AU764650B2 - Superantigens - Google Patents

Description

-1-

SUPERANTIGENS

TECHNICAL FIELD This invention relates to superantigens, and to their use, including in diagnosis and/or treatment of disease.

BACKGROUND ART Any discussion of the prior art throughout the specification should in no way be considered as an admission that such prior art is widely known or forms part of common general knowledge in the field.

Bacterial superantigens are the most potent T cell mitogens known. They stimulate large numbers ofT cells by directly binding to the side of the MHC class II and T cell Receptor (TcR) molecules. Because they override the normally exquisite MHC restriction phenomenon of T cell antigen recognition, they are prime candidates for either causing the onset of autoimmune diseases or exacerbating an existing autoimmune disorder.

The applicants have identified genes coding for four novel superantigens from S.

pyogenes. It is broadly to these superantigens and polynucleotides encoding them that the present invention is directed.

".SUMMARY OF THE INVENTION One embodiment of the invention relates to a superantigen selected from any one of SMEZ-2, SPE-G, SPE-H and SPE-J, or a functionally equivalent variant thereof.

A further embodiment of the invention relates to a polynucleotide molecule comprising a sequence encoding a superantigen chosen from SMEZ-2, SPE-G, SPE-H, SPE-J, or a functionally equivalent variant thereof.

-L

-2- Another embodiment of the invention relates to a method of subtyping Streptococci on the basis of superantigen genotype comprising detection of the presence of any or all of the above four superantigens or the corresponding polynucleotides.

A further embodiment of the invention relates to a construct comprising any of the above superantigens (or superantigen variants) bound to a cell-targeting molecule, which is preferably a tumour-specific antibody.

Yet a further embodiment of the invention relates to a pharmaceutical composition for therapy or prophylaxis comprising a superantigen or superantigen variant as described above linked to cell targeting molecule.

Accordingly, a first aspect of the invention provides a superantigen selected from any one of SMEZ-2, SPE-G, SPE-H and SPE-J, or a functionally equivalent variant thereof.

According to a second aspect, the invention provides a superantigen which is SMEZ-2 and which has an amino acid sequence of SEQ ID NO. 2, or a functionally equivalent variant thereof.

According to a third aspect, the invention provides a superantigen which is SPE- G and which has an amino acid sequence of SEQ ID NO. 4, or a functionally equivalent variant thereof According to a fourth aspect, the invention provides a superantigen which is SPE- H and which has an amino acid sequence of SEQ ID NO. 6, or a functionally equivalent variant thereof.

2a According to a fifth aspect, the invention provides a superantigen which is SPE-J and which has an amino acid sequence which includes SEQ ID NO. 8, or a functionally equivalent variant thereof.

According to a sixth aspect, the invention provides a polynucleotide comprising a nucleotide sequence encoding SMEZ-2 or a variant thereof according to the second aspect.

According to a seventh aspect, the invention provides a polynucleotide comprising a nucleotide sequence encoding SPE-G or a variant thereof according to the third aspect.

According to an eighth aspect, the invention provides a polynucleotide comprising a nucleotide sequence encoding SPE-H or a variant thereof according to the fourth aspect.

According to a ninth aspect, the invention provides a polynucleotide comprising a nucleotide sequence encoding SPE-J or a variant thereof according to the fifth aspect.

According to a tenth aspect, the invention provides a method of subtyping Streptococci which includes the step of detecting the presence or absence of a S* superantigen according to any one of the second to fifth aspects.

SAccording to an eleventh aspect, the invention provides a method of subtyping Streptococci which includes the step of detecting the presence or absence of a polynucleotide according to any one of the sixth to ninth aspects.

According to a twelfth aspect, the invention provides a construct which comprises a superantigen or variant thereof according to any one of the second to fifth aspects and Sa cell-targeting molecule.

*oo° ooo** *oo* 2b According to a thirteenth aspect, the invention provides a pharmaceutical composition which includes a construct according to the twelfth aspect.

According to a fourteenth aspect, the invention provides an antibody which binds superantigen SMEZ-2 according to the second aspect.

According to a fifteenth aspect, the invention provides an antibody which binds superantigen SPE-G according to the third aspect.

According to a sixteenth aspect, the invention provides an antibody which binds superantigen SPE-H according to the fourth aspect.

According to a seventeenth aspect, the invention provides an antibody which binds superantigen SPE-J according to the fifth aspect.

According to an eighteenth aspect, the invention provides a kit which includes an antibody according to any one of the twentieth to twenty-third aspects.

According to a nineteenth aspect, the invention provides a nucleic acid molecule which hybridises under stringent conditions to a polynucleotide according to the sixth aspect.

'According to a twentieth aspect, the invention provides a nucleic acid molecule which hybridises under stringent conditions to a polynucleotide according to the seventh aspect.

o* According to a twenty-first aspect, the invention provides a nucleic acid molecule which hybridises under stringent conditions to a polynucleotide according to the eighth aspect.

*o 2c According to a twenty-second aspect, the invention provides a nucleic acid molecule which hybridises under stringent conditions to a polynucleotide according to the ninth aspect.

According to a twenty-third aspect, the invention provides a kit which includes a nucleic acid molecule according to any one of the nineteenth to twenty-second aspects.

According to a twenty-fourth aspect, the invention provides a method of diagnosing a disease which is caused or mediated by expression of a superantigen according to the first aspect which includes the step of detecting the presence of said superantigen using an antibody according to any one of the thirteenth to sixteenth aspects, or detecting the presence ofa polynucleotide encoding said superantigen using a nucleic acid molecule according to any one of the nineteenth to twenty-second aspects.

Other aspects of the invention will be apparent from the description provided below, and from the appended claims.

Unless the context clearly requires otherwise, throughout the description and the claims, the words 'comprise', 'comprising', and the like are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense; that is to say, in the sense of "including, but not limited to".

"DESCRIPTON OF DRAWINGS While the invention is broadly defined above, it further includes embodiments of which the following description provides examples. It will also be better understood with reference to the following drawings: Fig 1: Multiple alignment of superantigen protein sequences.

S -The protein sequence of mature toxins were aligned using the PileUp programme onkocr on the GCG package. Regions of high sequence identity are in black boxes. The boxes S..o o-S9 o• *.go 2d below the sequences indicate the structural elements of SPE-C, as determined from the crystal structure (Roussel et al 1997 Nat. Struct. Biol. 4 no8:635-43). Regions with highest homology correspond to the p4, P5, oc4 and oc5 regions in SPE-C. The clear box near the C-terminus represents a primary zinc binding motif, a common feature of all toxins shown. The arrows on top of the sequence alignment show the regions of sequence diversity between SMEZ and SMEZ-2.

Figure 2: The nucleotide sequence of the portion of the smez-2 gene (SEQ ID NO.

1) coding the mature SMEZ-2 superantigen (SEQ ID NO. 2).

Figure 3: The nucleotide sequence of the portion of the spe-g gene (SEQ ID NO.

3) coding the mature SPE-G superantigen (SEQ ID NO. 4).

4 *oo* *oo WO 00/39159 PCT/NZ99/00228 3 Figure 4: The nucleotide sequence of the portion of the spe-h gene (SEQ ID NO. coding the mature SPE-H superantigen (SEQ ID NO. 6).

Figure 5: The nucleotide sequence of the portion of the spe-j gene (SEQ ID NO. 7) coding part of the mature SPE-J superantigen (SEQ ID NO. 8).

Figure 6: Gel electrophoresis of the purified recombinant toxins.

A. Two micrograms of purified recombinant toxin were run on a 12.5% SDSpolyacrylamide gel to show the purity of the preparations; B. Two micrograms of purified recombinant toxin were run on an isoelectric focusing gel PAA, pH The isoelectric point (IEP) of rSMEZ-2, rSPE-G and rSPE-H is similar and was estimated at pH 7-8. The IEP of rSMEZ was estimated at pH 6-6.5.

Figure 7: Stimulation of human T cells with recombinant toxins.

PBLs were isolated from human blood samples and incubated with varying concentrations of recombinant toxin. After 3d, 0.1 Ci 3 H]-thymidine was added and cells were incubated for another 24h, before harvested and counted on a gamma counter. 0, unstimulated; A, rSMEZ; Z, rSMEZ-2; rSPE-G; K, rSPE-H.

Figure 8: Jurkat cell assay Jurkat cells (bearing a Vp8 TcR) and LG-2 cells were mixed with varying concentrations of recombinant toxin and incubated for 24h, before Sel cells were added. After Id, 0.1 LCi 3 H]-thymidine was added and cells were counted after another 24h. The Vp8 targeting SEE was used as a positive control. The negative control was SEA. Both SMEZ and SMEZ-2 were potent stimulators of Jurkat cells, indicating their ability to specifically target V38 bearing T cells. 0, unstimulated; A, rSEA; Z, rSEE; rSMEZ; U, rSMEZ-2.

Figure 9: Zinc dependent binding of SMEZ-2 to LG-2 cells WO 00/39159 PCT/NZ99/00228 4 LG-2 cells were incubated in duplicates with 1 ng of 1251 labelled rSMEZ-2 and increasing amounts of unlabeled toxin at 37 0 C for Ih, and then the cells were washed and counted.

0, incubation in media; A, incubation in media plus 1mM EDTA; Z, incubation in media plus 1 mM EDTA, 2 mM ZnC1 2 Figure 10: Scatchard analysis of SMEZ-2 binding to LG-2 cells One nanogram 12

I

5 -labeled rSMEZ-2 was incubated in duplicates with LG-2 cells and a 2-fold dilution series of cold toxin (10 ig to 10 pg). After Ih, cells were washed and counted. Scatchard plots were performed as described by Cunningham et al 1989 Science 243:1330-1336.

Figure 11: Summary of competitive binding experiments.

Efficiency of each labelled toxin to compete with a 10,000-fold molar excess of any other unlabeled toxin for binding to LG-2 cells. O no competition; O, competition; El 50% competition; El 75% competition; U 100% competition.

The results within the boxes are at the bottom right have previously been published (Li et al. 1997).

Figure 12: Competition binding study with SMEZ-2.

LG-2 cells were incubated in duplicates with 1 ng of 12 5 1-labeled rSMEZ-2 and increasing amounts of unlabeled rSMEZ-2, rSEA, rSEB, rTSST or rSPE-C. After lh cells were washed and counted.

O, rSMEZ-2; A, rSEA; Z, rSEB; I rTSST; rSPE-C.

Figure 13: Southern blot analysis of genomic DNA with radiolabeled smez. HINDIII digested genomic DNA from various Steptococcus isolates was hybridized with a radiolabeled smez probe. Band A is a 1953 bp HindlII DNA fragment that carries the smez gene. Bands B and C are DNA fragments of about 4 kbp and 4.2 kbp, respectively, which both carry a smez like region. 1,S. pyogenes reference strain (ATCC 700294, Ml type); 2, isolate 9639 (MNT); 3, isolate 11789 (MNT); 4, isolate WO 00/39159 PCT/NZ99/00228 11152 (PT2612 type); 5, isolate RC4063 (group C streptococcus); 6, isolate 11070 type); 7, DNA marker lane; 8, isolate 4202 (NZ5118/M92 type); 9, isolate 94/229 (M49 type); 10, isolate 11610 (emm57 type); 11, isolate 95/127 (NZ1437/M89 type); 12, isolate 94/330 (M4 type).

DESCRIPTION OF THE INVENTION The focus of the invention is the identification of four superantigens (SPE-G, SPE-H, SPE-J and SMEZ-2) and the corresponding polynucleotides which encode them.

Figure 1 shows the amino acid sequences of the above four superantigens together with those of previously identified superantigens SMEZ, SPE-C and SEA.

Of the four superantigens SPE-G, SPE-H, SPE-J and SMEZ-2, the latter is perhaps of greatest interest.

The smez-2 gene which encodes SMEZ-2 was identified in an experiment designed to produce recombinant SMEZ protein from S. pyogenes 2035 genomic DNA. A full length smez gene was isolated from the strain but the DNA sequence of the smez gene of strain 2035 showed nucleotide changes in 36 positions (or compared to smez from strain Ml (Fig. The deduced protein sequences differed in 17 amino acid residues (or This difference establishes this as a new gene, smez-2, and the encoded protein as a new superantigen, SMEZ-2.

The most significant difference between SMEZ and SMEZ-2 is an exchanged pentapeptide sequence at position 96-100, where the EEPMS sequence of SMEZ is converted to KTSIL in SMEZ-2 (Fig. A second difference is at position 111-112, where an RR dipeptide is exchanged for GK in SMEZ-2. The remaining 10 different residues are spread over almost the entire primary sequence.

Figure 2 shows the nucleotide sequence encoding mature SMEZ-2 and the deduced amino acid sequence.

WO 00/39159 PCT/NZ99/00228 6 Likewise, Figures 3 to 5 show the nucleotide sequence encoding mature SPE-G, SPE-H and SPE-J superantigens, respectively, together with their respective deduced amino acid sequences.

The invention is of course not restricted to superantigens/polynucleotides having the specific sequences of Figures 1 to 5. Instead, functionally equivalent variants are contemplated.

The phrase "functionally equivalent variants" recognises that it is possible to vary the amino acid/nucleotide sequence of a peptide while retaining substantially equivalent functionality. For example, a peptide can be considered a functional equivalent of another peptide for a specific function if the equivalent peptide is immunologically cross-reactive with and has at least substantially the same function as the original peptide. The equivalent can be, for example, a fragment of the peptide, a fusion of the peptide with another peptide or carrier, or a fusion of a fragment which additional amino acids. For example, it is possible to substitute amino acids in a sequence with equivalent amino acids using conventional techniques. Groups of amino acids normally held to be equivalent are: Ala, Ser, Thr, Pro, Gly; Asn, Asp, Glu, Gin; His, Arg, Lys; Met, Leu, Ile, Val; and Phe, Tyr, Trp.

Equally, nucleotide sequences encoding a particular product can vary significantly simply due to the degeneracy of the nucleic acid code.

Variants can have a greater or lesser degree of homology as between the variant amino acid/nucleotide sequence and the original.

Polynucleotide or polypeptide sequences may be aligned, and percentage of identical nucleotides in a specified region may be determined against another sequence, using computer algorithms that are publicly available. Two exemplary algorithms for aligning and identifying the similarity of polynucleotide sequences are the WO 00/39159 PCT/NZ99/00228 7 BLASTN and FASTA algorithms. The similarity of polypeptide sequences may be examined using the BLASTP algorithm. Both the BLASTN and BLASTP software are available on the NCBI anonymous FTP server (ftp://ncbi.nlm.nih.gov) under /blast/executables/. The BLASTN algorithm version 2.0.4 [Feb-24-1998], set to the default parameters described in the documentation of variants according to the present invention. The use of the BLAST family of algorithms, including BLASTN and BLASTP, is described at NCBI's website at URL http://www.ncbi.nlm.nih.gov/BLAST/newblast.html and in the publication of Altschul, Stephen et al. (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-34023.

The computer algorithm FASTA is available on the Internet at the ftp site ftp://ftp.virginia.edu/pub/fasta/. Version 2.0u4, February 1996, set to the default parameters described in the documentation and distributed with the algorithm, is also preferred for use in the determination of variants according to the present invention. The use of the FASTA algorithm is described in W. R. Pearson and D. J.

Lipman, "Improved Tools for Biological Sequence Analysis", Proc. Natl. Acad. Sci. USA 85:2444-2448 (1988) and W. R. Pearson, "Rapid and Sensitive Sequence Comparison with FASTP and FASTA, "Methods in Enzymology 183:63-98 (1990).

The following running parameters are preferred for determination of alignments and similarities using BLASTN that contribute to E values (as discussed below) and percentage identity: Unix running command: blastall -p blastn -d embldb -e 10 -G 1 -E 1 -r 2 -v 50 -b 50 -I queryseq -o results; and parameter default values: -p Program Name [String] -d Database [String] -e Expectation value [Real] -G Cost to open a gap (zero invokes default behaviour) [Integer] -E Cost to extend a cap (zero invokes default behaviour) [Integer] -r Reward for a nucleotide match (blastn only) [Integer] -v Number of one-line descriptions [Integer] -b Number of alignments to show [Integer] -i Query File [File In] -o BLAST report Output File [File Out] Optional For BLASTP the following running parameters are preferred: blastall -p blastp -d swissprotdb -e 10 -G 1 -E 1 -v 50 -b 50 -I queryseq -o results WO 00/39159 PCT/NZ99/00228 8 -p Program Name [String] -d Database [String] -e Expectation value [Real] -G Cost to open a gap (zero invokes default behaviour) [Integer] -E Cost to extend a cap (zero invokes default behaviour) [Integer] -v Number of one-line descriptions [Integer] -b Number of alignments to show [Integer] -i Query File [File In] -o BLAST report Output File [File Out] Optional The "hits" to one or more database sequences by a queried sequence produced by BLASTN, BLASTP, FASTA, or a similar algorithm, align and identify similar portions of sequences. The hits are arranged in order of the degree of similarity and the length of sequence overlap. Hits to a database sequence generally represent an overlap over only a fraction of the sequence length of the queried sequence.

The BLASTN and FASTA algorithms also produce "Expect" or E values for alignments. The E value indicates the number of hits one can "expect" to see over a certain number of contiguous sequences by chance when searching a database of a certain size. The Expect value is used as a significance threshold for determining whether the hit to a database, such as the preferred EMBL database, indicates true similarity. For example, an E value of 0.1 assigned to a hit is interpreted as meaning that in a database of the size of the EMBL database, one might expect to see 0.1 matches over the aligned portion of the sequence with a similar score simply by chance. By this criterion, the aligned and matched portions of the sequences then have a 90% probability of being the same. For sequences having an E value of 0.01 or less over aligned and matched portions, the probability of finding a match by chance in the EMBL database is 1% or less using the BLASTN or FASTA algorithm.

According to one embodiment, "variant" polynucleotides, with reference to each of the polynucleotides of the present invention, preferably comprise sequences having the same number or fewer nucleic acids than each of the polynucleotides of the present invention and producing an E value of 0.01 or less when compared to the polynucleotide of the present invention. That is, a variant polynucleotide is any sequence that has at least a 99% probability of being the same as the WO 00/39159 PCT/NZ99/00228 9 polynucleotide of the present invention, measured as having an E value of 0.01 or less using the BLASTN or FASTA algorithms set at the parameters discussed above.

Variant polynucleotide sequences will generally hybridize to the recited polynucleotide sequence under stringent conditions. As used herein, "stringent conditions" refers to prewashing in a solution of 6X SSC, 0.2% SDS; hybridizing at 650C, 6X SSC, 0.2% SDS overnight; followed by two washes of 30 minutes each in 1X SSC, 0.1% SDS at 65oC and two washes of 30 minutes each in 0.2X SSC, 0.1% SDS at 650C.

The superantigens of the invention together with their fragments and other variants may be generated by synthetic or recombinant means. Synthetic polypeptides having fewer than about 100 amino acids, and generally fewer than about 50 amino acids, may be generated by techniques well known to those of ordinary skill in the art. For example, such peptides may be synthesised using any of the commercially available solid-phase techniques such as the Merryfield solid phase synthesis method, where amino acids are sequentially added to a growing amino acid chain (see Merryfield, J. Am. Chem. Soc 85: 2146-2149 (1963)). Equipment for automative synthesis of peptides is commercially available from suppliers such as Perkin Elmer/Applied Biosystems, Inc. and may be operated according to the manufacturers instructions.

Each superantigen, or a fragment or variant thereof, may also be produced recombinantly by inserting a polynucleotide (usually DNA) sequence that encodes the superantigen into an expression vector and expressing the superantigen in an appropriate host. Any of a variety of expression vectors known to those of ordinary skill in the art may be employed. Expression may be achieved in any appropriate host cell that has been transformed or transfected with an expression vector containing a DNA molecule which encodes the recombinant protein. Suitable host cells includes procaryotes, yeasts and higher eukaryotic cells. Preferably, the host cells employed are E. coli, yeasts or a mammalian cell line such as COS or CHO, or an insect cell line, such as SF9, using a baculovirus expression vector. The DNA sequence expressed in this matter may encode the naturally occurring superantigen, fragments of the naturally occurring protein or variants thereof.

WO 00/39159 PCTINZ99/00228 DNA sequences encoding the superantigen or fragments may be obtained, for example, by screening an appropriate S. pyogenes cDNA or genomic DNA library for DNA sequences that hybridise to degenerate oligonucleotides derived from partial amino acid sequences of the superantigen. Suitable degenerate oligonucleotides may be designed and synthesised by standard techniques and the screen may be performed as described, for example, in Maniatis et al. Molecular Cloning A Laboratory Manual, Cold Spring Harbour Laboratories, Cold Spring Harbour, NY (1989).

Identification of these superantigens and of their properties gives rise to a number of useful applications. A first such application is in the genotyping of organisms by reference to their superantigen profile.

An illustration of this is subtyping of strains of S. pyogenes.

One feature which has been observed is that all clones of S. pyogenes so far found to be positive for SMEZ express either SMEZ-1 or SMEZ-2 but not both. Thus they are mutually exclusive, which enables a rapid diagnostic test which tells whether an isolate or a patient sample is either SMEZ-1 +ve or SMEZ-2 +ve. This will assist in the typing of the isolate.

This general diagnostic approach is most simply achieved by providing a set or primers which amplify either all or a subset of superantigen genes and that generate gene specific fragments. This can be modified to provide a simple qualitative ELISA-strip type kit that detects biotin labelled PCR fragments amplified by the specific primers and hybridised to immobilised sequence specific probes.

This has usefulness for screening patient tissue samples for the presence of superantigen producing streptococcal strains.

Such approaches are well known and well understood by those persons skilled in the art.

Another approach is to provide monoclonal antibodies to detect each of the streptococcal superantigens. An ELISA kit containing such antibodies would allow the screening of large numbers of streptococcal isolates. A kit such as this would be WO 00/39159 PCT/NZ99/00228 11 useful for agencies testing for patterns in streptococcal disease or food poisoning outbreaks.

Another potential diagnostic application of the superantigens of the invention is in the diagnosis of disease, such as Kawasaki Syndrome (KS).

KS is an acute multi-system vasculitis of unknown aetiology. It occurs world-wide but is most prevalent in Japan or in Japanese ancestry. It primarily affects infants and the young up to the age of 16. It is an acute disease that without treatment, can be fatal. Primary clinical manifestations include Prolonged fever Bilateral non-exudative conjunctivitis Indurtation and erythema of the extremities Inflammation of the lips and oropharynx Polymorphous skin rash Cervical lymphoadenopathy In 15-25% of cases, coronary arterial lesions develop.

These indications are used as a primary diagnosis of KS.

In Japan and the US, KS has become one of the most common causes of acquired heart disease in children. Treatment involves the immediate intravenous administration of gamma globulin (IVGG) during the acute phase of the disease and this significantly reduces the level of coronary lesions.

There are two clear phases to the disease, an acute phase and a convalescent phase. The acute phase is marked by strong immune activation. Several reports have suggested that superantigens are involved and many attempts have been made to link the disease to infection with superantigen producing strains of Streptococcus pyogenes. Features of the acute phase of KS are the expansion of VP 2 and to a lesser extent V08 bearing T cells and an increase of DR expression T cells (a hallmark of T cell activation).

Because SMEZ-2 stimulates both Vp2 and Vp8 bearing T cells, testing for SMEZ-2 production is potentially very useful in the diagnosis of KS.

WO 00/39159 PCT/NZ99/00228 12 Antibodies to the superantigens for use in applications such as are described above are also provided by this invention. Such antibodies can be polyclonal but will preferably be monoclonal antibodies.

Monoclonal antibodies with affinities of 10- 8

M-

1 or preferably 10-9 to 10-to M-1 or stronger will typically be made by standard procedures as described, eg. in Harlow Lane (1988) or Goding (1986). Briefly, appropriate animals will be selected and the desired immunization protocol followed. After the appropriate period of time, the spleens of such animals are excised and individual spleen cells fused, typically, to immortalised myeloma cells under appropriate selection conditions. Thereafter, the cells are clonally separated and the supernatants of each clone tested for their production of an appropriate antibody specific for the desired region of the antigen.

Other suitable techniques for preparing antibodies well known in the art involve in vitro exposure of lymphocytes to the antigenic polypeptides, or alternatively, to selection of libraries of antibodies in phage or similar vectors.

Also, recombinant immunoglobulins may be produced using procedures known in the art (see, for example, US Patent 4,816,567 and Hodgson J. (1991)).

The antibodies may be used with or without modification. Frequently, antibodies will be labeled by joining, either covalently or non-covalently, a substance which provides for a detectable signal. A wide variety of labels and conjugation techniques are known and are reported extensively in the literature. Suitable labels include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent agents, chemiluminescent agents, magnetic particles and the like. Patents teaching the use of such labels include US Patents 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4,366,241.

The immunological assay in which the antibodies are employed can involve any convenient format known in the art.

The nucleotide sequence information provided herein may be used to design probes and primers for probing or amplification of parts of the smez-2, spe-g, spe-h and WO 00/39159 PCT/NZ99/00228 13 spe-j genes. An oligonucleotide for use in probing or PCR may be about 30 or fewer nucleotides in length. Generally, specific primers are upwards of 14 nucleotides in length. For optimum specificity and cost effectiveness, primers or 16-24 nucleotides in length are preferred. Those skilled in the art are well versed in the design of primers for use in processes such as PCR.

If required, probing can be done with entire polynucleotide sequences provided herein as SEQ ID NOS 1, 3, 5 and 7, optionally carrying revealing labels or reporter molecules.

Such probes and primers also form aspects of the present invention.

Probing may employ the standard Southern blotting technique. For instance, DNA may be extracted from cells and digested with different restriction enzymes.

Restriction fragments may then be separated by electrophoresis on an agarose gel, before denaturation and transfer to a nitrocellulose filter. Labelled probes may be hybridised to the DNA fragments on the filter and binding determined. DNA for probing may be prepared from RNA preparations from cells. Probing may optionally be done by means of so-called "nucleic acid chips" (see Marshall and Hodgson (1998) Nature Biotechnology 16:27-31).

In addition to diagnostic applications, another application of the superantigens is reliant upon their ability to bind to other cells.

One of the most important features of superantigens is that they bind a large number or T cell receptor molecules by binding to the Vp domain. They are the most potent of all T cell mitogens and are therefore useful to recruit and activate T cells in a relatively non-specific fashion.

This ability enables the formation of constructs in which the superantigen (or at least the T-cell binding portion of it) is coupled to a cell-targeting molecule, particularly an antibody, more usually a monoclonal antibody.

When a monoclonal antibody that targets a specific cell surface antigen (such as a tumor specific antigen) is coupled to a superantigen in such a construct, this generates a reagent that on the one hand will bind specifically to the tumor cell, and WO 00/39159 PCT/NZ99/00228 14 on the other hand recruit and selectively active T cells for the purpose of killing the targeted cell.

Bi-specific constructs of this type have important applications in therapy (particularly cancer therapy) and again may be prepared by means known to those skilled in art. For example SMEZ-2 may be coupled to a tumor specific monoclonal antibody. The constructs may be incorporated into conventional carriers for pharmaceutically-active proteins.

Various aspects of the invention will now be described with reference to the following experimental section, which is included for illustrative purposes.

EXAMPLE

SECTION A: SUPERANTIGEN IDENTIFICATION AND CHARACTERISATION Materials and Methods Identification of novel SAGs The novel superantigens were identified by searching the S. pyogenes Ml genome database at the University of Oklahoma (http://www.genome.ou.edu/strep.html) with highly conserved 35 and a4regions of streptococcal and staphylococcal superantigens, using a TBlastN search programme.

The open reading frames were defined by translating the DNA sequences around the matching regions and aligning the protein sequences to known superantigens using the computer programes Gap. Multiple alignments and dendrograms were performed with Lineup and Pileup. The FASTA programme was used for searching the SwissProt (Amos Bairoch, Switzerland) and PIR (Protein Identification Resource, USA) protein databases.

The leader sequences of SPE-G and SPE-H were predicted using the SP Scan programme All computer programmes are part of the GCG package (version 8).

WO 00/39159 PCT/NZ99/00228 Cloning of smez, smez-2, spe-g and spe-h.

Fifty nanograms of S.pyogenes Ml (ATCC 700294) or S.pyogenes 2035 genomic DNA was used as a template to amplify the smez DNA fragment and the smez-2 DNA fragment, respectively, by PCR using the primers smez-forward (TGGGATCCTTAGAAGTAGATAATA) and smez-reverse (AAGAATTCTTAGGAGTCAATTTC) and Taq Polymerase (Promega). The primers contain a terminal tag with the restriction enzyme recognition sequences BamHI and EcoRI, respectively. The amplified DNA fragment, encoding the mature protein without the leader sequence (Kamezawa et al, 1997 Infect. Immun. no9:38281-33) was cloned into a T-tailed pBlueScript SKII vector (Stratagene).

Spe-g and spe-h were cloned in a similiar approach, using the primers spe-g-fw (CTGGATCCGATGAAAATTTAAAAGATTTAA) and spe-g-rev (AAGAATTCGGGGGGAGAATAG), and primers spe-h-fw (TTGGATCCAATTCTTATAATACAACC) and spe-h-rev (AAAAGCTTTTAGCTGATTGACAC), respectively.

The DNA sequences of the subcloned toxin genes were confirmed by the dideoxy chain termination method using a Licor automated DNA sequencer. As the DNA sequences from the genomic database are all unedited raw data, 3 subclones of every cloning experiment were analyzed to ensure that no Taq polymerase related mutations were introduced.

Expression and purification of rSMEZ, rSMEZ-2, rSPE-G and rSPE-H.

Subcloned smez, smez-2 and spe-g fragments were cut from pBlueScript SKII vectors, using restriction enzymes BamHI and EcoRI (LifeTech), and cloned into pGEX-2T expression vectors (Pharmacia). Due to an internal EcoRI restriction site within the spe-H gene, the pBlueScript:spe-h subclone was digested with BamHI and HindIII and the spe-h fragment was cloned into a modified pGEX-2T vector that contains a HindIII 3'cloning site.

Recombinant SMEZ, rSMEZ-2 and rSPE-H were expressed in E.coli DH5a cells as glutathione-S-tranferase (GST) fusion proteins. Cultures were grown at 37" C and induced for 3-4 h after adding 0.2 mM isopropyl-f-D-thiogalactopyranoside (IPTG).

GST SPE-G fusion protein was expressed in cells grown at 28* C.

WO 00/39159 PCT/NZ99/00228 16 The GST fusion proteins were purified on glutathione agarose as described previously (Li et al, 1997) and the mature toxins were cleaved off from GST by trypsin digestion. All recombinant toxins, except rSMEZ, were further purified by two rounds of cation exchange chromatography using carboxy methyl sepharose (Pharmacia). The GST-SMEZ fusion protein was trypsin digested on the GSH-column and the flow through containing the SMEZ was collected.

Gel electrophoresis All purified recombinant toxins were tested on a 12% SDS-polyacrylamide gel according the procedure of Laemmli. The isoelectric point of the recombinant toxins was determined by isoelectric focusing on a 5.5% polyacrylamide gel using ampholine pH 5-8 (Pharmacia Biotech). The gel was run for 90 min at 1 W constant power.

Toxin proliferation assay Human peripheral blood lymphocytes (PBL) were purified from blood of a healthy donor by Histopaque Ficoll (Sigma) fractionation. The PBL were incubated in 96-well round bottom microtiter plates at 10 s cells per well with RPMI-10 (RPMI with fetal calf serum) containing varying dilutions of recombinant toxins. The dilution series was performed in 1:5 steps from a starting concentration of 10 ng/ml of toxin.

Pipette tips were changed after each dilution step. After 3 days 0.1 PCi 3 H]thymidine was added to each well and cells were incubated for another 24 h.

Cells were harvested and counted on a scintillation counter.

Mouse leukocytes were obtained from spleens of 5 different mouse strains (SJL, B10/J, C3H and BALB/C). Splenocytes were washed in DMEM-10, counted in 5% acetic acid and incubated on microtiter plates at 105 cells per well with and toxins as described for human PBLs.

TcR Vp analysis.

Vp enrichment analysis was performed by anchored multiprimer amplification (Hudson et al, 1993, J exp Med 177:175-185). Human PBLs were incubated with pg/ml of recombinant toxin at 106 cells/ml for 3 d. A two-fold volume expansion of the culture followed with medium containing 20 ng/ml IL-2. After another 24h, WO 00/39159 PCT/NZ99/00228 17 stimulated and resting cells were harvested and RNA was prepared using Trizol reagent (Life Tech). A 500 bp p-chain DNA probe was obtained by anchored multiprimer PCR as described previously radiolabeled and hybridized to del (36) individual Vps and a Cp DNA region dot blotted on a Nylon membrane. The membrane was analysed on a Molecular Dynamics Storm Phosphor imager using ImageQuant software. Individual Vps were expressed as a percentage of all the Vps determined by hybridization to the Co probe.

Jurkat cell assay Jurkat cells (a human T cell line) and LG-2 cells (a human B lymphoblastoid cell line, homozygous for HLA-DR1) were harvested in log phase and resuspended in One hundred microliter of the cell suspension, containing 1x105 Jurkat cells and 2x10 4 LG-2 cells were mixed with 100 ld of varying dilutions of recombinant toxins on 96 well plates. After incubating overnight at 370 C, 100 pl aliquots were transfered onto a fresh plate and 100 pl (1x10 4 of Sel cells (IL-2 dependent murine T cell line) per well were added. After incubating for 24 h, 0.1 pCi [3H]thymidine was added to each well and cells were incubated for another 24 h.

Cells were harvested and counted on a scintillation counter. As a control, a dilution series of IL-2 was incubated with Sel cells.

Computer aided modelling of protein structures Protein structures of SMEZ-2, SPE-G and SPE-H were created on a Silicon Graphics computer using InsightII/Homology software. The superantigens SEA, SEB and SPE-C were used as reference proteins to determine structurally conserved regions (SCRs). Coordinate files for SEA (1ESF), for SEB (1SEB) and for SPE-C (1ANS) were downloaded from the Brookhaven Protein Database. The primary amino acid sequences of the reference proteins and SMEZ-2, SPE-G and SPE-H, respectively, were aligned and coordinates from superimposed SCR's were assigned to the model proteins. The loop regions between the SCRs were generated by random choice.

MolScript software (PJ Kraulis, 1991, J App Critallography 24:946-50) was used for displaying the computer generated images.

Radiolabeling and LG-2 binding experiments Recombinant toxin was radioiodinated by the chloramine T method as previously described (by Li et al. 1997). Labeled toxin was seperated from free iodine by size WO 00/39159 PCT/NZ99/00228 18 exclusion chromatography using Sephadex G25 (Pharmacia). LG2 cells were used for cell binding experiments, as described (Li et al. 1997). Briefly, cells were harvested, resuspended in RPMI-10 and mixed at 106 cells/ml with 12 1s-tracer toxin (1 ng) and 0.0001 to 10 gg of unlabeled toxin and incubated at 37* C for 1 h. After washing with ice cold RPMI-1 the pelleted cells were analyzed in a gamma counter.

For zinc binding assays the toxins were incubated in either RPMI-10 alone, in RPMIwith 1 mM EDTA or in RPMI-10 with 1mM EDTA, 2 mM ZnCl a Scatchard analysis was performed as described by Cunningham et al. (1989). For competitive binding studies, 1 ng of 1 25 I-tracer toxin (rSMEZ, rSMES-2, rSPE-G, rSPE-H, rSEA, rSPE-C, or rTSST) was incubated with 0.0001 to 10 Ig of unlabeled toxin (rSMEZ, rSMES-2, rSPE-G, rSPE-H, rSEA, rSEB, rSPE-C, and rTSST) for lh.

For SEB inhibition studies, 20 ng of 12s 5 -rSEB was used as tracer and samples were incubated for 4h.

Results Identification and sequence analysis of superantigens.

The Oklahoma University Streptococcus pyogenes M 1 genome database is accessible via the internet and contains a collection of more than 300 DNA sequence contigs derived from a shot gun plasmid library of the complete S. pyogenes Ml genome.

The currently available DNA sequences cover about 95% of the total genome. This database was searched with a highly conserved superantigen peptide sequence, using a search program that screens the DNA database for peptide sequences in all 6 possible reading frames. 8 significant matches and predicted the open reading frames (ORFs) were found by aligning translated DNA sequences to complete protein sequences of known SAgs.

Five matches gave complete ORFs with significant homology to streptococcal and staphylococcal superantigens. Three of these ORFs correlate to SPE-C, SSA and the recently described SMEZ (Kamezawa et al. 1997), respectively. The remaining two ORFs could not be correlated to any known protein in the SwissProt and PIR databases. These novel putative superantigen genes were named spe-g and spe-h (see Figs 3 and One ORF could not be generated completely due to its location close to the end of a contig. The DNA sequence of the missing 5'-end is located on WO 00/39159 PCT/NZ99/00228 19 another contig, and individual contigs have yet to be be assembled in the database.

However, the available sequence shows an ORF for the 137 COOH-terminal amino acid residues of a putative novel superantigen which could not be found in the existing protein databases. This gene was named spe-j (see Fig. In two cases a complete ORF could not be defined due to several out-of-frame mutations. Although DNA sequencing errors on the unedited DNA sequences cannot be completely ruled out, the high frequency of inserts and deletions probably represent natural mutation events on pseudogenes, which are no longer used.

To produce recombinant proteins of SMEZ, SPE-G and SPE-H, individual genes (coding for the mature toxins without leader sequence) were amplified by PCR, and subcloned for DNA sequencing. Both, Str. pyogenes Ml and Str. pyogenes 2035 genomic DNA were used and individual toxin gene sequences compared between the two strains. The spe-h gene was isolated from Ml strain, but could not be amplified from strain 2035 genomic DNA suggesting a restricted strain specificity for this toxin. The spe-g gene was cloned from both M1 and 2035, and DNA sequence analysis of both genes showed no differences. The full length smez gene was isolated from both strains, but DNA sequence comparison revealed some striking differences. The smez gene of strain 2035 showed nucleotide changes in 36 positions (or compared to smez from strain M1 (Fig. The deduced protein sequences differed in 17 amino acid residues (or This difference was sufficient to indicate a new gene. This gene was named smez-2, because it is homologous to smez (see Fig. 2).

The most significant difference between SMEZ and SMEZ-2 is an exchanged pentapeptide sequence at position 96-100, where the EEPMS sequence of SMEZ is converted to KTSIL in SMEZ2 (Fig. A second cluster is at position 111-112, where an RR dipeptide is exchanged for GK in SMEZ-2. The remaining 10 different residues are spread over almost the entire primary sequence.

A revised superantigen family tree, based on primary amino acid sequence homology now shows 3 general subfamilies; group A comprises SPE-C, SPE-J, SPE- G, SMEZ and SMEZ-2, group B comprises SEC1-3, SEB, SSA, SPE-A and SEG and WO 00/39159 PCT/NZ99/00228 group C comprises SEA, SEE, SED, SEH and SEI. Two superantigens, TSST and SPE-H do not belong to any one of those subfamilies.

SMEZ, SMEZ-2, SPE-G and SPE-J are most closely related to SPE-C, increasing the number of this subfamily from 2 to 5 members. SPE-G shows the highest protein sequence homology with SPE-C (38.4% identity and 46.6% similarity). The homology of SPE-J to SPE-C is even more significant (56% identity and 62% similarity), but this comparison is only preliminary due to the missing NH2-terminal sequence. SMEZ shows 30.9% 40.7% homology to SPE-C and SMEZ-2 is 92% 93% homologous to SMEZ.

SPE-H builds a new branch in the family tree and is most closely related to SED, showing 25% identity and 37.3% similarity.

Multiple alignment of SAg protein sequences (Fig. 1) shows that similarities are clustered within structure determining regions, represented by a4, a5, 04 and regions. This applies to all toxins of the superantigen family (data not shown) and explains why superantigens like SPE-C and SEA have very similar overall structures despite their rather low sequence identity of 24.4 Although SPE-H is less related to SPE-C it shows 2 common features with the "SPE- C subfamily": a truncated NH2-terminus, lacking the al region and (II) a primary zinc binding motif at the C-terminus (Fig. It has been shown for several superantigens that this motif is involved in a zinc coordinated binding to the P-chain ofHLA-DR1.

Fusion proteins of GST-SMEZ, GST-SMEZ-2 and GST-SPE-H were completely soluble and gave yields of about 30 mg per liter. The GST-SPE-G fusion was insoluble when grown at 37" C, but mostly soluble when expressed in cells growing at 28* C. Although soluble GST-SPE-G yields were 20-30 mg per liter, solubility decreased after cleavage of the fusion protein with trypsin. Soluble rSPE-G was achieved by diluting the GST-SPE-G to less than 0.2 mg/ml prior to cleavage. After cation exchange chromatography, purified rSPE-G could be stored at about 0.4 mg/ml.

WO 00/39159 PCT/NZ99/00228 21 Recombinant SMEZ could not be separated from GST by ion exchange chromatography. Isoelectric focusing revealed that the isoelectric points of the two proteins are too similar to allow separation (data not shown). Therefore, rSMEZ was released from GST by cleaving with trypsin while still bound to the GSH agarose column. Recombinant SMEZ was collected with the flow through.

The purified recombinant toxins were applied to SDS-PAGE and isoelectric focusing (Fig. Each toxin ran as a single band on the SDS PAA gel confirming their purity and their calculated molecular weights of 24.33 (SMEZ), 24.15 (SMEZ-2), 24.63 (SPE-G) and 23.63 (SPE-H) (Fig. 6A). The isoelectric focusing gel (Fig. 6B) shows a significant difference between rSMEZ and rSMEZ-2. Like most other staphylococcal and streptococcal toxins, rSMEZ-2 possesses a slightly basic isoelectric point at pH 7-8, but rSMEZ is acidic with an IEP at pH 6-6.5.

T cell proliferation and V/ specificity To ensure the native conformation of the purified recombinant toxins, a standard 3 H]thymidine incorporation assay was performed to test for their potency to stimulate peripheral blood lymphocytes (PBLs). All toxins were active on human T cells (Fig. Recombinant SEA, rSEB, rSPE-C and rTSST were included as reference proteins. The mitogenic potency of these toxins was lower than described previously, but is regarded as a more accurate figure. In previous studies, a higher starting concentration of toxin (100 ng/ml) was used and tips were not changed in between dilutions. This led to significant carryover across the whole dilution range.

On this occasion, the starting concentration was 10 ng/ml and tips were changed in between dilutions preventing any carryover.

The half maximal response for rSPE-G and rSPE-H was 2 pg/ml and 50 pg/ml, respectively. No activity was detected at less than 0.02 pg/ml and 0.1 pg/ml, respectively. Both toxins are therefore less potent than rSPE-C. Recombinant SMEZ was similar in potency to rSPE-C, with a Psoo value of 0.08 pg/ml and no detectable proliferation at less than 0.5 fg/ml. Recombinant SMEZ-2 showed the strongest mitogenic potency of all toxins tested or, as far as can be determined, described elsewhere. The Pso% value was determined at 0.02 pg/ml and rSMEZ-2 was still active at less than 0.1 pg/ml. All Pso% values are summarized in Table 1.

WO 00/39159 WO 0039159PCT/NZ99/00228 22 TABLE 1 POTENCY OF RECOMBINANT TOXINS ON HUMAN AND MOUSE T CELLS.

PROLIFERATION POTENTIAL P 5 0% JPg/Ml] TOXIN HUMAN

SEA

SEE

SEB

TSST

SPE-C

SMEZ

SMEZ-2

SPE-G

SPE-H

0.1 0.2 0.8 0.2 0.1 0.08 0.02 2 50

SJL

20 10 7000 20 11.M 12 12 80,000 1000

BIO/J

1.8 1.5 5000 1.2 C3H 19 50 10,000 100

BALB/C

1000 1000 >100,000 >100,000 >100,000 100, 000 >100,000 80 100 100,000 15 80 15 >100,000 800 100 10 100,000 5000 9000 800 100,000 100 200 18 >100,000 1000 Human PBLs and mouse T cells were stimulated with varying amounts of recombinant toxin. The Pso% value reflects the concentration of recombinant toxin required to induce 50% maximal cell proliferation. No proliferation was detected for rSPE-C and rSPE- G at any concentration testcd on murine T' ceUs.

WO 00/39159 PCT/NZ99/00228 23 Murine T cells from 5 different mouse strains were tested for their mitogenic response to rSMEZ, rSMEZ-2, rSPE-G and rSPE-H (Table Recombinant SPE-G showed no activity against any of the mouse strains tested. Recombinant SPE-H, rSMEZ and rSMEZ-2 showed varied potency depending on the individual mouse strain. For example, rSMEZ-2 was 500-fold more potent than rSPE-H in the strain, while rSPE-H was 7.5-fold more active than rSMEZ-2 in the SJL strain.

The most consistently potent toxin on murine T cells was rSMEZ-2 with Pso% values of 10 pg/ml in B10/J and 800 pg/ml in C3H. Recombinant SMEZ varied between pg/ml in SJL and BO1.M and 9000 pg/ml in C3H. The Pso% value for rSPE-H was between 15 pg/ml in SJL and 5000 pg/ml in B1O/J.

WO 00/39159 PCT/NZ99/00228 24 TABLE 2 Vp SPECIFICITY OF RECOMBINANT TOXINS ON HUMAN PBLS.

PERCENT Vp ENRICHMENT V3 Resting SMEZ SMEZ-2 SPE-G SPE-H 1.1 0.2 0.3 0.4 1.2 1 2.1 0.4 8.4 1 17.9 8.6 3.2 4.8 3.1 2.5 3 2.4 4.1 3.5 24.8 14.4 11.2 5.2 5.1 6.2 1.4 2.5 5.7 2.2 5.3 5.6 2.2 4.1 4.7 4.1 6.3 3 0.8 2.3 4.7 6.4 5.4 2.1 5.9 9.6 5.6 6.9 6.9 3.5 9.3 19.1 12.2 7.3 3.5 15.3 7.3 3.2 12.6 7.4 9 13.5 11.7 2.9 6.3 8.1 8.7 20.7 36 4.5 2.4 9.1 0.3 0.05 0 1.2 2.3 12.3 0.8 1.6 2 3.2 2.6 12.5 3 1.2 2 3 2.3 15.1 0.6 0.5 0.7 1.2 0.8 23.1 0.2 0.1 0.3 0.8 1 total 62.1 99.7 102.8 97.1 75.2 Human PBLs were incubated with 20 pg/ml of recombinant toxin for 4d. Relative enrichment of Vp cDNAs was analyzed from RNA of stimulated and reting PBLs by anchored primer PCR and reverse dot blot to a panel of 17 different VP cDNAs.

The values representing the highest Vp enrichment are underlined.

WO 00/39159 PCT/NZ99/00228 The human TcR V0 specificity of the recombinant toxins was determined by multiprimer anchored PCR and dot blot analysis using a panel of 17 human VP DNA regions. The Vp enrichment after stimulation with toxin was compared to the Vp profile of unstimulated PBLs (Table The sum total of all VBs stimulated by rSMEZ, rSMEZ-2 and rSPE-G was close to 100 suggesting that the Vps used in the panel represent all the targeted Vps. On the other hand, the total of the Vps stimulated by rSPE-H was only 75%. It is therefore likely that rSPE-H also stimulated some less common Vps, which are not represented in the panel. The most dramatic response was seen with all toxins, except rSMEZ2, on V02.1 bearing T cells (21-fold for rSMEZ, 45-fold for rSPE-G and 22-fold for rSPE-H). In contrast, rSMEZ2 gave only a 2.5-fold increase of Vp2.1 T-cells. SPE-G also targeted V04.1, Vp6.9, Vp9.1 and Vp12.3 (3-4 fold). A moderate enrichment of VP12.6, Vp9.1 and Vp23.1 (4-8 fold) was observed with rSPE-H. Both, rSMEZ and rSMEZ2, targeted Vp4.1 and Vp8.1 with similiar efficiency (3-7-fold). This finding is of particular interest, because V08.1 activity had been found in some, but not all Str. pyogenes culture supernatants and in crude preparations of SPE-A and SPE-C. Moreover, SPE-B has often been claimed to have Vp8 specific activity, but has since been shown to be a contaminant previously called SpeX. The ability of rSMEZ and rSMEZ-2 to stimulate the Vp8.1 Jurkat cell line was tested (Fig. 8) Recombinant SMEZ was less potent than the control toxin (rSEE), showing a half maximal response of 0.2 ng/ml, compared to 0.08 ng/ml with rSEE, but rSMEZ-2 was more potent than rSEE (0.02 ng/ml). No proliferation activity was observed with the negative control toxin rSEA.

MHC class I binding To determine if there were significant structural differences, the protein structures of SMEZ-2, SPE-G and SPE-H were modelled onto the superimposed structurally conserved regions of SEA, SEB and SPE-C. The models showed that in all three proteins, the 2 amino acid side chains of the COOH-terminal primary zinc binding motif are in close proximity to a third potential zinc ligand to build a zinc binding site, similar to the zinc binding site observed in SEA and SPE-C.

The zinc binding residues in SPE-C are H167, H201, D203, and it is thought that H81 from the HLA-DR1 P-chain binds to the same zinc cation to form a regular tetrahedral complex. The two ligands of the primary zinc binding motif, H201 and WO 00/39159 PCT/NZ99/00228 26 D203, are located on the 012 strand, which is part of the p-grasp motif, a common structural domain of superantigens. The third ligand, H167, comes from the strand (Roussel et al. 1997).

In the model of SPE-G three potential zinc binding ligands (H167, H202 and D204) are located at corresponding positions. In the SMEZ-2 and the SPE-H models, the two corresponding p12 residues are H202, D204 and H198, D200, respectively. The third ligand in SPE-H (D160) and in SMEZ-2 (H162) comes from the p9 strand and is most similar to H187 in SEA. It has been shown from crystal structures that H167 of SPE-C and H187 of SEA are spatially and geometrically equivalent sites (Scad et al. 1997, Embo J 14 no 14:3292-301; Roussel et al. 1997).

All superantigens examined so far, except SPE-C, bind to a conserved motif in the MHC class II al-domain. In SEB and TSST, hydrophobic residues on the loop between the 1p and p2 strand project into a hydrophobic depression in the MHCII al-domain. This loop region has changed its character in SPE-C, where the hydrophobic residues F44, L45, Y46 and F47 in SEB) are substituted by the less hydrophobic residues T33, T34 and H35. A comparison of this region on the computer generated models revealed that the generic HLA-DR1 a-chain binding site might also be missing. As the loop regions are generated by random choice, no conclusions can be drawn from their conformation in the models. However, in none of the three models does the pl-02-loop have the required hydrophobic features observed in SEB and TSST Swaminathan, S. et al., Nature 359, No. 6398:801-6 (1992), Acharya et al., Nature 367, No. 6458: 94-7 (1994). The residues are 125, D26, F27, K28, T29 and S30 in SMEZ-2, T31, T32, N33, S34 in SPE-G and K28, N29, P31, D32, 133, V34 and T35 in SPE-H.

SMEZ-2 differs from SMEZ in only 17 amino acids. In the model of SMEZ-2 with the position of those 17 residues, most of the exchanges are located on loop regions, most significantly on the p5-06 loop with 5 consecutive residues replaced. The potential zinc binding site and the P1-02 loop are not affected by the replaced amino acids.

The TcR VP specificity differs between SMEZ and SMEZ-2 by one VB. SMEZ strongly stimulates VP2 T cells, but SMEZ-2 does not (Table One or more of the 17 WO 00/39159 PCT/NZ99/00228 27 exchanged residues in SMEZ/SMEZ-2 may therefore be directly involved in TcR binding. The exact position of the TcR binding site can not be predicted from the model as several regions have been implicated in TcR binding for different toxins.

Crystal structures of SEC2 and SEC3, complexed with a TcR P-chain indicated the direct role of several residues located on a2, the p2-03 loop, the 04-35 loop and a4 (Fields et al. 1996 Nature 384 no 6605:188-92). On the other hand, binding of TSST to the TcR involves residues from a4, the 07-08 loop and the a4-p9 loop (Acharya et al. 1994, Nature 367 no 6548:94-7). The SMEZ-2 model shows 3 residues, which may contribute to TcR binding. In SMEZ, Lys is exchanged for Glu at position and Thr is exchanged for Ile at position 84, both on the P4-05 loop. On the COOHterminal end of the a4 helix, Ala is replaced by Ser at position 143.

The results from the computer modelled protein structures suggest that all 4 toxins, SMEZ, SMEZ-2, SPE-G and SPE-H, might bind to the HLA-DR1 P-chain in a zinc dependent fashion, similar to SEA and SPE-C, but might not be able to interact with the HLA-DR1 a-site, a situation that has so far only been observed with SPE-C (Roussel et al. 1997; Li et al. 1997).

To find out whether or not zinc is required for binding of the toxins to MHC class II, a binding assay was performed using human LG-2 cells (which are MHC class II expressing cells homozygous for HLA-DR1). Direct binding of 1 2 sI-labeled toxins was completely abolished in the presence of 1 mM EDTA (Fig. 9, Table When 2 mM ZnC1 2 was added, binding to the LG-2 cells could be restored completely. These results show that the toxins bind in a zinc dependent mode, most likely to the HLA- DR1 P-chain similar to SEA and SPE-C. However, it does yet not exclude the possibility of an additional binding to the HLA-DR1 a-chain.

WO 00/39159 PCT/NZ99/00228 28 TABLE 3 BINDING AFFINITIES AND ZINC DEPENDENCIES FOR SUPERANTIGENS TO HUMAN CLASS II TOXIN MHC CLASS II BINDING ZINC DEPENDENCY kd [nM] SEA 36/1000 SEB 340 TSST 130 SPE-C 70 SMEZ 65/1000 SMEZ-2 25/ 1000 SPE-G 16/1000 SPE-H 37/2000 The binding affinities of the toxins to MHC class II were determined by Scatchard analysis using LG-2 cells.

Zinc dependency was determined by binding of recombinant toxins to LG-2 cells in the presence and absence of EDTA, as described in the Materials and Methods section.

The biphasic binding of SEA to HLA-DR1 can be deduced from Scatchard analysis. It shows that SEA possesses a high affinity binding site of 36 nM (which is the zinc dependent p-chain binding site) and a low affinity binding site of 1 p.M (a-chain binding site). On the other hand, only one binding site for HLA-DR1 was deduced from Scatchard analysis with SEB, TSST and SPE-C, respectively (Table 3).

Therefore, Scatchard analysis was performed with radiolabeled rSMEZ, rSMEZ-2, rSPE-G and rSPE-H using LG-2 cells. All four toxins showed multiphasic curves with at least 2 binding sites on LG-2 cells, a high affinity site of 15-65 nM and a low affinity site of 1-2 pM (Fig. 10, Table 3).

WO 00/39159 PCT/NZ99/00228 29 In a further attempt to determine the orientation of the toxins on MHC class II competition binding experiments were performed. The recombinant toxins and reference toxins (rSEA, rSEB, rSPE-C and rTSST) were radiolabeled and tested with excess of unlabeled toxin for binding to LG-2 cells. The results are summarized in Fig. 11. Both, rSEA and rSPE-C, inhibited binding of labeled rSMEZ, rSMEZ-2, rSPE-G and rSPE-H, respectively. However, rSPE-C only partially inhibited binding of the labeled rSMEZ-2 (Fig. 12). Recombinant SEB did not compete with any other toxin, even at the highest concentration tested. Recombinant TSST was only slightly competitive against 12 5 -labeled rSMEZ, rSMEZ-2 and rSPE-G, respectively, and did not inhibit rSPE-H binding at all.

Reciprocal competition experiments were performed. Recombinant SMEZ, rSMEZ-2 and rSPE-H prevented 12 5 1-rSEA from binding to LG-2 cells. However, only partial competition was observed even at the highest toxin concentrations (10,000 fold molar excess). Recombinant SPE-G did not prevent binding of 12s 5 -rSEA and 1 25 I-rTSST binding was only partially inhibited by rSMEZ, rSMEZ-2 and rSPE-H, but not by rSPE-G. Significantly, none of the toxins inhibited 125I-rSEB binding, even at the highest concentration tested.

In a further set of competition binding experiments, rSMEZ, rSMEZ-2, rSPE-G and rSPE-H were tested for competition against each other. Both, rSMEZ and rSMEZ-2 competed equally with each other and also prevented binding of labeled rSPE-G and rSPE-H. In contrast, rSPE-G and rSPE-H did not inhibit any other toxin binding suggesting that these toxins had the most restricted subset of MHC class II molecules, which represent specific receptors.

SECTION B: GENOTYPING Genotyping of S.pyogenes isolates Purified genomic DNA from all Str. Pyogenes isolates was used for PCR with specific primers for the smez, spe-g and spe-h genes as described above and by Proft (1999).

In addition, a primer pair specific to a DNA region encoding the 23S rRNA, oligo 23rRNA forward (GCTATTTCGGAGAGAACCAG) and oligo 23rRNA reverse (CTGAAACATCTAAGTAGCTG) was designed and used for PCR as a positive control.

WO 00/39159 PCT/NZ99/00228 Southern blot analysis About 5ig of genomic DNA was digested using restriction enzyme HindIII (GIBCO) and loaded onto a 0.7% agarose gel. The DNA was transferred from the gel to a Hybond-N+ nylon membrane (Amersham) as described by Maniatis (1989). A 640 bp DNA fragment of the smez-2 gene was radiolabeled using the RadPrime Labeling System (GIBCO) and a 32P-dCTP (NEN). The nylon blots were hybridized with the radiolabeled probe in 2x SSC, 0.5% SDS, 5x Denhards overnight at 650C. After washing twice in 0.2x SSC, 0.1% SDS at 650C the blots were analysed on a Storm Phosphorlmager.

RESULTS

PCR based genotyping was performed in order to determine the frequency of the genes smez, spe-g and spe-h in streptococcal isolates (Table The PCR primers for smez were designed to anneal with both genes, semz and smez-2. 103 isolates were collected between 1976 and 1998 from varying sites in patients with varying infections, although the majority were from sore throats. They comprised 94 group A Streptococcus (GAS) and 9 non-GAS, which were S. agalactiae (group S. equis (group C) and Streptococcus spp (group There are 25 distinct M/emm types represented among the GAS isolates, 13 isolates are M non-typable (MNT) and in 2 cases the M type is unknown. The analysis was undertaken blinded to the details of each isolate and 2 duplicate isolates were included (95/31 and 4202) to demonstrate the reproducibility of the testing procedure. The isolates are listed in 2 groups. Group 1 contained isolates collected within a large time frame (1976 to 1996). Group 2 comprised of isolates collected within a short time (1998).

All of the 9 non-GAS isolates (belonging to groups B, C and G) were negative for the tested sag genes. The frequencies for smez, spe-g and spe-h within the GAS isolates were 95.6%, 100% and 23.9% respectively. A correlation between a certain M/emm type and the presence of the spe-h gene could not be established. The deficiency in this current set was that only 5M/emm types were represented by more than one isolate. The most frequent serotype was M/emm 12 with 13 isolates, from which 7 were positive and 6 were negative for spe-h suggesting genetic diversity within the WO 00/39159 PCT/NZ99/00228 31 M/emml2 strain. In contrast, all 12 tested NZ1437/M89 isolates were negative for spe-h.

The high frequencies of smez and spe-g is of particular interest as this has not been described for any other streptococcal sag gene thus far. Other spe genes, like speA, speC and ssa are found at much lower frequencies and horizontal gene transfer might explain the varying frequencies of these genes in different strains. In contrast, both smez and spe-g were found in virtually all tested GAS isolates. Only 4 GAS isolates (11152, 11070, 94/229 and 11610) tested negative for smez. These were PT2612, emm65, M49 and emm57. Southern hybridisation was performed to find out if the negative PCR results were due to lack of the smez gene or to lack/alteration of the primer binding site(s). HindIII digested genomic DNA of selected streptococcal isolates was probed with a 640 bp radiolabeled smz-2 PCR fragment (Fig. 13). The smez gene is located on a 1953 bp HindIII fragment of about 4kb (fragment but not to the SMEZ bearing fragment A (lanes 4, 6, 9, 10). In addition, the smez probe bound to a second DNA fragment of about 4.2 kb (fragment C) in isolate 11152 (lane In the M1 reference strain (lane 1) and in isolate 4202 (lane 8) the smez probe also bound to fragment B, in addition to fragment A.

Fragment B in the M1 strain contains a 180 bp region that shares 97% sequence homology with the 3' end of the smez gene. These results suggest that the 4 PCR negative isolates possess a truncated smez gene or a smez-like sequence, but not a complete smez gene.

WO 00/39159 PCT/NZ99/00228 Table 4 Group 1: Isolates collected between 1976 and 1996 Strain No. Group M/emm Site Disease Rib.DNA Spe-g Spe-h Smez Vp8 FP 1943 A M53 ts ST FP 2658 A M59 ts ST FP 4223 A M80 ts ST FP 5417 A M41 ts ST FP 5847 A M ts ST FP 5971 A M57 ts ST 1/5045 A M4 ts ST 79/1575 A M I ts Tcarriage 81/3033 A M12 ts ST 82/20 A M4 sk ulcer 82/532 A M 12 ts ST 82/675 A NZ1437 ws wound 84/141 A M12 ts ST 84/1733 A M4 ts ST 84/781 A NZ1437 ts ST 85/1 A M12 ts ST 85/167 A M12 ts ST 85/314 A NZ1437 ws wound 85/437 A M81 ws inf eczema 85/722 A n.d. 86/435 A M4 ts RF 87/169 A M12 ts ST 87/19 A M12 ts ST 87/781 A M12 ts ST 88/627 A M12 sk wound 89/22 A M12 ts fever 89/25 A M12 ur erysipelas 89/26 A M I ts AGN 89/54 A NZ1437 ts ST 90/306 A M5 ear otorrhoea 90/424 A M4 ts ST 91/542 A M12 ts ST 94/11 A NZ1437 ps abscess 94/229 A M49 hvs endometr. 94/330 A M4 ts SF 94/354 A M12 ts ST 94/384 A M4 sk wound 94/712 A NZ1437 ws celulitis 95/127 A NZ1437 bc cellulitis WO 00/39159 PCTINZ99/00228 95/31 [A NZ1437 ws abscess 95/31(2) A NZ1437 ws abscess 95/361 A NZ1437 ps abscess 96/1 A n.d. 96/364 A NZ1437 be burns 96/551 A M4 eye eye infect 96/610 A M4 ts SF D21 A Ml ts Tcarriage RC4063 C t- s ST SP9205 C ts ST N16174 G ts ST N16192 B ts ST VC4141 G ts ST Group 2: Isolates collected in 1998 Strain student group M/emm site disease rib.DNA spe-g spe-h smez Vi8 No. ID 4202 3310 A NZ5118I ts ST 4202(2) 3310 A NZ5118n ts ST 9606 2252 A MNT ts ST 9639 2184 A MNT ts ST 9779 3230 A cmm56 ts ST 9893 6144 A PT 180 ts ST 9894 6564 A emm59 ts ST 10019 6264 A emm44 ts ST 10028 9366 A emm41 ts ST 10134 1880 A ST4547 ts ST 10303 3564 A emm59 ts ST 10307 4850 A NZ5118I ts ST 10438 4904 A ST3018 ts ST 10463 TSP A emm49 ts ST 10649 11510 A ST2267 ts ST 10730 11503 A MNT ts ST 10742 3374 A ST809 ts ST 10761 3254 A MNT ts ST 10763 6614 PT ts ST 1078 3875 2 4850 A MNT ts ST 10791 10290 A MNT ts ST 10792 10308 A MNT ts ST 10846 8854 A NZ1437 ts ST WO 00/39159 PCT/NZ99/00228 10902 6264 A NZ5118n ts ST 10989 5194 A PT2841 ts ST 11070 1434 A emm65 ts ST 11072 1880 A ST4547 ts ST 11083 4538 A MNT ts ST 11093 9791 A MNT ts ST 11152 2030 A PT2612 ts ST 11222 4928 A NZ5118n- ts ST 11227 8854 A emml4 ts ST 11244 2252 A ST4547 ts ST 11276 4524 A MNT ts ST 11299 2950 A emm80 ts ST 11574 3186 A ST809 ts ST 11580 3280 A emm53 ts ST 11610 2424 A emm57 ts ST 11646 1880 A ST4547 ts ST 11681 3564 A emml2 ts ST 11686 5528 A PT5757 ts ST 11745 12397 A emm59 ts ST 11789 1568 A MNT ts ST 11802 3266 A MNT ts ST 11869 2950 A ST4547 ts ST 11961 4916 A MNT ts ST 12015 12373 A emm59 ts ST 7625 8215 B ts ST 8011 3238 B ts ST 10388 1653 G ts ST 012633 5395 B ts ST Table 4: Genotyping of streptococcal isolates. The isolates were collected between 1976 and 1996 (group 1) and in 1998 (group 2) from patients with varying diseases.

The results are based on PCR analysis using purified genomic DNA and specific primers for each of the sag genes.

The non Gas are: B, S. agalactiae; C, S. equis; G, Streptococcus spp.

MNT, M non typable: ts, throat site; ws, wound site; sk, skin; ps, pus site; hvs, high vaginal site; bc, blood culture; ST, sore throat; SF, scarlet fever; RF, rheumatic fever; AGN, acture glomerulonephritis; T carriage, throat carriage.

WO 00/39159 PCT/NZ99/00228 and i, duplicate isolates; recently assigned as M89; II, recently assigned as M92.

INDUSTRIAL APPLICATION The superantigens of the invention, polynucleotides which encode them and antibodies which bind them have numerous applications. A number of these are discussed above (including Streptococci subtyping, diagnostic applications and therapeutic applications) but it will be appreciated that these are but examples.

Other applications will present themselves to those skilled in the art and are in no way excluded from the scope of the invention.

It will also be appreciated that the foregoing examples are illustrations of the invention. The invention may be carried out with the numerous variations and modifications as will be apparent to those skilled in the art. For example, a native superantigen may be replaced by a synthetic superantigen with on or more deletions, insertions and/or substitutions relative to the corresponding natural superantigen, provided that the superantigen activity is retained. Likewise there are many variations in the way in which the invention can be used in other aspects of it.

REFERENCES

Marrack, and J. Kappler. 1990. The staphylococcal enterotoxins and their relatives. Science 248:705-711.

Huber, P.N. Hsu, and N. Sutkowski. 1996. Virus-encoded superantigens.

Microbiol. Rev. 60, no. 3:473-82.

Alouf, H. Knoell, and W. Koehler. 1991. The family of mitogenic, shockinducing and superantigenic toxins from staphylococci and streptococci.

Sourcebook of bacterial protein toxins., eds. J.E. Alouf and J.H. Freer. Academic Press, San Diego. 367-414 pp.

WO 00/39159 PCT/NZ99/00228 36 Betley, D.W. Borst, and L.B. Regassa. 1992. Staphylococcal enterotoxins, toxic shock syndrome toxin and streptococcal exotoxins: a comparative study of their molecular biology. Chem. Immunol. 55:1-35.

Ren, J.D. Bannan, V. Pancholi, A.L. Cheung, J.C. Robbins, V.A. Fischetti, and J.B. Zabriskie. 1994. Characterization and biological properties of a new staphylococcal exotoxin. J. Exp. Med. 180, no. 5:1675-83.

Munson, M.T. Tremaine, M.J. Betley, and R.A. Welch. 1998. Identification and Characterization Of Staphylococcal Enterotoxin Types G and I From Staphylococcus Aureus. Infect. Immun. 66, no. 7:3337-3348.

Herman, J.W. Kappler, P. Marrack, and A.M. Pullen. 1991. Superantigens: mechanism of T-cell stimulation and role in immune responses. Annu. Rev. Immunol.

9:745-772.

Janeway, J. Yagi, P.J. Conrad, M.E. Katz, B. Jones, S. Vroegop, and S. Buxser.

1989. T-cell responses to Mls and to bacterial proteins that mimic its behavior.

Immunol. Rev. 107:61-68.

Fast, P.M. Schlievert, and R.D. Nelson. 1989. Toxic shock syndrome-associated staphylococcal and streptococcal pyrogenic toxins are potent inducers of tumor necrosis factor production. Infect. Immun. 57, no. 1:291-4.

Kotzin, D.Y. Leung, J. Kappler, and P. Marrack. 1993. Superantigens and their potential role in human disease. Adv. Immunol. 54, no. 99:99-166.

Bohach, D.J. Fast, R.D. Nelson, and P.M. Schlievert. 1990. Staphylococcal and streptococcal pyrogenic toxins involved in toxic shock syndrome and related illnesses. Crit. Rev. Microbiol. 17, no. 4:251-72.

Weeks, and J.J. Ferretti. 1986. Nucleotide Sequence of the Type A Streptococcal Exotoxin (Erythrogenic Toxin) Gene from Streptococcus pyogenes Bacteriophage T12. Infect. Immun. 52:144-150.

WO 00/39159 PCT/NZ99/00228 37 Goshorn, G.A. Bohach, and P.M. Schlievert. 1988. Cloning and characterization of the gene, speC, for pyrogenic exotoxin type C from Streptococcus pyogenes. Mol. Gen. Genet. 212, no. 1:66-70.

Mollick, G.G. Miller, J.M. Musser, R.G. Cook, D. Grossman, and R.R. Rich.

1993. A novel superantigen isolated from pathogenic strains of Streptococcus pyogenes with aminoterminal homology to staphylococcal enterotoxins B and C. J.

Clin. Invest. 92, no. 2:710-9.

Van Den Busche, J.D. Lyon, and G.A. Bohach. 1993. Molecular evolution of the staphylococcal and streptococcal pyrogenic toxin gene family. Mol. Phylogenet.

Evol. 2:281-292.

Dellabona, J. Peccoud, J. Kappler, P. Marrack, C. Benoist, and D. Mathis. 1990.

Superantigens interact with MHC class II molecules outside of the antigen groove.

Cell 62, no. 6:1115-21.

Fraser, J.D. 1989. High-affinity binding of staphylococcal enterotoxins A and B to HLA-DR. Nature 339, no. 6221:221-3.

Fleischer, and H. Schrezenmeier. 1988. T cell stimulation by staphylococcal enterotoxins. Clonally variable response and requirement for major histocompatibility complex class II molecules on accessory or target cells. J. Exp.

Med. 167, no. 5:1697-707.

Mollick, R.G. Cook, and R.R. Rich. 1989. Class II MHC molecules are specific receptors for staphylococcus enterotoxin A. Science 244, no. 4906:817-20.

Schad, I. Zaitseva, V.N. Zaitsev, M. Dohlsten, T. Kalland, P.M. Schlievert, D.H.

Ohlendorf, and L.A. Svensson. 1995. Crystal structure of the superantigen staphylococcal enterotoxin type A. EMBO J. 14, no. 14:3292-301.

Swaminathan, W. Furey, J. Pletcher, and M. Sax. 1992. Crystal structure of staphylococcal enterotoxin B, a superantigen. Nature 359, no. 6398:801-6.

WO 00/39159 PCT/NZ99/00228 38 Papageorgiou, K.R. Acharya, R. Shapiro, E.F. Passalacqua, R.D. Brehm, and H.S. Tranter. 1995. Crystal structure of the superantigen enterotoxin C2 from Staphylococcus aureus reveals a zinc-binding site. Structure 3, no. 8:769-79.

Sundstrom, L. Abrahmsen, P. Antonsson, K. Mehindate, W. Mourad, and M.

Dohlsten. 1996. The crystal structure of staphylococcal enterotoxin type D reveals Zn2+-mediated homodimerization. EMBO J. 15, no. 24:6832-40.

Acharya, E.F. Passalacqua, E.Y. Jones, K. Harlos, D.I. Stuart, R.D. Brehm, and H.S. Tranter. 1994. Structural basis of superantigen action inferred from crystal structure of toxic-shock syndrome toxin-1. Nature 367, no. 6458:94-7.

Roussel, B.F. Anderson, H.M. Baker, J.D. Fraser, and E.N. Baker. 1997. Crystal structure of the streptococcal superantigen SPE-C: dimerization and zinc binding suggest a novel mode of interaction with MHC class II molecules. Nat. Struct. Biol. 4, no. 8:635-43.

Kim, R.G. Urban, J.L. Strominger, and D.C. Wiley. 1994. Toxic shock syndrome toxin-1 complexed with a class II major histocompatibility molecule HLA-DR1.

Science 266, no. 5192:1870-4.

Hurley, R. Shimonkevitz, A. Hanagan, K. Enney, E. Boen, S. Malmstrom, B.L.

Kotzin, and M. Matsumura. 1995. Identification of class II major histocompatibility complex and T cell receptor binding sites in the superantigen toxic shock syndrome toxin 1. J. Exp. Med. 181, no. 6:2229-35.

Seth, L.J. Stern, T.H. Ottenhoff, I. Engel, M.J. Owen, J.R. Lamb, R.D. Klausner, and D.C. Wiley. 1994. Binary and ternary complexes between T-cell receptor, class II MHC and superantigen in vitro. Source (Bibliographic Citation): Nature 369, no.

6478:324-7.

Li, R.E. Tiedemann, S.L. Moffat, and J.D. Fraser. 1997. The superantigen streptococcal pyrogenic exotoxin C (SPE-C) exhibits a novel mode of action. J. Exp.

Med. 186, no. 3:375-83.

WO 00/39159 PCT/NZ99/00228 39 Hudson, R.E. Tiedemann, R.G. Urban, S.C. Lowe, J.L. Strominger, and J.D.

Fraser. 1995. Staphylococcal enterotoxin A has two cooperative binding sites on major histocompatibility complex class II. J. Exp. Med. 182, no. 3:711-20.

Kozono, D. Parker, J. White, P. Marrack, and J. Kappler. 1995. Multiple binding sites for bacterial superantigens on soluble class II MHC molecules. Immunity 3, no.

2:187-96.

Tiedemann, and J.D. Fraser. 1996. Cross-linking of MHC class II molecules by staphylococcal enterotoxin A is essential for antigen-presenting cell and T cell activation. J. Immunol. 157, no. 9:3958-66.

Braun, D. Gerlach, U.F. Hartwig, J.H. Ozegowski, F. Romagne, S. Carrel, W.

Kohler, and B. Fleischer. 1993. Stimulation of human T cells by streptococcal "superantigen" erythrogenic toxins (scarlet fever toxins). J. Immunol. 150, no.

6:2457-66.

Kline, and C.M. Collins. 1997. Analysis of the interaction between the bacterial superantigen streptococcal pyrogenic exotoxin A (SpeA) and the human T-cell receptor. Mol. Microbiol. 24, no. 1:191-202.

Fleischer, A. Necker, C. Leget, B. Malissen, and F. Romagne. 1996. Reactivity of mouse T-cell hybridomas expressing human Vbeta gene segments with staphylococcal and streptococcal superantigens. Infect. Immun. 64, no. 3:987-94.

Toyosaki, T. Yoshioka, Y. Tsuruta, T. Yutsudo, M. Iwasaki, and R. Suzuki. 1996.

Definition of the mitogenic factor (MF) as a novel streptococcal superantigen that is different from streptococcal pyrogenic exotoxins A, B, and C. Eur. J. Immunol. 26, no.

11:2693-701.

Kamezawa, T. Nakahara, S. Nakano, Y. Abe, J. Nozaki-Renard, and T. Isono.

1997. Streptococcal mitogenic exotoxin Z, a novel acidic superantigenic toxin produced by a T1 strain of Streptococcus pyogenes. Infect. Immun. 65, no. 9:3828- 33.

WO 00/39159 PCT/NZ99/00228 Hudson, H. Robinson, and J.D. Fraser. 1993. Two adjacent residues in Staphylococcal enterotoxins A an E determine Tcell receptor V beta specificity. J.

Exp. Med. 177:175-185.

Kraulis, P.J. 1991. MOLSCRIPT": a program to produce both detailed and schematic plots of protein structures. J. Appl. Critallography 24:946-950.

Cunningham, P. Jhurani, P. Ng, and J.A. Wells. 1989. Receptor and Antibody epitopes in human growth hormone identified by homologue scanning mutagenesis.

Science 243:1330-1336.

Fields, E.L. Malchiodi, H. Li, X. Ysern, C.V. Stauffacher, P.M. Schlievert, K.

Karjalainen, and R.A. Mariuzza. 1996. Crystal structure of a T-cell receptor betachain complexed with a superantigen [see comments]. Nature 384, no. 6605:188-92.

Wen, G.A. Cole, S. Surman, M.A. Blackman, and D.L. Woodland. 1996. Major histocompatibility complex class II-associated peptides control the presentation of bacterial superantigens to T cells. J. Exp. Med. 183, no. 3:1083-92.

Thibodeau, I. Cloutier, P.M. Lavoie, N. Labrecque, W. Mourad, T. Jardetzky, and R.P. Sekaly. 1994. Subsets of HLA-DR1 molecules defined by SEB and TSST-1 binding. Science 266, no. 5192:1874-8.

Abe, B.L. Kotzin, K. Jujo, M.E. Melish, M.P. Glode, T. Kohsaka, and D.Y. Leung.

1992. Selective expansion of T cells expressing T-cell receptor variable regions V beta 2 and V beta 8 in Kawasaki disease. PNAS 89, no. 9:4066-70.

Kawasaki, T. 1967. Acute febrile mucocutaneous syndrome with lymphoid involvement with specific desquamation of the fingers and toes in children. Jpn. J.

Allergol. 16:178.

Leung, R.C. Giorno, L.V. Kazemi, P.A. Flynn, and J.B. Busse. 1995. Evidence for superantigen involvement in cardiovascular injury due to Kawasaki syndrome. J.

Immunol. 155, no. 10:5018-21.

WO 00/39159 PCT/NZ99/00228 41 Cockerill, R.L. Thompson, J.M. Musser, P.M. Schlievert, J. Talbot, K.E. Holley, W.S. Harmsen, D.M. Ilstrup, P.C. Kohner, M.H. Kim, B. Frankfort, J.M. Manahan, J.M. Steckelberg, F. Roberson, and W.R. Wilson. 1998. Molecular, Serological, and Clinical Features Of 16 Consecutive Cases Of Invasive Streptococcal Disease. Clin.

Infect. Dis. 26, no. 6:1448-1458.

Kapur, K.B. Reda, L.L. Li, L.J. Ho, R.R. Rich, and J.M. Musser. 1994.

Characterization and distribution of insertion sequence IS1239 in Streptococcus pyogenes. Gene 150, no. 1: 135-40.

T. Proft, S.L. Moffatt, C.J. Berkahn, and J.D. Fraser (1999). Identification and characterisation of novel superantigens from Streptoccocus pyogenes. Journal of Experimental Medicine 189, No. 1:89-102.

T. Maniatis, E.F. Fritsch, and J. Sambrook. (1989). Molecular cloning: a laboratory manual. Cold Spring Harbour Laboratory, Cold Spring Harbour, NY, USA.

B.A. Roe, S.P. Linn, L. Song, X. Yuan, S. Clifton, M. McShan and J. Ferretti, (1999).

Str. Pyogenes Ml genome sequencing project at Oklahoma University. Web: http://www.genome.ou.edu.

EDITORIAL NOTE APPLICATION NUMBER 19010/00 The following Sequence Listing pages 1 to 10 are part of the description. The claims pages follow on pages 42 to WO 00/39159 WO 0039159PCT/NZ99/00228 SEQUENCE LISTING <110> Auckland UniServices Limited <120> Superantigens <130> 25426 MRB <140> <141> <150> NZ 333589 <151> 1998-12-24 <160> 8 <170> Patentln Ver. 2.1 <210> 1 <211> 702 <212> DNA <213> Streptococcus pyogenes <220> <221> CDS <222> (699) <400> 1 atg aaa aaa aca aaa Met Lys Lys Thr Lys 1 5 ctt att ttt tct Leu Ile Phe Ser act tca ata ttc Thr Ser Ile Phe att gca Ile Ala ata att tct Ile Ile Ser cgt Arg cct gtg ttt gga tta gaa gta gat aat Pro Val Phe Gly Leu Glu Val Asp Asn 25 aat tcc ctt Asn Ser Leu cta agg aat Leu Arg Asn atc tat agt acg att gta tat gaa tat tca gat ata gta Ile Tyr Ser Thr Ile Val Tyr Glu Tyr Ser Asp Ile Val att gat Ile Asp ttt aaa acc agt cat aac tta gtg act aag aaa ctt gat gtt Phe Lys Thr Ser His Asn Leu Val Thr Lys Lys Leu Asp Val aga Arg gat gct aga gat Asp Ala Arg Asp ttt att aac tcc gaa atg gac gaa tat Phe Ile Asn Ser Glu Met Asp Glu Tyr WO 00/39159 gcc aat gat Ala Asn Asp ttt gat tgg Phe Asp Trp ggt gga ata Gly Gly Ile 115 PCT/NZ99/00228 ttt aaa act gga gat aaa ata gct gtg tte tee gtc eca Phe Lys Thr Gly Asp Lys Ala Val Phe Ser Val Pro aac Asn 100 tat tta tea aaa Tyr Leu Ser Lys gga Gly 105 aaa gte aca gca Lys Val Thr Ala tat ace tat Tyr Thr Tyr 110 aat ate cct Asn Ile Pro aca ccc tae caa Thr Pro Tyr Gin act tea ata cct Thr Ser Ile Pro gtt aat Val Asn 130 tta tgg att aat Leu Trp Ile Asn aag cag ate tct Lys Gin Ile Ser cct tac aae gaa Pro Tyr Asn Glu ata Ile 145 tea act aac aaa Ser Thr Asn Lys aca gtt aca get Thr Val Thr Ala eaa Gin 155 gaa att gat eta Glu Ile Asp Leu aag Lys 160 gtt aga aaa ttt tta ata gca caa eat Val Arg Lys Phe Leu Ile Ala Gin His 165 tta tat tet tct Leu Tyr Ser Ser ggt tct Gly Ser 175 age tae aaa Ser Tyr Lys aaa tat tct Lys Tyr Ser 195 ggt aga ctg gtt Gly Arg Leu Val ttt Phe 185 cat aca aat gat His Thr Asn Asp aat tea gat Asn Ser Asp 190 aaa gaa agt Lys Giu Ser ttc gat ctt ttc Phe Asp Leu Phe tat Tyr 200 gta gga tat aga Val Gly Tyr Arg ate ttt Ile Phe 210 aaa gta tac aaa Lys Val Tyr Lys aat aaa tet ttc Asn Lys Ser Phe aat Asn 220 ata gat aaa att Ile Asp Lys Ile ggg Gly 225 cat tta gat ata His Leu Asp Ile att gae tee taa Ile Asp Ser <210> 2 <211> 233 <212> PRT <213> Streptococcus pyogenes <400> 2 Met Lys Lys Thr Lys Leu Ile Phe Ser Phe Thr Ser Ile Phe Ile Ala WO 00/39159 WO 0039159PCT/NZ99/00228 Ile Ile Ser Leu Arg Asn Pro Val Phe Gly Leu Giu Val Asp Asn Asn Ser Leu Asp Ile Vai Ile Tyr Ser Thr Val Tyr Giu Tyr Ile Asp Phe Lys Thr Ser Asn Leu Val Thr Lys Leu Asp Vai Arg Asp Ala Arg Asp Phe Ile Asn Ser Giu Met Asp Giu Tyr Aia Asn Asp Phe Lys Thr Gly Asp Lys Ala Val Phe Ser Vai Pro Phe Asp Trp Giy Giy Ile 115 Tyr Leu Ser Lys Giy 105 Lys Val Thr Ala Tyr Thr Tyr 110 Thr Pro Tyr Gin Thr Ser Ile Pro Lys 125 Asn Ile Pro Vai Asn 130 Leu Trp Ile Asn Gly Lys Gin Ile Ser 135 Pro Tyr Asn Giu Ile 145 Ser Thr Asn Lys Thr 150 Thr Val Thr Ala Giu Ile Asp Leu Lys 160 Val Arg Lys Phe Leu 165 Ile Ala Gin His Leu Tyr Ser Ser Giy Ser 175 Ser Tyr Lys Lys Tyr Ser 195 Ser 180 Gly Arg Leu Val His Thr Asn Asp Asn Ser Asp 190 Lys Giu Ser Phe Asp Leu Phe Tyr 200 Vai Gly Tyr Arg Asp 205 Ile Phe 210 Lys Val Tyr Lys Asp 215 Asn Lys Ser Phe Ile Asp Lys Ile Gly 225 His Leu Asp Ile Giu 230 Ile Asp Ser <210> 3 <211> 705 WO 00/39159 WO 0039159PCT/NZ99/00228 <212> DNA <213> Streptococcus pyogenes <220> <221> CDS <222> (702) <400> 3 atg aaa aca aac Met Lys Thr Asn ttg aca att atc Leu Thr Ile Ile tta tca tgt gtt Leu Ser Cys Val ttt agc Phe Ser tat gga agt caa tta gct tat gca Tyr Gly Ser Gin Leu Ala Tyr Ala gat Asp 25 gaa aat tta aaa Glu Asn Leu Lys gat tta aaa Asp Leu Lys tat gaa aat Tyr Giu Asn aga agt tta Arg Ser Leu aga ttt gcc tat Arg Phe Ala Tyr att acc cca tgc Ile Thr Pro Cys 144 gta gaa Val Giu att gca ttt gtt Ile Ala Phe Val act Thr 55 aca aat agc ata cat att aat act aaa Thr Asn Ser Ile His Ile Asn Thr Lys c aa Gin aaa aga tcg gaa Lys Arg Ser Giu att ctt tat gtt Ile Leu Tyr Val gat Asp 75 tct att gta tct Ser Ile Val Ser tta Leu ggc att act gat Gly Ilie Thr Asp ttt ata aaa ggg Phe Ile Lys Giy gat Asp aag gtc gat gtt Lys Vai Asp Val ttt ggt Phe Gly ctc cct tat Leu Pro Tyr att gta aaa Ile Vai Lys 115 aat As n 100 ttt tcc cca cct Phe Ser Pro Pro tat Tyr 105 gta gat aat att Val Asp Asn Ile tat ggt ggt Tyr Gly Gly 110 ttt gta gga Phe Val Gly cat tcg aat caa His Ser Asn Gin gga C ly 120 aat aaa tca. tta Asn Lys Ser Leu cag Gin 125 att tta Ile Leu 130 aat caa gat ggg Asn Gin Asp Gly gaa act tat ttg Giu Thr Tyr Leu ccc Pro 140 tct gag gct gtt Ser Giu Ala Val cgc Arg 145 ata aaa aag aaa Ile Lys Lys Lys cag Gin 150 ttt act tta cag Phe Thr Leu Gin gaa Giu 155 ttt gat ttt aaa Phe Asp Phe Lys ata Ile 160 WO 00/39159 WO 0039159PCT/NZ99/00228 aga aaa ttt cta Arg Lys Phe Leu atg gaa aaa tac aat atc tat gat tcg gaa tcg cgt Met Glu Lys Tyr Asn Tyr Asp Ser Glu Ser Arg 175 tat aca tcg Tyr Thr Ser gaa gtt gat Giu Val Asp 195 ggg Gly 180 agc ctt ttc ctt Ser Leu Phe Leu gct Ala 185 act aaa gat Thr Lys Asp tta ttt aat aag Leu Phe Asn Lys gat aag ctt tta Asp Lys Leu Leu agt aaa cat tat Ser Lys His Tyr 190 agtcga gac agt Ser Arg Asp Ser 205 agt gaa gaa att Ser Glu Giu Ile ttc ttt Phe Phe 210 aaa agg tat aaa Lys Arg Tyr Lys aat aag att ttt Asn Lys Ile Phe agt cat ttt gat atc Ser His Phe Asp Ile 225 tac Tyr 230 tta aaa acg cac tag Leu Lys Thr His 705 <210> 4 <211> 234 <212> PRT <213> Streptococcus pyogenes <400> 4 Met Lys Thr Asn Ile Leu Thr Ile Ile 1 5 Leu Ser Cys Val Phe Ser Tyr Gly Ser Arg Ser Leu Gin Leu Ala Tyr Ala Giu Asn Leu Lys Asp Leu Lys Tyr Giu Asn Arg Phe Ala Tyr Ile Thr Pro Cys Asp Vai Giu Ile Ala Phe Val Thr 55 Thr Asn Ser Ile His Ile Asn Thr Lys Ser Ile Val Ser Leu Gin Lys Arg Ser Glu Ile Leu Tyr Val Asp Gly Ile Thr Asp Phe Ile Lys Gly Lys Val Asp Val Phe Gly Leu Pro Tyr As n 100 Phe Ser Pro Pro Tyr 105 Vai Asp Asn Ile Tyr Giy Gly 110 WO 00/39 159 Ile Vai Lys 115 PCT/NZ99/00228 His Ser Asn Gin Asn Lys Ser Leu Phe Val Gly Ile Leu 130 Asn Gin Asp Gly Giu Thr Tyr Leu Pro 140 Ser Giu Ala Val Ile Lys Lys Lys Phe Thr Leu Gin Giu 155 Phe Asp Phe Lys Arg Lys Phe Leu Giu Lys Tyr Asn Ile 170 Tyr Asp Ser Giu Ser Arg 175 Tyr Thr Ser Glu Val Asp 195 Ser Leu Phe Leu Ala 185 Thr Lys Asp Ser Lys His Tyr 190 Arg Asp Ser Leu Phe Asn Lys Asp Lys Leu Leu Ser 205 Phe Phe 210 Lys Arg Tyr Lys Asp Asn Lys Ile Phe 215 Asn 220 Ser Glu Giu Ile His Phe Asp Ile Leu Lys Thr His <210> <211> <212> <213> <220> <221> <222> 711

DNA

Streptococcus pyogenes

CDS

(708) <400> atg aga tat aat tgt cgc tac tca cat Met Arg Tyr Asn Cys Arg Tyr Ser His 1 5 atg att ata tgt ttg tca ttt ctt tta Met Ile Ilie Cys Leu Ser Phe Leu Leu gat aag aaa atc Asp Lys Lys Ile tac agc.

Tyr Ser tat tcc aat gtt Tyr Ser Asn Val caa gca 96 Gin Ala aat tct tat aat aca Asn Ser Tyr Asn Thr acc aat aga cat aat cta gaa.

Thr Asn Arg His Asn Leu Giu ctt tat aag 144 Leu Tyr Lys WO 00/39159 cat gat tct His Asp Ser PCTINZ99/00228 aac ttg att gaa gcc gat agt ata aaa aat tct cca gat Asn Leu Ile Ala Asp Ser Ile Asn Ser Pro Asp at t Ile gta aca agc cat Val Thr Ser His ttg aaa tat agt Leu Lys Tyr Ser gtc Val1 aag gat aaa aat Lys Asp Lys Asn 240 288 tca gtt ttt ttt Ser Vai Phe Phe gag Giu aaa gat tgg ata Lys Asp Trp Ile cag gaa ttc aaa Gin Giu Phe Lys gat aaa Asp Lys gaa gta gat Giu Vai Asp ggg aaa agg Giy Lys Arg 115 tat gct cta tct Tyr Aia Leu Ser caa gag gtt tgt Gin Giu Val Cys gaa tgt cca Giu Cys Pro 110 aat tca gaa Asn Ser Giu tat gaa gcg ttt Tyr Giu Ala Phe gg t Gly 120 gga att aca tta Giy Ile Thr Leu aaa aaa Lys Lys 130 gaa att aaa gtt Giu Ile Lys Vai cct Pro 135 gta aac gtg tgg Val Asn Vai Trp aaa agt aaa caa Lys Ser Lys Gin ccg cct atg ttt Pro Pro Met Phe aca gtc aat aaa Thr Val Asn Lys ccg Pro 155 aaa gta acc gct Lys Val Thr Ala cag Gin 160 gaa gtg gat ata Giu Vai Asp Ile gtt aga. aag tta Vai Arg Lys Leu att aag aaa tac Ile Lys Lys Tyr gat atc Asp Ile 175 tat aat aac Tyr Asn Asn tta aat tca Leu Asn Ser 195 gaa caa aaa. tac Giu Gin Lys Tyr aaa gga act gtt Lys Gly Thr Vai acc tta gat Thr Leu Asp 190 ttt ggc aat Phe Gly Asn ggt aaa gat att.

Gly Lys Asp Ile gtt Val1 200 ttt gat ttg tat Phe Asp Leu Tyr gga gac Gly Asp 210 ttt aat agc atg Phe Asn Ser Met cta Leu 215 aaa ata tat tcc Lys Ile Tyr Ser aac gag aga ata Asn Giu Arg Ile tca act caa. tti Ser Thr Gin Phe gta gat gtg tca Vai Asp Val Ser atc agc taa Ile Ser 235 WO 00/39159 WO 0039159PCT/NZ99/00228 <210> 6 <211> 236 <212> PRT <213> Streptococcus pyogenes <400> 6 Met Arg 1 Tyr Asn Cys Arg Tyr Ser His Ile Asp Lys Lys Ile Tyr Ser Met Ile Ile Cys Leu Ser Phe Leu Tyr Ser Asn Val Asn Ser Tyr His Asp Ser As n Thr Thr Asn Asn Leu Glu Ser As n Val Gin Ala Leu Tyr Lys Ser Pro Asp Asn Leu Ile Ile Val Glu Leu Asp Ser Ilie Thr Ser His Lys Tyr Ser Ser Val1 Gin Asp Lys Asn Val Phe Phe Asp Trp Ile Giu Phe Lys Asp Lys Giu Val Asp Gly Lys Arg 115 Lys Lys Giu Ala Leu Ser Ala 105 Gly Giu Val Cys Glu Ala Phe Gly 120 Val Ilie Thr Leu Thr 125 Lys Giu Cys Pro 110 Asn Ser Giu Ser Lys Gin Ile Lys Val Asn Val Trp 130 Gin Pro Pro Met Phe Vai Asn Lys 145 Giu Pro 155 Ile Val Thr Ala Val Asp Ile Arg Lys Leu Leu 170 Lys Lys Lys Tyr Asp Ile 175 Tyr Asn Asn Leu Asn Ser 195 Gly Asp Phe 210 Gin Lys Tyr Ser 185 Phe Gly Thr Vai Lys Asp Ilie Asp Leu Tyr Thr Leu Asp 190 Phe Gly Asn Giu Arg Ile Asn Ser Met Ile Tyr Ser Asn 220 WO 00/39159 WO 00/91 59PCT/NZ99/00228 Asp Ser Thr Gin Phe His Val Asp Val Ser Ile Ser 225 230 235 <210> 7 <211> 414 <212> DNA <213> Streptococcus pyogenes <220> <221> CDS <222> (411) <400> 7 ctt ccg tac ata Leu Pro Tyr Ile

I

act cgt tat gat Thr Arg Tyr Asp gtt Val1 10 tat tat ata tat Tyr Tyr Ile Tyr ggt ggg Gly Gly gtt aca cca.

Val Thr Pro aat tta cta Asn Leu Leu tca.

Ser gta aac agt aat Val Asn Ser Asn gaa aat agt aaa Glu Asn Ser Lys att gta ggt Ile Val Gly aat ccc ata Asn Pro Ile ata gat gga gtc cag caa. aaa aca. cta Ile Asp Gly Val Gin Gin Lys Thr Leu aaa ata Lys Ile gat aaa cct att Asp Lys Pro Ile acg att, caa. gaa Thr Ile Gin Giu gac ttc aaa atc Asp Phe Lys Ile caa tat ctt atg Gin Tyr Leu Met aca tac aaa. att.

Thr Tyr Lys Ile tat Tyr gat cct aat tct Asp Pro Asn Ser 192 240 288 tac ata aaa ggg Tyr Ile Lys Giy tta gaa att gcg Leu Giu Ile Ala atc Ile aat ggc aat aaa Asn Gly Asn Lys cat gaa His Giu agt ttt aac Ser Phe Asn tta.

Leu 100 tat gat gca acc Tyr Asp Ala Thr tca Se r 105 tct agt aca agg Ser Ser Thr Arg agt gat att Ser Asp Ile 110 gat ttc agc Asp Phe Ser 336 ttt aaa Phe Lys aaa Lys 115 tat aaa gac aat Tyr Lys Asp Asn act ata aat atg Thr Ile Asn Met WO 00/39159 WO 0039159PCT/NZ99/00228 cat ttt gat att tac ctt tgg act aaa taa His Phe Asp Ile Tyr Leu Trp Thr Lys 130 135 <210> 8 <211> 137 <212> PRT <213> Streptococcus pyogenes <400> 8 Leu Pro Tyr Ile Phe Thr Arg Tyr Asp Val Tyr Tyr Ile Tyr Gly Gly Val Thr Pro Ser Val Asn Ser Asn Giu Asn Ser Lys Ile Val Gly Asn Pro Ile Asn Leu Leu Ile Asp Gly Val Gin Lys Thr Leu Lys Ile Asp Lys Pro Ile Phe Thr Ile Gin Giu 55 Phe Asp Phe Lys Ile Arg Gin Tyr Leu Met Thr Tyr Lys Ile Tyr Asp Pro Asn Ser Tyr Ile Lys Gly Gin Leu Glu Ile Ala Asn Gly Asn Lys His Giu Ser Phe Asn Phe Lys Lys 115 Tyr Asp Ala Thr Ser 105 Ser Ser Thr Arg Ser Asp Ile 110 Asp Phe Ser Tyr Lys Asp Asn Thr Ile Asn Met His Phe 130 Asp Ile Tyr Leu Trp Thr Lys 135

Claims (34)

1. A superantigen selected from any one of SMEZ-2, SPE-G, SPE-H and SPE-J, or a functionally equivalent variant thereof.

2. A superantigen which is SMEZ-2 and which has an amino acid sequence of SEQ ID NO. 2, or a functionally equivalent variant thereof.

3. A superantigen which is SPE-G and which has an amino acid sequence of SEQ ID NO. 4, or a functionally equivalent variant thereof.

4. A superantigen which is SPE-H and which has an amino acid sequence of SEQ ID NO. 6, or a functionally equivalent variant thereof.

5. A superantigen which is SPE-J and which has an amino acid sequence which includes SEQ ID NO. 8, or a functionally equivalent variant thereof.

6. A polynucleotide comprising a nucleotide sequence encoding SMEZ-2 or a variant thereof as claimed in claim 2.

7. A polynucleotide according to claim 6 in which said nucleotide sequence is or includes SEQ ID NO. 1.

8. A polynucleotide comprising a nucleotide sequence encoding SPE-G or a variant thereof as claimed in claim 3.

9. A polynucleotide according to claim 8 in which said nucleotide sequence is or includes SEQ ID NO. 3.

10. A polynucleotide comprising a nucleotide sequence encoding SPE-H or a variant thereof as claimed in claim 4.

11. A polynucleotide according to claim 10 in which said nucleotide sequence is or includes SEQ ID NO -43-

12. A polynucleotide comprising a nucleotide sequence encoding SPE-J or a variant thereof as claimed in claim

13. A polynucleotide according to claim 12 in which said nucleotide sequence includes SEQ ID NO. 7.

14. A method of subtyping Streptococci which includes the step of detecting the presence or absence of a superantigen as claimed in any one of claims 2 to A method of subtyping Streptococci which includes the step of detecting the presence or absence of a polynucleotide as claimed in any one of claims 6 to 13.

16. A construct which comprises a superantigen or variant thereof as claimed in any one of claims 2 to 5 and a cell-targeting molecule.

17. A construct according to claim 16 in which said cell-targeting molecule specifically binds a tumour cell.

18. A construct according to claim 16 or claim 17 in which said cell-targeting molecule is an antibody.

19. A pharmaceutical composition which includes a construct as claimed in any one of claims 16 to 18.

20. An antibody which binds superantigen SMEZ-2 as claimed in claim 2.

21. An antibody which binds superantigen SPE-G as claimed in claim 3. 21. An antibody which binds superantigen SPE-G as claimed in claim 3.

23. An antibody which binds superantigen SPE-H as claimed in claim 4. 23. An antibody which binds superantigen SPE-J as claimed in claim

24. A kit which includes an antibody as claimed in any one of claims 20 to 23. oooO.i 44 A nucleic acid molecule which hybridises under stringent conditions to a polynucleotide of claim 7.

26. A nucleic acid molecule which hybridises under stringent conditions to a polynucleotide of claim 9.

27. A nucleic acid molecule which hybridises under stringent conditions to a polynucleotide of claim 11.

28. A nucleic acid molecule which hybridises under stringent conditions to a polynucleotide of claim 13.

29. A kit which includes a nucleic acid molecule as claimed in any one of claims to 28. A method of diagnosing a disease which is caused or mediated by expression of a superantigen as claimed in claim 1 which includes the step of detecting the presence of said superantigen using an antibody as claimed in any one of claims 19 to 22, or detecting the presence of a polynucleotide encoding said superantigen using a nucleic acid molecule as claimed in any one of claims 25 to 28.

31. A superantigen substantially as herein described with reference to any one of the examples excluding comparative examples.

32. A polynucleotide substantially as herein described with reference to any one of the examples excluding comparative examples.

33. A method of subtyping Streptococci substantially as herein described with reference to any one of the examples excluding comparative examples.

34. A construct which comprises a superantigen substantially as herein described with reference to any one of the examples excluding comparative examples. A pharmaceutical composition substantially as herein described with reference to any one of the examples excluding comparative examples.

36. An antibody which binds a superantigen substantially as herein described with reference to any one of the examples excluding comparative examples.

37. A kit substantially as herein described with reference to any one of the examples excluding comparative examples.

38. A nucleic acid molecule substantially as herein described with reference to any one of the examples excluding comparative examples.

39. A method of diagnosing a disease which is caused or mediated by expression of a superantigen according to claim 1, substantially as herein described with reference to any one of the examples excluding comparative examples. DATED this 30 th day of June 2003 BALDWIN SHELSTON WATERS Attorneys for: AUCKLAND UNISERVICES LIMITED eg* *o .t ftf ft ee