JP2002535966A - Superantigen - Google Patents

Abstract

  (57) [Summary] PROBLEM TO BE SOLVED: To provide novel superantigens and their use including diagnosis and / or treatment of disease. The present invention provides superantigens SMEZ-2, SPE-G, SPE-H, and SPE-J, and polynucleotides encoding them. Such superantigens have, inter alia, diagnostic and therapeutic applications.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD OF THE INVENTION

The present invention relates to superantigens and their uses, including the diagnosis and / or treatment of diseases.

[0002]

[Prior art]

Bacterial superantigens are the most potent known T cell mitogens. They are responsible for a large number of T cells by direct binding to the sides of MHC class II and T cell receptor (TcR) molecules.
Stimulate cells. Major candidates for triggering the development of autoimmune diseases or reviving pre-existing autoimmune disorders, because they normally counteract the MHC restriction phenomenon of elaborate T cell antigen recognition It has become.

[0003] Applicants have identified genes encoding four novel superantigens from S. pyogenes. The present invention is directed generally to these superantigens and the polynucleotides that encode them.

[0004]

SUMMARY OF THE INVENTION

In one aspect, the present invention provides a superantigen selected from any one of SMEZ-2, SPE-G, SPE-H, and SPE-J, or a functionally equivalent variant thereof.

In a further aspect, the invention relates to SMEZ-2, SPE-G, SPE-H,
And a superantigen selected from SPE-J, or a polynucleotide molecule comprising a sequence encoding a functionally equivalent variant thereof.

In another aspect of the invention, a method of subtyping streptococci based on the genotype of the superantigen, comprising detecting the presence of any or all of the above four superantigens or corresponding polynucleotides. Is provided.

[0007] In a further aspect, the invention provides a construct comprising any of the above superantigens (or superantigen variants) conjugated to a cell targeting molecule, preferably a tumor specific antibody.

In yet a further aspect, the present invention provides a pharmaceutical composition for a therapeutic or prophylactic method, comprising a superantigen or superantigen variant as described above attached to a cell targeting molecule.

[0009] Other aspects of the invention will be apparent from the description provided below and the appended claims.

[0010]

DETAILED DESCRIPTION OF THE INVENTION

The focus of the present invention is the identification of the four superantigens (SPE-G, SPE-H, SPE-J, and SMEZ-2) and the corresponding polynucleotides that encode them.

FIG. 1 shows that the amino acid sequences of the above four superantigens were compared with those of the previously identified superantigen SME.
Z, SPE-C and SEA are shown together.

[0012] Of the four superantigens SPE-G, SPE-H, SPE-J, and SMEZ-2, the last is probably the most interesting.

The smez-2 gene encoding SMEZ-2 is Streptococcus pyogenes 203
5 were identified in experiments designed to produce recombinant SMEZ protein from genomic DNA. The full-length smez gene was isolated from this strain, but the smez gene of strain 2035 showed 36 (or 5%) nucleotide changes compared to smez from strain M1 (FIG. 1). The deduced protein sequences differed by 17 amino acid residues (or 8.1%). This difference establishes this as a novel gene, smez-2, and the encoded protein as a novel superantigen, SMEZ-2.

The most significant difference between SMEZ and SMEZ-2 is the exchanged pentapeptide sequence at positions 96-100, wherein the SMEZ EEPMS sequence is
In Z-2, it has been changed to KTSIL (FIG. 1). The second difference is the positions 111-1
12, where the RR dipeptide has been changed to GK in SMEZ. The remaining ten different residues span almost the entire primary sequence.

FIG. 2 shows the nucleotide sequence encoding mature SMEZ-2 and the deduced amino acid sequence.

Similarly, FIGS. 3-5 show mature SPE-G, SPE-H, and SPE-J, respectively.
The nucleotide sequence encoding the superantigen is shown with each deduced amino acid sequence.

The invention is of course not limited to superantigens / polynucleotides having the specific sequences of FIGS. Instead, functionally equivalent variants are expected.

[0018] The phrase "functionally equivalent variant" acknowledges that it is possible to alter the amino acid / nucleotide sequence of a peptide while retaining substantially equivalent functionality. For example, one peptide may be functionally identical to another peptide for a particular function if the equivalent peptide is immunologically cross-reactive with the original peptide and has at least a substantially similar function. Can be considered equivalent. Equivalents can be, for example, a fragment of the peptide, a fusion of the peptide with another peptide or carrier, or a fusion of a fragment with additional amino acids. For example, amino acids in a sequence can be replaced with equivalent amino acids using conventional techniques. The groups of amino acids that are normally considered equivalent are: (a) Ala, Ser, Thr, Pro, Gly; (b) Asn, Asp, Glu, Gln; (c) His, Arg, Lys; (d) Met, Leu, Ile, Val; and (e) Phe, Tyr, Trp.

Similarly, the nucleotide sequence encoding a particular product can vary significantly due to the mere degeneracy of the nucleic acid code.

Variants can have a greater or lesser degree of homology, such as between the amino acid / nucleotide sequence of the variant and the original.

[0021] Polynucleotide or polypeptide sequences may be aligned, and the percentage of equivalent nucleotides in one particular region may be determined relative to another using publicly available computer algorithms. Two exemplary algorithms for aligning polypeptide sequences and identifying similarities are described in
LASTN and FASTA algorithms. Polypeptide sequence similarity may be investigated using the BLASTP algorithm. BLASTN and BL
Both of the ASTP software are NCBI's anonymous FTP servers (ftp: // nc
bi.nlm.nih.gov.) Available at under / blast / executables. BLASTN algorithm version 2.0.4 [February 24, 1998] embarked on the default parameters described in the variant documentation according to the invention. BLASTN
The use of the BLAST family of algorithms, including
RL, NCBI website at http://www.ncbi.nlm.nih.gov/BLAST/newblast.html and Altschul, Stephen F., et al. (1997) "Gapped BLASTand PSI-BLAST.
: a new generation of protein database search programs (gapped BL
AST and PSI-BLAST: a new generation of protein database research programs) ", Nucleic Acids Res. 25: 3389-34023. The computer algorithm FASTA is described at ftp://ftp.virginia.edu/pub/fasta. It is available on the Internet at the http / site of /.version 2.0u., February 1996, embarking on default parameters described in the material and provided using the algorithm. 4 is also preferred for use in determining variants according to the present invention.The FASTA algorithm is described in WR Pearson and DJ Lipman, "Improved Tools for Biological Sequence Analysis", Proc. Natl. Acad. Sci. USA 85: 2444-2448 (1988), and WR Pearson, "Rap.
id and Sensitive Sequence Comparison with FASTP and FASTA (rapid and sensitive sequence comparison using FASTP and FASTA) ", Methods in Enzymol
ogy 183: 63-98 (1990).

The following performance parameters are preferred for alignment and similarity determination using BLASTN that contribute to the E value (discussed below) and percent identity. Single execution command: blastall -p blastn -de
mbldb-e10-G1-E1-r2-v50-b
50-I queryseq-0 results; and parameter defaults: -p program name [String] -d database [String] -e expected value (E) [Real] -G gap ) (Zero results in omission) [integer] -E Cost to open cap (zero results in omission) [integer] -r Reward for nucleotide match (Reward) ) (Blastn only) [integer]
-V Number of one-line descriptions (V) [integer] -b Number of alignments to be displayed (B) [integer] -i Query file [File In] -o BLAST report output file [File Out] Arbitrary BLASTP The following execution parameters are preferred for use: blastall −
p blastp -d swissprotdb -e 10 -G 1-
E 1 -v 50 -b 50 -I queryseq -o resul
ts -p program name [String] -d database [String] -e expected value (E) [Real] -G cost to open the gap (zero causes omission) [Integer]-cost for opening E cap (zero results in omission) [integer] -v number of one line description (V) [integer] -b number of alignments to display (B) [integer]- i Query File [File In] -o BLAST Report Output File [File Out] Optional For one or more database sequences by BLASTN, BLASTP, or FASTA, or a sequence of queried generated by a similar algorithm. A "hit" aligns and identifies similar parts of the sequence. Hits are arranged in order of degree of similarity and length of overlapping sequences. Hits against database sequences generally represent only a small overlap in the length of the query sequence.

The BLASTN and FASTA algorithms also use “
Produces an "Expect" or E value. The E value is that when searching a database of a certain size, it happens that for a certain number of adjacent sequences,
Shows the number of hits you can expect. The expect value is used as a threshold of significance to determine whether hits to a database, such as the preferred EMBL database, indicate true similarity. For example, an E value of 0.1 given for a hit would be a value of .0 for aligned portions of sequences with similar scores in the EMBL database size database.
Interpretation is taken to mean that one can simply expect to see a coincidence.
According to this criterion, sequence alignments and matched parts will therefore have a 90% probability of being identical. For sequences that have an E value of 0.01 or less for alignments and matched parts, the probability of finding a match in the EMBL database using the BLASTN or FASTA algorithm is 1% or less.

According to one embodiment, a “variant” polynucleotide, with respect to each polynucleotide of the invention, preferably has the same or less nucleic acid as each polynucleotide of the invention, and 0 when compared to the polynucleotide of the invention.
. Includes sequences that produce E values of 01 or less. That is, the variant polynucleotide is identical to the polynucleotide of the invention, for which an E value of 0.01 or less has been measured using the BLASTN or FASTA algorithm set with the parameters discussed above. Are sequences with a probability of at least 99% for

Variant polynucleotide sequences generally have stringent conditions or stringent regulation (stringent).
will hybridize with the polynucleotide sequences listed below. As used herein, "stringent conditions" refers to 6 x SSC, 0.2
Preliminary washing in a% SDS solution; hybridization at 65 ° C., 6 × SSC, 0.2% SDS; followed by two washes in 1 × SSC, 0.1% SDS at 65 ° C., each for 30 minutes; Refers to two washes in 2 × SSC, 0.1% SDS at 65 ° C. for 30 minutes each.

The superantigen of the present invention, together with fragments and other variants thereof, may be produced by synthetic or recombinant means. Less than about 100 amino acids, and generally 5
Synthetic polypeptides having fewer than zero amino acids may be produced by methods well known to those skilled in the art. For example, such peptides may be synthesized using any commercially available solid phase immobilization method, such as the Merrifield solid phase synthesis method in which amino acids are continuously added to a growing amino acid chain (Merryfield, J. Am. Ch
em. Soc 85: 2146-2149 (1963)). An instrument for automated peptide synthesis is available from Perkin Elmer / applied Biosystems.
Biosystems, Inc.) and may be operated according to the manufacturer's instructions.

Each superantigen, or a fragment or variant thereof, can be obtained by inserting a polynucleotide (usually DNA) encoding the superantigen into an expression vector and transferring the superantigen in an appropriate host. By expression, they may be produced using recombination. Any of a variety of vectors well known to those of ordinary skill in the art may be used. Expression may be performed in a suitable host cell, which has been transformed or transfected with an expression vector containing a DNA molecule encoding the protein. Suitable host cells include prokaryotes, yeast,
And even higher eukaryotic cells. Preferably used host cells are mammalian cell lines such as E. coli, yeast or COS or CHO, or insect cell lines such as SF9 using baculovirus expression vectors. The DNA sequence expressed in this material may encode a naturally occurring superantigen, a fragment of the naturally occurring superantigen, or a variant thereof.

The DNA sequence encoding the superantigen or fragment can be obtained by hybridizing an appropriate Streptococcus pyogenes cDNA or genomic DNA library to a modified oligonucleotide derived from the partial amino acid sequence of the superantigen. It may be obtained by screening for forming DNA sequences. Suitable degenerate oligonucleotides may be designed and synthesized by standard techniques, and screening may be performed, for example, by Maniatis et al., Molecular Cloning-A Laboratory Manua.
l (Molecular Cloning-Laboratory Manual), Cold Spring Harbor Laboratories, Cold Spring Harbor, NY (1989).

[0029] The identification of these superantigens and their properties has resulted in a number of useful applications. The first of such applications is the genotyping of an organism in relation to its superantigen profile.

One example of this is the subtyping of S. pyogenes strains.

One of the observed characteristics was that all S. pyogenes clones were SMEZ-1 or SMEZ, as long as they were known to be positive for SMEZ.
-2 but not both. Thus, they are mutually exclusive, which means that the isolate or patient sample is SMEZ-1 + ve
Or SMEZ-2 + ve for a rapid diagnostic test. This is useful for typing isolates.

The general diagnostic approach is most conveniently accomplished by providing a set of primers that amplify all or a subset of the superantigen gene, which comprises a fragment specific for the gene. Generate This is to provide a convenient qualitative ELISA (ELISA) strip-type kit that detects biotin-labeled PCR fragments that have been amplified by specific primers and hybridized to probes specific to the immobilized sequence. Can be done. This is useful for screening patient tissue specimens for the presence of strains of streptococci producing superantigens.

[0033] Such approaches are well known and will be well understood by those skilled in the art.

Another approach is to provide monoclonal antibodies for detecting each streptococcal superantigen. An ELISA kit containing such an antibody would allow the screening of large numbers of streptococcal isolates. Such a kit would be useful for institutions that are testing for the type of occurrence of streptococcal disease or food poisoning.

Another potential diagnostic application of the superantigens of the present invention is in the diagnosis of diseases such as Kawasaki disease (KS).

KS is acute multisystem vasculitis of unknown etiology. It occurs worldwide, but is most prevalent in Japan or among Japanese Americans. It mainly affects infants and children up to 16 years. It is an acute disease and can be fatal if not treated. Early clinical manifestations include: prolonged fever, left and right non-exudative conjunctivitis, erythema cirrhosis of the limbs, inflammation of the lips and oropharynx, polymorphic skin rash, cervical lymphadenopathy, and 15-20% of cases. Coronary lesions appear.

These signs are used as an early diagnosis of KS.

In Japan and the United States, KS is one of the most common causes of acquired heart disease in children. Treatment requires immediate intravenous administration of gamma globulin (IVGG) throughout the acute phase of the disease, which significantly reduces the level of coronary lesions.

There are two distinct phases for the disease, acute and convalescent. The acute phase is characterized by strong immune activation. Several reports have suggested that superantigens are deeply involved, and many attempts have been made to link the disease to infection by S. pyogenes strains that produce superantigens. Acute features of KS are the expansion of T cells carrying Vβ2 and to a lesser extent Vβ8, and an increase in DR-expressing T cells (a prominent feature of T cell activation).

Since SMEZ-2 stimulates both T cells carrying Vβ2 and Vβ8, testing for the production of SMEZ-2 has the potential to be very useful in the diagnosis of KS.

Antibodies to superantigens for use in the uses as described above are also provided by the present invention. Such antibodies can be polyclonal, but will preferably be monoclonal.

Monoclonal antibodies having an affinity of 10 ⁻⁸ M ⁻¹ , or preferably 10 ⁻⁹ to 10 ⁻¹⁰ M ⁻¹ , or greater, are typically, for example, Haelow
& Lane (1988) or Coding (1986). Briefly, appropriate animals are selected and the desired immunization protocol is continued. After an appropriate period of time, the spleen of such an animal is excised and individual splenocytes are fused, typically to immortalized myeloma cells, under appropriate selection conditions. The cells are then separated by clones and the supernatant of each clone is tested for the production of appropriate antibodies specific for the desired region of the antigen.

Other suitable antibody preparation techniques well known in the art include exposing lymphocytes to antigenic polypeptides in vitro, or, alternatively, to selection of an antibody library on phage or a similar vector. Need that.

[0044] Recombinant immunoglobulins may also be produced using methods well known in the art (see, eg, US Pat. No. 4,816,567 and Hodgson J. (1991)).

The antibodies may be used with or without modification. Frequently, antibodies will be labeled, by covalent or non-covalent attachments, by attaching a substance having a detectable signal. Numerous types of labeling and conjugation methods are well known and have been extensively reported in the literature. Suitable labels include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent agents, chemiluminescent agents, magnetic particles, and the like. Patents teaching the use of such labels include U.S. Patent Nos. 3,817,837;
No. 50,752; No. 3,939,350; No. 3,996,345; No. 4,277,
No. 437; 4,275,149; and 4,366,241.

The immunoassay in which the antibody is used may be of any convenient format known in the art.

The nucleotide sequence information provided herein includes smez-2, spe-g,
It may be used to design probes and primers for probing or amplifying parts of the spe-h and spe-j genes. Oligonucleotides for use in probing or PCR may be about 30 or less nucleotides in length. Generally, particular primers are more than 14 nucleotides in length. 16-2 for optimal specificity and cost effectiveness
A 4 nucleotide long primer is preferred. One skilled in the art is familiar with designing primers for use in processes such as PCR.

If necessary, probing uses the entire polynucleotide sequence carrying an optionally exposed label or reporter molecule, provided herein as SEQ ID NOs: 1, 3, 5, and 7. Can be done.

Such probes and primers also form an aspect of the present invention.

Probing may use standard Southern blotting techniques. For example, D
NA may be extracted from cells and digested with different restriction enzymes. The restriction fragments may then be separated by electrophoresis on an agarose gel prior to denaturation and transfer to nitrocellulose filters. The labeled probe is hybridized to the DNA fragment on the filter and binding may be measured. DNA for probing may be prepared from mRNA preparations from cells. Probing may optionally be performed by means of a so-called "nucleic acid chip" (Marshall and Hodgson (1998) Nature Biotechnology 16:27-
31).

[0051] In addition to diagnostic applications, another use of superantigens depends on their ability to bind other cells.

One of the most important features of superantigens is that they bind to the Vβ domain, thereby binding many T cell receptor molecules. They are the most potent of all T cell mitogens and are therefore useful for recruiting and activating T cells in a relatively non-specific manner.

This ability allows the formation of a construct in which the superantigen (or at least its T cell binding portion) is bound to a cell targeting molecule, in particular an antibody, more usually a monoclonal antibody. To

When a monoclonal antibody targeting a specific cell surface antigen (such as a tumor-specific antigen) is bound to the superantigen in such a construct, this allows, on the one hand, specific binding to tumor cells And, on the other hand, produce reagents for the purpose of killing target cells, which will recruit and activate T cells.

[0055] Bispecific constructs of this type have important applications in therapy, especially in cancer treatment, and may be prepared by means well known to those skilled in the art. For example,
SMEZ-2 may be conjugated to a tumor specific monoclonal antibody. The composition may be incorporated into a conventional carrier for a pharmaceutically active protein.

[0056] Various aspects of the invention will now be described with reference to the following experimental section, which is included for illustrative purposes.

[0057]

【Example】

Section A: Identification and Characterization of Superantigens Materials and Methods Identification of New SAGs Novel superantigens are highly conserved β5s of streptococcal and staphylococcal superantigens
And α4 region, M1 genome database of Streptococcus pyogenes at the University of Oklahoma (http://www.genome.ou.edu/street)
p. html) was identified by searching using the TBlastN search program.

An open reading frame was defined by translating the DNA sequence around the matching region and aligning its protein sequence to a known superantigen using the computer program Gap. Lineup and Pi
Numerous alignments and dendrograms were performed using leup. F
The ASTA program is SwissProt (Amos Bairoch)
, Switzerland) and PIR (Protein Identification Resource, United States).

The leader sequences of SPE-G and SPE-H were predicted using the SP Scan program. All computer programs are in the GCG package (
Version 8).

Cloning of smez, smez-2, spe-g, and sp-h Fifty nanograms of the genomic DNA of Streptococcus pyogenes M1 (ATCC 700294) or Streptococcus pyogenes 2035 consist of a smez DNA fragment and smez DNA, respectively.
The mez-2 DNA fragment was combined with the primers smez-forward (TGGGATCCTTTAGAAGTAGATAATA) and smez-reverse (AAGAATTCTTAGGAGTCAATTTC),
It was used as a template for amplification by PCR with Taq polymerase (Promega). Each of the primers has a restriction enzyme recognition sequence Bam.
Includes end tags with HI and EcoRI. The amplified DNA fragment encodes a mature protein without leader sequence (Kamezawa et al., 19).
97 Infect. Immun. 65 no9: 38281-33), T-tailed pBlueScr
It was cloned into the ipt SKII vector (Stratagene).

Spe-g and spe-h are primers, spe-g-forward (CTGGATCCGATGAAAATTTAAAAGAT
TTAA) and spe-g-reverse (AAGAATTCGGGGGGAGAA
TAG) and primer spe-h-forward (TTTGGATCCAATTCTT)
ATAATACAACC) and spe-h-reverse (AAAAGCTTTTA)
GCTGATTGACAC) and cloned in a similar approach.

[0062] The DNA sequence of the subcloned toxin gene was obtained from Licor Automated DN.
It was confirmed by the didioxy chain terminator method using an A sequencer. Since all DNA sequences from the genomic database are unedited raw data, three subclones were analyzed per cloning experiment to ensure that no Taq polymerase-related mutations were introduced.

Expression and Purification of rSMEZ, rSMEZ-2, rSPE-G, and rSPE-H Subcloned smez, smez-2, and spe-g were obtained using restriction enzymes BamHI and EcoRI (LifeTech) Using pBl
ueScript SKII vector and cloned into pGEX-2T expression vector (Pharmacia). Due to the internal EcoRI restriction site within the spe-H gene, the pBlueScript: spe-h subclone was digested with BamHI and HindIII, and the spe-h fragment was modified pGEX- containing the HindIII 3 'cloning site.
It was cloned into a 2T vector.

[0064] Recombinant SMEZ, rSMEZ-2, and rSPE-H were expressed in E. coli DH5α cells as a glutathione-S-transferase (GST) fusion protein. Cultures were grown at 37 ° C and 0.2 mM isopropyl-
It was induced over 3-4 hours after addition of β-D-thiogalactopyranoside (IPTG). The GST-SPE-G fusion protein was expressed in cells grown at 28 ° C. The GST fusion protein is purified on glutathione agarose as described previously (Li et al., 1997), and the mature toxin is purified by trypsin digestion.
Disconnected from ST. All recombinant toxins except rSMEZ were further purified by two cation exchange chromatography steps using carboxymethyl sepharose (Pharmacia). The GST-SMEZ fusion protein was trypsin digested on a GSH-column and the flow-through containing SMEZ was collected.

Gel Electrophoresis All purified recombinant toxins were 12% SDS- according to the method of Laemmli.
Tested on polyacrylamide gel. The isoelectric point of the recombinant toxin was determined using Amphorine pH 5-8 (Pharmacia Biotech).
Measured by isoelectric focusing on a 5% polyacrylamide gel. Gel is 9
It was run at a constant power of 1 W for 0 minutes.

Toxin Proliferation Assay Human peripheral blood lymphocytes (PBL) were purified from healthy donors by Histopaque Ficoll (Sigma) fractionation. PBL is
In 96-well round-bottom microtiter plates, with (RPMI containing 10% fetal bovine serum) RPMI-10 containing the recombinant toxin with different dilutions and incubated at 10 ⁵ cells per well. A series of dilutions was used with a starting concentration of 10ng
/ Ml toxin was performed in 1: 5 steps. The pipette tip was changed after each dilution step. Three days later, 0.1 μCi of [ ³ H] thymidine was added to each well and the cells were incubated for an additional 24 hours. Cells were harvested and counted in a scintillation counter.

Mouse leukocytes were obtained from five different strains of mice (SJL, B10.M, B10 / J
, C3H, and BALB / C). Splenocytes are DMWM-1
0 is washed with, counted in 5% acetic acid, in microtiter plates as described for human PBL, were incubated per well 10 ⁵ cells with DMEM-10 and toxins.

TcR Vβ Assay Vβ enrichment analysis was performed using Uncard multi-primer amplification (Hudson et al., 1993, Jex).
p Med 177: 175-185). Human PBL is 20 pg / m
It was incubated for 3 days at 10 ⁶ cells / ml with l recombinant toxin.
Medium containing 20 ng / ml IL-2 resulted in a 2-fold expansion of the culture. After an additional 24 hours, stimulated and resting cells were harvested and Trizol (Tr
RNA was prepared using izol) reagent (Lifetech). A 500 bp β-strand DNA probe was obtained by uncard multi-primer PCR as previously described (38), radiolabeled and hybridized to del (36).
Individual Vβ and Cβ DNA regions were blotted onto Nylon membranes. The membrane is made of Molecular Dynamics Storm Phosphor (Molecular
Analyzed on a Dynamics Storm Phosphor imager using ImageQuant software. Individual Vβ was expressed as a percentage of total Vβ measured by hybridization to the Cβ probe.

Jurkat Cell Assay Jurkat cells (human T cell line) and LG-2 cells (human B lymphoblastoma cell line, homozygous for HLA-DRI) were harvested in log phase and RPMI-
10 resuspended. 1 × 10 ⁵ Jurkat cells and b2 × 10 ⁴ LG
-100 microliters of the cell suspension containing 2 cells is 100 μl
Was mixed on a 96-well plate with the recombinant toxin at different dilutions. 37 ° C
After overnight incubation in 100 μl aliquots were transferred to a new plate and 100 μl (1 × 10 ⁴ ) of SeI cells (IL-IL) were added per well.
2-dependent mouse T cell line) was added. After incubation for 24 hours, 0.1 μCi of [ ³ H] thymidine was added to each well and the cells were incubated for another 24 hours. Cells were harvested and counted in a scintillation counter. As a control, serial dilutions of IL-2 were incubated with SeI cells.

Computer Assisted Modeling of Protein Structures The protein structures of SMEZ-2, SPE-G, and SPE-H were analyzed on a Silicon Graphics computer using Insight II / Homology software. It was created using software. Superantigen SE
A, SEB, and SPE-C were used as comparative proteins to determine structurally conserved regions (SCRs). SEA (1ESF), SEB (1S
Coordinate files for EB) and SPE-C (1AN8) were downloaded from the Brookhaven Protein Database. The comparative protein and SMEZ-2, SPE-G, and SPE-H
The primary amino acid sequence of each of the above was aligned and the equivalent from the superimposed SCR was assigned on the model protein. The loop region during the SCR was created by random selection. MolScript software (PJ Krauli)
s, 1991 J App Critallography 24: 946-50) was used to display computer-generated images.

Radiolabeling and LG-2 binding experiments Recombinant toxin was purified by the chloramine T method as previously described (Li et al., 1997).
Radiolabeled). The labeled toxin was separated from free iodine by size exclusion chromatography using Sephadex G25 (Pharmacia). LG-2 cells were used for cell binding experiments as described (Li et al., 1997). Briefly, cells were harvested, resuspended in RPMI-10, ¹²⁵ I- tracer toxin in 10 ⁶ cells / ml (1 ng) and 0.0001
Mixed with 0 μg unlabeled toxin and incubated at 37 ° C. for 1 hour. After washing with ice-cold RPMI-1, the pellet was analyzed in a gamma counter. For zinc binding assays, the toxin was either in RPMI-10 or 1 mM ED
Incubation was carried out in RPMI-10 with TA or in RPMI-10 with 1 mM EDTA, ₂ mM ZnCl2. Scatchard analysis
Performed as described by Cunningham et al. (1989). For competitive binding studies, 1 ng of ¹²⁵ I-tracer toxin (rSMEZ, rSMEZ-2, rS
PE-G, rSPE-H, rSEA, rSPE-C, or rTSST) are 0
.0001 to 10 μg of unlabeled toxin (rSMEZ, rSMEZ-2, rSPE-
G, rSPE-H, rSEA, rSEB, rSPE-C, and rTSST) for 1 hour. For the study of SEB inhibition, 20 ng of ¹²⁵ I
-RSEB was used as a tracer and the samples were incubated for 4 hours.

Results Identification and Sequence Analysis of Superantigens The University of Oklahoma Streptococcus pyogenes M1 Genome Database is accessible via the Internet and contains over 300 DNA sequences from a shotgun plasmid library of the complete Streptococcus pyogenes M1 genome. Contains a collection of contigs. Currently available DNA sequences cover about 95% of the entire genome.
This database was searched for highly conserved superantigenic peptide sequences using a search program that screened the DNA database for peptide sequences in all six possible open reading frames. By aligning the translated DNA sequence against the complete protein sequence of a known SAg (superantigen), eight significant matches were also found with the expected open reading frame (O
RF) was found.

The five matches gave a complete ORF with significant homology to the streptococcal and staphylococcal superantigens. Three of these OFRs are SPE-C, SSA
, And the recently described SMEZ (Kamezawa et al., 1997). The remaining two OFRs could not be related to any known proteins in the SwissProt and PIR databases. These new putative superantigen genes were named spe-g and spe-h (FIGS. 3 and 4). One O
RF could not be generated completely due to its position close to the end of the contig. The missing 5 'end DNA sequence is located on another contig, and the individual contigs have not yet been compiled in the database. However, the resulting sequence shows an ORF for the 137 COOH-terminal amino acid residues of a putative novel superantigen not found in existing protein databases. This gene was named spe-j (see FIG. 5).

In two cases, the complete OFR could not be defined due to some out-of-frame mutations. Although DNA sequencing errors for unedited DNA sequences cannot be completely ruled out, frequent insertions and deletions probably indicate the result of spontaneous mutations for pseudogenes that are no longer used.

To produce recombinant SMEZ, SPE-G, and SPE-H proteins, the individual genes (encoding the mature toxin without leader sequence) are
Amplified by R and further subcloned for DNA sequencing.
Genomic DNA of both Streptococcus pyogenes M and Streptococcus pyogenes 2035 is used,
The sequences of the individual toxin genes were compared between the two strains. The spe-h gene was isolated from the M1 strain, but could not be amplified from the genomic DNA of strain 2035, suggesting limited strain specificity for this toxin. The spe-g gene was cloned from both M1 and 2035, and DNA sequence analysis of both genes showed no differences. Although the full-length smez gene was isolated from both strains, DNA sequence comparisons showed some significant differences. Smez of strain 2035
The gene showed 36 (or 5%) nucleotide changes compared to smez from strain M1 (FIG. 1). The deduced protein sequences differed in 17 amino acid residues (or 8.1%). This difference was sufficient to represent a novel gene. Since this gene is 95% homologous to smez, sm
ez-2 (FIG. 2).

The most significant difference between SMEZ and SMEZ-2 is the exchange of the pentapeptide sequence at positions 96-100, where the EEPMS sequence of SMEZ is SMEZ2
Has been changed to KTSIL (Fig. 1). The second cluster is located at positions 111-1
12, the RP dipeptide is changed to GK in SMEZ-2. The remaining ten different residues span almost the entire primary sequence.

The phylogenetic tree of superantigens, modified on the basis of primary amino acid sequence homology, now shows three general subfamilies; Group A is SPE-C, SPE-J
, SPE-G, SMEZ, and SMEZ-2, and Group B comprises SEC1-
3, including SEB, SSA, SPE-A, and SEG, and Group C includes SEA,
Includes SEE, SED, SEH, and SEI. The two superantigens, TSST and SPE-H, do not belong to any one of these subfamilies.

[0078] SMEZ, SMEZ-2, SPE-G, and SPE-J are most closely related to SPE-C, increasing from 2 to 5 members of this subfamily. SPE-G shows the highest protein sequence homology with SPE-C (38.
4% identity and 46.6% similarity). Homology SPE-J for SPE-C is even more significant (56% identity and 62% similarity), but this comparison is only preliminary ones for the NH ₂ -terminal sequence of is not found Absent. SMEZ
Shows 30.9% / 40.7% homology to SPE-C, and SMEZ-2 has 92% / 93% homology to SMEZ.

SPE-H creates a new branch in the phylogenetic tree and is most closely related to SEDs with 25% identity and 37.3% similarity.

Multiple alignments of the SAg protein sequence (FIG. 1) show similarities with α4,
This indicates that the cells are clustered in the structure determining regions represented by the α5, β4, and β5 regions. This is compatible with all toxins of the superantigen family (data not shown), and why superantigens such as SPE-C and SEA are very, despite their rather low sequence identity of 24.4%. It is described whether or not it has an overall structure similar to.

Although SPE-H is less relevant for SPE-C, it shows two common features for the “SPE-C subfamily”: (I) truncated NH ₂ terminus,
Lack of α1 region and (II) primary zinc binding motif at C-terminus (HXD)
(FIG. 1). For some superantigens, this motif corresponds to the HLA-DRI β
It has been shown to be closely involved in coordinated zinc binding to the chain.

The GST-SMEZ, GST-SMEZ-2, and GST-SPE-H fusion proteins are completely soluble, yielding about 30 mg per liter. The GST-SPE-G fusion protein was insoluble when grown at 37 ° C, but was almost soluble when expressed in cells growing at 28 ° C. The yield of soluble GST-SPE-G was 20-30 mg per liter, but the solubility was reduced after cleavage of the fusion protein with trypsin.
Soluble rSPE-G was prepared by adding GST-SPE-G to 0.2 mg / ml prior to cleavage.
Achieved by diluting less than After cation exchange chromatography
Purified rSPE-G could be stored at about 0.4 mg / ml.

[0083] Recombinant SMEZ could not be separated from GST by ion exchange chromatography. Isoelectric focusing showed that the isoelectric points of the two proteins were too similar to allow separation (data not shown). Therefore rSM
EZ is released from GST by being cleaved by trypsin while still bound to the GSH afgarose column. Recombinant SMEZ is collected with the flow-through.

[0084] The purified recombinant toxin was applied to SDS-PAGE and isoelectric focusing (Figure 6). Each toxin runs as a single band on an SDS-PAA gel, its purity and calculated molecular weight, 24.33 (SMEZ), 24.15 (SMEZ-2).
, 24.63 (SPE-G), and 23.63 (SPE-H) were confirmed (FIG. 6A). Isoelectric focusing gels (FIG. 6B) show significant differences between rSMEZ and rSMEZ-2. Like most other staphylococci and streptococci, rSMEZ-2 has a slightly basic isoelectric point at pH 7-8, but rSMEZ has p
It has an IEP at H6-6.5 and is acidic.

Proliferation of T Cells and Specificity of Vβ To ensure the native conformation of the purified recombinant toxins, we investigated the ability of them to stimulate peripheral blood lymphocytes (PBL) using standard [ ³ H] thymidine incorporation testing was performed. All toxins were active on human T cells (FIG. 7). Recombinant SEA, rSEB, rSPE-C, and rTSST were included as comparative proteins. Although the mitogenic capacity of these toxins was lower than previously described, they are likely to be of a more precise shape. In previous studies, a higher starting concentration (100 ng / ml) of toxin was used and the tip was not exchanged during dilution. This results in significant carry over for the entire dilution range.

In this case, the starting concentration was 10 ng / ml and the tip was replaced during dilution to prevent carryover.

The 最大 maximal response for rSPE-G and rSPE-H was 2 pg each.
/ Ml and 50 pg / ml. 0.02 pg / ml and 0.1 pg respectively
No activity was detected at less than / ml. Therefore, both toxins are rSPE-
Less effective than C. Recombinant SMEZ was similar in potency to rSPE-C, with a P50 _% value of 0.08 pg / ml, with no detectable growth below 0.5 fg / ml. Recombinant SMEZ-2 showed greater mitogenic potential than all or other measurable toxins described. The P _50% value was determined to be 0.02 pg / ml, and rSMEZ-2 was still active at least below 0.1 pg / ml. All P _50% values are summarized in Table 1.

[0088]

[Table 1]

[0089] Human PBL and mouse T cells were stimulated with different amounts of recombinant toxin. P _{5
The 0%} value represents the concentration of the recombinant toxin required to induce 50% of maximal cell growth. For rSPE-C and rSPE-G, no proliferation was detected at any of the concentrations examined for mouse T cells.

Mouse T cells from five different mouse strains were rSMEZ, rSMEZ-2,
rSPE-G and their mitogenic response to rSPE-H were tested (Table 1). Recombinant SPE-G showed no activity against any of the strains of mice examined. Recombinant SPE-H, rSMEZ, and rSMEZ-2 showed different potency depending on the individual mouse strain. For example, rSMEZ-2 is B
The 10 / J strain was more than 500 times more potent than rSPE-H, but rSPE-H
H was 7.5 times more active than rSMEZ-2 in the SJL strain.

For mouse T cells, the most potent toxin consistently is 1 in B10 / J.
RSMEZ with a P _50% value of 0 pg / ml and 800 pg / ml for C3H
-2. Recombinant SMEZ varied between 80 pg / ml for SJL and B10M and 9000 pg / ml for C3H. For rSPE-H, S
It was between 15 pg / ml for JL and 5000 pg / ml for B10 / J.

[0092]

[Table 2]

Human PBL was incubated with 20 pg / ml of the recombinant toxin for 4 days. The relative increase in the concentration of Vβ cDNA was analyzed from stimulated and resting PBL RNA by uncard primer PCR and reverse dot plotting against a panel of 17 different Vβ cDNAs.

The numerical value representing the highest increase in Vβ concentration is underlined.

The human TcR Vβ specificity of the recombinant toxin was determined by multi-primer uncard PCR.
And measured by dot blot analysis using a panel of 17 human Vβ DNA regions. The increase in the concentration of Vβ after stimulation with the toxin increases the V of unstimulated PBL.
Compared to β profile (Table 2). rSMEZ, rSMEZ-2, and rS
The sum of all Vβ stimulated by PE-G was close to 100%, suggesting that the Vβ used in the panel represents the total Vβ targeted. On the other hand, rS
V-beta stimulated by PE-H was only 75%. Therefore, rSP
EH appeared to stimulate somewhat less common Vβ not shown in this panel. The most dramatic response was with rSMEZ for T cells carrying Vβ2.1.
-2 were found for all toxins except rSMEZ (21 times for rSMEZ, rSPE-G
45 times, and rSPE-H 22 times). In contrast, rSMEZ-2 is Vβ2
It only gave a 2.5 fold increase for .1 T cells. SPE-G is also Vβ4
.1, Vβ6.9, Vβ9.1, and Vβ12.3 (3-4 fold) were targeted. Intermediate increases in Vβ12.6, Vβ9.1, and Vβ23.1 (4- to 8-fold) were observed with rSPE-H. rSMEZ and rSMEZ2 are both Vβ
4.1 and Vβ8.1 were targeted with similar efficiency (3-7 fold). This finding is because Vβ8.1 activity has been found in some, but not Streptococcus pyogenes, but in culture supernatants and in crude preparations of SPE-A and SPE-C.
Especially interesting. Furthermore, SPE-B has often been claimed to have Vβ8-specific activity, but has since been shown to be an impurity previously referred to as SpeX. rSMEZ and rSMEZ-2 were tested for their ability to stimulate the Vβ8.1 Jurkat cell line (FIG. 8). Recombinant SMEZ is a control toxin (rS
EE), which is 0.2 ng compared to rSEE of 0.08 ng / ml.
However, rSMEZ-2 was even more potent than rSEE (0.02 ng / ml). In the negative control toxin rSEA,
No proliferative activity was seen.

MHC class II binding To determine if there are significant structural differences, SMEZ-2, SPE-
The protein structures of G and SPE-H were modeled on the overlaid SEA, SEB and SPE-C structurally conserved regions. The model shows that, of all three proteins, the two amino acid side chains of the COOH-terminal primary zinc binding motif create a zinc binding site similar to the zinc binding sites observed in SEA and SPE-C. It was shown to be very close to the third strong zinc ligand.

The zinc binding residues in SPE-C are H167, H201, D203,
It is believed that H81 from the HLA-DR1 β chain binds to the same zinc cation to form a tetrahedron. The two ligands of the primary zinc binding motif, H20
1 and D203 are located in the β12 chain, which is part of the β-grasp motif, a common structural domain of superantigens. Third ligand, H
167 is derived from the β10 chain (Roussel et al., 1997).

In the model of SPE-G, three potential zinc binding ligands (H16
7, H202, D204) are located at corresponding positions. In the SMEZ-2 and SPE-H models, the two corresponding β12 residues are H202,
D204, H198, and D200. SPE-H (D160) and S
The third ligand in MEZ-2 (H162) is derived from the β9 chain and is most similar to H187 in SEA. From the crystal structure, H167 and S of SPE-C
EA H187 has been shown to be a spatially and geometrically equivalent site (Scad et al., 1997; Embo J 14 no 14: 3292-301; Roussel et al., 1997).

All superantigens examined, except for SPE-C, bind to a conserved motif in the MHC class II αI domain. In SEB and TSST,
A hydrophobic residue on the loop between β1 and β2 protrudes into a hydrophobic cavity in the MHCIIα I domain. This loop region has altered its properties in SPE-C, and the hydrophobic residues (F44, L45, Y46, and F47 in SEB) are the less hydrophobic residues T33, T34, and Replaced by H35. Comparison of this region with a computer generated model indicated that no general HLA-DRI α chain binding site was found.
Since the loop regions are generated by random selection, no conclusions can be drawn from their structure in this model. However, among the three models, the required hydrophobic nature observed in SEB and TSST was
The β2-loop has nothing Swaminathan, S. et al., Nature 359, No. 6.
398: 801-6 (1992); Acharya et al., Nature 367, No. 6458: 94-7 (1994).
. The residues are I25, D26, F27, K28, T29 in SMEZ-2.
, And S30, and in SPE-G, T31, T32, N33, and S34.
And in SPE-H, K28, N29, S30, P31, D32,
I33, V34 and T35.

[0100] SMEZ-2 differs from SMEZ by only 17 amino acids. In the SMEZ-2 model with these 17 residue locations, most substitutions are located in the loop region, most notably in the β5-β6 loop where five consecutive residues are substituted. . The potential zinc binding site and the β1-β2 loop are not affected by the substituted amino acids.

The Vβ specificity of TcRs differs between SMEZ and SMEZ-2 by one Vβ. SMEZ potently stimulates Vβ2T cells, whereas SMEZ-2 does not (Table 2). One or more of the 17 substituted residues in SMEZ / SMEZ-2 may therefore be involved in TcR binding. Since several regions have been implicated in the binding of TcR to different toxins, the exact location of the TcR binding site cannot be predicted from the model. The crystal structure of SEC2 and SEC3 complexed with the TcRβ chain is α2, β2
Showed a direct role for the loop of ~ β3, the loop of β4-β5, and some residues located at α4 (Fields et al., 1996 Nature 384 no 6605: 188-92).
). On the other hand, the binding of TSST to TcR is caused by α4, β7-β8 loop, α4
-A9 involved in residues from the loop (Acharya et al., 1994, Nature 367 no 6
548: 94-7). The SMEZ-2 model shows three residues, which are Tc
It may contribute to the R bond. In SMEZ, Lys at position 80 is Gl
u and Thr at position 84 is replaced by Ile, both on the β4-β5 loop. At the COOH terminus of the α4 helix, Al
a is replaced by Ser at position 143.

The results from the computer modeled protein structure show that all four toxins, SMEZ, SMEZ-2, SPE-G, and SPE-H have zinc-dependent similarities to SEA and SPE-C. May bind to the β-chain of HLA-DRI in a fashion, but in situations where hitherto only observed for SPE-C, H
Suggests that it may not be able to interact with the α-site of LA-DRI (Roussel et al., 1997; Li et al., 1997).

To determine whether zinc is required for binding of the toxin to MHC class II, a binding assay was performed using human LG-2 cells (MHC class II expressing cells homozygous for HLA-DRI). Was. Direct binding of ¹²⁵ I-labeled toxin was completely abolished in the presence of 1 mM EDTA (FIG. 9, Table 3). 2 mM
When zinc (ZnC1 ₂₎ is added, binding to LG-2 cells could be completely revived. These results indicate that the toxin binds to the β-chain of HLA-DRI in a zinc-dependent manner, most likely similar to SEA and SPE-C. However, that does not yet rule out the possibility of additional binding to the α-chain of HLA-DRI.

[0104]

[Table 3]

The binding affinity of the toxin to MHC class II was measured by Scatchard analysis using LG-2 cells. Zinc dependence was measured by binding of the recombinant toxin to LG-2 cells in the presence and absence of EDTA, as described in Materials and Methods.

The biphasic binding of SEA to HLA-DRI can be deduced from Scatchard analysis. It shows that SEA has a 36 nM high-affinity binding site (zinc-dependent β-chain binding site) and a 1 μM low-affinity binding site (α-chain binding site). On the other hand, Scatchard analysis for SEB, TSST, and SPE-C deduced only one binding site for HLA-DRI (Table 3).

Thus, Scatchard analysis was performed on radiolabeled rSMEZ, rSMEZ
-2, rSPE-G, and rSPE-H were performed using LG-2 cells. All four toxins have at least two binding sites on LG-2 cells,
Polyphasic curves with 15-65 nM high affinity sites and 1-2 μM low affinity sites were shown (FIG. 10, Table 3).

In an attempt to further determine the orientation of the toxin to MHC class II, competitive binding experiments were performed. Recombinant and comparative toxins (rSEA, rSEB, r
SPE-C, and rTSST) were radiolabeled and tested for binding to LG-2 cells using an excess of unlabeled toxin. The results are summarized in FIG. Both rSEA and rSPE-C were labeled rSMEZ, rSM, respectively.
Inhibited the binding of EZ-2, rSPE-G, and rSPE-H. However,
rSPE-C only partially (50%) inhibited the binding of labeled rSMEZ-2 (FIG. 12). Recombined SEB did not compete with any other toxins, even at the highest concentrations examined. Recombinant TSST was ¹²⁵ I labeled
They competed only marginally for rSMEZ, rSMEZ-2, and rSPE-G, respectively, or did not inhibit rSPE-H binding at all.

Conflicting competition experiments were performed. Recombinant SMEZ, rSMEZ-2, rSPE-
H prevented ¹²⁵ I-labeled rSEA from binding to LG-2 cells. However, even at the highest toxin concentrations (10,000-fold molar excess),
Only partial competition (50%) was observed. Recombinant SPE-G has ¹²⁵ I
It does not interfere with the binding of rSEA, and the binding of ¹²⁵ IrTSST does not interfere with rSMEZ, rSM
Only partially inhibited by EZ-2 and rSPE-H, rSPE-G
Was not inhibited. Significantly, none of the toxins, even at the highest concentration tested, inhibited the binding of ¹²⁵ IrSEB.

In further competitive binding experiments, rSMEZ, rSMEZ-2, rSPE-G,
And rSPE-H were tested for competition against each other. rSMEZ and rS
Both MEZ-2 competed equally with each other and labeled rSPE-G and rSP
E-H binding was also inhibited. In contrast, rSPE-G and rSPE-H did not inhibit the binding of any other toxins, suggesting that these toxins have the most restricted subset of MHC class II molecules, Means a specific receptor.

Section B: Genotyping Genotyping of Streptococcus pyogenes isolates Purified genomic DNA from all Streptococcus pyogenes isolates was smez, spez, as described in the preamble or as described by Proft (1999). -G and sp
Used for PCR with specific primers for the eh gene. further,
23S rRNA, oligo 23 rRNA forward (GCTATTTCGGGAGAGAA
CCAG) and oligo 23 rRNA reverse direction (CTGAAACATCTAAGT
A primer pair specific for the DNA region encoding AGCTG) was designed and used for PCR as a positive control.

Southern blot analysis Approximately 5 μg of genomic DNA was digested with the restriction enzyme HindIII (GIBCO) and loaded on a 0.7% agarose gel. DNA was obtained from Mniatis (1989).
) Was transferred from the gel to a Hybond-N ⁺ nylon membrane (Amersham). A 640 bp fragment of the smez-2 gene was prepared using the RadPrime Labeling System.
em) (Gibco) and ³² P-dCTP (NEN). Nylon blots were hybridized overnight at 65 ° C. with a radiolabeled probe in 2 × SSC, 0.5% SDS, 5 × Denhards. After washing twice at 65 ° C. in 0.2 × SSC, 0.1% SDS, the blots were analyzed on a Storm PhosphorImager.

Results Genotyping based on PCR was performed to determine the frequency of the genes smez, spe-g, and spe-h in the Streptococcus isolates (Tables 4 and 5).
). PCR primers for smez were designed to anneal to both smez and smez-2 genes. Between 1976 and 1998, 103 isolates were collected from various sites in patients with various infections, mostly pharyngitis. They contain 94 group A streptococci (GAS) and 9 non-GAS, the latter being S. aureus. Agalactiae (group B); Equis
s) (Group C), and some species of the genus Streptococcus (Group C ). There are 25 separate M / emm types represented among the GAS isolates, 13 isolates are unclassifiable for M (MNT), and the M type is unknown in two cases. The analysis was undertaken without knowing details about each isolate, and two double isolates were included (95/31 and 4202) to demonstrate the reproducibility of the test procedure. The isolates are listed in two groups. Group 1 contains isolates collected during a long time frame (1976-1996). Group 2 contains isolates collected in a short time (1998).

All nine non-GAS isolates (belonging to groups B, C, and G) were negative for the sag gene tested. Smez, spe of GAS isolates
-G and spe-h frequencies were 95.6%, 100% and 23.9%, respectively.
Met. No correlation between certain M / emm types and the presence of the spe-h gene could be demonstrated. The deficiency in this current set is that only five M / emm types are represented by more than one isolate. The most common serotype is M / emm12 with 13 isolates, 7 of which are positive for spe-h, 6 are negative, and the genetic diversity within the M / emm12 strain Is suggested. In contrast, all NZ1437 / M89 isolates tested were negative for spe-h.

The high frequency of smez and spe-g is of particular interest as it has not been described so far for the sag gene of any other streptococci. speA,
Other spe genes, such as speC and ssa, have been found at much lower frequencies, and horizontal gene transfer may explain the altered frequency of these genes in different strains. In contrast, smez and spe-g were both found in almost all GAS isolates tested. Only four GAS isolates tested (11152, 11070, 94/229, and 116
Only 10) denies smez. These are PT2612, emm
65, M49, and emm57. The result of this negative PCR is smez
Southern hybridizations were performed to find out whether the gene was missing or the lack / denaturation of the primer binding site. HindIII digested genomic DNA of the selected streptococcal isolate was probed with a 640 bp radiolabeled smz-2 PCR fragment (FIG. 13). sm
The ez gene is localized on an approximately 4 kb 1953 bp HindIII fragment (fragment B), but not on fragment A carrying SMEZ (lanes 4, 6, 9, 10). Furthermore, the smez probe was used to isolate 11152
Bound to a second DNA fragment (fragment C) of about 4.2 kb (lane 4). In the M1 comparative strain (lane 1) and the isolate 4202 (lane 8), the smez probe bound to fragment B in addition to fragment A. Fragment B in strain M1 contains a 180 bp region sharing 97% sequence homology with the 3 'end of the smez gene. These results indicate that the four PCRs
It suggests that the negative isolate has a truncated smez gene or smez-like sequence but is not a complete smez gene.

[0116]

[Table 4]

[0117]

[Table 5]

Genotyping of Streptococcus isolates. Isolates were collected from patients with different diseases between 1976 and 1996 (Group 1) and 1998 (Group 2). The results are based on PCR analysis using purified genomic DNA and primers specific for each of the sag genes.

Non-GAS includes: B, S. Agalactiae, C, S. Aquis, G, some species of the genus Streptococcus.

Unclassifiable MNT, M; ts, pharynx; ws, injured; sk, skin; ps, pus; hvs, mature vagina; bc, blood culture; ST, pharyngitis; SF, scarlet fever; RF
AGN, acute glomerulonephritis; T carriage, T carriage.

* And |, double isolate; §, recently M89; Ρ, recently M29.

Industrial Applicability The superantigens of the present invention, the polynucleotides that encode them, and the antibodies that bind them have many applications. Some of these have been discussed in the preamble (including streptococcal subtyping, diagnostic applications, and therapeutic applications), but it will be understood that these are only examples. Other applications will occur to those skilled in the art, and they will also never be excluded from the present invention.

It will also be appreciated that the above-described examples illustrate the present invention. The present invention may be practiced with many changes and modifications apparent to those skilled in the art. For example, a natural superantigen may be a synthetic superantigen with one or more deletions, insertions and / or substitutions with respect to the corresponding natural superantigen, provided that the activity of the superantigen is retained. It may be replaced. Similarly, there are many variations on how the invention can be used in other respects.

[Sequence list]

[Brief description of the drawings]

DETAILED DESCRIPTION OF THE INVENTION The present invention is generally defined as described above, which further includes embodiments in which the following description provides examples. It can be better understood with reference to the following figures.

FIG. 1. Multiple alignments of superantigen protein sequences. The protein sequence of the mature toxin was aligned using the pile-up program for the GCG package. Areas of high sequence identity are in black boxes. The box below the sequence shows the structural elements of SPE-C as determined from the crystal structure (Roussel et al. 1997 Nat. Struct. Biol. 4 no8: 635).
-43). The most homologous regions are the β4, β5, α4, and α of SPE-C.
Equivalent to 5. The white box near the C-terminus represents the primary zinc binding motif, a common feature of all toxins shown. The arrow above the sequence alignment is S
Regions with sequence diversity between MEZ and SMRZ-2 are shown.

FIG. 2. smez-2 encoding the mature SMRZ-2 superantigen (SEQ ID NO: 2)
Nucleotide sequence of the gene (SEQ ID NO: 1).

FIG. 3. Nucleotide sequence of part of the spe-g gene (SEQ ID NO: 3) encoding the mature SPE-G superantigen (SEQ ID NO: 4).

FIG. 4. Nucleotide sequence of part of the spe-h gene (SEQ ID NO: 5) encoding the mature SPE-H superantigen (SEQ ID NO: 6).

FIG. 5: Nucleotide sequence of part of the spe-j gene (SEQ ID NO: 7) encoding the mature SPE-J superantigen (SEQ ID NO: 8).

FIG. 6: Gel electrophoresis of purified recombinant toxin. A. Two micrograms of purified recombinant toxin was run on a 12.5% SDS polyacrylamide gel to indicate the purity of the preparation; B. Two micrograms of purified recombinant toxin Gel for isoelectric focusing (5.5% PAA, pH
5-8). The isoelectric points (IEP) of rSMEZ-2, rSPE-G, and rSPE-H were similar and were estimated to be pH 7-8. rSMEZ IEP
Was estimated to be pH 6-6.5.

FIG. 7: Stimulation of human T cells with recombinant toxin. PBLs were isolated from human blood samples and incubated with varying concentrations of recombinant toxin. Three days later, 0.1 μCi of [ ³ H] -thymidine was added, and the cells were incubated for another 24 hours prior to harvesting and counted in a gamma counter. 〇 is unstimulated; △ is rSMEZ; □ is rSMEZ-2; ◆ is rSPE-G
;

[Note 1] Indicates rSPE-H.

FIG. 8. Jurkat cell assay Jurkat cells (carrying Vβ8TcR) and LG-2 cells were mixed with varying concentrations of recombinant toxin and incubated for 24 hours prior to addition of SeI cells. One day later, 0.1 μCi of [ ³ H] -thymidine was added and cells were counted after an additional 24 hours. SEE targeting Vβ8 was used as a positive control. The negative control was SEA. Both SMEZ and SMEZ-2 are potent stimulators of jerk cells, demonstrating their ability to specifically target T cells carrying Vβ8. 〇 indicates unstimulated; △ indicates rSEA; □ indicates rSEE; ◆ indicates rSMEZ; ■ indicates rSMEZ-2.

FIG. 9. Zinc-dependent binding of SMEZ-2 to LG-2 cells.¹²⁵I labeled rSMEZ-2 and increased amount
Incubated for 1 hour at 37 ° C with the unlabeled toxin
Purified and counted.イ ン キ ュ ベ ー シ ョ ン is incubation in medium; △ is 1 mM EDTA
Incubation in medium supplemented with 1 mM; 1 mM EDTA, 2 mM ZnCl ₂ 3 shows incubation in medium supplemented with.

FIG. 10. Scatchard analysis of SMEZ-2 binding to LG-2 cells. One nanogram of ^125- I labeled rSMEZ-2 was duplicated for LG-2 cells and unlabeled toxin (10 μg-10 pg). Incubated with 2-fold dilution series. After 1 hour, cells were washed and counted. Scatchard plots were performed as described by Cunningham et al., 1989 Sciende 243: 1330-1336.

FIG. 11. Summary of competitive binding experiments. Efficiency of each labeled toxin competing with a 10,000 fold molar excess of all other unlabeled toxins for binding to LG-2 cells. □ has no competition;

[Note 2] Is 25% competitive;

[Note 3] Is 50% competitive;

[Note 4] Indicates 75% competition; Δ indicates 100% competition. The results in the lower right box have been previously published (Lie et al., 1997).

FIG. 12: Competitive binding using SMEZ-2. LG-2 cells were duplicated with 1 ng of ¹²⁵ I-labeled rSMEZ-2 and increasing amounts of unlabeled rSMEZ-2, rSEA, rSEB, rTSST,
Or incubated with rSPE-C. After one hour, cells were washed and counted. 〇 is rSMEZ-2; △ is rSEA; □ is rSEB;

[Note 5] Indicates rTSST; ◆ indicates rSPE-C.

FIG. 13. Southern blot analysis of genomic DNA using radiolabeled smez. HINDIII digested genomic DNA from various Streptococcus isolates was hybridized with a radiolabeled smez probe. Band A is sm
1953 bp HindIII DNA fragment carrying the z gene.
Bands B and C are both 4 kbp and 4.2, respectively, carrying the smez-like region.
It is a kbp DNA fragment. 1. Streptococcus pyogenes comparative strain (ATCC 7
00294, M1 type); 2, bacterial isolate 9639 (MNT); 3, bacterial isolate 11789
(MNT); 4, isolate 11152 (PT2612 type); 5, isolate RC406
3 (group C streptococci); 6, isolate 11070 (emm65 type); 7, DNA marker lane; 8, isolate 4202 (NZ5118 / M92 type); 9, isolate 94
/ 229 (M49 type); 10, isolate 11610 (emm57 type); 11, isolate 95/127 (NZ1437 / M89 type); 12, isolate 94/330 (M4
Type).

[Reference 1]

[Reference 2]

[Reference 3]

[Reference 4]

[Reference 5]

[Reference 6]

[Reference 7]

[Sequence list]

[Table 6]

[Table 7]

[Table 8]

[Table 9]

[Table 10]

[Table 11]

[Table 12]

[Table 13]

[Table 14]

[Table 15]

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61K 39/395 A61K 47/48 47/48 A61P 35/00 A61P 35/00 37/02 37/02 C07K 14 / 315 C07K 14/315 16/12 16/12 C12Q 1/68 A C12Q 1/68 G01N 33/569 F G01N 33/569 C12N 15/00 ZNAA (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG) KZ, MD, RU, TJ, TM), AE, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CR, CU, CZ, DE, DK, DM, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS , LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW (72) Inventor Proft Thomas New Zealand Auckland Simmons Street 58 UNISERV SUIZ HOUSE Auckland Unicer VIS Limited (Without ground) F-term (reference) 4B024 AA01 AA13 BA31 CA02 CA09 CA12 HA13 HA14 4B063 QA01 QA18 QQ06 QQ43 QQ53 QQ79 QR32 QR35 QR39 QR48 QR56 QS33 QS34 QX02 4C076 CC07 CC27 EE59A FF68 4C011 AA13A01 AA13A01 AA13A01 AA13A01 AA13AA1AA1AA1A1A1A1A1A1A1 BA10 CA11 DA86 EA29 EA50 FA71 FA74

Claims (30)

[Claims] Claims: 1. SMEZ-2, SPE-G, SPE-H, and SPE-J
A superantigen selected from any one of the above, or a functionally equivalent variant thereof. 2. A superantigen having the amino acid sequence of SEQ ID NO: 2, or a functionally equivalent variant thereof, which is SMEZ-2. 3. SPE-G, a superantigen having the amino acid sequence of SEQ ID NO: 4, or a functionally equivalent variant thereof. 4. SPE-H, a superantigen having the amino acid sequence of SEQ ID NO: 6, or a functionally equivalent variant thereof. 5. SPE-J, a superantigen having an amino acid sequence comprising SEQ ID NO: 8, or a functionally equivalent variant thereof. 6. A polynucleotide comprising a nucleotide sequence encoding SMEZ-2 according to claim 2 or a variant thereof. 7. The polynucleotide of claim 6, wherein said nucleotide sequence is or comprises SEQ ID NO: 1. 8. A polynucleotide comprising a nucleotide sequence encoding SPE-G according to claim 3, or a variant thereof. 9. The polynucleotide of claim 8, wherein said nucleotide sequence is or comprises SEQ ID NO: 3. 10. A polynucleotide comprising a nucleotide sequence encoding SPE-H or a variant thereof according to claim 4. 11. The polynucleotide of claim 10, wherein said nucleotide sequence is or comprises SEQ ID NO: 5. 12. A polynucleotide comprising a nucleotide sequence encoding SPE-J or a variant thereof according to claim 5. 13. The polynucleotide of claim 12, wherein said nucleotide sequence comprises SEQ ID NO: 7. 14. A method for subtyping streptococci, the method comprising:
A method comprising the step of detecting the presence or absence of the superantigen according to any one of claims to 5. 15. A method for subtyping streptococci, wherein the method comprises sub-type 6.
A method comprising the step of detecting the presence or absence of the polynucleotide according to any one of claims 13 to 13. 16. A composition comprising a superantigen or a variant thereof according to any one of claims 2 to 5, and a cell targeting molecule. 17. The composition of claim 15, wherein said cell targeting molecule specifically binds to a tumor cell. 18. The composition of claim 15 or 16, wherein said cell targeting molecule is an antibody. 19. A pharmaceutical composition comprising the composition according to any one of claims 15 to 17. 20. An antibody that binds to the superantigen SMEZ-2 according to claim 2. 21. An antibody that binds to the superantigen SPE-G according to claim 3. 22. An antibody that binds to the superantigen SPE-H according to claim 4. 23. An antibody that binds to the superantigen SPE-J according to claim 5. A kit comprising the antibody according to any one of claims 19 to 22. 25. A nucleic acid molecule that hybridizes to the polynucleotide according to claim 7. 26. A nucleic acid molecule that hybridizes to the polynucleotide according to claim 9. 27. A nucleic acid molecule that hybridizes to the polynucleotide according to claim 11. 28. A nucleic acid molecule that hybridizes to the polynucleotide according to claim 13. A kit comprising the nucleic acid molecule according to any one of claims 25 to 28. 30. A method for diagnosing a disease caused or mediated by the expression of a superantigen according to claim 1, wherein the presence of said superantigen is determined by the method of claim 19.
29. The method according to any one of claims 25 to 28, wherein the step of detecting using the antibody according to any one of claims 2 to 2, or the presence of a polynucleotide encoding the superantigen is performed.
14. A method comprising the step of detecting using the nucleic acid molecule according to claim.