AU2494900A

AU2494900A - Polyhydroxyalkanoate biosynthesis associated proteins and coding region in bacillus megaterium

Info

Publication number: AU2494900A
Application number: AU24949/00A
Authority: AU
Inventors: Francis C. Cannon; Maura C. Cannon; Kenneth J. Gruys; Gabriel J. Mccool; Henry E. Valentin
Original assignee: University of Massachusetts UMass
Current assignee: University of Massachusetts UMass
Priority date: 1999-01-07
Filing date: 2000-01-07
Publication date: 2000-07-24
Anticipated expiration: 2020-01-07
Also published as: JP2003523170A; AU771433B2

Description

WO 00/40730 PCT/USOO/00364 POLYHYDROXYALKANOATE BIOSYNTHESIS ASSOCIATED PROTEINS AND CODING REGION IN BACILLUS MEGA TERIUM FIELD OF THE INVENTION The invention relates to nucleic acid and amino acid sequences involved in 5 polyhydroxyalkanoate biosynthesis, and more specifically, to polyhydroxyalkanoate biosynthesis sequences isolated from Bacillus megaterium. In particular, nucleic acid sequences phaP, phaQ, phaR, phaB, phaC, and their encoded amino acid sequences are disclosed. BACKGROUND OF THE INVENTION This patent application is related to U.S. Provisional Application Serial Number 10 60/115,092, filed on January 7, 1999. The government may own partial rights to the present invention pursuant to grant number MCB 9604450 from the National Science Foundation. Polyhydroxyalkanoic acids (PHA) are a class of aliphatic polyesters that accumulate in inclusion-bodies in many bacteria and archaea (2, 41). Their physiological role in the cell is that of carbon and energy reserves, and as a sink for reducing power. The most studied PHA have is repeating subunits of: -[O-CH(R)(CH 2 )xCO]-, where the most common form is polyhydroxybutyrate (PHB), with R = CH 3 and x = 1 (45). The PHA biosynthetic pathway has been determined for Alcaligenes eutrophus (17, 18, 44). In this organism two molecules of acetyl-Coenzyme A (CoA) are condensed by P-ketothiolase (PhaA). followed by a stereo specific reduction catalyzed by an NADPH dependent acetoacetyl-CoA reductase (PhaB) to 20 produce the monomer D-(-)-p-hydroxybutyryl-CoA, which is polymerized by PHA synthase (PhaC). These 3 pha genes are coded on the phaCAB operon. which is speculated to be constitutively expressed, but PHA is not constitutively synthesized. Alternative pathways for synthesis of the monomer in other organisms have been suggested, most notably in the Pseudomonas species where the side chain, R. is longer than CH 3 and its composition is 25 influenced by carbon substrates in the growth medium (7, 45). In addition to A. eutrophus, phaC has been cloned from more than twenty different bacteria (26, 43). Other genes associated with PHA synthesis, phaA, phaB, phaZ (PHA depolymerase) and genes for inclusion-body associated proteins and other low molecular weight proteins of unknown function, have also been cloned from some of these bacteria, in many cases by virtue of the fact that they are clustered with 30 phaC.

WO 00/40730 PCT/US00/00364 -2 PHA inclusion-bodies are 0.2 to 0.5ptm in diameter, but their structural details are largely unknown. They were described originally for some species of Bacillus (6, 8, 15, 30, 47) and later for many more bacteria including Pseudomonas, Alcaligenes and Rhodococcus (5, 11, 12, 25, 42). Those from Bacillus megaterium were shown to contain 97.7% PHA, 1.87% protein 5 and 0.46% lipid with protein and lipid forming an outer layer (15). More recent reports show the presence of a 14 kDa protein (GA14) on PHA inclusion-bodies of R. ruber (36, 37), and a 24 kDa protein (GA24) with similarities to GA14 on the inclusion-bodies of A. eutrophus (48). These proteins are not essential for PHA accumulation but have been shown to influence the size of PHA inclusion-bodies and the rate of PHA accumulation (37, 48). GA14 and GA24 have to been named "phasins" due to some similarities with oleosins, which are proteins on the surface of oil bodies in plant seeds (21). Granule associated proteins are wide-spread in PHA accumulating bacteria (49). The pattern of PHA inclusion-body growth and proliferation throughout the growth cycle of Bacillus megaterium has been described (32). is There exists a need for additional nucleic acid and amino acid sequences useful for the production of polymers in biological systems. SUMMARY OF THE INVENTION This invention is the result of a study of PHA inclusion-body associated proteins from Bacillus megaterium and the cloning and analysis of their coding region. The transcription starts 20 were identified, the functional expression of several of the sequences was confirmed in Escherichia coli and in PHA negative mutants of Bacillus megaterium and Pseudomonas putida, and PhaP and PhaC were localized to PHA inclusion-bodies throughout growth. A nucleic acid fragment encoding proteins involved in polyhydroxyalkanoate biosynthesis was isolated from Bacillus megaterium. Nine nucleic acid sequences and their 25 encoded amino acid sequences are disclosed. Sequences encoding PhaB and PhaC display not insignificant percent identity and similarity to known acetoacetyl-CoA reductase and polyhydroxyalkanoate synthase proteins, while sequences encoding PhaP, PhaQ, and PhaR do not display significant similarity to known sequences. YkoY is similar to known toxic anion resistance proteins; YkoZ is similar to known RNA polymerase sigma factors; YkrM is similar WO 00/40730 PCT/USO0/00364 -3 to known Na* -transporting ATP synthase proteins; and SspD matches the known B. megaterium spore specific DNA binding protein. While several PHA related sequences were expressed in two organisms, it is envisioned that the sequences may be expressed in a wide array of organisms, and that the nucleic acid 5 sequences themselves may be modified to change the sequence and properties of the encoded proteins. DESCRIPTION OF THE FIGURES The following figures form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by io reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. Figure 1. PHA inclusion-body associated proteins. SDS-polyacrylamide gel electrophoresis of proteins released from purified PHA inclusion-bodies. Lane 1, molecular weight markers in kDa, 14, 18, 29, 43, 68 and 97. Lane 2, proteins from inclusion-bodies of is cells harvested at late exponential growth phase. Lane 3, same as lane 2 except this part of the gel was stained following 45 minutes transfer of proteins (seen in lane 2) to PVDF membrane. The bands were visualized by staining with Coomassie Blue. Figure 2 (A): The pha sequence cluster and flanking sequences. Map of cloned fragment in pGM10 carrying the pha genes (stripped arrows), intergenic regions (igrs) and flanking genes 20 (thick black arrows) from Bacillus megaterium. The thin arrows indicate the locations and directions of transcripts; P, indicates promoter positions. pGM1, pGM6, pGM9 and pGM7 indicate the cloned DNA fragments in these plasmids (Table 1). Probes used to identify and clone the pha cluster are indicated by thick short lines under pGM1; n2 and n5 are degenerate probes; bmp and bmc are homologous probes to the ends of the pGM1 fragment. Ruler of 25 sequence in base pairs is for Bacillus megaterium and B. subtilis. Map of yko, sspD and ykr region in the B. subtilis genome; genes with homology to those of Bacillus megaterium in this region are indicted by thick black arrows; non-homologous genes are indicated by thick gray arrows. Gene annotations are horizontal over each gene symbol. Relevant restriction enzyme sites are vertical.

WO 00/40730 PCTIUS00/00364 -4 Figure 2 (B): Putative promoter regions for phaRBC, -Q, -P and sspD. Curved arrows indicate transcription start (+1), -10 and -35 nucleotides. The closest resemblance to known -10 and -35 promoter sequences are in lower case letters below putative pha promoter sequences. Immediately downstream from the PhaP stop codon, the previously described (9) sspD putative 5 promoter is boxed, and putative hairpin structure is underlined. Figure 2 (C): Mapping of the 5' ends of the phaRBC, -Q and -P transcripts (see Example 11). Lanes G, A, T and C show the dideoxy sequencing ladders obtained with the same primers used in primer extension analysis; nucleotide sequences are complementary to the transcripts. Lane P is the primer extension product. Lane M is a DNA molecular size marker measured in 10 nucleotides. The primer extension product is indicated by an arrowhead and the 5' end of the transcript within the sequence is indicated by a star. Only regions of the gel containing extension product bands are shown. Figure 3: Pairwise alignment of PhaC from Bacillus megaterium (this study) and P. oleovorans (SWISS-PROT accession no. P26494); amino acid identities are shown in black. 15 The Clustal method with PAM250 residue weight table was used. Figure 4. pha: :gfp fusion plasmids and precursors. Only relevant restriction sites are shown. Annotations are as Figure 2. In all fusions the c-terminus excluding the stop codon, of either phaC or phaP, is fused to the gfp gene by the pGFPuv polylinker. For more details, see Table 1. 20 Figure 5 (A): Time-course analysis of Bacillus megaterium (pGM 16.2) by phase contrast, green fluorescence, light image, and PHA fluorescence. Time (hours) are hours post-inoculation as indicated. Figure 5 (B): Growth curve for Figure 5 (A); arrowheads indicate a decrease in PhaP::GFP fluorescence. 25 Figure 5 (C): Bacillus megaterium (pGM16.2) sampled at 2 days post-inoculation. Top image is phase contrast, bottom image is GFP fluorescence. Figure 5 (D): Bacillus megaterium (pGM13) sampled at 2 days post-inoculation, left whole cells, right -lysed cells. Top image is phase contrast, bottom image is GFP fluorescence. Figure 5 (E): Bacillus megaterium (pGM13C) sampled at 9 hours post-inoculation. Top 30 image is phase contrast, bottom image is GFP fluorescence.

WO 00/40730 PCT/USOO/00364 -5 Figure 5 (F): Bacillus megaterium (pHPS9) showed no fluorescence at any time point. Top image is phase contrast, bottom image is GFP fluorescence. Figure 6: Hydrophilicity plot of PhaP protein. Figure 7: Hydrophilicity plot of PhaQ protein. 5 Figure 8: Hydrophilicity plot of PhaR protein. Figure 9: Pairwise alignment of PhaC from Bacillus megaterium (this study) and T violacea (SWISS-PROT accession no. P45366); amino acid identities are indicated by a star (*), and amino acid similarities are indicated by a period (.) below the sequences. The ClustalW method with PAM350 residue weight table was used. 10 Figure 10: Proposed biosynthetic pathway for the preparation of C8 copolymers. DESCRIPTION OF THE SEQUENCE LISTINGS The following sequence listings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these sequences in combination with the detailed is description of specific embodiments presented herein.

WO 00/40730 PCT/US00/00364 -6 SEQ ID NO Description 1 Bacillus megaterium 7,916 bp fragment 2 phaP nucleic acid sequence, 2566-3075 reverse complement 3 PhaP amino acid sequence, 170 amino acids 4 phaQ nucleic acid sequence, 3247-3684 reverse complement 5 PhaQ amino acid sequence, 146 amino acids 6 phaR nucleic acid sequence, 4170-4673 7 PhaR amino acid sequence, 168 amino acids 8 phaB nucleic acid sequence, 4758-5498 9 PhaB amino acid sequence, 247 amino acids 10 phaC nucleic acid sequence, 5578-6663 11 PhaC amino acid sequence, 362 amino acids 12 oligonucleotide probe n2, 39 bases 13 oligonucleotide probe n5, 30 bases 14 oligonucleotide probe bmp, 19 bases 15 oligonucleotide probe bmc, 22 bases 16 oligonucleotide primer for phaP transcription start, 20 bases 17 oligonucleotide primer for phaQ transcription start, 19 bases 18 oligonucleotide primer for phaRBC transcription start, 19 bases 19 N-terminal amino acid sequence of 14 kDa protein 20 N-terminal amino acid sequence of 20 kDa protein 21 N-terminal amino acid sequence of 41 kDa protein 22 ykoYnucleic acid sequence, 277-1089 23 YkoY amino acid sequence, 271 amino acids 24 ykoZ nucleic acid sequence, 1460-2167 25 YkoZ amino acid sequence, 236 amino acids 26 ykrMnucleic acid sequence, 6959-7916 (partial) 27 YkrM amino acid sequence, 319 amino acids (partial) 28 sspD nucleic acid sequence, 2419-2225 reverse complement 29 SspD amino acid sequence, 65 amino acids DEFINITIONS The following definitions are provided in order to aid those skilled in the art in understanding the detailed description of the present invention. "C-terminal region" refers to the region of a peptide, polypeptide, or protein chain from 5 the middle thereof to the end that carries the amino acid having a free a carboxyl group (the C terminus). "CoA" refers to coenzyme A.

WO 00/40730 PCT/US0O/00364 -7 The phrases "coding sequence", "open reading frame", and "structural sequence" refer to the region of continuous sequential nucleic acid triplets encoding a protein, polypeptide, or peptide sequence. The term "encoding DNA" or "encoding nucleic acid" refers to chromosomal nucleic 5 acid, plasmid nucleic acid, cDNA, or synthetic nucleic acid which codes on expression for any of the proteins or fusion proteins discussed herein. The term "genome" as it applies to bacteria encompasses both the chromosome and plasmids within a bacterial host cell. Encoding nucleic acids of the present invention introduced into bacterial host cells can therefore be either chromosomally-integrated or plasmid-localized. 1o The term "genome" as it applies to plant cells encompasses not only chromosomal DNA found within the nucleus, but organelle DNA found within subcellular components of the cell. Nucleic acids of the present invention introduced into plant cells can therefore be either chromosomally integrated or organelle-localized. "Identity" refers to the degree of similarity between two nucleic acid or protein 15 sequences. An alignment of the two sequences is performed by a suitable computer program. A widely used and accepted computer program for performing sequence alignments is CLUSTALW vl.6 (Thompson, et al. Nucl. Acids Res., 22: 4673-4680, 1994). The number of matching bases or amino acids is divided by the total number of bases or amino acids, and multiplied by 100 to obtain a percent identity. For example, if two 580 base pair sequences had 20 145 matched bases, they would be 25 percent identical. If the two compared sequences are of different lengths, the number of matches is divided by the shorter of the two lengths. For example, if there were 100 matched amino acids between 200 and a 400 amino acid proteins, they are 50 percent identical with respect to the shorter sequence. If the shorter sequence is less than 150 bases or 50 amino acids in length, the number of matches are divided by 150 (for 25 nucleic acids) or 50 (for proteins); and multiplied by 100 to obtain a percent identity. The terms "microbe" or "microorganism" refer to algae, bacteria, fungi, and protozoa. "N-terminal region" refers to the region of a peptide, polypeptide, or protein chain from the amino acid having a free amino group to the middle of the chain. "Nucleic acid" refers to ribonucleic acid (RNA) and deoxyribonucleic acid (DNA). 30 A "nucleic acid segment" is a nucleic acid molecule that has been isolated free of total genomic DNA of a particular species, or that has been synthesized. Included with the term WO 00/40730 PCT/USOO/00364 -8 "nucleic acid segment" are DNA segments, recombinant vectors, plasmids, cosmids, phagemids, phage, viruses, etcetera. "Overexpression" refers to the expression of a polypeptide or protein encoded by a DNA introduced into a host cell, wherein said polypeptide or protein is either not normally present in 5 the host cell, or wherein said polypeptide or protein is present in said host cell at a higher level than that normally expressed from the endogenous gene encoding said polypeptide or protein. The term "plastid" refers to the class of plant cell organelles that includes amyloplasts, chloroplasts, chromoplasts, elaioplasts, eoplasts, etioplasts, leucoplasts, and proplastids. These organelles are self-replicating, and contain what is commonly referred to as the chloroplastt 10 genome," a circular DNA molecule that ranges in size from about 120 to about 217 kb, depending upon the plant species, and which usually contains an inverted repeat region (Fosket, Plant growth and Development, Academic Press, Inc., San Diego, CA, p. 132, 1994). "Polyadenylation signal" or "polyA signal" refers to a nucleic acid sequence located 3' to a coding region that directs the addition of adenylate nucleotides to the 3' end of the mRNA 15 transcribed from the coding region. The term "polyhydroxyalkanoate (or PHA) synthase" refers to enzymes that convert hydroxyacyl-CoAs to polyhydroxyalkanoates and free CoA. The term "promoter" or "promoter region" refers to a nucleic acid sequence, usually found upstream (5') to a coding sequence, that controls expression of the coding sequence by 20 controlling production of messenger RNA (mRNA) by providing the recognition site for RNA polymerase and/or other factors necessary for start of transcription at the correct site. As contemplated herein, a promoter or promoter region includes variations of promoters derived by means of ligation to various regulatory sequences, random or controlled mutagenesis, and addition or duplication of enhancer sequences. The promoter region disclosed herein, and 25 biologically functional equivalents thereof, are responsible for driving the transcription of coding sequences under their control when introduced into a host as part of a suitable recombinant vector, as demonstrated by its ability to produce mRNA. "Regeneration" refers to the process of growing a plant from a plant cell (e.g., plant protoplast or explant). 30 "Transformation" refers to a process of introducing an exogenous nucleic acid sequence (e.g., a vector, recombinant nucleic acid molecule) into a cell or protoplast in which that WO 00/40730 PCT/USOO/00364 -9 exogenous nucleic acid is incorporated into a chromosome or is capable of autonomous replication. A "transformed cell" is a cell whose nucleic acid has been altered by the introduction of an exogenous nucleic acid molecule into that cell. 5 A "transformed plant" or "transgenic plant" is a plant whose nucleic acid has been altered by the introduction of an exogenous nucleic acid molecule into that plant, or by the introduction of an exogenous nucleic acid molecule into a plant cell from which the plant was regenerated or derived. DETAILED DESCRIPTION OF THE INVENTION 10 This invention was developed in the pursuit of proteins which are associated with polyhydroxyalkanoate inclusion bodies, and in the pursuit of novel nucleic acid and amino acid sequences from the bacteria Bacillus megaterium. A 7,916 base pair nucleic acid fragment was isolated and sequenced (SEQ ID NO: 1). This fragment was found to contain nine open reading frames, five of which encode proteins suspected of being involved in polyhydroxyalkanoate is biosynthesis. Genomic fragment An embodiment of the invention is a nucleic acid segment at least about 80% identical to SEQ ID NO: 1. More preferably, the nucleic acid segment is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:l. 20 Alternatively, the nucleic acid segment may be a nucleic acid segment that hybridizes under stringent conditions to SEQ ID NO:1, or to the complement thereof. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The invention is further directed to nucleic acid segments, proteins, recombinant vectors, 25 recombinant host cells, genetically transformed plant cells, genetically transformed plants, methods of preparing host cells, methods of preparing plants, fusion proteins, and nucleic acid segments encoding fusion proteins. phaP and PhaP A nucleic acid segment may comprise a nucleic acid sequence encoding a 30 polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid sequence is WO 00/40730 PCT/USOO/00364 - 10 selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:3; and a nucleic acid sequence encoding a protein that is 5 immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:2. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The io nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:3. An isolated polyhydroxyalkanoate inclusion body associated protein may comprise an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO:3; and an amino acid sequence that is immunoreactive with is an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3. The protein is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:3 A recombinant vector may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion 20 body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to 25 SEQ ID NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3; and c) a 3' transcription terminator. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:2. The nucleic acid segment may be obtained from a natural source, 30 may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, WO 00/40730 PCT/USOO/00364 - 11 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:3. The promoter may generally be any promoter, and more preferably is a tissue selective or tissue specific promoter. The promoter may be constitutive or inducible. The promoter may be a viral promoter. The promoter may be a CMV35S, enhanced CMV35S, an FMV35S, a Lesquerella 5 hydroxylase, or a 7S conglycinin promoter. A recombinant host cell may comprise a nucleic acid segment encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid segment is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID 10 NO:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID is NO:2. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:3. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The 20 bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell. 25 A genetically transformed plant cell may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% 30 identical to SEQ ID NO:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:2 or the complement thereof; a nucleic acid sequence encoding a protein at least WO 00/40730 PCT/USOO/00364 - 12 about 80% identical to SEQ ID NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3; c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA 5 transcribed from the structural nucleic acid sequence. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:2. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 1o 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:3. The plant may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant. is A method of preparing host cells useful to produce a polyhydroxyalkanoate inclusion body associated protein may comprise a) selecting a host cell; b) transforming the selected host cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% 20 identical to SEQ ID NO:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3; and c) obtaining transformed host cells. More preferably, 25 the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:2. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical 30 to SEQ ID NO:3. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, WO 00/40730 PCT/US0O/00364 - 13 Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell. 5 A method of preparing plants useful to produce a polyhydroxyalkanoate inclusion body associated protein may comprise a) selecting a host plant cell; b) transforming the selected host plant cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% io identical to SEQ ID NO:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3; c) obtaining transformed host plant cells; and d) is regenerating the transformed host plant cells. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:2. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 20 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:3. The plant (and plant cell) may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant. 25 The invention also relates to fusion proteins. A fusion protein may comprise a green fluorescent protein subunit; and a polyhydroxyalkanoate inclusion body associated protein subunit; wherein the polyhydroxyalkanoate inclusion body associated protein subunit comprises an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO:3; and an amino acid sequence that is immunoreactive with 30 an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3. The polyhydroxyalkanoate inclusion body associated protein subunit is WO 00/40730 PCT/US0O/00364 - 14 preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:3 A nucleic acid segment encoding a fusion protein may comprise a nucleic acid sequence encoding a green fluorescent protein subunit; and a nucleic acid sequence encoding a 5 polyhydroxyalkanoate inclusion body associated protein subunit; wherein the nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein subunit is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to 10 SEQ ID NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:2. The nucleic acid sequence may be obtained from a natural source, may be mutagenized, may be genetically is engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein subunit at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:3. phaO and PhaQ A nucleic acid segment may comprise a nucleic acid sequence encoding a 20 polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:4; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:5; and a nucleic acid sequence encoding a protein that is 25 immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:4. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The 30 nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:5.

WO 00/40730 PCT/US00/00364 - 15 An isolated polyhydroxyalkanoate inclusion body associated protein may comprise an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO:5; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with s SEQ ID NO:5. The protein is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:5 A recombinant vector may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate io inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:4; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an 15 antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5; and c) a 3' transcription terminator. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:4. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be 20 synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:5. The promoter may generally be any promoter, and more preferably is a tissue selective or tissue specific promoter. The promoter may be constitutive or inducible. The promoter may be a viral promoter. The promoter may be a CMV35S, enhanced CMV35S, an FMV35S, a Lesquerella 25 hydroxylase, or a 7S conglycinin promoter. A recombinant host cell may comprise a nucleic acid segment encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid segment is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:4; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID 30 NO:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:5; and a nucleic acid sequence encoding a protein that is WO 00/40730 PCTIUSOO/00364 - 16 immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:4. The nucleic acid segment may be obtained from a natural source, may be mutagenized, s may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:5. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha 10 cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell. A genetically transformed plant cell may comprise in the 5' to 3' direction: a) a promoter 15 that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:4; a nucleic acid sequence that hybridizes under stringent conditions to 20 SEQ ID NO:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5; c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA 25 transcribed from the structural nucleic acid sequence. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:4. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 30 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:5. The plant may generally be any plant, and more preferably a monocot, dicot, or conifer. The WO 00/40730 PCT/USOO/00364 - 17 plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant. A method of preparing host cells useful to produce a polyhydroxyalkanoate inclusion 5 body associated protein may comprise a) selecting a host cell; b) transforming the selected host cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:4; a nucleic acid sequence that hybridizes under stringent conditions to 10 SEQ ID NO:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5; and c) obtaining transformed host cells. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 15 99%, 99.5%, or 100% identical to SEQ ID NO:4. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:5. The host cell may generally be any host cell, and preferably is a bacterial, 20 fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell. 25 A method of preparing plants useful to produce a polyhydroxyalkanoate inclusion body associated protein may comprise a) selecting a host plant cell; b) transforming the selected host plant cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% 30 identical to SEQ ID NO:4; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:4 or the complement thereof; a nucleic acid sequence encoding a protein at least WO 00/40730 PCT/USOO/00364 - 18 about 80% identical to SEQ ID NO:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5; c) obtaining transformed host plant cells; and d) regenerating the transformed host plant cells. More preferably, the nucleic acid sequence is at 5 least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:4. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:5. The io plant (and plant cell) may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant. The invention also relates to fusion proteins. A fusion protein may comprise a green is fluorescent protein subunit; and a polyhydroxyalkanoate inclusion body associated protein subunit; wherein the polyhydroxyalkanoate inclusion body associated protein subunit comprises an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO:5; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with 20 SEQ ID NO:5. The polyhydroxyalkanoate inclusion body associated protein subunit is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:5 A nucleic acid segment encoding a fusion protein may comprise a nucleic acid sequence encoding a green fluorescent protein subunit; and a nucleic acid sequence encoding a 25 polyhydroxyalkanoate inclusion body associated protein subunit; wherein the nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein subunit is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:4; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to 30 SEQ ID NO:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with WO 00/40730 PCT/USOO/00364 - 19 SEQ ID NO:5. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:4. The nucleic acid sequence may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence 5 preferably encodes a protein subunit at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:5. phaR and PhaR A nucleic acid segment may comprise a nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid sequence is io selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:6; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being 15 immunoreactive with SEQ ID NO:7. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:6. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 20 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:7. An isolated polyhydroxyalkanoate inclusion body associated protein may comprise an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO:7; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with 25 SEQ ID NO:7. The protein is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:7 A recombinant vector may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate 30 inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:6; a WO 00/40730 PCT/USOO/00364 -20 nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with 5 SEQ ID NO:7; and c) a 3' transcription terminator. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:6. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, io 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:7. The promoter may generally be any promoter, and more preferably is a tissue selective or tissue specific promoter. The promoter may be constitutive or inducible. The promoter may be a viral promoter. The promoter may be a CMV35S, enhanced CMV35S, an FMV35S, a Lesquerella hydroxylase, or a 7S conglycinin promoter. 15 A recombinant host cell may comprise a nucleic acid segment encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid segment is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:6; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% 20 identical to SEQ ID NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:6. The nucleic acid segment may be obtained from a natural source, may be mutagenized, 25 may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:7. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha 30 cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants WO 00/40730 PCT/US00/00364 - 21 such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell. A genetically transformed plant cell may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate 5 inclusion body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:6; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:6 or the complement thereof; a nucleic acid sequence encoding a protein at least io about 80% identical to SEQ ID NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7; c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence. More preferably, the nucleic acid is sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:6. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:7. 20 The plant may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant. A method of preparing host cells useful to produce a polyhydroxyalkanoate inclusion 25 body associated protein may comprise a) selecting a host cell; b) transforming the selected host cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:6; a nucleic acid sequence that hybridizes under stringent conditions to 30 SEQ ID NO:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:7; and a nucleic acid sequence encoding a protein that is WO 00/40730 PCTIUS0O/00364 - 22 immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7; and c) obtaining transformed host cells. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:6. The nucleic acid segment may be obtained 5 from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:7. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, 10 Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell. A method of preparing plants useful to produce a polyhydroxyalkanoate inclusion body is associated protein may comprise a) selecting a host plant cell; b) transforming the selected host plant cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:6; a nucleic acid sequence that hybridizes under stringent conditions to 20 SEQ ID NO:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7; c) obtaining transformed host plant cells; and d) regenerating the transformed host plant cells. More preferably, the nucleic acid sequence is at 25 least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:6. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:7. The 30 plant (and plant cell) may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants WO 00/40730 PCT/US00/00364 -23 such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant. The invention also relates to fusion proteins. A fusion protein may comprise a green fluorescent protein subunit; and a polyhydroxyalkanoate inclusion body associated protein 5 subunit; wherein the polyhydroxyalkanoate inclusion body associated protein subunit comprises an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO:7; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7. The polyhydroxyalkanoate inclusion body associated protein subunit is io preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:7 A nucleic acid segment encoding a fusion protein may comprise a nucleic acid sequence encoding a green fluorescent protein subunit; and a nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein subunit; wherein the nucleic acid 15 sequence encoding a polyhydroxyalkanoate inclusion body associated protein subunit is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:6; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an 20 antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:6. The nucleic acid sequence may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence 25 preferably encodes a protein subunit at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:7. phaB and PhaB A nucleic acid segment may comprise a nucleic acid sequence encoding a 3-keto-acyl CoA reductase protein, wherein the nucleic acid sequence is selected from the group consisting 30 of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic WO 00/40730 PCT/USOO/00364 - 24 acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 5 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:8. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9. 10 An isolated 3-keto-acyl-CoA reductase protein may comprise an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO:9; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9. The protein is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 15 99.5%, or 100% identical to SEQ ID NO:9 A recombinant vector may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; b) a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence 20 at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9; and c) a 3' transcription 25 terminator. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:8. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 30 99%, 99.5%, or 100% identical to SEQ ID NO:9. The promoter may generally be any promoter, and more preferably is a tissue selective or tissue specific promoter. The promoter may be WO 00/40730 PCT/US0O/00364 - 25 constitutive or inducible. The promoter may be a viral promoter. The promoter may be a CMV35S, enhanced CMV35S, an FMV35S, a Lesquerella hydroxylase, or a 7S conglycinin promoter. A recombinant host cell may comprise a nucleic acid segment encoding a 3-keto-acyl 5 CoA reductase protein, wherein the nucleic acid segment is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ io ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:8. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably is encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a 20 tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell. A genetically transformed plant cell may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; b) a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase 25 protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID 30 NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9; c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate WO 00/40730 PCT/USOO/00364 - 26 nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:8. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by 5 mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9. The plant may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, 10 peanut, sugarcane, switchgrass, or alfalfa plant. A method of preparing host cells useful to produce a 3-keto-acyl-CoA reductase protein may comprise a) selecting a host cell; b) transforming the selected host cell with a recombinant vector having a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic is acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9; and c) obtaining 20 transformed host cells. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:8. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 25 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, 30 soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell.

WO 00/40730 PCT/US00/00364 - 27 A method of preparing plants useful to produce a 3-keto-acyl-CoA reductase protein may comprise a) selecting a host plant cell; b) transforming the selected host plant cell with a recombinant vector having a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein, wherein the structural nucleic acid sequence is selected from the group 5 consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9; c) io obtaining transformed host plant cells; and d) regenerating the transformed host plant cells. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:8. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably 15 encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9. The plant (and plant cell) may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant. 20 The invention also relates to fusion proteins. A fusion protein may comprise a green fluorescent protein subunit; and a 3-keto-acyl-CoA reductase protein subunit; wherein the 3 keto-acyl-CoA reductase protein subunit comprises an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO:9; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:9 25 as an antigen, the antibody being immunoreactive with SEQ ID NO:9. The 3-keto-acyl-CoA reductase protein subunit is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9 A nucleic acid segment encoding a fusion protein may comprise a nucleic acid sequence encoding a green fluorescent protein subunit; and a nucleic acid sequence encoding a 3-keto 30 acyl-CoA reductase protein subunit; wherein the nucleic acid sequence encoding a 3-keto-acyl CoA reductase protein subunit is selected from the group consisting of: a nucleic acid sequence WO 00/40730 PCT/US00/00364 -28 at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an 5 antigen, the antibody being immunoreactive with SEQ ID NO:9. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:8. The nucleic acid sequence may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein subunit at least about io 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9. phaC and PhaC A nucleic acid segment may comprise a nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein, wherein the nucleic acid sequence is selected from the is group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO: 10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO: 10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO: 11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with 20 SEQ ID NO: 11. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 25 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO: 11. An isolated polyhydroxyalkanoate synthase protein may comprise an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO: 11; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with 30 SEQ ID NO: 11. The protein is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:1 1 WO 00/40730 PCT/US00/00364 - 29 A recombinant vector may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic 5 acid sequence at least about 80% identical to SEQ ID NO: 10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO: 10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO: 11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with SEQ ID NO: 11; and c) a 3' 10 transcription terminator. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, is 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO: 11. The promoter may generally be any promoter, and more preferably is a tissue selective or tissue specific promoter. The promoter may be constitutive or inducible. The promoter may be a viral promoter. The promoter may be a CMV35S, enhanced CMV35S, an FMV35S, a Lesquerella hydroxylase, or a 7S conglycinin promoter. 20 A recombinant host cell may comprise a nucleic acid segment encoding a polyhydroxyalkanoate synthase protein, wherein the nucleic acid segment is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to 25 SEQ ID NO: 11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with SEQ ID NO: 11. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be 30 genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%. 90%, 92%, 94%, WO 00/40730 PCTIUSOO/00364 - 30 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:11. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant 5 cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell. A genetically transformed plant cell may comprise in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate 10 synthase protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO: 10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO: 10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID is NO: 11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with SEQ ID NO: 11; c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence. More preferably, the nucleic acid sequence is at least about 82%, 84%, 20 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO: 11. The plant may generally be any 25 plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant. A method of preparing host cells useful to produce a polyhydroxyalkanoate synthase protein may comprise a) selecting a host cell; b) transforming the selected host cell with a 30 recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein, wherein the structural nucleic acid sequence is selected from the group WO 00/40730 PCT/US00/00364 -31 consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO: 10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO: 10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO: 11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody 5 prepared using SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with SEQ ID NO: 11; and c) obtaining transformed host cells. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO: 10. The nucleic acid segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be io synthetic. The nucleic acid sequence preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO: 11. The host cell may generally be any host cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or 15 Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell. A method of preparing plants useful to produce a polyhydroxyalkanoate synthase protein may comprise a) selecting a host plant cell; b) transforming the selected host plant cell with a 20 recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO: 10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO: 10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID 25 NO: 11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with SEQ ID NO: 11; c) obtaining transformed host plant cells; and d) regenerating the transformed host plant cells. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid 30 segment may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence WO 00/40730 PCT/US00/00364 - 32 preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO: 11. The plant (and plant cell) may generally be any plant, and more preferably a monocot, dicot, or conifer. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, 5 sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant. The invention also relates to fusion proteins. A fusion protein may comprise a green fluorescent protein subunit; and a polyhydroxyalkanoate synthase protein subunit; wherein the polyhydroxyalkanoate synthase protein subunit comprises an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO: 11; 10 and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with SEQ ID NO: 11. The polyhydroxyalkanoate synthase protein subunit is preferably at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:1 1 A nucleic acid segment encoding a fusion protein may comprise a nucleic acid sequence is encoding a green fluorescent protein subunit; and a nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein subunit; wherein the nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein subunit is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO: 10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO: 10 or the complement thereof; a nucleic 20 acid sequence encoding a protein at least about 80% identical to SEQ ID NO: 11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with SEQ ID NO: 11. More preferably, the nucleic acid sequence is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid sequence may 25 be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence preferably encodes a protein subunit at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO: 1l. PHA biosynthesis methods: phaB and phaC 30 A method for the preparation of polyhydroxyalkanoate may comprise: a) obtaining a cell comprising: a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a nucleic WO 00/40730 PCT/USOO/00364 - 33 acid sequence encoding a PHA synthase protein; wherein: the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is not naturally found in the cell; the nucleic acid sequence encoding a PHA synthase protein is not naturally found in the cell; the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of: a nucleic 5 acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9; and the nucleic acid io sequence encoding a PHA synthase protein is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO: 10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO: 11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ is ID NO: 11 as an antigen, the antibody being immunoreactive with SEQ ID NO: 11; and b) culturing the cell under conditions suitable for the preparation of polyhydroxyalkanoate. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein more preferably is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:8. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein may be 20 obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence encoding a 3 keto-acyl-CoA reductase protein preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9. The nucleic acid sequence encoding a PHA synthase protein more preferably is at least about 82%, 84%, 25 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid sequence encoding a PHA synthase protein may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence encoding a PHA synthase protein preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% 30 identical to SEQ ID NO: 11. The cell may generally be any cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, WO 00/40730 PCT/USOO/00364 -34 Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell. The 5 polyhydroxyalkanoate may be a homopolymer or copolymer. The polyhydroxyalkanoate may be a polyhydroxybutyrate, polyhydroxyvalerate, polyhydroxyhexanoate, polyhydroxyoctanoate, polyhydroxydecanoate, or copolymers thereof. A method for the preparation of polyhydroxyalkanoate may comprise: a) obtaining a plant comprising: a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a io nucleic acid sequence encoding a PHA synthase protein; wherein: the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is not naturally found in the plant; the nucleic acid sequence encoding a PHA synthase protein is not naturally found in the plant; the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence 15 that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9; and the nucleic acid sequence encoding a PHA synthase protein is selected from the group consisting of: a 20 nucleic acid sequence at least about 80% identical to SEQ ID NO: 10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO: 10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO: 11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with SEQ ID NO: 11; and b) 25 growing the plant under conditions suitable for the preparation of polyhydroxyalkanoate. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein more preferably is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:8. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein may be obtained from a natural source, may be mutagenized, may be genetically engineered by 30 mutagenesis or other methods, or may be synthetic. The nucleic acid sequence encoding a 3 keto-acyl-CoA reductase protein preferably encodes a protein at least about 82%, 84%, 86%, WO 00/40730 PCT/USOO/00364 - 35 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9. The nucleic acid sequence encoding a PHA synthase protein more preferably is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid sequence encoding a PHA synthase protein may be obtained from a natural source, 5 may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence encoding a PHA synthase protein preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO: 11. The plant is preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, 10 peanut, sugarcane, switchgrass, or alfalfa plant. The polyhydroxyalkanoate may be a homopolymer or copolymer. The polyhydroxyalkanoate may be a polyhydroxybutyrate, polyhydroxyvalerate, polyhydroxyhexanoate, polyhydroxyoctanoate, polyhydroxydecanoate, or copolymers thereof. PHA biosynthesis methods: phaB is A method for the preparation of polyhydroxyalkanoate may comprise: a) obtaining a cell comprising: a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a nucleic acid sequence encoding a PHA synthase protein; wherein: the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is not naturally found in the cell; the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of: a nucleic 20 acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9; and b) culturing the 25 cell under conditions suitable for the preparation of polyhydroxyalkanoate. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein more preferably is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:8. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other 30 methods, or may be synthetic. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, WO 00/40730 PCT/USOO/00364 - 36 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9. The cell may generally be any cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is 5 preferably a tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell. The polyhydroxyalkanoate may be a homopolymer or copolymer. The polyhydroxyalkanoate may be a polyhydroxybutyrate, polyhydroxyvalerate, polyhydroxyhexanoate, polyhydroxyoctanoate, polyhydroxydecanoate, or copolymers thereof. 10 A method for the preparation of polyhydroxyalkanoate may comprise: a) obtaining a plant comprising: a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a nucleic acid sequence encoding a PHA synthase protein; wherein: the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is not naturally found in the plant; the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of: is a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9; and b) growing 20 the plant under conditions suitable for the preparation of polyhydroxyalkanoate. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein more preferably is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:8. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other 25 methods, or may be synthetic. The nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein preferably encodes a protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:9. The plant may generally be any plant, and preferably is a tobacco, wheat, potato, Arabidopsis, high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or 30 alfalfa plant. The polyhydroxyalkanoate may be a homopolymer or copolymer. The WO 00/40730 PCT/US0O/00364 -37 polyhydroxyalkanoate may be a polyhydroxybutyrate, polyhydroxyvalerate, polyhydroxyhexanoate, polyhydroxyoctanoate, polyhydroxydecanoate, or copolymers thereof. PHA biosynthesis methods: phaC A method for the preparation of polyhydroxyalkanoate may comprise: a) obtaining a cell 5 comprising: a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a nucleic acid sequence encoding a PHA synthase protein; wherein: the nucleic acid sequence encoding a PHA synthase protein is not naturally found in the cell; the nucleic acid sequence encoding a PHA synthase protein is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent io conditions to SEQ ID NO: 10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO: 11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with SEQ ID NO: 11; and b) culturing the cell under conditions suitable for the preparation of polyhydroxyalkanoate. The nucleic acid sequence encoding a 15 PHA synthase protein more preferably is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid sequence encoding a PHA synthase protein may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence encoding a PHA synthase protein preferably encodes a protein at least 20 about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO: 11. The cell may generally be any cell, and preferably is a bacterial, fungal, mammalian, or plant cell. The bacterial cell is preferably an Escherichia coli, Bacillus, Pseudomonas, or Ralstonia eutropha cell. The fungal cell is preferably a Saccharomyces cerevisiae or Schizosaccharomyces pombe cell. The plant cell is preferably a tobacco, wheat, 25 potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa cell. The polyhydroxyalkanoate may be a homopolymer or copolymer. The polyhydroxyalkanoate may be a polyhydroxybutyrate, polyhydroxyvalerate, polyhydroxyhexanoate, polyhydroxyoctanoate, polyhydroxydecanoate, or copolymers thereof. 30 A method for the preparation of polyhydroxyalkanoate may comprise: a) obtaining a plant comprising: a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a WO 00/40730 PCT/US0O/00364 -38 nucleic acid sequence encoding a PHA synthase protein; wherein: the nucleic acid sequence encoding a PHA synthase protein is not naturally found in the plant; the nucleic acid sequence encoding a PHA synthase protein is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO: 10; a nucleic acid sequence that hybridizes 5 under stringent conditions to SEQ ID NO: 10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO: 11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with SEQ ID NO: 11; and b) growing the plant under conditions suitable for the preparation of polyhydroxyalkanoate. The nucleic acid sequence o encoding a PHA synthase protein more preferably is at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO:10. The nucleic acid sequence encoding a PHA synthase protein may be obtained from a natural source, may be mutagenized, may be genetically engineered by mutagenesis or other methods, or may be synthetic. The nucleic acid sequence encoding a PHA synthase protein preferably encodes a 5 protein at least about 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO: 11. The plant may generally be any plant, and preferably is a tobacco, wheat, potato, Arabidopsis, high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, or alfalfa plant. The polyhydroxyalkanoate may be a homopolymer or copolymer. The polyhydroxyalkanoate may be o a polyhydroxybutyrate, polyhydroxyvalerate, polyhydroxyhexanoate, polyhydroxyoctanoate, polyhydroxydecanoate, or copolymers thereof. Methods for preparing higher polyhydroxyalkanoates Polyhydroxyalkanoate may be prepared by a method comprising: a) obtaining a recombinant host cell comprising: a nucleic acid sequence encoding a p-ketothiolase protein; a s nucleic acid sequence encoding a 3-ketoacyl-CoA reductase protein; a nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; a nucleic acid sequence encoding a p hydroxyacyl-CoA dehydrase; and a nucleic acid sequence encoding an acyl-CoA dehydrogenase protein or an enoyl-CoA reductase protein; and b) culturing the recombinant host cell under conditions suitable for the preparation of polyhydroxyalkanoate; wherein: the o polyhydroxyalkanoate comprises C6, C8, or C10 monomer subunits; the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of: a nucleic WO 00/40730 PCT/USOO/00364 - 39 acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID 5 NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9. Primers, probes, and antibodies The sequences disclosed in the sequence listing may also be used to prepare primers, probes, and monoclonal or polyclonal antibodies. SEQ ID NOS:1, 2, 4, 6, 8, 10, 22, 24, 26, and 28, and the their complementary strands io may be used to design oligonucleotide primers and probes. Primers and probes are typically at least 15 nucleotides in length, and more preferably are at least 20, 22, 24, 26, 28, 30, 40, or 50 nucleotides in length. Contiguous nucleotide sequences from a given sequence are chosen based upon favorable hybridization conditions, including minimization of hairpin or other detrimental sequences. The identification of suitable primer or probe sequences is well known to those of 15 skill in the art, and is facilitated by commercially available software such as MacVector (Oxford Molecular Group) and Xprimer (http://alces.med.umn.edu/rawprimer.html). Primers and probes may be used for the screening of libraries, for PCR amplification, and other routine molecular biological applications. Primers and probes may also be used for antisense applications. SEQ ID NOS:3, 5, 7, 9, 11, 23, 25, 27, and 29 may be used for the generation of 20 monoclonal or polyclonal antibodies. The entire sequences may be used, or antigenic fragments thereof. Alternatively, portions of the full length sequences may be synthesized and covalently attached to antigenic proteins such as keyhole limpet hemocyanin (KLH). Portions of the full length sequences may be used for the preparation of multi-antigenic peptides (52). The generation of monoclonal and polyclonal antibodies is well known to those of skill in the art. 25 The following Examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate 30 that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

WO 00/40730 PCTIUS00/00364 - 40 EXAMPLES Example 1: Bacterial strains and plasmids Table 1. Strains Strains Relevant characteristicsa Source or Reference E coli DH5c deoR endA] gyrA96 hsdR]7 (r- m') recA] relA] supE44 thi-1 Clontech A(lacZYA-argFV]69) 80lacZA3M15 F-. Cloning host and for expression of pha genes B. Wild type, used to clone pha genes ATCC" megaterium 11561 B. phaP, -Q, -R, -B and -C deletion derivative of B. megaterium This megaterium 11561 Applicatio PHA05 n P. PHA positive control ATCC oleovorans 29347 P. putida PHA negative mutant obtained by chemical mutagenesis (22) GPp 104 WO 00/40730 PCT/USOO/00364 - 41 Table 2. Plasmids Plasmids Relevant characteristicsa Source or Referenc e pBluescriptlIS Cloning vector, ColEl oriVc, Ampr Stratagen K e pGFPuv Source of gfp gene, ColE 1 oriV, Ampr Clontech pHPS9 Bacillus-Escherichia coli shuttle vector, ColE1 and pTA1060 (16) oriV, Emr, Cmr pSUP104 Pseudomonas-Escherichia coli shuttle vector, Q-type and mini 15 (40) oriV, Em', Tcr pGMl EcoRI in phaP to HindIII in phaC, cloned into the EcoRI-HindIII This sites of pBluescriptlISK, Amp' applicatio n pGM6 PstI in phaB to EcoRI in ykrM, cloned into the PstI-EcoRI sites of This pBluescriptIlSK, Ampr applicatio n pGM7 EcoRI in phaP to EcoRI in ykrM, cloned into the EcoRI site of This pBluescriptlISK, Amp' applicatio n pGM9 HindIII upstream of ykoY to PstI in phaB, cloned into the HindIII - This PstI sites of pBluescriptlISK, Ampr application n pGM1O HindIII upstream of ykoY to EcoRI in ykrM, cloned into the This HindIII -EcoRI sites of pBluescriptlISK, Amp' applicatio n pGM7H EcoRI in phaP to EcoRI in ykrM, cloned into the EcoRI site of This pHPS9, Cmr applicatio n pC/GFP2 PhaC::GFP out-of-frame fusion plasmid. This Fragment shown in Figure 4A cloned in pBluescriptlISK, Amp' applicatio n pC/GFP3 PhaC::GFP in-frame fusion plasmid. This Fragment shown in Figure 4B cloned in pBluescriptlISK, Amp' applicatio n pGM13 PhaC::GFP in-frame fusion plasmid. This Fragment shown in Figure 4C cloned in pHPS9, Em'Lm' applicatio n pGM13C GFP localization control plasmid. Part ofphaB and phaC deleted. This Fragment shown in Figure 4D cloned in pHPS9, EmrLmr applicatio n pP/GFP3 PhaP::GFP in-frame fusion plasmid. This Fragment shown in Figure 4E cloned in pBluescriptlISK, Ampt applicatio WO 00/40730 PCTIUSOO/00364 -42 n pGM16.2 PhaP::GFP in-frame fusion plasmid. This Fragment shown in Figure 4F cloned in pHPS9, EmrLm' application n pGM107 EcoRI in phaP to EcoRI in ykrM, cloned as a BamHI-SalI This fragment from pGM7, into the BamHI and Sall sites of applicatio pSUP104, Cmr n pDR1 PstI in phaB to EcoRI in ykrM, cloned as a SmaI-EcoRV fragment This from pGM6 into the two Dral sites of pSUP 104 in same applicatio orientation as the Cm gene, with phaC expressed from the Cm n promoter, Ter pGM61 Derived from pGM13. It carries an in-frame 594 bp deletion in This phaR, extending from 96 bp upstream of the phaR initiation Applicati codon through codon 144. on pGM73 Derived from pGM6 1. Carries a transcriptional fusion between This the promoter ofphaP and the coding region plus translation Applicati signals ofphaR. A 663 bp DNA fragment harboring phaR was on cloned into the SnaBI site in phaP in the sense orientation. r "Em', erythromycin resistant; Lm', lincomycin resistant; Cm', chloramphenicol resistant; Amp, ampicillin resistant; Tcr, Tetracycline resistant. bATCC, American Type Culture Collection. cOrigin of replication. Example 2: Media and growth conditions 5 Cultures were grown at 37'C (unless otherwise stated) in liquid media, aerated by rotation at 250 rpm in either Luria-Bertani (LB) broth (33) or M9 Minimal Salts (Life Technologies, Bethesda, MD) with 1% (w/v) glucose. For growth on plates, the above media with 1.5% agar (Sigma, A4550) was used. For plasmid selections, the appropriate antibiotics were included in the media: ampicillin (200 ug/mL [AMP 200]), chloramphenicol (25 ig/mL 10 [CM ]), erythromycin (200 ptg/mL [EM200]), or tetracycline (12.5 ptg/mL [TC ]) for plasmid selection in Escherichia coli; chloramphenicol (12 ptg/mL [CM ]), or erythromycin (1 pg/mL [EM']) plus lincomycin (25 tg/mL [LM 2 5 ]) for plasmid selection in Bacillus megaterium; chloramphenicol (160 pg/mL [CM' 60 ]), or tetracycline (30 Ig/mL [TC 30 ]) for selection in Pseudomonas. 15 Example 3: Transformations Escherichia coli and Pseudomonas putida were transformed by electroporation of competent cells using an electroporator (Eppendorf) and following the manufacturers WO 00/40730 PCT/USO0/00364 - 43 instructions. Bacillus megaterium was transformed using a biolistic transformation procedure (39). Example 4: Microscopy For phase contrast microscopy, wet mounts of cultures were visualized at xl,000 5 magnification in a light microscope with phase contrast attachments (Labophot-2 Microscope, Nikon, Inc.). To view PHA inclusion-bodies, samples were heat fixed, stained with 1% (w/v) Nile Blue A (Sigma) for 15 minutes at 55'C, destained for 30 seconds in 8% (v/v) acetic acid, water washed, air dried, and viewed at x1000 magnification under fluorescence using filters; excitation, 446/10 nm; barrier filter, 590 nm; dichroic mirror, 580 nm. To view GFP, wet io mounts of cultures with or without 1% (w/v) agarose were viewed at x1000 magnification under fluorescence using filters; excitation, 390-450 nm; barrier filter, 480-520 nm; dichroic mirror, 470 nm. Example 5: Codon usage in Bacillus megaterium Bacillus megaterium uses three codons as start codons in protein coding sequences. is ATG, TTG, and GTG all encode methionine when present at the start of a coding region. TTG and GTG encode leucine and valine when present within a coding region, respectively. Bacillus megaterium uses TGA, TAA, and TAG as stop codons. Bacillus megaterium sequences starting with TTG or GTG may require mutagenesis to ATG if the sequences are to be expressed in organisms that use ATG exclusively as a start 20 codon. Example 6: Separation of polypeptides associated with PHA inclusion-bodies. In an attempt to determine their relevance, proteins that co-purify with PHA inclusion bodies were separated by electrophoreses on an SDS-polyacrylamide gel (Figure 1). Inclusion-bodies were purified (32) followed by suspension in TE buffer (10 mM Tris 25 HCl pH 8, 1 mM EDTA) with 2% (w/v) SDS. An equal volume of 2x sample buffer (100 mM Tris-HCl (pH 6.8), 4% SDS, 4 mM EDTA, 20% glycerol, 2% 2-mercaptoethanol, 0.1% bromophenol blue) was added prior to boiling for 5 minutes and samples were centrifuged for 3 minutes to pellet PHA; the supernatant was loaded on a 12% SDS-polyacrylamide gel and run at 8 mA overnight at 4C to separate proteins. The gel was stained with Coomassie Blue for 5 WO 00/40730 PCT/US0O/00364 - 44 minutes prior to transfer of proteins to a polyvinylidene difluoride membrane using a semi-dry electroblotter at 400 mA for 45 minutes. There were at least thirteen such proteins present in various quantities. Some or all of these proteins could be intrinsic structural components of PHA inclusion-bodies, enzymes 5 involved with PHA metabolism or possibly scaffolding components involved in inclusion-body assembly. Alternatively, they could have been acquired by the inclusion-bodies during the purification procedure. The three most abundant proteins had molecular weights of approximately 14, 20 and 41 kDa. The N-terminal amino acid sequence for the three most prevalent proteins were 10 determined. Membrane carrying the proteins of interest was cut for use in N-terminal amino acid sequence determination by Edman Degradation using a minimum quantity of 200 pmols of each protein. The N-terminal amino acid sequence of the 14 kDa protein was KVFGRXELAAAMKRXGL (SEQ ID NO: 19), the 20 kDa protein was NTVKYXTVIXAMXXQ (SEQ ID NO:20), and the 41 kDa proteins was AIPYVQEXEKL is (SEQ ID NO:21). A BLASTp search ((1), performed with NCBI Entrez database; http://www.ncbi.nlm.nih.gov/Entrez/) revealed that the 14 kDa protein was lysozyme and the other two N-terminal sequences were novel. It was concluded that the lysozyme used in the cell lysis procedure had co-purified with the PHA inclusion bodies. This result confirms that not necessarily all of the proteins that co-purify with PHA inclusion-bodies are associated with them 20 in vivo, as was also shown for Chromatium vinosum (27). Example 7: Cloning the pha region Purification of genomic and plasmid DNA, Southern blot, hybridization and cloning were by standard procedures (38). To clone the DNA sequences that coded for the two most abundant proteins on purified PHA inclusion-bodies, degenerate oligonucleotide probes based on their N 25 terminal amino acid sequences were used. The probes were: AAYACRGTNAAATAYNNNACRGTNATYNNNGCDATGATG (n2, SEQ ID NO:12) and GCDATYCCDTAYGTNCARGAAGGHTTYAAA (n5, SEQ ID NO:13) for the 20 kDa and 41 kDa proteins, respectively (Figure 1). Both probes, used in separate 38'C Southern blotting hybridization experiments, 30 identified a 6.4 kb HindIII, a 5.2 kb EcoRI, and a 3.7 kb HindIl to EcoRI DNA fragment of WO 00/40730 PCT/USOO/00364 -45 DNA, indicating that the 5' ends of the coding regions for both of these proteins were located less than 3.7 kb apart in the genome. The three fragments were purified from agarose following electrophoresis, and cloned into plasmid pBluescriptIlSK. Positive clones were identified by hybridization to the same degenerate probes, thus 5 yielding plasmid pGM1 containing the 3.7 kb fragment. Sequences contiguous with and overlapping this primary cloned fragment were cloned in a similar manner except that probes based on the ends of the sequenced DNA fragment were used, and hybridization was performed at 55*C. The probes used were GCTTCATGCGTGCGGTTTG (bmp, SEQ ID NO:14) and GGACCGTTCGGAAAATCAGCGG (bmc, SEQ ID NO: 15), yielding respectively, pGM9 and o pGM6 (Figure 2). DNA fragments of pGM1, pGM6 and pGM9 were subcloned into pBluescriptIISK, and sequenced, from both ends using universal primers and internally by primer walking on both strands, using dye terminator chemistry, cycle sequencing and an ABI Prism 377 sequencer (Applied Biosystems). Sequence assembly and analysis was performed using Lasergene s (DNAStar, Inc.), and Gapped BLAST and PSI BLAST (1). The 3.7 kb fragment contained 5 ORIs (Figure 2), whose predicted amino acid sequences encode PhaP (20 kDa protein), PhaQ, PhaR, PhaB and PhaC (41 kDa protein). The 20 and 41 kDa proteins were identified by their N-terminal amino acid sequences. Since the C-terminus for each of these two proteins extended beyond the boundaries of pGM1, the remaining sequence D were obtained from plasmids pGM6 and pGM9. Example 8: The pha locus. The 7,916 bp region (SEQ ID NO: 1) containing pha genes from Bacillus megaterium was cloned, sequenced and characterized. It was shown to carry 8 complete and 1 incomplete open reading frame (Figure 2, Tables 3 and 4). Coding sequences in this region were assigned on the basis of homology to known sequences, N-terminal amino acid sequences, putative ribosome binding sites and operon location. The complement and arrangement of genes flanking the pha genes in Bacillus megaterium are very similar to a region of Bacillus subtilis 168 (Figure 2). This strain is negative for PHA and no known pha genes or sequences occur in its genome, for which the complete sequence is available (24). In place of pha genes in this region of B.

WO 00/40730 PCT/US00/00364 - 46 subtilis are ykrI, ykrK and ykrL, which, respectively, code for putative proteins similar to two unknown proteins, and a probable heat shock protein. Table 3: Sequence analysis results Sequence Number of amino acids Mol mass Daltons Isoelectric point ykoY 271 29,996 6.89 ykoZ 236 27,662 9.36 sspD 65 7,027 8.58 phaP 170 19,906 5.29 phaQ 146 16,686 5.09 phaR 168 19,150 5.10 phaB 247 26,098 7.39 phaC 362 41,463 8.31 ykrM 318a ND ND aPartial protein.

WO 00/40730 PCT/US00/00364 -47 Table 4: Sequence homologies Sequen Homologies to known and Identit Similarit Function or putative function ce putative genes (accession y y no.) a ykoY YkoY, B. subtilis 64% 73% Toxic anion resistance (Z991 10) protein (24) ykoZ YkoZ, B. subtilis 57% 74% RNA polymerase sigma (Z99 111) factor (24) sspD SspD, Bacillus 100% Spore specific, DNA binding megaterium (P10572) protein (4, 10) SspD, B. subtilis (P04833) 73% 87% phaP None PHA inclusion-body structure, shape and size (49) phaQ None Unknown phaR None Unknown phaB FabG, Synechocystis 50% 66% Fatty acid biosynthesis (23) (D90907) 48% 64% 3-ketoacyl-CoA reductase PhaB, C. vinosum D 47% 67% (28) (P45375) Fatty acid biosynthesis (35) FabG, B. subtilis (P51831) phaC PhaC, T. violacea 38% 59% PHA synthase (29, 23, 28) (P45366) 37% 56% PhaC, Synechocystis 35% 55% (D90906) PhaC, C. vinosum (P45370) ykrM YkrM, B. subtilis 55% 71% Na' -transporting ATP (Z99 111) 1 synthase (24) aAccession numbers are SWISS-PROT, EMBL or DDBJ; None, No discernible similarity to known sequences. Example 9: The pha nucleic acid and encoded protein sequences 5 The deduced amino acid sequence of PhaP shows a 20 kDa extremely hydrophilic product with no obvious similarity to known sequences (Figure 6). Inclusion-body associated low molecular weight proteins (phasins) have been described in many bacteria (49), but where sequences were available no similarities of identifiable significance with PhaP of Bacillus megaterium were found. o Low molecular weight, PHA inclusion-body abundant proteins play an important role in PHA producing cells, since they are involved in determining inclusion-body size and shape, and are present in quantities up to 5% of total protein in the case of PHA producing A. eutrophus WO 00/40730 PCT/US00/00364 - 48 (48). It is an interesting observation that the amino acid sequences of phasin proteins are so dissimilar, even in closely related bacteria. Some similarity between such proteins would be expected in closely related bacteria, were they to have a role in inclusion-body biogenesis, however, conservation of sequence would be entirely unnecessary should they have a role as 5 storage proteins. The deduced amino acid sequences of PhaQ and PhaR also revealed small hydrophilic proteins with no significant identifiable similarity to known proteins (Figures 7 and 8). Figure 1 (lane 2) shows that purified inclusion-bodies have proteins represented by bands of the approximate sizes of PhaQ (17 kDa) and PhaR (19 kDa), but the roles of these proteins are io unknown. They may be non-orthologous replacements for the small putative gene products, whose roles are also unknown, coded in known pha gene clusters. The deduced amino acid sequence of PhaB, is similar in size and amino acid sequence to known phaB and fabG gene products (Table 2). The deduced amino acid sequence of PhaC shows that while it has low homology overall to known PhaC proteins, it is most similar to that of T. violacea, Synechocystis is and C. vinosum. PhaC proteins from these three bacterial strains, respectively, have 355, 378, and 355 amino acids while PhaC from Bacillus megaterium has 362 amino acids. All other PhaC proteins studied are larger in size, and range from 559 amino acids for that of P. oleovorans (22) to 636 amino acids for that of Rhizobium etli (3). Alignment studies of sequences of all previously known PhaC proteins show that the synthases are either large single 20 subunit enzymes (PhaC) or smaller two subunit enzymes (PhaC and PhaE). The Bacillus megaterium PhaC protein aligns poorly with large, single subunit enzymes such as the P. oleovorans PhaC (Figure 3). Example 10: Functionality of the pha gene cluster It has been demonstrated that the phaP, -Q, -R, -B and -C gene cluster can complement a 25 deletion mutant of B. megaterium. This mutant PHA05 was constructed by a gene substitution technique. A plasmid (based on pGM1O) in which the pha genes were substituted by the erythromycin gene, was propagated in B. megaterium 11561. Selection on erythromycin allowed isolation of the PHA05 mutant that was negative for PHA synthesis. Complementation with the phaP, -Q, -R, -B and -C gene cluster was obtained when pGM7H or pGM13 was introduced into 30 the PHA05 strain.

WO 00/40730 PCT/US00/00364 - 49 Experiments introducing a phaR deletion of pGM 13 (pGM6 1) into PHA05 suggests that the presence of phaR may be preferred for PHA synthesis. This result was confirmed by the recloning of phaR into pGM61 (pGM73) as it was isolated from PHA05(pGM61) strain, followed by the introduction of pGM73 into PHA05. Accumulation of PHA in PHA05(pGM73) confirmed the preference for phaR. It has been previously demonstrated that the small type PhaCs (see Example 17) is not sufficient for PHA synthesis; another peptide, PhaE of approximate size 30 kDa, is also required (51). These complementation studies suggest that it is preferable to combine PhaC of B. megaterium (also a small type PhaC) and phaR (19 kDa), however there is no sequence similarity between phaR of B. megaterium and phaE of other D organisms. Example 11: Mapping transcription starts The transcription start points were mapped in the region from the EcoRI restriction site in phaP to the HindIII site in ykrM by primer extension analysis, using the Promega system for primer extension on RNA templates. DNA oligonucleotide primers, 17 to 20 nucleotides in s length, were synthesized to match target sequences, initially at approximately 500 base pair intervals and subsequently at about 50 to 250 nucleotides down-stream from the predicted transcription start points. The 32 P 5' end-labeled primers were extended with reverse transcriptase using total RNA (10 pg per reaction) purified from Bacillus megaterium (31). The fragment length initially, and transcription start nucleotides subsequently, were determined by a running the cDNA on a 8% denaturing polyacrylamide gel along-side the products of sequencing reactions, which were generated using the same 5'-end labeled primers. The primers used to identify the transcription start nucleotides for the phaP, phaQ, and phaRBC promoters were, respectively, CCCCTTTGTCCATTGTTCCC (SEQ ID NO:16); CCATGTAGATTCCACCCTC (SEQ ID NO:17); and CTCCATCTCCTTTCTTGTG (SEQ ID NO:18). 5 Primer extension products showed a single band from each reaction, indicating one transcript, while control reactions in which RNA was omitted showed no bands. The extension products run alongside sequencing reaction products obtained with the same primer (Figure 2C), identified the 5' ends of the transcripts thus allowing the putative promoter sequences at approximately -10 and -35 -bp for phaP, -Q and -R to be identified. The arrangement of genes in o the pha cluster of Bacillus megaterium is unique among those already published and phaA is WO 00/40730 PCTIUS0O/00364 - 50 notably absent. The phaP, -Q, -R, -B and -C genes were shown to be in a 4,104 -bp region, with phaP and -Q transcribed in one orientation, each from a separate promoter, while phaR, -B and C were divergently transcribed from a promoter in front of phaR. The putative promoters responsible for transcription of phaQ and phaR, phaB and phaC show strong similarity to both 5 Bacillus subtilis Sigma A type (34) and Escherichia coli, Sigma 70 type promoters (14), which can express constitutively. This is in keeping with previous data for Alcaligenes eutrophus showing that phaC is constitutively synthesized, but PHA is not constitutively accumulated (19). The third putative promoter in this region, the phaP promoter, resembles a Sigma D (SigD) type promoter known to control the expression of a regulon of genes associated with flagellar io assembly, chemotaxis and motility (13, 20, 46). In Bacillus subtilis Sigma D is expressed in the exponential phase and peaks in late exponential phase of growth. This parallels the pattern of PHA accumulation previously described for Bacillus megaterium 11561 (32). However, further experiments are required to test the hypothesis that PHA accumulation in regulated by sigma D or products of its resulting transcripts. The phaP gene has 18 -bp duplicate sequences that could is base-pair to form a rho-independent terminator close to its translational stop codon (Figure 2B). The fact that the -35 promoter region of sspD is within this putative hairpin structure, suggests that transcription of phaP and sspD could be mutually exclusive, thus allowing the expression of phaP to play a regulatory role in the expression of sspD (spore specific storage protein). Example 12: Expression of Bacillus megaterium pha genes in Escherichia coli and Pseudomonas 20 putida Functionality of the Bacillus megaterium putative pha gene cluster was tested in Escherichia coli, which is naturally PHA negative, and Pseudomonas putida GPp104, a phaC~ mutant. Plasmids carrying one or more of these genes were introduced and the resulting transformants were tested for PHA accumulation following growth on LB or M9 medium with 25 various carbon sources and the appropriate antibiotic for plasmid selection. Triplicate 500 mL cultures, were grown in 2 liter flasks at 30 0 C, rotating at 250, using 1% inocula of 16 hour cultures, which had been grown in LB, centrifuged and resuspended in equal volumes of 0.9% saline. At 48 hours samples were removed for microscopy and cells were harvested, washed once in dH 2 0 and lyophilized. For PHA extraction, lyophilized cells were 30 suspended in 10 volumes of 5% (w/v) bleach, shaken at 65'C for 1 hour and centrifuged. The pellet was resuspended in 10 volumes of 5% bleach and centrifuged followed by sequentially WO 00/40730 PCT/USOO/00364 - 51 washing in water and 95% ethanol. The amount of PHA is expressed as percent PHA per mass of vacuum dried cells (w/w). Escherichia coli carrying pGM7 or pGM10 accumulated low levels of PHA while Escherichia coli carrying pGM1 or pGM6 accumulated no PHA. Fluorescence microscopy of 5 Nile Blue A stained cells showed approximately 1 cell in 20 had one or several inclusion-bodies and the quantity of PHA produced was approximately 5% of cell dry weight. Since Escherichia coli does not have PhaA, a low level or no PHA is the expected result. However, in Pseudomonas where PhaA is not known to be required, Pseudomonas putida GPp 104 (pGM 107) accumulated PHA on rich as well as minimal medium with various carbon sources to >50% of io cell dry weight, and 90 to 100% of cells appeared full of PHA (Table 5). The positive control P. oleovorans, (equivalent to wild-type Pseudomonas putida) accumulated PHA only when grown on longer chain carbon sources, and not on LB. No PHA was accumulated by the negative control or by Pseudomonas putida carrying phaC alone (pDR1). These results showed that this Bacillus megaterium gene cluster is functional in both Escherichia coli and Pseudomonas putida. is It is not known if the negative results obtained with pDR1 was due to PhaC alone being insufficient to complement PhaC- Pseudomonas putida or to synthesize PHA in Escherichia coli, or if the expression of phaC on pDR1 was not successful in producing protein.

WO 00/40730 PCTUSOO/00364 - 52 Table 5: Cells with PHA as a percent' of total cells following growth on different carbon sources Substrates Source of Positive Negative phaP"QRBC phaC: (no. C atoms) genes: control: control, vector only: Bacillus P. Pseudomona Pseudomona Pseudomona megaterium oleovorans s putida s putida s putida GPp104 GPp104 GPp104 (pSUP104) (pGM107) (pDR1) LB 100 0 0 90 0 LB/Glucose, 100 0 0 92 0 1% M9/Caproate, no growth 88 0 100* 0 12 mM (C6) M9/Octanoat no growth 90 0 92 0 e, 12 mM (C8) '100%, PHA in all cells; 0%, no PHA in any cell; data averaged from >5 fields of each of 3 different cultures, error less than 5%. "N-terminus only present. * Cell shape distorted by large 5 quantity of PHA. These results suggest that the B. megaterium gene cluster, phaP, -Q, -R, -B, and -C, is functional in both E coli and P. putida in so far as accumulation of PHA polymer. It is not known if the negative results obtained with pDR1 were due to PhaC alone being insufficient to complement the PhaC mutant of P. putida or to synthesize PHA in K coli. o Example 13: Localization of PhaP and PhaC proteins Proteins associated with purified PHA inclusion-bodies may not accurately reflect the localization of the these proteins within the growing cell. Visualization ofpha::gfp gene product fusion proteins in living cells throughout culture growth is a useful method for determining both the localization of the pha gene products and their comparative levels in growing cells. PhaP s and PhaC, as fusion proteins (Figure 4), localized to PHA inclusion-bodies at all time points tested throughout growth of Bacillus megaterium 11561. The negative control (pHPS9) showed no fluorescence at any time point. The localization control (pGM 13C) showed non-localized green fluorescence at all time points. The profiles of PHA accumulation in these two control strains were similar to that of the wild-type, where the quantity of PHA decreased during the lag o phase, increased during exponential phase, and continued to increase at a lower steady state rate in stationary phase growth (32).

WO 00/40730 PCT/USOO/00364 - 53 At time 0, cultures of Bacillus megaterium carrying, pGM16.2, pGM13, pGM13C or pHPS9, grown in LB with LM25 EM' for 24 hours at 35'C, were inoculated (5% v/v) into 75 mL of fresh media of the same composition, in 300 mL Naphelco flasks, and growth was continued at 27*C, 250 rpm. Optical densities of cultures were monitored and samples were removed for 5 microscopy at time points starting at time 0, for up to 24 hours. One part of each sample was immediately observed for green fluorescence by embedding in 1% low melting point agarose for viewing in phase contrast and under fluorescence for GFP, magnification x1 000. Another part of each sample was stained for PHA and viewed under light microscopy and by fluorescence for PHA inclusion bodies, magnification x1000. Images were recorded using identical parameters o for all samples to allow comparison of fluorescence and light intensities (f-stop, 1/15; brightness, 0.6; sharpness, 1.0; contrast, 0.8; color, 0.3; see also methods and materials). Results are shown in Figure 5 (A-F). PhaP, monitored as a PhaP::GFP fusion protein in pGM16.2 (Figures 5A and 5B), decreased significantly during the first half (2 hours) of lag phase growth, increased during late is lag phase and early to mid-exponential phase, decreased in mid to late exponential phase and increased during stationary phase growth. A possible explanation for the rapid decrease of PhaP in lag phase is that PhaP may be a storage protein that is degraded as a source of amino acids. The profile of PHA accumulation in these cells (carrying pGM16.2) followed a similar pattern to that of PhaP except that PHA decreased only in the lag phase and continued to accumulate 20 throughout other phases of culture growth. This data is consistent with PHA inclusion-bodies being a source of carbon, reducing equivalents and amino acids when the organism is first provided with fresh medium. Possible explanations as to why the level of PhaP and not PHA decreased at mid to late exponential phase are that either PhaP was synthesized at a slower rate than that of PHA, or PhaP was used as a source of amino acids at this phase of growth or both 25 scenarios may apply. PhaC, monitored as a PhaC::GFP fusion protein in pGM13 showed a similar profile of expression to that of PhaP with one exception: PhaC did not reduce in level during lag phase growth. It did, however, reduce in level in mid to late exponential phase growth, as did PhaP. The profile of PHA accumulation in these cells carrying PhaC::GFP was similar to that of cells 3o carrying PhaP::GFP, except that the PHA level did not reduce during lag phase growth. The increased quantity of PhaC in the cell is a likely explanation since PhaC remained functional in WO 00/40730 PCT/USO0/00364 - 54 the fusion protein PhaC::GFP. This was indicated by the fact that Escherichia coli DH5a (pC/GFP3) and Escherichia coli DH5a (pGM7) accumulated PHA to equivalent low levels, while the host strain alone, or carrying pGFPuv accumulated no PHA, as visualized by fluorescence microscopy of Nile Blue A stained cells. The reduction in level of PhaC in mid to 5 late exponential phase, as was also seen with PhaP, is consistent with both PhaC and PhaP being synthesized at a slower rate than that of PHA. In cells of all growth phases, inclusion-bodies were rarely visible under light in stained heat fixed cells while larger inclusion-bodies were visible in phase contrast of living cells (Figure 5C-F). In older cultures (2 days and older) some cells were lysed, and showed PhaP::GFP and o PhaC::GFP localized to free PHA inclusion-bodies (Figure 5D). Both free and intracellular inclusion-bodies had doughnut shaped localization of GFP at some focal planes while at other focal planes the same inclusion-bodies appeared completely covered in GFP. We interpret this data as a difference in quantity of GFP that is visible when viewed through the edge or the center of the inclusion-bodies. is Example 14: Analysis of Bacillus megaterium 3-ketoacyl-CoA reductase PhaB Stereospecificity assays were conducted on the Bacillus megaterium reductase using various chain length enoyl-CoA esters (C4-C8, Table 6). The assay was done using crotonase from Sigma (L-hydroxy acids) or hydratase from Rhodosprillum rubrum (D-hydroxy acids) to form the 3-hydroxyacyl-CoA compounds from the enoyl-CoA esters. Acetoacetyl-CoA reductase 2o activity was monitored spectrophotometrically as the reduction of NADP* while 3-hydroxyacyl CoAs were oxidized. Based on the assay results (Table 6) the Bacillus megaterium reductase is a D-specific enzyme with a preference for C6 carbon chains. Enzyme reactions using NADH as electron donor for 3-ketoacyl-CoA reduction did not indicate significant enzyme activity with this cofactor.

WO 00/40730 PCT/USO0/00364 - 55 Table 6: Analysis for stereo-specificity of the Bacillus megaterium 3-ketoacyl-CoA reductase. Clone #a D-stereoisomer Spec. act. Clone # L-stereoisomer Spec. act. (hydratase) U/mg (crotonase) U/mg B1-30 Crotonyl CoA 0.155 B1-30 Crotonyl CoA 0.014 B1-30 C5 0.15 B1-30 C5 0.009 B1-30 C6 0.39 B1-30 C6 0.017 B1-30 C8 0.014 B1-30 C8 0.039 B5-20 Crotonyl CoA 0.077 B5-20 Crotonyl CoA 0.004 B5-20 C5 0.074 B5-20 C5 0.01 B5-20 C6 0.219 B5-20 C6 0.012 B5-20 C8 0.003 B5-20 C8 0.001 Negative Crotonyl CoA 0.02 Negative Crotonyl CoA 0.001 Negative C5 0.011 Negative C5 0.003 Negative C6 0.006 Negative C6 0.008 Negative C8 0.033 Negative C8 0.003 a Clone B 1-30 contains pMON48213; clone B5-20 contains pMON48214. Example 15: Verification of the Bacillus megaterium 3-ketoacyl-CoA reductase for PHA accumulation 5 The functionality of the Bacillus megaterium sequence for PHA accumulation in a recombinant system was assayed. Escherichia coli DH5a harboring either pMON48222 (phaARe, phaBBm, phaCRe) only, or two of the following plasmids: pJM9238 AAB (phaA and phaB deleted by FseI digest and religation) or pJM9117 AAB (phaA and phaB deleted by FseI digest and religation) and pMON48220 (phaARe, phaBBm,) was grown in LB + mannitol in io concentrations of 1 or 2 % (w/v), respectively. Cultures were induced for PHA accumulation at

OD

6 00 = 0.6. Percentage PHA (Table 7) and enzyme activity (Table 8) were determined. Plasmid pMON48213 contains the same pha sequences as pMON48220, but was constructed with pSE380 (Invitrogen, Carlsbad, CA), a high level expression vector. Plasmid pMON48221 contains the same pha sequences as pMON48220, but lacks a small fragment of the multicloning 15 site between phaA Re and phaBBm 3-Ketoacyl-CoA reductase was monitored in a total volume of 1 mL containing 100 mM potassium phosphate buffer pH 7.0, 50 tM acetoacetyl-CoA and 150 pM NADPH. The reaction mixture contained between 5 and 50 pL cell extract. Assays were monitored spectrophotometrically at 340 nm.

WO 00/40730 PCT/USOO/00364 - 56 Table 7: Application of the Bacillus megaterium 3-ketoacyl-CoA reductase for PHA formation in Escherichia coli Vectors % PHA Standard deviation pMON48222-4 12.9 pMON48222-8 19.2 Average 16.1 ±4.5 pJM9238 AAB pMON48220 23.7 pJM9238 AAB pMON48220 18.9 Average 21.3 ±3.4 pJM9238 AAB Average 1.5 ± 1.5 pJM9117 AAB pMON48220 12.5 pJM9117 AAB pMON48220 3.9 Average 8.2 ±6.1 pJM9117 AAB Average 0.7 ±0.1 Table 8: Enzyme activity of the Bacillus megaterium 3-ketoacyl-CoA reductase using pMON48220 and pMON48213 Vector acetoacetyl-CoA reductase[U/mg] Negative control 0.08 pMON48220-2 0.24 0.15 pMON48220-9 0.22 0.23 Average 0.21 ± 0.04 pMON48213 4.0 5 Table 9: Verification of the Bacillus megaterium 3-ketoacyl-CoA reductase functionality WO 00/40730 PCT/USO0/00364 - 57 E. coli DH5ax containing plasmids Relevant genotype PHB content % CDW pJM9238AAB, pMON34610 phaCRe nd pJM9238AAB, pMON34575 phaCRe, phaARe 1.2 ± 0.4 pJM9238AAB, pMON48221 phaCRe, phaARe, phaBBm 22.2 ± 4.7 nd = not detectable Example 16: Additional sequences in genomic fragment The 7,916 base pair genomic fragment (SEQ ID NO: 1) additionally contained three complete open reading frames and one incomplete open reading frame encoding proteins in 5 addition to PhaP, PhaQ, PhaR, PhaB, and PhaC. As indicated in Tables 3 and 4, sequence comparisons suggest that ykoY (SEQ ID NO:22) encodes toxic anion resistance protein YkoY (SEQ ID NO:23), ykoZ (SEQ ID NO:24) encodes RNA polymerase sigma factor protein YkoZ (SEQ ID NO:25), and ykrM (SEQ ID NO:26) encodes a portion of the Na* -transporting ATP synthase protein YkrM (SEQ ID NO:27). Sequence sspD (SEQ ID NO:28) matches the known o Bacillus megaterium sequence (4, 10) encoding SspD (SEQ ID NO:29). While the activity of the proteins is identified by their similarity to other known proteins, it is possible that the proteins may have additional functionality involved in polyhydroxyalkanoate biosynthesis. These nucleic acid and amino acid sequences may be used in nucleic acid segments, recombinant vectors, transgenic host cells, and transgenic plants. 5 Example 17: One and two subunit PHA synthase proteins PHA synthases have been identified to be either one or two subunit enzymes (51). Single subunit enzymes have only the PhaC protein, while two subunit enzymes have PhaC and PhaE protein subunits. Nucleic acid sequences encoding PhaE subunits have been found to be located adjacent to the nucleic acid sequences encoding PhaC.

WO 00/40730 PCTUSOO/00364 -58 Table 10: One and two subunit PHA synthases Source organism (Reference) Subunits PhaC Amino acids T. violacea (P45366, D48376) 2 355 C. vinosum (P45370, S29274) 2 355 T. pfennigii (WO 96/08566) 2 357 Synechocystis sp. PCC6803 (50, 2 378 D90906, S77327) P. oleovorans (22, A38604) 1 559 P. aeruginosa (S29305) 1 559 R.ruber(S25725) 1 562 R. eutropha (A34371) 1 589 A. caviae (D88825) 1 594 P. denitrificans (JC6023) 1 624 R. etli (3, U30612) 1 636 B. megaterium (SEQ ID NO: 11) 362 Based on the number of amino acids in the deduced sequence and homology to known PhaC proteins, the B. megaterium would be expected to be part of a two subunit synthase. However, the nucleic acid sequences adjacent to phaC in the 7,916 base pair genomic fragment 5 show no significant similarity to a phaE sequence. Upstream of phaC is phaB, and downstream is ykrM, a suspected Na* transporting ATP synthase (Table 4). In combination with the observation that the B. megaterium sequences were able to complement P. putida GPp104 to accumulate PHA, this suggests that the B. megaterium phaC may encode a novel class of PHA synthase, i.e. a single subunit synthase with a molecular weight in the range of two subunit PhaC o proteins. Example 18: Pathway for the production of C4/C6/C8/C 10 PHA copolymers Figure 10 outlines a proposed biosynthetic pathway for the production of PHA copolymers incorporating C4 and/or C6 monomer units. Produced polymers may include C4-co C6, C4-co-C8, C4-co-C6-co-C8, C6-co-C8, C6, and C8. A recombinant host cell or plant may s be constructed to contain the nucleic acid sequences encoding the required enzymes. The p-ketothiolase is preferably BktB (53, WO 98/00557). The p-ketothiolase can condense two molecules of acetyl-CoA to form acetoacetyl-CoA. This product may be reduced to 3HB-CoA by the Bacillus megaterium 3-keto-acyl-CoA reductase protein. 3HB-CoA may be WO 00/40730 PCT/USOO/00364 - 59 converted to crotonyl-CoA by a hydratase such as that from Aeromonas caviae (54). Subsequent reduction to butyryl-CoA is performed by a butyryl-CoA dehydrogenase such as that cloned from Clostridium acetobutylicum (55). This product may be condensed with acetyl-CoA by the p-ketothiolase to afford 3-ketohexanoyl-CoA. This is the preferred substrate of the Bacillus 5 megaterium reductase, leading to the production of 3-hydroxyhexanoyl-CoA. This product may be incorporated into C6 polymers or copolymers (e.g. C4-co-C6) by a PHA synthase having a broad substrate specificity (e.g. (56)). An additional round of condensation may lead to production of the C8 monomer, allowing the introduction of C8 into PHA polymers or copolymers. A further additional round of condensation may lead to production of the C 10 io monomer, allowing the introduction of C10 into PHA polymers or copolymers. Example 19: Nucleic acid mutation and hybridization Variations in the nucleic acid sequence encoding a protein may lead to mutant protein sequences that display equivalent or superior enzymatic characteristics when compared to the sequences disclosed herein. This invention accordingly encompasses nucleic acid sequences is which are similar to the sequences disclosed herein, protein sequences which are similar to the sequences disclosed herein, and the nucleic acid sequences that encode them. Mutations may include deletions, insertions, truncations, substitutions, fusions, shuffling of subunit sequences, and the like. Mutations to a nucleic acid sequence may be introduced in either a specific or random 20 manner, both of which are well known to those of skill in the art of molecular biology. A myriad of site-directed mutagenesis techniques exist, typically using oligonucleotides to introduce mutations at specific locations in a nucleic acid sequence. Examples include single strand rescue (Kunkel, T. Proc. Nat. A cad. Sci. U.S.A., 82: 488-492, 1985), unique site elimination (Deng and Nickloff, Anal. Biochem. 200: 81, 1992), nick protection (Vandeyar, et al. Gene 65: 129-133, 25 1988), and PCR (Costa, et al. Methods Mol. Biol. 57: 31-44, 1996). Random or non-specific mutations may be generated by chemical agents (for a general review, see Singer and Kusmierek, Ann. Rev. Biochem. 52: 655-693, 1982) such as nitrosoguanidine (Cerda-Olmedo et al., J. Mol. Biol. 33: 705-719, 1968; Guerola, et al. Nature New Biol. 230: 122-125, 1971) and 2 aminopurine (Rogan and Bessman, J. Bacteriol. 103: 622-633, 1970), or by biological methods 30 such as passage through mutator strains (Greener et al. Mol. Biotechnol. 7: 189-195, 1997).

WO 00/40730 PCT/USOO/00364 - 60 Nucleic acid hybridization is a technique well known to those of skill in the art of DNA manipulation. The hybridization properties of a given pair of nucleic acids is an indication of their similarity or identity. Mutated nucleic acid sequences may be selected for their similarity to the disclosed nucleic acid sequences on the basis of their hybridization to the disclosed 5 sequences. Low stringency conditions may be used to select sequences with multiple mutations. One may wish to employ conditions such as about 0.15 M to about 0.9 M sodium chloride, at temperatures ranging from about 20*C to about 55'C. High stringency conditions may be used to select for nucleic acid sequences with higher degrees of identity to the disclosed sequences. Conditions employed may include about 0.02 M to about 0.15 M sodium chloride, about 0.5% to io about 5% casein, about 0.02% SDS and/or about 0.1% N-laurylsarcosine, about 0.001 M to about 0.03 M sodium citrate, at temperatures between about 50*C and about 70'C. More preferably, high stringency conditions are 0.02 M sodium chloride, 0.5% casein, 0.02% SDS, 0.001 M sodium citrate, at a temperature of 50*C. Example 20: Determination of homologous and degenerate nucleic acid sequences 15 Modification and changes may be made in the sequence of the proteins of the present invention and the nucleic acid segments which encode them and still obtain a functional molecule that encodes a protein with desirable properties. The following is a discussion based upon changing the amino acid sequence of a protein to create an equivalent, or possibly an improved, second-generation molecule. The amino acid changes may be achieved by changing 20 the codons of the nucleic acid sequence, according to the codons given in Table 11.

WO 00/40730 PCT/USOO/00364 - 61 Table 11: Codon degeneracies of amino acids Amino acid One letter Three letter [Codons Alanine A Ala GCA GCC GCG GCT Cysteine C Cys TGC TGT Aspartic acid D Asp GAC GAT Glutamic acid E Glu GAA GAG Phenylalanine F Phe TTC TTT Glycine G Gly GGA GGC GGG GGT Histidine H His CAC CAT Isoleucine I Ile ATA ATC ATT Lysine K Lys AAA AAG Leucine L Leu TTA TTG CTA CTC CTG CTT Methionine M Met ATG Asparagine N Asn AAC AAT Proline P Pro CCA CCC CCG CCT Glutamine Q Gln CAA CAG Arginine R Arg AGA AGG CGA CGC CGG CGT Serine S Ser AGC AGT TCA TCC TCG TCT Threonine T Thr ACA ACC ACG ACT Valine V Val GTA GTC GTG GTT Tryptophan W Trp TGG Tyrosine Y Tyr TAC TAT Certain amino acids may be substituted for other amino acids in a protein sequence without appreciable loss of enzymatic activity. It is thus contemplated that various changes may be made in the peptide sequences of the disclosed protein sequences, or their corresponding 5 nucleic acid sequences without appreciable loss of the biological activity. In making such changes, the hydropathic index of amino acids may be considered. The importance of the hydropathic amino acid index in conferring interactive biological function on a protein is generally understood in the art (Kyte and Doolittle, . Mol. Biol., 157: 105-132, 1982). It is accepted that the relative hydropathic character of the amino acid contributes to the o secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like. Each amino acid has been assigned a hydropathic index on the basis of their hydrophobicity and charge characteristics. These are: isoleucine (+4.5); valine (+4.2); leucine 5 (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine WO 00/40730 PCT/USOO/00364 - 62 (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine ( 3.2); glutamate/glutamine/aspartate/asparagine (-3.5); lysine (-3.9); and arginine (-4.5). It is known in the art that certain amino acids may be substituted by other amino acids having a similar hydropathic index or score and still result in a protein with similar biological 5 activity, i.e., still obtain a biologically functional protein. In making such changes, the substitution of amino acids whose hydropathic indices are within ±2 is preferred, those within ±1 are more preferred, and those within ±0.5 are most preferred. It is also understood in the art that the substitution of like amino acids may be made effectively on the basis of hydrophilicity. U.S. Patent No. 4,554,101 (Hopp, T.P., issued o November 19, 1985) states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the protein. The following hydrophilicity values have been assigned to amino acids: arginine/lysine (+3.0); aspartate/glutamate (+3.0 ±1); serine (+0.3); asparagine/glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5 ±1); alanine/histidine (-0.5); cysteine (-1.0); methionine (-1.3); 5 valine (-1.5); leucine/isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); and tryptophan ( 3.4). It is understood that an amino acid may be substituted by another amino acid having a similar hydrophilicity score and still result in a protein with similar biological activity, i.e., still obtain a biologically functional protein. In making such changes, the substitution of amino acids o whose hydropathic indices are within ±2 is preferred, those within ±1 are more preferred, and those within ±0.5 are most preferred. As outlined above, amino acid substitutions are therefore based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions which take various of the foregoing 5 characteristics into consideration are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine. Changes which are not expected to be advantageous may also be used if these resulted in functional fusion proteins.

WO 00/40730 PCT/USOO/00364 - 63 Plant Vectors In plants, transformation vectors capable of introducing nucleic acid sequences encoding polyhydroxyalkanoate biosynthesis enzymes are easily designed, and generally contain one or more nucleic acid coding sequences of interest under the transcriptional control of 5' and 3' 5 regulatory sequences. Such vectors generally comprise, operatively linked in sequence in the 5' to 3' direction, a promoter sequence that directs the transcription of a downstream heterologous structural nucleic acid sequence in a plant; optionally, a 5' non-translated leader sequence; a nucleic acid sequence that encodes a protein of interest; and a 3' non-translated region that encodes a polyadenylation signal which functions in plant cells to cause the termination of io transcription and the addition of polyadenylate nucleotides to the 3' end of the mRNA encoding the protein. Plant transformation vectors also generally contain a selectable marker. Typical 5' 3' regulatory sequences include a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal. Vectors for plant transformation have been reviewed in Rodriguez et al. (Vectors: A Survey of Molecular is Cloning Vectors and Their Uses, Butterworths, Boston., 1988), Glick et al. (Methods in Plant Molecular Biology and Biotechnology, CRC Press, Boca Raton, Fla., 1993), and Croy (Plant Molecular Biology Labfax, Hames and Rickwood (Eds.), BIOS Scientific Publishers Limited, Oxford, UK., 1993). Plant Promoters 20 Plant promoter sequences can be constitutive or inducible, environmentally- or developmentally-regulated, or cell- or tissue-specific. Often-used constitutive promoters include the CaMV 35S promoter (Odell, J.T. et al., Nature 313: 810-812. 1985), the enhanced CaMV 35S promoter, the Figwort Mosaic Virus (FMV) promoter (Richins et al.. Nucleic Acids Res. 20: 8451-8466, 1987), the mannopine synthase (mas) promoter, the nopaline synthase (nos) 25 promoter, and the octopine synthase (ocs) promoter. Useful inducible promoters include promoters induced by salicylic acid or polyacrylic acids (PR-1. Williams , S. W. et al, Biotechnology 10: 540-543, 1992), induced by application of safeners (substituted benzenesulfonamide herbicides, Hershey, H.P. and Stoner, T.D., Plant Mol. Biol. 17: 679-690, 1991), heat-shock promoters (Ou-Lee et al., Proc. Natl. Acad. Sci U.S.A. 83: 6815-6819, 1986; 30 Ainley et al., Plant Mol. Biol. 14: 949-967, 1990), a nitrate-inducible promoter derived from the spinach nitrite reductase gene (Back et al., Plant Mol. Biol. 17: 9-18. 1991), hormone-inducible WO 00/40730 PCT/USOO/00364 - 64 promoters (Yamaguchi-Shinozaki, K. et al., Plant Mol. Biol. 15: 905-912, 1990; Kares et al., Plant Mol. Biol. 15: 225-236, 1990), and light-inducible promoters associated with the small subunit of RuBP carboxylase and LHCP gene families (Kuhlemeier et al., Plant Cell 1: 471, 1989; Feinbaum, R.L. et al., Mol. Gen. Genet. 226: 449-456, 1991; Weisshaar, B. et al., EMBO 5 J. 10: 1777-1786, 1991; Lam, E. and Chua, N.H., J. Biol. Chem. 266: 17131-17135, 1990; Castresana, C. et al., EMBO J. 7: 1929-1936, 1988; Schulze-Lefert et al., EMBO J. 8: 651, 1989). Examples of useful tissue-specific, developmentally-regulated promoters include the p conglycinin 7S promoter (Doyle, J.J. et al., J. Biol. Chem. 261: 9228-9238, 1986; Slighton and Beachy, Planta 172: 356-363, 1987), and seed-specific promoters (Knutzon, D.S. et al., Proc. o Natl. Acad. Sci U.S.A. 89: 2624-2628, 1992; Bustos, M.M. et al., EMBO J. 10: 1469-1479, 1991; Lam and Chua, Science 248: 471, 1991; Stayton et al., Aust. J. Plant. Physiol. 18: 507, 1991). Plant functional promoters useful for preferential expression in seed plastids include those from plant storage protein genes and from genes involved in fatty acid biosynthesis in oilseeds. Examples of such promoters include the 5' regulatory regions from such genes as napin (Kridl et s al., Seed Sci. Res. 1: 209-219, 1991), phaseolin, zein, soybean trypsin inhibitor, ACP, stearoyl ACP desaturase, and oleosin. Seed-specific gene regulation is discussed in EP 0 255 378. Promoter hybrids can also be constructed to enhance transcriptional activity (Comai, L. and Moran, P.M., U.S. Patent No. 5,106,739, issued April 21, 1992), or to combine desired transcriptional activity and tissue specificity. A developing seed selective promoter may be o obtained from the fatty acid hydroxylase gene of Lesquerella (P-lh) (Broun, P. and C. Somerville. Plant Physiol. 113: 933-942, 1997). Plant transformation and regeneration A variety of different methods can be employed to introduce such vectors into plant protoplasts, cells, callus tissue, leaf discs, meristems, etcetera, to generate transgenic plants, including Agrobacterium-mediated transformation, particle gun delivery, microinjection, electroporation, polyethylene glycolmediated protoplast transformation, liposome-mediated transformation, etcetera (reviewed in Potrykus, I. Ann. Rev. Plant Physiol. Plant Mol. Biol. 42: 205-225, 1991). In general, transgenic plants comprising cells containing and expressing DNAs encoding polyhydroxyalkanoate biosynthesis proteins can be produced by transforming plant o cells with a DNA construct as described above via any of the foregoing methods; selecting plant WO 00/40730 PCT/USOO/00364 - 65 cells that have been transformed on a selective medium; regenerating plant cells that have been transformed to produce differentiated plants; and selecting a transformed plant which expresses the protein-encoding nucleotide sequence. Specific methods for transforming a wide variety of dicots and obtaining transgenic 5 plants are well documented in the literature (Gasser and Fraley, Science 244: 1293-1299, 1989; Fisk and Dandekar, Scientia Horticulturae 55: 5-36, 1993; Christou, Agro Food Industry Hi Tech, p.

1 7, 1994; and the references cited therein). Successful transformation and plant regeneration have been reported in the monocots as follows: asparagus (Asparagus officinalis; Bytebier et al., Proc. Natl. Acad Sci. U.S.A. 84: 5345 10 5349, 1987); barley (Hordeum vulgarae; Wan and Lemaux, Plant Physiol. 104: 37-48, 1994); maize (Zea mays; Rhodes, C.A. et al., Science 240: 204-207, 1988; Gordon-Kamm et al., Plant Cell 2: 603-618, 1990; Fromm, M.E. et al., Bio/Technology 8: 833-839, 1990; Koziel et al., Bio/Technology 11: 194-200, 1993); oats (Avena sativa; Somers et al., Bio/Technology 10: 1589 1594, 1992); orchardgrass (Dactylis glomerata; Horn et al., Plant Cell Rep. 7: 469-472, 1988); 15 rice (Oryza sativa, including indica and japonica varieties; Toriyama et al., Bio/Technology 6: 10, 1988; Zhang et al., Plant Cell Rep. 7: 379-384, 1988; Luo and Wu, Plant Mol. Biol. Rep. 6: 165-174, 1988; Zhang and Wu, Theor. Appl. Genet. 76: 835-840, 1988; Christou et al., Bio/Technology 9: 957-962, 1991); rye (Secale cereale; De la Pena et al., Nature 325: 274-276, 1987); sorghum (Sorghum bicolor; Casas, A.M. et al., Proc. Natl. Acad Sci. U.S.A. 90: 11212 20 11216, 1993); sugar cane (Saccharum spp.; Bower and Birch, Plant J. 2: 409-416, 1992); tall fescue (Festuca arundinacea; Wang, Z.Y. et al., Bio/Technology 10: 691-696, 1992); turfgrass (Agrostispalustris; Zhong et al., Plant Cell Rep. 13: 1-6, 1993); wheat (Triticum aestivum; Vasil et al., Bio/Technology 10: 667-674, 1992; Weeks, T. et al., Plant Physiol. 102: 1077-1084, 1993; Becker et al., Plant J. 5: 299-307, 1994), and alfalfa (Masoud, S.A. et al., Transgen. Res. 5: 313, 25 1996). Host plants Particularly useful plants for polyhydroxyalkanoate production include those that produce carbon substrates, including tobacco, wheat, potato, Arabidopsis, and high oil seed plants such as corn, soybean, canola, oil seed rape, sugarbeet, sunflower, flax, peanut, sugarcane, switchgrass, 30 and alfalfa.

WO 00/40730 PCT/US0O/00364 - 66 Example 21: Plastid transformation Alternatively, polyhydroxyalkanoate biosynthesis enzymes facilitating the increase in oil content of plants and/or herbicide resistance discussed herein can be expressed in situ in plastids by direct transformation of these organelles with appropriate recombinant expression constructs. 5 Constructs and methods for stably transforming plastids of higher plants are well known in the art (Svab, Z. et al., Plant Mol. Biol. 14(2): 197-205, 1990; Svab et al., Proc. Natl. Acad Sci. US A. 90(3): 913-917, 1993; Staub et al., EMBO J. 12(2): 601-606, 1993; Maliga et al., U.S. Patent No. 5,451,513; PCT International Publications WO 95/16783, WO 95/24492, and WO 95/24493). These methods generally rely on particle gun delivery of DNA containing a io selectable or scorable marker in addition to introduced DNA sequences for expression, and targeting of the DNA to the plastid genome through homologous recombination. Transformation of a wide variety of different monocots and dicots by particle gun bombardment is routine in the art (Hinchee et al., 1994; Walden and Wingender, 1995). The plastid may be transformed by using protoplast and PEG (polyethylene glycol) (Koop, et al., Physiol. Plant. 85: 339, 1992; is Golds et al., Bio/Technol. 11: 95-97, 1993), cocultivation of protoplasts and Agrobacteria carrying transformation vectors (De Block et al., EMBO J. 4: 1367-1372, 1985), and by electroporation (Kin-Ying et al., Plant J. 4: 737, 1996). Nucleic acid constructs for plastid transformation generally comprise a targeting segement comprising flanking nucleic acid sequences substantially homologous to a 20 predetermined sequence of a plastid genome, which targeting segment enables insertion of nucleic acid coding sequences of interest into the plastid genome by homologous recombination with the predetermined sequence; a selectable marker sequence, such as a sequence encoding a form of plastid 16S ribosomal RNA that is resistant to spectinomycin or streptomycin, or that encodes a protein which inactivates spectinomycin or streptomycin (such as the aadA gene), 25 disposed within the targeting segment, wherein the selectable marker sequence confers a selectable phenotype upon plant cells, substantially all the plastids of which have been transformed with the nucleic acid construct; and one or more nucleic acid coding sequences of interest disposed within the targeting segment relative to the selectable marker sequence so as not to interfere with conferring of the selectable phenotype. In addition, plastid expression 30 constructs also generally include a plastid promoter region and a transcription termination region WO 00/40730 PCT/US0O/00364 - 67 capable of terminating transcription in a plant plastid, wherein the regions are operatively linked to the nucleic acid coding sequences of interest. A further refinement in chloroplast transformation/expression technology that facilitates control over the timing and tissue pattern of expression of introduced nucleic acid coding 5 sequences in plant plastid genomes has been described in PCT International Publication WO 95/16783. This method involves the introduction into plant cells of constructs for nuclear transformation that provide for the expression of a viral single subunit RNA polymerase and targeting of this polymerase into the plastids via fusion to a plastid transit peptide. Transformation of plastids with nucleic acid constructs comprising a viral single subunit RNA 1o polymerase-specific promoter specific to the RNA polymerase expressed from the nuclear expression constructs operably linked to nucleic acid coding sequences of interest permits control of the plastid expression constructs in a tissue and/or developmental specific manner in plants comprising both the nuclear polymerase construct and the plastid expression constructs. Expression of the nuclear RNA polymerase coding sequence can be placed under the control of is either a constitutive promoter, or a tissue- or developmental stage-specific promoter, thereby extending this control to the plastid expression construct responsive to the plastid-targeted, nuclear-encoded viral RNA polymerase. The introduced nucleic acid coding sequence can be a single encoding region, or may contain a number of consecutive encoding sequences to be expressed as an engineered or synthetic operon. The latter is especially attractive where, as in 20 the present invention, it is desired to introduce multigene biochemical pathways into plastids. This approach is more complex using standard nuclear transformation techniques since each gene introduced therein must be engineered as a monocistron, including an encoded transit peptide and appropriate promoter and terminator signals. Individual gene expression levels may vary widely among different cistrons, thereby possibly adversely affecting the overall 25 biosynthetic process. This can be avoided by the chloroplast transformation approach. All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the 30 compositions and/or methods and in the steps or in the sequence of steps of the methods described herein without departing from the concept, spirit and scope of the invention. More WO 00/40730 PCTIUS0O/00364 - 68 specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention.

WO 00/40730 PCT/US00/00364 - 69 REFERENCES The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. 5 1. Altschul, S.F., T.L. Madden, A.A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D.J. Lipman. 1997. Gapped BLAST and PSI BLAST: a new generation of protein database search programs. Nucleic Acids Res., 25: 3389-3402. 2. Anderson, A. and E.A. Dawes. 1990. Occurrence, metabolism, metabolic role, and industrial uses of bacterial polyhydroxyalkanoates. Microbiol. Rev., 54: 450-472. o 3. Cevallos, M.A., S. Encarnacion, A. Leija, Y. Mora, and J. Mora. 1996. Genetic and physiological characterization of a Rhizobium etli mutant strain unable to synthesize poly-beta-hydroxybutyrate. J. Bacteriol., 178: 1646-1654. 4. Connors, M.J., J.M. Mason, and P. Setlow. 1986. Cloning and nucleotide sequencing of genes for three small, acid soluble proteins Bacillus subtilis spores. J. Bacteriol., 166: 5 417-425. 5. deSmet, M.J., G. Eggink, B. Witholt, J. Kingma, and H. Wynberg. 1983. Characterization of intracellular inclusions formed by Pseudomonas oleovorans during growth on octane. J. Bacteriol., 154: 870-878. 6. Dunlop, W. and A.W. Robards. 1973. Ultrastructural study of poly-jp-hydroxybutyrate 0 granules from Bacillus cereus. J. Bacteriol., 114: 1271-1280. 7. Eggink, G., P. de Waard, and G.N.M. Huijberts. 1992. The role of fatty acid biosynthesis and degradation in the supply of substrates for poly(3-hydroxyalkanoate) formation in Pseudomonasputida. FEMSMicrobiol. Rev., 103: 159-164. 8. Ellar, D., D.G. Lundgren, K. Okamura, and R.H. Marchessault. 1968. Morphology of 5s poly- P-hydroxybutyrate granules. J. Mol. Biol., 35: 489-502. 9. Fliss, E.R., A.C. Loshon, and P. Setlow. 1986. Genes for Bacillus megaterium small, acid-soluble spore proteins: Cloning and nucleotide sequence of three additional genes from this multigene family. J. Bacteriol., 165: 467-473. 10. Fliss, E.R. and P. Setlow. 1984. Bacillus megaterium spore protein C-3: nucleotide 3o sequence of its gene and the amino acid sequence at its spore cleavage site. Gene, 30: 167-172.

WO 00/40730 PCT/USOO/00364 - 70 11. Fuller, R.C., J.P. O'Donnell, J Saulnier, T.E. Redlinger, J. Foster, and R.W. Lenz. 1992. The supramolecular architecture of the polyhydroxyalkanoate inclusions in Pseudomonas oleovorans. FEMS Microbiol. Rev., 103: 279-288. 12. Gerngross, T.U., P. Reilly, J. Stubbe, A.J. Sinskey, and O.P. Peoples. 1993. 5 Immunocytochemical analysis of poly-fp-hydroxybutyrate (PHB) synthase enzyme at the surface of PHB granules. J. Bacteriol., 175: 5289-5293. 13. Gilman, M.Z., J.L. Wings, and M.J. Chamberlin. 1981. Nucleotide sequence of two Bacillus subtilis promoters used by Bacillus subtilis sigma-28 RNA polymerase. Nucleic Acids Res., 9: 5991-6000. io 14. Gitt, M.A., L.F. Wang, and R.H. Doi. 1985. A strong sequence homology exists between RNA polymerase sigma factors of Bacillus subtilis and Escherichia coli. J. Biol. Chem., 260: 7178-7185. 15. Griebel, R., Z. Smith, and M. Merrick. 1968. Metabolism of poly- P-hydroxybutyrate. 1. Purification, composition, and properties of native poly- p-hydroxyburyrate granules from is Bacillus megaterium. Biochem., 7: 3676-3681. 16. Haima, P., D. van Sinderen, H. Scholting, S. Bron, and G. Venema. 1990. Development of p-galactosidase a.-complementation system for molecular cloning in Bacillus subtilis. Gene, 86: 63-69. 17. Haywood, G.W., A.J. Anderson, L. Chu, and E.A. Dawes. 1988. The role of NADH- and 20 NADPH-linked acetoacetyl-CoA reductases in the poly-3-hydroxybutyrate synthesizing organism Alcaligenes eutrophus. FEMS Microbiol. Lett., 52: 259-264. 18. Haywood, G.W., A.J. Anderson, L. Chu, and E.A. Dawes. 1988. Characterization of two 3-ketothiolases in the polyhydroxyalkanoate synthesizing organism Alcaligenes eutrophus. FEMS Microbiol. Lett., 52: 91-96. 25 19. Haywood, G.W., A.J. Anderson, and E.A. Dawes. 1989. The importance of PHB synthase substrate specificity in polyhydroxyalkanoate synthesis by Alcaligenes eutrophus. FEMSMicrobiol. Lett., 57: 1-6. 20. Helmann, J.D. 1991. Alternative sigma factors and the regulation of flagellar gene expression. Mol. Microbiol., 5: 2875-2882. 30 21. Huang, A.H.C. 1992. Oil bodies and oleosins in seeds. Annu. Rev. Plant Physiol. Plant Mol. Biol., 43: 177-200.

WO 00/40730 PCT/USOO/00364 - 71 22. Huisman, G.W., E. Wonink, R. Meima, B. Kazemier, P. Terpstra, and B. Witholt. 1991. Metabolism of poly(3-hydroxyalkanoates) (PHAs) by Pseudomonas oleovorans. J. Biol. Chem., 266: 2191-2198. 23. Kaneko, T. et al. 1996. Sequence analysis of the genome of the unicellular 5 cyanobacterium Synechocystis sp. strain PCC6803. II. Sequence determination of the entire genome and assignment of potential protein-coding regions. DNA Res., 3: 109 136. 24. Kunst, N. et al. 1997. The complete genome sequence of the Gram-positive bacterium Bacillus subtilis. Nature, 390: 249-256. 10 25. Lauzier, C., R.H. Marchessault, P. Smith, and H. Chanzy. 1992. Structural study of isolated poly(p-hydroxybutyrate) granules. Polymer, 33: 823-827. 26. Lee, S.Y. 1995. Bacterial polyhydroxyalkanoates. Biotechnology & Engineering, 49: 1-14. 27. Liebergesell, M., B. Schmidt, and A. Steinbichel. 1992. Isolation and identification of granule-associated proteins relevant for poly(hydroxyalkanoic acid) biosynthesis in 15 Chromatium vinosum D. FEMS Microbiol. Lett., 99: 227-232. 28. Liebergesell, M. and A. Steinbichel. 1992. Cloning and nucleotide sequences of genes relevant for biosynthesis of poly(3-hydroxybutyric acid) in Chromatium vinosum strain D. Eur. J. Biochem., 209: 135-150. 29. Liebergesell, M. and A. Steinbtichel. 1993. Cloning and molecular analysis of the poly 20 (3-hydroxybutyric acid) biosynthetic genes of Thiocystis violacea. Appl. Microbiol. Biotechnol., 38: 493-501. 30. Lundgren, D.G., R.M. Pfister, and J.M. Merrick. 1964. Structure of poly-p hydroxybutyric acid granules. J. Gen. Microbiol., 34: 441-446. 31. Magni, C., P. Marini, and D. de Mendoza. 1995. Extraction of RNA from gram-positive 25 bacteria. Biotechniques, 19: 882-884. 32. McCool, G.J., T. Fernandez, N. Li, and M.C. Cannon. 1996. Polyhydroxyalkanoate inclusion-body growth and proliferation in Bacillus megaterium. FEMS Microbiol. Lett., 137: 41-48. 33. Miller, J.H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, 30 Cold Spring Harbor, NY: WO 00/40730 PCT/USOO/00364 - 72 34. Moran, C.P. Jr., N. Lang, S.F.J. LeGrice, G. Lee, M. Stephens, A.L. Sonnenshein, J. Pero, and R. Losick. 1982. Nucleotide sequences that signal the initiation of transcription and translation in Bacillus subtilis. Mol. Gen. Genet., 186: 339-346. 35. Morbidoni, H.R., D. de Mendoza, and J.E. Cronan. 1996. Bacillus subtilis acyl carrier 5 protein is encoded in a cluster of lipid biosynthesis genes. J. Bacteriol., 178: 4794-4800. 36. Pieper-Furst, U., M.H. Madkour, F. Mayer, and A. Steinbtichel. 1994. Purification and characterization of a 14-kilodalton protein that is bound to the surface of polyhydroxyalkanoic acid granules in Rhodococcus ruber. J. Bacteriol., 176: 4328-4337. 37. Pieper-Furst, U., M.H. Madkour, F. Mayer, and A. Steinbtichel. 1995. Identification of 10 the region of a 14-kilodalton protein of Rhodococcus ruber that is responsible for the binding of this Phasin to polyhydroxyalkanoic acid granules. J. Bacteriol., 177: 2513 2523. 38. Sambrook, J., E.F. Fritsch & T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual., 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 15 39. Shark, K.B., F.D. Smith, P.R. Harpending, and J.L. Rasmussen. 1991. Biolistic transformation of a procaryote, Bacillus megaterium. Apple. Environ. Microbiol., 57: 480 485. 40. Simon, R., Priefer, U. & PGhler, A. 1983. In A. Phfiler (Ed.), Molecular genetics of the bacteria-plant interaction. Springer, Berlin. p. 98-106. 20 41. Steinbichel, A. 1991. Polyhydroxyalkanoic acids. p. 123-213. In D. Byrom (Ed.), Biomaterials, novel materials from biological sources. Macmillan Publishers Ltd., Basingstoke, England. 42. Steinbiichel, A., K. Aerts, W. Babel, C. Follner, M. Liebergesell, M.H. Madkour, F. Mayer, U. Pieper-Furst, A. Pries, H.E. Valentin, and R. Wieczorek. 1995. Considerations 25 on the structure and biochemistry of bacterial polyhydroxyalkanoic acid inclusions. Can. J. Microbiol., 41: 94-105. 43. Steinbtchel, A., E. Hustede, M. Liebergesell, U. Pieper, A. Timm, and H. Valentin. 1992. Molecular basis for biosynthesis and accumulation of polyhydroxyalkanoic acids in bacteria. FEMS Microbiol. Rev., 103: 217-230. 30 44. Steinbiichel, A. and H.G. Schlegel. 1991. Physiology and molecular genetics of poly(p hydroxyalkanoic acid) synthesis in Alcaligenes eutrophus. Mol. Microbiol., 5: 535-542.

WO 00/40730 PCT/USOO/00364 - 73 45. Steinbtichel, A. and H.E. Valentin. 1995. Diversity of bacterial polyhydroxyalkanoic acids. FEMS Microbiol. Lett., 128: 219-228. 46. Vary, P. 1993. The genetic map of Bacillus megaterium, p. 475-481. In A.L. Sonenshein, J.A. Hoch & R. Losich (Eds.), Bacillus subtilis and other gram positive 5 bacteria. American Society for Microbiology, Washington, D.C. 47. Wang, W.S. and D.G. Lundgren. 1969. Poly- p-hydroxybutyrate in the chemolithotrophic bacterium Ferrobacillusferrooxidans. J. Bacteriol., 97: 947-950. 48. Wieczorek, R., A. Pries, A. Steinbtichel, and F. Mayer. 1995. Analysis of a 24-kilodalton protein associated with the polyhydroxyalkanoic acid granules in Alcaligenes eutrophus. 10 J. Bacteriol., 177: 2425-2435. 49. Wieczorek, R., A. Steinbichel, and B. Schmidt. 1996. Occurrence of polyhydroxyalkanoic acid granule-associated proteins related to the Alcaligenes eutrophus H16 GA24 protein in other bacteria. FEMS Microbiol. Lett., 135: 23-30. 50. Hein, S., Tran, H., and A. Steinbiichel. 1998. Synechocystis sp. PCC6803 possesses a is two-component polyhydroxyalkanoic acid synthase similar to that of anoxygenic purple sulfur bacteria. Arch. Microbiol., 170(3): 162-70. 51. Steinbtichel, A., Hustede, E., Liebergesell, M., Pieper, U., Timm, A., and H. Valentin. 1992. Molecular basis for biosynthesis and accumulation of polyhydroxyalkanoic acids in bacteria. FEMS Microbiol. Rev. 103: 217-230. 20 52. Basak, A., Boudreault, A., Chen, A., Chretien, M., Seidah, N.G., and C. Lazure. 1995. Application of the multiple antigenic peptides (MAP) strategy to the production of prohormone convertases antibodies: synthesis, characterization and use of 8-branched immunogenic peptides. J. Pept. Sci. 1(6): 385-95. 53. Slater, S., K.L. Houmiel, M. Tran, T.A. Mitsky, T.B. Taylor, S.R. Padgette, and K.J. 25 Gruys. 1998. Multiple P-ketothiolases mediate poly(P-hydroxyalkanoate) copolymer synthesis in Ralstonia eutropha. J. Bacteriol. 180: 1979-1987. 54. Fukui, T., N. Shiomi, and Y. Doi. 1998. Expression and characterization of (R)-specific enoyl coenzyme A hydratase involved in polyhydroxyalkanoate biosynthesis in Aeromonas caviae. J. Bacteriol. 180: 667-6673. 30 55. Boynton, Z.L., G.N. Bennett, and F.B. Rudolph. 1996. Cloning, sequencing, and expression of clustered genes encoding b-hydroxybutyryl-coenzyme A (CoA) WO 00/40730 PCT/US0O/00364 - 74 dehydrogenase, crotonase, and butyryl-CoA dehydrogenase from Clostridium acetobutylicum ATCC 824. J. Bacteriol. 178: 3015-3024. 56. Liebergesell, M., F. Mayer, and A. Steinbtichel. 1993. Analysis of polyhydroxyalkanoic acid-biosynthesis genes of anoxygenic phototrophic bacteria reveals synthesis of a 5 polyester exhibiting an unusual composition. Apple. Microbiol. Biotechnol. 40:292-300.

Claims

1. A nucleic acid segment comprising a nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid 5 sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:3; o and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3. s

2. The nucleic acid segment of claim 1, wherein the nucleic acid sequence is SEQ ID NO:2.

3. The nucleic acid segment of claim 1, wherein the nucleic acid sequence encodes SEQ ID NO:3. o

4. An isolated polyhydroxyalkanoate inclusion body associated protein comprising an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO:3; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3.

5. The isolated polyhydroxyalkanoate inclusion body associated protein of claim 4, wherein the amino acid sequence is SEQ ID NO:3.

6. A recombinant vector comprising in the 5' to 3' direction: 0 a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; WO 00/40730 PCT/US00/00364 - 76 b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:2; 5 a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an 10 antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3; and c) a 3' transcription terminator.

7. The recombinant vector of claim 6, wherein the nucleic acid sequence is SEQ ID NO:2. 15

8. The recombinant vector of claim 6, wherein the nucleic acid sequence encodes SEQ ID NO:3.

9. A recombinant host cell comprising a nucleic acid segment encoding a 20 polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid segment is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:2 or the complement thereof; 25 a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3. 30

10. The recombinant host cell of claim 9, wherein the nucleic acid sequence is SEQ ID NO:2. WO 00/40730 PCT/US00/00364 - 77

11. The recombinant host cell of claim 9, wherein the nucleic acid sequence encodes SEQ ID NO:3. 5

12. A genetically transformed plant cell comprising in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected 10 from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID is NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3; c) a 3' transcription terminator; and 20 d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence.

13. The genetically transformed plant cell of claim 12, wherein the nucleic acid sequence is 25 SEQ ID NO:2.

14. The genetically transformed plant cell of claim 12, wherein the nucleic acid sequence encodes SEQ ID NO:3. 30

15. A genetically transformed plant comprising in the 5' to 3' direction: WO 00/40730 PCT/US0O/00364 - 78 a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected 5 from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID 10 NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3; c) a 3' transcription terminator; and is d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence.

16. The genetically transformed plant of claim 15, wherein the nucleic acid sequence is SEQ 20 ID NO:2.

17. The genetically transformed plant of claim 15, wherein the nucleic acid sequence encodes SEQ ID NO:3. 25

18. A method of preparing host cells useful to produce a polyhydroxyalkanoate inclusion body associated protein, the method comprising: a) selecting a host cell; b) transforming the selected host cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body 30 associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: WO 00/40730 PCTIUSO0/00364 - 79 a nucleic acid sequence at least about 80% identical to SEQ ID NO:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID 5 NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3; and c) obtaining transformed host cells. 0

19. The method of claim 18, wherein the nucleic acid sequence is SEQ ID NO:2.

20. The method of claim 18, wherein the nucleic acid sequence encodes SEQ ID NO:3. s

21. A method of preparing plants useful to produce a polyhydroxyalkanoate inclusion body associated protein, the method comprising: a) selecting a host plant cell; b) transforming the selected host plant cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body 0 associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:2; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:2 or the complement thereof; 5 a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3; 0 c) obtaining transformed host plant cells; and d) regenerating the transformed host plant cells. WO 00/40730 PCT/USO0/00364 - 80

22. The method of claim 21, wherein the nucleic acid sequence is SEQ ID NO:2.

23. The method of claim 21, wherein the nucleic acid sequence encodes SEQ ID NO:3. 5

24. A fusion protein comprising: a green fluorescent protein subunit; and a polyhydroxyalkanoate inclusion body associated protein; wherein the polyhydroxyalkanoate inclusion body associated protein comprises an amino 10 acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO:3; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3. 15

25. The fusion protein of claim 24, wherein the amino acid sequence is SEQ ID NO:3.

26. A nucleic acid segment encoding a fusion protein, the nucleic acid segment comprising: a nucleic acid sequence encoding a green fluorescent protein subunit; and 20 a nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:2; 25 a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:2 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:3; and a nucleic acid sequence encoding a protein that is immunoreactive with an 30 antibody prepared using SEQ ID NO:3 as an antigen, the antibody being immunoreactive with SEQ ID NO:3. WO 00/40730 PCT/USOO/00364 - 81

27. The nucleic acid segment of claim 26, wherein the nucleic acid sequence is SEQ ID NO:2. 5

28. The nucleic acid segment of claim 26, wherein the nucleic acid sequence encodes SEQ ID NO:3.

29. A nucleic acid segment comprising a nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid 10 sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:4; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:5; 15 and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5. 20

30. The nucleic acid segment of claim 29, wherein the nucleic acid sequence is SEQ ID NO:4.

31. The nucleic acid segment of claim 29, wherein the nucleic acid sequence encodes SEQ ID NO:5. 25

32. An isolated polyhydroxyalkanoate inclusion body associated protein comprising an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO:5; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID 30 NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5. WO 00/40730 PCT/USOO/00364 - 82

33. The isolated polyhydroxyalkanoate inclusion body associated protein of claim 32, wherein the amino acid sequence is SEQ ID NO:5.

34. A recombinant vector comprising in the 5' to 3' direction: s a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: 10 a nucleic acid sequence at least about 80% identical to SEQ ID NO:4; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:5; and 15 a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5; and c) a 3' transcription terminator. 20

35. The recombinant vector of claim 34, wherein the nucleic acid sequence is SEQ ID NO:4.

36. The recombinant vector of claim 34, wherein the nucleic acid sequence encodes SEQ ID NO:5. 25

37. A recombinant host cell comprising a nucleic acid segment encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid segment is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:4; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:4 or the 30 complement thereof; WO 00/40730 PCT/US00/00364 - 83 a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive 5 with SEQ ID NO:5.

38. The recombinant host cell of claim 37, wherein the nucleic acid sequence is SEQ ID NO:4. o

39. The recombinant host cell of claim 37, wherein the nucleic acid sequence encodes SEQ ID NO:5.

40. A genetically transformed plant cell comprising in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence 5 encoding a polyhydroxyalkanoate inclusion body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:4; 0 a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an 5 antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5; c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid 0 sequence. WO 00/40730 PCT/US00/00364 - 84

41. The genetically transformed plant cell of claim 40, wherein the nucleic acid sequence is SEQ ID NO:4.

42. The genetically transformed plant cell of claim 40, wherein the nucleic acid sequence 5 encodes SEQ ID NO:5.

43. A genetically transformed plant comprising in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; 10 b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:4; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID 15 NO:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being 20 immunoreactive with SEQ ID NO:5; c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence. 25

44. The genetically transformed plant of claim 43, wherein the nucleic acid sequence is SEQ ID NO:4.

45. The genetically transformed plant of claim 43, wherein the nucleic acid sequence encodes 30 SEQ ID NO:5. WO 00/40730 PCT/US00/00364 - 85

46. A method of preparing host cells useful to produce a polyhydroxyalkanoate inclusion body associated protein, the method comprising: a) selecting a host cell; b) transforming the selected host cell with a recombinant vector having a structural 5 nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:4; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID 10 NO:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being i5 immunoreactive with SEQ ID NO:5; and c) obtaining transformed host cells.

47. The method of claim 46, wherein the nucleic acid sequence is SEQ ID NO:4. 20

48. The method of claim 46, wherein the nucleic acid sequence encodes SEQ ID NO:5.

49. A method of preparing plants useful to produce a polyhydroxyalkanoate inclusion body associated protein, the method comprising: a) selecting a host plant cell; 25 b) transforming the selected host plant cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:4; 30 a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:4 or the complement thereof; WO 00/40730 PCTIUSOO/00364 - 86 a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:5; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being 5 immunoreactive with SEQ ID NO:5; c) obtaining transformed host plant cells; and d) regenerating the transformed host plant cells.

50. The method of claim 49, wherein the nucleic acid sequence is SEQ ID NO:4. 10

51. The method of claim 49, wherein the nucleic acid sequence encodes SEQ ID NO:5.

52. A fusion protein comprising: a green fluorescent protein subunit; and 15 a polyhydroxyalkanoate inclusion body associated protein; wherein the polyhydroxyalkanoate inclusion body associated protein comprises an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO:5; and an amino acid sequence that is immunoreactive with an antibody prepared using 20 SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5.

53. The fusion protein of claim 52, wherein the amino acid sequence is SEQ ID NO:5. 25

54. A nucleic acid segment encoding a fusion protein, the nucleic acid segment comprising: a nucleic acid sequence encoding a green fluorescent protein subunit; and a nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body 30 associated protein is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:4; WO 00/40730 PCT/USOO/00364 - 87 a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:4 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:5; and 5 a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:5 as an antigen, the antibody being immunoreactive with SEQ ID NO:5.

55. The nucleic acid segment of claim 54, wherein the nucleic acid sequence is SEQ ID o NO:4.

56. The nucleic acid segment of claim 54, wherein the nucleic acid sequence encodes SEQ ID NO:5. s

57. A nucleic acid segment comprising a nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:6; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:6 or the o complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive 5 with SEQ ID NO:7.

58. The nucleic acid segment of claim 57, wherein the nucleic acid sequence is SEQ ID NO:6. o

59. The nucleic acid segment of claim 57, wherein the nucleic acid sequence encodes SEQ ID NO:7. WO 00/40730 PCT/US0O/00364 - 88

60. An isolated polyhydroxyalkanoate inclusion body associated protein comprising an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO:7; and 5 an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7.

61. The isolated polyhydroxyalkanoate inclusion body associated protein of claim 60, wherein the amino acid sequence is SEQ ID NO:7. 10

62. A recombinant vector comprising in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion is body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:6; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:6 or the complement thereof; 20 a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7; and 25 c) a 3' transcription terminator.

63. The recombinant vector of claim 62, wherein the nucleic acid sequence is SEQ ID NO:6.

64. The recombinant vector of claim 62, wherein the nucleic acid sequence encodes SEQ ID 30 NO:7. WO 00/40730 PCT/US00/00364 - 89

65. A recombinant host cell comprising a nucleic acid segment encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the nucleic acid segment is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:6; 5 a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody o prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7.

66. The recombinant host cell of claim 65, wherein the nucleic acid sequence is SEQ ID NO:6. 5

67. The recombinant host cell of claim 65, wherein the nucleic acid sequence encodes SEQ ID NO:7.

68. A genetically transformed plant cell comprising in the 5' to 3' direction: 0 a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected from the group consisting of: 5 a nucleic acid sequence at least about 80% identical to SEQ ID NO:6; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:7; and WO 00/40730 PCT/USOO/00364 - 90 a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7; c) a 3' transcription terminator; and 5 d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence.

69. The genetically transformed plant cell of claim 68, wherein the nucleic acid sequence is o SEQ ID NO:6.

70. The genetically transformed plant cell of claim 68, wherein the nucleic acid sequence encodes SEQ ID NO:7. 5

71. A genetically transformed plant comprising in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the structural nucleic acid sequence is selected zo from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:6; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID 25 NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7; c) a 3' transcription terminator; and WO 00/40730 PCT/US0O/00364 -91 d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence. 5

72. The genetically transformed plant of claim 71, wherein the nucleic acid sequence is SEQ ID NO:6.

73. The genetically transformed plant of claim 71, wherein the nucleic acid sequence encodes SEQ ID NO:7. 10

74. A method of preparing host cells useful to produce a polyhydroxyalkanoate inclusion body associated protein, the method comprising: a) selecting a host cell; b) transforming the selected host cell with a recombinant vector having a structural is nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:6; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID 20 NO:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being 25 immunoreactive with SEQ ID NO:7; and c) obtaining transformed host cells.

75. The method of claim 74, wherein the nucleic acid sequence is SEQ ID NO:6. 30

76. The method of claim 74, wherein the nucleic acid sequence encodes SEQ ID NO:7. WO 00/40730 PCT/US00/00364 - 92

77. A method of preparing plants useful to produce a polyhydroxyalkanoate inclusion body associated protein, the method comprising: a) selecting a host plant cell; b) transforming the selected host plant cell with a recombinant vector having a 5 structural nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:6; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID 10 NO:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:7; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being is immunoreactive with SEQ ID NO:7; c) obtaining transformed host plant cells; and d) regenerating the transformed host plant cells.

78. The method of claim 77, wherein the nucleic acid sequence is SEQ ID NO:6. 20

79. The method of claim 77, wherein the nucleic acid sequence encodes SEQ ID NO:7.

80. A fusion protein comprising: a green fluorescent protein subunit; and 25 a polyhydroxyalkanoate inclusion body associated protein; wherein the polyhydroxyalkanoate inclusion body associated protein comprises an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO:7; and an amino acid sequence that is immunoreactive with an antibody prepared using 30 SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7. WO 00/40730 PCTIUSOO/00364 - 93

81. The fusion protein of claim 80, wherein the amino acid sequence is SEQ ID NO:7.

82. A nucleic acid segment encoding a fusion protein, the nucleic acid segment comprising: 5 a nucleic acid sequence encoding a green fluorescent protein subunit; and a nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein; wherein the nucleic acid sequence encoding a polyhydroxyalkanoate inclusion body associated protein is selected from the group consisting of: 10 a nucleic acid sequence at least about 80% identical to SEQ ID NO:6; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:6 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:7; and 15 a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:7 as an antigen, the antibody being immunoreactive with SEQ ID NO:7.

83. The nucleic acid segment of claim 82, wherein the nucleic acid sequence is SEQ ID 20 NO:6.

84. The nucleic acid segment of claim 82, wherein the nucleic acid sequence encodes SEQ ID NO:7. 25

85. A nucleic acid segment comprising a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein, wherein the nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the 30 complement thereof; WO 00/40730 PCT/US0O/00364 - 94 a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive 5 with SEQ ID NO:9.

86. The nucleic acid segment of claim 85, wherein the nucleic acid sequence is SEQ ID NO:8. o

87. The nucleic acid segment of claim 85, wherein the nucleic acid sequence encodes SEQ ID NO:9.

88. An isolated 3-keto-acyl-CoA reductase protein comprising an amino acid sequence selected from the group consisting of: 5 an amino acid sequence at least about 80% identical to SEQ ID NO:9; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9.

89. The isolated 3-keto-acyl-CoA reductase protein of claim 88, wherein the amino acid o sequence is SEQ ID NO:9.

90. A recombinant vector comprising in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; s b) a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID 0 NO:8 or the complement thereof; WO 00/40730 PCT/USOO/00364 - 95 a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being 5 immunoreactive with SEQ ID NO:9; and c) a 3' transcription terminator.

91. The recombinant vector of claim 90, wherein the nucleic acid sequence is SEQ ID NO:8. o

92. The recombinant vector of claim 90, wherein the nucleic acid sequence encodes SEQ ID NO:9.

93. A recombinant host cell comprising a nucleic acid segment encoding a 3-keto-acyl-CoA reductase protein, wherein the nucleic acid segment is selected from the group consisting 5 of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; 0 and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9. s

94. The recombinant host cell of claim 93, wherein the nucleic acid sequence is SEQ ID NO:8.

95. The recombinant host cell of claim 93, wherein the nucleic acid sequence encodes SEQ ID NO:9. 30

96. A genetically transformed plant cell comprising in the 5' to 3' direction: WO 00/40730 PCT/USOO/00364 -96 a) a promoter that directs transcription of a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; b) a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; wherein the structural nucleic acid sequence is selected from the group consisting 5 of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID 10 NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9; c) a 3' transcription terminator; and is d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence.

97. The genetically transformed plant cell of claim 96, wherein the nucleic acid sequence is 20 SEQ ID NO:8.

98. The genetically transformed plant cell of claim 96, wherein the nucleic acid sequence encodes SEQ ID NO:9. 25

99. A genetically transformed plant comprising in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; b) a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; wherein the structural nucleic acid sequence is selected from the group consisting 30 of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; WO 00/40730 PCT/USOO/00364 - 97 a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and s a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9; c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate 10 nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence.

100. The genetically transformed plant of claim 99, wherein the nucleic acid sequence is SEQ ID NO:8. 15

101. The genetically transformed plant of claim 99, wherein the nucleic acid sequence encodes SEQ ID NO:9.

102. A method of preparing host cells useful to produce a 3-keto-acyl-CoA reductase protein, 20 the method comprising: a) selecting a host cell; b) transforming the selected host cell with a recombinant vector having a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein, wherein the structural nucleic acid sequence is selected from the group consisting of: 25 a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and WO 00/40730 PCTUSOO/00364 - 98 a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9; and c) obtaining transformed host cells. 5

103. The method of claim 102, wherein the nucleic acid sequence is SEQ ID NO:8.

104. The method of claim 102, wherein the nucleic acid sequence encodes SEQ ID NO:9. o

105. A method of preparing plants useful to produce a 3-keto-acyl-CoA reductase protein, the method comprising: a) selecting a host plant cell; b) transforming the selected host plant cell with a recombinant vector having a structural nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein, s wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; o a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9; s c) obtaining transformed host plant cells; and d) regenerating the transformed host plant cells.

106. The method of claim 105, wherein the nucleic acid sequence is SEQ ID NO:8. o

107. The method of claim 105, wherein the nucleic acid sequence encodes SEQ ID NO:9. WO 00/40730 PCT/US0O/00364 - 99

108. A fusion protein comprising: a green fluorescent protein subunit; and a 3-keto-acyl-CoA reductase protein; wherein the 3-keto-acyl-CoA reductase protein comprises an amino acid sequence 5 selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO:9; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9. 0

109. The fusion protein of claim 108, wherein the amino acid sequence is SEQ ID NO:9.

110. A nucleic acid segment encoding a fusion protein, the nucleic acid segment comprising: a nucleic acid sequence encoding a green fluorescent protein subunit; and 5 a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; wherein the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID .0 NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being 25 immunoreactive with SEQ ID NO:9.

111. The nucleic acid segment of claim 110, wherein the nucleic acid sequence is SEQ ID NO:8. 30

112. The nucleic acid segment of claim 110, wherein the nucleic acid sequence encodes SEQ ID NO:9. WO 00/40730 PCTIUS0O/00364 - 100

113. A nucleic acid segment comprising a nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein, wherein the nucleic acid sequence is selected from the group consisting of: 5 a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:11; and 10 a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive with SEQ ID NO:l l.

114. The nucleic acid segment of claim 113, wherein the nucleic acid sequence is SEQ ID 15 NO:10.

115. The nucleic acid segment of claim 113, wherein the nucleic acid sequence encodes SEQ ID NO:11. 20

116. An isolated polyhydroxyalkanoate synthase protein comprising an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO: 11; and an amino acid sequence that is immunoreactive with an antibody prepared using SEQ ID NO: I1 as an antigen, the antibody being immunoreactive with SEQ ID NO:11. 25

117. The isolated polyhydroxyalkanoate synthase protein of claim 116, wherein the amino acid sequence is SEQ ID NO: 11.

118. A recombinant vector comprising in the 5' to 3' direction: 30 a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; WO 00/40730 PCT/USOO/00364 - 101 b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; 5 a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO: 10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:l l; and a nucleic acid sequence encoding a protein that is immunoreactive with an 0 antibody prepared using SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with SEQ ID NO: 11; and c) a 3' transcription terminator.

119. The recombinant vector of claim 118, wherein the nucleic acid sequence is SEQ ID is NO:10.

120. The recombinant vector of claim 118, wherein the nucleic acid sequence encodes SEQ ID NO: 1l. 2o

121. A recombinant host cell comprising a nucleic acid segment encoding a polyhydroxyalkanoate synthase protein, wherein the nucleic acid segment is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO: 10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or is the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:11 as an antigen, the antibody being immunoreactive 0 with SEQ ID NO:11. WO 00/40730 PCT/USOO/00364 - 102

122. The recombinant host cell of claim 121, wherein the nucleic acid sequence is SEQ ID NO:10.

123. The recombinant host cell of claim 121, wherein the nucleic acid sequence encodes SEQ 5 ID NO:11.

124. A genetically transformed plant cell comprising in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; o b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID 5 NO: 10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO: 1l as an antigen, the antibody being 0 immunoreactive with SEQ ID NO:11; c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence. 5

125. The genetically transformed plant cell of claim 124, wherein the nucleic acid sequence is SEQ ID NO:10.

126. The genetically transformed plant cell of claim 124, wherein the nucleic acid sequence o encodes SEQ ID NO:11. WO 00/40730 PCT/USOO/00364 - 103

127. A genetically transformed plant comprising in the 5' to 3' direction: a) a promoter that directs transcription of a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; b) a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase 5 protein; wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO: 10 or the complement thereof; 10 a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:l l; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with SEQ ID NO: 11; is c) a 3' transcription terminator; and d) a 3' polyadenylation signal sequence that directs the addition of polyadenylate nucleotides to the 3' end of RNA transcribed from the structural nucleic acid sequence. 20

128. The genetically transformed plant of claim 127, wherein the nucleic acid sequence is SEQ ID NO:10.

129. The genetically transformed plant of claim 127, wherein the nucleic acid sequence encodes SEQ ID NO: 11. 25

130. A method of preparing host cells useful to produce a polyhydroxyalkanoate synthase protein, the method comprising: a) selecting a host cell; b) transforming the selected host cell with a recombinant vector having a structural 30 nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein, WO 00/40730 PCT/US00/00364 - 104 wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO: 10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID 5 NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO: 11 as an antigen, the antibody being o immunoreactive with SEQ ID NO: 11; and c) obtaining transformed host cells.

131. The method of claim 130, wherein the nucleic acid sequence is SEQ ID NO:10. i5

132. The method of claim 130, wherein the nucleic acid sequence encodes SEQ ID NO: 11.

133. A method of preparing plants useful to produce a polyhydroxyalkanoate synthase protein, the method comprising: a) selecting a host plant cell; 20 b) transforming the selected host plant cell with a recombinant vector having a structural nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein, wherein the structural nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; 2s a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO: 10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:11; and a nucleic acid sequence encoding a protein that is immunoreactive with an 0o antibody prepared using SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with SEQ ID NO: 11; WO 00/40730 PCT/US0O/00364 - 105 c) obtaining transformed host plant cells; and d) regenerating the transformed host plant cells.

134. The method of claim 133, wherein the nucleic acid sequence is SEQ ID NO:10.

135. The method of claim 133, wherein the nucleic acid sequence encodes SEQ ID NO:11.

136. A fusion protein comprising: a green fluorescent protein subunit; and 0 a polyhydroxyalkanoate synthase protein; wherein the polyhydroxyalkanoate synthase protein comprises an amino acid sequence selected from the group consisting of: an amino acid sequence at least about 80% identical to SEQ ID NO: 11; and an amino acid sequence that is immunoreactive with an antibody prepared using 5 SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11.

137. The fusion protein of claim 136, wherein the amino acid sequence is SEQ ID NO:11. o

138. A nucleic acid segment encoding a fusion protein, the nucleic acid segment comprising: a nucleic acid sequence encoding a green fluorescent protein subunit; and a nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; wherein the nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein is selected from the group consisting of: 5 a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO: 10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:11; and WO 00/40730 PCT/US0O/00364 - 106 a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11. 5

139. The nucleic acid segment of claim 138, wherein the nucleic acid sequence is SEQ ID NO:10.

140. The nucleic acid segment of claim 138, wherein the nucleic acid sequence encodes SEQ ID NO:11. 10

141. A method for the preparation of polyhydroxyalkanoate, the method comprising: a) obtaining a cell comprising: a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a nucleic acid sequence encoding a PHA synthase protein; [5 wherein: the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is not naturally found in the cell; the nucleic acid sequence encoding a PHA synthase protein is not naturally found in the cell; 20 the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions 5 to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an 0 antigen, the antibody being immunoreactive with SEQ ID NO:9; and WO 00/40730 PCT/USOO/00364 - 107 the nucleic acid sequence encoding a PHA synthase protein is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; 5 a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO: 11; and a nucleic acid sequence encoding a protein that is immunoreactive 10 with an antibody prepared using SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11; and b) culturing the cell under conditions suitable for the preparation of polyhydroxyalkanoate. 15

142. The method of claim 141, wherein the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is SEQ ID NO:8.

143. The method of claim 141, wherein the nucleic acid sequence encoding a 3-keto-acyl-CoA 20 reductase protein encodes SEQ ID NO:9.

144. The method of claim 141, wherein the nucleic acid sequence encoding a PHA synthase protein is SEQ ID NO:10. 25

145. The method of claim 141, wherein the nucleic acid sequence encoding a PHA synthase protein encodes SEQ ID NO: 11.

146. A method for the preparation of polyhydroxyalkanoate, the method comprising: a) obtaining a plant comprising: 30 a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a nucleic acid sequence encoding a PHA synthase protein; WO 00/40730 PCT/USO0/00364 - 108 wherein: the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is not naturally found in the plant; the nucleic acid sequence encoding a PHA synthase protein is not 5 naturally found in the plant; the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; 10 a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive 15 with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9; and the nucleic acid sequence encoding a PHA synthase protein is selected from the group consisting of: 20 a nucleic acid sequence at least about 80% identical to SEQ ID NO:10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO: 10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% 25 identical to SEQ ID NO: 11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11; and 30 b) growing the plant under conditions suitable for the preparation of polyhydroxyalkanoate. WO 00/40730 PCT/USOO/00364 - 109

147. The method of claim 146, wherein the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is SEQ ID NO:8. 5

148. The method of claim 146, wherein the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein encodes SEQ ID NO:9.

149. The method of claim 146, wherein the nucleic acid sequence encoding a PHA synthase protein is SEQ ID NO:10. 10

150. The method of claim 146, wherein the nucleic acid sequence encoding a PHA synthase protein encodes SEQ ID NO: 11.

151. A method for the preparation of polyhydroxyalkanoate, the method comprising: 15 a) obtaining a cell comprising: a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a nucleic acid sequence encoding a PHA synthase protein; wherein: the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is 20 not naturally found in the cell; the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; 25 a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive 30 with an antibody prepared using SEQ ID NO:9 as an WO 00/40730 PCT/USO0/00364 -110 antigen, the antibody being immunoreactive with SEQ ID NO:9; and b) culturing the cell under conditions suitable for the preparation of polyhydroxyalkanoate. 5

152. The method of claim 151, wherein the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is SEQ ID NO:8.

153. The method of claim 151, wherein the nucleic acid sequence encoding a 3-keto-acyl-CoA 10 reductase protein encodes SEQ ID NO:9.

154. A method for the preparation of polyhydroxyalkanoate, the method comprising: a) obtaining a plant comprising: a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and 15 a nucleic acid sequence encoding a PHA synthase protein; wherein: the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is not naturally found in the plant; the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is 20 selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; 25 a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID 0 NO:9; and WO 00/40730 PCT/US00/00364 - 111 b) growing the plant under conditions suitable for the preparation of polyhydroxyalkanoate.

155. The method of claim 154, wherein the nucleic acid sequence encoding a 3-keto-acyl-CoA 5 reductase protein is SEQ ID NO:8.

156. The method of claim 154, wherein the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein encodes SEQ ID NO:9. 10

157. A method for the preparation of polyhydroxyalkanoate, the method comprising: a) obtaining a cell comprising: a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and a nucleic acid sequence encoding a PHA synthase protein; wherein: 15 the nucleic acid sequence encoding a PHA synthase protein is not naturally found in the cell; the nucleic acid sequence encoding a PHA synthase protein is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID 20 NO: 10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:10 or the complement thereof; a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO: 11; and 25 a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with SEQ ID NO:11; and b) culturing the cell under conditions suitable for the preparation of 30 polyhydroxyalkanoate. WO 00/40730 PCT/US0O/00364 - 112

158. The method of claim 157, wherein the nucleic acid sequence encoding a PHA synthase protein is SEQ ID NO:10.

159. The method of claim 157, wherein the nucleic acid sequence encoding a PHA synthase 5 protein encodes SEQ ID NO:11.

160. A method for the preparation of polyhydroxyalkanoate, the method comprising: a) obtaining a plant comprising: a nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein; and o a nucleic acid sequence encoding a PHA synthase protein; wherein: the nucleic acid sequence encoding a PHA synthase protein is not naturally found in the plant; the nucleic acid sequence encoding a PHA synthase protein is selected 5 from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO: 10; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO: 10 or the complement thereof; 0 a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO: 11; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO: 11 as an antigen, the antibody being immunoreactive with SEQ ID 5 NO:11; and b) growing the plant under conditions suitable for the preparation of polyhydroxyalkanoate.

161. The method of claim 160, wherein the nucleic acid sequence encoding a PHA synthase o protein is SEQ ID NO:10. WO 00/40730 PCT/USOO/00364 -113

162. The method of claim 160, wherein the nucleic acid sequence encoding a PHA synthase protein encodes SEQ ID NO: 11.

163. A method for the preparation of polyhydroxyalkanoate, the method comprising: 5 a) obtaining a recombinant host cell comprising: a nucleic acid sequence encoding a p-ketothiolase protein; a nucleic acid sequence encoding a 3-ketoacyl-CoA reductase protein; a nucleic acid sequence encoding a polyhydroxyalkanoate synthase protein; a nucleic acid sequence encoding a p-hydroxyacyl-CoA dehydrase; and 10 a nucleic acid sequence encoding an acyl-CoA dehydrogenase protein or an enoyl-CoA reductase protein; and b) culturing the recombinant host cell under conditions suitable for the preparation of polyhydroxyalkanoate; wherein: the polyhydroxyalkanoate comprises C6, C8, or C10 monomer subunits; 15 the nucleic acid sequence encoding a 3-keto-acyl-CoA reductase protein is selected from the group consisting of: a nucleic acid sequence at least about 80% identical to SEQ ID NO:8; a nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO:8 or the complement thereof; 20 a nucleic acid sequence encoding a protein at least about 80% identical to SEQ ID NO:9; and a nucleic acid sequence encoding a protein that is immunoreactive with an antibody prepared using SEQ ID NO:9 as an antigen, the antibody being immunoreactive with SEQ ID NO:9. 25