CA2322729C - Modification of fatty acid metabolism in plants - Google Patents

Abstract

Methods and systems to modify fatty acid biosynthesis and oxidation in plants to make new polymers are provided. Two enzymes are essential: a hydratase such as D-specific enoyl-CoA hydratase, for example, the hydratase obtained from Aeromonas caviae, and a .beta.-oxidation enzyme system. Some plants have a .beta.-oxidation enzyme system which is sufficient to modify polymer synthesis when the plants are engineered to express the hydratase. Examples demonstrate production of polymer by expression of these enzymes in transgenic plants.
Examples also demonstrate that modifications in fatty acid biosynthesis can be used to alter plant phenotypes, decreasing or eliminating seed production and increasing green plant biomass, as well as producing polyhydroxyalkanoates.

Description

MODIFICATION OF FATTY ACID METABOLISM IN PLANTS
Background Of The Invention The present invention is generally in the field of transgenic plant systems for the production of polyhydroxyalkanoate materials, modification of triglycerides and fatty acids, and methods for altering seed production in plants.
Methods for producing stable transgenic plants for agronomic crops have been developed over the last 1 S years. Crops have been genetically modified for improvements in both input and output traits. In the former traits, tolerance to specific agrochemicals has been engineered into crops, and specific natural pesticides, such as the Bacillus thuringenesis toxin, have been expressed directly in the plant. There also has been significant progress in developing male sterility systems for the production of hybrid plants.
I 5 With respect to output traits, crops are being modified to increase the value of the product, generally the seed, grain, or fiber of the plant. Critical metabolic targets include the modification of starch, fatty acid, and oil biosynthetic pathways.
There is considerable commercial interest in producing microbial polyhydroxyalkanoate (PHA) biopolymers in plant crops. See, for example, U.S. Patent Nos. 5,245,023 and 5,250,430 to Peoples and Sinskey; U.S.
Patent No. 5,502,273 to Bright et al.; U.S. Patent No. 5,534,432 to Peoples and Sinskey; U.S. Patent No. 5,602,321 to John; U.S. Patent No. 5,610,041 to Somerville et al.; PCT WO 91/00917; PCT~WO-~2%19'74~; PCT WO
93/02187; PCT WO 93/02194; PCT WO 94/12014; Poirier et al., Science 256:520-23 (1992); van der Leij & Witholt, Can. J. Microbiol.
41(supplement):222-38 (1995); Nawrath & Poirier, The International Symposium on Bacterial Polyhydroxyalkanoates, (Eggink et al., eds.) Davos Switzerland (August 18-23, 1996); and Williams and Peoples, CHEMTECH
26: 38-44 (1996). PHAs are natural, thermoplastic polyesters and can be processed by traditional polymer techniques for use in an enormous variety of applications, including consumer packaging, disposable diaper linings and garbage bags, food and medical products.
Early studies on the production of polyhydroxybutyrate in the chloroplasts of the experimental plant system Arabidopsis thaliana resulted in the accumulation of up to 14% of the leaf dry weight as PHB (Nawrath et al., 1993). Arabidopsis, however, has no agronomic value. Moreover, in order to economically produce PHAs in agronomic crops, it is desirable to produce the PHAs in the seeds, so that the current infrastructure for harvesting and processing seeds can be utilized. The options for recovery of the PHAs from plant seeds (PCT WO 97/15681) and the end use applications (Williams & Peoples, CHEMTECH 26:38-44 (1996)) are significantly ai~ected by the polymer composition. Therefore, it would be advantageous to develop transgenic plant systems that produce PHA polymers having a well-defined composition.
Careful selection of the PHA biosynthetic enzymes on the basis of their substrate specificity allows for the production of PHA polymers of defined composition in transgenic systems (U.S. Patent Nos. 5,229,279;
5,245,023; 5,250,430; 5,480,794; 5,512,669; 5,534,432; 5,661,026; and 5,663,063).
In bacteria, each PHA group is produced by a specific pathway. In the case of the short pendant group PHAs, three enzymes are involved: (3-ketothiolase, acetoacetyl-CoA reductase, and PHA synthase. The homopolymer PHB, for example, is produced by the condensation of two molecules of acetyl-coenzyme A to give acetoacetyl-coenzyme A. The latter then is reduced to the chiral intermediate R-3-hydroxybutyryl-coenzyme A
by the reductase, and subsequently polymerized by the PHA synthase enzyme. The PHA synthase notably has a relatively wide substrate specificity which allows it to polymerize C3-CS hydroxy acid monomers including both 4-hydroxy and 5-hydroxy acid units. This biosynthetic pathway is found in a number of bacteria such as Alcaligenes eutrophus, A.
latus, AZOtobacter vinlandii, and Zoogloea ramigera. Long pendant group PHAs are produced for example by many different Pseudomonas bacteria.

Their biosynthesis involve the (3-oxidation of fatty acids and fatty acid synthesis as routes to the hydroxyacyl-coenzyme A monomeric units. The latter then are converted by PHA syntheses which have substrate specificities favoring the larger C6-C 14 monomeric units (Peoples & Sinskey, 1990).
In the case of the PHB-co-HX copolymers which usually are produced from cells grown on fatty acids, a combination of these routes can be responsible for the formation of the different monomeric units. Indeed, analysis of the DNA locus encoding the PHA synthase gene in Aeromonas caviae, which produces the copolymer PHB-co-3-hydroxyhexanoate, was used to identify a gene encoding a D-specific enoyl-CoA hydratase responsible for the production of the D-~i-hydroxybutyryl-CoA and D-p -hydroxyhexanoyl-CoA units (Fukui & Doi, J. Bacteriol. 179:4821-30 (1997); Fukui et. al., J. Bacteriol. 180:667-73 (1998)). Other sources of such hydratase genes and enzymes include Alcaligenes, Pseudomonas, and Rhodospirillum.
The enzymes PHA synthase, acetoacetyl-CoA reductase, and (3-ketothiolase, which produce the short pendant group PHAs in A. eutrophus, are coded by an operon comprising the phbC phbA phbB genes; Peoples et al., 1987; Peoples & Sinskey, 1989). In the Pseudomonas organisms, the PHA syntheses responsible for production of the long pendant group PHAs have been found to be encoded on the pha locus, specifically by the phaA
and phaC genes (LJ.S. Patent Nos. 5,245,023 and 5,250,430; Huisman et. al., J. Biol. Chem. 266:2191-98 (1991)). Since these earlier studies, a range of PHA biosynthetic genes have been isolated and characterized or identified from genome sequencing projects. Examples of known PHA biosynthetic genes are disclosed in the following references: Aeronomas caviae (Fukui &
Doi, 1997, J. Bacteriol. 179:4821-30); Alcadigenes eutrophus (U.S. Patent Nos. 5,245,023; 5,250,430; 5,512,669; and 5,661,026; Peoples & Sinskey, J.
Biol. Chem. 264:15298-03 (1989)); Acinetobacter (Schembri et. al., FEMS
Microbiol. Lett. 118:145-52 (1994)); Chromatium vinosum (Liebergesell &
Steinbuchel, Eur. J. Biochem. 209:135-50 (1992)); Methylobacterium extorquens (Valentin & Steinbuchel, Appl. Microbiol. Biotechnol. 39:309-17 (1993)); Nocardia corallina (GENBANK Accession No. AF019964; Hall et.
al., 1998, Can. J. Microbiol. 44:687-69); Paracoccus denitrificans (LJeda et al., J. Bacteriol. 178:774-79 {1996}; Yabutani et. al., FEMSMicrobiol. Lett.
133:85-90 (1995)); Pseudomonas acidophila (LJmeda et. al., 1998, Applied Biochemistry and Biotechnology, 70-72:341-52); Pseudomonas sp. 61-3 (Matsusaki et al., 1998, J. Bacteriol. 180:6459-67); Nocardia corallina;
Pseudomonas aeruginosa (Timm & Steinbuchel, Eur. J. Biochem. 209:15-30 (1992)); P. oleovorans (U.S. Patent Nos. 5,245,023 and 5,250,430; Huisman et. al., J. Biol. Chem. 266 4 :2191-98 (1991); Rhizobium etli (Cevallos et.
al., J. Bacteriol. 178:1646-54 (1996)); R. meliloti (Tombolini et. al., Microbiology 141:2553-59 (1995)); Rhodococcus ruber (Pieper-Furst &
Steinbuchel, FEMS Microbiol. Lett. 75:73-79 (1992)); Rhodospirillum rubrum (Hustede et. al., FEMSMicrobiol. Lett 93:285-90 (1992));
Rhodobacter sphaeroides (Hustede et. al., FEMS Microbiol. Rev. 9:217-30 (1992); Biotechnol. Lett. 15:709-14 (1993); Synechocystis sp. (DNA Res.

3:109-36 (1996)); Thiocapsiae violacea (Appl. Microbiol. Biotechnol.
38:493-501 (1993)) and Zoogloea ramigera (Peoples et. al., J. Biod. Chem.
262:97-102 (1987); Peoples & Sinskey, Molecular Microbiology 3:349-57 ( 1989)). The availability of these genes or their published DNA sequences should provide a range of options for producing PHAs.
PHA synthases suitable for producing PHB-co-HH copolymers comprising from 1-99% HH monomers are encoded by the Rhodococcus ruber, Rhodospirillum rubrum, Thiocapsiae violacea, and Aeromonas caviae PHA synthase genes. PHA synthases useful for incorporating 3-hydroxyacids of 6-12 carbon atoms in addition to R-3-hydroxybutyrate i.e.
for producing biological polymers equivalent to the chemically synthesized copolymers described in PCT WO 95/20614, PCT WO 95/20615, and PCT
WO 95/20621 have been identified in a number of Pseudomonas and other bacteria (Steinbuchel & Wiese, Appl. Microbiol. Biotechnol. 37:691-97 (1992); Valentin et al., Appl. Microbiol: Biotechnol. 36:507-14 (1992);
Valentin et al., Appl. Microbiol. Biotechnol. 40:710-16 (1994); Lee et al., Appl. Microbiol. Biotechnol. 42:901-09 (1995); Kato et al., Appl. Microbiol.

Biotechnol 45:363-70 (1996); Abe et al., Int. J. Biol. Macromol. 16:115-19 (1994); Valentin et al., Appl. Microbiol. Biotechnol. 46:261-67 (1996)) and can readily be isolated as described in U.S. Patent Nos. 5,245,023 and 5,250,430. The PHA synthase from P. oleovorans (U.S. Patent Nos.
5,245,023 and 5,250,430; Huisman et. al., J. Biol. Chem. 266(4): 2191-98 (1991)) is suitable for producing the long pendant group PHAs. Plant genes encoding (3-ketothiolase also have been identified (Vollack & Bach, Plant Physiol. 111:1097-107 (1996)).
Despite this ability to modify monomer composition by selection of 10 the syntheses and substrates, it is desirable to modify other features of polymer biosynthesis, such as that which involves fatty acid metabolism.
It is therefore an object of the present invention to provide a method and DNA constructs to introduce fatty acid oxidation enzyme systems for manipulating the cellular metabolism of plants.
15 It is another object of the present invention to provide methods for enhancing the production of PHAs in plants, preferably in the oilseeds thereof.
Summary Of The Invention 20 Methods and systems to modify fatty acid biosynthesis and oxidation in plants to make new polymers are described. Two enzymes are essential: a hydratase such as D-specific enoyl-CoA hydratase, for example, the hydratase obtained from Aeromonas caviae, and a (3-oxidation enzyme system. Some plants have a j3-oxidation enzyme system which is sufficient 25 to modify polymer synthesis when the plants are engineered to express the hydratase.
Examples demonstrate production of polymer by expression of these enzymes in transgenic plants. Examples also demonstrate that modifications in fatty acid biosynthesis can be used to alter plant phenotypes, decreasing or 30 eliminating seed production and increasing green plant biomass, as well as producing PHAs.

Brief Description of the Drawings Figure 1 is a schematic of fatty acid ~i-oxidation routes to produce polyhydroxyalkanoate monomers.
Figure 2 is a schematic showing plasmid constructs pSBS2024 and pSBS2025.
Figures 3A and 3B are schematics showing plasmid constructs pCGmf124 and pCGmf125.
Figures 4A and 4B are schematics showing plasmid constructs pmf1249 and pmf1254.
Figures SA and SB are schematics showing plasmid constructs pCGmf224 and pCGmfZ25.
Figures 6A and 6B are schematics showing plasmid constructs pCGmfIP2S and pCGmf2PlS.
Detailed Description Of The Invention Methods and DNA constrocts for manipulating the cellular metabolism of plants by introducing fatty acid oxidation enzyme systems into the cytoplasm or plastids of developing oilseeds or green tissue are provided. Fatty acid oxidation systems typically comprise several enzyme activities including a ~i-ketothiolase enzyme activity which utilizes a broad range of ~i-ketoacyl-CoA substrates.
It surprisingly was found that expression of at least one of these transgenes from the bean phaseolin promoter results in male sterility.
Interestingly, these plants did not set seed, but instead produced higher than normal levels of biomass (e.g., leafs, stems, stalks). Therefore the methods and constructs described herein also can be used to create male sterile plants, for example, for hybrid production or to increase the production of biomass of forage, such as alfalfa or tobacco. Plants generated using these methods and DNA constructs are useful for producing polyhydroxyalkanoate biopolymers or for producing novel oil compositions.
The methods described herein include the subsequent incorporation of additional transgenes, in particular encoding additional enzymes involved in fatty acid oxidation or polyhydroxyalkanoate biosynthesis. For polyhydroxyalkanoate biosynthesis, the methods include the incorporation of transgenes encoding enzymes, such as NADH and/or NADPH acetoacetyl-CoenzymeA reductases, PHB synthases, PHA synthases, acetoacetyl-CoA
thiolase, hydroxyacyl-CoA epimerases, delta3-cis-delta2-trans enoyl-CoA
isomerases, acyl-CoA dehydrogenase, acyl-CoA oxidase and enoyl-CoA
hydratases by subsequent transformation of the transgenic plants produced using the methods and DNA constructs described herein or by traditional plant breeding methods.
I. Plant Expression Systems In a preferred embodiment, the fatty acid oxidation transgenes are expressed from a seed specific promoter, and the proteins are expressed in the cytoplasm of the developing oilseed. In an alternate preferred embodiment, fatty acid oxidation transgenes are expressed from a seed specific promoter and the expressed proteins are directed to the plastids using plastid targeting signals. In another preferred embodiment, the fatty acid oxidation transgenes are expressed directly from the plastid chromosome where they have been integrated by homologous recombination. The fatty acid oxidation transgenes may also be expressed throughout the entire plant tissue from a constitutive promoter. It is also useful to be able to control the expression of these transgenes by using promoters that can be activated following the application of an agrochemical or other active ingredient to the crop in the field. Additional control of the expression of these genes encompassed by the methods described herein include the use of recombinase technologies for targeted insertion of the transgenes into specific chromosomal sites in the plant chromosome or to regulate the expression of the transgenes.
The methods described herein involve a plant seed having a genome including (a) a promoter operably linked to a first DNA sequence and a 3'-untranslated region, wherein the first DNA sequence encodes a fatty acid oxidation polypeptide and optionally (b) a promoter operably linked to a second DNA sequence and a 3'-untranslated region, wherein the second WO 99145122 PC'TNS99/04999 DNA sequence encodes a fatty acid oxidation polypeptide. Expression of the two transgenes provides the plant with a functional fatty acid f3-oxidation system having at least (3-ketothiolase, dehydrogenase and hydratase activities in the cytoplasm or plastids other than peroxisomes or glyoxisomes. The first and/or second DNA sequence may be isolated from bacteria, yeast, fungi, algae, plants, or animals. It is preferable that at least one of the DNA
sequences encodes a polypeptide with at least two, and preferably three, enzyme activities.
Transformation Vectors DNA constructs useful in the methods described herein include transformation vectors capable of introducing transgenes into plants. Several plant transformation vector options are available, including those described in "Gene Transfer to Plants" (Potrykus, et al., eds.) Springer-Verlag Berlin Heidelberg New York (1995); "Transgenic Plants: A Production System for Industrial and Pharmaceutical Proteins" (Owen, et al., eds.) John Wiiey &
Sons Ltd. England (1996); and "Methods in Plant Molecular Biology: A
Laboratory Course Manual" (Malign, et al. eds.) Cold Spring Laboratory Press, New York (1995). Plant transformation vectors generally include one or more coding sequences of interest under the transcriptional control of S' and 3' regulatory sequences, including a promoter, a transcription termination and/or polyadenylation signal, and a selectable or screenable marker gene. The usual requirements for 5' regulatory sequences include a promoter, a transcription termination and/or a polyadenylation signal. For the expression of two or more polypeptides from a single transcript, additional RNA processing signals and ribozyme sequences can be engineered into the construct (LJ.S. Patent No. 5,519,164). This approach has the advantage of locating multiple transgenes in a single locus, which is advantageous in subsequent plant breeding efforts. An additional approach is to use a vector to specifically transform the plant plastid chromosome by homologous recombination (U.S. Patent No. 5,545,818), in which case it is possible to take advantage of the prokaryotic nature of the plastid genome and insert a number of transgenes as an operon.

Promoters A large number of plant promoters are known and result in either constitutive, or environmentally or developmentally regulated expression of the gene of interest. Plant promoters can be selected to control the expression of the transgene in different plant tissues or organelles for all of which methods are known to those skilled in the art (Gasser & Fraley, Science 244:1293-99 (1989)). The S' end of the transgene may be engineered to include sequences encoding plastid or other subcellular organelle targeting peptides linked in-frame with the transgene. Suitable constitutive plant promoters include the cauliflower mosaic virus 355 promoter (CaM~ and enhanced CaMV promoters (Odell et. al., Nature, 313: 810 (1985)), actin promoter (McElroy et al., Plant Cell 2:163-71 (1990)}, AdhI promoter (Fromm et. al., BiolTechnology 8:833-39 (1990);
Kyozuka et al., Mol. Gen. Genet. 228:40-48 ( 1991 )), ubiquitin promoters, the 15 Figwort mosaic virus promoter, mannopine synthase promoter, nopaline synthase promoter and octopine synthase promoter. Useful regulatable promoter systems include spinach nitrate-inducible promoter, heat shock promoters, small subunit of ribulose biphosphate carboxylase promoters and chemically inducible promoters (U.S. Patent No. 5,364,780 to Hershey et al.).
In a preferred embodiment of the methods described herein, the transgenes are expressed only in the developing seeds. Promoters suitable for this purpose include the napin gene promoter (LJ.S. Patent Nos. 5,420,034 and 5,608,152), the acetyl-CoA carboxylase promoter (LT.S. Patent Nos.
25 5,420,034 and 5,608,152), 2S albumin promoter, seed storage protein promoter, phaseolin promoter (Slightom et. al., Proc. Natl. Acad. Sci. USA
80:1897-1901 (1983)), oleosin promoter (Plant et. al., Plant Mol. Biol.
25:193-205 (1994); Rowley et al., Biochim. Biophys. Acta. 1345:1-4 (199?};
U.S. Patent No. 5,650,554; and PCT WO 93/20216), zero promoter, glutelin promoter, starch synthase promoter, and starch branching enzyme promoter.
The transformation of suitable agronomic plant hosts using these vectors can be accomplished with a variety of methods and plant tissues.

Representative plants useful in the methods disclosed herein include the Brassica family including napus, rappa, sp. carinata and juncea; maize;
soybean; cottonseed; sunflower; palm; coconut; safflower; peanut; mustards including Sinapis alba; and flax. Crops harvested as biomass, such as silage 5 corn, alfalfa, or tobacco, also are useful with the methods disclosed herein.
Representative tissues for transformation using these vectors include protoplasts, cells, callus tissue, leaf discs, pollen, and meristems.
Representative transformation procedures include Agrobacterium-mediated transformation, biolistics, microinjection, electroporation, polyethylene glycol-mediated protoplast transformation, liposome-mediated transformation, and silicon fiber-mediated transformation (U. S. Patent No.
5,464,765; "Gene Transfer to Plants" (Potrykus, et al., eds.) Springer-Verlag Berlin Heidelberg New York (1995); "Transgenic Plants: A Production System for Industrial and Pharmaceutical Proteins" (Oven, et al., eds.) John 15 Wiley & Sons Ltd. England (1996); and "Methods in Plant Molecular Biology: A Laboratory Course Manual" (Malign, et al. eds.) Cold Spring Laboratory Press, New York (1995)).
II. Methods for Making and Screening for Transgenic Plants In order to generate transgenic plants using the constructs described 20 herein, the following procedures can be used to obtain a transformed plant expressing the transgenes subsequent to transformation: select the plant cells that have been transformed on a selective medium; regenerate the plant cells that have been transformed to produce differentiated plants; select transformed plants expressing the transgene at such that the level of desired 25 polypeptide is obtained in the desired tissue and cellular location.
For the specific crops useful for practicing the described methods, transformation procedures have been established, as described for example, in "Gene Transfer to Plants" (Potrykus, et al., eds.) Springer-Verlag Berlin Heidelberg New York (1995); "Transgenic Plants: A Production System for 30 Industrial and Pharmaceutical Proteins" (Owen, et al., eds.) John Wiley &
Sons Ltd. England (1996); and "Methods in Plant Molecular Biology: A
Laboratory Course Manual" (Malign, et al. eds.) Cold Spring Laboratory Press, New York (1995).
Brassica napus can be transformed as described, for example, in U. S.
Patent Nos. 5,188,958 and 5,463,174. Other Brassica such as rappa, carinata and juncea as well as Sinapis alba can be transformed as described S by Moloney et. aL, Plant Cell Reports 8:238-42 (1989). Soybean can be transformed by a number of reported procedures (U.S. Patent Nos.
5,015,580; 5,015,944; 5,024,944; 5,322,783; 5,416,011; and 5,169,770).
Several transformation procedures have been reported for the production of transgenic maize plants including pollen transformation (U.S. Patent No.
5,629,183), silicon fiber-mediated transformation (U.S. Patent No.
5,464,765), electroporation of protoplasts (LJ.S. Patent Nos. 5,231,019;
5,472,869; and 5,384,253) gene gun (U.S. Patent Nos. 5,538,877 and 5,538,880 and Agrobacterium-mediated transformation (EP 0 604 662 Al;
PCT WO 94/00977}. The Agrobacterium-mediated procedure is particularly preferred, since single integration events of the transgene constructs are more readily obtained using this procedure, which greatly facilitates subsequent plant breeding. Cotton can be transformed by particle bombardment (U.S.
Patent Nos. 5,004,863 and 5,159,135). Sunflower can be transformed using a combination of particle bombardment and Agrobacterium infection (EP 0 486 233 A2; U.S. Patent No. 5,030,572). Flax can be transformed by either particle bombardment or Agrobacterium-mediated transformation.
Recombinase technologies include the cre-lox, FLP/FRT, and Gin systems.
Methods for utilizing these technologies are described for example in U.S.
Patent No. 5,527,695 to Hodges et al.; Dale & Ow, Proc. Natl. Acad. Sci.
USA 88:10558-62 (1991); Medberry et. al., Nucleic AcidsRes. 23:485-90 (1995).
Selectable Marker Genes Selectable marker genes useful in practicing the methods described herein include the neomycin phosphotransferase gene nptlI (U.S. Patent Nos.
5,034,322 and 5,530,196), hygromycin resistance gene (U.S. Patent No.
5,668,298), bar gene encoding resistance to phosphinothricin (U.S. Patent No. 5,276,268). EP 0 530 129 Al describes a positive selection system which enables the transformed plants to outgrow the non-transformed lines by expressing a transgene encoding an enzyme that activates an inactive compound added to the growth media. Screenable marker genes useful in the methods herein include the (3-glucuronidase gene (Jefferson et. al., EMBO J. 6:3901-07 (1987); U.S. Patent No. 5,268,463) and native or modified green fluorescent protein gene (Cubitt et. al., Trends Biochem Sci.
20:448-55 (1995); Pang et. al., Plant Physiol. 112:893-900 (1996)). Some of these markers have the added advantage of introducing a trait, such as herbicide resistance, into the plant of interest, thereby providing an additional agronomic value on the input side.
In a preferred embodiment of the methods described herein, more than one gene product is expressed in the plant. This expression can be achieved via a number of different methods, including (1) introducing the encoding DNAs in a single transformation event where all necessary DNAs are on a single vector; (2) introducing the encoding DNAs in a co-transformation event where all necessary DNAs are on separate vectors but introduced into plant cells simultaneously; (3) introducing the encoding DNAs by independent transformation events successively into the plant cells i.e. transformation of transgenic plant cells expressing one or more of the encoding DNAs with additional DNA constructs; and (4) transformation of each of the required DNA constructs by separate transformation events, obtaining transgenic plants expressing the individual proteins and using traditional plant breeding methods to incorporate the entire pathway into a single plant.
III. ~i-Oxidation Enzyme Pathways Production of PHAs in the cytosol of plants requires the cytosolic localization of enzymes that are able to produce R-3-hydroxyacyl CoA
thioesters as substrates for PHA synthases. Both eukaryotes and prokaryotes possess a (3-oxidation pathway for fatty acid degradation that consists of a series of enzymes that convert fatty acyl CoA thioesters to acetyl CoA.
While these pathways proceed via intermediate 3-hydroxyacyl CoA, the stereochemistry of this intermediate varies among organisms. For example, the j3-oxidation pathways of bacteria and the peroxisomal pathway of higher eukaryotes degrade fatty acids to acetyl CoA via S-3-hydroxyacyl CoA
(Schultz, "Oxidation of Fatty Acids" in Biochemistry of Lipids, Lipoproteins andMembranes (Vance et al., eds.) pp. 101-06 (Elsevier, Amsterdam 1991)).
5 In Escherichia coli, an epimerase activity encoded by the ~3-oxidation multifunctional enzyme complex is capable of converting S-3-hydroxyacyl CoA to R-3-hydroxyacyl CoA. Yeast possesses a peroxisomal localized fatty acid degradation pathway that proceeds via intermediate R-3-hydroxyacyl CoA (Hiltunen, et al. J. Biol. Chem. 267: 6646-53 (1992);
10 Filppula, et al. J. Biol. Chem. 270:27453-57 (1995)), such that no epimerase activity is required to produce PHAs.
Plants, like other higher eukaryotes, possesses a [i-oxidation pathway for fatty acid degradation localized subcellularly in the peroxisomes (Gerhardt, "Catabolism of Fatty Acids [a and (3 Oxidation]" in Lipid 15 Metabolism in Plants (Moose, Jr., ed.) pp. 527-65 (CRC Press, Boca Raton, Florida 1993)). Production of PHAs in the cytosol of plants therefore necessitates the cytosolic expression of a (3-oxidation pathway, for conversion of fatty acids to R-3-hydroxyacyl CoA thioesters of the correct chain length, as well as cytosolic expression of an appropriate PHA synthase, 20 to polymerize R-3-hydroxyacyl CoA to polymer.
Fatty acids are synthesized as saturated acyl-ACP thioesters in the plastids of plants (Hartwood, "Plant Lipid Metabolism" in Plant Biochemistry (Dey et al., eds.} pp. 237-72 (Academic Press, San Diego 1997}). Prior to export from the plastid into the cytosol, the majority of fatty 25 acids are desaturated via a d9 desaturase. The pool of newly synthesized fatty acids in most oilseed crops consists predominantly of oleic acid (cis 9-octadecenoic acid), stearic acid (octadecanoic acid), and palmitic acid (hexadecanoic acid). However, some plants, such as coconut and palm kernel, synthesize shorter chain fatty acids (C8-14). The fatty acid is 30 released from ACP via a thioesterase and subsequently converted to an acyl-CoA thioester via an acyl CoA synthetase located in the plastid membrane (Andrews, et al., "Fatty acid and lipid biosynthesis and degradation" in Plant Physiology, Biochemistry, and Molecular Biology (Dennis et al., eds.) pp.
345-46 (Longman Scientific & Technical, Essex, England 1990); Harwood, "Plant Lipid Metabolism" in Plant Biochemistry (Dey et al., eds) p. 246 (Academic Press, San Diego 1997)).
The cytosolic conversion of the pool of newly synthesized acyl CoA
thioesters via fatty acid degradation pathways and the conversion of intermediates from these series of reactions to R-3-hydroxyacyl-CoA
substrates for PHA syntheses can be achieved via the enzyme reactions outlined in Figure 1. The PHA synthase substrates are C4-C16 R-3-10 hydroxyacyl CoAs. For saturated fatty acyl CoAs, conversion to R-3-hydroxyacyl CoA thioesters using fatty acids degradation pathways necessitates the following sequence of reactions: conversion of the acyl CoA
thioester to traps-2-enoyl-CoA (reaction 1 ), hydration of traps-2-enoyl-CoA
to R-3-hyddroxy acyl CoA (reaction 2a, e.g. yeast system operates through 15 this route and the Aeromonas caviae D-specific hydratase yields C4-C7 R-3-hydroxyacyl-CoAs), hydration of traps-2-enoyl-CoA to S-3-hydroxy acyl CoA (reaction 2b), and epimerization of S-3-hydroxyacyl CoA to R-3-hydroxyacyl CoA (reaction 5, e.g. cucumber tetrafunctional protein, bacterial systems). If 3-hydroxyacyl CoA is not polymerized by PHA synthase 20 forming PHA, it can proceed through the remainder of the (3-oxidation pathway as follows: oxidation of 3-hydroxyacyl CoA to form (3-keto acyl CoA (reaction 3) followed by thiolysis in the presence of CoA to yield acetyl CoA and a saturated acyl CoA thioester shorter by two carbon units (reaction 4). The acyl CoA thioester produced in reaction 4 is free to re-enter the (3-25 oxidation pathway at reaction 1 and the acetyl-CoA produced can be converted to R-3-hydroxyacyl CoA by the action of (3-ketothiolase (reaction 7) and NADH or NADPH acetoacetyl-CoA reductase (reaction 6). This latter route is useful for producing R-3-hydroxybutyryl-CoA, R-3-hydroxyvaleryl-CoA and R-3-hydroxyhexanoyl-CoA. The 8-3-30 hydroxyacids of four to sixteen carbon atoms produced by this series of enzymatic reactions can be polymerized by PHA syntheses expressed from a transgene, or transgenes in the case of the two subunit synthase enzymes, into PHA polymers.
For A9 unsaturated fatty acyl CoAs, a variation of the reaction sequences described is required. Three cycles of (3-oxidation, as detailed in Figure l, will remove six carbon units yielding an unsaturated acyl CoA
thioester with a cis double bond at position 3. Conversion of the cis double bond at position 3 to a traps double bond at position 2, catalyzed by D3-cis-~2-traps-enoyl CoA isomerase will allow the ~i-oxidation reaction sequences outlined in Figure 1 to proceed. This enzyme activity is present on the microbial (3-oxidation complexes and the plant tetrafunctional protein, but not on the yeast foxl.
Acyl CoA thioesters also can be degraded to a (3-keto acyl CoA and converted to R-3-hydroxyacyl CoA via a NADH or NADPH dependent reductase (reaction 6).
Multifunctional enzymes that encode S-specific hydratase, S-specific 1 S dehydrogenase, ~i-ketothiolase, epimerase and D3-cis-D2-traps-enoyl CoA
isomerase activities have been found in bacteria such as Escherichia coli (Spratt, et al., J. Bacteriol. 158:535-42 (1984)) and Pseudomonas fragi (Immure, et al., J. Biochem. 107:184-89 ( 1990)). The multifunctional enzyme complexes consist of two copies of each of two subunits such that catalytically active protein forms a heterotetramer. The hydratase, dehydrogenase, epimerase, and 43-cis-DZ-traps-enoyl CoA isomerase activities are located on one subunit, whereas the thiolase is located on another subunit. The genes encoding the enzymes from organisms such as E.
coli (Spratt, et al., J. Bacteriol. 158:535-42 (1984); DiRusso, J. Bacteriod.
172:6459-68 (1990)) and P. fragi (Sato, et al., J. Biochem. 111:8-15 (1992)) have been isolated and sequenced and are suitable for practicing the methods described herein. Furthermore, the E. coli enzyme system has been subjected to site-directed mutagenesis analysis to identify amino acid residues critical to the individual enzyme activities (He & Yang, Biochemistry 35:9625-30 (1996); Yang et. al., Biochemistry 34:6641-47 (1995); He & Yang, Biochemishy 36:11044-49 (1997); He et. al., Biochemistry 36:261-68 (1997); Yang & Elzinga, J. Biol. Chem. 268:6588-92 (1993)). These mutant genes also could be used in some embodiments of the methods described herein.
Mammals, such as rat, possess a trifunctional (3-oxidation enzyme in their peroxisomes that contains hydratase, dehydrogenase, and D3-cis-42-5 traps-enoyl CoA isomerase activities. The trifunctional enzyme from rat liver has been isolated and has been found to be monomeric with a molecular weight of 78 kDa (Palosaari, et al., J. Biol. Chem. 265:2446-49 (1990)).
Unlike the bacterial system, thiolase activity is not part of the multienzyme protein (Schultz, "Oxidation of Fatty Acids" in Biochemistry ojLipids, 10 Lipoproteins and Membranes (Vance et al., eds) p. 95 (Elsevier, Amsterdam (1991)). Epimerization in rat occurs by the combined activities of two distinct hydratases, one which converts R-3-hydroxyacyl CoA to traps-2-enoyl CoA, and another which converts traps-2-enoyl CoA to S-3-hydroxyacyl CoA (Smeland, et al., Biochemical and Biophysical Research 15 Communications 160:988-92 (1989)). Mammals also possess (3-oxidation pathways in their mitochondria that degrade fatty acids to acetyl CoA via intermediate S-3-hydroxyacyl CoA (Schultz, "Oxidation of Fatty Acids" in Biochemistry of Lipids, Lipoproteins and Membranes (Vance et al., eds) p.
96 (Elsevier, Amsterdam (1991)). Genes encoding mitochondria) (i-20 oxidation activities have been isolated from several animals including a Rat mitochondria) long chain acyl CoA hydratase/3-hydroxy acyl CoA
dehydrogenase (GENBANK Accession # D 16478) and a Rat mitochondria) thiolase (GENBANK Accession #s D13921, D00511).
Yeast possesses a multifunctional enzyme, Fox2, that differs from the 25 (3-oxidation complexes of bacteria and higher eukaryotes in that it proceeds via a R-3-hydroxyacyl CoA intermediate instead of S-3-hydroxyacyl CoA
(Hiltunen, et al., J. Biol. Chem. 267:6646-53 (1992)). Fox2 possesses R-specific hydratase and R-specific dehydrogenase enzyme activities. This enzyme does not possess the ~3-cis-02-traps-enoyl CoA isomerase activity 30 needed for degradation of 09-cis-hydroxyacyl CoAs to form R-3-hydroxyacyl CoAs. The gene encoding jox2 from yeast has been isolated and sequenced and encodes a 900 amino acid protein. The DNA sequence of the structural gene and amino acid sequence of the encoded polypeptide is shown in SEQ ID NO:1 and SEQ ID N0:2.
Plants have a tetrafunctional protein similar to the yeast Fox2, but also encoding a 03-cis-02-traps-enoyl CoA isomerase activity (Muller et., al., J. Biol. Chem. 269:20475-81 ( 1994)). The DNA sequence of the cDNA and amino acid sequence of the encoded polypeptide is shown in SEQ ID N0:3 and SEQ ID N0:4.
IV. Targeting of Enzymes to the Cytoplasm of Oil Seed Crops Engineering PHA production in the cytoplasm of plants requires 10 directing the expression of (3-oxidation to the cytosol of the plant. No targeting signals are present in the bacterial systems, such as faoAB. In fungi, yeast, plants, and mammals, (3-oxidation occurs in subcellular organelles. Typically, the genes are expressed from the nuclear chromosome, and the polypeptides synthesized in the cytoplasm are directed 15 to these organelles by the presence of specific amino acid sequences. To practice the methods described herein using genes isolated from eukaryotic sources, e.g., fatty acid oxidation enzymes from eukaryotic sources, such as yeast, fungi, plants, and mammals, the removal or modification of subcellular targeting signals is required to direct the enzymes to the cytosol.
20 It may be useful to add signals for directing proteins to the endoplasmic reticulum. Peptides useful in this process are well known in the art. The general approach is to modify the transgene by inserting a DNA sequence specifying an ER targeting peptide sequence to form a chimeric gene.
Eukaryotic acyl CoA dehydrogenases, as well as other mitrochondrial 25 proteins, are targeted to the mitochondria via leader peptides on the N-terminus of the protein that are usually 20-60 amino acids long (Norwich, Current Opinion in Cell Biology, 2:625-33 (1990)). Despite the lack of an obvious consensus sequence for mitochondria) import leader peptides, mutagenesis of key residues in the leader sequence have been demonstrated 30 to prevent the import of the mitochrondrial protein. For example, the import of Saccharomyces cerevisiae F1-ATPase was prevented by mutagenesis of its leader sequence, resulting in the accumulation of the modified precursor protein in the cytoplasm (Bedwell, et al., Mol. Cell Biol. 9:1014-25 (1989)) Three eukaryotic peroxisomal targeting signals have been reported (Gould, et al., J. Cell Biol. 108:1657-64 (1989); Brickner, et al., J. Plant Physiol., 113:1213-21 (1997)). The tripeptide targeting signal S/A/C-K/H/R-L occurs at the C-terminal end of many peroxisomal proteins (Gould, et al., J. Cell Biol. 108:1657-64 ( 1989)). Mutagenesis of this sequence has been shown to prevent import of proteins into peroxisomes. Some peroxisomal proteins do not contain the tripeptide at the C-terminal end of the protein. For these proteins, it has been suggested that targeting occurs via the tripeptide in an internal position within the protein sequence (Gould, et al., J. Cell Biol. 108:1657-64 (1989)) or via an unknown, unrelated sequence (Brickner, et al., .l. Plant Physiol. 113:1213-21 (1997)). The results of in vitro peroxisomal targeting experiments with fragments of acyl CoA oxidase from Candida tropicalis appear to support the latter theory and suggest that there are two separate targeting signals within the internal amino acid sequence of the polypeptide (Small, et al., The EMBO Journal 7:1167-73 (1988)). In the aforementioned study, the targeting signals were localized to two regions of 118 amino acids in length, and neither of regions was found to contain the targeting signal S/A/C-K/H/R-L. A small number of peroxisomal proteins appear to contain an amino terminal leader sequence for import into peroxisomes (Brickner, et al., J. Plant Physiol. 113:1213-21 (1997)). These targeting signals can be deleted or altered by site directed mutagenesis.
' V. Cultivation and Harvesting of Transgenic Plant The transgenic plants can be grown using standard cultivation techniques. The plant or plant part also can be harvested using standard equipment and methods. The PHAs can be recovered from the plant or plant part using known techniques such as solvent extraction in conjunction with traditional seed processing technologies, as described in PCT WO 97/15681, or can be used directly, for example, as animal feed, where it is unnecessary to extract the PHA from the plant biomass.
Several Iines which did not produce seed, produced much higher levels of biomass. produced much higher levels of biomass. This phenotype therefore may be useful as a means to increase the amount of green biomass produced per acre for silage, forage, or other biomass crops. End uses include the more cost effective production of forage crops for animal feed or as energy crops for electric power generation. Other uses include increasing biomass levels in crops, such as alfalfa or tobacco, for subsequent recovery of industrial products, such as PHAs by extraction.
The compositions and methods of preparation and use thereof described herein are further described by the following non-limiting examples.
Example 1: Isolation and Characterization of the Pseudomonas putida faoAB Genes and Fao Enzyme All DNA manipulations, including PCR, DNA sequencing E. coli transformation, and plasmids purification, were performed using standard procedures, as described, for example, by Sambrook et. al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, New York (1989)). The genes encoding faoAB from Pseudomonas putida were isolated using a probe generated from P. putida genomic DNA by PCR
(polymerase chain reaction) using primers 1 and 2 possessing homology to faoB from Pseudomonas fragi (Sato, et al., J. Biochem. 111:8-15 (1992)).
Primer 1:
5' gat ggg ccg ctc caa ggg tgg 3' (SEQ D7 NO:S) Primer 2:
5' caa ccc gaa ggt gcc gcc att 3' (SEQ >D N0:6) A 1.1 kb DNA fragment was purified from the PCR reaction and used as a probe to screen a P. putida genomic library constructed in plasmid pBKCMV using the lambda ZAP expression system (Stratagene). Plasmid pMFXI was selected from the positive clones and the DNA sequence of the insert containing the faoAB genes and flanking sequences determined. This is shown in SEQ ID N0:7. A fragment containing faoAB was subcloned with the native P. putida ribosome binding site intact into the expression WO 99/45122 PC'T/US99/04999 vector pTRCN forming plasmid pMFX3 as follows. Plasmid pMFXI was digested with BsrG I. The resulting protruding ends were filled in with Klenow. Digestion with Hind III yielded a 3.39 kb blunt ended/Hind III
fragment encoding FaoAB. The expression vector pTRCN was digested with Sma llHind III and ligated with the faoAB fragment forming the 7.57 kb plasmid pMFX3.
Enzymes in the FaoAB multienzyme complex were assayed as follows. Hydratase activity was assayed by monitoring the conversion of NAD to NADH using the coupling enzyme L-~i-hydroxyacyl CoA
10 dehydrogenase as previously described, except that assays were run in the presence of CoA (Filppula, et al., J. Biol. Chem. 270:27453-57 (1995)).
Severe product inhibitation of the coupling enzyme was observed in the absence of CoA. The assay contained (1 mL final volume) 60 p,M crotonyl CoA, 50 p.M Tris-CI, pH 9, 50 p,g bovine serum albumin per mL, 50 mM
KCI, 1 mM NAD, 7 pg L-specific ~i-hydroxyacyl CoA dehydrogenase from porcine heart per mL, and 0.25 mM CoA. The assay was initiated with the addition of FaoAB to the assay mixture. A control assay was performed without substrate to determine the rate of consumption of NAD in the absence of the hydratase generated product, S-hydroxybutyryl CoA. One unit of activity is defined as the consumption of one p,Mol of NAD per min (ESao = 6220 M'1 cni ~ ).
Hydroxyacyl CoA dehydrogenase was assayed in the reverse direction with acetoacetyl CoA as the substrate by monitoring the conversion of NADH to NAD at 340 nm (Binstock, et aL, Methods in Enzymology, 71:403 (1981)). The assay contained (1 mL final volume) 0.1 M KH2P04, pH 7, 0.2 mg bovine serum albumin per mL, 0.1 mM NADH, and 33 p,M
acetoacetyl CoA. The assay was initiated with the addition of FaoAB to the assay mixture. When necessary, enzyme samples were diluted in 0.1 M
KH2POa, pH 7, containing 1 mg bovine serum albumin per mL. A control 30 assay was performed without substrate acetoacetyl CoA to detect the rate of consumption of NADH in the crude due to enzymes other than hydroxyacyl CoA dehydrogenase. One unit of activity is defined as the consumption of WO 99/45122 PC'TNS99/04999 one p.Mol of NADH per minute (s3~o= 6220 M-'crri').
HydroxyacylCoA dehydrogenase was assayed in the forward direction with crotonyl CoA as a substrate by monitoring the conversion of NAD -to NADH at 340 nm (Binstock, et al., Methods in Enzymology, 71:403 5 (1981)). The assay mixture contained (1 mL final volume) 0.1 M KH2P04, pH 8, 0.3 mg bovine serum albumin per mL, 2 mM ~i-mercaptoethanol, 0.25 mM CoA, 30 p,M crotonyl CoA, and an aliquot of FaoAB. The reaction was preincubated for a couple of minutes to allow in situ formation of S-hydroxybutyryl CoA. The assay then was initiated by the addition of NAD
10 (0.45 mM). A control assay was performed without substrate to detect the rate of consumption of NAD due to enzymes other than hydroxyacyl CoA
dehydrogenase. One unit of activity is defined as the consumption of one p.Mol ofNAD per minute (E3ao= 6220 M-'crri') Thiolase activity was determined by monitoring the decrease in 15 absorption at 304 nm due to consumption of substrate acetoacetyl CoA as previously described with some modifications (Palmer, et al., J. Biol. Chem.
266:1-7 (1991)). The assay contained (final volume 1 mL) 62.4 mM Tris-Cl, pH 8.1, 4.8 mM MgCl2, 62.5 p.M CoA, and 62.5 p.M acetoacetyl CoA. The assay was initiated with the addition of FaoAB to the assay mixture. A
20 control sample without enzyme was performed for each assay to detect the rate of substrate degradation of pH 8.1 in the absence of enzyme. One unit of activity is defined as the consumption of one N.MoI of substrate acetoacetyl CoA per minute (s3ao= 169001V1-'cni').
Epimerase activity was assayed as previously described (Binstock, et 25 al., Methods in Enrymology, 71:403 (1981)) except that R-3-hydroxyacyl CoA thioesters were utilized instead of D,L-3-hydroxyacyl CoA mixtures.
The assay contained (final volume 1 mL) 30 p,M R-3-hydroxyacyl CoA, ISO
mM KH2PO4 (pH 8), 0.3 mg/mL BSA, 0.5 mM NAD, 0.1 mM CoA, and 7 p,g/mL L-specific ~i-hydroxyacyl CoA dehydrogenase from porcine heart.
30 The assay was initiated with the addition of FaoAB.
For expression of FaoAB in DHSoc/pMFX3, cultures were grown in 2xTY medium at 30 °C. 2xTY medium contains (per L) 16 g tryptone, 10 g yeast, and 5 g NaCI. A starter culture was grown overnight and used to inoculate (1% inoculum) fresh medium (100 mL in a 250 mL Erlenmeyer flask for small scale growths; 1.5L in a 2.8L flask for large scale growths).
Cells were induced with 0.4 n~IVI IPTG when the absorbance at 600 nm was in the range of 0.4 to 0.6. Cells were cultured an additional 4 h prior to harvest. Cells were lysed by sonication, and the insoluble matter was removed from the soluble proteins by centrifugation. Acyl CoA
dehydrogenase activity was monitored in the reverse direction to ensure activity of the FaoA subunit (SEQ m N0:31 ) and thiolase activity was assayed to determine activity of the Fao subunit. FaoAB in DHSoc/pMFX3 contained dehydrogenase and thiolase activity values of 4.3 and 0.99 U/mg, respectively, which is significantly more than the 0.0074 and 0.0033 U/mg observed for dehydrogenase and thiolase, respectively, in control strain DHSoc/pTRCN.
1 S FaoAB was purified from DHSoc/pMFX3 using a modified procedure previously described for the purification of FaoAB from Pseudomonas fragi (Imamura, et al., .I. Biochem. 107:184-89 ( 1990)). Thiolase activity (assayed in the forward direction) and dehydrogenase activities (assayed in the reverse direction) were monitored throughout the purification. Three liters of DHSoc/pMFX3 cells (2 X 1.5 L aliquots in 2.8 L Erlenmeyer flasks) were grown in 2 x TY medium using the cell growth procedure previously described for preparing cells for enzyme activity analysis. Cells {15.8 g) were resuspended in 32 mL of 10 mM KH2P04, pH 7, and lysed by sonication. Soluble proteins were removed from insoluble cells debris by centrifugation (18,000 RPM, 30 min., 4 °C). The soluble extract was made 50% in acetone and the precipitated protein was isolated by centrifugation and redissolved in 10 mM KHZP04, pH 7. The sample was adjusted to 33%
saturation with (NH4)2504 and the soluble and insoluble proteins were separated by centrifugation. The resulting supernatant was adjusted to 56%
saturation with (NHa)2504 and the insoluble pellet was isolated by centrifugation and dissolved in 10 mM KH2P04, pH 7. The sample was heated at 50°C for 30 min. and the soluble proteins were isolated by centrifugation and dialyzed in a 6,000 to 8,000 molecular weight cut off membrane in 10 mM KH2POa, pH 7 (2 X 3L; 20 h). The sample was loaded on a Toyo Jozo DEAF FPLC column (3 cm x 14 cm) that previously had been equilibrated in 10 mM KHzP04, pH 7. The protein was eluted with a linear gradient (100 mL by 100 mL; 0 to 500 mM NaCI in 10 KHZP04, pH 7) at a flow of 3 mL/min. FaoAB eluted between 300 and 325 mM NaCI. The sample was dialyzed in a 50,000 molecular weight cut off membrane in I O
mM KH2POa, pH 7 (1 X 2L; 15h) prior to loading on a macro-prep hydroxylapatite 18/30 (Biorad) FPLC column (2 cm x 15 cm) that previously had been equilibrated in 10 mM KH2P04, pH 7. The protein was eluted with a linear gradient (250 mL by 250 mL; 10 to 500 mM KH2P04, pH 7) at a flow rate of 3 mL/min. FaoAB eluted between 70 and 130 mM KH2P04, The fractions containing activity were concentrated to 9 mL using a MIZLIPORETM 100,000 molecular weight cutoff concentrator. The buffer was exchanged 3 times with 10 mM KHZP04, pH 7 containing 20% sucrose and frozen at -70°C. Enzyme activities of the hydroxylapatite purified fraction were assayed with a range of substrates. The results are shown in Table 1 below.
T~AIP i ~ Fnwmp Cuhctratec and Activities En me Substrate Activit U/m h dratase croton 1 CoA 8.8 deh dro enase forwardcroton 1 CoA 0.46 deh dro enase reverseacetoace 1 CoA 29 thiolase acetoace 1 CoA 9.9 a imerase R-3-h drox octan 0.022 1 CoA

a imerase R-3- h drox hexan 0.0029 1 CoA

epimerase R-3- hydroxybutyryl0.000022 CoA

Example 2: Production of Antibodies to the FaoAB and FaoAB Polypeptides Following purification of the FaoAB protein as described in Example 1, a sample was separated by SDS-PAGE. The protein band corresponding to the FaoA (SEQ ID N0:31) and FaoB (SEQ ID N0:26) was excised and used to immunize New Zealand white rabbits with complete Freunds adjuvant. Boosts were performed using incomplete Freunds at three week - intervals. Antibodies were recovered from serum by affinity chromatography on Protein A columns (Pharmacia) and tested against the antigen by Western blotting procedures. Control extracts of Brassica seeds were used to test for cross reactivity to plant proteins. No cross reactivity S was detected.
Example 3: Construction of Plasmids for Expression of the Pseudomonas putido fao AB Genes in Transgenic Oilseeds Construction of pSBS2024 Oligonucleotide primers GVR471 5'-CGGTACCCATTGTACTCCCAGTATCAT-3' (SEQ ID N0:8) and GVR472 S'-CA TTTAAA TAGTAGAGTATTGAATATG-3' (SEQ ID N0:9) homologous to sequences flanking the 5' and 3' ends (underlined), respectively, of the bean phaseolin promoter (SEQ 117 NO:10; Slightom et al., 1983) were designed with the addition of KpnI {in italics, nucleotides 1-in SEQ ID N0:8) and SwaI (in italics, nucleotides 1-9 in SEQ ID N0:9) at the 5' ends of GVR471 and GVR472, respectively. These restriction sites were incorporated to facilitate cloning. The primers were used to amplify a 1.4 kb phaseolin promoter, which was cloned at the SmaI site in pUCl9 by blunt ended ligation. The designated plasmid, pCPPI (see Figure 2) was cut with SaII and SwaI and ligated to a SaIIlSwaI phaseolin terminator (SEQ ID
N0:27). The bean phaseolin terminator sequence encompassing the ' polyadeilylation signals was amplified' using the following PCR'piiliiers: ' GVR396:
5'-GATTTAAATGCAAGCTTAAATAAGTATGAACTAAAATGC-3' (SEQ ID N0:22) and GVR397:
S'-CGGTACCTTAGTTGGTAGGGTGCTA-3' (SEQ ID N0.23) and the 1.2Kb fragment (SEQ ID N0:27) cloned into Sall-SaI site of pCCPI
to obtain pSBS2024 (Figure 2). The resulting plasmid which contains a unique HindIII site for cloning was called pSBS2024 (Figure 2).

Construction of pSBS2025 A soybean oleosin promoter fragment (SEQ ID NO:l 1; Rowley et al., 1997) was simplified with primers that flank the DNA sequence.
Primer JA408 5' -TCTAGATACATCCATTTCTTAATATAATCCTCTTATTC-3' (SEQ ID N0:12) contains sequences that are complementary to the 5' end (underlined).
Primer np 1 5' -CA TTTAAA TGGTTAAGGTGAAGGTAGGGCT-3' (SEQ ID N0:13) contains sequences homologous to the 3' end (underlined) of the promoter fragment. The restriction sites Xbal (in italics) and SwaI (in italics) were incorporated at the 5' end of JA408 and npl, respectively, to facilitate cloning. The primers were used to amplify a 975 by promoter fragment, which then was cloned into Small site of pUCl9 (see Figure 2). The resulting plasmid, pCSPI, was cut with Salt and Swal and iigated to the soybean terminator (SEQ ID N0:28). The soybean oleosin terminator was amplified by PCR using the following primers:
JA410:
5'-AAGCTTACGTGATGAGTATTAATGTGTTGTTATG-3' (SEQ ID N0:29) and JA411:
'S'-TCfiAGACAATTCATCAAATACAAATCACATTGCC-3' (SEQ ID N0:30) and the 225 by fragment cloned into the SaII-SwaI site of pCSPl to obtain plasmid pSBS2025 (Figure 6). The designated plasmid, pSBS2025, earned a unique HindIII site for cloning (Figure 2).

Construction of Promoter-coding Sequence Fusions Two oligonucleotide primers were synthesized:
np2 5'AA GCTT'AAAATGATTTACGAAGGTAAAGCC-3' (SEQ ID N0:14) homologous to nucleotides 553 to 573 of the 5' flanking sequences, and np3 5' A TTGCTTT CAGTTGAAGCGCTG-3' (SEQ ID NO:15) complementary to nucleotides 2700 to 2683 flanking the 3' end of mfl (faoA, SEQ ID N0:24) of plasmid pmfx3. A HindIII (in italics) site was introduced at the S' end of primers np2 and np3 to facilitate cloning. In addition, a 3 by AAA sequence (bold) was incorporated to obtain a more favorable sequence surrounding the plant translational initiation codon. Primers np2 and np3 were used to amplify the fragment and cloned into SmaI site of pUCl9. The resulting plasmid was called pCmfl (Figures 3A and 3B). Plasmid pBmfl was constructed in a similar process {Figures SA and SB). In order to generate a HindIII {in italics) at 5' and 3' ends of the mFl (faoB) gene (SEQ
ID N0:25) for cloning, a second set of synthetic primers were designed.
Primers np4 5' AAGCTTAAAATGAGCCTGAATCCAAGAGAC-3' (SEQ ID N0:16) complementary to 5' (nucleotides 2732-2752 bp) and np5 5'AAGCTTTCAGACGCGTTCGAAGACAGTG -3' ' w (SEQ ID N0:17) homologous to 3' (nucleotides 3907-3886 bp) sequences of mf2 (faoB, SEQ
ID N0:25) of plasmid pmfx3 were used in a PCR reaction to amplify the 1.17 kb DNA fragment. The resulting PCR product was cloned into the EcoRV site of pBluescript. The plasmid was referred to as pBmf2.
Both plasmids were individually cut with HindIII and their inserts cloned in plasmids pSBS2024 and pSBS2025, which had previously been linearized with the same restriction enzyme. As a result, the following WO 99/45122 PC'T/US99/04999 plasmids were generated: pmf124 and pmf125 (Figures 3A and 3B) and pmfZ24 and pmf225 (Figures SA and SB) containing the Fao genes (mfl and mf2) fused to either the phaseolin or soybean promoters. DNA sequence analysis confirmed the correct promoter-coding sequence-termination sequence fusions for pmf124, pmf125, pmfZ24, and pmf225.
Example 4: Assembly of Promoter-coding Sequence Fusions into Plant Transformation Vectors After obtaining plasmids pmf124, pmf125, pmf224, and pmf225, promoter-coding sequence fusions were independently cloned into the binary vectors, pCGN1559 (McBride and Summerfelt, 1990) containing the CaMV
35S promoter driving the expression of NPTII gene (conferring resistance to the antibiotic kanamycin) and pSBS2004 containing a parsley ubiquitin promoter driving the PPT gene, which confers resistance to the herbicide phosphinothricine. Binary vectors suitable for this purpose with a variety of selectable markers can be obtained from several sources.
The phaseolin-mf21 fusion cassette was released from the parent plasmid withXbaI and ligated with pCGN1559, which had been linearized with the same restriction enzyme. The resulting plasmid was designated pCGmf124 (Figures 3A and 3B). Plasmid pCGmf125 containing the soybean-mfl fusion was constructed in a similar way (Figures 3A and 3B), except that both pmf125 and pCGNl 559 were cut with BamHI before ligation.
Construction of pmf1249 an pmf1254 The plasmid pSBS2004 was linearized with BamHI fragment containing the soybean-mfl fusion. This plasmid was designated pmf1254 (Figures 4A and 4B). Similarly, the Xbal phaseolin-mfl fusion fragment was ligated to pSBS2004 which had been linearized with the same restriction enzyme. The resulting plasmid was designated pmfI249 (Figures 4A and 4B).
Construction of pCGmfz24 and pCGmf225 The phaseolin-mfZ and soybean-mf2 fusions were constructed by excising the fusions from the vector by cutting with either BamHI or XbaI, and cloned into pCGNI559 which had been linearized with either restriction enzyme (Figures SA and SB).
Construction of ~CGmfl P2S and pCGmf2P 1 S
The two expression cassettes containing the promoter-coding sequence fusions were assembled on the same binary vector as follows:
Plasmid pmf124 containing the phaseolin-mfl fusion was cut with BamHI
and cloned into the BamHI site of pCGN1559 to create pCGmfB 124. This plasmid then was linearized with XbaI and Iigated to the XbaI fragment of pmf225 containing the soybean-mf2 fusion. The final plasmid was designated pCGmfl P2S (Figures 6A and 6B). Plasmid pCGmfZP 1 S was assembled in similar manner. The phaseolin-mfZ fusion was released from pmf224 by cutting with BamHI and cloned at the BamHI site of pCGN 1559.
The resulting plasmid, pCGmfB224, was linearized with XbaI and ligated to the Xbal fragment of pmf125 containing the soybean-mfl fusion (Figures 6A
and 6B).
Example 5: Transformation of Brassica Brassica seeds were surface sterilized in 10% commercial bleach (Javex, Colgate-Palmolive) for 30 min. with gentle shaking. The seeds were washed three times in sterile distilled water. Seeds were placed in germination medium comprising Murashige-Skoog (MS) salts and vitamins, 3% (w/v) sucrose and 0.7% (w/v) phytagar, pH 5.8 at a density of 20 per ' ' plate and maintained at 24 °C and a 16 h light 7 8 h dark' photoperiod 'at a light intensity of 60-80 ,uEni 2s'1 for four to five days.
Each of the constructs, pCGmf124, pCGmf125, pCGmf224, pCGmfIP2S, and pCGmf2PlS were introduced intoAgrobacterium tumefacians strain EHA101 (Hood et al., J. Bacteriol. 168:1291-1301 (1986)) by electroporation. Prior to transformation of cotyledonary petioles, single colonies of strain EHA101 harboring each construct were grown in 5 ml of minimal medium supplemented with 100 mg kanamycin per liter and 100 mg gentamycin per liter for 48 hr at 28 °C. One milliliter of bacterial suspension was pelletized by centrifugation for 1 min in a microfuge. The pellet was resuspended in 1 ml minimal medium.
For transformation, cotyledons were excised from 4 day old, or in some cases S day old, seedlings, so that they included approximately 2 mm of petiole at the base. Individual cotyledons with the cut surface of their petioles were immersed in diluted bacterial suspension for 1 s and immediately embedded to a depth of approximately 2 mm in co-cultivation medium, MS medium with 3% (w/v) sucrose and 0.7% phytagar and enriched with 20 ,uM benzyladenine. The inoculated cotyledons were plated at a density of 10 per plate and incubated under the same growth conditions for 48 h. After co-cultivation, the cotyledons then were transferred to regeneration medium comprising MS medium supplemented with 3%
sucrose, 20 pM benzyladenine, 0.7% (w/v) phytagar, pH 5.8, 300 mg timentinin per liter, and 20 mg kanamycin sulfate per liter.
After two to three weeks, regenerant shoots obtained were cut and maintained on "shoot elongation" medium (MS medium containing, 3%
sucrose, 300 mg timentin per liter, 0.7% (w/v) phytagar, 300 mg timentinin per liter, and 20 mg kanamycin sulfate per liter, pH 5.8) in Magenta jars.
The elongated shoots were transferred to "rooting" medium comprising MS
medium, 3% sucrose, 2 mg indole butyric acid per liter, 0.7% phytagar, and 500 mg carbenicillin per liter. After roots emerged, plantlets were transferred to potting mix (Redi Earth, W.R. Grace and Co.). The plants were maintained in a misting chamber (75% relative humidity) under the same growth conditions. Two to three weeks after growth, leaf samples were taken for neomycin phosphotransferase (NPTII) assays (Moloney et al., Plant Cell Reports 8:238-42 (1989)).
Seeds from the FaoA and FaoB transgenic lines can be analyzed for expression of the fatty acid oxidation polypeptides by western blotting using the anti-FaoA and anti-FaoB antibodies. The FaoB polypeptide (SEQ ID
N0:26) is not functional in the absence of the FaoA gene product; however, the FaoAB gene product has enzyme activity.
Transgenic lines expressing the FaoA and FaoB complex are obtained by crossing the FaoA and FaoB transgenic lines expressing the individual polypeptides and seeds analyzed by western blotting and enzymes assays as described.
Example 6: Transformation of B. napes cv. Westar and Analysis of Transgenic Lines Transformation The protocol used was adopted from a procedure described by Moloney et ad. ( 1989). Seeds of Brassica napes cv. Westar were surface sterilized in 10% commercial bleach (Javex, Colgate-Palmolive Canada Inc.) for 30 min with gentle shaking. The seeds were washed three times in sterile distilled water. Seeds were placed on germination medium comprising Murashige-Skoog (MS} salts and vitamins, 3% sucrose and 0.7% phytagar, pH 5.8 at a density of 20 per plate and maintained at 24 °C in a 16 h light/8 h dark photoperiod at a light intensity of 60-80 p,Eni 2s 1 for four to five days.
Each of the constructs, pCGmf124, pCGmf125, pCGmf224, pCGmfZ25, pCGmfIP2S, and pCGmfZPIS were introduced into Agrobacterium tumefaciens strain EHA101 (Hood et al. 1986} by electroporation. Prior to transformation of cotyledonary petioles, single colonies of strain EHA101 harboring each construct were grown in 5 mL of minimal medium supplemented with 100 mg kanamycin per liter, and 100 mg gentamycin per liter for 48 h at 28 °C. One milliliter of bacterial suspension was pelletized by centrifugation for 1 min in a microfuge. The pellet was resuspended in 1 mL minimal medium.
For transformation, cotyledons were excised from four-day-old, or in some cases five-day-old, seedlings so that they included approximately 2 mm of petiole at the base. Individual cotyledons with the cut surface of their petioles were immersed in diluted bacterial suspension for 1 s and immediately embedded to a depth of approximately 2 mm in co-cultivation medium, MS medium with 3% sucrose and 0.7% phytagar, enriched with 20 N,M benzyladenine. The inoculated cotyledons were plated at a density of 10 per plate and incubated under the same growth conditions for 48 h. After co-cultivation, the cotyledons then were transferred to regeneration medium, which comprised MS medium supplemented with 3% sucrose, 20 p.M
benzyladenine, 0.7% phytagar, pH 5.8, 300 mg timentinin per liter, and 20 mg kanamycin sulfate per liter.
After two to three weeks, regenerant shoots were obtained, cut, and maintained on "shoot elongation" medium (MS medium containing 3%
sucrose, 300mg timentin per liter, 0.7% phytagar, and 20 mg kanamycin per liter, pH 5.8) in Magenta jars. The elongated shoots then were transferred to "rooting" medium, which comprised MS medium, 3% sucrose, 2 mg indole butyric acid per liter, 0.7% phytagar and 500 mg carbenicillin per liter.
After roots emerged, the plantlets were transferred to potting mix (Redi Earth, W.R. Grace and Co. Canada Ltd.). The plants were maintained in a misting chamber (75% RH) under the same growth conditions. Two to three weeks after growth, leaf samples were taken for neomycin phosphotransferase (NPT II) assays (Moloney et al. 1989). The results are shown in Table 2 below. The data show the number of plants that were confirmed to be transformed.
Table 2: NPT II Activity in Transformed Plants Constructs No. of NPTII NPTII No. of plants plants assayedconfirmedconfirmed transformed CGmfl24 47 27 23 33 CGmf125 37 28 18 18 CGmfZ24 49 40 30 39 CGmf225 52 37 28 34 SpCGmfIP2S 27 27 21 21 6 CGmfl,P

pCGmf124 -bean pltaseolin regulatory sequences driving FaoA gene 'pCGmf125 - soybean oleosin regulatory sequences driving FaoA gene 3pCGmf224 - be n phaseolin regulatory sequences driving FaoB gene 4pCGmfl25 - soybean oleosin regulatory sequences driving FaoB gene SpCGmf192S - bean phaseolin and soybean oleosin regulatory sequences driving FaoA &
FaoB genes, respectively 6pCGmflPlS -bean phaseolin and soybean oleosin regulatory sequences driving FaoB &
FaoA genes, respectively The fate of the transforming DNA was investigated for sixteen randomly selected transgenic lines. Southern DNA hybridization analysis showed that the FaoA and/or FaoB were integrated into the genomes of the transgenic lines tested.
Approximately 80% of the pmf124 transgenic plants in which the FaoA gene is expressed from the strong bean phaseolin promoter were observed to be male sterile. Clearly high level expression of the FaoA gene 5 from this promoter results in functional expression of the FaoA gene product which impairs seed and/or pollen development. This result was very unexpected, since it was not anticipated that the plant cells would be capable of carrying out the first step in the (i-oxidation pathway in the cytosol.
This result, however, provides additional applications for expressing ~i-oxidation 10 genes in plants for male sterility for hybrid production or to prevent the production of seed. It was also note that in a side-by-side comparison with normal transgenic lines, the pmf124 lines produced much higher levels of biomass, presumably due to the elimination of seed development. This phenotype therefore may be useful as a means to increase the amount of 15 green biomass produced per acre for silage, forage, or other biomass crops.
Here, the use of an inducible promoter system or recombinase technology could be used to produce seed for planting. Seven of the sterile plants were successfully cross-pollinated with pollen from pmfl25 transgenic lines and set seeds.
20 Northern analysis on RNA from seeds from pmf224 lines containing the phaseolin promoter-FaoB constructs showed a signal indicative of the expected 1.2 kb transcript in all the samples tested except the control.
Northern analysis on RNA from seeds from pmf125 lines containing the weak soybean oleolsin promoter-FaoA constructs revealed a transcript of the .
25 expected size of 2.1 kb. Western blotting on 300-500 leg of protein from approximately 80% of seeds of pmf125 plants where the FaoA gene is expressed from the relatively weak soybean oleosin promoter were inconclusive, although a weak signal was detected in one transgenic line.
Fatt~Acid Analysis 30 Given the unexpected results indicating a strong metabolic effect of expressing the FaoA gene from the strong bean phaseolin promoter in seeds, the fatty acid profile of the seeds from transgenic lines expressing the FaoA

gene from the weak soybean oleosin promoter was analyzed. Seeds expressing only the FaoA gene or also expressing the FaoB gene from the bean phaseolin promoter were examined. The analysis was carried out as described in Millar et al., The Plant Cell 11:1889-902 (1998). Seed fatty 5 acid methyl esters (FAMES) were prepared by placing ten seeds of B. napus in 15 x 45-mm screw capped glass tubes and heating at 80 °C in 0.75 mL
of 1N methanolic HCl reagent (Supelco, PA) and 10 gL of 1 mg 17:0 methyl ester (internal standard) per mL overnight. After cooling the samples, the FAMES were extracted with 0.3 mL hexane and 0.5 mL 0.9% NaCI by 10 vortexing vigorously. The samples were allowed to stand to separate the phases, and 300 pL of the organic phase was drawn and analyzed on a Hewlett-Packard gas chromatograph.
Fatty acid profile analysis indicated the presence of an additional component or enhanced component in the lipid profile in all of the transgenic 15 plants expressing the FaoA gene SEQ m N0:24 which was absent from the control plants. This result again proves conclusively that the FaoA gene is being transcribed and translated and that the FaoA polypeptide SEQ ID NO:
27 is catalytically active. This peak also was observed in eleven additional transgenic plants harboring SoyP-FaoA, PhaP-FaoA-SoyP-FaoB, SoyP-20 FaoA-PhaP-FaoB genes and a sterile (PhaP-FaoA) plant cross-pollinated with SoyP-FaoB. These data clearly demonstrate functional expression of the FaoA gene and that even the very low levels of expression are sufficient to change the lipid profile of the seed. Adapting the methods described herein, one of skill in the art can express these genes at levels intermediate 25 between that obtained with the phaseolin promoter and the soybean oleosin promoter using other promoters such as the Arabidopsis oleosin promoter, napin promoter, or cruciferin promoter, and can use inducible promoter systems or recombinase technologies to control when fatty acid oxidation transgenes are expressed.
Example 7: Yeast ~i-oxidation Multi-functional Enzyme Complex S. cerevisiae contains a (i-oxidation pathway that proceeds via R-WO 99/45122 PC'fNS99/04999 hydroxyacyl CoA rather than the S-3-hydroxyacyl CoA observed in bacteria and higher eukaryotes. The fox2 gene from yeast encodes a hydratase that produces R-3-hydroxyacyl CoA from traps-2-enoyl-CoA and a dehydrogenase that utilizes R-3-hydroxyacyl-CoA to produce ~i-keto acyl CoAs.
The fox2 gene (sequence shown in SEQ ID NO:1) was isolated from S. cerevisiae genomic DNA by PCR in two pieces. Primers N-fox2b and N-bamfox2b were utilized to PCR a 1.1 kb SmaIBamHI fragment encoding the N-terminal region of Fox2, and primers C-fox2 and C-bamfox2 were utilized 10 to PCR a 1.6 kb BamHI/XbaI fragment encoding the C-terminal Fox2 region. The full fox2 gene was reconstructed via subcloning in vector pTRCN.
N-fox2b fox2 tcc ccc ggg agg agg ttt tta tta tgc ctg gaa att tat cct tca aag ata gag tt 1 S (SEQ ID N0:18) N-bamfox2b fox2 aaggatccttgatgtcatttacaactacc (SEQ ID NO:I9) C-fox2 fox2 get cta gat agg gaa aga tgt atg taa g (SEQ ID N0:20) 20 C-bamfox2 fox2 tgacatcaaggatcctttt (SEQ ID N0:21) The foil gene, however, does not possess a p-ketothiolase activity and this activity must be supplied by a second transgene. Representative sources of such a gene include algae, bacteria, yeast, plants, and mammals. The 25 bacterium Alcaligenes eutrophus possesses a broad specificity (3-ketothiolase gene suitable for use in the methods described herein. It can be readily isolated using the acetoacetyl-CoA thiolase gene as a hybridization probe, as described in U.S. Patent 5,661,026 to Peoples et al. This enzyme also has been purified (Haywood et al., FEMSMicro. Lett. 52:91 (1988)), and the 30 purified enzyme is useful for preparing antibodies or determining protein sequence information as a basis for the isolation of the gene.

Example 8: Plant ~i-Oxidation Gene The DNA sequence of the cDNA encoding (3-oxidation tetrafunctional protein, shown in SEQ ID N0:4, can be isolated as described in Preisig-Muller et al., J. Biol. Chem. 269:20475-8I (1994). The equivalent gene can be isolated from other plant species including Arabidopsis, Brassica, soybean, sunflower, and corn using similar procedures or by screening genomic libraries, many of which are commercially available, for example from Clontech Laboratories Inc., Palo Alto, California, USA. A
peroxisomal targeting sequence P-R-M was identified at the carboxy I O terminus of the protein. Constructs suitable for expressing in the plant cytosol can be prepared by PCR amplification of this gene using primers designed to delete this sequence.

SSQUENCB LISTING
<110> Metabolix, Inc.
<120> Modification of Fatty Acid Metabolism in Plants <130> MBX 024 <140>
<141>
<150> 60/077,107 <151> 1998-03-06 <160> 31 <170> PatentIn Ver. 2.0 <210> 1 <211> 2703 <212> DNA
<213> Saccharomyces <220>
<221> gene <222> (1)..(2703) <223> fox2 gene <400> 1 atgcctggaa atttatcctt caaagataga gttgttgtaa tcacgggcgc tggagggggc 60 ttaggtaagg tgtatgcact agcttacgca agcagaggtg caaaagtggt cgtcaatgat 120 ctaggtggca ctttgggtgg ttcaggacat aactccaaag ctgcagactt agtggtggat 180 gagataaaaa aagccggagg tatagctgtg gcaaattacg actctgttaa tgaaaatgga 240 gagaaaataa ttgaaacggc tataaaagaa ttcggcaggg ttgatgtact aattaacaac 300 gctggaatat taagggatgt ttcatttgca aagatgacag aacgtgagtt tgcatctgtg 360 ~w ~gtagatgttc atttgacagg tggctataag ctatcgcgtg°~c'tgettggcc ttatatgcgc 420 tctcagaaat ttggtagaat cattaacacc gcttcccctg ccggtctatt tggaaatttt 480 ggtcaagcta attattcagc agctaaaatg ggcttagttg gtttggcgga aaccctcgcg 540 aaggagggtg ecaaatacaa cattaatgtt aattcaattg cgccattggc tagatcacgt 600 atgacagaaa acgtgttacc accacatatc ttgaaacagt taggaccgga aaaaattgtt 660 cccttagtac tctatttgac acacgaaagt acgaaagtgt caaactccat ttttgaactc 720 gctgctggat tctttggaca gctcagatgg gagaggtctt ctggacaaat tttcaateca 780 gaccccaaga catatactcc tgaagcaatt ttaaataagt ggaaggaaat cacagactat 840 agggacaagc catttaacaa aactcagcat ccatatcaac tctcggatta taatgattta 900 atcaccaaag caaaaaaatt acctcccaat gaacaaggct cagtgsaaat caagtcgctt 960 tgcaacaaag tcgtagtagt tacgggtgca ggaggtggtc ttgggaagtc tcatgcaatc 1020 tggtttgcac ggtacggtgc gaaggtagtt gtaaatgaca tcaaggatcc tttttcagtt 1080 gttgaagaaa taaataaact atatggtgaa ggcacagcca ttccagattc ccatgatgtg 1140 gtcaccgaag ctcctctcat tatccaaact gcaataagta agtttcagag agtagacatc 1200 ttggtcaata acgctggtat tttgcgtgac aaatcttttt taaaaatgaa agatgaggaa 1260 tggtttgctg tcctgaaagt ccaccttttt tccacatttt cattgtcaaa agcagtatgg 1320 ccaatattta ecaaacaaaa gtctggattt attatcsata ctacttctac ctcaggaatt 1380 tatggtaatt ttggacaggc caattatgcc gctgcaaaag ccgccatttt aggattcagt 1440 aaaactattg cactggaagg tgccaagaga ggaattattg ttaatgttat cgctcctcat 1500 gcagaaacgg ctatgacaaa gactatattc tcggagaagg aattatcaaa ccactttgat 1560 gcatctcaag tetccccact tgttgttttg ttggcatctg sagaactaca aaagtattct 1620 ggaagaaggg ttattggcca attattcgaa gttggcggtg gttggtgtgg gcaaaccaga 1680 tggcaaagaa gttccggtta tgtttctatt aaagagacta ttgaaccgga agaaattaaa 1740 gaaaattgga accacatcac tgatttcagt cgcaacacta tcascccgag ctccacagag 1800 gagtcttcta tggcaacctt gcaagccgtg caaaaagcgc actcttcaaa ggagttggat 1860 gatggattat tcaagtacac taccaaggat tgtatcttgt acaatttagg acttggatgc 1920 acaagcaaag agcttaagta cacctacgag aatgatccag acttccaagt tttgcccacg 1980 ttcgccgtca ttccatttat gcaagctact gccacactag ctatggacaa tttagtcgat 2040 aacttcaatt atgcaatgtt actgcatgga gaacaatatt ttaagctctg cacgccgaca 2100 atgccaagta atggaactct aaagacactt gctaaacctt tacaagtact tgacaagaat 2160 ggtaaagccg ctttagttgt tggtggcttc gaaacttatg acattaaaac taagaaactc 2220 atagcttata acgaaggatc gttcttcatc aggggcgcac atgtacctcc agaaaaggaa 2280 gtgagggatg ggaaaagagc caagtttgct gtccaaaatt ttgaagtgcc acatggaaag 2340 gtaccagatt ttgaggcgga gatttctacg aataaagatc aagccgcatt gtacaggtta 2400 tctggcgatt tcaatccttt acatatcgat cccacgctag ccaaagcagt tsaatttcct 2460 acgccaattc tgcatgggct ttgtacatta ggtattagtg cgaaagcatt gtttgaacat 2520 tatggtccat atgaggagtt gaaagtgaga tttaccaatg ttgttttccc aggtgatact 2580 ctaaaggtta aagcttggaa gcaaggctcg gttgtcgttt ttcaaacaat tgatacgacc 2640 agaaacgtca ttgtattgga taacgccgct gtaaaactat cgcaggcaaa atctaaacta 2700 taa 2703 <210> 2 <211> 900 <212> PRT
<213> Saccharomyces <220>
<221> PEPTIDE
<2,22..> ~1) .,. (900) , .. . , . , ~ ., t <223> fox2 encoded polypeptide <400> 2 Met Pro Gly Asn Leu Ser Phe Lys Asp Arg Val Val Val Ile Thr Gly Ala Gly Gly Gly Lau Gly Lys Val Tyr Ala Leu Ala Tyr Ala Ser Arg Gly Ala Lys Val Val Val Asn Asp Leu Gly Gly Thr Leu Gly Gly Ser Gly His Asn Ser Lys Ala Ala Asp Leu Val Val Asp Glu Ile Lys Lys Ala Gly Gly Ile Ala Val Ala Asn Tyr Asp Ser Val Asn Glu Asn Gly Glu Lys Ile Ile Glu Thr Ala Ile Lys Glu Phe Gly Arg Val Asp Val Leu Ile Asn Asn Ala Gly Ile Leu Arg Asp Val Ser Phe Ala Lys Met Thr Glu Arg Glu Phe Ala Ser Val Val Asp Val His Leu Thr Gly Gly Tyr Lys Leu Ser Arg Ala Ala Trp Pro Tyr Mat Arg Ser Gln Lys Phe Gly Arg Ile Ile Asn Thr Ala Ser Pro Ala Gly Leu Phe Gly Asn Phe Gly Gln Ala Asn Tyr Ser Ala Ala Lys Met Gly Leu Val Gly Leu Ala Glu Thr Leu Ala Lys Glu Gly Ala Lys Tyr Asn Ile Asn Val Asn Ser Ile Ala Pro Leu Ala Arg Ser Arg Mat Thr Glu Asn Val Leu Pro Pro His Ile Leu Lys Gln Leu Gly Pro Glu Lys Ile Val Pro Leu Val Leu Tyr Leu Thr His Glu Ser Thr Lys Val Ser Asn Ser Ile Phe Glu Leu Ala Ala Gly Phe Phe Gly Gln Leu Arg Trp Glu Arg Ser Ser Gly Gln Ile Phe Asn Pro Asp Pro Lys Thr Tyr Thr Pro Glu Ala Ile Leu Asn Lys Trp Lys Glu Ile Thr Asp Tyr Arg Asp Lys Pro Phe Asn Lys Thr Gln His Pro Tyr Gln Leu Ser Asp Tyr Asn Asp Leu Ile Thr Lys Ala Lys Lys Leu Pro Pro Asn Glu Gln Gly Ser Val Lys Ile Lys Ser Leu Cys Asn Lys Val Val Val Val Thr Gly Ala Gly Gly Gly Leu Gly Lys Ser His Ala Ile Trp Phe Als Arg Tyr Gly Ala Lys Val Val Val Asn Asp Ile Lys Asp Pro Phe Ser Val Val Glu Glu Ile Aan Lys Leu Tyr Gly Glu Gly Thr Ala Ile Pro Asp Ser His Asp Val Val Thr Glu Ala Pro Leu Ile Ile Gln Thr Ala Ile Ser Lys Phe Gln Arg Val Asp Ile Leu Val Asn Asn Ala Gly Ile Leu Arg Asp Lys Sar Phe Leu Lys Met Lys Asp Glu Glu Trp Phe Ala Val Leu Lys Val His Leu Phe Ser Thr Phe Ser Leu Ser Lys Ala Val Trp Pro Ile Phe Thr Lys Gln Lys Ser Gly Phe Ile Ile Asn Thr Thr Ser Thr Ser Gly Ile Tyr Gly Aan Phe Gly Gln Ala Asn Tyr Ala Ala Ala Lys Ala Ala Ile Leu Gly Phe Ser Lys Thr Ile Ala Leu Glu Gly Ala Lys Arg Gly Ile Ile Val Asn Val Ile Ala Pro His Ala Glu Thr Ala Met Thr Lys Thr Ile Phe Ser Glu Lys Glu Leu Ser Asn His Phe Asp Ala Ser Gln Val Ser Pro Leu Val Val Leu Leu Ala Ser Glu Glu Leu Gln Lys Tyr Ser Gly Arg Arg Val Ile Gly Gln Leu Phe Glu Val Gly Gly Gly Trp Cys Gly Gln Thr Arg Trp Gln Arg Ser Ser Gly Tyr Val Ser Ile Lys Glu Thr Ile Glu Pro Glu Glu Ile Lys Glu Asn Trg Asn His Ile Thr Asp Phe Ser Arg Asn Thr Ile Asn Pro Ser Ser Thr Glu Glu Ser Ser Met Ala Thr Leu Gln Ala Val Gln Lys Ala His Ser Ser Lys Glu Leu Asp Asp Gly Leu Phe Lys Tyr Thr Thr Lys Asp Cys Ile Leu Tyr Asn Leu Gly Leu Gly Cys Thr Ser Lys Glu Leu Lys Tyr Thr Tyr Glu Asn Asp Pro Asp Phe Gln Val Leu Pro Thr Phe Ala Val Ile Pro Phe Met Gln Ala Thr Ala Thr Leu Ala Met Asp Asn Leu Val Asp Asn Phe Asn Tyr Ala Mat Leu Leu His Gly Glu Gln Tyr Phe Lys Leu Cys Thr Pro Thr Met Pro Ser Asn Gly Thr Leu Lys Thr Leu Ala Lys Pro Leu Gln Val Leu Asp Lys Asn Gly Lys Ala Ala Leu Val Val Gly Gly Phe Glu Thr Tyr Asp Ile Lys Thr Lys Lys Leu Ile Ala Tyr Asn Glu Gly Ser Phe Phe Ile Arg Gly Ala His Val Pro Pro Glu Lys Glu Val Arg Asp Gly Lys Arg Ala Lys Phe Ala Val Gln Asn Phe Glu Val Pro His Gly Lys Val Pro Asp Phe Glu Ala Glu Ile Ser Thr Asn Lys Asp Gln Ala Ala Leu Tyr Arg Leu Ser Gly Asp Phe Asn Pro Leu His Ile Asp Pro Thr Leu Ala Lys Ala Val Lys Phe Pro Thr Pro Ile Leu His Gly Leu Cys Thr Leu Gly Ile Ser Ala Lys Ala Leu Phe Glu His Tyr Gly Pro Tyr Glu Glu Leu Lys Val Arg Phe Thr Asn Val Val Phe Pro Gly Asp Thr Leu Lys Val Lys Ale Trp Lys Gln Gly Ser Val Val Val Phe Gln Thr Ile Asp Thr Thr Arg Asn Val Ile Val Leu Asp Asn Ala Ala Val Lys Leu Ser Gln Ala Lys Ser Lys Leu <210> 3 <211> 2177 <212> DNA
<213> Artificial Sequence <220>
<221> gene <222> (1)..(2177) <223> tetrafunctional beta-oxidation gene <220>
<223> Description of Artificial Sequence <400> 3 atgggaagca atgcaaaagg aagaacggta atggaggtgg gaactgatgg agtagcaata 60 atcaccatca tcaaccctcc agttaactcc ttgtcttttg atgtgttatt cagcctgaga 120 gatagttatg aacaagcctt'gagaagagat gatgtgaagg caattgttgt tacaggtgca 180 aagggaaaat tttctggtgg ctttgatata actgcttttg gtgtactcca aggaggaaag 240 ggggagcaac caaatgttag aaacatatca attgaaatga tcactgatat ttttgaagct 300 gcccgaaaac ctgcggttgc agcgatagat ggacttgctt tgggtggagg gttggaggtt 360 gccatggctt gtcatgctcg aatatcaact cctaccgctc aattagggtt gcctgaactt 420 cagctcggaa taattcctgg ttttggagga acacaacggc ttccacgtct tgttggtctc 480 tcaaaggccc tagaaatgat gttgacgtca aagccaatta aaggacaaga agctcattct 540 ttggggttag tggatgccat tgtccctccc gaagagttga tcaacactgc acgtagatgg 600 gctcttgaaa tcctagagcg gagaagacca tgggttcaca gtcttcacag gactgacaag 660 ttagagtctc ttgctgaggc taggaaaata tttaacttag ctagagctca ggcaaagaaa 720 cagtacccaa atcttaagca tacaattgcc tgcattgatg ctgttgaaac gggtgtcgtc 780 tctggccctc gtgctggact ttggaaggag gctgaagaat ttcagggact cctacattct 840 gatacttgca aaagcttaat tcatatcttc tttgcccagc gttcaacaac taaggtacct 900 ggagttactg atctgggttt ggtaccgaga caaatcaaga aagttgctat tgtcggagga 960 ggattaatgg gatctggtat agctacagca ttgattctta gcaactatca tgtggtactt 1020 aaagaagtga acgataagtt cttgcaggct ggcattgaca gagtcagagc aaacctacaa 1080 agccgagtca aaaaagggaa tatgactaat gagaaattcg aaasgagtat ttctttactc 1140 aagggagttc ttaactacga aagttttaaa gatgtagata tggtgataga ggctgttatt 1200 gagaatgttt ctttgaagca acaaatcttt tctgatcttg aaaaatattg ccccccacat 1260 tgcatgcttg ctactaatac ttccacaata gacttggagt tgattggaga gagaataaag 1320 tctcgtgaca ggattattgg aacagctgca caagtgattg ttgatctgct agatgttggg 1380 aagaatataa agaaaacacc agttgtcgtt ggaaattgta caggttttgc tgtcaacaga 1440 atgttttttc cctactctca ggctgcaatt ttacttgcag aacatggggt agatccctat 1500 cagattgaca gggctatttc caagtttgga atgccaatgg gacccttcag gttgtgcgac 1560 cttgttggtt ttggtgtggc agcagcaact gccagtcagt ttgttcaagc ttttccagaa 1620 agaacttata aatcgatgct aattcctctg atgcaagagg ataagaatgc aggtgaatcc 1680 actcgtaaag gtttctatgt ctatgacaag aaccgaaaag ctgggccaaa tccagagtta 1740 aagaaatata tcgagaaggc taggaacagt tctggtgttt cagttgatcc taagctcaca 1800 aagttacccg aaaaggacat tgtggagatg atatttttcc cagtggtgaa tgaagcatgt 1860 cgtgtccttg ccgaaggcat agcagtcaaa gcagctgacc tggacattgc tggtgtaatg 1920 ggaatgggtt tcccctccta cggggaggac tcatgttctg ggcggattct cttggatcaa 1980 attacatcta ttcaaggttg gaggaatggt cgaaacagta tggtggattt ttcaagccct 2040 gtggatactt agctgaaagg gctgttcagg gtgcaactct gagtgctccg ggtggccatg 2100 ctaaacctcg aatgtaagct catttcttta gtcctgctca catcatgccg ctattggaaa 2160 ttgtccgtac caagcat 2177 <210> 4 <211> 725 <212> PRT
<213> Cucumber <220>
<221> PEPTIDE
<222> (1)..(725) <223> tetrafunctional beta-oxidation protein <400> 4 Met Gly Ser Asn Ala Lys Gly Arg Thr Val Mat Glu Val Gly Thr Asp Gly Val Ala Ile Ile Thr Ile Ile Asn Pro Pro Val Asn Sar Leu Ser Phe Asp Val Lau Phe Ser Leu Arg Asp Sar Tyr Glu Gln Ala Leu Arg Arg Asp Asp Val Lys Ala Ile Val Val Thr Gly Als Lya Gly Lys Phe Ser Gly Gly Phe Asp Ile Thr Ala Phe Gly Val Leu Gln Gly Gly Lys Gly Glu Gln Pro Asn Val Arg Asn Ile Ser Ile Glu Met Ile Thr Asp Ile Phe Glu Ala Ala Arg Lys Pro Ala Val Ala Ala Ile Asp Gly Leu Ala Leu Gly Gly Gly Leu Glu Val Ala Met Ala Cys His Ala Arg Ile Ser Thr Pro Thr Ala Gln Leu Gly Leu Pro Glu Lau Gln Leu Gly Ile Ile Pro Gly Phe Gly Gly Thr Gln Arg Lau Pro Arg Leu Val C~ly Leu Ser Lys Ala Leu Glu Met Met Leu Thr Ser Lys Pro Ile Lys Gly Gln Glu Ala His Ser Leu Gly Leu Val Asp Ala Ile Val Pro Pro Glu Glu Leu Ile Asn Thr Ala Arg Arg Trp Ala Leu Glu Ile Leu Glu Arg Arg Arg Pro Trp Val His Ser Leu His Arg Thr Asp Lys Leu Glu Ser Leu Ala Glu Ala Arg Lys Ile Phe Asn Lau Ala Arg Ala Gln Ala Lys Lys Gln Tyr Pro Aan Leu Lys His Thr Ile Ala Cys Ile Asp Ala Val Glu Thr Gly Val Val Sar Gly Pro Arg Ala Gly Leu Trp Lys Glu Ala Glu 260 265 270' Glu Phe Gln Gly Leu Leu His Ser Asp Thr Cys Lys Ser Leu Ile His Ile Phe Phe Ala Gln Arg Ser Thr Thr Lys Val Pro Gly Val Thr Asp Leu Gly Leu Val Pro Arg Gln Ile Lys Lys Val Ala Ile Val Gly Gly Gly Leu Met Gly Ser Gly Ile Ala Thr Ala Leu Ile Leu Ser Asn Tyr His Val Val Leu Lys Glu Val Asn Asp Lys Phe Leu Gln Ala Gly Ile Asp Arg Val Arg Ala Asn Leu Gln Sar Arg Val Lys Lys Gly Asn Met Thr Asn Glu Lys Phe Glu Lys Ser Ile Ser Leu Leu Lys Gly Val Leu Asn Tyr Glu Ser Phe Lys Asp Val Asp Mat Val Ile Glu Ala Val Ile Glu Asn Val Ser Leu Lys Gln Gln Ile Phe Ser Asp Leu Glu Lys Tyr Cys Pro Pro His Cys Mat Leu Ala Thr Asn Thr Ser Thr Ile Asp Leu Glu Leu Ile Gly Glu Arg Ile Lys Ser Arg Asp Arg Ile Ile Gly His Thr Ala Ala Gln Val Ile Val Asp Leu Leu Asp Val Gly Lys Asn Ile Lys Lys Thr Pro Val Val Val Gly Asn Cys Thr Gly Phe Ala Val Asn Arg Met Phe Phe Pro Tyr Ser Gln Ala Ala Ile Leu Leu Ala Glu His Gly Val Asp Pro Tyr Gln Ile Asp Arg Ala Ile Ser Lys Phe Gly Met Pro Met Gly Pro Phe Arg Leu Cys Asp Leu Val Gly Phe Gly Val Ala Ala Ala Thr Ala Ser Gln Phe Val Gln Ala Phe Pro Glu Arg Thr Tyr Lys Ser Met Leu Ile Pro Leu Met Gln Glu Asp Lys Asn Ala Gly Glu Ser Thr Arg Lys Gly Phe Tyr Val Tyr Asp Lys Asn Arg Lys Ala Gly Pro Asn Pro Glu Leu Lys Lys Tyr Ile Glu Lys Ala Arg Asn Ser Ser Gly Val Ser Val Asp Pro Lys Leu Thr Lys Leu Pro Glu Lys Asp Ile Val Glu Met Ile Phe Phe Pro Val Val Asn Glu Ala Cys Arg Val Leu Ala Glu Gly Ile Ala Val Lys Ala Ala Asp Leu Asp Ile Ala Gly Val Met Gly Met Gly Phe Pro Ser Tyr Arg Gly Gly Leu Met Phe Trp Ala Asp Ser Leu Gly Ser Asn Tyr Ile Tyr Ser Arg Leu Glu Glu Trp Ser Lys Gln Tyr Gly Gly Phe Phe Lys Pro Cys Gly Tyr Leu Ala Glu Arg Ala Val Gln Gly Ala Thr Leu Ser Ala Pro Gly Gly His Ala Lys Pro Arg Mat Ala His Phe Phe Sar Pro Ala His Ile Met Pro Leu Leu Glu Ile Val Arg Thr Lys <210> 5 <211> 21 <212> DNA
<213> Artificial Sequence <220>
,. .~ . <223> Description of Artificial Sequence:
oligonucleotide primer- Primer 1 <400> 5 gatgggccgc tccaagggtg g 21 <210> 6 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Seguence:

oligonucleotide primer- Primer 2 <400> 6 caacccgaag gtgccgccat t 21 <210> 7 <211> 3907 <212> DNA
<213> Pseudomonas putida <220>
<221> gene <222> (1)..(3907) <223> faoAB gene sequeace <400> 7 gatggcgttt ttactgaaaa tttgcctccg gccatagaat ctcctacggg ggcatccagg 60 ctggtcaatc tgttctgtaa cgacaaagcg gcggctcggc ataaccctga aggggtgggg 120 tgccaagtcg ccgctttgcg ttctgctgcg cagaaaaggc caggcaggcc gggttattca 180 ttcaagcaag tgccagtgta gtcgccttgg ctcttcgcga agcgcaaagc aataagccga 240 tgcttgtggt caatcgctga catgaatgac cggcgatcac tgtcatcatg ttttgtaccc 300 ggacgataga aaatgactgg aaagtcgcgt tttcgccgtg ctcgtgagca tttgacaacg 360 cccatctttt cggagaatgt gtgcacaccc aaatcaaacg ggcgtatgaa ttgagcgttt 420 gtatgtcatg acgccaagcc atacttccga ctagcgcgct gacgggtgtg cctggggcaa 480 ggcagcttag gcctgcttct gctgcagcga tcggcgtgta cagttcagct tccatatcgt 540 ggagatcagt tgatgattta cgaaggtaaa gccatcacgg ttaaggctct tgaaagtggc 600 atcgtcgagc tcaagttcga cctcaagggt gagtccgtca acaagttcaa ccgccttacc 660 ctgaacgagc tgcgccaggc cgtcgatgcc atccgggccg atgcttcggt caagggcgtg 720 atcgtcagga gtggcaagga cgtgttcatc gtcggcgccg acatcaccga gttcgtcgac 780 aacttcaagc tgcctgaggc cgaactggtc gctggcaacc tggaagccaa tcgcatcttc 840 aacgcgttcg aagacctcga agtgccgacc gttgccgcca tcaacggcat cgcgctgggc 900 ggcggcctgg aaatgtgcct ggcggccgac taccgggtca tgtccaccag cgccaggatc 960 ggcctgccgg aagtcaagct gggtatctac ccgggctttg gcggtaccgt gcgcctgccg 1020 cgcctgatcg gctcggacaa cgccatcgag tggatcgccg ccggcaagga aaaccgtgcc 1080 gaagatgccc tgaaagtggg ggccgtcgac gccgtggtcg cccctgagct gctgctggcc 1140 w ° ggtgccctcg'-'acctgatcaa gcgtgccatc agtggcgagc 'tgg~ctacaa ggccaagcgc 1200 cagccgaagc tggaaaagct caagctcaat gccatcgagc agatgatggc cttcgagact 1260 gccaagggct tcgtcgctgg ccaggccggc ccgaactacc cggccccggt cgaagcgatc 1320 aagagcatcc agaaagccgc caacttcggt cgcgacaagg ccctggaagt cgaagccgca 1380 ggctttgcca agctggccaa gacctctgtc gccgagagcc tgatcggctt gttcctcaac 1440 gatcaggaac tcaagcgcaa ggccaaggcg catgacgaga tcgcccacga cgtgaagcag 1500 gccgccgtgc tcggcgccgg catcatgggc ggcggtatcg cctaccagtc ggcggtcaaa 1560 ggtacgccga tcctgatgaa ggacatccgc gaggaagcca ttcagctggg tctgaacgag 1620 gcctccaagt tgcttggcaa ccgcgtcgag aagggccgcc tgaccccggc caagatggcc 1680 gaggccctca acgccattcg cccgaccctg tcctatggcg atttcgccaa tgtcgacatc 1740 gtcgtcgagg ctgtggtcga gaacccgaag gtcaagcaag cggtactggc ggaagtggaa 1800 ggccaggtga aggacgatgc gatcctcgct tccaacacct ctaccatctc catcaacctg 1860 ctggccaagg cgctcaagcg cccggaaaac ttcgtcggca tgcacttctt caacccggtg 1920 il cacatgatgc cgctggttga agtgatccgt ggcgagaagt ccagtgacgt ggcggtcgcc 1980 accaccgtgg cctacgccaa gaaaatgggc aagaacccga tcgtggtcaa cgactgcccg 2040 ggctttttgg tcaaccgcgt gctgttcccg tactttggcg gttttgccaa gctggtcagc 2100 gccggtgtcg acttcgtgcg catcgacaag gtcatggaga agttcggctg gccgatgggc 2160 ccagcctact tgatggacgt ggtcggcatc gacaccggcc accacggccg tgacgtcatg 2220 gccgaaggct tcccggatcg catgaaggac gagcgccgct cggcagtcga cgcgttgtac 2280 gaggccaacc gcctgggcca gaagaacggt aagggcttct acgcctacga aaccgacaag 2340 cgcggcaagc cgaagaaggt cttcgatgcc sccgtgctcg acgtgctcaa accgatcgtg 2400 ttcgagcagc gtgaagtcac tgacgaagac atcatcaact ggatgatggt cccgctgtgc 2460 cttgagaccg tgcgttgcct ggaagacggc atcgtcgaaa ccgctgccga agccgacatg 2520 ggcctggtct acggcattgg tttccctccc ttccgcggtg gtgcgctgcg ttacatcgac 2580 tcgatcggtg tggccgaatt cgtcgccctg gccgatcagt atgccgacct ggggccgctg 2640 taccacccga ccgccaagct gcgtgaaatg gccaagaacg gccagcgctt cttcaactga 2700 gcggtcaacg agctagagcg agagatttga tatgagcctg aatccaagag acgtggtgat 2760 tgtcgacttc ggtcgcacgc caatgggccg ctccaagggt ggcatgcacc gcaacacccg 2820 cgccgaagac atgtcggcgc acctgatcag caagctgctg gaacgcaacg gcaaggtcga 2880 cccgaaagaa gtcgaggacg tgatctgggg ctgcgtcaac cagaccctgg agcagggctg 2940 gaacatcgcc cgcatggctt cgctgatgac cccgatcccg cacacctctg cggcgcagac 3000 cgtcagccgc ctgtgcggct cgtccatgag cgcgctgcac acggccgccc aggcgatcat 3060 gaccggtaac ggtgatgtgt tcgtggtcgg tggcgtggag cacatgggcc acgtcagcat 3120 gatgcatggc gtagacccca acccgcacct gtccttgcat gccgccaagg cttccgggat 3180 gatgggcctg actgcagaaa tgctcggcaa gatgcacggc atcacccgtg agcagcagga 3240 cctgttcggc ttgcgttcgc accagctggc ccacaaggcc acggtcgaag gcaagttcaa 3300 ggacgagatc atcccgatgc agggctacga cgagaacggc ttcctgaagg tgttcgattt 3360 cgacgaaacc attcgcccgg aaaccaccct cgaaggcctg gcatcgctca agcctgcgtt 3420 caacccgaaa ggcggtacgg tcacggccgg tacctcgtcg cagatcaccg acggcgcctc 3480 gtgcatgatc gtcatgtccg gtcagcgtgc catggacctc ggtatccagc cattggcggt 3540 gatccgttcg atggcagtgg ccggtgtcga cccggcaatc atgggctacg gcccggtgcc 3600 atcgacccag aaagccctca agcgtgcggg cttgaccatg gccgatatcg acttcatcga 3660 gctcaacgaa gccttcgctg cgcaggccct gcccgtgctg aaagacttga aagtgctcga 3720 caagatggat gagaaggtta acctgcacgg cggcgccatt gctttgggcc acccgttcgg 3780 ttgctccggg gcgcggattt ccggcaccct gctcaacgtc atgaagcaaa atggcggtac 3840 gctgggtgtt gcgaccatgt gcgtcggcct gggccaaggt atcaccactg tcttcgaacg 3900 cgtctga 3907 <210> g _ , ...~.. _", .. ... . ._ . ,.
<211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence oligonucleotide primer- Primer (iVR471 <400> 8 cggtacccat tgtactccca gtatcat 27 <210> 9 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
oligonucleotide primer- Primer GVR472 <400> 9 catttaaata gtagagtatt gaatatg 27 <210> 10 <211> 1558 <212> DNA
<213> Bean Phaseolin <220>
<221> promoter <222> (1)..(1558) <400> 10 cggtacccat tgtactccca gtatcattat agtgaaagtt ttggctctct cgccggtggt 60 tttttacctc tatttaaagg ggttttccac ctaaaaattc tggtatcatt ctcactttac 120 ttgttacttt aatttctcat aatctttggt tgaaattatc acgcttccgc acacgatatc 180 cctacaaatt tattatttgt taaacatttt caaaccgcat aaaattttat gaagtcccgt 240 ctatctttaa tgtagtctaa cattttcata ttgaaatata taatttactt aattttagcg 300 ttggtagaaa gcataaagat ttattcttat tcttcttcat ataaatgttt aatatacaat 360 ataaacaaat tctttacctt aagaaggatt tcccatttta tattttaaaa atatatttat 420 caaatatttt tcaaccacgt aaatctcata ataataagtt gtttcaaaag taataaaatt 480 taactccata atttttttat tcgactgatc ttsaagcaac acccagtgac acaactagcc 540 atttttttct ttgaataaaa aaatccaatt atcattgtat tttttttata caatgaaaat 600 ttcaccaaac aatcatttgt ggtatttctg aagcaagtca tgttatgcaa aattctataa 660 ttcccatttg acactacgga agtaactgaa gatctgcttt tacatgcgag acacatcttc 720 taaagtaatt ttaataatag ttactatatt caagatttca tatatcaaat actcaatatt 780 acttctaaaa aattaattag atataattaa astattactt ttttaatttt aagtttaatt 840 --~.f gttgaatttg tgactattgart~ttattattc tactatgttt aaattgtttt atagatagtt'900 taaagtaaat ataagtaatg tagtagagtg ttagagtgtt accctaaacc ataaactata 960 acatttatgg tggactaatt ttcatatatt tcttattgct tttacctttt cttggtatgt 1020 aagtccgtaa ctagaattac agtgggttgc catggcactc tgtggtcttt tggttcatgc 1080 atgggtcttg cgcaagaaaa agacaaagaa caaagaaaaa agacaaaaca gagagacaaa 1140 acgcaatcac acaaccaact caaattagtc actggctgat caagatcgcc gcgtccatgt 1200 atgtctaaat gccatgcaaa gcaacacgtg cttaacatgc actttaaatg gctcacccat 1260 ctcaacccac acacaaacac attgcctttt tcttcatcat caccacaacc acctgtatat 1320 attcattctc ttccgccacc tcaatttctt cacttcaaca cacgtcaacc tgcatatgcg 1380 tgtcatccca tgcccaaatc tccatgcatg ttccaaccac cttctctctt atataatacc 1440 tataaatacc tctaatatca ctcacttctt tcatcatcca tccatccaga gtactactac 1500 tctactacta taatacccca acccaactca tattcaatac tactctacta tttaaatg 1558 <210>11 <211>983 <212>DNA

<213>Soybean oleosin <220>
<221> promoter <222> (1)..(983) <400> 11 tctagataca tccatttctt aatataatcc tcttattcaa attgcaattg cccagatctc 60 tgtatggact atggctcgag gaatccatac atagagacat tecccactcg tatacttgta 120 tctgtcaaat gcctattgtt gttgaaataa agtaacttat gcatcaattt aaaacaatca 180 gttaggtaat ggacattaat gtaaagtgac ttatagaatc catatttgta taacaaagat 240 gttgagacat tgactattgt gtgctatttc aaaaagatct gataaaatat ttaataaaac 300 attaaaagta aataataatc gctaaacatc atcaaaatat taatcattag attcaatttt 360 tgcaattaaa accagaagaa ctaaatctac attaccatac ttaagactat acatagagaa 420 ttaaacttaa tgttatattt aaggaaaagg acgaaactta naacttaaat acaattgtat 480 gattaatttt agtattgtct ttaatgagaa ttaaagtttt attcactaat ttatgattat 540 ttcatttact aatttatgta atgtgatttc aataagtgag gtsaactccg attgattgaa 600 gataccacca acaccaacac caccaccacc tgcgaaactg tacgtatctc aattgtcctt 660 aataaaaatg taaatagtac attattctcc ttgcctgtca ttatttatgt gcccccagct 720 ttaatttttc tgatgtactt aacccagggc aaactgaaac atgttcctca tgcasagccc 780 caactcatca tgcatcatgt acgtgtcatc atccagcaac tccacttttg ctatataact 840 cctcccccat cacactcccc atctctctaa cacacacata cccccaacta acaataattc 900 cttcacttgc agaacttagt tctctgttgc atcatcatca tcttcattag tgttagccct 960 aacttcacct taaccattta atg 983 <210> 12 <211> 38 <212> DNA
<213> Artificial Seguence <220>
<223> Description of Artificial Sequence:
< , ... ,. " a ~, oligonucleotide primer- Primer JA408 , _ . . . s , " . . _ ".. , ... . . :. ., <400> 12 tctagataca tccatttett aatataatcc tcttattc 38 <210> 13 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
oligonucleotide primer- npl <400> 13 catttaaatg gttaaggtga aggtagggct 30 <210> 14 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequences oligonucleotide primer- Primer apt <400> 14 aagcttaaaa tgatttacga aggtaaagcc 30 <210> 15 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
oligonucleotide primer- Primer np3 <400> 15 attgctttca gttgaagcgc tg 22 <210> 16 <211> 30 <212> DNA
<213> Artificial Sequence <a2o>
<223> Description of Artificial Sequence:
,.":, : . , of gonucleotide primer- Primer ap4 . . ~ , ,. , . . . . . .
<400> 16 aagcttaaaa tgagcctgaa tccaagagac 30 <210>17 <211>28 <212>DNA

<213>Artificial Sequence <220>
<223> Description of Artificial Sequence:
oligonucleotide primer- Primer np5 <400> 17 aagctttcag acgcgttcga agacagtg 28 <210> 18 <211> 56 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
oligonucleotide primer- Primer N-fox2b <400> 18 tcccccggga ggaggttttt attatgcctg gaaatttatc cttcaaagat agagtt 56 <210> 19 <211> 29 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequences oligonucleotide primer- Primer N-bamfox2b <400> 19 aaggatcctt gatgtcattt acaactacc 29 <210> 20 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
oligonucleotide primer- Primer C-fox2~ 't,~'e" , ~ ~ ' ~ .
<400> 20 gctctagata gggaaagatg tatgtaag 28 <210> 21 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
oligonucleotide primer- Primer C-bamfox2 WO 99/45122 PC'T/US99/04999 <400> 21 tgacatcaag gatcctttt 19 <210> 22 <211> 39 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
oligonucleotide primer- Primer CiVR396 <400> 22 gatttaaatg caagcttaaa taagtatgaa ctaaaatgc 39 <210> 23 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequences oligonucleotide primer- Primer G1VR397 <400> 23 cggtacctta gttggtaggg tgcta 25 <210> 24 <211> 2162 <212> DNA
<213> Pseudomonas putida <220>
<221> gene <222> (1) .. (216-2) . , ~ ,..,. . , <223> FaoA gene sequence <400> 24 aagcttaaat gatttacgaa ggtaaagcca tcacggttaa ggctcttgaa agtggcatcg 60 tcgagctcaa gttcgacctc aagggtgagt ccgtcaacaa gttcaaccgc cttaccctga 120 acgagctgcg ccaggccgtc gatgccatcc gggccgatgc ttcggtcaag ggcgtgatcg 180 tcaggagtgg caaggacgtg ttcatcgtcg gcgccgacat caccgagttc gtcgacaact 240 tcaagctgcc tgaggccgaa ctggtcgctg gcaacctgga agccaatcgc atcttcaacg 300 cgttcgaaga cctcgaagtg ccgaccgttg ccgccatcaa cggcatcgcg ctgggcggcg 360 gcctggaaat gtgcctggcg gccgactacc gggtcatgtc caccagcgcc aggatcggcc 420 tgccggaagt caagctgggt atctacccgg gctttggcgg taccgtgcgc ctgccgcgcc 480 tgatcggctc ggacaacgcc atcgagtgga tcgccgccgg caaggaaaac cgtgccgaag 540 atgccctgaa agtgggggcc gtcgacgccg tggtcgcccc tgagctgctg ctggccggtg 600 ccctcgacct gatcaagcgt gccatcagtg gcgagctgga ctacaaggccwaagcgccagc 660 cgaagctgga aaagctcaag ctcaatgcca tcgagcagat gatggccttc gagactgcca 720 agggcttcgt cgctggccag gccggcccga actacccggc cccggtcgaa gcgatcaaga 780 gcatccagaa agccgccaac ttcggtcgcg acaaggccct ggaagtcgaa gccgcaggct 840 ttgccaagct ggccaagacc tctgtcgccg agagcctgat cggcttgttc ctcaacgatc 900 aggaactcaa gcgcaaggcc aaggcgcatg acgagatcgc ccacgacgtg aagcaggccg 960 ccgtgctcgg cgccggcatc atgggcggcg gtatcgccta ccagtcggcg gtcaaaggta 1020 cgccgatcct gatgaaggac atccgcgagg aagccattca gctgggtctg aacgaggcct 1080 ccaagttgct tggcaaccgc gtcgagaagg gccgcctgac cccggccaag atggccgagg 1140 ccctcaacgc cattcgcccg accctgtcct atggcgattt cgccaatgtc gacatcgtcg 1200 tcgaggctgt ggtcgagaac ccgaaggtca agcaagcggt actggcggaa gtggaaggcc 1260 aggtgaagga cgatgcgatc ctcgcttcca acacctctac catctccatc aacctgctgg 1320 ccaaggcgct caagcgcccg gaaaacttcg tcggcatgca cttcttcaac ccggtgcaca 1380 tgatgccgct ggttgaagtg atccgtggcg agaagtccag tgacgtggcg gtcgccacca 1440 ccgtggccta cgccaagaaa atgggcaaga acccgatcgt ggtcaacgac tgcccgggct 1500 ttttggtcaa ccgcgtgctg ttcccgtact ttggcggttt tgccaagctg gtcagcgccg 1560 gtgtcgactt cgtgcgcatc gacsaggtca tggagaagtt cggctggccg atgggcccag 1620 cctacttgat ggacgtggtc ggcatcgaca ccggccacca cggccgtgac gtcatggccg 1680 aaggcttccc ggatcgcatg aaggacgagc gccgctcggc agtcgacgcg ttgtacgagg 1740 ccaaccgcct gggccagaag aacggtaagg gcttctacgc ctacgaaacc gacaagcgcg 1800 gcaagccgaa gaaggtcttc gatgccaccg tgctcgacgt gctcaaaccg atcgtgttcg 1860 agcagcgtga agtcactgac gaagacatca tcaactggat gatggtcccg ctgtgccttg 1920 agaccgtgcg ttgcctggaa gacggcatcg tcgsaaccgc tgccgaagcc gacatgggcc 1980 tggtctacgg cattggtttc cctcccttcc gcggtggtgc gctgcgttac atcgactcga 2040 tcggtgtggc cgaattcgtc gccctggccg atcagtatgc cgacctgggg ccgctgtacc 2100 acccgaccgc caagctgcgt gaaatggcca agaacggcca gcgcttcttc aactgaaagc 2160 tt 2162 <210> 25 <211> 1190 <212> DNA
<213> Pseudomonas putida <220>
<221> gene .
<222> (1)..(1190) <223> FaoB gene sequence <400> 25 aagcttaaat gagcctgaat ccaagagacg tggtgattgt cgacttcggt cgcacgccaa 60 tgggccgctc caagggtggc atgcaccgca acacccgcgc cgaagacatg tcggcgcacc 120 tgatcagcaa gctgctggaa cgcaacggca aggtcgaccc gaaagaagtc gaggacgtga 180 tctggggctg cgtcaaccag accctggagc agggctggaa catcgcccgc atggcttcgc 240 tgatgacccc gatcccgcac acctctgcgg cgcagaccgt cagccgcctg tgcggctcgt 300 ccatgagcgc gctgcacacg gccgcccagg cgatcatgac cggtaacggt gatgtgttcg 360 tggtcggtgg cgtggagcac atgggccacg tcagcatgat gcatggcgta gaccccaacc 420 cgcacctgtc cttgcatgcc gccaaggctt ccgggatgat gggcctgact gcagaaatgc 480 tcggcaagat gcacggcatc acccgtgagc agcaggacct gttcggcttg cgttcgcacc 540 agctggccca caaggccacg gtcgaaggca agttcaagga cgagatcatc~ccgatgcagg 600 gctacgacga gaacggcttc ctgaaggtgt tcgatttcga cgaaaccatt cgcccggaaa 660 ccaccctcga aggcctggca tcgctcaagc ctgcgttcaa cccgaaaggc ggtacggtca 720 cggccggtac ctcgtcgcag atcaccgacg gcgcctcgtg catgatcgtc atgtccggtc 780 agcgtgccat ggacctcggt atccagccat tggcggtgat ccgttcgatg gcagtggccg 840 gtgtcgaccc ggcaatcatg ggctacggcc cggtgccatc gacccagaaa gccctcaagc 900 gtgcgggctt gaccatggcc gatatcgact tcatcgagct caacgaagcc ttcgctgcgc 960 aggccctgcc cgtgctgaaa gacttgaaag tgctcgacsa gatggatgag aaggttaacc 1020 tgcacggcgg cgccattgct ttgggccacc cgttcggttg ctccggggcg cggatttccg 1080 gcaccctgct caacgtcatg aagcaaaatg gcggtacgct gggtgttgcg accatgtgcg 1140 tcggcctggg ccaaggtatc accactgtct tcgaacgcgt ctgaaagctt 1190 <210> 26 <211> 391 <212> PRT
<213> Pseudomonas putida <220>
<221> P$PTID$
<222> (1) .. (391) <223> FaoB amino acid sequence <400> 26 Met Ser Leu Asn Pro Arg Asp Val Val Ile Val Asp Phe Gly Arg Thr Pro Met Gly Arg Ser Lys Gly Gly Mat His Arg Asn Thr Arg Ala Glu Asp Mat Ser Ala His Leu Ile Ser Lys Leu Leu Glu Arg Asn Gly Lys Val Asp Pro Lys Glu Val Glu Asp Val Ile Trp Gly Cys Val Asn Gln Thr Leu Glu Gln Gly Trp Asa Ile Ala Arg Met Ala Ser Leu Met Thr Pro Ile Pro His Thr Ser Ala Ala Gln Thr Val Ser Arg Leu Cys Gly Ser Ser Mat Ser Ala Leu His Thr Ala Ala Gln Ala Ile Met Thr Gly Asn Gly Asp Val Phe Val Val Gly Gly Val Glu His Met Gly His Val Ser Mat Met His Gly Val Asp Pro Asn Pro His Leu Ser Leu His Ala Ala Lys Ala Ser Gly Met Met Gly Leu Thr Ala Glu Met Leu Gly Lys Met His Gly Ile Thr Arg Glu Gln Gln Asp Leu Phe Gly Leu Arg Ser His Gln Lau Ala His Lys Ala Thr Val Glu Gly Lys Phe Lys Asp Glu Ile Ile Pro Met Gln Gly Tyr Asp Glu Asn Gly Phe Lau Lys Val Phe Asp Phe Asp Glu Thr Ile Arg Pro Glu Thr Thr Leu Glu Gly Leu Ala Ser Leu Lys Pro Ala Phe Asn Pro Lys Gly Gly Thr Val Thr Ala Gly Thr Ser Ser Gln Ile Thr Asp Gly Ala Ser Cys Mat Ile Val Met Ser Gly Gln Arg Ala Met Asp Leu Gly Ile Gln Pro Leu Ala Val Ile Arg Ser Met Ala Val Ala Gly Val Asp Pro Ala Ile Met Gly Tyr Gly Pro Val Pro Ser Thr Gln Lys Ala Leu Lys Arg Ala Gly Leu Thr Met Ala Aap Ile Asp Phe Ile Glu Leu Asn Glu Ala Phe Ala Als Gln Ala Leu Pro Val Leu Lys Asp Leu Lys Val Leu Asp Lys Met Asp Glu Lys Val Asn Leu His Gly Gly Ala Ile Ala Leu Gly His Pro Phe Gly Cys Ser Gly Ala Arg Ile Ser Gly Thr Leu Leu Asn Val Met Lys Gln Asn Gly Gly Thr Leu Gly Val Ala Thr Mat Cys Val Gly Leu Gly Gln Gly Ile Thr Thr Val Phe Glu Arg Val <210> 27 <211> 1244 <212> DNA
<213> Bean Phaseolin <220>
<221> termiaator <222> (1)..(1244) <400> 27 gatttaaatg caagcttaaa taagtatgaa ctaaaatgca tgtaggtgta agagctcatg 60 gagagcatgg aatattgtat ccgaccatgt aacagtataa taactgagct ccatctcact 120 tcttctatga ataaacaaag gatgttatga tatattaaca ctctatctat gcaccttatt 180 gttctatgat aaatttcctc ttattattat aaatcatctg aatcgtgacg gcttatggaa 240 tgcttcaaat agtacaaaaa caaatgtgta ctataagact ttctaaacaa ttctaacttt 300 agcattgtga acgagacata agtgttaaga agacataaca attataatgg aagaagtttg 360 tctccattta tatattatat attacccact tatgtattat attaggatgt taaggagaca 420 taacaattat aaagagagaa gtttgtatcc atttatatat tatatactac ccatttatat 480 attatactta tccacttatt taatgtcttt ataaggtttg atccatgata tttetaatat 540 tttagttgat atgtatatga aagggtacta tttgaactct cttactctgt ataaaggttg 600 gatcatcctt aaagtgggtc tatttaattt tattgcttct tacagataaa aaaaaaatta 660 tgagttggtt tgataaaata ttgaaggatt taaaataata ataaataata aataacatat 720 aatatatgta tataaattta ttataatata acatttatct ataaaaaagt aaatattgtc 780 ataaatctat acaatcgttt agccttgctg gacgactctc aattatttaa acgagagtaa 840 acatatttga ctttttggtt atttaacaaa ttattattta acactatatg aaattttttt 900 tttttatcgg caaggaaata aaattaaatt aggagggaca atggtgtgtc ccaatcctta 960 tacaaccaac ttccacagga aggtcaggtc ggggacaaca aaaaaacagg caagggaaat 1020 tttttaattt gggttgtctt gtttgctgca taatttatgc agtaaaacac tacacataac 1080 ccttttagca gtagagcaat ggttgaccgt gtgcttagct tcttttattt tattttttta 1140 tcagcaaaga ataaataaaa taaaatgaga cacttcaggg atgtttcaac ccttatacaa 1200 aaccccaaaa acaagtttcc tagcacccta ccaactaagg tacc 1244 <210> 28 <211> 225 <212> DNA
<213> Soybean oleosin <220>
<221> tex~iaator <222> (1)..(225) <400> 28 aagcttacgt gatgagtatt aatgtgttgt tatgaactta tgatgttggt ttatgtgggg 60 aaataaatga tgtatgtacc tcttcttgcc tatgtagtag gtttgggtgt tttgttgtct 120 agctttgctt atttagtaat tagtagaagg gatgttcgtt cgtgtctcat aaaaaggggt 180 actaccactc tggcaatgtg atttgtattt gatgaattgt ctaga 225 <210> 29 <211> 34 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
oligonucleotide primer- Primer JA410 <400> 29 aagcttacgt gatgagtatt aatgtgttgt tatg 34 <210> 30 <211> 34 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
oligonucleotide primer- Primer JA411 <400> 30 tctagacaat tcatcaaata caaatcacat tgcc 34 <210> 31 <211> 715 <212> PRT
<213> Pseudomonas putida <220>
<221> PgPTIDE
<222> (1) . . (715) <223> FaoA amino acid sequence <400> 31 Mat Ile Tyr Glu Gly Lys Ala Ile Thr Val Lys Ala Leu Glu Ser Gly Ile Val Glu Leu Lys Phe Asp Leu Lys Gly Glu Ser Val Asn Lys Phe Asn Arg Lau Thr Leu Asn Glu Leu Arg Gln Ala Val Asp Ala Ile Arg Ala Asp Ala Ser Val Lys Gly Val Ile Val Arg Ser Gly Lys Asp Val Phe Ile Val Gly Ala Asp Ile Thr Glu Phe Val Asp Asn Phe Lys Leu Pro Glu Ala Glu Leu Val Ala Gly Asn Leu Glu Ala Asn Arg Ile Phe Asn Ala Phe Glu Asp Leu Glu Val Pro Thr Val Ala Ala Ile Asn Gly Ile Ala Leu Gly Gly Gly Leu Glu Met Cys Leu Ala Ala Aap Tyr Arg Val Mat Ser Thr Ser Ala Arg Ile Gly Leu Pro Glu Val Lys Leu Gly Ile Tyr Pro Gly Phe Gly Gly Thr Val Arg Leu Pro Arg Leu Ile Gly Ser Asp Asn Ala Ile Glu Trp Ile Ala Ala Gly Lys Glu Asn Arg Ala Glu Asp Ala Leu Lys Val Gly Ala Val Asp Ala Val Val Ala Pro Glu Leu Leu Leu Ala Gly Ala Leu Asp Leu Ile Lys Arg Ala Ile Ser Gly Glu Leu Asp Tyr Lys Ala Lys Arg Gln Pro Lys Leu Glu Lys Leu Lys Leu Asn Ala Ile Glu Gln Met Met Ala Phe Glu Thr Ala Lys Gly Phe wVal-Ala~Gly Gln Ala Gly Pro Asn Tyr Pro Ala Pro Val Glu Ala Ile Lys Ser Ile Gln Lys Ala Als Asn Pha Gly Arg Asp Lys Ala Leu Glu Val Glu Ala Ala Gly Phe Ala Lys Leu Ala Lys Thr Ser Val Ala Glu Ser Leu Ile Gly Leu Phe Leu Asn Asp Gln Glu Leu Lys Arg Lys Ala Lys Ala His Asp Glu Ile Ala His Asp Val Lys ~Gln Ala Ala Val Leu Gly Ala Gly Ile Met Gly Gly Gly Ile Ala Tyr Gln Ser Ala Val Lys Gly Thr Pro Ile Leu Mat Lys Asp Ile Arg Glu Glu Ala Ile Gln Leu Gly Leu Asn Glu Ala Ser Lys Leu Leu Gly Asn Arg Val Glu Lys Gly Arg Leu Thr Pro Ala Lys Met Ala Glu Ala Leu Asn Ala Ile Arg Pro Thr Leu Ser Tyr Gly Asp Phe Ala Asn Val Asp Ile Val Val Glu Ala Val Val Glu Asn Pro Lys Val Lys Gln Ala Val Leu Ala Glu Val Glu Gly Gln Val Lys Asp Asp Ala Ile Leu Ala Ser Asn Thr Ser Thr Ile Ser Ile Asn Leu Leu Ala Lys Ala Leu Lys Arg Pro Glu Aan Phe Val Gly Met His Phe Phe Asn Pro Val His Met Met Pro Leu Val Glu Val Ile Arg Gly Glu Lys Ser Ser Asp Val Ala Val Ala Thr Thr Val Ala Tyr Ala Lys Lys Met Gly Lys Asn Pro Ile Val Val Asn Asp Cys Pro Gly''Phe'Leu'Val Asn Arg Val Leu Phe Pro Tyr Phe Gly Gly Phe Ala '' Lys Leu Val Ser Ala Gly Val Asp Phe Val Arg Ile Asp Lys Val Met Glu Lys Phe Gly Trp Pro Met Gly Pro Ala Tyr Leu Met Asp Val Val Gly Ile Asp Thr Gly His His Gly Arg Asp Val Met Ala Glu Gly Phe Pro Asp Arg Mat Lys Asp Glu Arg Arg Ser Ala val Asp Ala Leu Tyr WO 99!45122 PCTNS99/04999 Glu Ala Asn Arg Leu Gly Gln Lys Asn Gly Lys Gly Phe Tyr Ala Tyr Glu Thr Asp Lys Arg Gly Lys Pro Lys Lys Val Phe Aap Ala Thr Val Leu Asp Val Leu Lys Pro Ile Val Phe Glu Gla Arg Glu Val Thr Asp Glu Asp Ile Ile Asn Trp Met Met Val Pro Leu Cys Leu Glu Thr Val Arg Cys Leu Glu Asp Gly Ile Val Glu Thr Ala Ala Glu Ala Asp Met Gly Leu Val Tyr Gly Ile Gly Phe Pro Pro Phe Arg Gly Gly Ala Leu Arg Tyr Ile Asp Ser Ile Gly Val Ala Glu Phe Val Ala Leu Ala Asp Gln Tyr Ala Asp Leu Gly Pro Leu Tyr His Pro Thr Ala Lys Leu Arg Glu Mat Ala Lys Asn Gly Gln Arg Phe Phe Aan

Claims (24)

We claim:

1. A method for manipulating the metabolism of a plant, comprising expressing transgenes encoding fatty acid .beta.-oxidation enzyme activities in cytosol, plastids other than the peroxisomes or glyoxisomes, or mitochondria of the plant.

2. The method of claim 1 wherein the fatty acid .beta.-oxidation enzymes are expressed from genes selected from the group consisting of bacterial, yeast, fungal, plant, and mammalian.

3. The method of claim 1 wherein the fatty acid .beta.-oxidation enzymes are expressed from genes from bacteria selected from the group consisting of Escherichia, Pseudomonas, Alcaligenes, and Coryneform.

4. The method claim 3 wherein the genes are Pseudomonas putida faoAB.

5. The method of claim 1 further comprising expressing genes of bacterial, fungal, yeast, plant or animal origin encoding enzymes selected from the group consisting of polyhydroxyalkanoate synthases, acetoacetyl-CoA reductases, .beta.-ketoacyl-CoA thiolases, and enoyl-CoA hydratases, wherein the enzymes encoded by these genes are directed to the cytosol, plastids other than the peroxisomes or glyoxisomes, or mitochondria of the plant.

6. A DNA construct for use in a method of manipulating the metabolism of a plant cell comprising, in phase, (a) a promoter region functional in a plant;
(b) a structural DNA sequence encoding at least one fatty acid .beta.-oxidation enzyme activity; and (c) a 3' nontranslated region of a gene naturally expressed in a plant, wherein the nontranslated region encodes a signal sequence for polyadenylation of mRNA.

7. The DNA construct of claim 6 wherein the promoter is a seed specific promoter.

8. The DNA construct of claim 7 wherein the seed specific promoter is selected from the group consisting of napin promoter, phaseolin promoter, oleosin promoter, 2S albumin promoter, zein promoter, .beta.-conglycinin promoter, acyl-carrier protein promoter, and fatty acid desaturase promoter.

9. The DNA construct of claim 6 wherein the promoter is a constitutive promoter.

10. The DNA construct of claim 6 wherein the promoter is selected from the group consisting of CaMV 35S promoter, enhanced CaMV 35S
promoter, and ubiquitin promoter.

11. A method for enhancing the biological production of polyhydroxyalkanoates in a transgenic plant, comprising expressing genes encoding heterologous fatty acid .beta.-oxidation enzymes in cytosol, plastids other than the peroxisomes or glyoxisomes, or mitochondria of the plant.

12. The method of claim 11 wherein the transgenic plant is selected from the group consisting of Brassica, maize, soybean, cottonseed, sunflower, palm, coconut, safflower, peanut, mustards, flax, tobacco, and alfalfa.

13. A transgenic plant or part thereof comprising heterologous genes encoding fatty acid .beta.-oxidation enzymes in cytosol, plastids other than the peroxisomes or glyoxisomes, or mitochondria of the plant.

14. The plant or part thereof of claim 13 wherein the fatty acid .beta.-oxidation enzymes are expressed from genes selected from the group consisting of bacterial, yeast, fungal, plant, and mammalian.

15. The plant or part thereof of claim 14 wherein the fatty acid oxidation enzymes are expressed from genes from bacteria selected from the group consisting of Escherichia, Pseudomonas, Alcaligenes, and Coryneform.

16. The plant or part thereof of claim 15 wherein the genes are Pseudomonas putida faoAB.

17. The plant or part thereof of claim 13 further comprising genes encoding enzymes selected from the group consisting of polyhydroxyalkanoate synthases, acetoacetyl-CoA reductases, .beta.-ketoacyl-CoA thiolases, and enoyl-CoA hydratases.

18. The plant or part thereof of claim 13 wherein the plant is selected from the group consisting of Brassica, maize, soybean, cottonseed, sunflower, palm, coconut, safflower, peanut, mustards, flax, tobacco, and alfalfa.

19. The plant or part thereof of claim 13 comprising a DNA
construct comprising, in phase, (a) a promoter region functional in a plant;
(b) a structural DNA sequence encoding at least one fatty acid .beta.-oxidation enzyme activity; and (c) a 3' nontranslated region of a gene naturally expressed in a plant, wherein the nontranslated region encodes a signal sequence for polyadenylation of mRNA.

20. The plant or part thereof of claim 19 wherein the promoter is a seed specific promoter.

21. The plant or part thereof of claim 20 wherein the seed specific promoter is selected from the group consisting of napin promoter, phaseolin promoter, oleosin promoter, 2S albumin promoter, zero promoter, .beta.-conglycinin promoter, acyl-carrier protein promoter, and fatty acid desaturase promoter.

22. The plant or part thereof of claim 19 wherein the promoter is a constitutive promoter.

23. The plant or part thereof of claim 20 wherein the promoter is selected from the group consisting of CaMV 35S promoter, enhanced CaMV
35S promoter, and ubiquitin promoter.

24. A method of preventing or suppressing seed production in a plant, comprising expressing heterologous genes encoding fatty acid .beta.-oxidation enzymes in cytosol or plastids other than the peroxisomes, glyoxisomes or mitochondria of the plant.