid io sequence encoding a PHA synthase protein is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:11;
and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ
i s ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID
NO:11; and b) culturing the cell under conditions suitable for the preparation of polyhydroxyalkanoate. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein more preferably is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100%
identical to SEQ ID N0:8. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein may be Zo obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:9.
The nucleic acid sequence encoding a PHA synthase protein more preferably is at least about 82%, 84%, is 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID
NO:10. The nucleic acid sequence encoding a PHA synthase protein may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence encoding a PHA synthase protein preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100%
3o identical to SEQ ID NO:11. The cell may generally be any cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus,

-34-Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.
The s polyhydroxyalkanoate may be a homopolymer or copolymer. The polyhydroxyalkanoate may be a polyhydroxybutyrate, polyhydroxyvalerate, polyhydroxyhexanoate, polyhydroxyoctanoate, polyhydroxydecanoate, or copolymers thereof.
A method for the preparation of polyhydroxyalkanoate may comprise: a) obtaining a plant comprising: a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a to nucleic acid sequence encoding a PHA synthase protein; wherein: the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is not naturally found in the plant; the nucleic acid sequence encoding a PHA synthase protein is not naturally found in the plant;
the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID N0:8; a nucleic acid sequence is that hybridizes under stringent conditions to SEQ ID N0:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID N0:9;
and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ
ID N0:9 as an antigen, the antibody being immunoreactive with SEQ ID N0:9; and the nucleic acid sequence encoding a PHA synthase protein is selected from the group consisting of: a 2o nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:1 l; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ
ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11;
and b) zs growing the plant under conditions suitable for the preparation of polyhydroxyalkanoate. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein more preferably is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100%
identical to SEQ ID N0:8. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein may be obtained from a natural source, may be mutagenized, may be genetically engineered by 3o mutagenesis or other methods, or may be synthetic. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein preferably encodes a protein at least about 82%, 84%, 86%,

-35-88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:9.
The nucleic acid sequence encoding a PHA synthase protein more preferably is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID
NO:10. The nucleic acid sequence encoding a PHA synthase protein may be obtained from a natural source, s may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence encoding a PHA synthase protein preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100%
identical to SEQ ID NO:11. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, io peanut, sugarcane, switchgrass, or alfalfa plant. The polyhydroxyalkanoate may be a homopolymer or copolymer. The polyhydroxyalkanoate may be a polyhydroxybutyrate, polyhydroxyvalerate, polyhydroxyhexanoate; polyhydroxyoctanoate, polyhydroxydecanoate, or copolymers thereof.
PHA biosynthesis methods: ~haB
is A method for the preparation of polyhydroxyalkanoate may comprise: a) obtaining a cell comprising: a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a nucleic acid sequence encoding a PHA synthase protein; wherein: the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is not naturally found in the cell; the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting o~ a nucleic zo acid sequence at least about 80% identical to SEQ ID N0:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID N0:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID N0:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID
N0:9 as an antigen, the antibody being immunoreactive with SEQ ID N0:9; and b) culturing the Zs cell under conditions suitable for the preparation of polyhydroxyalkanoate.
The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein more preferably is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ
ID N0:8.
The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other 3o methods, or may be synthetic. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%,

-36-98%, 99%, 99.5%, or 100% identical to SEQ ID N0:9. The cell may generally be any cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is s preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.
The polyhydroxyalkanoate may be a homopolymer or copolymer. The polyhydroxyalkanoate may be a polyhydroxybutyrate, polyhydroxyvalerate, polyhydroxyhexanoate, polyhydroxyoctanoate, polyhydroxydecanoate, or copolymers thereof.
io A method for the preparation of polyhydroxyalkanoate may comprise: a) obtaining a plant comprising: a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a nucleic acid sequence encoding a PHA synthase protein; wherein: the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is not naturally found in the plant; the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of:
is a nucleic acid sequence at least about 80% identical to SEQ ID N0:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID N0:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID N0:9;
and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ
ID N0:9 as an antigen, the antibody being immunoreactive with SEQ ID N0:9; and b) growing Zo the plant under conditions suitable for the preparation of polyhydroxyalkanoate. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein more preferably is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ
ID N0:8.
The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other Zs methods, or may be synthetic. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID N0:9. The plant may generally be any plant, and preferably is a tobacco, wheat, potato, Arabidopsis, high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or 3o alfalfa plant. The polyhydroxyalkanoate may be a homopolymer or copolymer.
The

-37-polyhydroxyalkanoate may be a polyhydroxybutyrate, polyhydroxyvalerate, polyhydroxyhexanoate, polyhydroxyoctanoate, polyhydroxydecanoate, or copolymers thereof.
PHA biosynthesis methods: phaC
A method for the preparation of polyhydroxyalkanoate may comprise: a) obtaining a cell s comprising: a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a nucleic acid sequence encoding a PHA synthase protein; wherein: the nucleic acid sequence encoding a PHA synthase protein is not naturally found in the cell; the nucleic acid sequence encoding a PHA synthase protein is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent io conditions to SEQ ID NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11; and b) culturing the cell under conditions suitable for the preparation of polyhydroxyalkanoate. The nucleic acid sequence encoding a is PHA synthase protein more preferably is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid sequence encoding a PHA synthase protein may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence encoding a PHA synthase protein preferably encodes a protein at least Zo about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100%
identical to SEQ ID NO:11. The cell may generally be any cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, Zs potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.
The polyhydroxyalkanoate may be a homopolymer or copolymer. The polyhydroxyalkanoate may be a polyhydroxybutyrate, polyhydroxyvalerate, polyhydroxyhexanoate, polyhydroxyoctanoate, polyhydroxydecanoate, or copolymers thereof.
3o A method for the preparation of polyhydroxyalkanoate may comprise: a) obtaining a plant comprising: a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a

-38-nucleic acid sequence encoding a PHA synthase protein; wherein: the nucleic acid sequence encoding a PHA synthase protein is not naturally found in the plant; the nucleic acid sequence encoding a PHA synthase protein is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes s under stringent conditions to SEQ ID NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ
ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11; and b) growing the plant under conditions suitable for the preparation of polyhydroxyalkanoate. The nucleic acid sequence ~o encoding a PHA synthase protein more preferably is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid sequence encoding a PHA synthase protein may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence encoding a PHA synthase protein preferably encodes a is protein at least about 82% 84% 86% 88% 90% 92% 94% 96% 98% 99% 99.5% or 100%
> > > > > > > > > > >
identical to SEQ ID NO:11. The plant may generally be any plant, and preferably is a tobacco, wheat, potato, Arabidopsis, high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant.
The polyhydroxyalkanoate may be a homopolymer or copolymer. The polyhydroxyalkanoate may be zo a polyhydroxybutyrate, polyhydroxyvalerate, polyhydroxyhexanoate, polyhydroxyoctanoate, polyhydroxydecanoate, or copolymers thereof.
Methods for preparing higher polyhydroxyalkanoates Polyhydroxyalkanoate may be prepared by a method comprising: a) obtaining a recombinant host cell comprising: a nucleic acid sequence encoding a (3-ketothiolase protein; a zs nucleic acid sequence encoding a 3-ketoacyl-CoA reductase protein; a nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; a nucleic acid sequence encoding a (3-hydroxyacyl-CoA dehydrase; and a nucleic acid sequence encoding an acyl-CoA
dehydrogenase protein or an enoyl-CoA reductase protein; and b) culturing the recombinant host cell under conditions suitable for the preparation of polyhydroxyalkanoate; wherein: the 3o polyhydroxyalkanoate comprises C6, C8, or C10 monomer subunits; the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of: a nucleic

-39-acid sequence at least about 80% identical to SEQ ID N0:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID N0:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID N0:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID
s N0:9 as an antigen, the antibody being immunoreactive with SEQ ID N0:9.
Primers, probes, and antibodies The sequences disclosed in the sequence listing may also be used to prepare primers, probes, and monoclonal or polyclonal antibodies.
SEQ ID NOS:1, 2, 4, 6, 8, 10, 22, 24, 26, and 28, and the their complementary strands io may be used to design oligonucleotide primers and probes. Primers and probes are typically at least 15 nucleotides in length, and more preferably are at least 20, 22, 24, 26, 28, 30, 40, or 50 nucleotides in length. Contiguous nucleotide sequences from a given sequence are chosen based upon favorable hybridization conditions, including minimization of hairpin or other detrimental sequences. The identification of suitable primer or probe sequences is well known to those of is skill in the art, and is facilitated by commercially available software such as MacVector (Oxford Molecular Group) and Xprimer (http://alces.med.umn.edu/rawprimer.html).
Primers and probes may be used for the screening of libraries, for PCR amplification, and other routine molecular biological applications. Primers and probes may also be used for antisense applications.
SEQ ID NOS:3, 5, 7, 9, 11, 23, 25, 27, and 29 may be used for the generation of Zo monoclonal or polyclonal antibodies. The entire sequences may be used, or antigenic fragments thereof. Alternatively, portions of the full length sequences may be synthesized and covalently attached to antigenic proteins such as keyhole limpet hemocyanin (KLH).
Portions of the full length sequences may be used for the preparation of multi-antigenic peptides (52). The generation of monoclonal and polyclonal antibodies is well known to those of skill in the art.
Zs The following Examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate so that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

-40-EXAMPLES
Example 1: Bacterial strains and plasmids Table 1. Strains Strains Relevant characteristicsa Source or Reference E. coli deoR endAl gyrA96 hsdRl7 (r,; mk*) recAl relAlClontech DHSa supE44 thi-1 A~'(lacZYA-argFY169) ~80lacZ~EMIS F-~,-. Cloning host and for expression of pha genes B. Wild type, used to clone pha genes ATCC

megaterium B. phaP, -Q, -R, -B and -C deletion derivative This of B. megaterium megaterium 11561 Applicatio PHA05 n P. PHA positive control ATCC

oleovorans P. putida PHA negative mutant obtained by chemical mutagenesis(22) GPp 104

-41 -Table 2. Plasmids Plasmids Relevant characteristicsa Source or Referenc a pBluescriptIISCloning vector, ColEl oriV, Amp' Stratagen K a pGFPuv Source of gfp gene, ColEl oriV, Amp' Clontech pHPS9 Bacillus-Escherichia coli shuttle vector, ColEl(16) and pTA1060 oriV, Em', Cm' pSUP104 Pseudomonas-Escherichia coli shuttle vector, (40) Q-type and minil5 oriV, Em', Tc' pGM 1 EcoRI in phaP to HindIII in phaC, cloned into This the EcoRI-HindIII

sites of pBluescriptIISK, Amp' applicatio n pGM6 PstI in phaB to EcoRI in ykrM, cloned into This the PstI-EcoRI sites of pBluescriptIISK, Amp' applicatio n pGM7 EcoRI in phaP to EcoRI in ykrM, cloned into This the EcoRI site of pBluescriptIISK, Amp' applicatio n pGM9 HindIII upstream of ykoY to PstI in phaB, clonedThis into the HindIII -PstI sites of pBluescriptIISK, Amp' applicatio n pGMlO HindIII upstream of ykoYto EcoRI in ykrM, clonedThis into the HindIII -EcoRI sites of pBluescriptIISK, Amp' applicatio n pGM7H EcoRI in phaP to EcoRI in ykrM, cloned into This the EcoRI site of pHPS9, Cm' applicatio n pC/GFP2 PhaC::GFP out-of frame fusion plasmid. This Fragment shown in Figure 4A cloned in pBluescriptIISK,applicatio Amp' n pC/GFP3 PhaC::GFP in-frame fusion plasmid. This Fragment shown in Figure 4B cloned in pBluescriptIISK,applicatio Amp' n pGMl3 PhaC::GFP in-frame fusion plasmid. This Fragment shown in Figure 4C cloned in pHPS9, applicatio Em'Lm' n pGMl3C GFP localization control plasmid. Part of phaBThis and phaC deleted.

Fragment shown in Figure 4D cloned in pHPS9, applicatio Em'Lm' ' n pP/GFP3 PhaP::GFP in-frame fusion plasmid. This Fragment shown in Figure 4E cloned in pBluescriptIISK,applicatio Amp'

-42-n pGMl6.2 PhaP::GFP in-frame fusion plasmid. This Fragment shown in Figure 4F cloned in pHPS9, applicatio EmrLmr n pGM107 EcoRI in phaP to EcoRI in ykrM, cloned as a This BamHI-SaII

fragment from pGM7, into the BamHI and SaII applicatio sites of pSUP104, Cm~ n pDRl PstI in phaB to EcoRI in ykrM, cloned as a This SmaI-EcoRV fragment from pGM6 into the two DraI sites of pSUP 104 applicatio in same orientation as the Cm gene, with phaC expressedn from the Cm promoter, Tcr pGM61 Derived from pGMl3. It carries an in-frame This 594 by deletion in phaR, extending from 96 by upstream of the Applicati phaR initiation codon through codon 144. on pGM73 Derived from pGM61. Carries a transcriptional This fusion between the promoter of phaP and the coding region Applicati plus translation signals of phaR. A 663 by DNA fragment harboringon phaR was cloned into the SnaBI site in phaP in the sense orientation.

"P;m', erythromycin resistant; Lm', lincomycin resistant; Cm', chlorampheW col resistant; Amp', ampicillin resistant; Tc', Tetracycline resistant. bATCC, American Type Culture Collection.
Origin of replication.
Example 2: Media and growth conditions s Cultures were grown at 37°C (unless otherwise stated) in liquid media, aerated by rotation at 250 rpm in either Luria-Bertani (LB) broth (33) or M9 Minimal Salts (Life Technologies, Bethesda, MD) with 1 % (w/v) glucose. For growth on plates, the above media with 1.5% agar (Sigma, A4550) was used. For plasmid selections, the appropriate antibiotics were included in the media: ampicillin (200 ~g/mL [AMPZOO]), chloramphenicol (25 ~g/mL
io [CM25]), erythromycin (200 ~,g/mL [EM2°°]), or tetracycline (12.~ ~g/mL [TC12~']) for plasmid selection in Escherichia coli; chloramphenicol (12 ~g/mL [CM12]), or erythromycin (1 ~g/mL
[EM1]) plus lincomycin (25 ~.g/mL [LM25]) for plasmid selection in Bacillus megaterium;
chloramphenicol (160 ~g/mL [CMlbo]), or tetracycline (30 ~g/mL [TC3°]) for selection in Pseudomonas.
1 s Example 3 : Transformations Escherichia coli and Pseudomonas putida were transformed by electroporation of competent cells using an electroporator (Eppendorfj and following the manufacturers

- 43 -instructions. Bacillus megaterium was transformed using a biolistic transformation procedure (39).
Example 4: Microsco~y-For phase contrast microscopy, wet mounts of cultures were visualized at x1,000 s magnification in a light microscope with phase contrast attachments (Labophot-2 Microscope, Nikon, Inc.). To view PHA inclusion-bodies, samples were heat fixed, stained with 1 % (w/v) Nile Blue A (Sigma) for 15 minutes at 55°C, destained for 30 seconds in 8% (v/v) acetic acid, water washed, air dried, and viewed at x1000 magnification under fluorescence using filters;
excitation, 446/10 nm; barrier filter, 590 nm; dichroic mirror, 580 nm. To view GFP, wet Io mounts of cultures with or without 1% (w/v) agarose were viewed at x1000 magnification under fluorescence using filters; excitation, 390-450 nm; barrier filter, 480-520 nm; dichroic mirror, 470 nm.
Example 5: Codon usage in Bacillus megaterium Bacillus megaterium uses three codons as start codons in protein coding sequences.
~ s ATG, TTG, and GTG all encode methionine when present at the start of a coding region. TTG
and GTG encode leucine and valine when present within a coding region, respectively. Bacillus megaterium uses TGA, TAA, and TAG as stop codons.
Bacillus megaterium sequences starting with TTG or GTG may require mutagenesis to ATG if the sequences are to be expressed in organisms that use ATG exclusively as a start Zo codon.
Example 6: Set~aration of nolvneptides associated with PHA inclusion-bodies.
In an attempt to determine their relevance, proteins that co-purify with PHA
inclusion-bodies were separated by electrophoreses on an SDS-polyacrylamide gel (Figure 1 ).
Inclusion-bodies were purified (32) followed by suspension in TE buffer (10 mM
Tris-Zs HCl pH 8, 1 mM EDTA) with 2% (w/v) SDS. An equal volume of 2x sample buffer (100 mM
Tris-HCl (pH 6.8), 4% SDS, 4 mM EDTA, 20% glycerol, 2% 2-mercaptoethanol, 0.1%
bromophenol blue) was added prior to boiling for 5 minutes and samples were centrifuged for 3 minutes to pellet PHA; the supernatant was loaded on a 12% SDS-polyacrylamide gel and run at 8 mA overnight at 4°C to separate proteins. The gel was stained with Coomassie Blue for 5

-44-minutes prior to transfer of proteins to a polyvinylidene difluoride membrane using a semi-dry electroblotter at 400 mA for 45 minutes.
There were at least thirteen such proteins present in various quantities. Some or all of these proteins could be intrinsic structural components of PHA inclusion-bodies, enzymes s involved with PHA metabolism or possibly scaffolding components involved in inclusion-body assembly. Alternatively, they could have been acquired by the inclusion-bodies during the purification procedure. The three most abundant proteins had molecular weights of approximately 14, 20 and 41 kDa.
The N-terminal amino acid sequence for the three most prevalent proteins were io determined. Membrane carrying the proteins of interest was cut for use in N-terminal amino acid sequence determination by Edman Degradation using a minimum quantity of 200 pmols of each protein. The N-terminal amino acid sequence of the 14 kDa protein was KVFGRXELAAAMKRXGL (SEQ ID N0:19), the 20 kDa protein was NTVKYXTVIXAMXXQ (SEQ ID N0:20), and the 41 kDa proteins was AIPYVQEXEKL
i s (SEQ ID N0:21 ). A BLASTp search (( 1 ), performed with NCBI Entrez database;
http://www.ncbi.nlm.nih.gov/Entrezn revealed that the 14 kDa protein was lysozyme and the other two N-terminal sequences were novel. It was concluded that the lysozyme used in the cell lysis procedure had co-purified with the PHA inclusion bodies. This result confirms that not necessarily all of the proteins that co-purify with PHA inclusion-bodies are associated with them Zo in vivo, as was also shown for Chromatium vinosum (27).
Example 7: Cloning the pha re ion Purification of genomic and plasmid DNA, Southern blot, hybridization and cloning were by standard procedures (38). To clone the DNA sequences that coded for the two most abundant proteins on purified PHA inclusion-bodies, degenerate oligonucleotide probes based on their N-Zs terminal amino acid sequences were used. The probes were:
AAYACRGTNAAATAYNNNACRGTNATYNNNGCDATGATG (n2, SEQ ID N0:12) and GCDATYCCDTAYGTNCARGAAGGHTTYAAA (n5, SEQ ID N0:13) for the 20 kDa and 41 kDa proteins, respectively (Figure 1 ).
Both probes, used in separate 38°C Southern blotting hybridization experiments, 3o identified a 6.4 kb HindIII, a 5.2 kb EcoRI, and a 3.7 kb HindIII to EcoRI
DNA fragment of

- 45 -DNA, indicating that the 5' ends of the coding regions for both of these proteins were located less than 3.7 kb apart in the genome. The three fragments were purified from agarose following electrophoresis, and cloned into plasmid pBluescriptIISK.
Positive clones were identified by hybridization to the same degenerate probes, thus s yielding plasmid pGMl containing the 3.7 kb fragment. Sequences contiguous with and overlapping this primary cloned fragment were cloned in a similar manner except that probes based on the ends of the sequenced DNA fragment were used, and hybridization was performed at 55°C. The probes used were GCTTCATGCGTGCGGTTTG (bmp, SEQ ID N0:14) and GGACCGTTCGGAAAATCAGCGG (bmc, SEQ ID NO:15), yielding respectively, pGM9 and io pGM6 (Figure 2).
DNA fragments of pGMl, pGM6 and pGM9 were subcloned into pBluescriptIISK, and sequenced, from both ends using universal primers and internally by primer walking on both strands, using dye terminator chemistry, cycle sequencing and an ABI Prism 377 sequencer (Applied Biosystems). Sequence assembly and analysis was performed using Lasergene Is (DNAStar, Inc.), and Gapped BLAST and PSI BLAST (1).
The 3.7 kb fragment contained 5 ORFs (Figure 2), whose predicted amino acid sequences encode PhaP (20 kDa protein), PhaQ, PhaR, PhaB and PhaC (41 kDa protein). The 20 and 41 kDa proteins were identified by their N-terminal amino acid sequences. Since the C-terminus for each of these two proteins extended beyond the boundaries of pGMI, the remaining sequence Zo were obtained from plasmids pGM6 and pGM9.
Example 8: The pha locus.
The 7,916 by region (SEQ ID NO:1) containing pha genes from Bacillus megaterium was cloned, sequenced and characterized. It was shown to carry 8 complete and 1 incomplete open reading frame (Figure 2, Tables 3 and 4). Coding sequences in this region were assigned Zs on the basis of homology to known sequences, N-terminal amino acid sequences, putative ribosome binding sites and operon location. The complement and arrangement of genes flanking the pha genes in Bacillus megaterium are very similar to a region of Bacillus subtilis 168 (Figure 2). This strain is negative for PHA and no known pha genes or sequences occur in its genome, for which the complete sequence is available (24). In place of pha genes in this region of B.

-46-subtilis are ykrl, ykrK and ykrL, which, respectively, code for putative proteins similar to two unknown proteins, and a probable heat shock protein.
Table 3: Sequence analysis results Sequence Number of amino Mol mass DaltonsIsoelectric acids point ykoY 271 29,996 6.89 ykoZ 236 27,662 9.36 sspD 65 7,027 8.58 phaP 170 19,906 5.29 phaQ 146 16,686 5.09 phaR 168 19,150 5.10 phaB 247 26,098 7.39 phaC 362 41,463 8.31 ---ykrM 318a ND ND

aPartial protein.

-47-Table 4: Sequence homologies Sequen Homologies to known IdentitSimilaritFunction or putative and function ce putative genes (accessiony y n0.) a ykoY YkoY, B. subtilis 64% 73% Toxic anion resistance (Z99110) protein (24) ykoZ YkoZ, B. subtilis 57% 74% RNA polymerase sigma (Z99111 ) factor (24) sspD SspD, Bacillus 100% Spore specific, DNA
binding megaterium (P10572) protein (4, 10) SspD, B. subtilis 73% 87%
(P04833) phaP None PHA inclusion-body structure, shape and size (49) phaQ None Unknown phaR None Unknown phaB FabG, Synechocystis 50% 66% Fatty acid biosynthesis (23) (D90907) 48% 64% 3-ketoacyl-CoA reductase PhaB, C. vinosum 47% 67% (28) D

(P45375) Fatty acid biosynthesis (35) FabG, B. subtilis (P51831) phaC PhaC, T violacea 38% 59% PHA synthase (29, 23, 28) (P45366) 37% 56%

PhaC, Synechocystis 35% 55%

(D90906) PhaC, C. vinosum (P45370) ykrM YkrM, B. subtilis 55% 71% Na'~-transporting ATP

(Z99111 ) synthase (24) °Accession numbers are SWISS-PROT, EMBL or DDBJ; None, No discernible similarity to known sequences.
Example 9: The pha nucleic acid and encoded protein sequences s The deduced amino acid sequence of PhaP shows a 20 kDa extremely hydrophilic product with no obvious similarity to known sequences (Figure 6). Inclusion-body associated low molecular weight proteins (phasins) have been described in many bacteria (49), but where sequences were available no similarities of identifiable significance with PhaP of Bacillus megaterium were found.
io Low molecular weight, PHA inclusion-body abundant proteins play an important role in PHA producing cells, since they are involved in determining inclusion-body size and shape, and are present in quantities up to 5% of total protein in the case of PHA
producing A. eutrophus

-48-(48). It is an interesting observation that the amino acid sequences of phasin proteins are so dissimilar, even in closely related bacteria. Some similarity between such proteins would be expected in closely related bacteria, were they to have a role in inclusion-body biogenesis, however, conservation of sequence would be entirely unnecessary should they have a role as s storage proteins.
The deduced amino acid sequences of PhaQ and PhaR also revealed small hydrophilic proteins with no significant identifiable similarity to known proteins (Figures 7 and 8). Figure 1 (lane 2) shows that purified inclusion-bodies have proteins represented by bands of the approximate sizes of PhaQ (17 kDa) and PhaR (19 kDa), but the roles of these proteins are to unknown. They may be non-orthologous replacements for the small putative gene products, whose roles are also unknown, coded in known pha gene clusters. The deduced amino acid sequence of PhaB, is similar in size and amino acid sequence to known phaB and fabG gene products (Table 2). The deduced amino acid sequence of PhaC shows that while it has low homology overall to known PhaC proteins, it is most similar to that of T.
violacea, Synechocystis is and C. vinosum. PhaC proteins from these three bacterial strains, respectively, have 355, 378, and 355 amino acids while PhaC from Bacillus megaterium has 362 amino acids.
All other PhaC proteins studied are larger in size, and range from 559 amino acids for that of P.
oleovorans (22) to 636 amino acids for that of Rhizobium etli (3). Alignment studies of sequences of all previously known PhaC proteins show that the synthases are either large single zo subunit enzymes (PhaC) or smaller two subunit enzymes (PhaC and PhaE). The Bacillus megaterium PhaC protein aligns poorly with large, single subunit enzymes such as the P.
oleovorans PhaC (Figure 3).
Example 10: Functionality of the pha gene cluster It has been demonstrated that the phaP, -Q, -R, -B and -C gene cluster can complement a zs deletion mutant of B. megaterium. This mutant PHA05 was constructed by a gene substitution technique. A plasmid (based on pGMlO) in which the pha genes were substituted by the erythromycin gene, was propagated in B. megaterium 11561. Selection on erythromycin allowed isolation of the PHA05 mutant that was negative for PHA synthesis.
Complementation with the phaP, -Q, -R, -B and -C gene cluster was obtained when pGM7H or pGMl3 was introduced into 30 the PHA05 strain.

-49-Experiments introducing a phaR deletion of pGM 13 (pGM61 ) into PHA05 suggests that the presence of phaR may be preferred for PHA synthesis. This result was confirmed by the recloning of phaR into pGM61 (pGM73) as it was isolated from PHA05(pGM61) strain, followed by the introduction of pGM73 into PHA05. Accumulation of PHA in PHA05(pGM73) s confirmed the preference for phaR. It has been previously demonstrated that the small type PhaCs (see Example 17) is not sufficient for PHA synthesis; another peptide, PhaE of approximate size 30 kDa, is also required (51). These complementation studies suggest that it is preferable to combine PhaC of B. megaterium (also a small type PhaC) and phaR
(19 kDa), however there is no sequence similarity between phaR of B. megaterium and phaE
of other io organisms.
Example 11: Mapp~ transcription starts The transcription start points were mapped in the region from the EcoRl restriction site in phaP to the HindIII site in ykrM by primer extension analysis, using the Promega system for primer extension on RNA templates. DNA oligonucleotide primers, 17 to 20 nucleotides in is length, were synthesized to match target sequences, initially at approximately 500 base pair intervals and subsequently at about 50 to 250 nucleotides down-stream from the predicted transcription start points. The 32P 5' end-labeled primers were extended with reverse transcriptase using total RNA (10 ~g per reaction) purified from Bacillus megaterium (31). The fragment length initially, and transcription start nucleotides subsequently, were determined by zo running the cDNA on a 8% denaturing polyacrylamide gel along-side the products of sequencing reactions, which were generated using the same 5'-end labeled primers. The primers used to identify the transcription start nucleotides for the phaP, phaQ, and phaRBC
promoters were, respectively, CCCCTTTGTCCATTGTTCCC (SEQ ID N0:16); CCATGTAGATTCCACCCTC
(SEQ ID N0:17); and CTCCATCTCCTTTCTTGTG (SEQ ID N0:18).
zs Primer extension products showed a single band from each reaction, indicating one transcript, while control reactions in which RNA was omitted showed no bands.
The extension products run alongside sequencing reaction products obtained with the same primer (Figure 2C), identified the 5' ends of the transcripts thus allowing the putative promoter sequences at approximately -10 and -35 -by for phaP, -Q and -R to be identified. The arrangement of genes in 3o the pha cluster of Bacillus megaterium is unique among those already published and phaA is

-50-notably absent. The phaP, -Q, -R, -B and -C genes were shown to be in a 4,104 -by region, with phaP and -Q transcribed in one orientation, each from a separate promoter, while phaR, -B and -C were divergently transcribed from a promoter in front of phaR. The putative promoters responsible for transcription of phaQ and phaR, phaB and phaC show strong similarity to both s Bacillus subtilis Sigma A type (34) and Escherichia coli, Sigma 70 type promoters (14), which can express constitutively. This is in keeping with previous data for Alcaligenes eutrophus showing that phaC is constitutively synthesized, but PHA is not constitutively accumulated (19).
The third putative promoter in this region, the phaP promoter, resembles a Sigma D (SigD) type promoter known to control the expression of a regulon of genes associated with flagellar io assembly, chemotaxis and motility (13, 20, 46). In Bacillus subtilis Sigma D is expressed in the exponential phase and peaks in late exponential phase of growth. This parallels the pattern of PHA accumulation previously described for Bacillus megaterium 11561 (32).
However, further experiments are required to test the hypothesis that PHA accumulation in regulated by sigma D
or products of its resulting transcripts. The phaP gene has 18 -by duplicate sequences that could ~s base-pair to form a rho-independent terminator close to its translational stop codon (Figure 2B).
The fact that the -35 promoter region of sspD is within this putative hairpin structure, suggests that transcription of phaP and sspD could be mutually exclusive, thus allowing the expression of phaP to play a regulatory role in the expression of sspD (spore specific storage protein).
Example 12~ Expression of Bacillus megaterium pha genes in Escherichia coli and Pseudomonas 2o up tidy Functionality of the Bacillus megaterium putative pha gene cluster was tested in Escherichia coli, which is naturally PHA negative, and Pseudomonas putida GPp104, a phaC-mutant. Plasmids carrying one or more of these genes were introduced and the resulting transformants were tested for PHA accumulation following growth on LB or M9 medium with is various carbon sources and the appropriate antibiotic for plasmid selection.
Triplicate 500 mL cultures, were grown in 2 liter flasks at 30°C, rotating at 250, using 1 % inocula of 16 hour cultures, which had been grown in LB, centrifuged and resuspended in equal volumes of 0.9% saline. At 48 hours samples were removed for microscopy and cells were harvested, washed once in dH20 and lyophilized. For PHA extraction, lyophilized cells were so suspended in 10 volumes of 5% (w/v) bleach, shaken at 65°C for 1 hour and centrifuged. The pellet was resuspended in 10 volumes of 5% bleach and centrifuged followed by sequentially

-51 -washing in water and 95% ethanol. The amount of PHA is expressed as percent PHA per mass of vacuum dried cells (w/w).
Escherichia coli carrying pGM7 or pGMlO accumulated low levels of PHA while Escherichia coli carrying pGMI or pGM6 accumulated no PHA. Fluorescence microscopy of s Nile Blue A stained cells showed approximately 1 cell in 20 had one or several inclusion-bodies and the quantity of PHA produced was approximately 5% of cell dry weight.
Since Escherichia coli does not have PhaA, a low level or no PHA is the expected result.
However, in Pseudomonas where PhaA is not known to be required, Pseudomonas putida GPp104 (pGM107) accumulated PHA on rich as well as minimal medium with various carbon sources to >50% of io cell dry weight, and 90 to 100% of cells appeared full of PHA (Table 5).
The positive control P.
oleovorans, (equivalent to wild-type Pseudomonas putida) accumulated PHA only when grown on longer chain carbon sources, and not on LB. No PHA was accumulated by the negative control or by Pseudomonas putida carrying phaC alone (pDRI ). These results showed that this Bacillus megaterium gene cluster is functional in both Escherichia coli and Pseudomonas putida.
is It is not known if the negative results obtained with pDRI was due to PhaC
alone being insufficient to complement PhaC- Pseudomonas putida or to synthesize PHA in Escherichia coli, or if the expression of phaC on pDRI was not successful in producing protein.

-52-Table 5: Cells with PHA as a percents of total cells following growth on different carbon sources Substrates Source Positive Negative phaP"QRBC phaC:
of (no. C atoms)genes: control: control, vector only:

Bacillus P. PseudomonaPseudomona Pseudomona megateriumoleovoranss putida s putida s putida GPp 104 GPp 104 GPp 104 (pSUP 104)(pGM 107) (pDRI ) LB/Glucose,100 0 0 92 0 1%

M9/Caproate,no growth 88 0 100* 0 12 mM (C6) M9/Octanoatno growth 90 0 92 0 e, 12 mM

(C8) 100%, PHA in all cells; 0%, no PHA in any cell; data averaged from >5 fields of each of 3 different cultures, error less than 5%. °N-terminus only present. *
Cell shape distorted by large s quantity of PHA.
These results suggest that the B. megaterium gene cluster, phaP, -Q, -R, -B, and -C, is functional in both E. coli and P. putida in so far as accumulation of PHA
polymer. It is not known if the negative results obtained with pDRl were due to PhaC alone being insufficient to complement the PhaC mutant of P. putida or to synthesize PHA in E. coli.
~o Example 13: Localization of PhaP and PhaC proteins Proteins associated with purified PHA inclusion-bodies may not accurately reflect the localization of the these proteins within the growing cell. Visualization of pha:: gfp gene product fusion proteins in living cells throughout culture growth is a useful method for determining both the localization of the pha gene products and their comparative levels in growing cells. PhaP
is and PhaC, as fusion proteins (Figure 4), localized to PHA inclusion-bodies at all time points tested throughout growth of Bacillus megaterium 11561. The negative control (pHPS9) showed no fluorescence at any time point. The localization control (pGMl3C) showed non-localized green fluorescence at all time points. The profiles of PHA accumulation in these two control strains were similar to that of the wild-type, where the quantity of PHA
decreased during the lag ao phase, increased during exponential phase, and continued to increase at a lower steady state rate in stationary phase growth (32).

-53-At time 0, cultures of Bacillus megaterium carrying, pGM16.2, pGMl3, pGMl3C or pHPS9, grown in LB with LM25 EMl for 24 hours at 35°C, were inoculated (5% v/v) into 75 mL
of fresh media of the same composition, in 300 mL Naphelco flasks, and growth was continued at 27°C, 250 rpm. Optical densities of cultures were monitored and samples were removed for s microscopy at time points starting at time 0, for up to 24 hours. One part of each sample was immediately observed for green fluorescence by embedding in 1 % low melting point agarose for viewing in phase contrast and under fluorescence for GFP, magnification x1000.
Another part of each sample was stained for PHA and viewed under light microscopy and by fluorescence for PHA inclusion bodies, magnification x1000. Images were recorded using identical parameters ~o for all samples to allow comparison of fluorescence and light intensities (f stop, 1/15; brightness, 0.6; sharpness, 1.0; contrast, 0.8; color, 0.3; see also methods and materials). Results are shown in Figure 5 (A-F).
PhaP, monitored as a PhaP::GFP fusion protein in pGM16.2 (Figures SA and SB), decreased significantly during the first half (2 hours) of lag phase growth, increased during late is lag phase and early to mid-exponential phase, decreased in mid to late exponential phase and increased during stationary phase growth. A possible explanation for the rapid decrease of PhaP
in lag phase is that PhaP may be a storage protein that is degraded as a source of amino acids.
The profile of PHA accumulation in these cells (carrying pGM16.2) followed a similar pattern to that of PhaP except that PHA decreased only in the lag phase and continued to accumulate Zo throughout other phases of culture growth. This data is consistent with PHA
inclusion-bodies being a source of carbon, reducing equivalents and amino acids when the organism is first provided with fresh medium. Possible explanations as to why the level of PhaP
and not PHA
decreased at mid to late exponential phase are that either PhaP was synthesized at a slower rate than that of PHA, or PhaP was used as a source of amino acids at this phase of growth or both Zs scenarios may apply.
PhaC, monitored as a PhaC::GFP fusion protein in pGMl3 showed a similar profile of expression to that of PhaP with one exception: PhaC did not reduce in level during lag phase growth. It did, however, reduce in level in mid to late exponential phase growth, as did PhaP.
The profile of PHA accumulation in these cells carrying PhaC::GFP was similar to that of cells 3o carrying PhaP::GFP, except that the PHA level did not reduce during lag phase growth. The increased quantity of PhaC in the cell is a likely explanation since PhaC
remained functional in

-54-the fusion protein PhaC::GFP. This was indicated by the fact that Escherichia coli DHSa (pC/GFP3) and Escherichia coli DHSa (pGM7) accumulated PHA to equivalent low levels, while the host strain alone, or carrying pGFPuv accumulated no PHA, as visualized by fluorescence microscopy of Nile Blue A stained cells. The reduction in level of PhaC in mid to s late exponential phase, as was also seen with PhaP, is consistent with both PhaC and PhaP being synthesized at a slower rate than that of PHA.
In cells of all growth phases, inclusion-bodies were rarely visible under light in stained heat fixed cells while larger inclusion-bodies were visible in phase contrast of living cells (Figure SC-F). In older cultures (2 days and older) some cells were lysed, and showed PhaP::GFP and Io PhaC::GFP localized to free PHA inclusion-bodies (Figure SD). Both free and intracellular inclusion-bodies had doughnut shaped localization of GFP at some focal planes while at other focal planes the same inclusion-bodies appeared completely covered in GFP. We interpret this data as a difference in quantity of GFP that is visible when viewed through the edge or the center of the inclusion-bodies.
is Example 14~ Analysis of Bacillus megaterium 3-ketoacyl-CoA reductase PhaB
Stereospecificity assays were conducted on the Bacillus megaterium reductase using various chain length enoyl-CoA esters (C4-C8, Table 6). The assay was done using crotonase from Sigma (L-hydroxy acids) or hydratase from Rhodosprillum rubrum (D-hydroxy acids) to form the 3-hydroxyacyl-CoA compounds from the enoyl-CoA esters. Acetoacetyl-CoA reductase Zo activity was monitored spectrophotometrically as the reduction of NADP+
while 3-hydroxyacyl-CoAs were oxidized. Based on the assay results (Table 6) the Bacillus megaterium reductase is a D-specific enzyme with a preference for C6 carbon chains. Enzyme reactions using NADH as electron donor for 3-ketoacyl-CoA reduction did not indicate significant enzyme activity with this cofactor.

-55-Table 6: Analysis for stereo-specificity of the Bacillus megaterium 3-ketoacyl-CoA reductase.
Clone D-stereoisomerSpec. Clone L-stereoisomerSpec. act.
#a (hydratase)act. # (crotonase) U/mg U/mg B1-30 Crotonyl 0.155 B1-30 Crotonyl CoA 0.014 CoA

B1-30 C5 0.15 Bl-30 C5 0.009 B1-30 C6 0.39 B1-30 C6 0.017 B1-30 C8 0.014 B1-30 C8 0.039 B5-20 Crotonyl 0.077 B5-20 Crotonyl CoA 0.004 CoA

B5-20 C5 0.074 B5-20 C5 0.01 B5-20 C6 0.219 B5-20 C6 0.012 B5-20 C8 0.003 B5-20 C8 0.001 NegativeCrotonyl 0.02 NegativeCrotonyl CoA 0.001 CoA

NegativeCS 0.011 NegativeC5 0.003 NegativeC6 0.006 NegativeC6 0.008 NegativeC8 0.033 NegativeC8 0.003 Clone B1-30 contains pMUN48213; clone >35-~u contains pmmv4a~m.
Example 15~ Verification of the Bacillus megaterium 3-ketoacvl-CoA reductase for PHA
an~mmWatW n s The functionality of the Bacillus megaterium sequence for PHA accumulation in a recombinant system was assayed. Escherichia coli DHSa harboring either pMON48222 (phaARe, phaBBm, phaCRe) only, or two of the following plasmids: pJM9238 DAB
(phaA and phaB deleted by FseI digest and religation) or pJM9117 DAB (phaA and phaB
deleted by FseI
digest and religation) and pMON48220 (phaARe, phaBBm,) was grown in LB +
mannitol in ~o concentrations of 1 or 2 % (w/v), respectively. Cultures were induced for PHA accumulation at OD6oo = 0.6. Percentage PHA (Table 7) and enzyme activity (Table 8) were determined.
Plasmid pMON48213 contains the same pha sequences as pMON48220, but was constructed with pSE380 (Invitrogen, Carlsbad, CA), a high level expression vector.
Plasmid pMON48221 contains the same pha sequences as pMON48220, but lacks a small fragment of the multicloning i s site between phaARe and phaBBm.
3-Ketoacyl-CoA reductase was monitored in a total volume of 1 mL containing 100 mM
potassium phosphate buffer pH 7.0, 50 ~.M acetoacetyl-CoA and 150 ~M NADPH.
The reaction mixture contained between 5 and 50 pL cell extract. Assays were monitored spectrophotometrically at 340 nm.

-56-Table 7: Application of the Bacillus megaterium 3-ketoacyl-CoA reductase for PHA formation in Escherichia coli Vectors % PHA Standard deviation pMON48222-4 12.9 pMON48222-8 19.2 Average16.1 ~ 4.5 pJM9238 pMON 48220 23.7 pJM9238 pMON48220 18.9 DAB

Average21.3 ~ 3.4 pJM9238 Average1.5 ~ 1.5 DAB

pJM9117 pMON 48220 12.5 DAB

pJM9117 pMON48220 3.9 DAB

Average8.2 ~ 6.1 pJM9117 Average0.7 ~ 0.1 DAB

Table 8: Enzyme activity of the Bacillus megaterium 3-ketoacyl-CoA reductase using pMON48220 and pMON48213 Vector acetoacetyl-CoA reductase[U/mg]

Negative control 0.08 pMON48220-2 0.24 0.15 pMON48220-9 0.22 0.23 Average 0.21 0.04 pMON48213 4.0 Table 9: Verification of the Bacillus megaterium 3-ketoacyl-CoA reductase functionality

-57-E. coli DHSa containing Relevant genotype PHB content %
plasmids CDW

pJM92380AB, pMON34610 phaCRe nd pJM9238~AB, pMON34575 phaCRe, phaARe 1.2 ~ 0.4 pJM92380AB, pMON48221 phaCRe, phaARe, phaBB~"22.2 ~ 4.7 nd = not detectable Example 16: Additional sequences in ~enomic fragment The 7,916 base pair genomic fragment (SEQ ID NO: l ) additionally contained three complete open reading frames and one incomplete open reading frame encoding proteins in s addition to PhaP, PhaQ, PhaR, PhaB, and PhaC. As indicated in Tables 3 and 4, sequence comparisons suggest that ykoY (SEQ ID N0:22) encodes toxic anion resistance protein YkoY
(SEQ ID N0:23), ykoZ (SEQ ID N0:24) encodes RNA polymerase sigma factor protein YkoZ
(SEQ ID N0:25), and ykrM (SEQ ID N0:26) encodes a portion of the Na+ -transporting ATP
synthase protein YkrM (SEQ ID N0:27). Sequence sspD (SEQ ID N0:28) matches the known io Bacillus megaterium sequence (4, 10) encoding SspD (SEQ ID N0:29). While the activity of the proteins is identified by their similarity to other known proteins, it is possible that the proteins may have additional functionality involved in polyhydroxyalkanoate biosynthesis.
These nucleic acid and amino acid sequences may be used in nucleic acid segments, recombinant vectors, transgenic host cells, and transgenic plants.
~ a Example 17: One and two subunit PHA synthase proteins PHA synthases have been identified to be either one or two subunit enzymes (51). Single subunit enzymes have only the PhaC protein, while two subunit enzymes have PhaC and PhaE
protein subunits. Nucleic acid sequences encoding PhaE subunits have been found to be located adjacent to the nucleic acid sequences encoding PhaC.

-58-Table 10: One and two subunit PHA synthases Source organism (Reference) Subunits PhaC Amino acids T. violacea (P45366, D48376)2 355 C. vinosum (P45370, 529274) 2 355 T. pfennigii (WO 96/08566) 2 357 Synechocystis sp. PCC6803 2 378 (50, D90906, 577327) P. oleovorans (22, A38604) 1 559 P. aeruginosa (S29305) 1 559 R. Tuber (S25725) 1 562 R. eutropha (A34371 ) 1 589 A. caviae (D88825) 1 594 P. denitrificans (JC6023) 1 624 R. etli (3, U30612) 1 636 B. megaterium (SEQ ID NO:11) 362 Based on the number of amino acids in the deduced sequence and homology to known PhaC proteins, the B. megaterium would be expected to be part of a two subunit synthase.
However, the nucleic acid sequences adjacent to phaC in the 7,916 base pair genomic fragment s show no significant similarity to a phaE sequence. Upstream of phaC is phaB, and downstream is ykrM, a suspected Na+ transporting ATP synthase (Table 4). In combination with the observation that the B. megaterium sequences were able to complement P. putida GPp104 to accumulate PHA, this suggests that the B. megaterium phaC may encode a novel class of PHA
synthase, i.e. a single subunit synthase with a molecular weight in the range of two subunit PhaC
to proteins.
Example 18: Pathway for the~roduction of C4/C6/C8/C 10 PHA copolymers Figure 10 outlines a proposed biosynthetic pathway for the production of PHA
copolymers incorporating C4 and/or C6 monomer units. Produced polymers may include C4-co-C6, C4-co-C8, C4-co-C6-co-C8, C6-co-C8, C6, and C8. A recombinant host cell or plant may is be constructed to contain the nucleic acid sequences encoding the required enzymes.
The ~3-ketothiolase is preferably BktB (53, WO 98/00557). The ~3-ketothiolase can condense two molecules of acetyl-CoA to form acetoacetyl-CoA. This product may be reduced to 3HB-CoA by the Bacillus megaterium 3-keto-acyl-CoA reductase protein. 3HB-CoA may be

-59-converted to crotonyl-CoA by a hydratase such as that from Aeromonas caviae (54). Subsequent reduction to butyryl-CoA is performed by a butyryl-CoA dehydrogenase such as that cloned from Clostridium acetobutylicum (55). This product may be condensed with acetyl-CoA by the (3-ketothiolase to afford 3-ketohexanoyl-CoA. This is the preferred substrate of the Bacillus s megaterium reductase, leading to the production of 3-hydroxyhexanoyl-CoA.
This product may be incorporated into C6 polymers or copolymers (e.g. C4-co-C6) by a PHA
synthase having a broad substrate specificity (e.g. (56)). An additional round of condensation may lead to production of the C8 monomer, allowing the introduction of C8 into PHA
polymers or copolymers. A further additional round of condensation may lead to production of the C 10 ~o monomer, allowing the introduction of C10 into PHA polymers or copolymers.
Example 19: Nucleic acid mutation and hybridization Variations in the nucleic acid sequence encoding a protein may lead to mutant protein sequences that display equivalent or superior enzymatic characteristics when compared to the sequences disclosed herein. This invention accordingly encompasses nucleic acid sequences is which are similar to the sequences disclosed herein, protein sequences which are similar to the sequences disclosed herein, and the nucleic acid sequences that encode them.
Mutations may include deletions, insertions, truncations, substitutions, fusions, shuffling of subunit sequences, and the like.
Mutations to a nucleic acid sequence may be introduced in either a specific or random Zo manner, both of which are well known to those of skill in the art of molecular biology. A myriad of site-directed mutagenesis techniques exist, typically using oligonucleotides to introduce mutations at specific locations in a nucleic acid sequence. Examples include single strand rescue (Kunkel, T. Proc. Natl. Acad. Sci. U.S.A., 82: 488-492, 1985), unique site elimination (Deng and Nickloff, Anal. Biochem. 200: 81, 1992), nick protection (Vandeyar, et al.
Gene 65: 129-133, zs 1988), and PCR (Costa, et al. Methods Mol. Biol. 57: 31-44, 1996). Random or non-specific mutations may be generated by chemical agents (for a general review, see Singer and Kusmierek, Ann. Rev. Biochem. 52: 655-693, 1982) such as nitrosoguanidine (Cerda-Olmedo et al., J. Mol.
Biol. 33: 705-719, 1968; Guerola, et al. Nature New Biol. 230: 122-125, 1971 ) and 2-aminopurine (Rogan and Bessman, J. Bacteriol. 103: 622-633, 1970), or by biological methods 3o such as passage through mutator strains (Greener et al. Mol. Biotechnol. 7:
189-195, 1997).

-60-Nucleic acid hybridization is a technique well known to those of skill in the art of DNA
manipulation. The hybridization properties of a given pair of nucleic acids is an indication of their similarity or identity. Mutated nucleic acid sequences may be selected for their similarity to the disclosed nucleic acid sequences on the basis of their hybridization to the disclosed s sequences. Low stringency conditions may be used to select sequences with multiple mutations.
One may wish to employ conditions such as about 0.15 M to about 0.9 M sodium chloride, at temperatures ranging from about 20°C to about 55°C. High stringency conditions may be used to select for nucleic acid sequences with higher degrees of identity to the disclosed sequences.
Conditions employed may include about 0.02 M to about 0.15 M sodium chloride, about 0.5% to ~o about 5% casein, about 0.02% SDS and/or about 0.1% N-laurylsarcosine, about 0.001 M to about 0.03 M sodium citrate, at temperatures between about 50°C and about 70°C. More preferably, high stringency conditions are 0.02 M sodium chloride, 0.5%
casein, 0.02% SDS, 0.001 M sodium citrate, at a temperature of 50°C.
Example 20: Determination of homologous and degenerate nucleic acid seguences ~s Modification and changes may be made in the sequence of the proteins of the present invention and the nucleic acid segments which encode them and still obtain a functional molecule that encodes a protein with desirable properties. The following is a discussion based upon changing the amino acid sequence of a protein to create an equivalent, or possibly an improved, second-generation molecule. The amino acid changes may be achieved by changing zo the codons of the nucleic acid sequence, according to the codons given in Table 11.

-61 -Table 11: Codon degeneracies of amino acids I Ammo acid One letterThree letter Codons Alanine A Ala GCA GCC GCG GCT

Cysteine C Cys TGC TGT

Aspartic acidD Asp GAC GAT

Glutamic acidE Glu GAA GAG

PhenylalanineF Phe TTC TTT

Glycine G Gly GGA GGC GGG GGT

Histidine H His CAC CAT

Isoleucine I Ile ATA ATC ATT

Lysine K Lys AAA AAG

Leucine L Leu TTA TTG CTA
CTC
CTG
CTT

Methionine M Met ATG

Asparagine N Asn AAC AAT

Proline P Pro CCA CCC CCG CCT

Glutamine Q Gln CAA CAG

Arginine R Arg AGA AGG CGA CGC CGG CGT

Serine S Ser AGC AGT TCA TCC TCG TCT

Threonine T Thr ACA ACC ACG ACT

Valine V Val GTA GTC GTG
GTT

Tryptophan W Trp TGG

Tyrosine Y Tyr TAC TAT I

Certain amino acids may be substituted for other amino acids in a protein sequence without appreciable loss of enzymatic activity. It is thus contemplated that various changes may be made in the peptide sequences of the disclosed protein sequences, or their corresponding s nucleic acid sequences without appreciable loss of the biological activity.
In making such changes, the hydropathic index of amino acids may be considered. The importance of the hydropathic amino acid index in conferring interactive biological function on a protein is generally understood in the art (Kyte and Doolittle, J. Mol. Biol., 157: 105-132, 1982).
It is accepted that the relative hydropathic character of the amino acid contributes to the io secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like.
Each amino acid has been assigned a hydropathic index on the basis of their hydrophobicity and charge characteristics. These are: isoleucine (+4.5);
valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9);
alanine (+1.8); glycine

-62-(-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3);
proline (-1.6); histidine (-3.2); glutamate/glutamine/aspartate/asparagine (-3.5); lysine (-3.9); and arginine (-4.5).
It is known in the art that certain amino acids may be substituted by other amino acids having a similar hydropathic index or score and still result in a protein with similar biological s activity, i.e., still obtain a biologically functional protein. In making such changes, the substitution of amino acids whose hydropathic indices are within ~2 is preferred, those within ~1 are more preferred, and those within ~0.5 are most preferred.
It is also understood in the art that the substitution of like amino acids may be made effectively on the basis of hydrophilicity. U.S. Patent No. 4,554,101 (Hopp, T.P., issued io November 19, 1985) states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the protein. The following hydrophilicity values have been assigned to amino acids: arginine/lysine (+3.0); aspartate/glutamate (+3.0 ~1); serine (+0.3); asparagine/glutamine (+0.2); glycine (0);
threonine (-0.4); proline (-0.5 ~1); alanine/histidine (-0.5); cysteine (-1.0); methionine (-1.3);
is valine (-1.5); leucine/isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); and tryptophan (-3.4).
It is understood that an amino acid may be substituted by another amino acid having a similar hydrophilicity score and still result in a protein with similar biological activity, i.e., still obtain a biologically functional protein. In making such changes, the substitution of amino acids zo whose hydropathic indices are within ~2 is preferred, those within ~1 are more preferred, and those within ~0.5 are most preferred.
As outlined above, amino acid substitutions are therefore based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions which take various of the foregoing zs characteristics into consideration are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine. Changes which are not expected to be advantageous may also be used if these resulted in functional fusion proteins.

- 63 -Plant Vectors In plants, transformation vectors capable of introducing nucleic acid sequences encoding polyhydroxyalkanoate biosynthesis enzymes are easily designed, and generally contain one or more nucleic acid coding sequences of interest under the transcriptional control of 5' and 3' s regulatory sequences. Such vectors generally comprise, operatively linked in sequence in the 5' to 3' direction, a promoter sequence that directs the transcription of a downstream heterologous structural nucleic acid sequence in a plant; optionally, a 5' non-translated leader sequence; a nucleic acid sequence that encodes a protein of interest; and a 3' non-translated region that encodes a polyadenylation signal which functions in plant cells to cause the termination of ~o transcription and the addition of polyadenylate nucleotides to the 3' end of the mRNA encoding the protein. Plant transformation vectors also generally contain a selectable marker. Typical 5'-3' regulatory sequences include a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal. Vectors for plant transformation have been reviewed in Rodriguez et al. (Vectors: A
Survey of Molecular ~s Cloning Vectors and Their Uses, Butterworths, Boston., 1988), Glick et al.
(Methods in Plant Molecular Biology and Biotechnology, CRC Press, Boca Raton, Fla., 1993), and Croy (Plant Molecular Biology Labfax, Hames and Rickwood (Eds.), BIOS Scientific Publishers Limited, Oxford, UK., 1993).
Plant Promoters 2o Plant promoter sequences can be constitutive or inducible, environmentally-or developmentally-regulated, or cell- or tissue-specific. Often-used constitutive promoters include the CaMV 35S promoter (Odell, J.T. et al., Nature 313: 810-812. 1985), the enhanced CaMV
35S promoter, the Figwort Mosaic Virus (FMV) promoter (Richins et al., Nucleic Acids Res. 20:
8451-8466, 1987), the mannopine synthase (mas) promoter, the nopaline synthase (nos) 2, promoter, and the octopine synthase (ocs) promoter. Useful inducible promoters include promoters induced by salicylic acid or polyacrylic acids (PR-I, Williams , S.
W. et al, Biotechnology 10: 540-543, 1992), induced by application of safeners (substituted benzenesulfonamide herbicides, Hershey, H.P. and Stoner, T.D., Plant Mol.
Biol. 17: 679-690, 1991), heat-shock promoters (Ou-Lee et al., Proc. Natl. Acad Sci U.S.A. 83:
6815-6819, 1986;
3o Ainley et al., Plant Mol. Biol. 14: 949-967, 1990), a nitrate-inducible promoter derived from the spinach nitrite reductase gene (Back et al., Plant Mol. Biol. 17: 9-18. 1991), hormone-inducible

-64-promoters (Yamaguchi-Shinozaki, K. et al., Plant Mol. Biol. 15: 905-912, 1990;
Kares et al., Plant Mol. Biol. 15: 225-236, 1990), and light-inducible promoters associated with the small subunit of RuBP carboxylase and LHCP gene families (Kuhlemeier et al., Plant Cell 1: 471, 1989; Feinbaum, R.L. et al., Mol. Gen. Genet. 226: 449-456, 1991; Weisshaar.
B. et al., EMBO
s J. 10: 1777-1786, 1991; Lam, E. and Chua, N.H., J. Biol. Chem. 266: 17131-17135, 1990;
Castresana, C. et al., EMBO J. 7: 1929-1936, 1988; Schulze-Lefert et al., EMBO
J. 8: 651, 1989). Examples of useful tissue-specific, developmentally-regulated promoters include the (3-conglycinin 7S promoter (Doyle, J.J. et al., J. Biol. Chem. 261: 9228-9238, 1986; Slighton and Beachy, Planta 172: 356-363, 1987), and seed-specific promoters (Knutzon, D.S.
et al., Proc.
~o Natl. Acad. Sci U.S.A. 89: 2624-2628, 1992; Bustos, M.M. et al., EMBO J.
10: 1469-1479, 1991;
Lam and Chua, Science 248: 471, 1991; Stayton et al., Aust. J. Plant. Physiol.
18: 507, 1991).
Plant functional promoters useful for preferential expression in seed plastids include those from plant storage protein genes and from genes involved in fatty acid biosynthesis in oilseeds.
Examples of such promoters include the 5' regulatory regions from such genes as napin (Kridl et ~ s al., Seed Sci. Res. 1: 209-219, 1991 ), phaseolin, zero, soybean trypsin inhibitor, ACP, stearoyl-ACP desaturase, and oleosin. Seed-specific gene regulation is discussed in EP
0 255 378.
Promoter hybrids can also be constructed to enhance transcriptional activity (Comai, L. and Moran, P.M., U.S. Patent No. 5,106,739, issued April 21, 1992), or to combine desired transcriptional activity and tissue specificity. A developing seed selective promoter may be zo obtained from the fatty acid hydroxylase gene of Lesquerella (P-lh) (Broun, P. and C.
Somerville. Plant Physiol. 113: 933-942, 1997).
Plant transformation and regeneration A variety of different methods can be employed to introduce such vectors into plant protoplasts, cells, callus tissue, leaf discs, meristems, etcetera, to generate transgenic plants, zs including Agrobacterium-mediated transformation, particle gun delivery, microinjection, electroporation, polyethylene glycolmediated protoplast transformation, liposome-mediated transformation, etcetera (reviewed in Potrykus, I. Ann. Rev. Plant Physiol.
Plant Mol. Biol. 42:
205-225, 1991). In general, transgenic plants comprising cells containing and expressing DNAs encoding polyhydroxyalkanoate biosynthesis proteins can be produced by transforming plant 30 cells with a DNA construct as described above via any of the foregoing methods; selecting plant

-65-cells that have been transformed on a selective medium; regenerating plant cells that have been transformed to produce differentiated plants; and selecting a transformed plant which expresses the protein-encoding nucleotide sequence.
Specific methods for transforming a wide variety of dicots and obtaining transgenic s plants are well documented in the literature (Gasser and Fraley, Science 244: 1293-1299, 1989;
Fisk and Dandekar, Scientia Horticulturae 55: 5-36, 1993; Christou, Agro Food Industry Hi Tech, p.17, 1994; and the references cited therein).
Successful transformation and plant regeneration have been reported in the monocots as follows: asparagus (Asparagus officinalis; Bytebier et al., Proc. Natl. Acad.
Sci. U.S.A. 84: 5345-~0 5349, 1987); barley (Hordeum vulgarae; Wan and Lemaux, Plant Physiol. 104:
37-48, 1994);
maize (Zea mays; Rhodes, C.A. et al., Science 240: 204-207, 1988; Gordon-Kamm et al., Plant Cell 2: 603-618, 1990; Fromm, M.E. et al., BiolTechnology 8: 833-839, 1990;
Koziel et al., BiolTechnology l l: 194-200, 1993); oats (Avena saliva; Somers et al., BiolTechnology 10: 1589-1594, 1992); orchardgrass (Dactylis glomerata; Horn et al., Plant Cell Rep. 7:
469-472, 1988);
is rice (Oryza saliva, including indica and japonica varieties; Toriyama et al., BiolTechnology 6:
10, 1988; Zhang et al., Plant Cell Rep. 7: 379-384, 1988; Luo and Wu, Plant Mol. Biol. Rep. 6:
165-174, 1988; Zhang and Wu, Theor. Appl. Genet. 76: 835-840, 1988; Christou et al., BiolTechnology 9: 957-962, 1991); rye (Secale cereale; De la Pena et al., Nature 325: 274-276, 1987); sorghum (Sorghum bicolor; Casas, A.M. et al., Proc. Natl. Acad. Sci.
U.S.A. 90: 11212-Zo 11216, 1993); sugar cane (Saccharum spp.; Bower and Birch, Plant J. 2: 409-416, 1992); tall fescue (Festuca arundinacea; Wang, Z.Y. et al., BiolTechnology 10: 691-696, 1992); turfgrass (Agrostis palustris; Zhong et al., Plant Cell Rep. 13: 1-6, 1993); wheat (Triticum aestivum; Vasil et al., BiolTechnology 10: 667-674, 1992; Weeks, T. et al., Plant Physiol.
102: 1077-1084, 1993;
Becker et al., Plant J. 5: 299-307, 1994), and alfalfa (Masoud, S.A. et al., Transgen. Res. 5: 313, 2s 1996).
Host lp ants Particularly useful plants for polyhydroxyalkanoate production include those that produce carbon substrates, including tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, 3o and alfalfa.

-66-Example 21: Plastid transformation Alternatively, polyhydroxyalkanoate biosynthesis enzymes facilitating the increase in oil content of plants and/or herbicide resistance discussed herein can be expressed in situ in plastids by direct transformation of these organelles with appropriate recombinant expression constructs.
s Constructs and methods for stably transforming plastids of higher plants are well known in the art (Svab, Z. et al., Plant Mol. Biol. 14(2): 197-205, 1990; Svab et al., Proc. Natl. Acad. Sci. U S
A. 90(3): 913-917, 1993; Staub et al., EMBO J. 12(2): 601-606, 1993; Maliga et al., U.S. Patent No. 5,451,513; PCT International Publications WO 95/16783, WO 95/24492, and WO
95/24493). These methods generally rely on particle gun delivery of DNA
containing a ~ o selectable or scorable marker in addition to introduced DNA sequences for expression, and targeting of the DNA to the plastid genome through homologous recombination.
Transformation of a wide variety of different monocots and dicots by particle gun bombardment is routine in the art (Hinchee et al., 1994; Walden and Wingender, 1995). The plastid may be transformed by using protoplast and PEG (polyethylene glycol) (Koop, et al., Physiol. Plant.
85: 339, 1992;
Golds et al., BiolTechnol. 11: 95-97, 1993), cocultivation of protoplasts and Agrobacteria carrying transformation vectors (De Block et al., EMBO J. 4: 1367-1372, 1985), and by electroporation (Kin-Ying et al., Plant J. 4: 737, 1996).
Nucleic acid constructs for plastid transformation generally comprise a targeting segement comprising flanking nucleic acid sequences substantially homologous to a zo predetermined sequence of a plastid genome, which targeting segment enables insertion of nucleic acid coding sequences of interest into the plastid genome by homologous recombination with the predetermined sequence; a selectable marker sequence, such as a sequence encoding a form of plastid 16S ribosomal RNA that is resistant to spectinomycin or streptomycin, or that encodes a protein which inactivates spectinomycin or streptomycin (such as the aadA gene), z, disposed within the targeting segment, wherein the selectable marker sequence confers a selectable phenotype upon plant cells, substantially all the plastids of which have been transformed with the nucleic acid construct; and one or more nucleic acid coding sequences of interest disposed within the targeting segment relative to the selectable marker sequence so as not to interfere with conferring of the selectable phenotype. In addition, plastid expression 3o constructs also generally include a plastid promoter region and a transcription termination region

-67-capable of terminating transcription in a plant plastid, wherein the regions are operatively linked to the nucleic acid coding sequences of interest.
A further refinement in chloroplast transformation/expression technology that facilitates control over the timing and tissue pattern of expression of introduced nucleic acid coding s sequences in plant plastid genomes has been described in PCT International Publication WO
95/16783. This method involves the introduction into plant cells of constructs for nuclear transformation that provide for the expression of a viral single subunit RNA
polymerise and targeting of this polymerise into the plastids via fusion to a plastid transit peptide.
Transformation of plastids with nucleic acid constructs comprising a viral single subunit RNA
~o polymerise-specific promoter specific to the RNA polymerise expressed from the nuclear expression constructs operably linked to nucleic acid coding sequences of interest permits control of the plastid expression constructs in a tissue and/or developmental specific manner in plants comprising both the nuclear polymerise construct and the plastid expression constructs.
Expression of the nuclear RNA polymerise coding sequence can be placed under the control of ~ s either a constitutive promoter, or a tissue- or developmental stage-specific promoter, thereby extending this control to the plastid expression construct responsive to the plastid-targeted, nuclear-encoded viral RNA polymerise. The introduced nucleic acid coding sequence can be a single encoding region, or may contain a number of consecutive encoding sequences to be expressed as an engineered or synthetic operon. The latter is especially attractive where, as in zo the present invention, it is desired to introduce multigene biochemical pathways into plastids.
This approach is more complex using standard nuclear transformation techniques since each gene introduced therein must be engineered as a monocistron, including an encoded transit peptide and appropriate promoter and terminator signals. Individual gene expression levels may vary widely among different cistrons, thereby possibly adversely affecting the overall 2> biosynthetic process. This can be avoided by the chloroplast transformation approach.
All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure.
While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the 3o compositions and/or methods and in the steps or in the sequence of steps of the methods described herein without departing from the concept, spirit and scope of the invention. More

-68-specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention.

-69-REFERENCES
The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.
s 1. Altschul, S.F., T.L. Madden, A.A. Schaffer, J. Zhang, Z. Zhang, W.
Miller, and D.J.
Lipman. 1997. Gapped BLAST and PSI BLAST: a new generation of protein database search programs. Nucleic Acids Res., 25: 3389-3402.
2. Anderson, A. and E.A. Dawes. 1990. Occurrence, metabolism, metabolic role, and industrial uses of bacterial polyhydroxyalkanoates. Microbiol. Rev., 54: 450-472.
~0 3. Cevallos, M.A., S. Encarnacion, A. Leija, Y. Mora, and J. Mora. 1996.
Genetic and physiological characterization of a Rhizobium etli mutant strain unable to synthesize poly-beta-hydroxybutyrate. J. Bacteriol., 178: 1646-1654.
4. Connors, M.J., J.M. Mason, and P. Setlow. 1986. Cloning and nucleotide sequencing of genes for three small, acid soluble proteins Bacillus subtilis spores. J.
Bacteriol., 166:
Is 417-425.
5. deSmet, M.J., G. Eggink, B. Witholt, J. Kingma, and H. Wynberg. 1983.
Characterization of intracellular inclusions formed by Pseudomonas oleovorans during growth on octane.
J. Bacteriol., 154: 870-878.
6. Dunlop, W. and A.W. Robards. 1973. Ultrastructural study of poly-(3-hydroxybutyrate ao granules from Bacillus cereus. J. Bacteriol., 114: 1271-1280.
7. Eggink, G., P. de Waard, and G.N.M. Huijberts. 1992. The role of fatty acid biosynthesis and degradation in the supply of substrates for poly(3-hydroxyalkanoate) formation in Pseudomonas putida. FEMS Microbiol. Rev., 103: 159-164.
8. Ellar, D., D.G. Lundgren, K. Okamura, and R.H. Marchessault. 1968.
Morphology of is poly-~3-hydroxybutyrate granules. J. Mol. Biol., 35: 489-502.
9. Fliss, E.R., A.C. Loshon, and P. Setlow. 1986. Genes for Bacillus megaterium small, acid-soluble spore proteins: Cloning and nucleotide sequence of three additional genes from this multigene family. J. Bacteriol., 165: 467-473.
10. Fliss, E.R. and P. Setlow. 1984. Bacillus megaterium spore protein C-3:
nucleotide so sequence of its gene and the amino acid sequence at its spore cleavage site. Gene, 30:
167-172.

-70-11. Fuller, R.C., J.P. O'Donnell, J Saulnier, T.E. Redlinger, J. Foster, and R.W. Lenz. 1992.
The supramolecular architecture of the polyhydroxyalkanoate inclusions in Pseudomonas oleovorans. FEMS Microbiol. Rev., 103: 279-288.
12. Gerngross, T.U., P. Reilly, J. Stubbe, A.J. Sinskey, and O.P. Peoples.
1993.
s Immunocytochemical analysis of poly-(3-hydroxybutyrate (PHB) synthase enzyme at the surface of PHB granules. J. Bacteriol., 175: 5289-5293.
13. Gilman, M.Z., J.L. Wings, and M.J. Chamberlin. 1981. Nucleotide sequence of two Bacillus subtilis promoters used by Bacillus subtilis sigma-28 RNA polymerase.
Nucleic Acids Res., 9: 5991-6000.
~0 14. Gitt, M.A., L.F. Wang, and R.H. Doi. 1985. A strong sequence homology exists between RNA polymerase sigma factors of Bacillus subtilis and Escherichia coli. J.
Biol. Chem., 260: 7178-7185.
15. Griebel, R., Z. Smith, and M. Merrick. 1968. Metabolism of poly-(3-hydroxybutyrate. 1.
Purification, composition, and properties of native poly-(3-hydroxyburyrate granules from is Bacillus megaterium. Biochem., 7: 3676-3681.
16. Haima, P., D. van Sinderen, H. Scholting, S. Bron, and G. Venema. 1990.
Development of (3-galactosidase a,-complementation system for molecular cloning in Bacillus subtilis.
Gene, 86: 63-69.
17. Haywood, G.W., A.J. Anderson, L. Chu, and E.A. Dawes. 1988. The role of NADH- and ao NADPH-linked acetoacetyl-CoA reductases in the poly-3-hydroxybutyrate synthesizing organism Alcaligenes eutrophus. FEMS Microbiol. Lett., 52: 259-264.
18. Haywood, G.W., A.J. Anderson, L. Chu, and E.A. Dawes. 1988.
Characterization of two 3-ketothiolases in the polyhydroxyalkanoate synthesizing organism Alcaligenes eutrophus. FEMSMicrobiol. Lett., 52: 91-96.
Zs 19. Haywood, G.W., A.J. Anderson, and E.A. Dawes. 1989. The importance of PHB-synthase substrate specificity in polyhydroxyalkanoate synthesis by Alcaligenes eutrophus. FEMSMicrobiol. Lett., 57: 1-6.
20. Helmann, J.D. 1991. Alternative sigma factors and the regulation of flagellar gene expression. Mol. Microbiol., 5: 2875-2882.
30 21. Huang, A.H.C. 1992. Oil bodies and oleosins in seeds. Annu. Rev. Plant Physiol. Plant Mol. Biol., 43: 177-200.

-71 -22. Huisman, G.W., E. Wonink, R. Meima, B. Kazemier, P. Terpstra, and B.
Witholt. 1991.
Metabolism of poly(3-hydroxyalkanoates) (PHAs) by Pseudomonas oleovorans. J.
Biol.
Chem., 266: 2191-2198.
23. Kaneko, T. et al. 1996. Sequence analysis of the genome of the unicellular s cyanobacterium Synechocystis sp. strain PCC6803. II. Sequence determination of the entire genome and assignment of potential protein-coding regions. DNA Res., 3:

136.
24. Kunst, N. et al. 1997. The complete genome sequence of the Gram-positive bacterium Bacillus subtilis. Nature, 390: 249-256.
~0 25. Lauzier, C., R.H. Marchessault, P. Smith, and H. Chanzy. 1992.
Structural study of isolated poly((3-hydroxybutyrate) granules. Polymer, 33: 823-827.
26. Lee, S.Y. 1995. Bacterial polyhydroxyalkanoates. Biotechnology &
Engineering, 49: 1-14.
27. Liebergesell, M., B. Schmidt, and A. Steinbiichel. 1992. Isolation and identification of granule-associated proteins relevant for poly(hydroxyalkanoic acid) biosynthesis in is Chromatium vinosum D. FEMS Microbiol. Lett., 99: 227-232.
28. Liebergesell, M. and A. Steinbiichel. 1992. Cloning and nucleotide sequences of genes relevant for biosynthesis of poly(3-hydroxybutyric acid) in Chromatium vinosum strain D. Eur. J. Biochem., 209: 135-150.
29. Liebergesell, M. and A. Steinbiichel. 1993. Cloning and molecular analysis of the poly Zo (3-hydroxybutyric acid) biosynthetic genes of Thiocystis violacea. Appl.
Microbiol.
Biotechnol., 38: 493-501.
30. Lundgren, D.G., R.M. Pfister, and J.M. Merrick. 1964. Structure of poly-(3-hydroxybutyric acid granules. J. Gen. Microbiol., 34: 441-446.
31. Magni, C., P. Marini, and D. de Mendoza. 1995. Extraction of RNA from gram-positive is bacteria. Biotechniques, 19: 882-884.
32. McCool, G.J., T. Fernandez, N. Li, and M.C. Cannon. 1996.
Polyhydroxyalkanoate inclusion-body growth and proliferation in Bacillus megaterium. FEMS
Microbiol. Lett., 137: 41-48.
33. Miller, J.H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, 3o Cold Spring Harbor, NY:

-72-34. Moran, C.P. Jr., N. Lang, S.F.J. LeGrice, G. Lee, M. Stephens, A.L.
Sonnenshein, J.
Pero, and R. Losick. 1982. Nucleotide sequences that signal the initiation of transcription and translation in Bacillus subtilis. Mol. Gen. Genet., 186: 339-346.
35. Morbidoni, H.R., D. de Mendoza, and J.E. Cronan. 1996. Bacillus subtilis acyl carrier s protein is encoded in a cluster of lipid biosynthesis genes. J. Bacteriol., 178: 4794-4800.
36. Pieper-Furst, U., M.H. Madkour, F. Mayer, and A. Steinbiichel. 1994.
Purification and characterization of a 14-kilodalton protein that is bound to the surface of polyhydroxyalkanoic acid granules in Rhodococcus ruber. J. Bacteriol., 176:
4328-4337.
37. Pieper-Furst, U., M.H. Madkour, F. Mayer, and A. Steinbiichel. 1995.
Identification of to the region of a 14-kilodalton protein of Rhodococcus ruber that is responsible for the binding of this Phasin to polyhydroxyalkanoic acid granules. J. Bacteriol., 177: 2513-2523.
38. Sambrook, J., E.F. Fritsch & T. Maniatis. 1989. Molecular Cloning: A
Laboratory Manual., 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
is 39. Shark, K.B., F.D. Smith, P.R. Harpending, and J.L. Rasmussen. 1991.
Biolistic transformation of a procaryote, Bacillus megaterium. Appl. Environ.
Microbiol., 57: 480-485.
40. Simon, R., Priefer, U. & Piihler, A. 1983. In A. Puhler (Ed.), Molecular genetics of the bacteria-plant interaction. Springer, Berlin. p. 98-106.
ao 41. Steinbiichel, A. 1991. Polyhydroxyalkanoic acids. p. 123-213. In D.
Byrom (Ed.), Biomaterials, novel materials from biological sources. Macmillan Publishers Ltd., Basingstoke, England.
42. Steinbiichel, A., K. Aerts, W. Babel, C. Follner, M. Liebergesell, M.H.
Madkour, F.
Mayer, U. Pieper-Furst, A. Pries, H.E. Valentin, and R. Wieczorek. 1995.
Considerations Zs on the structure and biochemistry of bacterial polyhydroxyalkanoic acid inclusions. Can.
J. Microbiol., 41: 94-105.
43. Steinbiichel, A., E. Hustede, M. Liebergesell, U. Pieper, A. Timm, and H.
Valentin. 1992.
Molecular basis for biosynthesis and accumulation of polyhydroxyalkanoic acids in bacteria. FEMS Microbiol. Rev., 103: 217-230.
30 44. Steinbiichel, A. and H.G. Schlegel. 1991. Physiology and molecular genetics of poly((3-hydroxyalkanoic acid) synthesis in Alcaligenes eutrophus. Mol. Microbiol., 5:
535-542.

-73-45. Steinbiichel, A. and H.E. Valentin. 1995. Diversity of bacterial polyhydroxyalkanoic acids. FEMS Microbiol. Lett., 128: 219-228.
46. Vary, P. 1993. The genetic map of Bacillus megaterium, p. 475-481. In A.L.
Sonenshein, J.A. Hoch & R. Losich (Eds.), Bacillus subtilis and other gram positive s bacteria. American Society for Microbiology, Washington, D.C.
47. Wang, W.S. and D.G. Lundgren. 1969. Poly-(3-hydroxybutyrate in the chemolithotrophic bacterium Ferrobacillus ferrooxidans. J. Bacteriol., 97: 947-950.
48. Wieczorek, R., A. Pries, A. Steinbiichel, and F. Mayer. 1995. Analysis of a 24-kilodalton protein associated with the polyhydroxyalkanoic acid granules in Alcaligenes eutrophus.
io J. Bacteriol., 177: 2425-2435.
49. Wieczorek, R., A. Steinbiichel, and B. Schmidt. 1996. Occurrence of polyhydroxyalkanoic acid granule-associated proteins related to the Alcaligenes eutrophus H16 GA24 protein in other bacteria. FEMS Microbiol. Lett., 135: 23-30.
50. Hein, S., Tran, H., and A. Steinbiichel. 1998. Synechocystis sp. PCC6803 possesses a is two-component polyhydroxyalkanoic acid synthase similar to that of anoxygenic purple sulfur bacteria. Arch. Microbiol., 170(3): 162-70.
51. Steinbiichel, A., Hustede, E., Liebergesell, M., Pieper, U., Timm, A., and H. Valentin.
1992. Molecular basis for biosynthesis and accumulation of polyhydroxyalkanoic acids in bacteria. FEMS Microbiol. Rev. 103: 217-230.
zo 52. Basak, A., Boudreault, A., Chen, A., Chretien, M., Seidah, N.G., and C.
Lazure. 1995.
Application of the multiple antigenic peptides (MAP) strategy to the production of prohormone convertases antibodies: synthesis, characterization and use of 8-branched immunogenic peptides. J. Pept. Sci. 1(6): 385-95.
53. Slater, S., K.L. Houmiel, M. Tran, T.A. Mitsky, T.B. Taylor, S.R.
Padgette, and K.J.
Zs Gruys. 1998. Multiple (3-ketothiolases mediate poly(~3-hydroxyalkanoate) copolymer synthesis in Ralstonia eutropha. J. Bacteriol. 180: 1979-1987.
54. Fukui, T., N. Shiomi, and Y. Doi. 1998. Expression and characterization of (R)-specific enoyl coenzyme A hydratase involved in polyhydroxyalkanoate biosynthesis in Aeromonas caviae. J. Bacteriol. 180: 667-6673.
30 5~. Boynton, Z.L., G.N. Bennett, and F.B. Rudolph. 1996. Cloning, sequencing, and expression of clustered genes encoding b-hydroxybutyryl-coenzyme A (CoA)

-74-dehydrogenase, crotonase, and butyryl-CoA dehydrogenase from Clostridium acetobutylicum ATCC 824. J. Bacteriol. 178: 3015-3024.
56. Liebergesell, M., F. Mayer, and A. Steinbiichel. 1993. Analysis of polyhydroxyalkanoic acid-biosynthesis genes of anoxygenic phototrophic bacteria reveals synthesis of a polyester exhibiting an unusual composition. Appl. Microbiol. Biotechnol.
40:292-300.

SEQUENCE LISTING
<110> McCool, Gabriel J.
Cannon, Maura C.
Cannon, Francis C.
Valentin, Henry E.
Gruys, Kenneth J.
<120> POLYHYDROXYALKANOATE BIOSYNTHESIS ASSOCIATED PROTEINS
AND CODING REGION IN BACILLUS MEGATERIUM
<130> MOBT212 <140> 60/115,092 <141> 1999-01-07 <160> 29 <170> PatentIn Ver. 2.1 <210> 1 <211> 7916 <212> DNA
<213> Bacillus megaterium <400> 1 aagcttaaca aaaggttaga gggcttttaa ttgacttatt aatgaacctt ttataaaata 60 aaaacaactt aatacattta cttcttacgg agtaaagggg agtagcgtca gggaaacctg 120 aaacaaagtc gtcattacat ggagtattcc atcggctttg ttggcataat gattatgctt 180 agcaagacct ttgccatatt tggcaaaggt ctttttgtgt tttattccgg taatgaggat 240 aaataaactt atacaaagaa acgagagggg atttttatgg atgcatcact tttgttagag 300 tatggatggg tattgctagt gctggttgca ttagaaggaa ttttggcggc ggataatgct 360 cttgtgatgg ctattatggt caaacattta ccggaagaaa aacgcaagaa ggcattattt 420 tacggattag ccggtgcctt tatttttaga tttggttcgt tgttcttgat ttcattttta 480 gtcgacgtat ggcagcttca agctatagga gccatttact tattgttcat ttccattaat 540 catattgtga agcgatatgt gaaaaaagac gatcatgaaa aagtgaaaga agcagacgag 600 aaaaagggct caggtttctg gatgacggtt ttaaaagtag aaatagcaga cattgctttt 660 gccgttgatt caattttggc cgctgtggct ctcgccgtta cgttgccaac aacaaatctt 720 cctcaaattg gcggactcga cggcggacaa ttcttggtga tcttcgccgg aggaattatg 780 ggattaatta ttatgcgttt tgctgcaact tggttcgtca agctattaaa tacgcgccca 840 ggcctagaaa cggcggcttt tgctattgta ggctgggtag gagttaagtt agcggtctat 900 acccttgctc atccagagtt aggtattatt aatgaacatt tccctgaatc aaaagtgtgg 960 aaaattacgt tttggattgt gttacttggc atagctgctt caggctggtt tctatctaaa 1020 aataaagaac aaactgatct tgaaggctca gagaaagaaa aagaatcgtt aaaaaaaatt 1080 gaaaatcaat aataaaaaaa acgcgccttc aatgttaatt gaaggcgcgt tttttatagg 1140 gggataaaat acctagttta gattgtttaa ataaagggta aaagaattaa ttactgttta 1200 attactgtat atccgaatgt tttgcttttt cgttcatatt ctgtagagaa cagagccgtg 1260 agtaattcag ttcaatgaag tttatttcag tttataaaca tatatttcaa atgtatgtta 1320 attggtaaaa ttgagctatt atgggttata ataaaggaaa attaaaagga gcagagcgct 1380 tctcaaccct gttcgtcatc aaaagaatgg atattaacat ggtataaagc aactgagtat 1440 agtaaaagag gtgaagccaa tgctcacaaa agttcaaacg cctccatcgc ttgaaacgct 1500 tgtactgacg attcagcaag gggataaaca attacataat gaaatgattc aacaatataa 1560 accgtttatt gctaaagttg tttcagctgt atgtaaacgt tatataagtg aagctgacga 1620 tgaatttagc attggtctga ttgcatttaa tgaagccatt gaaaattaca caatccaaaa 1680 aggacgatct cttcttgcat ttgcggaact tattattaaa agaagagtaa tcgactatat 1740 tcgaaaagaa aagcgaaatc aaacgctgct ctataaccga attgaaaatg aaggttttat 1800 tcaaggtaag gtagaaaggg atatatcgct ttctaactat aaaaggcaaa gtgaaacttc 1860 2 _.
atatattcaa gaggaaatga cttatttttg tcaggcgcta aaattgttta aattaactct 1920 tgaagacatt attaacacgt ctcctaaaca taaggatgca aggggaaatg cagtggaagt 1980 tgcatctttt atcgtcaatg aaaaagaatt aaaagataag ctgtttttaa agcggcagct 2040 tcctattcgc ttgattgaaa aacatgtcaa agtaagccgg aaaacaattg aaagaaaccg 2100 taaatatatt atcgcgatgg ttattatatt agcgggggac tacgtgtatt taaaagacta 2160 tattatgtaa gaaaaaggca cacgcaggtg ccttttttta gccatgttat gaaattatgt 2220 tttatttttg tgtgctgccg cttaagtgag cttgagcttg ttgcaccaag cgttttgtga 2280 tttctccgcc tactgaaccg ttgctgcgtg cagcagtgtc agaacctaga gttaccccaa 2340 attcttgagc gatttcatat ttatattgat ctaaaaattg ttctactcct ggtgttaata 2400 gtttatttgt tctagccatg attagtcatc tcctttttta gtggtacagc agttcactgc 2460 tgtacctgta ttatttgttg tttcctattt tgcatactgg taatggtttg caagaaagta 2520 taaaaaagcc cagctttcaa agaagctggg cttttttata tattatttta caactgcata 2580 ttgctcaaga gactgagcaa atgacttttg aagagatttt acttgttcta cgtatgcatc 2640 agatacgtgt tggaattctt ggcgcgtttt cttttgctct tctactaatt gtgttactac 2700 ttgatgatat tgttcttgcg cttgctttac taaagaatag cttgatttgc tttggttaaa 2760 aaaaagctct tgtaatttat ttaatgcttc atgcgtgcgg tttgtccatt cttcataaga 2820 atcggcaaca gcgtttccag ctgttttacg taagttttca actgtttttt gttgaaggtc 2880 ttccaattca gctttccatt gtttgtctgt tgcttgaagt tgttcaactg cttttgttac 2940 aaattcttgc tgttgctcaa gtgcttttaa cgtccattgc tcaatttgtt tgtttccgtc 3000 tgcaatgttt tgtaacccct ttgtccattg ttcccacatt gcatcaatta ctgtatcata 3060 ctttactgtt gacataatca aattcctcct tgaataattt ggtctggcga acagttatcg 3120 taatgaacaa aacgttaaag aagaaattcg tagttgtgtg ataaacctaa cattccgcgc 3180 tcgctggttg accgtgaaat ttaacattat attaggaaac gcagatgtac tgcgtgaatc 3240 cctttaatcg ttttcttcct cttttgattc ttttgacttt ttagaagaag aagagctaaa 3300 agggaacaac atgtcggtat acatgtgaaa aaatgaatct aacatgtttt gatactgttc 3360 aagtgaatta gcccacatac ttaaatattg ttcgccggca tctgttaatg aataaatccg 3420 gcgtgcaggt ccttcagctg acgtatccca ttgcgatgta atcaagttgt ctttttcaag 3480 ctgtctcagc gtgcggtaga catttccctg atcaactgat gtgaatccaa agctcattag 3540 ttgctgaatg agcttgtaac catgtagatt ccaccctctt aaacttaaaa gaagaaaagg 3600 aaccatcaag ttttttggtg caccgctaat cgatttttct aagttgtttg aattagaggt 3660 gttatctttt tcacttgatc ccaaggtaat caccccttcg aaaaaagaga atttgttttc 3720 catatgtgta atttacacct agatgaaaaa attgtcaaca ctttaaaaca ggtctttcaa 3780 atacaggaaa aaagaacgat tttttggatt tcgacaaaaa gcgtcaaaaa aattcaaaaa 3840 taaacaaaga tttagaattg tttattttgg aaaacgtatt tataatagta catgtaggta 3900 atttttataa catttataat ttgttggtaa gtgaattgtg aaaagattta cattatccaa 3960 taaataaacg caaaattggt tgcgtttact tagagcttct aatatgtcgc ttgtcacatt 4020 aagtgtccat attgaaagcc atcactttta acgtacacaa gaaaggagat ggagttttgg 4080 aacagcaaaa agtatttgat ccgtttcaag catggaaaga cgtatatgac aaaaccgaat 4140 cttactgggg taaagttatt ggggacaata tgaatcgtga agaattttcc cagctcatgg 4200 gaaatgtgct aaatatgaac cttcaatatc aacaagcagt aaatgaagta acggggcgct 4260 atctgcacca agtaaatgta ccaacaaaag aagatgtagc aaacgttgcg tcattagtca 4320 tcaatgtgga agaaaaagta gaattattag aagagcaatt tgacgatcgt tttgatgaat 4380 tagaagcaca gcaagaaagt gcatctgctt tgaaaaaaga tgtcactaag ctgaaatctg 4440 atgtcaaatc gttagacaaa aaactcgata aagttttatc tcttcttgaa gggcagcaaa 4500 aaacacaaga cgagttaaaa gaaacgattc aaaaacaaat taaaactcaa ggtgagcagc 4560 ttcaggctca gctgttagaa aaacaagaaa aattagctga aaagccaaag gcagaagcta 4620 aatctgaagc aaaaccatca aacgctcaaa aaactgagca gccggctcgc aagtaaggta 4680 tcggagattt tataacaaca ttaactgctg tatttacagt aaaaatcatc gctgaagaag 4740 caagggggaa atttttcatg acaacattac aaggtaaagt agcaatcgta acaggcggat 4800 ctaaaggtat cggggcagca attacacgtg agcttgcttc taatggagta aaagtagcag 4860 taaactataa cagcagtaaa gaatctgcag aagcaattgt aaaagaaatt aaagacaacg 4920 gcggagaagc tattgcggtt caagctgacg tgtcttatgt agatcaagca aaacacctaa 4980 tcgaagaaac aaaagctgcg tttggtcaat tagacattct agtaaacaat gctggaatta 5040 cgcgcgaccg ttcattcaag aagttaggtg aagaagattg gaaaaaagta attgatgtaa 5100 acttacatag cgtatacaac acaacatcag ctgcgctaac gcacctttta gaatctgaag 5160 gtggtcgtgt tatcaatatt tcatcaatta ttggtcaagc gggcggattt ggtcaaacaa 5220 actactcagc tgctaaagca ggtatgctag gattcactaa atcattagct cttgaactag 5280 ctaagacagg cgtaacggtt aatgcaattt gcccaggatt tattgaaacg gaaatggtga 5340 tggcaattcc tgaagatgtt cgtgcaaaaa ttgttgcgaa aattccaact cgtcgcttag 5400 gtcacgctga agaaattgca cgtggagttg tttacttagc aaaagacggc gcgtacatta 5460 caggacaaca gttaaacatt aacggcggct tatacatgta ataaatgctg gccctgactt 5520 ttgtcggggc tgtgcttgtt aactaactac taatggaatg aaagggtgtg tatattcgtg 5580 gcaattcctt acgtgcaaga gtgggaaaaa ttaatcaaat caatgccaag tgaatataaa 5640 agttctgcaa gacgttttaa gcgtgcatat gaaattatga caacagaagc ggaaccggaa 5700 gttggattaa caccaaaaga ggttatttgg aaaaagaaca aagcgaaatt atatcgctat 5760 acgccagtaa aagataacct gcataaaaca ccaatcttac tcgtatatgc attgatcaat 5820 aaaccgtata ttttggattt aacacctgga aacagccttg ttgaatactt attaaaccgc 5880 ggttttgacg tgtatttgct tgactgggga actcctgggc ttgaagacag caatatgaag 5940 ctagatgatt atattgtaga ttatattcca aaagcggcga aaaaggtgct gcgcacttct 6000 aaatctcctg atttgtctgt tcttggttac tgcatgggcg gaactatgac atctattttt 6060 gctgcattaa atgaagactt gccgattaaa aacttaattt ttatgacaag tccatttgat 6120 ttttcggata caggtttata cggagcattc ctagatgatc gctactttaa tttagataaa 6180 gcagtagata cattcggaaa catccctcca gagatgattg actttggaaa caagatgtta 6240 aagccaatca cgaatttcta cggcecgtat gtaacgttgg tggaccgttc ggaaaatcag 6300 cggtttgttg aaagctggaa gctaatgcaa aagtgggttg ctgacggaat cccatttgct 6360 ggcgaagctt atcgtcagtg gattcgtgac ttctatcaac aaaacaaact aatcaatggt 6420 2o gaacttgaag ttcgcggacg caaagtagat ttaaaaaata ttaaagctaa tattttaaac 6480 attgctgcta gccgtgatca tattgcgatg ccgcatcaag tggcagcttt aatggacgct 6540 gtttcaagtg aagataaaga gtataaattg ttgcaaacag gtcacgtatc tgttgtattt 6600 ggtccaaaag cagtgaagga aacatatcct tcaatcggcg attggctaga aaaacgctct 6660 aaataaaata aagacgaggc tgagacaaaa gtattttagc cgaagtgaaa aacgaaccac 6720 tgatatcagt ggttcgtttt tttgtataaa cagacaatag cgagtgatga ttctttatct 6780 ggactgatgg gatttatgat atctaatgac aagtgagatg acttctttta tactaatgta 6840 gtcaccttct taaacatggg attttttaca tggatatagc tattcatgta acaatgagta 6900 tgctttgaga agaaagaaga aaactattag tattataatg aaaaaggaat gtcagattat 6960 gccacaacca tggaaacgac gagtaaggca gatgtcttca gctcaaatta ttgttacatt 7020 3o ttacatagtg gctgttacgc ttgggtttct attacttagt attccagaag ctttaaggcc 7080 aggagcaaag ttagcattta ttgatcgctt atttattgcc gttagtgcgg taagtgtaac 7140 agggctgaca cctgtctcga ctccagatac atttagtaca acgggctatt ttttactcgt 7200 ttttattttt caaatcggtg gtattggtgt aatgacactc agtacattta tttggatgat 7260 tttaggtaaa aaaatcggtc tgaaggaacg tcagctcatt atgacggacc ataatcaatc 7320 ccgtttatca ggattagttg atttgatgag aaatatttta tttattattt ttgccattga 7380 actagttggc gccattattt tagggttaca ttttctccgt tattattcga gctggacaga 7440 tgcgtttttg catggtttct ttgcttctgt cagtgctaca acaaatgctg gcttcgatat 7500 tacaggatct tcatttattc cgtatgccca tgattatttc gtacaagtgg taaccgttat 7560 tttaattacg cttggagcga ttggattccc tgtattaatt gaaatcaagc actatttttt 7620 aacatttaaa gataagcgta aatttcaatt ttcgctattt acgaagctaa cgactattat 7680 gttttttctg ctgttaggag ggggaacaat cttgattctt gtgctagagc attcaggatt 7740 tctagcagat aagtcttggg atgaatcgtt tttttatgcg tttttccaat ccgctgccac 7800 aaggagcgga ggagtggcga ccatgaatat taatgagttt tcacttccta cgttaattat 7860 gatgagcgcg atgatgttta tcggtgcttc accgagttca gtagggggag gaattc 7916 <210> 2 <211> 510 <212> DNA
<213> Bacillus megaterium <400> 2 atgtcaacag taaagtatga tacagtaatt gatgcaatgt gggaacaatg gacaaagggg 60 ttacaaaaca ttgcagacgg aaacaaacaa attgagcaat ggacgttaaa agcacttgag 120 caacagcaag aatttgtaac aaaagcagtt gaacaacttc aagcaacaga caaacaatgg 180 aaagctgaat tggaagacct tcaacaaaaa acagttgaaa acttacgtaa aacagctgga 240 aacgctgttg ccgattctta tgaagaatgg acaaaccgca cgcatgaagc attaaataaa 300 ttacaagagc ttttttttaa ccaaagcaaa tcaagctatt ctttagtaaa gcaagcgcaa 360 gaacaatatc atcaagtagt aacacaatta gtagaagagc aaaagaaaac gcgccaagaa 420 ttccaacacg tatctgatgc atacgtagaa caagtaaaat ctcttcaaaa gtcatttgct 480 cagtctcttg agcaatatgc agttgtaaaa 510 <210> 3 <211> 170 <212> PRT
<213> Bacillus megaterium <400> 3 Met Ser Thr Val Lys Tyr Asp Thr Val Ile Asp Ala Met Trp Glu Gln Trp Thr Lys Gly Leu Gln Asn Ile Ala Asp Gly Asn Lys Gln Ile Glu Gln Trp Thr Leu Lys Ala Leu Glu Gln Gln Gln Glu Phe Val Thr Lys Ala Val Glu Gln Leu Gln Ala Thr Asp Lys Gln Trp Lys Ala Glu Leu Glu Asp Leu Gln Gln Lys Thr Val Glu Asn Leu Arg Lys Thr Ala Gly Asn Ala Val Ala Asp Ser Tyr Glu Glu Trp Thr Asn Arg Thr His Glu Ala Leu Asn Lys Leu Gln Glu Leu Phe Phe Asn Gln Ser Lys Ser Ser Tyr Ser Leu Val Lys Gln Ala Gln Glu Gln Tyr His Gln Val Val Thr Gln Leu Val Glu Glu Gln Lys Lys Thr Arg Gln Glu Phe Gln His Val Ser Asp Ala Tyr Val Glu Gln Val Lys Ser Leu Gln Lys Ser Phe Ala Gln Ser Leu Glu Gln Tyr Ala Val Val Lys <210> 4 <211> 438 <212> DNA
<213> Bacillus megaterium <400> 4 ttgggatcaa gtgaaaaaga taacacctct aattcaaaca acttagaaaa atcgattagc 60 ggtgcaccaa aaaacttgat ggttcctttt cttcttttaa gtttaagagg gtggaatcta 120 catggttaca agctcattca gcaactaatg agctttggat tcacatcagt tgatcaggga 180 aatgtctacc gcacgctgag acagcttgaa aaagacaact tgattacatc gcaatgggat 240 acgtcagctg aaggacctgc acgccggatt tattcattaa cagatgccgg cgaacaatat 300 ttaagtatgt gggctaattc acttgaacag tatcaaaaca tgttagattc attttttcac 360 atgtataccg acatgttgtt cccttttagc tcttcttctt ctaaaaagtc aaaagaatca 420 aaagaggaag aaaacgat 438 <210> 5 <211> 146 <212> PRT
<213> Bacillus megaterium <400> 5 Met Gly Ser Ser Glu Lys Asp Asn Thr Ser Asn Ser Asn Asn Leu Glu Lys Ser Ile Ser Gly Ala Pro Lys Asn Leu Met Val Pro Phe Leu Leu Leu Ser Leu Arg Gly Trp Asn Leu His Gly Tyr Lys Leu Ile Gln Gln Leu Met Ser Phe Gly Phe Thr Ser Val Asp Gln Gly Asn Val Tyr Arg Thr Leu Arg Gln Leu Glu Lys Asp Asn Leu Ile Thr Ser Gln Trp Asp Thr Ser Ala Glu Gly Pro Ala Arg Arg Ile Tyr Ser Leu Thr Asp Ala Gly Glu Gln Tyr Leu Ser Met Trp Ala Asn Ser Leu Glu Gln Tyr Gln Asn Met Leu Asp Ser Phe Phe His Met Tyr Thr Asp Met Leu Phe Pro Phe Ser Ser Ser Ser Ser Lys Lys Ser Lys Glu Ser Lys Glu Glu Glu Asn Asp <210> 6 <211> 504 <212> DNA
<213> Bacillus megaterium <400> 6 atgaatcgtg aagaattttc ccagctcatg ggaaatgtgc taaatatgaa ccttcaatat 60 caacaagcag taaatgaagt aacggggcgc tatctgcacc aagtaaatgt accaacaaaa 120 gaagatgtag caaacgttgc gtcattagtc atcaatgtgg aagaaaaagt agaattatta 180 gaagagcaat ttgacgatcg ttttgatgaa ttagaagcac agcaagaaag tgcatctgct 240 ttgaaaaaag atgtcactaa gctgaaatct gatgtcaaat cgttagacaa aaaactcgat 300 aaagttttat ctcttcttga agggcagcaa aaaacacaag acgagttaaa agaaacgatt 360 caaaaacaaa ttaaaactca aggtgagcag cttcaggctc agctgttaga aaaacaagaa 420 aaattagctg aaaagccaaa ggcagaagct aaatctgaag caaaaccatc aaacgctcaa 480 aaaactgagc agccggctcg caag 504 <210> 7 <211> 168 <212> PRT
<213> Bacillus megaterium <400> 7 Met Asn Arg Glu Glu Phe Ser Gln Leu Met Gly Asn Val Leu Asn Met Asn Leu Gln Tyr Gln Gln Ala Val Asn Glu Val Thr Gly Arg Tyr Leu IS His Gln Val Asn Val Pro Thr Lys Glu Asp Val Ala Asn Val Ala Ser Leu Val Ile Asn Val Glu Glu Lys Val Glu Leu Leu Glu Glu Gln Phe Asp Asp Arg Phe Asp Glu Leu Glu Ala Gln Gln Glu Ser Ala Ser Ala Leu Lys Lys Asp Val Thr Lys Leu Lys Ser Asp Val Lys Ser Leu Asp Lys Lys Leu Asp Lys Val Leu Ser Leu Leu Glu Gly Gln Gln Lys Thr Gln Asp Glu Leu Lys Glu Thr Ile Gln Lys Gln Ile Lys Thr Gln Gly Glu Gln Leu Gln Ala Gln Leu Leu Glu Lys Gln Glu Lys Leu Ala Glu Lys Pro Lys Ala Glu Ala Lys Ser Glu Ala Lys Pro Ser Asn Ala Gln Lys Thr Glu Gln Pro Ala Arg Lys <210> 8 <211> 741 <212> DNA
<213> Bacillus megaterium <400> 8 atgacaacat tacaaggtaa agtagcaatc gtaacaggcg gatctaaagg tatcggggca 60 gcaattacac gtgagcttgc ttctaatgga gtaaaagtag cagtaaacta taacagcagt 120 aaagaatctg cagaagcaat tgtaaaagaa attaaagaca acggcggaga agctattgcg 180 gttcaagctg acgtgtctta tgtagatcaa gcaaaacacc taatcgaaga aacaaaagct 240 gcgtttggtc aattagacat tctagtaaac aatgctggaa ttacgcgcga ccgttcattc 300 aagaagttag gtgaagaaga ttggaaaaaa gtaattgatg taaacttaca tagcgtatac 360 aacacaacat cagctgcgct aacgcacctt ttagaatctg aaggtggtcg tgttatcaat 420 atttcatcaa ttattggtca agcgggcgga tttggtcaaa caaactactc agctgctaaa 480 gcaggtatgc taggattcac taaatcatta gctcttgaac tagctaagac aggcgtaacg 540 gttaatgcaa tttgcccagg atttattgaa acggaaatgg tgatggcaat tcctgaagat 600 gttcgtgcaa aaattgttgc gaaaattcca actcgtcgct taggtcacgc tgaagaaatt 660 gcacgtggag ttgtttactt agcaaaagac ggcgcgtaca ttacaggaca acagttaaac 720 attaacggcg gcttatacat g 741 <210> 9 <211> 247 <212> PRT
<213> Bacillus megaterium <400> 9 Met Thr Thr Leu Gln Gly Lys Val Ala Ile Val Thr Gly Gly Ser Lys Gly Ile Gly Ala Ala Ile Thr Arg Glu Leu Ala Ser Asn Gly Val Lys Val Ala Val Asn Tyr Asn Ser Ser Lys Glu Ser Ala Glu Ala Ile Val Lys Glu Ile Lys Asp Asn Gly Gly Glu Ala Ile Ala Val Gln Ala Asp Val Ser Tyr Val Asp Gln Ala Lys His Leu Ile Glu Glu Thr Lys Ala Ala Phe Gly Gln Leu Asp Ile Leu Val Asn Asn Ala Gly Ile Thr Arg Asp Arg Ser Phe Lys Lys Leu Gly Glu Glu Asp Trp Lys Lys Val Ile Asp Val Asn Leu His Ser Val Tyr Asn Thr Thr Ser Ala Ala Leu Thr His Leu Leu Glu Ser Glu Gly Gly Arg Val Ile Asn Ile Ser Ser Ile Ile Gly Gln Ala Gly Gly Phe Gly Gln Thr Asn Tyr Ser Ala Ala Lys Ala Gly Met Leu Gly Phe Thr Lys Ser Leu Ala Leu Glu Leu Ala Lys Thr Gly Val Thr Val Asn Ala Ile Cys Pro Gly Phe Ile Glu Thr Glu Met Val Met Ala Ile Pro Glu Asp Val Arg Ala Lys Ile Val Ala Lys Ile Pro Thr Arg Arg Leu Gly His Ala Glu Glu Ile Ala Arg Gly Val Val Tyr Leu Ala Lys Asp Gly Ala Tyr Ile Thr Gly Gln Gln Leu Asn Ile Asn Gly Gly Leu Tyr Met <210> 10 <211> 1086 <212> DNA
<213> Bacillus megaterium <400> 10 gtggcaattc cttacgtgca agagtgggaa aaattaatca aatcaatgcc aagtgaatat 60 aaaagttctg caagacgttt taagcgtgca tatgaaatta tgacaacaga agcggaaccg 120 gaagttggat taacaccaaa agaggttatt tggaaaaaga acaaagcgaa attatatcgc 180 tatacgccag taaaagataa cctgcataaa acaccaatct tactcgtata tgcattgatc 240 aataaaccgt atattttgga tttaacacct ggaaacagcc ttgttgaata cttattaaac 300 cgcggttttg acgtgtattt gcttgactgg ggaactcctg ggcttgaaga cagcaatatg 360 aagctagatg attatattgt agattatatt ccaaaagcgg cgaaaaaggt gctgcgcact 420 tctaaatctc ctgatttgtc tgttcttggt tactgcatgg gcggaactat gacatctatt 480 tttgctgcat taaatgaaga cttgccgatt aaaaacttaa tttttatgac aagtccattt 540 2o gatttttcgg atacaggttt atacggagca ttcctagatg atcgctactt taatttagat 600 aaagcagtag atacattcgg aaacatccct ccagagatga ttgactttgg aaacaagatg 660 ttaaagccaa tcacgaattt ctacggcccg tatgtaacgt tggtggaccg ttcggaaaat 720 cagcggtttg ttgaaagctg gaagctaatg caaaagtggg ttgctgacgg aatcccattt 780 gctggcgaag cttatcgtca gtggattcgt gacttctatc aacaaaacaa actaatcaat 840 ggtgaacttg aagttcgcgg acgcaaagta gatttaaaaa atattaaagc taatatttta 900 aacattgctg ctagccgtga tcatattgcg atgccgcatc aagtggcagc tttaatggac 960 gctgtttcaa gtgaagataa agagtataaa ttgttgcaaa caggtcacgt atctgttgta 1020 tttggtccaa aagcagtgaa ggaaacatat ccttcaatcg gcgattggct agaaaaacgc 1080 tctaaa 1086 <210> 11 <211> 362 <212> PRT
<213> Bacillus megaterium <400> 11 Met Ala Ile Pro Tyr Val Gln Glu Trp Glu Lys Leu Ile Lys Ser Met Pro Ser Glu Tyr Lys Ser Ser Ala Arg Arg Phe Lys Arg Ala Tyr Glu Ile Met Thr Thr Glu Ala Glu Pro Glu Val Gly Leu Thr Pro Lys Glu Val Ile Trp Lys Lys Asn Lys Ala Lys Leu Tyr Arg Tyr Thr Pro Val 50 Lys Asp Asn Leu His Lys Thr Pro Ile Leu Leu Val Tyr Ala Leu Ile Asn Lys Pro Tyr Ile Leu Asp Leu Thr Pro Gly Asn Ser Leu Val Glu Tyr Leu Leu Asn Arg Gly Phe Asp Val Tyr Leu Leu Asp Trp Gly Thr Pro Gly Leu Glu Asp Ser Asn Met Lys Leu Asp Asp Tyr Ile Val Asp Tyr Ile Pro Lys Ala Ala Lys Lys Val Leu Arg Thr Ser Lys Ser Pro Asp Leu Ser Val Leu Gly Tyr Cys Met Gly Gly Thr Met Thr Ser Ile Phe Ala Ala Leu Asn Glu Asp Leu Pro Ile Lys Asn Leu Ile Phe Met Thr Ser Pro Phe Asp Phe Ser Asp Thr Gly Leu Tyr Gly Ala Phe Leu Asp Asp Arg Tyr Phe Asn Leu Asp Lys Ala Val Asp Thr Phe Gly Asn Ile Pro Pro Glu Met Ile Asp Phe Gly Asn Lys Met Leu Lys Pro Ile Thr Asn Phe Tyr Gly Pro Tyr Val Thr Leu Val Asp Arg Ser Glu Asn Gln Arg Phe Val Glu Ser Trp Lys Leu Met Gln Lys Trp Val Ala Asp Gly Ile Pro Phe Ala Gly Glu Ala Tyr Arg Gln Trp Ile Arg Asp Phe Tyr Gln Gln Asn Lys Leu Ile Asn Gly Glu Leu Glu Val Arg Gly Arg Lys Val Asp Leu Lys Asn Ile Lys Ala Asn Ile Leu Asn Ile Ala Ala Ser Arg Asp His Ile Ala Met Pro His Gln Val Ala Ala Leu Met Asp Ala Val Ser Ser Glu Asp Lys Glu Tyr Lys Leu Leu Gln Thr Gly His Val Ser Val Val Phe Gly Pro Lys Ala Val Lys Glu Thr Tyr Pro Ser Ile Gly Asp Trp Leu Glu Lys Arg Ser Lys <210> 12 <211> 39 <212> DNA
<213> Artificial Sequence SS
<220>
<223> Description of Artificial Sequence: Synthetic <400> 12 aayacrgtna aataynnnac rgtnatynnn gcdatgatg 39 <210> 13 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic <400> 13 gcdatyccdt aygtncarga agghttyaaa 30 <210> 14 <211> 19 <212> DNA
<213> SYNTHETIC
<400> 14 gcttcatgcg tgcggtttg 19 <210> 15 <211> 22 <212> DNA
<213> SYNTHETIC
<400> 15 ggaccgttcg gaaaatcagc gg 22 <210> 16 <211> 20 <212> DNA
<213> SYNTHETIC
<400> 16 cccctttgtc cattgttccc 20 <210> 17 <211> 19 <212> DNA
<213> SYNTHETIC
<400> 17 ccatgtagat tccaccctc 19 <210> 18 ~5 <211> 19 <212> DNA
<213> SYNTHETIC

<400> 18 ctccatctcc tttcttgtg 19 <210> 19 <211> 17 <212> PRT
<213> Bacillus megaterium <400> 19 Lys Val Phe Gly Arg Xaa Glu Leu Ala Ala Ala Met Lys Arg Xaa Gly Leu <210> 20 <211> 15 <212> PRT
<213> Bacillus megaterium <400> 20 Asn Thr Val Lys Tyr Xaa Thr Val Ile Xaa Ala Met Xaa Xaa Gln <210> 21 <211> 11 <212> PRT
<213> Bacillus megaterium <400> 21 Ala Ile Pro Tyr Val Gln Glu Xaa Glu Lys Leu <210> 22 <211> 813 <212> DNA
<213> Bacillus megaterium <400> 22 atggatgcat cacttttgtt agagtatgga tgggtattgc tagtgctggt tgcattagaa 60 ggaattttgg cggcggataa tgctcttgtg atggctatta tggtcaaaca tttaccggaa 120 gaaaaacgca agaaggcatt attttacgga ttagccggtg cctttatttt tagatttggt 180 tcgttgttct tgatttcatt tttagtcgac gtatggcagc ttcaagctat aggagccatt 240 tacttattgt tcatttccat taatcatatt gtgaagcgat atgtgaaaaa agacgatcat 300 gaaaaagtga aagaagcaga cgagaaaaag ggctcaggtt tctggatgac ggttttaaaa 360 gtagaaatag cagacattgc ttttgccgtt gattcaattt tggccgctgt ggctctcgcc 420 gttacgttgc caacaacaaa tcttcctcaa attggcggac tcgacggcgg acaattcttg 480 gtgatcttcg ccggaggaat tatgggatta attattatgc gttttgctgc aacttggttc 540 gtcaagctat taaatacgcg cccaggccta gaaacggcgg cttttgctat tgtaggctgg 600 gtaggagtta agttagcggt ctataccctt gctcatccag agttaggtat tattaatgaa 660 catttccctg aatcaaaagt gtggaaaatt acgttttgga ttgtgttact tggcatagct 720 gcttcaggct ggtttctatc taaaaataaa gaacaaactg atcttgaagg ctcagagaaa 780 gaaaaagaat cgttaaaaaa aattgaaaat caa 813 <210> 23 <211> 271 <212> PRT
<213> Bacillus megaterium <400> 23 Met Asp Ala Ser Leu Leu Leu Glu Tyr Gly Trp Val Leu Leu Val Leu Val Ala Leu Glu Gly Ile Leu Ala Ala Asp Asn Ala Leu Val Met Ala Ile Met Val Lys His Leu Pro Glu Glu Lys Arg Lys Lys Ala Leu Phe Tyr Gly Leu Ala Gly Ala Phe Ile Phe Arg Phe Gly Ser Leu Phe Leu Ile Ser Phe Leu Val Asp Val Trp Gln Leu Gln Ala Ile Gly Ala Ile Tyr Leu Leu Phe Ile Ser Ile Asn His Ile Val Lys Arg Tyr Val Lys Lys Asp Asp His Glu Lys Val Lys Glu Ala Asp Glu Lys Lys Gly Ser Gly Phe Trp Met Thr Val Leu Lys Val Glu Ile Ala Asp Ile Ala Phe Ala Val Asp Ser Ile Leu Ala Ala Val Ala Leu Ala Val Thr Leu Pro Thr Thr Asn Leu Pro Gln Ile Gly Gly Leu Asp Gly Gly Gln Phe Leu Val Ile Phe Ala Gly Gly Ile Met Gly Leu Ile Ile Met Arg Phe Ala Ala Thr Trp Phe Val Lys Leu Leu Asn Thr Arg Pro Gly Leu Glu Thr Ala Ala Phe Ala Ile Val Gly Trp Val Gly Val Lys Leu Ala Val Tyr Thr Leu Ala His Pro Glu Leu Gly Ile Ile Asn Glu His Phe Pro Glu Ser Lys Val Trp Lys Ile Thr Phe Trp Ile Val Leu Leu Gly Ile Ala Ala Ser Gly Trp Phe Leu Ser Lys Asn Lys Glu Gln Thr Asp Leu Glu Gly Ser Glu Lys Glu Lys Glu Ser Leu Lys Lys Ile Glu Asn Gln S <210> 24 <211> 708 <212> DNA
<213> Bacillus megaterium <400> 24 atgctcacaa aagttcaaac gcctccatcg cttgaaacgc ttgtactgac gattcagcaa 60 ggggataaac aattacataa tgaaatgatt caacaatata aaccgtttat tgctaaagtt 120 gtttcagctg tatgtaaacg ttatataagt gaagctgacg atgaatttag cattggtctg 180 attgcattta atgaagccat tgaaaattac acaatccaaa aaggacgatc tcttcttgca 240 tttgcggaac ttattattaa aagaagagta atcgactata ttcgaaaaga aaagcgaaat 300 caaacgctgc tctataaccg aattgaaaat gaaggtttta ttcaaggtaa ggtagaaagg 360 gatatatcgc tttctaacta taaaaggcaa agtgaaactt catatattca agaggaaatg 420 acttattttt gtcaggcgct aaaattgttt aaattaactc ttgaagacat tattaacacg 480 tctcctaaac ataaggatgc aaggggaaat gcagtggaag ttgcatcttt tatcgtcaat 540 gaaaaagaat taaaagataa gctgttttta aagcggcagc ttcctattcg cttgattgaa 600 aaacatgtca aagtaagccg gaaaacaatt gaaagaaacc gtaaatatat tatcgcgatg 660 gttattatat tagcggggga ctacgtgtat ttaaaagact atattatg 708 <210> 25 <211> 236 <212> PRT
<213> Bacillus megaterium <400> 25 Met Leu Thr Lys Val Gln Thr Pro Pro Ser Leu Glu Thr Leu Val Leu Thr Ile Gln Gln Gly Asp Lys Gln Leu His Asn Glu Met Ile Gln Gln 3~ 20 25 30 Tyr Lys Pro Phe Ile Ala Lys Val Val Ser Ala Val Cys Lys Arg Tyr Ile Ser Glu Ala Asp Asp Glu Phe Ser Ile Gly Leu Ile Ala Phe Asn Glu Ala Ile Glu Asn Tyr Thr Ile Gln Lys Gly Arg Ser Leu Leu Ala Phe Ala Glu Leu Ile Ile Lys Arg Arg Val Ile Asp Tyr Ile Arg Lys Glu Lys Arg Asn Gln Thr Leu Leu Tyr Asn Arg Ile Glu Asn Glu Gly ~0 100 105 110 Phe Ile Gln Gly Lys Val Glu Arg Asp Ile Ser Leu Ser Asn Tyr Lys Arg Gln Ser Glu Thr Ser Tyr Ile Gln Glu Glu Met Thr Tyr Phe Cys Gln Ala Leu Lys Leu Phe Lys Leu Thr Leu Glu Asp Ile Ile Asn Thr Ser Pro Lys His Lys Asp Ala Arg Gly Asn Ala Val Glu Val Ala Ser Phe Ile Val Asn Glu Lys Glu Leu Lys Asp Lys Leu Phe Leu Lys Arg Gln Leu Pro Ile Arg Leu Ile Glu Lys His Val Lys Val Ser Arg Lys Thr Ile Glu Arg Asn Arg Lys Tyr Ile Ile Ala Met Val Ile Ile Leu Ala Gly Asp Tyr Val Tyr Leu Lys Asp Tyr Ile Met <210> 26 <211> 957 <212> DNA
<213> Bacillus megaterium <400> 26 atgccacaac catggaaacg acgagtaagg cagatgtctt cagctcaaat tattgttaca 60 ttttacatag tggctgttac gcttgggttt ctattactta gtattccaga agctttaagg 120 ccaggagcaa agttagcatt tattgatcgc ttatttattg ccgttagtgc ggtaagtgta 180 acagggctga cacctgtctc gactccagat acatttagta caacgggcta ttttttactc 240 3o gtttttattt ttcaaatcgg tggtattggt gtaatgacac tcagtacatt tatttggatg 300 attttaggta aaaaaatcgg tctgaaggaa cgtcagctca ttatgacgga ccataatcaa 360 tcccgtttat caggattagt tgatttgatg agaaatattt tatttattat ttttgccatt 420 gaactagttg gcgccattat tttagggtta cattttctcc gttattattc gagctggaca 480 gatgcgtttt tgcatggttt ctttgcttct gtcagtgcta caacaaatgc tggcttcgat 540 attacaggat cttcatttat tccgtatgcc catgattatt tcgtacaagt ggtaaccgtt 600 attttaatta cgcttggagc gattggattc cctgtattaa ttgaaatcaa gcactatttt 660 ttaacattta aagataagcg taaatttcaa ttttcgctat ttacgaagct aacgactatt 720 atgttttttc tgctgttagg agggggaaca atcttgattc ttgtgctaga gcattcagga 780 tttctagcag ataagtcttg ggatgaatcg tttttttatg cgtttttcca atccgctgcc 840 acaaggagcg gaggagtggc gaccatgaat attaatgagt tttcacttcc tacgttaatt 900 atgatgagcg cgatgatgtt tatcggtgct tcaccgagtt cagtaggggg aggaatt 957 <210> 27 <211> 319 <212> PRT
<213> Bacillus megaterium <400> 27 Met Pro Gln Pro Trp Lys Arg Arg Val Arg Gln Met Ser Ser Ala Gln Ile Ile Val Thr Phe Tyr Ile Val Ala Val Thr Leu Gly Phe Leu Leu Leu Ser Ile Pro Glu Ala Leu Arg Pro Gly Ala Lys Leu Ala Phe Ile Asp Arg Leu Phe Ile Ala Val Ser Ala Val Ser Val Thr Gly Leu Thr 5 Pro Val Ser Thr Pro Asp Thr Phe Ser Thr Thr Gly Tyr Phe Leu Leu Val Phe Ile Phe Gln Ile Gly Gly Ile Gly Val Met Thr Leu Ser Thr Phe Ile Trp Met Ile Leu Gly Lys Lys Ile Gly Leu Lys Glu Arg Gln Leu Ile Met Thr Asp His Asn Gln Ser Arg Leu Ser Gly Leu Val Asp Leu Met Arg Asn Ile Leu Phe Ile Ile Phe Ala Ile Glu Leu Val Gly Ala Ile Ile Leu Gly Leu His Phe Leu Arg Tyr Tyr Ser Ser Trp Thr Asp Ala Phe Leu His Gly Phe Phe Ala Ser Val Ser Ala Thr Thr Asn Ala Gly Phe Asp Ile Thr Gly Ser Ser Phe Ile Pro Tyr Ala His Asp Tyr Phe Val Gln Val Val Thr Val Ile Leu Ile Thr Leu Gly Ala Ile Gly Phe Pro Val Leu Ile Glu Ile Lys His Tyr Phe Leu Thr Phe Lys Asp Lys Arg Lys Phe Gln Phe Ser Leu Phe Thr Lys Leu Thr Thr Ile Met Phe Phe Leu Leu Leu Gly Gly Gly Thr Ile Leu Ile Leu Val Leu Glu His Ser Gly Phe Leu Ala Asp Lys Ser Trp Asp Glu Ser Phe Phe Tyr Ala Phe Phe Gln Ser Ala Ala Thr Arg Ser Gly Gly Val Ala Thr Met Asn Ile Asn Glu Phe Ser Leu Pro Thr Leu Ile Met Met Ser Ala Met Met Phe Ile Gly Ala Ser Pro Ser Ser Val Gly Gly Gly Ile <210> 28 <211> 195 <212> DNA
<213> Bacillus megaterium <400> 28 atggctagaa caaataaact attaacacca ggagtagaac aatttttaga tcaatataaa 60 tatgaaatcg ctcaagaatt tggggtaact ctaggttctg acactgctgc acgcagcaac 120 ggttcagtag gcggagaaat cacaaaacgc ttggtgcaac aagctcaagc tcacttaagc 180 ggcagcacac aaaaa 195 <210> 29 <211> 65 <212> PRT
<213> Bacillus megaterium <400> 29 Met Ala Arg Thr Asn Lys Leu Leu Thr Pro Gly Val Glu Gln Phe Leu Asp Gln Tyr Lys Tyr Glu Ile Ala Gln Glu Phe Gly Val Thr Leu Gly Ser Asp Thr Ala Ala Arg Ser Asn Gly Ser Val Gly Gly Glu Ile Thr Lys Arg Leu Val Gln Gln Ala Gln Ala His Leu Ser Gly Ser Thr Gln Lys

Claims

CLAIMS:

1. A nucleic acid segment comprising a nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:2;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:2 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID NO:3;
and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3.

2. The nucleic acid segment of claim 1, wherein the nucleic acid sequence is SEQ ID NO:2.

The nucleic acid segment of claim 1, wherein the nucleic acid sequence encodes SEQ ID
NO:3.

4. An isolated polyhydroxyalkanoate inclusion body associated protein comprising an amino acid sequence selected from the group consisting of:
an amino acid sequence at least about 80% identical to SEQ ID NO:3; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID
NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3.

5. The isolated polyhydroxyalkanoate inclusion body associated protein of claim 4, wherein the amino acid sequence is SEQ ID NO:3.

6. A recombinant vector comprising in the 5' to 3' direction:
a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein;

b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:2;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:2 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3; and c) a 3' transcription terminator.

7. The recombinant vector of claim 6, wherein the nucleic acid sequence is SEQ
ID NO:2.

8. The recombinant vector of claim 6, wherein the nucleic acid sequence encodes SEQ ID
NO:3.

9. A recombinant host cell comprising a nucleic acid segment encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid segment is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:2;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:2 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID NO:3;
and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3.

10. The recombinant host cell of claim 9, wherein the nucleic acid sequence is SEQ ID NO:2.

11. The recombinant host cell of claim 9, wherein the nucleic acid sequence encodes SEQ ID
NO:3.

12. A genetically transformed plant cell comprising in the 5' to 3' direction:
a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein;
b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:2;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:2 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3;
c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence.

13. The genetically transformed plant cell of claim 12, wherein the nucleic acid sequence is SEQ ID NO:2.

14. The genetically transformed plant cell of claim 12, wherein the nucleic acid sequence encodes SEQ ID NO:3.

15. A genetically transformed plant comprising in the 5' to 3' direction:

a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein;
b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:2;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:2 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3;
c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence.

16. The genetically transformed plant of claim 15, wherein the nucleic acid sequence is SEQ
ID NO:2.

17. The genetically transformed plant of claim 15, wherein the nucleic acid sequence encodes SEQ ID NO:3.

18. A method of preparing host cells useful to produce a polyhydroxyalkanoate inclusion body associated protein, the method comprising:
a) selecting a host cell;
b) transforming the selected host cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of:

a nucleic acid sequence at least about 80% identical to SEQ ID NO:2;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:2 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3; and c) obtaining transformed host cells.

19. The method of claim 18, wherein the nucleic acid sequence is SEQ ID NO:2.

20. The method of claim 18, wherein the nucleic acid sequence encodes SEQ ID
NO:3.

21. A method of preparing plants useful to produce a polyhydroxyalkanoate inclusion body associated protein, the method comprising:
a) selecting a host plant cell;
b) transforming the selected host plant cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:2;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:2 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3;
c) obtaining transformed host plant cells; and d) regenerating the transformed host plant cells.

22. The method of claim 21, wherein the nucleic acid sequence is SEQ ID NO:2.

23. The method of claim 21, wherein the nucleic acid sequence encodes SEQ ID
NO:3.

24. A fusion protein comprising:
a green fluorescent protein subunit; and a polyhydroxyalkanoate inclusion body associated protein;
wherein the polyhydroxyalkanoate inclusion body associated protein comprises an amino acid sequence selected from the group consisting of:
an amino acid sequence at least about 80% identical to SEQ ID NO:3; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3.

25. The fusion protein of claim 24, wherein the amino acid sequence is SEQ ID
NO:3.

26. A nucleic acid segment encoding a fusion protein, the nucleic acid segment comprising:
a nucleic acid sequence encoding a green fluorescent protein subunit; and a nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein;
wherein the nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:2;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:2 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3.

27. The nucleic acid segment of claim 26, wherein the nucleic acid sequence is SEQ ID
NO:2.

28. The nucleic acid segment of claim 26, wherein the nucleic acid sequence encodes SEQ
ID NO:3.

29. A nucleic acid segment comprising a nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:4;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:4 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID NO:5;
and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5.

30. The nucleic acid segment of claim 29, wherein the nucleic acid sequence is SEQ ID
NO:4.

31. The nucleic acid segment of claim 29, wherein the nucleic acid sequence encodes SEQ
ID NO:5.

32. An isolated polyhydroxyalkanoate inclusion body associated protein comprising an amino acid sequence selected from the group consisting of:
an amino acid sequence at least about 80% identical to SEQ ID NO:5; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID
NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5.

33. The isolated polyhydroxyalkanoate inclusion body associated protein of claim 32, wherein the amino acid sequence is SEQ ID NO:5.

34. A recombinant vector comprising in the 5' to 3' direction:
a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein;
b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:4;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:4 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5; and c) a 3' transcription terminator.

35. The recombinant vector of claim 34, wherein the nucleic acid sequence is SEQ ID NO:4.

36. The recombinant vector of claim 34, wherein the nucleic acid sequence encodes SEQ ID
NO:5.

37. A recombinant host cell comprising a nucleic acid segment encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid segment is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:4;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:4 or the complement thereof;

a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID NO:5;
and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5.

38. The recombinant host cell of claim 37, wherein the nucleic acid sequence is SEQ ID
N0:4.

39. The recombinant host cell of claim 37, wherein the nucleic acid sequence encodes SEQ
ID NO:5.

40. A genetically transformed plant cell comprising in the 5' to 3' direction:
a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein;
b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:4;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:4 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5;
c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence.

41. The genetically transformed plant cell of claim 40, wherein the nucleic acid sequence is SEQ ID NO:4.

42. The genetically transformed plant cell of claim 40, wherein the nucleic acid sequence encodes SEQ ID NO:5.

43. A genetically transformed plant comprising in the 5' to 3' direction:
a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein;
b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:4;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:4 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5;
c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence.

44. The genetically transformed plant of claim 43, wherein the nucleic acid sequence is SEQ
ID NO:4.

45. The genetically transformed plant of claim 43, wherein the nucleic acid sequence encodes SEQ ID NO:5.

46. A method of preparing host cells useful to produce a polyhydroxyalkanoate inclusion body associated protein, the method comprising:
a) selecting a host cell;
b) transforming the selected host cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID N0:4;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:4 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5; and c) obtaining transformed host cells.

47. The method of claim 46, wherein the nucleic acid sequence is SEQ ID NO:4.

48. The method of claim 46, wherein the nucleic acid sequence encodes SEQ ID
NO:5.

49. A method of preparing plants useful to produce a polyhydroxyalkanoate inclusion body associated protein, the method comprising:
a) selecting a host plant cell;
b) transforming the selected host plant cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:4;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:4 or the complement thereof;

a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:S as an antigen, the antibody being immunoreactive with SEQ ID NO:5;
c) obtaining transformed host plant cells; and d) regenerating the transformed host plant cells.

50. The method of claim 49, wherein the nucleic acid sequence is SEQ ID NO:4.

51. The method of claim 49, wherein the nucleic acid sequence encodes SEQ ID
NO:5.

52. A fusion protein comprising:
a green fluorescent protein subunit; and a polyhydroxyalkanoate inclusion body associated protein;
wherein the polyhydroxyalkanoate inclusion body associated protein comprises an amino acid sequence selected from the group consisting of:
an amino acid sequence at least about 80% identical to SEQ ID NO:5; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5.

53. The fusion protein of claim 52, wherein the amino acid sequence is SEQ ID
NO:5.

54. A nucleic acid segment encoding a fusion protein, the nucleic acid segment comprising:
a nucleic acid sequence encoding a green fluorescent protein subunit; and a nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein;
wherein the nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:4;

a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:4 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5.

55. The nucleic acid segment of claim 54, wherein the nucleic acid sequence is SEQ ID
NO:4.

56. The nucleic acid segment of claim 54, wherein the nucleic acid sequence encodes SEQ
ID NO:5.

57. A nucleic acid segment comprising a nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:6;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:6 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID NO:7;
and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7.

58. The nucleic acid segment of claim 57, wherein the nucleic acid sequence is SEQ ID
NO:6.

59. The nucleic acid segment of claim 57, wherein the nucleic acid sequence encodes SEQ
ID NO:7.

60. An isolated polyhydroxyalkanoate inclusion body associated protein comprising an amino acid sequence selected from the group consisting of:
an amino acid sequence at least about 80% identical to SEQ ID N0:7; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID
NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7.

61. The isolated polyhydroxyalkanoate inclusion body associated protein of claim 60, wherein the amino acid sequence is SEQ ID NO:7.

62. A recombinant vector comprising in the 5' to 3' direction:
a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein;
b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:6;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:6 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7; and c) a 3' transcription terminator.

63. The recombinant vector of claim 62, wherein the nucleic acid sequence is SEQ ID NO:6.

64. The recombinant vector of claim 62, wherein the nucleic acid sequence encodes SEQ ID
NO:7.

65. A recombinant host cell comprising a nucleic acid segment encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid segment is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:6;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:6 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID NO:7;
and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7.

66. The recombinant host cell of claim 65, wherein the nucleic acid sequence is SEQ ID
NO:6.

67. The recombinant host cell of claim 65, wherein the nucleic acid sequence encodes SEQ
ID NO:7.

68. A genetically transformed plant cell comprising in the 5' to 3' direction:
a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein;
b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:6;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:6 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7;
c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence.

69. The genetically transformed plant cell of claim 68, wherein the nucleic acid sequence is SEQ ID NO:6.

70. The genetically transformed plant cell of claim 68, wherein the nucleic acid sequence encodes SEQ ID NO:7.

71. A genetically transformed plant comprising in the 5' to 3' direction:
a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein;
b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:6;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:6 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7;
c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence.

72. The genetically transformed plant of claim 71, wherein the nucleic acid sequence is SEQ
ID NO:6.

73. The genetically transformed plant of claim 71, wherein the nucleic acid sequence encodes SEQ ID NO:7.

74. A method of preparing host cells useful to produce a polyhydroxyalkanoate inclusion body associated protein, the method comprising:
a) selecting a host cell;
b) transforming the selected host cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:6;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:6 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7; and c) obtaining transformed host cells.

75. The method of claim 74, wherein the nucleic acid sequence is SEQ ID NO:6.

76. The method of claim 74, wherein the nucleic acid sequence encodes SEQ ID
NO:7.

77. A method of preparing plants useful to produce a polyhydroxyalkanoate inclusion body associated protein, the method comprising:
a) selecting a host plant cell;
b) transforming the selected host plant cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:6;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:6 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7;
c) obtaining transformed host plant cells; and d) regenerating the transformed host plant cells.

78. The method of claim 77, wherein the nucleic acid sequence is SEQ ID NO:6.

79. The method of claim 77, wherein the nucleic acid sequence encodes SEQ ID
NO:7.

80. A fusion protein comprising:
a green fluorescent protein subunit; and a polyhydroxyalkanoate inclusion body associated protein;
wherein the polyhydroxyalkanoate inclusion body associated protein comprises an amino acid sequence selected from the group consisting of:
an amino acid sequence at least about 80% identical to SEQ ID NO:7; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7.

81. The fusion protein of claim 80, wherein the amino acid sequence is SEQ ID
NO:7.

82. A nucleic acid segment encoding a fusion protein, the nucleic acid segment comprising:
a nucleic acid sequence encoding a green fluorescent protein subunit; and a nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein;
wherein the nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:6;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:6 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7.

83. The nucleic acid segment of claim 82, wherein the nucleic acid sequence is SEQ ID
NO:6.

84. The nucleic acid segment of claim 82, wherein the nucleic acid sequence encodes SEQ
ID NO:7.

85. A nucleic acid segment comprising a nucleic acid sequence encoding a 3-keto-acyl-CoA
reductase protein, wherein the nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:8;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:8 or the complement thereof;

a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID NO:9;
and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9.

86. The nucleic acid segment of claim 85, wherein the nucleic acid sequence is SEQ ID
NO:8.

87. The nucleic acid segment of claim 85, wherein the nucleic acid sequence encodes SEQ
ID NO:9.

88. An isolated 3-keto-acyl-CoA reductase protein comprising an amino acid sequence selected from the group consisting of:
an amino acid sequence at least about 80% identical to SEQ ID NO:9; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID
NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9.

89. The isolated 3-keto-acyl-CoA reductase protein of claim 88, wherein the amino acid sequence is SEQ ID NO:9.

90. A recombinant vector comprising in the 5' to 3' direction:
a) a promoter that directs transcription of a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein;
b) a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein;
wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:8;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:8 or the complement thereof;

a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9; and c) a 3' transcription terminator.

91. The recombinant vector of claim 90, wherein the nucleic acid sequence is SEQ ID NO:8.

92. The recombinant vector of claim 90, wherein the nucleic acid sequence encodes SEQ ID
NO:9.

93. A recombinant host cell comprising a nucleic acid segment encoding a 3-keto-acyl-CoA
reductase protein, wherein the nucleic acid segment is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:8;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:8 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID NO:9;
and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9.

94. The recombinant host cell of claim 93, wherein the nucleic acid sequence is SEQ ID
NO:8.

95. The recombinant host cell of claim 93, wherein the nucleic acid sequence encodes SEQ
ID NO:9.

96. A genetically transformed plant cell comprising in the 5' to 3' direction:

a) a promoter that directs transcription of a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein;
b) a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein;
wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:8;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:8 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9;
c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence.

97. The genetically transformed plant cell of claim 96, wherein the nucleic acid sequence is SEQ ID NO:8.

98. The genetically transformed plant cell of claim 96, wherein the nucleic acid sequence encodes SEQ ID NO:9.

99. A genetically transformed plant comprising in the 5' to 3' direction:
a) a promoter that directs transcription of a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein;
b) a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein;
wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:8;

a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:8 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9;
c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence.

100. The genetically transformed plant of claim 99, wherein the nucleic acid sequence is SEQ
ID NO:8.

101. The genetically transformed plant of claim 99, wherein the nucleic acid sequence encodes SEQ ID NO:9.

102. A method of preparing host cells useful to produce a 3-keto-acyl-CoA
reductase protein, the method comprising:
a) selecting a host cell;
b) transforming the selected host cell with a recombinant vector having a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein, wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:8;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:8 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9; and c) obtaining transformed host cells.

103. The method of claim 102, wherein the nucleic acid sequence is SEQ ID
NO:8.

104. The method of claim 102, wherein the nucleic acid sequence encodes SEQ ID
NO:9.

105. A method of preparing plants useful to produce a 3-keto-acyl-CoA
reductase protein, the method comprising:
a) selecting a host plant cell;
b) transforming the selected host plant cell with a recombinant vector having a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein, wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:8;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:8 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9;
c) obtaining transformed host plant cells; and d) regenerating the transformed host plant cells.

106. The method of claim 105, wherein the nucleic acid sequence is SEQ ID
NO:8.

107. The method of claim 105, wherein the nucleic acid sequence encodes SEQ ID
NO:9.

108. A fusion protein comprising:
a green fluorescent protein subunit; and a 3-keto-acyl-CoA reductase protein;
wherein the 3-keto-acyl-CoA reductase protein comprises an amino acid sequence selected from the group consisting of:
an amino acid sequence at least about 80% identical to SEQ ID NO:9; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9.

109. The fusion protein of claim 108, wherein the amino acid sequence is SEQ
ID NO:9.

110. A nucleic acid segment encoding a fusion protein, the nucleic acid segment comprising:
a nucleic acid sequence encoding a green fluorescent protein subunit; and a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein;
wherein the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:8;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:8 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9.

111. The nucleic acid segment of claim 110, wherein the nucleic acid sequence is SEQ ID
NO:8.

112. The nucleic acid segment of claim 110, wherein the nucleic acid sequence encodes SEQ
ID NO:9.

113. A nucleic acid segment comprising a nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein, wherein the nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:10;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:10 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11.

114. The nucleic acid segment of claim 113, wherein the nucleic acid sequence is SEQ ID
NO:10.

115. The nucleic acid segment of claim 113, wherein the nucleic acid sequence encodes SEQ
ID NO:11.

116. An isolated polyhydroxyalkanoate synthase protein comprising an amino acid sequence selected from the group consisting of:
an amino acid sequence at least about 80% identical to SEQ ID NO:11; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID
NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11.

117. The isolated polyhydroxyalkanoate synthase protein of claim 116, wherein the amino acid sequence is SEQ ID NO:11.

118. A recombinant vector comprising in the 5' to 3' direction:
a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein;

b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:10;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:10 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11; and c) a 3' transcription terminator.

119. The recombinant vector of claim 118, wherein the nucleic acid sequence is SEQ ID
NO:10.

120. The recombinant vector of claim 118, wherein the nucleic acid sequence encodes SEQ ID
NO:11.

121. A recombinant host cell comprising a nucleic acid segment encoding a polyhydroxyalkanoate synthase protein, wherein the nucleic acid segment is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:10;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:10 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11.

122. The recombinant host cell of claim 121, wherein the nucleic acid sequence is SEQ ID
NO:10.

123. The recombinant host cell of claim 121, wherein the nucleic acid sequence encodes SEQ
ID NO:11.

124. A genetically transformed plant cell comprising in the 5' to 3' direction:
a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein;
b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:10;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:10 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11;
c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence.

125. The genetically transformed plant cell of claim 124, wherein the nucleic acid sequence is SEQ ID NO:10.

126. The genetically transformed plant cell of claim 124, wherein the nucleic acid sequence encodes SEQ ID NO:11.

127. A genetically transformed plant comprising in the 5' to 3' direction:
a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein;
b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:10;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:10 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11;
c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence.

128. The genetically transformed plant of claim 127, wherein the nucleic acid sequence is SEQ ID NO:10.

129. The genetically transformed plant of claim 127, wherein the nucleic acid sequence encodes SEQ ID NO:11.

130. A method of preparing host cells useful to produce a polyhydroxyalkanoate synthase protein, the method comprising:
a) selecting a host cell;
b) transforming the selected host cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein, wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:10;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:10 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11; and c) obtaining transformed host cells.

131. The method of claim 130, wherein the nucleic acid sequence is SEQ ID
NO:10.

132. The method of claim 130, wherein the nucleic acid sequence encodes SEQ ID
NO:11.

133. A method of preparing plants useful to produce a polyhydroxyalkanoate synthase protein, the method comprising:
a) selecting a host plant cell;
b) transforming the selected host plant cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein, wherein the structural nucleic acid sequence is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:10;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:10 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11;

c) obtaining transformed host plant cells; and d) regenerating the transformed host plant cells.

134. The method of claim 133, wherein the nucleic acid sequence is SEQ ID
NO:10.

135. The method of claim 133, wherein the nucleic acid sequence encodes SEQ ID
NO:11.

136. A fusion protein comprising:
a green fluorescent protein subunit; and a polyhydroxyalkanoate synthase protein;
wherein the polyhydroxyalkanoate synthase protein comprises an amino acid sequence selected from the group consisting of:
an amino acid sequence at least about 80% identical to SEQ ID NO:11; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11.

137. The fusion protein of claim 136, wherein the amino acid sequence is SEQ
ID NO:11.

138. A nucleic acid segment encoding a fusion protein, the nucleic acid segment comprising:
a nucleic acid sequence encoding a green fluorescent protein subunit; and a nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein;
wherein the nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:10;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID
NO:10 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ
ID
NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11.

139. The nucleic acid segment of claim 138, wherein the nucleic acid sequence is SEQ ID
NO:10.

140. The nucleic acid segment of claim 138, wherein the nucleic acid sequence encodes SEQ
ID NO:11.

141. A method for the preparation of polyhydroxyalkanoate, the method comprising:
a) obtaining a cell comprising:
a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a nucleic acid sequence encoding a PHA synthase protein;
wherein:
the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is not naturally found in the cell;
the nucleic acid sequence encoding a PHA synthase protein is not naturally found in the cell;
the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID
NO:8;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80%
identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID
NO:9; and the nucleic acid sequence encoding a PHA synthase protein is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID
NO:10;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80%
identical to SEQ ID NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID
NO:11; and b) culturing the cell under conditions suitable for the preparation of polyhydroxyalkanoate.

142. The method of claim 141, wherein the nucleic acid sequence encoding a 3-keto-acyl-CoA
reductase protein is SEQ ID NO:8.

143. The method of claim 141, wherein the nucleic acid sequence encoding a 3-keto-acyl-CoA
reductase protein encodes SEQ ID NO:9.

144. The method of claim 141, wherein the nucleic acid sequence encoding a PHA
synthase protein is SEQ ID NO:10.

145. The method of claim 141, wherein the nucleic acid sequence encoding a PHA
synthase protein encodes SEQ ID NO:11.

146. A method for the preparation of polyhydroxyalkanoate, the method comprising:
a) obtaining a plant comprising:
a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a nucleic acid sequence encoding a PHA synthase protein;

wherein:
the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is not naturally found in the plant;
the nucleic acid sequence encoding a PHA synthase protein is not naturally found in the plant;
the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID
NO:8;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80%
identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID
NO:9; and the nucleic acid sequence encoding a PHA synthase protein is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID
NO:10;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80%
identical to SEQ ID NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID
NO:11; and b) growing the plant under conditions suitable for the preparation of polyhydroxyalkanoate.

147. The method of claim 146, wherein the nucleic acid sequence encoding a 3-keto-acyl-CoA
reductase protein is SEQ ID NO:8.

148. The method of claim 146, wherein the nucleic acid sequence encoding a 3-keto-acyl-CoA
reductase protein encodes SEQ ID NO:9.

149. The method of claim 146, wherein the nucleic acid sequence encoding a PHA
synthase protein is SEQ ID NO:10.

150. The method of claim 146, wherein the nucleic acid sequence encoding a PHA
synthase protein encodes SEQ ID NO:11.

151. A method for the preparation of polyhydroxyalkanoate, the method comprising:
a) obtaining a cell comprising:
a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a nucleic acid sequence encoding a PHA synthase protein;
wherein:
the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is not naturally found in the cell;
the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID
NO:8;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80%
identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID
NO:9; and b) culturing the cell under conditions suitable for the preparation of polyhydroxyalkanoate.

152. The method of claim 151, wherein the nucleic acid sequence encoding a 3-keto-acyl-CoA
reductase protein is SEQ ID NO:8.

153. The method of claim 151, wherein the nucleic acid sequence encoding a 3-keto-acyl-CoA
reductase protein encodes SEQ ID NO:9.

154. A method for the preparation of polyhydroxyalkanoate, the method comprising:
a) obtaining a plant comprising:
a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a nucleic acid sequence encoding a PHA synthase protein;
wherein:
the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is not naturally found in the plant;
the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID
NO:8;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80%
identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID
NO:9; and b) growing the plant under conditions suitable for the preparation of polyhydroxyalkanoate.

155. The method of claim 154, wherein the nucleic acid sequence encoding a 3-keto-acyl-CoA
reductase protein is SEQ ID NO:8.

156. The method of claim 154, wherein the nucleic acid sequence encoding a 3-keto-acyl-CoA
reductase protein encodes SEQ ID NO:9.

157. A method for the preparation of polyhydroxyalkanoate, the method comprising:
a) obtaining a cell comprising:
a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a nucleic acid sequence encoding a PHA synthase protein;
wherein:
the nucleic acid sequence encoding a PHA synthase protein is not naturally found in the cell;
the nucleic acid sequence encoding a PHA synthase protein is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID
NO:10;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80%
identical to SEQ ID NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID
NO:11; and b) culturing the cell under conditions suitable for the preparation of polyhydroxyalkanoate.

158. The method of claim 157, wherein the nucleic acid sequence encoding a PHA
synthase protein is SEQ ID NO:10.

159. The method of claim 157, wherein the nucleic acid sequence encoding a PHA
synthase protein encodes SEQ ID NO:11.

160. A method for the preparation of polyhydroxyalkanoate, the method comprising:
a) obtaining a plant comprising:
a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a nucleic acid sequence encoding a PHA synthase protein;
wherein:
the nucleic acid sequence encoding a PHA synthase protein is not naturally found in the plant;
the nucleic acid sequence encoding a PHA synthase protein is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID
NO:10;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80%
identical to SEQ ID NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID
NO:11; and b) growing the plant under conditions suitable for the preparation of polyhydroxyalkanoate.

161. The method of claim 160, wherein the nucleic acid sequence encoding a PHA
synthase protein is SEQ ID NO:10.

162. The method of claim 160, wherein the nucleic acid sequence encoding a PHA
synthase protein encodes SEQ ID NO:11.

163. A method for the preparation of polyhydroxyalkanoate, the method comprising:
a) obtaining a recombinant host cell comprising:
a nucleic acid sequence encoding a .beta.-ketothiolase protein;
a nucleic acid sequence encoding a 3-ketoacyl-CoA reductase protein;
a nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein;
a nucleic acid sequence encoding a .beta.-hydroxyacyl-CoA dehydrase; and a nucleic acid sequence encoding an acyl-CoA dehydrogenase protein or an enoyl-CoA reductase protein; and b) culturing the recombinant host cell under conditions suitable for the preparation of polyhydroxyalkanoate; wherein:
the polyhydroxyalkanoate comprises C6, C8, or C10 monomer subunits;
the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of:
a nucleic acid sequence at least about 80% identical to SEQ ID NO:8;
a nucleic acid sequence that hybridizes under stringent conditions to SEQ
ID NO:8 or the complement thereof;
a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9.