MODIFICATION OF METABOLISM OF FATTY ACIDS IN BACKGROUND PLANTS OF THE INVENTION The present invention relates, in general terms, to the field, of transgenic plant systems for the production of polyhydroxyalkanoate materials, modification of triglycerides and fatty acids, and methods for altering the production of seeds in plants. In the last 15 years, methods have been developed for the production of stable transgenic plants for agronomic crops. The harvests have been genetically modified for improvements of the characteristics as much to level of input as of production. In the characteristics of input, the tolerance to specific agrochemicals has been introduced into the crops, and specific natural pesticides such as the toxin Bacillus thuringenesis have been expressed directly in the plant. Significant progress has also been observed in the development of male sterility systems for the production of hybrid plants. With regard to the characteristics of production, crops were modified in order to increase the value of the product, generally the seed, grain, or fiber of the plant. Critical metabolic targets include the modification of the biosynthetic pathways of oil, fatty acids and starch. There is considerable commercial interest for the production of biopolymers of microbial polyhydroxyalkanoates (PHA) in plant crops. See, for example, U.S. Patent Nos. 5,245,023 and 5,250,430 to Peoples and Sinskey; U.S. Patent No. 5,502,273 to Bright et al., U.S. Patent No. 5,534,432 to Peoples and Sinskey; U.S. Patent No. 5,602,321 to John; U.S. Patent No. 5,610,041 to Somerville et al .; PCT documents O 91/00917; PCT WO 92/19747; PCT WO 93/02187; PCT WO 93/02194; PCT WO 94/12014; Poirier et al., Science 256: 520-23 (1992); van der Leij & Witholt, Can. J. Microbiol. 41_ (supplement): 222-38 (1995); Nawrath & Poirier, The International Symposium on Bacterial
Polyhydroxyalkanoates, (Eggink et al., Edsj Davos Switzerland ("August 18-23, 1996) and Williams and Peoples, CHEMTECH 26: 38-44 (1996) Polyhydroxyalkanoates are natural thermoplastic polyesters and can be processed by polymer techniques Traditional products for use in a wide variety of applications, including consumer packaging, disposable diaper liners, garbage bags, food and medical products Initial studies of polyhydroxybutyrate production in the chloroplasts of the experimental plant system Arabidopsis thaliana resulted in the accumulation of up to 14% of the dry weight of the leaf in the form of polyhydroxybutyrate (Nawrath et al, 1993) .However, Arabidopsis has no agronomic value.In addition, for the purpose of producing polyhydroxyalkanoates economically in agronomic crops, it is desirable produce the polyhydroxyalkanoates in the seeds in such a way that the current infrastructure can be used to Harvest and process the seeds. Options for recovering polyhydroxyalkanoates from plant seeds (PCT WO 97/15681) and end-use applications (Williams &Peoples, CHEMTECH 26: 38-44 (1996)) are significantly affected by polymer composition . Accordingly, it would be advantageous to develop systems of transgenic plants that produce polyhydroxyalkanoate polymers having a well-defined composition. A careful selection of polyhydroxyalkanoate biosynthetic enzymes based on their substrate specificity allows the production of polyhydroxyalkanoate polymers of defined composition in transgenic systems (US Patent Nos. 5,229,279; 5,245,023; 5,250,430; 5, 480, 794; 5,512,669; 5, 534,432; 5,661,026; and 5,663,063). In bacteria,. Each polyhydroxyalkanoate group is produced through a specific route. In the case of polyhydroxyalkanoates of short pendant groups, three enzymes are involved: beta-quetotiolase, acetoacetyl-CoA reductase, and PHA synthase. The PHB homopolymer, for example, is produced by the condensation of two molecules of acetyl-coenzyme A to provide acetoacetyl-coenzyme A. The latter is then reduced in the chiral intermediate R-3-hydroxybutyryl-coenzyme A by reductase, and subsequently polymerized by the PHA synthase enzyme. The PHA synthase enzyme remarkably has a relatively broad substrate specificity which allows it to polymerize C3-C5 hydroxy acid monomers including both 4-hydroxy acid and 5-hydroxy acid units. This biosynthetic pathway is found in numerous bacteria such as Alcaligenes e trophus, A. Latus, Azotobacter vinlandii, and Zoogloea ramigera. Polyhydroxyalkanates of long pendant groups are produced, for example, by many different Pseudomonas bacteria. Its biosynthesis involves the beta-oxidation of fatty acids and the synthesis of fatty acids as routes to the monomeric units of hydroxyacyl-coenzyme A. The latter are then converted by PHA synthases that have substrate specificities that favor the C6-C14 monomeric units more large (Peoples & Sinskey, 1990). In the case of PHB-co-HX copolymers usually produced from cells cultured in fatty acids, a combination of these routes may be responsible for the formulation of different monomer units. In fact, the analysis of the DNA locus encoding the PHA synthase gene in Aeromonas caviae, which produces the copolymer PHA-co-3-hydroxy exanoate; it was used to identify a gene encoding an enoyl-CoA hydratase specific for D responsible for the production of D-beta-hydroxybutyryl-CoA and D-beta-hydroxyhexanoyl-CoA units (Fukui &Doi, J. Bacteriol. : 4821-30 (1997), Fukui et al., J. Bacteriol 180: 667-73 (1998)). Other sources of these hydratase genes and enzymes include Alcaligenes, Pseudomonas, and
Rhodospirillum The enzymes PHA synthase, acetoacetyl-CoA reductase, and beta-quetothiolase, which produce the PHAs of short pendant groups in A. eutrophus, are encoded by an operon comprising the genes phbC-phbA-phbB; (Peoples et al., 1987; Peoples &Sinskey, 1989). In Pseudomonas organisms, the PHA synthases responsible for the production of the PHAs of long pendant groups are encoded at the pha locus, specifically by the phaA and phaC genes (US Patent Nos. 5,245,023 and 5,250,430; Huisiman et al., J. Biol. Chem. 26 ^: 2191-98 (1991)). From these initial studies, several PHA biosynthetic genes were isolated which were chaerized or identified from genome sequencing projects. Examples of known PHA biosynthetic genes are presented in the following references: Aeronomas caviae (Fukui &Doi, 1997, J. Bacteriol 179: 821-30); Alcaligenes eutrophus (U.S. Patent Nos. 5,245,023; 5,250,430; 5,512,669; and 5,661,026; Peoples &Sinskey, J. Bio. Chem. 264: 15298-03 (1989)); Acinetobacter (Schembri et al., FEMS Microbiol. Lett. 118: 145-52 (1994)); Chromatium vinosum (Liebergesell &Steinbuchel, Eur. J. Biochem 209: 135-50 (1992)); Methylobacterium extorquens (Valentin &Steinbuchel, Appl. Microbiol. Biotechnol. _39: 309-17 (1993)); Nocardia corallina (GENBANK Accession No. AF019964; Hall et al., 1998, Can J. Microbiol., 44: 687-69); Paccus denitrificans (Ueda et al., J. Bacteriol.178: 774-79 (1996), Yabutani et al., FEMS Microbiol. Lett 133: 85-90 (1995)); Pseudomonas acidophila (Umeda et al., 1998, Applied Biochemistry and Biotechnology, 70-72: 341-52); Pseudomonas sp. 61-3 (Matsusaki et al., 1998, J. Bacteriol .1806459-67); Nocardia corallina; Pseudomonas aeruginosa (Timm &Steinbuchel, Eur. J. Biochem. 209: 15-30 (1992)); P. Oleovorans (US Patents Nos.
5, 245, 023 and 5,250, 430; Huisman et al., J. Biol. Chem.266 (4): 2191-98 (1991); Rhizobium etli (Cevallos et al., J. Bacteriol., 17: 1646-54 (1996)); R. Meliloti (Tombolini et al., Microbiologyl 1: 2553-59 (1995)); Rhodococcus ruber (Pieper-Furst &Steinbuchel, FEMS Microbiol, Lett 75: 73-79 (1992)); Rhodospirillum rubrum (Hustede et al., FEMS Microbiol, Lett 93: 285-90 (1992)); Rhodobacter sphaeroides (Hustede et al., FEMS Microbiol Rev. 9: 217-30 (1992); Biotechnol.Lett. 15: 709-14 (1993); Synechocystis sp. (DNA Res.3: 109-36 (1996) ); Thicapsiae violaceous (Appl. Microbiol.
Biotechnol. 38: 493-501 (1993)) and Zoogloea ra igera (Peoples et al., J. Biol Chem. 262: 97-102 (1987); Peoples &Sinskey, Molecular Microbiology 3: 349-57 (1989)). The availability of these genes or their published DNA sequences should provide a range of options for the production of PHAs. PHA synthases suitable for the production of PHB-co-HH copolymers comprising from 1 to 99% of HH monomers are encoded by the PHA synthase genes of Rhodococcus ruber, Rhodospirillum rubrum, Thiocapsiae violacea, and Aeromonas caviae. PHA synthases useful for incorporating 3-hydroxy acids of 6-12 carbon atoms in addition to R-3-hydroxybutyrate, ie, for the production of biological polymers equivalent to the chemically synthesized copolymers described in PCT WO 95/20614, PCT WO 95/20615, and PCT WO 95/20621 have been identified in numerous Pseudo onas and other bacteria (Steinbüchel &Wiese, Appl. Microbiol. Biotechnol., 37691-97 (1992); Valentin et al., Appl. Microbiol. Biotechnol 36: 507-14 (1992), Valentin et al., Appl. Microbiol. Biotechnol _40: 710-16 (1994), Lee et al., Appl. Microbiol. Biotechnol 42: 901-09 (1995); Kato. et al., Appl. Microbiol. Biotechnol., 45: 363-70 (1996), Abe et al., Int.J. Biol. Macromol.16: 115-19 (1994), Valentin et al., Appl. Microbiol. Biotechnol 46: 261-67 (1996)) and can be easily isolated in accordance with that described in US Patent Nos. 5,245,023 and 5,250,430. The PHA synthase of P. oleovorans (US Patent Nos. 5,245,023 and 5,250,430; Huisman et al., J. Biol. Chem. 266 (4): 2191-98 (1991)) is suitable for the production of PHAs of long pendant groups. Plant genes encoding beta-quetothiolase have also been identified (Vollack &Bach, Plant Physiol. 11_1: 1097-107 (1996)). Despite the ability to modify a monomer composition by selecting the synthesis and substrates, it is desirable to modify other characteristics of the biosynthesis of polymers, such as those involving the metabolism of fatty acids. Accordingly, it is an object of the present invention to provide a DNA method and constructs for introducing fatty acid oxidation enzyme systems to manipulate the cell metabolism of plants. It is another object of the present invention to provide methods for increasing the production of PHAs in plants, preferably in seeds for the production of oils. COMPENDIUM OF THE INVENTION Methods and systems are described to modify the biosynthesis and oxidation of fatty acids in plants to elaborate new polymers. Two enzymes are essential: a hydratase such as, for example, enoyl-CoA hydratase specific for D, for example, the hydratase obtained from Aeromonas caviae, and a beta-oxidation enzyme system. Some plants have a beta-oxidation enzyme system that is sufficient to modify the synthesis of polymers when plants are manipulated to express the hydratase. Examples demonstrate the production of polymer by the expression of these enzymes in transgenic plants. Examples also show that modifications in the synthesis of fatty acids can be used to alter plant phenotypes, decrease or eliminate seed production and increase the biomass of green plants as well as the production of PHAs. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a scheme of beta-oxidation pathways of fatty acids to produce polyhydroxyalkanoate monomers. Figure 2 is a schematic showing constructs of plasmid pSB2024 and pSB2025. Figures 3A and 3B are schemes showing constructs of plasmid pCGmfl24 and pCGmfl25. Figures 4A and 4B are schemes showing plasmid constructs pmfl249 and pmfl254. Figures 5A and 5B are schemes showing plasmid constructs pCGmf224 and pCGmf225. Figures 6A and 6B are burns showing plasmid constructs pCGmflP2S and pCGmf2PlS. DETAILED DESCRIPTION OF THE INVENTION DNA methods and constructs are provided for manipulating plant cell metabolism by the introduction of fatty acid oxidation systems in the cytoplasm or plastids of developing oil seeds or green tissue. The fatty acid oxidation systems typically comprise various enzyme activities including a beta-keto-thiolase enzyme activity employing a wide range of beta-ketoacyl-CoA substrates. It is surprising that the expression of at least one of these transgenes of the bean phaseolin promoter results in male sterility. Interestingly, these plants did not produce seeds but produced higher than normal levels of biomass (eg, leaves, stems, etc.). Accordingly, the methods and constructs described herein can also be used to create sterile male plants, for example, for hybrid production or to increase the production of forage biomass such as alfalfa or tobacco. The plants generated using these DNA methods and constructs are useful for the production of polyhydroxyalkanoate biopolymers or for the production of novel oil compositions. The methods described herein include the subsequent incorporation of additional transgenes, which encode particularly additional enzymes involved in the oxidation of fatty acids or in the biosynthesis of polyhydroxyalkanoates. For the biosynthesis of polyhydroxyalkanoates, the methods include the incorporation of transgenes encoding enzymes such as NADH and / or NADPH acetoacetyl-coenzyme A reductases, PHB synthases, PHA synthases, acetoacetyl-CoA thiolase, hydroxyacyl-CoA epimerases, A3-cis-A2-trans enoyl-CoA isomerases, acyl-CoA dehydrogenase, acyl-CoA oxidase and enoyl-CoA hydrated by the subsequent transformation of the plants transgenic produced using the DNA methods and constructs described herein or by traditional methods of plant crossing. I. Plant Expression Systems In a preferred embodiment, the fatty acid oxidation transgenes are expressed from a seed-specific promoter, and the proteins are expressed in the cytoplasm of the developing oilseed. In an alternative preferred embodiment, fatty acid oxidation transgenes are expressed from a seed-specific promoter and the expressed proteins are directed towards the plastids using focussing signals towards plastids. In another preferred embodiment, the fatty acid oxidation transgenes are expressed directly from the plastid chromosome where they have been integrated by homologous recombination. The fatty acid oxidation transgenes can also be expressed in the entire tissue of the plant from a constitutive pro engine. It is also useful to be able to control the expression of these transgenes by the use of promoters that can be activated after the application of an agrochemical ingredient or an active ingredient of another type to the harvest in the field. Additional control of the expression of these genes encompassed by the methods described here includes the use of recombinase technologies for the focused insertion of transgenes into specific chromosomal sites on the plant chromosome or to regulate the expression of transgenes. The methods described herein include a plant seed that has a genome that includes (a) a promoter operably linked to a first DNA sequence and a 3 'untranslated region, wherein the first DNA sequence encodes a DNA oxidation polypeptide. fatty acids and optionally (b) a promoter operably linked to a second DNA sequence and a 3 'untranslated region, wherein the second DNA sequence encodes a fatty acid oxidation polypeptide. The expression of the two transgenes offers the plant a functional fatty acid beta-oxidation system that has at least the beta-quetothiolase, dehydrogenase and hydratase activities in the cytoplasm or plastids other than peroxisomes or glyoxysomes. The first DNA sequence and / or the second DNA sequence can be isolated from bacteria, yeasts, fungi, algae, plants, or animals. It is preferable that at least one of the DNA sequences encode a polypeptide with at least two enzyme activities and preferably three enzyme activities. Transformation vectors DNA constructs useful in the methods described herein include transformation vectors capable of introducing transgenes into plants. Various options for plant transformation vectors are suitable, including those described in "Gene Transfer to Plants" (Potrykus, et al., Eds.) Springer-Verlag Berlin Heidelberg New York (1995); "Transgenic Plants: A Production System for Industrial and Pharmaceutical Proteins" (Owen, et al., Eds.) John iley & Sons Ltd. England (1996) and "Methods in Plant Molecular Biology: A Laboratory Course Manual" (Maliga, et al., Eds.) Cold Spring Laboratory Press, New York, 1995. Plant transformation vectors generally include a or various coding sequences of interest under the transcriptional control of 5 'and 3' regulatory sequences, including a promoter, a transcription termination signal and / or polyadenylation, and a selectable or screened marker gene.The usual requirements for regulatory sequences 5 'include a promoter, a transcription termination signal and / or polyadenylation For the expression of two or more polypeptides from a single transcript, additional AR processing signals and additional ribozyme sequences can be manipulated in the construct ( U.S. Patent No. 5,519,164) This approach has the advantage of locating multiple transgenes at a single locus, which is helpful for Subsequent crossbreeding of plants. A further approach is the use of a vector to specifically transform the plant plastid chromosome by homogeneous recombination (US Patent No. 5,545,818), in which case it is possible to exploit the prokaryotic nature of the plastic genome and insert numerous transgenes as an operon. Promoters A large number of plant promoters are known and result either in constitutive or environmentally regulated expression or in the development of the gene of interest, plant promoters can be selected to control the expression of the transgene in different plant tissues for all of which experts in the matter they know methods (Gasser &Fraley, Science, 244: 1293-99 (1989)). The 5 'end of the transgene can be manipulated to include plastid encoding sequences or other subcellular organelle focusing peptides linked in frame with the transgene. Suitable constitutive plant promoters include the 35S promoter of cauliflower mosaic virus (CaMV) and improved CaMV promoters (Odell et al., Nature, 313: 810 (1985)), actin promoter / McElroy et al., Plant Cell 2 : 163-71 (1990), Adhl promoter (Fromm et al., Bio / Technology 8: 833-39 (1990); Kyozuka et al., Mol. Gen. Genet. 228: 0-48 (1991)), promoters of ubiquitin, the promoter of the scrofularia mosaic virus, the promoter of the mannopinsynthase, the promoter of the nopalinsynthase, and the promoter of octopinsynthase. Useful systems of regulatable promoters include the spinach nitrate inducible promoter, thermal shock promoters, small subunit of ribulose biphosphatcarboxylase promoters as well as chemically inducible promoters (U.S. Patent No. 5,364,780 to Hershey et al.). In a preferred embodiment of the methods described herein, transgenes are expressed only in developing seeds. Promoters suitable for this purpose include the napin gene promoter (US Patent Nos. 5,420,034 and 5,608,152), the acetyl-CoA carboxylase promoter (US Patent Nos. 5,420,034 and 5,608,152), 2S Albumin Promoter, seed, phaseolin promoter (Slightom et al., Proc. Nati, Acad. Sci. USA 80: 1897-1901 (1983)), oleosin promoter (Plant et al., Plant Mol. Biol. 25: 193-205 ( 1994), Rowley et al., Biochim Biophys, Acta 1345, 1-4 (1997), U.S. Patent No. 5,650,554, and PCT WO 93/20216), zein promoter, glutelin promoter, starch synthase promoter, and starch branching enzyme promoter. The transformation of suitable agronomic plant hosts employing these vectors can be achieved with various plant methods and tissues. Representative plants useful in the methods disclosed here include the family Brassica napus, rappa, sp. carinata and júncea; corn; soy; cottonseed; sunflower; palm; coconut; safflower; peanut; mustard including Sinapis alba; and linen. Crops harvested as biomass, such as for example silage maize, alfalfa, or tobacco, are also useful with the methods disclosed herein. Representative tissues for transformation using these -vectors include protoplasts, cells, callus tissue, leaf discs, pollen, and meristems. Representative transformation methods include Agrobacterium-mediated transformation, biolistics, microinjection, electroporation, propylene glycol-mediated protoplast transformation, liposome-mediated transformation, and silicon-mediated transformation (US Patent No. 5,464,765; "Gene Transfer to Plants" (Potrykus , et al., eds.) Springer-Verlag Berlin Heidelberg New York (1995), "Transgenic Plants: A Production System for Industrial and Pharmaceutical Proteins" (Owen, et al., eds.) John Wiley &Sons Ltd. England ( 1996) and "Methods in Plant Molecular Biology: A Laboratory Course Manual" (Maligna, et al., Eds.) Cold Spring Laboratory Press, New York (1995)). II. Methods for making and screening transgenic plants In order to generate transgenic plants by employing the constructs described herein, the following methods can be employed to obtain a transformed plant that expresses the transgenes after transformation: select the plant cells that have been transformed into a selective medium; regenerate plant cells that have been transformed to produce differentiated plants; selecting transformed plants that express the transgene in such a way as to obtain the desired polypeptide level in the desired tissue and in the locator. desired cell For the specific harvests useful for the practice of the methods described, transformation procedures were established, as described, for example, in "Gene Transfer to Plants" (Potrykus, et al., Eds.) Springer-Verlag, Berlin, New Heidelberg York (1995); "Transgenic Plants: A Production System for Industrial and Pharmaceutical Proteins" (Owen et al., Eds.) John Wiley s Sons Ltd. England (1996); and "Methods in Plant Molecular Biology: A Laboratory Course Manual" (Maliga, et al., eds.) Cold Spring Laboratory Press, New York (1995). Brassica napus can be processed in accordance with what is described, for example, in US Patents Nos. 5,188,958 and 5,463,174. Other Brassica such as rappa, carinata and juscea as well as Sinapis alba can be transformed in accordance with that described by Moloney et al., Plant Cell Reports 8: 238-42 (1989). Soybeans can be processed by several reported procedures (US Patent Nos. 5,015,580, 5,015,944, 5,024,944, 5,322,783, 5,416,011, and 5,169,770). Various transformation procedures have been reported for the production of transgenic maize plants including pollen transformation (US Patent No. 5,629,183), silicon fiber mediated transformation (US Patent No. 5,464,765), protoplast electroporation (US Patent Nos. 5,231,019).; 5,472,869; and 5,384,253), gene gun (US Patents Nos. 5,538,877 and 5,538,880) and Agrobacterium-mediated transformation (EP 0 604 662 Al; PCT WO 94/00977). The Agrobacterium-mediated process is especially preferred since individual integration events of the transgene constructs are easier to obtain using this method, which greatly facilitates subsequent cross-breeding of the plants. Cotton can be processed by particle bombardment (US Patent Nos. 5,004,863 and 5,159,135). The sunflower can be transformed using a combination of particle bombardment and Agrobacterium infection (EP O 486 233 A2 US Patent No. 5,030, 572). The flax can be transformed either by particle bombardment or by transformation mediated by Agrobacterium. Recombinase technologies include the cre-lox, FLP / FRT, and Gin systems. Methods for employing this technology are described, for example, in U.S. Patent No. 5,527,695 to Hodges et al., Dale &; Ow, Proc. Nati Acad. Sci USA 8_8: 10558-62 (1991); Medberry et al., Nucleic Acids Res. 23: 85-90 (1995). Selectable marker genes Useful selectable marker genes for practicing the methods described herein include the nptll neomycin phosphotransferase gene (US Patent No. 5,034,322 and 5,530,196), the hygromycin resistance gene (U.S. Patent No. 5,668,298), the bar gene which codes for resistance to phosphinothricin (U.S. Patent No. 5,276,268). EP 0 530 129 AI discloses a positive selection system that allows transformed plants to grow more than untransformed lines by expressing a transgene encoding an enzyme that activates an inactive compound added to the culture medium. Sieveable marker genes useful in the methods herein include the β-glucuronidase gene (Jefferson et al., EMBO J. 6: 3901-07 (1987); US Patent No. 5, 268,463) and the native green fluorescent protein gene or modified (Cubitt et al., Trends Biochem Sci. 20: 448-55 (1995); Pang et al., Plant Physiol. 112: 893-900 (1996)). Some of these markers have the additional advantage of introducing a trait, such as resistance to herbicides, into the plant of interest, thereby offering an additional agronomic value on the side of the insulator. In a preferred embodiment of the methods described herein, it is expressed more than a gene product in the plant. This expression can be achieved through numerous different methods, including (1) the introduction of coding DNAs in a single transformation event where all the necessary DNAs are in a single vector; (2) introducing the coding DNAs in a co-transformation event where all the necessary DNAs are the vectors separated but introduced into plant cells simultaneously; (3) introducing the coding DNAs by independent transformation events successively into the plant cells, ie transforming the transgenic plant cells expressing one or more of the coding DNAs with additional DNA constructs; and (4) transformation of each of the DNA constructs required by separate transformation events, obtaining transgenic plants expressing the individual proteins and employing methods of crossing traditional plants to incorporate the entire pathway in a single plant. III. Pathways of ß-oxidation enzyme The production of PHAs in the cytosol of plants requires the cytosolic location of enzymes that can produce thioesters of R-3-hydroxyacyl CoA as substrates for PHA synthases. Both eukaryotes and prokaryotes have a β-oxidation pathway for fatty acid degradation consisting of a series of enzymes that convert thioesters of fatty acylCoA to acetyl CoA. While these pathways progress through the intermediate 3-hydroxyacyl CoA, the stereochemistry of this intermediate varies between organisms. For example, the ß-oxidation pathways of bacteria and the peroxisomal pathway of higher eukaryotes degrade fatty acids in acetyl CoA through S-3-hydroxyacetyl CoA (Schultz, "Oxidation of Fatty Acids" in Biochemistry of Lipids, Lipoproteins and Membranes (Vanee et al., Eds.) Pages 101-106 (Elsevier, Amsterdam 1991)). In Escherichia coli, an epimerase activity encoded by the multifunctional enzyme complex of β oxidation can convert S-3-hydroxyacyl CoA to R-3-hydroxyacyl CoA. The yeast possesses a degradation pathway of peroxisomal fatty acids which proceeds through the intermediate R-3-hydroxyacyl CoA (Hiltunen, et al., J. Biol. Chem. 267: 6646-53 (1992); Filppula, et al. ., J. Biol. Chem. 270: 27453-57 (1995)), such that no epimerase activity is required to produce PHAs. Plants, like other higher eukaryotes, have a ß oxidation pathway for the degradation of fatty acids that are located subcellularly in peroxisomes (Gerhardt, "Catabolism of Fatty Acids [alpha and beta Oxidation]" in Lipid Metabolism in Plants (Moore, J r., Ed.) Pages 527-65 (CRD Press, Boca Raton, 'Florida, 1993)). The production of PHAs in the cytosol of plants therefore requires the cytosolic expression of a beta oxidation pathway, for the conversion of fatty acids into thioesters of R-3-hydroxyacyl CoA of correct chain length, as well as of cytosolic expression of a PHA synthase suitable for polymerizing R-3-hydroxyacyl CoA in polymer. Fatty acids are synthesized as saturated acyl-ACP thioesters in plant plastids (Hartwood, "Plants Lipid Metabolism" in Plant Biochemistry (Dey et al., Eds.) Pages 237-72 (Academic Press, San Diego 1997)). Before the export of the plastid in the cytosol, most of the fatty acids are desaturated through? 9 desaturase. The group of fatty acids newly synthesized in most oilseed crops consists predominantly of oleic acid (cis 9-octadecenoic acid), stearic acid (octadecanoic acid) and palmitic acid (hexadecanoic acid). However, some plants, such as coconut and palm, synthesize shorter chain fatty acids (C8-14). The fatty acid is released from ACP through a thioesterase and is subsequently converted to an acyl thioester-CoA through an acyl CoA synthetase, located in the plasmid membrane (Andrews, et al., "Fatty acid and lipid biosynthesis and degradation "in Plant Physiology, Biochemistry, and Molecular Biology (Dennis et al., eds.) pages 345-46 (Longman Scientific & amp;; Technical, Essex, England 1S90); Harwood, "Plant Lipid Metabolism" in Plant Biochemistry (Dey et al., Eds) page 246 (Academic Press, San Diego 1997)). The cytosolic conversion of the newly synthesized acyl CoA thioesters via the fatty acid degradation pathways and the conversion of intermediates from the series of reactions on R-3-hydroxyacyl-CoA substrates to PHA synthases can be achieved through the enzymatic reactions presented in figure 1. PHA tapeza substrates are R-3-hydroxyacyl CoAs C4-C16. In the case of saturated fatty acyl CoAs, conversion to thioesters R-3-hydroxyacyl CoA using fatty acid degradation pathways requires the following reaction sequence: conversion of thioester acyl CoA to trans-2-enoyl-CoA (reaction 1 ), hydration of trans-2-enoyl-CoA in R-3-hydroxyacyl CoA (reaction 2a, for example, the yeast system operates through this route and the hydratase specific for Aeromonas caviae D provides R-3-hydroxyacyl -CoAs C4-C7), hydration of trans-2-enoyl-CoA in S-3-hydroxyacyl CoA (reaction 2b), and epimerization of S-3-hydroxyacyl CoA in R-3-hydroxyacyl CoA (reaction 5, for example , tetrafunctional cucumber protein, bacterial systems). If 3-hydroxyacyl CoA is not polymerized by PHA tape that forms PHA, it can be carried out through the remainder of the beta oxidation pathway as follows: oxidation of 3-hydroxyacyl CoA to form β-ketoacyl CoA (reaction 3) followed by thiolysis in the presence of CoA to provide acetyl CoA and a shorter saturated acyl CoA thioester for two carbon units (reaction 4). The thiaester of acyl CoA produced in reaction 4 can again enter the path of β oxidation in reaction 1 and the acetyl-CoA that is produced can be converted to R-3-hydroxyacyl CoA by the action of β-quetothiolase ( reaction 7) and NADH or NADPH acetoacetyl-CoA reductase (reaction 6). This last route is useful for the production of R-3-hydroxybutyryl-CoA, R-3-hydroxyvaleryl-CoA and R-3-hydroxyhexanoyl-CoA. The R-3-hydroxy acids of four to sixteen carbon atoms produced by this series of enzymatic reactions can be polymerized by PHA synthases expressed from a transgene, or transgenes in the case of two subunits of tape enzymes in PHA polymers.
For unsaturated fatty acyl CoAs 9, a variation of the reaction sequences is required. Three cycles of β-oxidation, in accordance with what is presented with details in Figure 1, remove six carbon units providing an unsaturated acyl CoA thioester with a cis double bond at position 3. The conversion of the cis double bond into the position 3 to a trans double bond in position 2, catalyzed by A3-cis-A2-trans-enoyl CoA isomerase allows conduction of the ß-oxidation reaction sequences presented in figure 1. This enzymatic activity is present in the microbial ß-oxidation complexes and the tetrafunctional plant protein, but not in the yeast f ~ oxl · Acyl CoA thioesters can also be degraded in a β-ketoacyl CoA and converted to R-3-hydroxyacyl CoA through a reductase dependent on NADH or NADPH (reaction 6). Multifunctional enzymes encoding specific hydratase activities for S, dehydrogenase specific for S, β-keto-thiolase, epimerase and A3-cis-A2-trans-enoyl CoA isomerase were found in bacteria such as Escherichia coli (Spratt, et al., J. Bacteriol 158: 535-42 (1984)) and Pseudomonas fragi (Immure et al., J. Biochem 107: 184-89 (1990)). The multifunctional enzyme complexes consist of two copies of each of two subunits in such a way that the catalytically active protein forms a heterotetramer. The hydratase, dehydrogenase, epimerase, and A3-cis-A2-trans-enoyl CoA isomerase activities are in one subunit, while the thiolase is located in another subunit. Genes encoding enzymes from organisms such as E. Coli (Spratt, et al., J. Bacteriol, 15: 535-42 (1984); DiRusso, J. Bacteriol. 172: 6459-68 (1990)) and P. fragi (Sato et al., J. Biochem. 111: 8-15 (1992)) have been isolated and sequenced and are suitable for practicing the methods described herein. In addition, the E. coli enzyme system has undergone site-directed mutagenesis analysis to identify critical amino acid residues for the activities of individual enzymes (He &Yang, Biochemistry 35: 9625-30 (1996); al., Biochemistry 34: 6641-47 (1995), He &Yang, Biochemistry 36: 11044-49 (1997), He et al., Biochemistry 36: 261-68 (1997), Yang &Elzinga, J. Biol. Chem. 268: 6588-92 (1993)). These mutant genes could also be employed in some embodiments of the methods described herein. Mammals, such as the rat, possess a trifunctional ß-oxidation enzyme in their peroxisomes, which contains hydratase, dehydrogenase, and A3-cis-ñ2-trans-enoyl CoA isomerase activities. The trifunctional enzyme from rat liver has been isolated and found to be monomeric with a molecular weight of 78 kDa (Palosaari, et al., J. Biol. Chem. 265: 2446-49 (1990)). Unlike the bacterial system, the thiolase activity is not part of the multiple enzyme protein (Schultz, "Oxidation of Fatty Acids" in Biochemistry of Lipids, Lipoproteins and Membranes (Vanee et al., Eds) page 95 (Elsevier, Amsterdam ( 1991).) Epimerization in rats occurs through the combined activities of two different hydratases, one that converts R-3-hydroxyacyl CoA into trans-2-enoyl CoA, and another that converts trans-2-enoyl CoA into S -3-hydroxyacyl CoA (Smeland, et al., Biochemical and Biophysical Research Communications 160: 988-92 (1989)) Mammals also have ß-oxidation pathways in their mitochondria that degrade fatty acids in acetyl CoA through the intermediate S-3-hydroxyacyl CoA (Schultz, "Oxidation of Fatty Acids" in Biochemistry of Lipids, Lipoproteins and Membranes (Vanee et al., Eds) page 96 (Elsevier, Amsterdam (1991).) Genes encoding ß-oxidation activities mitochondrial have been isolated from several animals include of a rat mitochondrial CoA hydratase / 3-hydroxyacyl CoA dehydrogenase (No. ID 6478 of GENBANK) and rat mitochondrial thiolase (Accession Nos. D13921, D00511 from GENBANK). The yeast possesses a multifunctional enzyme, Fox2, which differs from ß-oxidation complexes of bacteria and higher eukaryotes insofar as it proceeds through an intermediate R-3-hydroxyacyl CoA instead of S-3-hydroxyacyl CoA (Hiltunen , et al., J. Biol. Chem.267: 6646-53 (1992)). Fox2 possesses specific hydratase activities for R and dehydrogenase specific for R. This enzyme does not possess the preferred A3-cis-A2-trans-enoyl CoA isomerase activity to degrade ñ9-cis-hydroxyacyl CoAs to form R-3-hydroxyacyl CoAs. The gene encoding fox2 from the yeast has been isolated and sequenced and encodes a protein of 900 amino acids. The DNA sequence of the structural gene and the amino acid sequence of the encoded polypeptide appear in SEQ ID NO: 1 and SEQ ID NO: 2 Plants have a tetrafunctional protein similar to yeast Fox2, but which also encodes a 3-cis-activity. 2-trans-enoyl CoA isomerase (Muller et al., J. Biol. Chem. 269: 20475-81 (1994)). The DNA sequence of the cDNA and the amino acid sequence of the encoded polypeptide appear in SEQ ID NO: 3 and SEQ ID NO: 4. IV. Enzyme focus on the cytoplasm of oilseed crops The manipulation of PHA production in the cytoplasm of plants requires a focus on the expression of ß-oxidation towards the cytosol of the plant. No focusing signal is present in bacterial systems such as faoAB. In fungi, yeast, plants and mammals, ß-oxidation occurs in subcellular organelles. Typically genes are expressed from the nuclear chromosome, and polypeptides synthesized in the cytoplasm are directed to these organelles by the presence of specific amino acid sequences. To practice the methods described herein using genes isolated from eukaryotic sources, for example, fatty acid oxidation enzymes from eukaryotic sources, such as yeast, fungi, plants and mammals, the removal or modification of focus signals subcellular is required to direct the enzymes towards the cytosol. It may be useful to add signals to direct the proteins to the endoplasmic reticulum. Peptides useful in this process are well known in the art. The general approach is transgene modified by inserting a DNA sequence that specifies an ER that targets a sequence of peptides to form a chimeric gene. Acyl CoA eukaryotic dehydrogenases, as well as other mitochondrial proteins, are targeted to mitochondria through leading peptides at the N-terminus of the protein that are usually 20 to 60 amino acids in length (Horwich, Current Opinion in Cell Biology, 2: 625 -33 (1990)). Despite the lack of an obvious consensus sequence for the mitochondrial import of leading peptides, the mutagenesis of key residues in the leader sequence prevents the importation of mitochondrial protein. For example, the importation of Saccharomyces cerevisiae FI-ATPase was prevented by mutagenesis of its leader sequence, resulting in the accumulation of the modified precursor protein in the cytoplasm (Bedwell, et al., Mol. Cell Biol. 9: 1014 -25 (1989)). Three eukaryotic peroxisomal focus signals have been reported (Gould, et al., J. Cell Biol. 108: 1657-64 (1989); Brickner, et al., J. Plant Physiol. , 113: 1213-21 (1997)). The S / A / C / K / H / R-L tripeptide targeting signal occurs at the C-terminal end of many peroxisomal proteins (Gould, et al., J. Cell Biol. 1_08: 1657-64 (1989)). The mutagenesis of this sequence prevents the import of proteins into peroxisomes. Some peroxisomal proteins do not contain the tripeptide at the C-terminal end of the protein. For these proteins, it has been suggested that the approach occurs through the tripeptide at an internal position within the protein sequence (Gould, et al., J. Cell Biol. 108: 1657-64 (1989)) or through of an unknown, unrelated sequence (Brickner, et al., J. Plant Physiol. 113: 1213-21 (1997)). The results of the in vitro peroxisomal approach experiments with acyl CoA oxidase fragments from Candida tropicalis seem to support this latter theory and suggest that there are two separate focus signals within the internal amino acid sequence of the polypeptide (Small, et al. , The EMBO Journal 1_: 1167-73 (1988)). In the aforementioned study, the focus signals were located in the two regions of 118 amino acids in length, and no region containing the focus signal S / A / C-K / H / R-L was found. A small number of peroxisomal proteins appear to contain an amino terminal leader sequence for import into peroxisomes (Brickner, et al., J. Plant Physiol. 113: 1213-21 (1997)). These focus signal can be removed or altered by site-directed mutagenesis. V. Cultivation and harvest of transgenic plants Transgenic plants can be cultivated using standard culture techniques. The plant or a part of the plant can also be harvested using standard equipment and methods. The PHAs can be recovered from the plant or a part of the plant using known techniques such as for example solvent extraction in combination with traditional seed processing technologies, in accordance with that described in PCT WO 97/15681, or they can be used directly, for example, as animal fodder, where it is unnecessary to extract the PHA from the plant biomass. Several lines that did not produce seeds produced much higher levels of biomass. This phenotype may therefore be useful as a means to increase the amount of green biomass produced per acre for silage, forage, or other biomass crops. Final uses include the most effective production of fodder crops for animal feed or as harvests for energy in order to generate electrical energy. Other uses include increased levels of biomass in crops such as alfalfa or tobacco for the subsequent recovery of industrial products such as PHAs by extraction. The compositions and methods of preparation and use described herein are further described through the following non-limiting examples. Example 1: Isolation and characterization of FaoAB genes from Pseudomonas putida and Fao enzyme All DNA manipulations, including polymerase chain reaction, transformation of E. coli by DNA sequencing, and purification of plasmids were carried out using standard procedures in accordance with that described, for example, by Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, New York, (1989)). Genes encoding faoAB from Pséudo onas putida were isolated using a probe generated from genomic DNA of P. putida by polymerase chain reaction using primers 1 and 2 that possess homology with FaoB of Pseudomonas fragi (Sato, et al. al., J. Biochem 1118-15 (1992)). Initiator 1: 5 'gat ggg ccg ctg ca ggg tgg 3' (SEQ ID NO: 5) Initiator 2: 5 'cac ccc gaa ggt gcc gcc att 3' (SEQ ID NO: 6) A fragment of 1.1 kb of DNA was purified from the polymerase chain reaction and using as a probe for screening a P. putida genomic library constructed in plasmid pBKCMV using the lambda ZAP expression system (Stratagene). Plasmid pMFX1 was selected between the positive clones and the DNA sequence of the insert containing the faoAB genes and the flanking sequences were determined. This is shown in SEQ ID NO: 7. A fragment containing faoAB was subcloned with the ribosome binding site of native P. putida intact in the expression vector pTRCN forming the plasmid pMFX3 in the following manner. Plasmid pMFX1 was digested with BsrG l. The resulting protruding ends were filled with Klenow. Digestion with Hind III yielded a 3.39 kb flat-snuff III fragment encoding FaoAB. The pTRCN expression vector was digested with Sma I / Hind III and ligated with the faoAB fragment to form the plasmid pMFX3 of 7.57 kb. Enzymes in the FaoAB multiple enzyme complex were assayed in the following manner. The hydratase activity was tested by monitoring the conversion of NAD into NADH using the coupling enzyme L-B-hydroxyacyl CoA dehydrogenase in accordance with the previously described, except that the assays were performed in the presence of CoA (Filppula et al., J. Biol. Chem. 270: 27453-57 (1995)). A severe inhibition of the coupling enzyme product was observed in the absence of CoA. The assay contained (1 mL of final volume) 60 uM of crotonyl CoA, 50 uM of Tris-Cl, pH 9, 50] iq of bovine serum albumin per mL, 50 mM of KC1, 1 mM of NAD, 7 ig of ß -hydroxyacyl CoA dehydrogenase specific for L from porcine heart per mL and 0.25 mM CoA. The assay was started with the addition of FaoAB to the assay mixture. A control assay without substrate was carried out to determine the rate of NAD consumption in the absence of the product generated by hydratase, S-hydroxybutyryl CoA. One unit of activity is defined as the consumption of one uMol of NAD per minute (e34? - 6220 M ^ crrT1). Hydroxyacyl CoA dehydrogenase was tested in the reverse direction with acetoacetyl CoA as a substrate by monitoring the conversion of NADH to NAD at 340 nm (Binstock, et al., Methods in Enzymology, 7: 1, 403 (1981)). The assay contained (1 mL of final volume) 2 ??, 0.1 M, pH 7, 0.2 mg of bovine serum albumin per mL, 0.1 mM of NADH, and 33 uM of acetoacetyl CoA. The assay was started with the addition of FaoAB to the assay mixture. If necessary, enzyme samples were diluted in 0.1 M H2P04, pH 7, containing 1 mg of bovine serum albumin per mL. A control assay without acetoacetyl CoA substrate was carried out to detect the rate of consumption of NADH in the crude due to enzymes other than hydroxyacyl CoA dehydrogenase. One unit of activity is defined as the consumption of one uMol of NADH per minute. Hydroxyacyl CoA dehydrogenase was tested in the direct direction with crotonyl CoA as a substrate by monitoring the conversion of NAD to NADH at 340 nm (Binstock, et al., Methods in Enzymology, | 71: 403 (1981)). The assay mixture contained (1 mL of final volume) 0.1 M KH2P04, pH 8, 0.3 mg of bovine serum albumin per mL, 2 mM of β-mercaptoethanol, 0.25 mM of CoA, 30 uM of crotonyl CoA, and an aliquot of FaoAB. The reaction was preincubated for a couple of minutes to allow in situ formation of S-hydroxybutyryl CoA. The assay was then initiated by the addition of NAD (0.45 mM). A control assay without substrate was performed to detect the rate of consumption of NAD due to enzymes other than hydroxyacyl CoA dehydrogenase. A unit of activity is defined as the consumption of one uMol of NAD per minute (€ 340 = 6220 M "1cm" 1). The thiolase activity was determined by monitoring the absorption decrease at 304 nm due to the consumption of acetoacetyl CoA substrate in accordance with that previously described with some modifications (Palmer, et al., J. Biol. Chem. 266: 1-7 (1991)). The assay contained (final volume 1 mL) 62.4 mM Tris-Cl, pH 8.1, 0.8 mM MgCl2, 62.5 uM CoA, and 62.5 uM acetoacetyl CoA. The assay was started with the addition of FaoAB to the assay mixture. A control sample without enzyme was carried out for each test in order to detect the substrate degradation rate of pH 8.1 in the absence of enzyme. One unit of activity is defined as the consumption of one uMol of acetoacetyl CoA substrate per minute (e34? = 16900 M ^ cm "1). The epimerase activity was tested in accordance with that previously described (Binstock et al., Methods in Enzymology , 71_: 403 (1981)) except thioesters of R-3-hydroxyacyl CoA were used instead of mixtures of D, L-3-hydroxyacyl CoA The test contained (final volume 1 mL), 30 uM of R-3 -hydroxyacyl CoA, 150 mM of KH2P0 (pH 8), 0.3 itig / mL of BSA, 0.5 mM of NAD, 0.1 mM of CoA, and 7 ug / mL of β-hydroxyac 1 CoA dehydrogenase specific for L from porcine heart The assay was initiated with the addition of FaoAB.For the expression of FaoAB in DH5alpha / pMFX3, cultures were grown in 2xTY medium at a temperature of 30 ° C. The 2xTY medium contains (per L) 16 g of tryptone, 10 g of yeast and 5 g of NaCl An initiator culture was grown overnight and used to inoculate (1% inoculum) a fresh medium (100 mL in 250 mL in an Erlenmeyer flask) for small-scale cultivation; 1.5L in a 2.8L jar for large-scale cultivation). The cells were induced with 0.4 mM of IPTG when the absorbance at 600 nm was found within a range of 0.4 to 0.6. Cells were cultured for an additional 4 hours before harvest. The cells were lysed by sonication, and the insoluble matter was removed from the soluble proteins by centrifugation. The acyl CoA dehydrogenase activity was monitored in the reverse direction to ensure the activity of the FaoA subunit (SEQ ID NO: 31) and the thiolase activity was assayed to determine the activity of the Fao subunit. FaoAB in D H5alpha / pMFX3 contained dehydrogenase and thiolase activity values of 4.3 and 0.99 U / mg, respectively, which is significantly more than the values 0.0074 and 0.0033 U / mg observed for dehydrogenase and thiolase, respectively, in control strains DH5alpha / pTRCN. FaoAB was purified from DH5alpha / pMFX3 using a modified procedure previously described for the purification of FaoAB from Pseudomonas fragi (Imamura, et al., J. Biochem.107: 184-89 (1990)). The thiolase activity (tested in the direct direction) and the dehydrogenated activities (tested in the reverse direction) were monitored during the purification. Three liters of DH5alpha / pMFX3 cells (2 X 1.5 L aliquots in 2.8 L Erlenmeyer flasks) were cultured in a 2 x TY medium using the cell culture method previously described to prepare cells for analysis of enzyme activity. Cells (15.8 g) were resuspended in 32 mL of 10 mM KH2P04, pH 7, and lysed by sonication. The soluble proteins were removed from the insoluble cell residues by centrifugation (18,000 revolutions per minute, 30 minutes, 4 ° C). The soluble extract was prepared 50% in acetone and the precipitated protein was isolated by centrifugation and dissolved again in 10 mM of KH2P04, pH 7. The sample was adjusted to a saturation of 33% with (NH4) 2S04 and the soluble proteins insolubles were separated by centrifugation. The resulting supernatant was adjusted to a saturation of 55% with (NH4) 2S04 and the insoluble pellet was isolated by centrifugation and dissolved in 10 mM KH2P04, pH 7. The sample was heated at a temperature of 50 ° C for 30 minutes and the soluble proteins were isolated by centrifugation and dialyzed in a molecular weight cut-off membrane from 6,000 to 8,000 in 10 mM KH2P04, pH 7 (2 X 3L, 20 hours). The sample was loaded on a Toyo Jozo DEAE FPLC column (3 cm x 14 cm) that had previously been equilibrated in 10 mM KH2P04 / pH 7. The protein was eluted with a linear gradient (100 mL per 100 μL, from 0 to 500 mM NaCl in 10 KH2P04 / pH 7) at a flow rate of 3 mL / min. FaoAB was eluted between 300 and 325 mM NaCl. The sample was dialyzed in a 50,000 molecular weight cut-off membrane in 10 mM KH2P04 / pH 7 (IX 2L, 15 hours) before being loaded onto a FPLC column (2 cm x 15 cm) of macro-prep from Hydroxylapatite 18/30 (Biorad) that had previously been equilibrated in 10 mM KH2P04, pH 7. The protein was eluted with a linear gradient (250 mL by 250 mL, from 10 to 500 IrmM of KH2P04, pH 7) at a rate flow rate of 3 mL / min. FaoAB was eluted between 70 and 130 mM of KH2P04. The fractions containing the activity were concentrated to 9 mL using a 100,000 MILLIPORE® molecular weight cut-off concentrator. The regulator was changed 3 times with 10 mM KH2PO4, pH 7 containing 20% sucrose and frozen at a temperature of -70 ° C. The enzymatic activities of the purified fraction of hydroxylapatite were tested with a range of substrates. The results appear in table 1 below. Table 1: Enzyme and activity substrates Enzyme substrate activity (U / mg) Crotonyl hydratase CoA 8.8 dehydrogenase (direct) Crotonyl CoA 0.46 dehydrogenase (reverse) acetoacetyl CoA 29 thiolase acetoacetyl CoA 9.9 epimerase R-3-hydroxyoctanyl CoA 0.022 epimerase R-3 -hydroxyhexanil CoA 0.0029 epimerase R-3-hydroxybutyryl CoA 0.000022
Example 2: Production of FaoAB antibodies and FaoAB polypeptides After purification of the FaoAB protein in accordance with that described in Example 1, a sample was separated by SDS-PAGE. The protein band corresponding to FaoA (SEQ ID NO: 31) and FaoB (SEQ ID NO: 26) was removed and used to immunize white rabbits of the New Zealand breed with. Freund's complete adjuvant. Reinforcements were performed using incomplete Freund's adjuvant at three-week intervals. The antibodies were recovered from the soil by affinity chromatography on protein A column (Pharmacia) and tested against the antigen by Western blot procedures. Extracts of control of Brassica seeds were used to test the cross reactivity with vegetable proteins. No cross-reactivity was detected. Example 3: Construction of plasmids for the expression of fao AB genes of Pseudomonas putido in transgenic oilseeds Construction of pSBS2024 Oligonucleotide primers GVR471 5 '-CGG ¾CCCATTGTACTCCCAGTATCAT-3' (SEQ ID NO: 8) and GVR472 5 '-CArrrAAAmGTAGAGTATTGAATATG-3 '(SEQ ID NO: 9) homologues to the sequences flanking the 5' and 3 'ends (underlined) respectively, of the bean phaseolin promoter (SEQ ID NO: 10; Slightom et al., 1983) were designed with the addition of Kpnl (in italics, nucleotides 1-7 in SEQ ID NO: 8) and SwaI (in italics, nucleotides 1-9 in SEQ ID O:) at the 5 'ends of GVR471 and GVR472, respectively.
T restriction sites were incorporated to facilitate cloning. The primers were used to amplify a 1.4 kb phaseolin promoter that was cloned into the Smal site in pUC19 by ligation of flat ends. The designated plasmid, pCPP1 (see Figure 2) was cut with SalI and SwaI and ligated onto a SalI / SwaI phaseolin terminator (SEQ ID NO: 27). The bean phaseolin terminator sequence spanning the polyadenylation signals was amplified using the following polymerase chain reaction primers: GVR 396: 5 '-GATTTAAATGCAAGCTTAAATAAGTATGAACTAAAATGC-3' (SEQ ID NO: 22) and GVR397: 5 '- CGGTACCTTAGTTGGTAGGGTGCTA-3 '(SEQ ID NO: 23) and the 1.2 Kb fragment (SEQ ID NO: 27) was cloned into the Sall-Sal site of pCCPl to obtain pSBS2024 (Figure 2). The resulting plasmid containing a unique HindIII site for cloning was named pSBS2024 (Figure 2). Construction of pSBS2025 A fragment of soybean oleosin promoter (SEQ ID NO: 11;
Rowley et al., 1997) was simplified with primers flanking the DNA sequence. Initiator JA408 5 '- rCTAGATACATCCATTTCTTAATATAATCCTCTTATTC-3' (SEQ ID NO: 12) contains sequences that are complementary to the 5 'end (underlined). The npl primer 5 '-CATTTAAATGGTTAAGGTGAAGGTAGGGCT-3'. { SEQ ID NO: 13) contains sequences homologous to the 3 'end (underlined) of the promoter fragment. The restriction sites Xtíal (in italics) and SwaI (in italics) were incorporated in the 5 'end of JA408 and npl, respectively, in order to facilitate cloning. The primers were used to amplify a promoter fragment of 975 base pairs, which was then cloned into the Small site of pUC19 (see Figure 2). The resulting plasmid pCSPI was cut with Sali and SwaI and ligated to the soy terminator (SEQ ID NO: 28). The soybean oil oleosin terminator was amplified by polymerase chain reaction employing the following primers: JA410: 5 '-AAGCTTACGTGATGAGTATTAATGTGTTGTTATG-3' (SEQ ID NO: 29) and JA411: 5'-TCTAGACAATTCATCAAATACAAATCACATTGCC-3 '(SEQ ID NO: 30) and the 225 base pair fragment was cloned into the Sall-Swal site of pCSPl to obtain the plasmid pSBS2025 (Figure 6). The designated plasmid, pSBS 2025, carried a unique Hindi site for cloning (figure 2). Construction of promoter coding sequence fusions Two oligonucleotide primers were syntzed: np2 5 'AAGCrrAAAATGATTTACGAAGGTAAAGCC-3' (SEQ ID NO: 14) homologous to nucleotides 553 to 573 of the 5 'flank sequences, and np3 5-ATTGCrriTCAGTTGAAGCGCTG-3 '(SEQ ID NO: 15) complementary to nucleotides 2700 to 2683 flank the 3' end of mfl (faoA, SEQ ID NO: 24) of plasmid pmfx3. A Hindi site (in italics) was introduced at the 5 'end of the np2 and np3 primers to facilitate cloning. In addition, an AAA sequence of 3 base pairs (bold) was incorporated to obtain a more favorable sequence surrounding the plant translation initiation codon. The np2 and np3 primers were used to amplify the fragment and cloned into the Smal site of pUC19. The resulting plasmid was called pCmfI (see Figures 3A and 3B). Plasmid pBmf2 was constructed in a similar process (Figures 5A and 5B). In order to generate a Hindi (in italics) at the 5 'and 3' ends of the mf2 (faoB) gene (SEQ ID NO: 25) for cloning, a second set of synthetic primers was designed. Initiators np4 5 '-AAGCT ?????? GAGC CTG ATCCAAGAGAC-3' (SEQ ID NO: 16) complementary to the sequence 5 '(nucleotides 2732-2752 base pairs) and np5 5' AAGCTTTCAGACGCGTTCGAAGACAGTG-3 '(SEQ ID NO: 17) homologue to the 3 'sequence (nucleotides 3907-3886 base pairs) of mf2 (faoB, SEQ ID NO: 25) of plasmid pmfx3 were used in a polymerase chain reaction to amplify the DNA fragment of 1.17 kb. The resulting polymerase chain reaction product was cloned into the EcoRV site of pBluescript. The plasmid was known as pBmf2. Both plasmids were cut individually with Hindi and their inserts were cloned into plasmids pSBS2024 and pSBS2025 that had previously been linearized with the same restriction enzyme. As a result, the following plasmids were generated: pmfl24 and pmfl25 (Figures 3A and 3B) and pmf225 and pmf225 (Figures 5A and 5B) containing the Fao genes (mfl and mf2) fused in either the phaseolin or soybean promoter . DNA sequence analysis confirmed the correct fusions of promoter-coding sequence termination sequence for pmfl24, pmfl25, pmf224, and pmf225. Example 4: Fusion assembly of promoter coding sequences in plant transformation vectors After obtaining the plasmids pmfl24, pmfl25, pmf224, and pmf225, fusions of promoter coding sequences were cloned independently into the binary vectors, pCGN1559 (McBride and Summerfelt, 1990) containing the CaMV 35S promoter that drives the expression of the NPTII gene (which confers resistance to the antibiotic kanamycin) and pSBS2004 which contains a parsley ubiquitin promoter that drives the PPT gene, which confers resistance to the herbicide phosphinothricin. Binary vectors suitable for this purpose with several selectable markers can be obtained from several sources. The phaseolin-mf21 fusion cassette was released from the plasmid of origin with Xbal and ligated with pCGN1559, which had been linearized with the same restriction enzyme. The resulting plasmid was designated pCGmfl24 (Figures 3A and 3B). The pCGmfl25 plasmid containing the soybean-mfl fusion was constructed in a similar manner (Figures 3A and 3B), except that both pmfl25 and pCGN1559 were cut with BamEI before ligation. Construction of pmf! 249 and pmf! 254 Plasmid pSBS2004 was linearized with a BamHI fragment containing the soy-mfl fusion. This plasmid was designated pmfl254 (Figures 4A and 4B). Similarly, the Xbal phaseolin-mf1 fusion fragment was ligated with pSBS2004 which had been linearized with the same restriction enzyme. The resulting plasmid was designated pmfl249 (Figures 4A and 4B). Construction of pCGmd224 and pCGmf225 The phaseolin-mf2 and soybean-mf2 fusions were constructed by removing fusions from the vector by cleaving with either BamHI or Xbal, and cloned into pCGN1559 that had been linearized with any of these restriction enzymes ( Figures 5A and 5B). Construction of pCGmflP2S and pCGmf2P! S Two expression cassettes containing the fusions of promoter coding sequences were assembled in the same binary vector as follows: the plasmid pmfl24 containing the phaseolin-mf1 fusion was cut with BamHI and cloned into the BamHI site of pCGN1559 to create pCGmfB124. This plasmid was then linearized with Xbal and ligated into the fragment X £ >to that of pmf225 that contained the soy-mf2 fusion. The final plasmid was designated pCGmflP2S (Figures 6A and 6B). The plasmid pCGmf2PlS was assembled in a similar manner. The phaseolin-mf2 fusion was released from pmf224 by cutting with BamHI and cloned into the BamHI site of pCGN1559. The resulting plasmid, pCGmFB224, was linearized with Xbal and ligated into the Xbal fragment of pmfl25 which contained the soy-mfl fusion (Figures 6A and 6B). Example 5: Transformation of Brassica Brassica Seeds were surface sterilized in commercial 10% bleach (Javex, Colgate-Palmolive) for 30 minutes with gentle agitation. The seeds were washed three times in sterile distilled water. The seeds were placed in a germination medium comprising Murashige-Skoog (MS) and vitamin salts, 3% sucrose (weight / volume) and 0.7% phytagar (weight / volume), pH 5.8 at a density of 20 plate and was maintained at a temperature of 24 ° C and during photoperiod of 16 hours of light / 8 hours of darkness with a light intensity of 60-80 pEm "2s" 1 for four to five days. Each of the constructs, pCGmfl24, pCGmfl25, pCGmf224, pCGmflP2S, and pCGmf2PlS was introduced into strain EHA101 of Agrobacterium tumefacians (Hood et al., J. Bacteriol., 168: 1291-1301 (1986)) by electroporation. Before the transformation of the cotyledonary petioles, individual colonies of strain EHA101 containing each construct were cultured in 5 ml of minimal medium supplemented with 100 mg of kanamycin per liter and 100 mg of gentamicin per liter for 48 hours at a temperature of 28 ° C. . One milliliter of bacterial suspension was formed into pellets by centrifugation for 1 minute in a microcentrifuge. The pellet was resuspended in 1 ml of minimal medium. For the transformation, the cotyledons were removed from small plants of 4 days or in some cases 5 days, in such a way that they included approximately 2 mm of petiole in the base. Individual cotyledons with the cut surface of their petioles were immersed in a diluted bacterial suspension for 1 second and immediately placed at a depth of approximately 2 mm in a co-culture medium, MS medium with 3% sucrose (weight / volume) and 0.7% of phytagar and enriched with 20 uM of benziladenina. The inoculated cotyledons were plated at a density of 10 per plate and incubated under the same growth conditions for 48 hours. After co-culture, the cotyledons were then transferred to a regeneration medium containing MS medium supplemented with 3% sucrose, 20 μ? of benziladenine, 0.7% phytagar (weight / volume), pH 5.8, 300 mg of timentinine per liter, and 20 mg of kanamycin sulfate per liter. After two to three weeks, shoots were cut and maintained in a medium of "shoot elongation" (MS medium containing 3% sucrose, 300 mg of timentinin per liter, 0.7% (weight / volume) of phytagar, 300 mg of timentinine per liter and 20 mg of kanamycin sulfate per liter, pH 5.8) in Magenta bottles. The elongated shoots were transferred to a "root" medium containing MS medium, 3% sucrose, 2 mg indole butyric acid per liter, 0.7% phytagar and 500 mg carbenicillin per liter. After emergence of the roots, the small plants were transferred to a pot culture mix (Redi Earth, W.R. Grace and Co.). The plants were kept in a humidification chamber (75% relative humidity) under the same growth conditions. Two to three weeks after growth, leaf samples were taken for neomycin phosphotransferase (NPTII) assays (Moloney et al., Plant Cell Reports 8: 238-42 (1989)). Seeds of the FaoA and FaoB transgenic lines can be analyzed for the expression of the fatty acid oxidation polypeptides by western blot using anti-FaoA and anti-FaoB antibodies. The FaoB polypeptide (SEQ ID NO: 26) is not functional in the absence of the FaoA gene product; however, the FaoAB gene product has an enzymatic activity. Transgenic lines expressing the FaoA and FaoB complex are obtained by crossing the transgenic FaoA and FaoB lines expressing the individual polypeptides and the seeds are analyzed by Wester blot and enzyme assays as described. Example 6: Transformation of B. napus cv. Westar and analysis of transgenic lines Transformation The protocol used was adapted from the procedure described by Moloney et al. (1989). Seeds of Brassica napus cv. Westar were superficially sterilized in commercial 10% bleach (Javex, Colgate-Palmolive Canada Inc.) for 30 minutes with gentle shaking. The seeds were washed three times in sterile distilled water. Seeds were placed in germination medium containing Murashige-Skoog (MS) and vitamins, 3% sucrose and 0.7% phytagar, pH 5.8, at a density of 20 per plate and the seeds were maintained at a temperature of 24 ° C in a photoperiod of 16 hours of light / 8 hours of darkness with a light intensity of 60 to 80 μ ???? e "1 for four or five days.Each of the constructs pCGmfl24, pCGmfl25, pCGmf224, pCGmf225 , pCGmflP2S, and pCGmf2PlS was introduced into the strain EHA101 of Agrobacterium tumefaciens (Hood et al., 1986) by electroporation Before the transformation of the cotyledonary petioles, individual colonies of strain EHA101 containing each construct were cultured in 5 ml of minimal medium Complied with 100 mg of kanamycin per liter, and 100 mg of gentamicin per liter for 48 hours at a temperature of 28 ° C. One milliliter of bacterial suspension was formed into pellets by centrifugation for one minute in a microcentrifuge. The pellet was resuspended in 1 mL of minimal medium. For the average transformation, the cotyledons were removed from small plants of 4 days and in some cases 5 days in such a way that they included approximately 2 p of petiole in the base. Individual cotyledons with the cut surface of their petioles were immersed in a bacterial suspension diluted for one second and immediately placed at a depth of about 2 mm in a co-culture medium, MS medium with 3% sucrose and 0.7 phytase, enriched with 20 μ? of benzyladenine. The inoculated cotyledons were plated at a density of 10 per plate and incubated under the same growth conditions for 48 hours. After co-culture, the cotyledons were then transferred to a regeneration medium containing MS medium supplemented with 3% sucrose, 20 uM of benzyladenine, 0.7% of phytagar, pH 5.8, 300 mg of timentinin per liter, and 20 mg of kanamycin sulfate per liter. After two to three weeks, regenerant shoots were obtained, cut and maintained in a medium of "shoot elongation" (MS medium containing 3% of sucrose, 300 mg of timentin per liter, 0.7% of phytagar, and 20 mg of kanamycin per liter, pH 5.8) in Magenta bottles. The elongated shoots were then transferred to a "root" medium containing MS medium, 3% sucrose, 2 mg indole butyl butyric acid per liter, 0.7% phytagar and 500 mg carbenicillin per liter. After emergence of the roots, the small plants were transferred to a pot culture mix (Redi Earth, W.R. Grace and Co. Canada Ltd.). The plants were kept in a humidification chamber (relative humidity of 75%) in the same growing conditions. Two to three weeks after growth, leaf samples were taken for neomycin phosphotransferase (NPT II) assays (Moloney et al., 1989). The results appear in table 2 below. The data shows the number of plants that were confirmed as transformed. Table 2: NPT II Activity in Transformed Plants Constructs number of NPTII NPTII Number of plants tested confirmed plants with confirmed transformation
1pCGmfl24 47 27 23 33 2pCGmfl25 37 28 18 18 3pCGmf224 49 40 30 39. 4pCGmf225 52 37 28 34 5pCGmflP2S 27 27 21 21 6pCGmf2plS 1pCGmfl24 - bean phaseolin regulation sequences that drive the FaoÁ gene 2pCGmfl25 - soybean oleosin regulation sequences that drive the FaoA gene 3pCGmf224 - bean phaseolin regulation sequences that drive the FaoB gene pCGmf225 - soybean oleosin regulatory sequences that drive the FaoB gene 5pCGmflP2S - bean phaseolin regulation sequences and soybean oleosin that drive the FaoA and FaoB genes respectively 5pCGmf2plS - phaseolin regulation sequences of beans and soybean oleosin that drive the FaoB and FaoA genes, respectively. The fate of the transforming DNA was investigated for sixteen randomly selected transgenic lines. Southern DNA hybridization analysis showed that FaoA and / or FaoB were integrated into the genomes of the transgenic lines tested. Approximately 80% of the transgenic plants pmfl24 where the FaoA gene is expressed from the strong bean phaseolin promoter were found to be sterile males. A clearly elevated level expression of the FaoA gene from this promoter results in the functional expression of the FaoA gene product which adversely affects the development of the seeds and / or pollen. This result was very unexpected since it was not anticipated that the plant cells could carry out the first step in the ß-oxidation pathway in the cytosol. However, this result offers additional applications for the expression of ß-oxidation genes in plants for sterility of males for hybrid production or to prevent seed production. It was also observed that, in a side-by-side comparison with normal transgenic lines, the pmfl24 lines produced much higher levels of biomass, possibly due to the elimination of seed development. This phenotype may therefore be useful as a means to increase the amount of green biomass produced per acre for silage, forage and other biomass crops. Here, the use of an inducible promoter system or a recombinase technology could be used to produce seeds for planting. 7 of the sterile plants were successfully cross-pollinated with pollen from the pmf225 transgenic lines and produced seeds. A Northern analysis on RNA from seeds of the pmf 224 lines containing the promoter phaseolin-FaoB construct showed a signal indicative of the expected transcriptor of 1.2 kb in all samples tested except the control. A Northern analysis on seed RNA from the pmf 125 lines containing the weak FaoA soybean oleosin promoter constructs revealed a transcript of the expected size of 2.1 kb. Western blot analysis on 300-500 protein from approximately 80% of plant seeds pmfl25 where the FaoA gene is expressed from the relatively weak soybean oil promoter was inconclusive, even when a weak signal was detected on a line transgenic Analysis of Fatty Acids Given the unexpected results that indicate a strong metabolic effect of the expression of the FaoA gene from the phaseolin promoter of strong bean in seeds, the profile of the fatty acids of the seeds was analyzed from transgenic lines expressing the FaoA gene of the weak soybean oleosin promoter. Seeds that express only the FaoA gene or that also express the FaoB gene from the bean phaseolin promoter were examined. The analysis was carried out in accordance with that described in Millar et al., The plant Cell 11: 1889-902 (1998). Fatty Acid Methyl Esters (FAMES) from seeds were prepared by placing 10 seeds of B. Napus in glass tubes capped with a 15 x 45 mm thread and heated to a temperature of 80 ° C in 0.75 mL of methanolic HCL reagent 1N (Supelco, PA) and 10 μ? 1 mg 17: 0 methyl ester (internal standard) per mL during the night. After cooling the samples, the FAMES were extracted with 0.3 mL of hexane and 0.5 mL of 0.9% NaCl by subjecting to a vigorous vortex. Samples were left to separate the phases and 300 μ? of the organic phase which was analyzed in a Hewlett-Packard gas chromatograph. The analysis of fatty acid profiles indicated the presence of a component. additional or increased component in the lipid profile in all of the transgenic plants expressing the FaoA gene SEQ ID NO: 24 absent from the control plants. This result again conclusively confirms that the FaoA gene is transcribed and translated and that the FaoA polypeptide SEQ ID NO: 27 is catalytically active. This peak was also observed in 11 additional transgenic plants containing SoyP-FaoA, PhaP-FaoA-SoyP-FaoB, SoyP-FaoA-PhaP-FaoB and a sterile plant (PAP-FaoA) cross-pollinated with SoyP-FaoB. These data clearly demonstrate the functional expression of the FaoA gene and that even very low levels of expression are sufficient to change the lipid profile of the seed. By adapting the methods described herein, one skilled in the art can express these genes at intermediate levels between those obtained with the phaseolin promoter and the soybean oleosin promoter using other promoters such as the Arabidopsis oelosin promoter, napin promoter, or promoter. of cruciferin, and it is also possible to use systems of inducible promoters or recombinase technologies to control the expression of transgenes of fatty acid oxidation. Example 7: Multifunctional Enzymatic Complex of yeast ß-oxidation. S. cerevisiae contains a ß-oxidation pathway that proceeds through R-hydroxyacyl CoA instead of S-3-hydroxyacyl CoA that is observed in bacteria and higher eukaryotes. The fox2 gene of the yeast encodes a hydratase which produces R-3-hydroxyacyl CoA from trans-2-enoyl-CoA and a dehydrogenase which employs R-3-hydroxyacyl-CoA to produce β-ketoacyl CoAs. The fox2 gene (the sequence shown SEQ ID N0: 1) was isolated from S. cerevisiae genomic DNA by a polymerase chain reaction in two pieces. The N-fox2b and N-bamfox2b primers were used to polymerase chain reaction a 1.1 kb Smal / BamHI fragment encoding the N-terminal region of Fox2, and the c-fox2 and C-bamfox2 primers were used to subjecting a 1.6 kb BamHI / Xbal fragment coding for the C-terminal Fox2 region to a polymerase chain reaction. The entire Fox2 gene was reconstructed through subcloning in pTRCN vector. N-fox2b fox2 tcc ccc ggg agg agg ttt tta tta tgc ctg gaa att tat cct tea aag ata gag tt (SEQ ID NO: 18) N-bamfox2b fox2 aaggatccttgatgtcatttacaactacc (SEQ ID NO: 19)
C-fox2 fox2 gct cta gat agg gaa aga tgt atg taa g (SEQ ID NO: 20) C-bamfox2 fox2 Tgacatcaaggatcctttt The foxl gene, however, does not possess the β-quetothiolase activity and this activity must be supplied by a second transgene . Representative sources of such a gene include algae, bacteria, yeast, plants and mammals. The bacterium Alcaligenes eutrophus possesses a β-quetothiolase gene of broad specificity suitable for use in the methods described herein. It can be easily isolated using the acetoacetyl-CoA thiolase gene as a hybridization probe, in accordance with that described in US Pat. No. 5,661,026 of Peoples et al. This enzyme has also been purified (Haywood et al., FEMS Micro.Lett.:52:91 (1988)), and the purified enzyme is useful for preparing antibodies or for determining protein sequence information as a basis for gene isolation. Example 8: ß-Plant Oxidation Gene The DNA sequence of the cDNA encoding the ß-oxidation tetrafunctional protein, which is shown in SEQ ID NO; 4, can be isolated in accordance with that described in Preising-Muller et al., J. Biol. Chem. 269: 20475-81 (1994). The equivalent gene can be isolated from other plant species including Arabidopsis, Brassica, soybean, sunflower and corn using similar procedures or by screening genomic libraries, many of which are commercially available, for example, from Clontech Laboratories Inc. , Palo Alto, California, United States of America. A peroximal focusing sequence P-R-M was identified at the carboxy terminus of the protein. Suitable constructs for expression in the plant cytosol can be prepared by amplification by polymerase chain reaction of this gene using primers designed to remove this sequence.
SEQUENCE LISTS < 110 > Metabolix, Inc. < 120 > Modification of fatty acid metabolism in plants < 130 > MBX 024 < 140 > < 141 > < 150 > 60 / 077,107 < 151 > 1998-03-06 < 160 > 31 < 170 > Patentln ver. 2.0. < 210 > 1 < 211 > 2703 < 212 > DNA < 213 > Saccharomyces < 220 > < 221 > gene < 222 > (1) .. (2703) < 223 > fox2 gene < 400 > 1 atttatcctt atgcctggaa gttgttgtaa caaagataga tcacgggcgc tggagggggc 60 ttaggtaagg tgtatgcact agcttacgca agcagaggtg caaaagtggt cgtcaatgat 120 ctaggtggca ctttgggtgg ttcaggacat aactccaaag ctgcagactt agtggtggat 180 gagataaaaa aagccggagg tatagctgtg gcaaattacg tgaaaatgga actctgttaa 240 gagaaaataa ttgaaacggc tataaaagaa ttcggcaggg ttgatgtact aattaacaac 300 gctggaatat taagggatgt ttcatttgca aagatgacag aacgtgagtt tgcatctgtg 360 gtagatgttc atttgacagg tggctataag ctatcgcgtg ctgcttggcc ttatatgcgc 420 tctcagaaat ttggtagaat cattaacacc gcttcccctg ccggtctatt tggaaatttt 480 ggtcaagcta attattcagc agctaaaatg ggcttagttg gtttggcgga aaccctcgcg 540 aaggagggtg ccaaatacaa cattaatgtt aattcaattg cgccattggc tagatcacgt 600 atgacagaaa acgtgttacc accacatatc ttgaaacagt caggaccgga aaaaattgtt 660 cccttagtac tctatttgac acacgaaagt acgaaagtgt caaactccat ttttgaa tc 720 gctgctggat tctttggaca gctcagatgg gagaggtctt ctggicaiat tttcaaccca 78C gaccccaaga catatactcc tgaagcaatt ttaaataagt ggaaggaaat cacagactat 840 aggga aagc cattta ACAA aactcagcat atcaccaaag caaaaaaatt acctcccaat gaacaaggct cagLgaaaat caagccgcct 960 tgcaauaaag tcgtagtagt tacgggtgca ggaggtgg c ttggga gtc tcacgcaacc 10-0 tggLLLgcac ggtacggtgc gaaggtagtt gtaaatga to lcaaggalcc tttttcagtt 1030 gttgaagaaa taaataaact atatgg gaa ggcacagcc-i .tccagact.c ccJLgatgtg 1140 gtcaccgaag ctcctctcat tatccaaact gcaataagta agcttcagag agtagacatc 1200 ttggtcaata acgctggtat tttgcgtgac aaatcttttt taaaaatgaa agacgaggaa 1260 tggtttgctg tcctgaaagt ccaccttttt tccacatctt cattgtcaaa agcagtatgg 1320 ccaaacaaaa ccaatattta gtctggattt attatcaata ctacttctac ctcaggaatt 1380 tatggtaatt ttggacaggc caattatgcc gctgcaaaag ccgccatttt aggattcagt 1440 aaaactattg cactggaagg tgccaagaga ggaattattg ttaatgttat cgctcctcat 1500 gcagaaacgg ctatgacaaa gactatattc tcggagaagg aattatcaaa ccactttgat 1560 gcatctcaag tctccccact tgttgttttg ttggoatctg aagaactaca aaagtattct 1620 ttattggcca ggaagaaggg attattcgaa gttggcggtg gttggtgtgg gcaaaccaga 1680 gttccggtta tggcaaagaa tgtttctatt aaagagacta ttgaaccgga agaaattaaa 1740 gaaaattgga accacatcac tgatttcagt cgcaacacta tcaacccgag ctccacagag 1800 gagtcttcta tggcaacctt gcaagccgtg caaaaagcgc actcttcaaa ggagttggat 1860 gatggattat tcaagtacac taccaaggat tgtatcttgt acaatttagg acttggatgc 1920 agcttaagta acaagcaaag cacctacgag aatgatccag acttccaagt tttgcccacg 1330 ttcgccgtca ttccatttat gcaagctact gccacactag ctatggacaa tttagtcgat 2040 aacttcaatt atgcaatgtt actgcatgga gaacaatatt ttaagctctg cacgccgaca 2100 atgccaagta atggaactct aaagacactt gctaaacctt tacaagtact tgacaagaat 2160 ggtaaagccg ctttagttgt tggtggcttc gaaacttatg acattaaaac taagaaactc 2220 atagcttata acgaaggatc gttcttcatc aggggcgcac atgtacctcc agaaaaggaa 2280 gtgagggatg ggaaaagagc caagtttgct gtccaaaatt ttgaagtgcc acatggaaag 2340 ttgaggcgga gtaccagatt gatttc tacg aataaagatc aagccgcatt gtacaggtta 24C0 tctggcgatt tcaatccttt acatatcgat cccacgctag ccaaagcagt taaatttcct 2460 acgccaattc tgcatgggct ttgtacatta ggtattagtg cgaaagcatt gtttgaacat 2520 tatggtccat atgaggagtt gaaagtgaga tttaccaatg ttgttttccc aggtgatact 2S80 ctaaaggtta aagcttggaa gcaaggctcg gttgtcgttt ttcaaacaat tgatacgacc 2S4C agaaacgtca ttgtattgga taacgccgct gcaaaactat atctaaacta cgcaggcaaa 2700 taa 2703
< 210 > 2 < 211 > 900 < 212 > PRT < 213 > Saccharomyces < 220 > < 221 > PEPTIDE < 222 > (1) .. (900) < 223 > polypeptide encoded by fox2 < 400 > 2 Mee Pro Gly Asr. Leu Ser Phe Lys Asp Arg Val Val Val lie Thr Gly 1 5 10 15
Aia Gly Gly Gly Leu Gly Lys Val Tyr Ala Leu Ala Tyr Ala Sor Arg 20 25 30
Gly Ala Lys Val Val Val Asn Asp Leu Gly Gly Thr Leu Giv Glv Ser 35 40 45 Gly His Asn Ser Lys Wing Wing Asp Leu Val Val Asp Glu lie Lys Lys 50 55 60
Wing Gly Gly lie Wing Val Wing Asn Tyr Asp Ser Val Asn Glu Asn Gly 65 70 75 80
Glu Lys lie lie Glu Thr Ala lie Lys Glu Phe Gly Arg Val Asp Val 85 90 95
Leu lie Asn Asn Ala Gly lie Leu Arg Asp Val Ser Phe Ala Lys Met 100 105 110
Thr Glu Arg Glu Phe Ala Ser Val Val Asp Val His Leu Thr Gly Gly 115 120 125
Tyr Lys Leu Ser Arg Wing Wing Trp Pro Tyr Met Arg Ser Gln Lys Phe 130 135 140
Gly Arg Lie Lie Asn Thr Ala Ser Pro Ala Gly Leu Phe Gly Asn Phe 145 150 155 160
Gly Gln Wing Asn Tyr Wing Wing Lys Met Gly Leu Val Gly Leu Wing 165 170 175
Glu Thr Leu Wing Lys Glu Gly Wing Lys Tyr Asn lie Asn Val Asn Ser 180 185 190 lie Wing Pro Leu Wing Arg Being Arg Met Thr Glu Asn Val Leu Pro Pro 195 200 20S
His lie Leu Lys GLn Leu Gly Pro Glu Lys lie Val Pro Leu Val Leu 210 215 220
Tyr Leu Thr His Glu Ser Thr Lys Val Ser Asn Ser lie Phe Glu Leu 225 230 235 240
Ala Ala Gly Phe Phe Gly Gln Leu Arg Trp Glu Arg Ser Gly Gln 245 250 255
lie Phe Asn Pro Asp Pro Lys Thr Tyr Thr Pro Glu Ala lie Leu Asn 260 265 270
Lys Trp Lys Glu lie Thr Asp Tyr Arg Asp Lys Pro Phe Asn Lys Thr 275 280 285
Gln His Pro Tyr Gln Leu Ser Asp Tyr Asn Asp Leu lie Thr Lys Ala
290 295 300 Lys Lys Leu Pro Pro Asn Glu Gln Gly Ser Val Lys lie Lys Ser Leu 305 310 315 320
Cys Asn Lys Val Val Val Val Thr Gly Ala Gly Gly Gly Leu Gly Lys 325 330 335
Ser His Ala lie Trp Phe Ala Arg Tyr Gly Ala Lys Val Val Val Asn 340 345 350
Asp lie Lys Asp Pro Phe Ser Val Val Glu Glu lie Asn Lys Leu Tyr 355 360 365
Gly Glu Gly Thr Ala lie Pro Asp Ser His Asp Val Val Thr Glu Ala 370 375 380
Pro Leu lie lie Gln Thr Ala lie Ser Lys Phe Gln Arg Val Asp lie 385 390 395 400
Leu Val Asn Asn Wing Gly lie Leu Arg Asp Lys Ser Phe Leu Lys Met 405 410 415
Lys Asp Glu Glu Trp Phe Wing Val Leu Lys Val His Leu Phe Ser Thr 420 425 430 Phe Ser Leu Ser Lys Wing Val Trp Pro lie Phe Thr Lys Gln Lys Ser 435 440 445
Gly Phe Lie Lie Asn Thr Thr Ser Thr Ser Glyle Tyr Gly Asn Phe 450 455 460
Gly Gln Ala Asn Tyr Ala Ala Ala Ala Ala Ala Lie Leu Gly Phe Ser 465 470 475 480
Lys Thr lie Wing Leu Glu Gly Wing Lys Arg Gly lie lie Val Asr. Val 485 490 495
lie Ala Pro His Wing Glu Thr Wing Met Thr Lys Thr lie Phe Ser Glu 500 505 510
Lys Glu Leu Ser Asn His Phe Asp Wing Ser Gln Val Ser Pro Leu Val 515 520 52S
Val Leu Leu Wing Ser Glu Glu Leu Gln Lys Tyr Ser Gly Arg Arg Val 530 535 S4C
lie Gly Gln Leu Phe Glu Val Gly Gly Gly Trp Cys Gly Gln Thr Arg
545 550 SS5 560
Trp Gln Arg Ser Ser Gly Tyr Val Ser lie Lys Glu Thr lie Glu Pro 565 S70 575
Glu Glu lie Lys Glu Asn Trp Asn His lie Thr Asp Phe Ser Arg Asn 580 585 S90
Thr lie Asn Pro Ser Ser Thr Glu Glu Ser Met Met Ala Thr Leu Gln 595 600 605
Wing Val Gln Lys Wing His Ser Ser Lys Glu Leu Asp Asp Gly Leu Phe 610 615 620
Lys Tyr Thr Thr Lys Asp Cys lie Leu Tyr Asn Leu Gly Leu Gly Cys 625 630 635 640
Thr Ser Lys Glu Leu Lys Tyr Thr Tyr Glu Asn Asp Pro Asp Phe Gln 645 650 655
Val Leu Pro Thr Phe Wing Val lie Pro Phe Met Gln Wing Thr Wing Thr 660 665 670 Leu Wing Met Asp Asn Leu Val Asp Asn Phe Asn Tyr Wing Met Leu Leu 675 680 685
His Gly Glu Gln Tyr Phe Lys Leu Cys Thr Pro Thr Met Pro Ser Asn 690 695 700
Gly Thr Leu Lys Thr Leu Wing Lys Pro Leu Gln Val Leu Asp Lys Asn TOS 710 715 720
Gly Lys Ala Ala Leu Val Val Gly Gly Phe Glu Thr Tyr Asp lie Lys 725 730 735
Thr Lys Lys Leu lie Wing Tyr Asn Glu Gly Being Phe Phe lie Arg Gly 740 74S 750
Ala His Val Pro Pro Glu Lys Glu Val Arg Asp Gly Lys Arg Ala Lys 755 760 765
Phe Ala Val Gln Asn Phe Glu Val Pro His Gly Lys Val Pro Asp Phe 770 775 780
Glu Ala Glu lie Ser Thr Asn Lys Asp Gln Ala Ala Leu Tyr Arg Leu 785 790 795 S00
Ser Gly Asp Phe Asn Pro Leu His lie Asp Pro Thr Leu Ala Lys Wing 805 810 815
Val Lys Phe Pro Thr Pro lie Leu His Gly Leu Cys Thr Leu Gly lie 820 825 830
Be Ala Lys Ala Leu Phe Glu His Tyr Gly Pro Tyr Glu Glu Leu Lys 835 840 845
Val Arg Phe Thr Asn Val Val Phe Pro Gly Asp Thr Leu Lys Val Lys 850 855 860
Wing Trp Lys Gln Gly Ser Val Val Val Phe Gln Thr lie Asp Thr Thr 865 870 875 880
Arg Asn Val lie Val Leu Asp Asn Ala Ala Val Lys Leu Ser Gln Ala 885 890 895
Lys Ser Lys Leu 900 < 210 > 3 < 211 > 2177 < 212 > DNA < 213 > Artificial sequence < 220 > < 221 > gene < 222 > (1) .. (2177) < 223 > tetrafunctional beta-oxidation gene < 220 > < 223 > Artificial sequence description < 400 > 3 atgggaagca atgcaaaagg aagaacggta atggaggtgg gaactgatgg agtagcaata 60 atcaccatca tcaaccctcc agttaactcc ttgtcttttg atgtgttatt cagcctgaga 120 gatagttatg iacaagcctt gagaagagat gatgtgaagg caattgttgt tacaggtgca 180 aagggaaaat tttctggtgg ctttgatata actgcttttg gtgtactcca aggaggaaag 240 ggggagcaac caaatgttag aaacatatca attgaaatga tcactgatat ttttgaagct 300 gcccgaaaac ctgcggttgc agcgatagat ggacttgctt tgggtggagg gttggaggtt 360 gccatggctt gtcatgctcg aatatcaact cctaccgctc aattagggtt gcccgaactt 420 cagctcggaa taattcctgg ttttggagga acacaacggc ttccacgtct tgttggtctc 480 tcaaaggccc tagaaatgat gttgacgtca aagccaatta aaggacaaga agctcattct 540 ttggggttag tggatgccat tgtccctccc gaagagttga tcaacactgc acgtagatgg 600 tcctagagcg gctcttgaaa tgggtccaca gagaagacca gtcttcacag gactgacaag 660 ttagagtctc ttgctgaggc taggaaaata tttaacttag ctagagctca ggcaaagaaa 720 atcttaagca cagtacccaa tacaattgcc tgcattgatg ctgttgaaac gggtgtcgtc 780 tctggccctc gtgctggact ttggaaggag gctgaagaat ttcagggact cccacattct 840 gatacttgca aaagctt aau tcatatcttc tttgcccagc gttcaacaac taaggtacct 900 ggagttactg atctgggttt caaatcaaga ggtaccgaga tgtcggagga aagttgctat 960 ggattaatgg gatctggtat agctacagca ttgattctta gcaactatca tgtggtactt 1020 acgataagtt aaagaagtga cttgcaggct ggcattgaca gagtcagagc aaacctacaa 1080 aaaaagggaa agccgagtca tatgactaat gagaaattcg aaaagagtat ttctttactc 1140 ttaactacga aagggagttc aagttttaaa gatgtagata tggtgataga ggctgttatt 1200 gagaatgttt ctttgaagca acaaatcttt tctgatcttg aaaaatattg ccccccacat 1260 tgcatgcttg ctactaatac ttccacaata gacttggagt tgattggaga gagaataaag 1320 tctcgtgaca ggattattgg aacagctgca caagtgattg ttgatctgct agatgttggg 1380 aagaatataa agaaaacacc agttgtcgtt ggaaattgta caggttttgc tgtcaacaga 1440 cctactctca atgttttttc ggctgcaatt ttacttgcag aacatggggt agatccctat 1500 gggctatttc cagattgaca caagtttgga atgccaatgg gacccttcag gttgtgcgac 1560 cttgttggtt ttggtgtggc agcagcaact gccagtcagt ttgttcaagc ttttccagaa 1620 agaacttata aatcgatgct aattcctctg atgcaagagg ataagaatgc aggtgaatcc 1680 actcgtaaag gtttctatgt cta tgacaag aaccgaaaag ctgggccaaa tccagagtta 1740 aagaaatata tcgagaaggc taggaacagt tctggtgttt cagttgatcc taagctcaca 1800 aagttacccg aaaaggacat tgtggagatg atatttttcc cagtggtgaa tgaagcatgt 1860 cgtgtccttg ccgaaggcat agcagtcaaa gcagctgacc tggacattgc tggtgtaatg 1920 ggaatgggtt tcccctccta cggggaggac tcatgttctg ggcggattct cttggatcaa 1980 attacatcta ttcaaggttg gaggaatggt cgaaacagta tggtggattt ttcaagccct 2040 gtggatactt agctgaaagg gctgttcagg gtgcaactct gagtgctccg ggtggccatg 2100 ctaaacctcg aatgtaagct catttcttta gtcctgctca catcatgccg ctattggaaa 2160 ttgtccgtac caagcat 2177
< 210 > 4 < 211 > 725 < 212 > P T < 213 > Cucumber < 220 > < 221 > PEPTIDE < 222 > (1) .. (725) < 223 > tetrafunctional beta-oxidation protein < 400 > 4 Met Gly Ser Asn Ala Lys Gly Arg Thr Val Met Glu Val Gly Thr Asp 1 10 15
Gly Val Ala lie lie Thr lie lie Asn Pro Pro Val Asn Ser Leu Ser 20 25 30
Phe Asp Val Leu Phe Ser Leu Arg Asp Ser Tyr Glu Gln Ala Leu Arg 35 40 45
Arg Asp Asp Val Lys Ala lie Val Val Thr Gly Ala Lys Gly Lys Phe SO 55 60
Be Gly Gly Phe Asp lie Thr Wing Phe Gly Val Leu Gln Gly Gly Lys 65 70 75 80 Gly Glu Gln Pro Asn Val Arg Asn lie Ser lie Glu Met lie Thr Asp 85 90 95
lie Phe Glu Ala Ala Arg Lys Pro Ala Ala Ala Ala lie Asp Gly Leu 100 105 110
Wing Leu Gly Gly Glu Leu Glu Val Wing Mee Wing Cys His Wing Arg lie 115 120 125
Be Thr Pro Thr Ala Gln Leu Gly Leu Pro Glu Leu Gln Leu Gly lie 130 135 140
lie Pro Gly Phe Gly Gly Thr Gln Arg Leu Pro Arg Leu Val Gly Leu 145 150 155 160
Ser Lys Ala Leu Glu Met Met Leu Thr Ser Lys Pro lie Lys Gly Gln 165 170 175
Glu Ala His Ser Leu Gly Leu Val Asp Ala lie Val Pro Pro Glu Glu 180 185 190
Leu lie Asn Thr Ala Arg Arg Trp Ala Leu Glu lie Leu Glu Arg Arg
195 200 205
Arg Pro Trp Val His Ser Leu His Arg Thr Asp Lys Leu Glu Ser Leu 210 215 220
Ala Glu Ala Arg Lys lie Phe Asn Leu Ala Arg Ala Gln Ala Lys Lys 225 230 235 240
Gln Tyr Pro Asn Leu Lys His Thr lie Wing Cys lie Asp Wing Val Glu 245 250 255
Thr Gly Val Val Ser Gly Pro Arg Ala Gly Leu Trp Lys Glu Ala Glu 260 265 270
Glu Phe Gln Gly Leu Leu His Ser Asp Thr Cys Lys Ser Leu He His 275 280 285
lie Phe Phe Ala Gln Arg Ser Thr Thr Lys Val Pro Gly Val Thr Asp 290 295 300
Leu Gly Leu Val Pro Arg Gln lie Lys Val Val Ala lie Val Gly Gly 305 310 315 320
Gly Leu Met Gly Ser Gly lie Wing Thr Wing Leu lie Leu Sor Asn Tyr 325 330 335 is Val Val Leu Lys Glu Val Asn Asp Lys Phe Leu Gln Wing Gly lie 340 345 3S0
Asp Arg Val Arg Ala Asn Leu Gln Ser Arg Val Lys Lys Gly Asn Met 355 360 365
Thr Asn Glu Lys Phe Glu Lys Ser lie Ser Leu Leu Lys Gly Val Leu 370 375 380
Asn Tyr Glu Ser Phe Lys Asp Val Asp Met Val lie Glu Wing Val lie 38S 390 395 400
Glu Asn Val Ser Leu Lys Gln Gln lie Phe Ser Asp Leu Glu Lys Tyr 405 410 415
Cys Pro Pro His Cys Met Leu Wing Thr Asn Thr Ser Thr lie Asp Leu 420 425 430
Glu Leu lie Gly Glu Arg lie Lys Ser Arg Asp Arg lie lie Gly His 435 440 445
Thr Ala Ala Gln Val lie Val Asp Leu Leu Asp Val Gly Lys Asn lie 450 455 460
Lys Lys Thr Pro Val Val Val Gly Asn Cys Thr Gly Phe Ala Val Asn 465 470 475 480
Arg Met Phe Phe Pro Tyr Ser Gln Ala Ala lie Leu Leu Ala Glu His 485 490 495
Gly Val Asp Pro Tyr Gln lie Asp Arg Ala lie Ser Lys Phe Gly Met 500 505 510
Pro Met Gly Pro Phe Arg Leu Cys Asp Leu Val Gly Phe Gly Val Wing 515 520 525
Ala Ala Thr Ala Ser Gln Phe Val Gln Ala Phe Pro Glu Arg Thr Tyr 530 535 540
Lys Sor Met Leu Lie Pro Leu Met Gln Glu Asp Lys Asn Wing Gly Glu 545 550 S55 560
Being Thr Arg Lys Gly Phe Tyr Val Tyr Asp Lys Asn Arg Lys Wing Gly 565 570 575
Pro Asn Pro Glu Leu Lys Lys Tyr lie Glu Lys Wing Arg Asn Ser Ser 580 585 590 Gly Val Ser Val Asp Pro Lys Leu Thr Lys Leu Pro Glu Lys Asp He 595 600 605
Val Glu Met lie Phe Phe Pro Val Val Asn Glu Ala Cys Arg Val Leu 610 615 620
Wing Glu Gly lie Wing Val Lys Wing Wing Asp Leu Asp lie Wing Gly Val 625 630 635 640
Met Gly Met Gly Phe Pro Ser Tyr Arg Gly Gly Leu Met Phe Trp Wing 64S 650 655
Asp Ser Leu Gly Ser Asn Tyr lie Tyr Ser Arg Leu Glu Glu Trp Ser 660 665 670
Lys Gln Tyr Gly Gly Phe Phe Lys Pro Cys Gly Tyr Leu Wing Glu Arg 675 680 685
Ala Val Gln Gly Ala Thr Leu Ser Ala Pro Gly Gly His Ala Lys Pro 690 695 700
Arg Met Wing His Phe Phe Ser Pro Wing His He Met Met Pro Law Leu Glu 705 710 715 720
He Val Arg Thr Lys 725
< 210 > 5 < 211 > 21 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Artificial sequence description: oligonucleotide primer-initiator 1 < 400 > 5 gatgggccgc tccaagggtg g 21 < 210 > 6 < 211 > 21 < 212 > DNA < 213 > Artificial sequence < 220 > . < 223 > Artificial sequence description: oligonucleotide primer-initiator 2 < 400 > 6 caacccgaag gtgccgccat t 21 < 210 > 7 < 211 > 3907 < 212 > DNA < 213 > Pseudomonas putida < 220 > < 221 > gene < 222 > (1) .. (3907) < 223 > gene faoAB sequences < 400 > 7 gatggcgttt ttactgaaaa tttgcctccg gccatagaat ctcctacggg ggcatccagg 60 ctggtcaatc tgttctgtaa cgacaaagcg gcggctcggc ataaccctga aggggtgggg 120 tgccaagtcg ccgctttgcg ttctgctgcg cagaaaaggc caggcaggcc gggttattca 180 ttcaagcaag tgccagtgtá gtcgccttgg ctcttcgcga agcgcaaagc aataagccga 240 caatcgctga tgcttgtggt catgaatgac cggcgatcac tgtcatcatg ttttgtaccc 300 ggacgataga aaatgactgg aaagtcgcgt tttcgccgtg ctcgtgagca tttgacaacg 360 cccatctttt cggagaatgt gtgcacaccc aaatcaaacg ggcgtatgaa ttgagcgttt 420 gtatgtcatg acgccaagcc atacttccga ctagcgcgct gacgggtgtg cctggggcaa 480 ggcagcttag gcctgcttct gctgcagcga tcggcgtgta cagttcagct tccatatcgt 540 ggagatcagt tgatgattta cgaaggtaaa gccatcacgg ttaaggctct tgaaagtggc 600 atcgtcgagc tcaagttcga gagtccgtca cctcaagggt acaagttcaa ccgccttacc 660 ctgaacgagc tgcgccaggc cgtcgatgcc atccgggccg atgcttcggt caagggcgtg 720 gtggcaagga atcgtcagga cgtgttcatc gtcggcgccg acatcaccga gttcgtcgac 780 aacttcaagc tgcctgaggc cgaactggtc gctggcaacc tggaagccaa tcgcatcttc 840 aacgcgttcg aagacc TCGA agtgccgacc gttgccgcca tcaacggcac cgcgctgggc 900 ggcggcctgg aaatgtgcct ggcggccgac taccgggtca tgtccaccac cgccaggatc 960 ggcctgccgg aagtcaagct gggtatctac ccgggctttg gcggtaccgt. gcgcctgccg 1020 cgcctgatcg gctcggacaa cgccatcgag tggatcgccg ccggcaagga aaaccgtgcc 1080 gaagatgccc tgaaagtggg ggccgtcgac gccgtggtcg cccctgagct gctgctggcc 1140 ggtgccctcg acc tgatcaa gcgtgccatc agtggcgagc tggactacaa ggccaagcgc 1200 cagccgaagc tggaaaagct caagctcaat gccatcgagc agatgatggc cttcgagact 1260 gccaagggc tcgtcgctgg ccaggccggc ccgaactacc cggccccggt cgaagcgatc 1320 aagagcatcc agaaagccgc caacttcggt cgcgacaagg ccctggaacc cgaagccgca 1380 agctggccaa ggctttgcca gacctctgtc gccgagagcc tgatcggctt gttcctcaac 1440 gatcaggaac ccaagcgcaa ggccaaggcg catgacgaga tcgcccacga cgtgaagcag 1500 gccgccgtgc tcggcgccgg catcatgggc ggcggtatcg cctaccagtc ggcggtcaaa 1560 ggtacgccga aka tgatgaa ggacatccgc gaggaagcca ttcagctggq tctgaacgag 1620 gcctccaagt tgcttggcaa ccgcgtcgag aagggccgcc tgaccccggr caagatggcc 1680 gaggccc tca acgccattcg cccgaccc tg tcctatggcg atttcgccaa tgtcgacatc 1740 gtcgtcgagg ctgtggtcga gaacccgaag gtcaagcaag cggtactg c ggaagtggaa 1800 ggccaggtga aggacgatgc gatcctcgct tccaacacct ctaccatc: c cat caacctg 1860 ctggccaagg cgctcaagcg cccggaaaac ttcgCcggca cgcaccict caacccggcg 1920 cgctggttga cacatgatgc agtgatccgt ggcgagaagt ccagtgacgt ggcggtcgcc 1980 accaccgtgg cctacgccaa gaaaatgggc aagaacccga tcgtggtcaa cgactgcccg 2040 ggctttttgg tcaaccgcgt gctgttcccg tactttggcg gttttgccaa gctggtcagc 2100 gccggtgtcg acttcgtgcg catcgacaag gtcatggaga agttcggctg gccgatgggc 2160 ccagcctact tgatggacgt ggtcggcatc gacaccggcc accacggccg tgacgtcatg 2220 gccgaaggct tcccggatcg ca gaaggac gagcgccgct cggcagtcga cgcgttgtac 2280 gaggccaacc gcctgggcca gaagaacggt aagggcttct acgcctacga aaccgacaag 2340 cgcggcaagc cgaagaaggt cttcgatgcc accgtgctcg acgtgctcaa accgatcgtg 2400 ttcgagcagc gtgaagtcac tgacgaagac atcatcaact ggatgatggt cccgctgtgc 2460 cttgagaccg tgcgttgcc ggaagacggc atcgtcgaaa ccgctgccga agccgacatg 2520 ggcctggtct acggca tgg tttccctccc ttccgcggtg gtgcgctgcg ttacatcgac 2S80 tcgatcggtg tggccgaatt cgtcgccctg gccgatcagt atgccgacct ggggccgctg 2640 taccacccga ccgccaagct gcgtgaaatg gccaagaacg gccagcgctt cttcaactga 2700 gcggtcaacg agctagagcg agagatttga tatgagcctg aatccaagag acgtggtgat 2760 tgtcgacttc ggtcgcacgc caatgggccg ctccaagggt ggcatgcacc gcaacacccg 2820 cgccgaagac atgtcggcgc acctgatcag caagctgctg gaacgcaacg gcaaggtcga 2880 cccgaaagaa gtcgaggacg tgatctgggg ctgcgtcaac cagaccctgg agcagggctg 2940 gaacatcgcc cgcatggctt cgctgatgac cccgatcccg cacacctctg cggcgcagac 3000 cgtcagccgc ctgtgcggct cgtccatgag cgcgctgcac acggccgccc aggcgatcat 3060 gaccggtaac ggtgatgtgt tcgtggtcgg tggcgtggag cacatgggcc acgtcagcat 3120 gatgcatggc gtagacccca acccgcacct gtccttgcat gccgccaagg cttccgggat 3180 gatgggcctg actgcagaaa tgctcggcaa gatgcacggc atcacccgtg agcagcagga 3240 cctgttcggc ttgcgttcgc accagc ggc ccacaaggcc acggtcgaag gcaagttcaa 3300 ggacgagatc atcccgatgc agggctacga cgagaacggc ttcctgaagg tgttcgattt 3360 cgacgaaacc attcgcccgg aaaccaccct cgaaggcctg gcatcgctca agcctgcgtt 3420 caacccgaaa ggcggtacgg tcacggccgg tacctcgtcg cagatcaccg acggcgcctc 3480 gtgcatgatc gtcatgtccg gtcagcgtgc catggacctc cgtatccagc cattggcggt 3S40 gatccgttcg atggcagtgg ccggtgtcga cccggcaatc atgggctacg gcccggtgcc 3600 atcgacccag aaagccctca agcgtgcggg cttgaccatg gccgatatcc acttcatcga 3660 gctcaacgaa gccttcgctg cgcaggccct gcccgtgctg aaagacttga aagtgctcga 3720 caagatggat gagaaggtta acctgcacgg cggcgccatt gctttgggcc to ccgttcgg 3780 ttgctccggg gcgcggattt ccggcaccct gctcaacgtc atgaagcaaa atggcggtac 3840 gctgggtgtt gcgaccatgt gcgtcggccc gggccaaggt atcaccactg tcttcgaacg cgtctga 3900 3907
< 210 > 8 < 211 > 27 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Artificial sequence description: oligonucleotide primer-primer GVR471 < 400 > 8 cggtacccat tgtactccca gtatcat 27 < 210 > 9 < 211 > 27 < 212 > DNA < 213 > Artificial sequence < 220 > _ < 223 > Artificial sequence description: oligonucleotide primer-primer GVR472 < 400 > 9 catttaaata gtagagtatt gaatatg 27 < 210 > 10 < 211 > 1558 < 212 > DNA < 213 > Bean Phaseolithic < 220 > < 221 > promoter < 222 > (1) .. (1558) < 400 > 10 cggtacccat tgtactccca gtatcattat agtgaaagtt ttggctctct cgccggtggt 60 tttttacctc tatttaaagg ggttttccac ctaaaaattc tggtatcatt ctcactttac 120 ttgttacttt aatttctcat aatctttggt tgaaattatc acgcttccgc acacgatatc 180 cctacaaatt tattatttgt taaacatttt caaaccgcat aaaattttat gaagtcccgt 240 tgtagtctaa ctatctttaa cattttcata ttgaaatata taatttactt aattttagcg 300 ttggtagaaa gcataaagat ttattcttat tcttcttcat ataaatgttt aatatacaat 360 ataaacaaat tctttacctt aagaaggatt tcccatttta tattttaaaa atatatttat 420 caaatatttt tcaaccacgt aaatctcata ataataagtt gtttcaaaag taataaaatt 480 taactccata atttttttat tcgactgatc ttaaagcaac acccagtgac acaactagcc 540 atttttttct ttgaataiaa aaatccaat atcattgtat tttttttata caatgaaaat 600 ttcaccaaac aatcatttgt ggtatttctg aagcaagtca tgttatgcaa aattctataa 660 ttcccatttg acactacgga agtaactgaa gatctgcttt tacatgcgag acacatcttc 720 taaagtaatt ttaataatag ttactatatt caagatttca tatatcaaat actcaatatt 780 acttctaaaa aattaattag atataattaa aatattactt ttttaatttt aagtttaatt 840 gttgaatttg tgactat tga tttattattc tactatgttt aaattgtttt atagatagtt 900 taaagtaaat ataagtaatg tagtagagtg ttagagtgtt accctaaacc ataaactata 960 acatttatgg tggactaatt ttcatatatt tcttattgct tttacctttt cttggtatgt 1020 aagtccgtaa ctagaattac agtgggttgc catggcactc tgtggtcttt tggttcatgc 1080 atgggtcttg agacaaagaa cgcaagaaaa agacaaaaca caaagaaaaa gagagacaaa 1140 acgcaatcac acaaccaact caaattagtc actggctgat caagaccgcc gcgtccatgt 1200 atgtctaaat gccatgcaaa gcaacacgtg cttaacatgc actttaaacg gctcacccat 1260 ctcaacccac acacaaacac attgcctttt tcttcatcat caccacaacc acctgtatat 1320 attcattctc ttccgccacc tcaatttctt cacttcaaca cacgtcaacc tgcatatgcg 1380 tgtcatccca tgcccaaatc tccatgcatg ttccaaccac cttctctctt atataatacc 1440 tataaatacc tctaatatca ctcacttctt tcatcatcca tccatccaga gtactactac 1500 taatacccca tctactacta acccaactca tattcaatac tactctacta tttaaatg 1558
< 210 > 11 < 211 > 983 < 212 > DNA < 213 > Soy oleosin. < 220 > < 221 > promoter < 222 > (1) .. (983) < 400 > 11 tctagataca tccatttctt aatataatcc tcttattcaa attgcaattg cccagatctc 60 tgtatggact atggctcgag gaatccatac atagagacat tccccactcg tatacttgta 120 tctgtcaaat gcctattgtt gttgaaataa agtaacttat gcatcaattt aaaacaatca 180 gttaggtaat ggacattaat gtaaagtgac ttatagaatc catatttgta taacaaagat 240 gttgagacat tgactattgt gtgctatttc aaaaagatct gataaaatat ttaataaaac 300 attaaaagta aataataatc gctaaacatc atcaaaatat taatcattag attcaatttt 360 tgcaattaaa accagaagaa ctaaatctac attaccatac ttaagactat acatagagaa 420 ttaaacttaa tgttatattt aaggaaaagg acgaaactta aaacttaaat acaattgtat 480 gattaatttt agtattgtct ttaatgagaa ttaaagtttt attcactaat ttatgattat 540 ttcatttact aatttatgta atgtgatttc aataagtgag gtaaactccg attgattgaa 600 gataccacca acaccaacac caccaccacc tgcgaaactg tacgtatctc aattgtcctt 660 aataaaaatg taaatagtac attattctcc ttgcctgtca ttatttatgt gcccccagct 720 ttaatttttc tgatgtactt aacccagggc aaactgaaac atgttcctca tgcaaagccc 780 caactcatca tgcatcatgt acgtgtcatc atccagcaac tccacttttg ctatataact 840 cctcccccat cacact cccc atctctctaa cacacacata cccccaacta acaataattc 900 cttcacttgc agaacttagt tctctgttgc atcatcatca tcttcattag tgttagccct 960 aacttcacct taaccattta atg 983
< 210 > 12 < 211 > 38 < 212 > DNA < 213 > Artificial sequence < 220 >
< 223 > Artificial sequence description: oligonucleotide primer-initiator JA408 < 400 > 12
tctagataca tccatttctt aatataatcc tcttattc 38 < 210 > 13 < 211 > 30 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Artificial sequence description: oligonucleotide primer-npl < 400 > 13 catttaaatg gttaaggtga aggtagggct 30 < 210 > 14 < 211 > 30 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Artificial sequence description: oligonucleotide primer-np2 primer
< 400 > 14 aagcttaaaa tgatttacga aggtaaagcc 30 < 210 > 15 < 211 > 22 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Artificial sequence description: oligonucleotide primer-np3 initiator < 400 > 15 attgctttca gttgaagcgc tg 22 < 210 > 16 < 211 > 30 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Artificial sequence description: oligonucleotide primer-np4 initiator < 400 > 16 aagcttaaaa tgagcctgaa tccaagagac 30 < 210 > 17 < 211 > 28 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Artificial sequence description: oligonucleotide primer-primer np5 < 400 > 17 aagctttcag acgcgttcga agacagtg 28 < 210 > 18 < 211 > 56 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Artificial sequence description: oligonucleotide primer-initiator N-fox2b < 400 > 18 tcccccggga ggaggttttt attatgcctg gaaatttatc cttcaaagat agagtt 56 < 210 > 19 < 211 > 29 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Artificial sequence description: oligonucleotide primer-initiator N-bamfox2b < 400 > 19 aaggatcctt gatgtcattt acaactacc 29 < 210 > 20 < 211 > 28 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Artificial sequence description: oligonucleotide primer-initiator C-fox2 < 400 > 20 gctctagata gggaaagatg tatgtaag 28 < 210 > 21 < 211 > 19 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Artificial sequence description: oligonucleotide initiator-initiator C-bamfox2 < 400 > 21 tgacatcaag gatcctttt 19 < 210 > 22 < 211 > 39 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Artificial sequence description: oligonucleotide primer-primer GVR396 < 400 > 22 gatttaaatg caagcttaaa taagtatgaa ctaaaatgc 39 < 210 > 23 < 211 > 25 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Artificial sequence description: oligonucleotide primer-primer GVR397 < 400 > 23 cggtacctta gttggtaggg tgcta 25 < 210 > 24 < 211 > 2162 < 212 > DNA < 213 > Pseudomonas putida < 220 > < 221 > gene < 222 > (1) .. (2162) < 223 > FaoA gene sequences < 400 > 24 gatttacgaa aagcttaaat tcacggttaa ggtaaagcca ggctcttgaa agtggcatcg 60 tcgagctcaa gttcgacctc aagggtgagt ccgtcaacaa gttcaaccgc cttaccctga 120 acgagctgcg ccaggccgtc gatgccatcc gggccgatgc ttcggtcaag ggcgtgatcg 180 tcaggagtgg caaggacgcg ttcatcgtcg gcgccgacat caccgagctc gtcgacaact 240 tcaagctgcc tgaggccgaa ceggtcgctg gcaacctgga agccaatcgc atcttcaacg 300 cgctcgaaga cctcgaagcg ccgaccgttg ccgccaccaa cggcatcgcg ctgggcggcg 360 gcctggaaat gtgcctggcg gccgactacc gggtcatgtc caccagcgcc aggatcggcc 420 tgccggaagt caagctgggt atctacccgg gctttggcgg taccgtgcgc ctgccgcgcc 480 tgatcggctc ggacaacgcc atcgagtgga tcgccgccgg caaggaaaac cgtgccgaag 540 atgccctgaa agtgggggcc gtcgacgccg tggtcgcccc tgagctgctg ctggccggtg 600 ccctcgacct gatcaagcgt gccatcagtg gcgagctgga ctacaaggcc aagcgccagc 660 aaagctcaag cgaagctgga tcgagcagat ctcaatgcca gagactgcca gatggccttc 720 agggcttcgt cgctggccag gccggcccga actacccggc gcgatcaaga cccggtcgaa 780 gcatccagaa agccgccaac ttcggtcgcg acaaggccct ggaagtcgaa gccgcaggct 840 ttgccaagct ggccaa GACC tctgtcgccg agagcctgat cggcttgttc ctcaacgatc 900 aggaactcaa gcgcaaggcc aaggcgcatg acgagatcgc ccacgacgtg aagcaggccg 960 ccgtgctcgg cgccggcatc atgggcggcg gtatcgccta ccagtcggcg gtcaaaggta 1020 cgccgatcct gatgaaggac atccgcgagg aagccattca gctgggtctg aacgaggcct 1080 ccaagttgct tggcaaccgc gtcgagaagg gccgcctgac cccggccaag atggccgagg 1140 ccctcaacgc cattcgcccg accctgtcct atggcgattt cgccaatgtc gacatcgtcg 1200 tcgaggctgt ggtcgagaac ccgaaggtca agcaagcggt actggcggaa gtggaaggcc 1260 aggtgaagga cgatgcgatc ctcgcttcca. cacctctac catctccatc aacctgctgg 1320 ccaaggcgct caagcgcccg gaaaacttcg tcggcatgca ccggtgcaca cttcttcaac 1380 tgatgccgct ggttgaagtg atccgtggcg agaagtccag tgacgtggcg gtcgccacca 1440 - ccgtggccta atgggcaaga cgccaagaaa acccgatcgt ggtcaacgac tgcccgggct 1500 ttttggtcaa ccgcgtgctg ttcccgtact ttggcggttt tgccaagctg gtcagcgccg 1560 gtgtcgactt cgtgcgcatc gacaaggtca tggagaagtt cggctggccg atgggcccag 1620 cctacttgat ggacgtggtc ggcatcgaca ccggccacca cggccgtgac gtcatggccg 1680 aaggcttccc ggatcgcatg aaggacgagc gccgctcggc agtcgacgcg ttgtacgagg 1740 ccaaccgcct gggccagaag aacggtaagg gcttctacgc ctacgaaacc gacaagcgcg 1800 geaagccgaa gaaggtcttc gatgccaccg tgctcgacgt gctcaaaccg atcgtgttcg 1860 agtcactgac agcagcgtga gaagacatca tcaactggat gatggtcccg ctgtgccttg 1920 agaccgtgcg ttgcctggaa gacggcatcg tcgaaaccgc tgccgaagcc gacatgggcc 1980 tggtctacgg cattggtttc cctcccttcc gcggtggtgc gctgcgttac atcgactcga 2040 tcggtgtggc cgaattcgtc GCCC tggccg atcagtatgc cgacctgggg ccgctgtacc 2100 acccgaccgc caagctgcgc gaaacggcca agaacggcca gcgcttcttc aactgaaagc 2160 tc 2162
< 210 > 25 < 211 > 1190 < 212 > DNA < 213 > Pseudomonas putida < 220 > < 221 > gene < 222 > (1) .. (1190) < 223 > FaoB gene sequences < 400 > 25 aagcttaaat gagcctgaat ccaagagacg tggtgattgt cgacttcggc cgcacgccaa 60 tgggccgctc caagggtggc atgcaccgca acacccgcgc cgaagacatg tcggcgcacc 12U tgatcagcaa gctgctggaa cgcaacggca aggtcgaccc gaaagaagtc gággacgtga 160 tctggggctg cgtcaaccag accctggagc agggctggaa catcgcccgc atggcttcg .: 240 tgatgacccc gatcccgcac acctctgcgg cgcagaccgt cagccgcctg tgcggctcg "300 ccatgagcgc gctgcacacg gccgcccagg cgatcatgac cggtaacggt gatgtgttco J60 tggtcggtgg cgtggagcac atgggccacg tcagcatgat gcatggcgta gaccccaacc 420 cgcacctgtc cttgcatgcc gccaaggctt. ccgggatgat gggcctgacL gcagaaatgc 480 tcggcaagat gcacggcatc acccgtgagc agcaggacct gttcggcttg cgttcgcacc 540 caaggccacg agctggccca gtcgaaggca agttcaagga cgagatcatc ccgatgcagg 600 gctacgacga gaacggcttc ctgaaggtgt tcgatttcga cgaaaccatt cgcccggaaa 660 aggcctggca ccaccctcga tcgctcaagc ctgcgttcaa cccgaaaggc ggtacggtca 720 cggccggtac ctcgtcgcag atcaccgacg gcgcctcgtg catgatcgtc atgtccggtc 780 agcgtgccat ggacctcggt atccagccat tggcggtgat ccgttcgatg gcagtggccg 840 gtgtcgaccc gg caatcatg ggctacggcc cggtgccatc gacccagaaa gccctcaagc 900 gtgcgggctt gaccatggcc gatatcgact tcatcgagct caacgaagcc ttcgctgcgc 960 aggccctgcc cgtgctgaaa gacttgaaag tgctcgacaa gatggatgag aaggttaacc 1020 tgcacggcgg cgccattgct ttgggccacc cgttcggttg ctccggggcg cggatttccg 1080 gcaccctgct caacgtcatg aagcaaaatg gcggtacgct gggtgttgcg accatgtgcg 1140 tcggcctggg ccaaggtatc accactgtct tcgaacgcgt ctgaaagctt 1190
< 210 > 26 < 211 > 391 < 212 > PRT < 213 > Pseudomonas putida < 220 > < 221 > PEPTIDE < 222 > (1) .. (391) < 223 > Amino acid sequences of FaoB < 400 > 26 Met Ser Leu Asn Pro Arg Asp Val Val lie Val Asp Phe Gly Arg Thr 1 s 10 15
Pro Met Gly Arg Ser Lys Gly Gly Met His Arg Asn Thr Arg Ala Glu
Asp Met Ser Ala His Leu lie Ser Lys Leu Leu Glu Arg Asn Gly Lys 35 40 45
Val Asp Pro Lys Glu Val Glu Asp Val lie Trp Gly Cys Val Asn Gln 50 5S 60
Thr Leu Glu Gln Gly Trp Asn lie Wing Arg Met Wing Being Leu Met Thr 65 70 75 80
Pro lie Pro His Thr Ser Ala Ala Gln Thr Val Ser Arg Leu Cys Gly 85 90 95
Being Ser Met Being Ala Leu His Thr Ala Ala Gln Ala Lie Mee Thr Gly 100 105 110
Asn GLy Asp Val Phe Val Val Gly Gly Val Glu His Met Gly His Val 115 120 125
Ser Met Met His Gly Val Asp Pro Asn Pro His Leu Ser Leu His Wing 130 13S i4o
Ala Lys Ala Ser Gly Met Met Gly Leu Thr Ala Glu Met Leu Gly Lys 14S "0 155 160
Met His Gly He Thr Arg Glu Gln Gln Asp Leu Phe Gly Leu Arg Ser 165 170 17S His Gln Leu Ala His Lys Ala Thr Val Glu Gly Lys Phe Lys Asp Glu 180 185 190
He He Pro Pro Met Gln Gly Tyr Asp Glu Asn Gly Phe Leu Lys Val Phe 195 200 205
Asp Phe Asp Glu Thr He Arg Pro Glu Thr Thr Leu Glu Gly Leu Wing 210 215 220
Ser Leu Lys Pro Wing Phe Asn Pro Lys Gly Gly Thr Val Thr Wing Gly 225 230 235 240
Thr Ser Ser Gln He Thr Asp Gly Wing Ser Cys Met He Val Met Ser 245 250 255
Gly Gln Arg Wing Met Asp Leu Gly He Gln Pro Leu Wing Val He Arg
260 265 270
Be Met Wing Val Wing Gly Val Asp Pro Wing He Met Gly Tyr Gly Pro 275 280 285
Val Pro Ser Thr Gln Lys Wing Leu Lys Arg Wing Gly Leu Thr Met Wing 290 295 300
Asp He Asp Phe He Glu Leu Asn Glu Wing Phe Wing Wing Gln Wing Leu 305 310 315 320
Pro Val Leu Lys Asp Leu Lys Val Leu Asp Lys Met Asp Glu Lys Val 325 330 335
Asn Leu His Gly Gly Wing He Wing Leu Gly His Pro Phe Gly Cys Ser 340 345 350
Gly Ala Arg Be Ser Gly Thr Leu Leu Asn Val Met Lys Gln Asn Gly 355 360 365
- Gly Thr Leu Gly Val Wing Thr Met Cys Val Gly Leu Gly Gln Gly He 370 37S 380
Thr Thr Val Phe Glu Arg Val 385 390 < 210 > 27 < 211 > 1244 < 212 > DNA < 213 > Bean Phaseolithic < 220 > < 221 > terminator < 222 > (1) .. (1244) < 400 > 27
gatttaaatg caagcttaaa taagtatgaa ctaaaatgca tgtaggtgta agagctcatg 60 gagagcatgg aatattgtat ccgaccatgt aacagtataa taactgagct ccatctcact 120 tcttctatga ataaacaaag tatattaaca gatgttatga ctctatctat gcaccttatt 180 gttctatgat aaatttcctc ttattattat aaatcatctg aatcgtgacg gcttatggaa 240 agtacaaaaa tgcttcaaat caaatgtgta ctataagact ttctaaacaa ttctaacttt 300 agcattgtga acgagacata agacataaca agtgttaaga attataatgg aagaagtttg 360 tctccattta tatattatat attacccact tatgtattat attaggatgt taaggagaca 420 taacaattat aaagagagaa gtttgtatcc atttatatat tatatactac ccatttatat 480 attatactta tccacttatt taatgtcttt ataaggtttg atccatgata tttctaatat 540 atgtatatga tttagttgat aagggtacta tttgaactct cttactctgt ataaaggttg 600 gatcatcctt aaagtgggtc tatttaattt tattgcttct tacagataaa aaaaaaatta 660 tgataaaata tgagttggtt taaaataata ttgaaggatt acaaataata aataacatat 720 tataaattta aatatatgta ttataatata acatttatct ataaaaaagt aaatattgtc 780 ataaatctat acaatcgttt agccttgctg gacgactctc aattatttaa acgagagtaa 840 acatatttga ctttttggtt atttaacaaa ttattattta acactatatg aaattttttt 900 caaggaaata tttttatcgg aaattaaatt aggagggaca ccaatcctta atggtgtgtc 960 tacaaccaac ttccacagga aggtcaggtc ggggacaac aaaaaaacagg caagggaaat 1020 tttttaattt gggttgtctt gtttgctgca taatttatgc agtaaaacac tacacataac 1080 ccttttagca gtagagcaat ggttgaccgt gtgcttagct tcttttattt tattttttta 1140 tcagcaaaga ataaataaaa taaaatgaga cacttcaggg atgtttcaac ccttatacaa 1200 aaccccaaaa acaagtttcc tagcacccta ccaactaagg tace 1244
< 210 > 28 < 211 > 225 < 212 > DNA < 213 > Soy Oleosin < 220 > < 221 > terminator < 222 > (1) .. (225) < 400 > 28
aagcLtacgt gatgagtatt aatgtgttgt tatgaactta cgatgccggt LCacgtgi? 6 '"> aaataaatga tgtatgtacc tcttcttgcc tacgtagtag gcttgggtgt tttgtLgcct 1' .VI
agctttgctt atttagtaat tagtagaagg gatgttcgtt cgtgtctcat aaaaaggggt 180 actaccactc tggcaatgtg atttgtattt gatgaattgt ctaga 225
< 210 > 29 < 211 > 34 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Artificial sequence description: oligonucleotide primer-initiator JA410 < 400 > 29 aagcttacgt gatgagtatt aatgtgttgt tatg 34 < 210 > 30 < 211 > 34 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Artificial sequence description: oligonucleotide primer-initiator JA411 < 400 > 30 tctagacaat tcatcaaata caaatcacat tgcc 34 < 210 > 31 < 211 > 715 < 212 > PRT < 213 > Pseudomonas putida < 220 > < 221 > PEPTIDE < 222 > (1) .. (715) < 223 > Amino acid sequences < 400 > 31
Met lie Tyr Glu Gly Lys Ala lie Thr Val Lys Ala Leu Glu Ser Gly 1 5 10 15
lie Val Glu Leu Lys Phe Asp Leu Lys Gly Glu Ser Val Asn Lys Phe 20 25 30
Asn Arg Leu Thr Leu Asn Glu Leu Arg Gln Wing Val Asp Wing lie Arg 35 40 45
Wing Asp Wing Ser Val Lys Gly Val lie Val Arg Ser Gly Lys Asp Val 50 55 60
Phe lie Val Gly Wing Asp lie Thr Glu Phe Val Asp Asn Phe Lys Leu 65 70 75 80
Pro Glu Wing Glu Leu Val Wing Gly Asn Leu Glu Wing Asn Arg lie Phe 85 90 95
Asn Ala Phe Glu Asp Leu Glu Val Pro Thr Val Ala Ala lie Asn Gly 100 105 110
lie Wing Leu Gly Gly Gly Leu Glu Met Cys Leu Wing Ala Asp Tyr Arg 115 120 125
Val Met Ser Thr Ser Ala Arg lie Gly Leu Pro Glu Val Lys Leu Gly 130 13S 140
lie Tyr Pro Gly Phe Gly Gly Thr Val Arg Leu Pro Arg Leu lie Gly 145 150 1S5 160 Ser Asp Asn Wing He Glu Trp He Wing Wing Gly Lys Glu Asn Arg Wing 165 170 175
Glu Asp Ala Leu Lys Val Gly Ala Val Asp Ala Val Val Ala Pro Glu 180 185 190
Leu Leu Leu Ala Gly Ala Leu Asp Leu He Lys Arg Ala He Ser Gly 195 200 205
Glu Leu Asp Tyr Lys Wing Lys Arg Gln Pro Lys Leu Glu Lys Leu Lys 210 215 220
Leu Asn Wing He Glu Gln Met Met Wing Phe Glu Thr Wing Lys Gly Phe 225 230 235 240
Val Ala Gly Gln Ala Gly Pro Asn Tyr Pro Ala Pro Val Glu Ala He 24S 250 255
Lys Ser He Gln Lys Ala Ala Asn Phe Gly Arg Asp Lys Ala Leu Glu 260 265 270
Val Glu Ala Ala Gly Phe Ala Lys Leu Ala Lys Thr Ser Val Ala Glu 275 280 285
Ser Leu He Gly Leu Phe Leu Asn Asp Gln Glu Leu Lys Arg Lys Wing 290 295 300
Lys Ala His Asp Glu He Ala His Asp Val Lys Gln Ala Ala Val Leu 305 310 315 320
Gly Wing Gly He Met Gly Gly Gly Wing Wing Tyr Gln Being Wing Val Lys 325 330 33b
Gly Thr Pro He Leu Met Lys Asp He Arg Glu Glu Ala He Gln Leu 340 345 350
Gly Leu Asn Glu Wing Being Lys Leu Leu Gly Asn Arg Val Glu Lys Gly 355 360 365
Arg Leu Thr Pro Wing Lys Met Wing Glu Wing Leu Asn Wing He Arg Pro 370 375 380
Thr Leu Ser Tyr Gly Asp Phe Wing Asn Val Asp He Val Val Glu Wing 385 390 395 400 Val Val Glu Asn Pro Lys Val Lys Gln Wing Val Leu Wing Glu Val Glu 40S 410 415
Gly Gln Val Lys Asp Asp Ala lie Leu Ala Ser Asn Thr Ser Thr lie 420 425 430
Ser lie Asn Leu Leu Ala Lys Ala Leu Lys Arg Pro Glu Asn Phe Val 435 440 445
Gly Met His Phe Phe Asn Pro Val His Met Met Pro Leu Val Glu Val 450 455 460
lie Arg Gly Glu Lys Ser Ser Asp Val Wing Val Wing Thr Thr Val Wing 465 470 475 480
Tyr Ala Lys Lys Met Gly Lys Asn Pro lie Val Val Asn Asp Cys Pro 485 490 49S
Gly Phe Leu Val Asn Arg Val Leu Phe Pro Tyr Phe Gly Gly Phe Wing 500 505 510
Lys Leu Val Ser Wing Gly Val Asp Phe Val Arg lie Asp Lys Val Met
515 520 525
Glu Lys Phe Gly Trp Pro Met Gly Pro Wing Tyr Leu Met Asp Val Val 530 535 540
Gly lie Asp Thr Gly His His Gly Arg Asp Val Met Wing Glu Gly Phe 545 550 555 560
Pro Asp Arg Met Lys Asp Glu Arg Arg Ser Wing Val Asp Wing Leu Tyr S65 S70 S7S
Glu Wing Asn Arg Leu Gly Gln Lys Asn Gly Lys Gly Phe Tyr Wing Tyr S80 585 590
Glu Thr Asp Lys Arg Gly Lys Pro Lys Lys Val Phe Asp Wing Thr Val 595 600 605
Leu Asp Val Leu Lys Pro lie Val Phe Glu Gln Arg Glu Val Thr Asp 610 615 620
Glu Asp lie lie Asn Trp Met Met Val Pro Leu Cys Leu Glu Thr Val 625 630 635 640 Arg Cys Leu Glu Asp Gly lie Val Glu Thr Ala Ala Glu Ala Asp Met 645 650 655
Gly Leu Val Tyr Gly lie Gly Phe Pro Pro Phe Arg Gly Gly Ala Leu 660 665 670
Arg Tyr lie Asp Ser lie Gly Val Ala Glu Phe Val Ala Leu Ala Asp 675 680 685
Gln Tyr Wing Asp Leu Gly Pro Leu Tyr His Pro Thr Wing Lys Leu Arg 690 695 700
Glu Met Wing Lys Asn Gly Gln Arg Phe Phe Asn 705 710 715