NZ511943A - Superantigens - Google Patents

Abstract

A superantigen selected from any one of SMEZ-2, SPE-G, SPE-H and SPE-J and polynucleotides which encode them. Diagnostic and therapeutic applications of these superantigens are described.

Description

4 TECHNICAL FIELD SUPERANTIGENS INTEL JscttjaTP^FRTY OFt-inp Of- N2 2 4 FEB 2003 RECEIVED This invention relates to superantigens, and to their use, including in diagnosis and/or treatment of disease.

BACKGROUND ART Bacterial superantigens are the most potent T cell mitogens known. They stimulate large numbers of T cells by directly binding to the side of the MHC class II and T cell Receptor (TcR) molecules. Because they override the normally exquisite MHC restriction phenomenon of T cell antigen recognition, they are prime candidates for either causing the onset of autoimmune diseases or exacerbating an existing autoimmune disorder.

The applicants have identified genes coding for four novel superantigens from S. pyogenes. It is broadly to these superantigens and polynucleotides encoding them that the present invention is directed.

It is an object of the present invention to provide superantigens selected from any one of SMEZ-2, SPE-G, SPE-H or SPE-J or functionally equivalent variants thereof, polynucleotides comprising nucleotide sequences encoding SMEZ-2, SPE-G, SPE-H or SPE-J or variants thereof, methods of subtyping Streptococci, constructs comprising a superantigen selected from any one of SMEZ-2, SPE-G, SPE-H or SPE-J or a variant thereof, pharmaceutical compositions including said constructs, antibodies which bind a superantigen selected from any one of SMEZ-2, SPE-G, SPE-H or SPE-J or variants thereof, a nucleic acid molecule which hybridises under stringent conditions to SEQ ID: 1, SEQ ID:3, SEQ ID:5 or SEQ ID:7, a kit which includes said nucleic acid molecule, a method of diagnosing a disease which is caused or mediated by expression of any one of SMEZ-2, SPE-G, SPE-H, SPE-J or a variant thereof, or at least to provide the public with a choice of any one of each.

SUMMARY OF THE INVENTION OBJECT In one aspect the invention provides a superantigen selected from any one of SMEZ-2, SPE-G, SPE-H and SPE-J, or a functionally equivalent variant thereof. 1a 4 4 fi Q k a § w a In a further aspect the invention provides a polynucleotide molecule comprising a sequence encoding a superantigen chosen from SMEZ-2, SPE-G, SPE-H, SPE-J, or a functionally equivalent variant thereof.

In another aspect of the invention there is provided a method of subtyping Streptococci on the basis of superantigen genotype comprising detection of the presence of any or all of the above four superantigens or the corresponding polynucleotides. "iNTE^C^rp^pFRTY1 Ofc'C£ OF M2 2 4 FES 2003 received 511943 " In a further aspect the invention provides a construct comprising any of the above' superantigens (or superantigen variants) bound to a cell-targeting molecule, which is preferably a tumour-specific antibody. in yet a further aspect, the invention provides a pharmaceutical composition for therapy or prophylaxis comprising a superantigen or superantigen variant as described above linked to cell targeting molecule.

In yet another aspect, the invention provides a kit comprising a polynucleotide as above described.

In another aspect, the invention provides a method of diagnosing a disease which is caused or mediated by expression of a superantigen hereinbefore described which includes the step of detecting the superantigen using an antibody, or detecting the presence of a polynucleotide encoding said superantigen using a nucleic acid molecule which hybridises under stringent conditions to said polynucleotide, and wherein the method excludes in vivo diagnosis.

In another aspect, the invention provides a nucleic acid molecule which hybridises under stringent conditions to the nucleic acid SEQ ID: 1, or SEQ ID:3, or SEQ ID:5 or SEQ ID:7.

Other aspects of the invention will be apparent from the description provided below, and from the appended claims.

DESCRIPTION OF DRAWINGS While the invention is broadly defined above, it further includes embodiments of which the following description provides examples. It will also be better understood with reference to the following drawings: Fig 1: Multiple alignment of superantigen protein sequences.

The protein sequence of mature toxins were aligned using the PileUp programme on the GCG package. Regions of high sequence identity are in black boxes. The boxes below the sequences indicate the structural elements of SPE-C, as determined from the crystal structure (Roussel et al 1997 Nat. Struct. Biol. 4 no8:635-43). Regions with highest homology correspond to the (34 ,(35, x4 and cc5 regions in SPE-C. The clear box near the C-terminus represents a primary zinc binding motif, a common feature of all toxins shown.

The arrows on top of the sequence alignment show the regions of sequence diversity between SMEZ and SMEZ-2.

Figure 2: The nucleotide sequence of the portion of the smez-2 gene (SEQ ID NO. 1) coding the mature SMEZ-2 superantigen (SEQ ID NO. 2).

Figure 3: The nucleotide sequence of the portion of the spe-g gene (SEQ ID NO. 3) coding the mature SPE-G superantigen (SEQ ID NO. 4). 3 Figure 4: The nucleotide sequence of the portion of the spe-h gene (SEQ ID NO. 5) coding the mature SPE-H superantigen (SEQ ID NO. 6).

Figure 5: The nucleotide sequence of the portion of the spe-j gene (SEQ ID NO. 7) 5 coding part of the mature SPE-J superantigen (SEQ ID NO. 8).

Figure 6: Gel electrophoresis of the purified recombinant toxins.

A. Two micrograms of purified recombinant toxin were run on a 12.5% SDS-10 polyaciylamide gel to show the purity of the preparations; B. Two micrograms of purified recombinant toxin were run on an isoelectric focusing gel (5.5% PAA, pH 5-8). The isoelectric point (IEP) of rSMEZ-2, rSPE-G and rSPE-H is similar and was estimated at pH 7-8. The IEP of rSMEZ was estimated at pH 6-6.5.

Figure 7: Stimulation of human T cells with recombinant toxins.

PBLs were isolated from human blood samples and incubated with varying concentrations of recombinant toxin. After 3d, 0.1 fiCi [3H]-thymidine was added and cells were incubated for another 24h, before harvested and counted on a 20 gamma counter. O, unstimulated; ▲, rSMEZ; 2, rSMEZ-2; ♦, rSPE-G; E, rSPE-H.

Figure 8: Jurkat cell assay Jurkat cells (bearing a V(38 TcR) and LG-2 cells were mixed with varying 25 concentrations of recombinant toxin and incubated for 24h, before Sel cells were added. After Id, 0.1 |j.Ci [3H]-thymidine was added and cells were counted after another 24h. The Vp8 targeting SEE was used as a positive control. The negative control was SEA. Both SMEZ and SMEZ-2 were potent stimulators of Jurkat cells, indicating their ability to specifically target Vp8 bearing T cells. O, unstimulated; 30 A, rSEA; 1, rSEE; ♦, rSMEZ; ■, rSMEZ-2.

Figure 9: Zinc dependent binding of SMEZ-2 to LG-2 cells 4 LG-2 cells were incubated in duplicates with 1 ng of 125I labelled rSMEZ-2 and increasing amounts of unlabeled toxin at 37°C for lh, and then the cells were washed and counted.

O, incubation in media; ▲, incubation in media plus ImM EDTA; Z, incubation in media plus 1 mM EDTA, 2 mM ZnCk.

Figure 10: Scatchard analysis of SMEZ-2 binding to LG-2 cells 0 One nanogram 125I-labeled rSMEZ-2 was incubated in duplicates with LG-2 cells and a 2-fold dilution series of cold toxin (10 jig to 10 pg). After lh, cells were washed and counted. Scatchard plots were performed as described by Cunningham et al 1989 Science 243:1330-1336.

Figure 11: Summary of competitive binding experiments.

Efficiency of each labelled toxin to compete with a 10,000-fold molar excess of any other unlabeled toxin for binding to LG-2 cells. □ , no competition; 0, 25% competition; H , 50% competition; H 75% competition; ■ , 100% competition. 0 The results within the boxes are at the bottom right have previously been published (Li et al. 1997).

Figure 12: Competition binding study with SMEZ-2.

LG-2 cells were incubated in duplicates with 1 ng of 125I-labeled rSMEZ-2 and increasing amounts of unlabeled rSMEZ-2, rSEA, rSEB, iTSST or rSPE-C. After lh cells were washed and counted.

O, rSMEZ-2; ▲, rSEA; Z, rSEB; B iTSST; ♦, rSPE-C. 0 Figure 13: Southern blot analysis of genomic DNA with radiolabeled smez. H1NDIII digested genomic DNA from various Steptococcus isolates was hybridized with a radiolabeled smez probe. Band A is a 1953 bp Hindlll DNA fragment that carries the smez gene. Bands B and C are DNA fragments of about 4 kbp and 4.2 kbp, respectively, which both cany a smez like region. 1,S. pyogenes reference strain 5 (ATCC 700294, Ml type); 2, isolate 9639 (MNT); 3, isolate 11789 (MNT); 4, isolate 11152 (PT2612 type); 5, isolate RC4063 (group C streptococcus); 6, isolate 11070 (emm65 type); 7, DNA marker lane; 8, isolate 4202 (NZ5118/M92 type); 9, isolate 94/229 (M49 type); 10, isolate 11610 (emm57 type); 11, isolate 95/127 (NZ1437/M89 type); 12, isolate 94/330 (M4 type).

DESCRIPTION OF THE INVENTION The focus of the invention is the identification of four superantigens (SPE-G, SPE-H, SPE-J and SMEZ-2) and the corresponding polynucleotides which encode them.

Figure 1 shows the amino acid sequences of the above four superantigens together with those of previously identified superantigens SMEZ, SPE-C and SEA.

Of the four superantigens SPE-G, SPE-H, SPE-J and SMEZ-2, the latter is perhaps 15 of greatest interest.

The smez-2 gene which encodes SMEZ-2 was identified in an experiment designed to produce recombinant SMEZ protein from S. pyogenes 2035 genomic DNA. A full length smez gene was isolated from the strain but the DNA sequence of the smez 20 gene of strain 2035 showed nucleotide changes in 36 positions (or 5%) compared to smez from strain Ml (Fig. 1). The deduced protein sequences differed in 17 amino acid residues (or 8.1%). This difference establishes this as a new gene, smez-2, and the encoded protein as a new superantigen, SMEZ-2.

The most significant difference between SMEZ and SMEZ-2 is an exchanged pentapeptide sequence at position 96-100, where the EEPMS sequence of SMEZ is converted to KTSIL in SMEZ-2 (Fig. 1). A second difference is at position 111-112, where an RR dipeptide is exchanged for GK in SMEZ-2. The remaining 10 different residues are spread over almost the entire primaiy sequence.

Figure 2 shows the nucleotide sequence encoding mature SMEZ-2 and the deduced amino acid sequence.

Likewise, Figures 3 to 5 show the nucleotide sequence encoding mature SPE-G, SPE-H and SPE-J superantigens, respectively, together with their respective deduced amino acid sequences.

The invention is of course not restricted to superantigens/polynucleotides having the specific sequences of Figures 1 to 5. Instead, functionally equivalent variants are contemplated.

The phrase "functionally equivalent variants" recognises that it is possible to vaiy 10 the amino acid/nucleotide sequence of a peptide while retaining substantially equivalent functionality. For example, a peptide can be considered a functional equivalent of another peptide for a specific function if the equivalent peptide is immunologically cross-reactive with and has at least substantially the same function as the original peptide. The equivalent can be, for example, a fragment of 15 the peptide, a fusion of the peptide with another peptide or carrier, or a fusion of a fragment which additional amino acids. For example, it is possible to substitute amino acids in a sequence with equivalent amino acids using conventional techniques. Groups of amino acids normally held to be equivalent are: (a) Ala, Ser, Thr, Pro, Gly; (b) Asn, Asp, Glu, Gin; (c) His, Arg, Lys; (d) Met, Leu, He, Val; and (e) Phe, Tyr, Trp.

Equally, nucleotide sequences encoding a particular product can vary significantly simply due to the degeneracy of the nucleic acid code.

Variants can have a greater or lesser degree of homology as between the variant 30 amino acid/nucleotide sequence and the original.

Polynucleotide or polypeptide sequences may be aligned, and percentage of identical nucleotides in a specified region may be determined against another sequence, using computer algorithms that are publicly available. Two exemplary algorithms 35 for aligning and identifying the similarity of polynucleotide sequences are the WO 00/39159 PCT/NZ99/00228 7 BLASTN and FASTA algorithms. The similarity of polypeptide sequences may be examined using the BLASTP algorithm. Both the BLASTN and BLASTP software are available on the NCBI anonymous FTP server (ftp://ncbi.nlm.nih.gov) under /blast/executables/. The BLASTN algorithm version 2.0.4 [Feb-24-1998], set to the 5 default parameters described in the documentation of variants according to the present invention. The use of the BLAST family of algorithms, including BLASTN and BLASTP, is described at NCBI's website at URL http: / /www.ncbi nlm .nih. gov /BLAST / newblast.html and in the publication of Altschul, Stephen F., et al. (1997), "Gapped BLAST and PSI-BLAST: a new 10 generation of protein database search programs", Nucleic Acids Res. 25:3389-34023. The computer algorithm FASTA is available on the Internet at the ftp site ftp: / /ftp.Virginia.edu /pub/fasta/. Version 2.0u4, February 1996, set to the default parameters described in the documentation and distributed with the algorithm, is also preferred for use in the determination of variants according to the present 15 invention. The use of the FASTA algorithm is described in W. R. Pearson and D. J. Lipman, "Improved Tools for Biological Sequence Analysis", Proc. Natl. Acad. Sci. USA 85:2444-2448 (1988) and W. R. Pearson, "Rapid and Sensitive Sequence Comparison with FASTP and FASTA, "Methods in Enzymology 183:63-98 (1990).

The following running parameters are preferred for determination of alignments and similarities using BLASTN that contribute to E values (as discussed below) and percentage identity: Unix running command: blastall -p blastn -d embldb -e 10 -G 1 -E 1 -r 2 -v 50 -b 50 -I queryseq -o results; and parameter default values: -p Program Name [String] -d Database [String] -e Expectation value (E) [Real] -G Cost to open a gap (zero invokes default behaviour) [Integer] -E Cost to extend a cap (zero invokes default behaviour) [Integer] -r Reward for a nucleotide match (blastn only) [Integer] -v Number of one-line descriptions (V) [Integer] -b Number of alignments to show (B) [Integer] -i Query File [File In] -o BLAST report Output File [File Out] Optional For BLASTP the following running parameters are preferred: blastall -p blastp -d 35 swissprotdb -e 10 -G 1 -E 1 -v 50 -b 50 -I queryseq -o results 8 -p Program Name [String] -d Database [String] -e Expectation value (E) [Real] -G Cost to open a gap (zero invokes default behaviour) [Integer] -E Cost to extend a cap (zero invokes default behaviour) [Integer] -v Number of one-line descriptions (v) [Integer] -b Number of alignments to show (b) [Integer] -i Query File [File In] -o BLAST report Output File [File Out] Optional The "hits" to one or more database sequences by a queried sequence produced by BLASTN, BLASTP, FASTA, or a similar algorithm, align and identify similar portions of sequences. The hits are arranged in order of the degree of similarity and the length of sequence overlap. Hits to a database sequence generally represent an 15 overlap over only a fraction of the sequence length of the queried sequence.

The BLASTN and FASTA algorithms also produce "Expect" or E values for alignments. The E value indicates the number of hits one can "expect" to see over a certain number of contiguous sequences by chance when searching a database of a 20 certain size. The Expect value is used as a significance threshold for determining whether the hit to a database, such as the preferred EMBL database, indicates true similarity. For example, an E value of 0.1 assigned to a hit is interpreted as meaning that in a database of the size of the EMBL database, one might expect to see 0.1 matches over the aligned portion of the sequence with a similar score simply 25 by chance. By this criterion, the aligned and matched portions of the sequences then have a 90% probability of being the same. For sequences having an E value of 0.01 or less over aligned and matched portions, the probability of finding a match by chance in the EMBL database is 1% or less using the BLASTN or FASTA algorithm.

According to one embodiment, "variant" polynucleotides, with reference to each of the polynucleotides of the present invention, preferably comprise sequences having the same number or fewer nucleic acids than each of the polynucleotides of the present invention and producing an E value of 0.01 or less when compared to the polynucleotide of the present invention. That is, a variant polynucleotide is any 35 sequence that has at least a 99% probability of being the same as the 9 polynucleotide of the present invention, measured as having an E value of 0.01 or less using the BLASTN or FASTA algorithms set at the parameters discussed above.

Variant polynucleotide sequences will generally hybridize to the recited 5 polynucleotide sequence under stringent conditions. As used herein, "stringent conditions" refers to prewashing in a solution of 6X SSC, 0.2% SDS; hybridizing at 65°C, 6X SSC, 0.2% SDS overnight; followed by two washes of 30 minutes each in IX SSC, 0.1% SDS at 65°C and two washes of 30 minutes each in 0.2X SSC, 0.1% SDS at 65°C.

The superantigens of the invention together with their fragments and other variants may be generated by synthetic or recombinant means. Synthetic polypeptides having fewer than about 100 amino acids, and generally fewer than about 50 amino acids, may be generated by techniques well known to those of ordinary skill in the 15 art. For example, such peptides may be synthesised using any of the commercially available solid-phase techniques such as the Merryfield solid phase synthesis method, where amino acids are sequentially added to a growing amino acid chain (see Merryfield, J. Am. Chem. Soc 85: 2146-2149 (1963)). Equipment for automative synthesis of peptides is commercially available from suppliers such as Perkin 20 Elmer/Applied Biosystems, Inc. and may be operated according to the manufacturers instructions.

Each superantigen, or a fragment or variant thereof, may also be produced recombinantly by inserting a polynucleotide (usually DNA) sequence that encodes 25 the superantigen into an expression vector and expressing the superantigen in an appropriate host. Any of a variety of expression vectors known to those of ordinary skill in the art may be employed. Expression may be achieved in any appropriate host cell that has been transformed or transfected with an expression vector containing a DNA molecule which encodes the recombinant protein. Suitable host 30 cells includes procaryotes, yeasts and higher eukaiyotic cells. Preferably, the host cells employed are E. coli, yeasts or a mammalian cell line such as COS or CHO, or an insect cell line, such as SF9, using a baculovirus expression vector. The DNA sequence expressed in this matter may encode the naturally occurring superantigen, fragments of the naturally occurring protein or variants thereof.

DNA sequences encoding the superantigen or fragments may be obtained, for example, by screening an appropriate S. pyogenes cDNA or genomic DNA library for DNA sequences that hybridise to degenerate oligonucleotides derived from partial amino acid sequences of the superantigen. Suitable degenerate oligonucleotides 5 may be designed and synthesised by standard techniques and the screen may be performed as described, for example, in Maniatis et al. Molecular Cloning - A Laboratory Manual, Cold Spring Harbour Laboratories, Cold Spring Harbour, NY (1989).

Identification of these superantigens and of their properties gives rise to a number of useful applications. A first such application is in the genotyping of organisms by reference to their superantigen profile.

An illustration of this is subtyping of strains of S. pyogenes.

One feature which has been observed is that all clones of S. pyogenes so far found to be positive for SMEZ express either SMEZ-1 or SMEZ-2 but not both. Thus they are mutually exclusive, which enables a rapid diagnostic test which tells whether an isolate or a patient sample is either SMEZ-1 +ve or SMEZ-2 +ve. This will assist in 20 the typing of the isolate.

This general diagnostic approach is most simply achieved by providing a set or primers which amplify either all or a subset of superantigen genes and that generate gene specific fragments. This can be modified to provide a simple 25 qualitative ELISA-strip type kit that detects biotin labelled PCR fragments amplified by the specific primers and hybridised to immobilised sequence specific probes. This has usefulness for screening patient tissue samples for the presence of superantigen producing streptococcal strains.

Such approaches are well known and well understood by those persons skilled in the art.

Another approach is to provide monoclonal antibodies to detect each of the streptococcal superantigens. An ELISA kit containing such antibodies would allow 35 the screening of large numbers of streptococcal isolates. A kit such as this would be 11 useful for agencies testing for patterns in streptococcal disease or food poisoning outbreaks.

Another potential diagnostic application of the superantigens of the invention is in 5 the diagnosis of disease, such as Kawasaki Syndrome (KS).

KS is an acute multi-system vasculitis of unknown aetiology. It occurs world-wide but is most prevalent in Japan or in Japanese ancestry. It primarily affects infants and the young up to the age of 16. It is an acute disease that without treatment, 10 can be fatal. Primary clinical manifestations include • Prolonged fever • Bilateral non-exudative conjunctivitis • Indurtation and erythema of the extremities • Inflammation of the lips and oropharynx 15 • Polymorphous skin rash • Cervical lymphoadenopathy • In 15-25% of cases, coronary arterial lesions develop.

These indications are used as a primary diagnosis of KS.

In Japan and the US, KS has become one of the most common causes of acquired heart disease in children. Treatment involves the immediate intravenous administration of gamma globulin (IVGG) during the acute phase of the disease and this significantly reduces the level of coronary lesions.

There are two clear phases to the disease, an acute phase and a convalescent phase. The acute phase is marked by strong immune activation. Several reports have suggested that superantigens are involved and many attempts have been made to link the disease to infection with superantigen producing strains of 30 Streptococcus pyogenes. Features of the acute phase of KS are the expansion of VP 2 and to a lesser extent VP8 bearing T cells and an increase of DR expression T cells (a hallmark of T cell activation).

Because SMEZ-2 stimulates both Vp2 and Vp8 bearing T cells, testing for SMEZ-2 35 production is potentially very useful in the diagnosis of KS. 12 Antibodies to the superantigens for use in applications such as are described above are also provided by this invention. Such antibodies can be polyclonal but will preferably be monoclonal antibodies.

Monoclonal antibodies with affinities of 10 8 M'1 or preferably 109 to 10"10 M*1 or stronger will typically be made by standard procedures as described, eg. in Harlow 8s Lane (1988) or Goding (1986). Briefly, appropriate animals will be selected and the desired immunization protocol followed. After the appropriate period of time, the 10 spleens of such animals are excised and individual spleen cells fused, typically, to immortalised myeloma cells under appropriate selection conditions. Thereafter, the cells are clonally separated and the supernatants of each clone tested for their production of an appropriate antibody specific for the desired region of the antigen.

Other suitable techniques for preparing antibodies well known in the art involve in vitro exposure of lymphocytes to the antigenic polypeptides, or alternatively, to selection of libraries of antibodies in phage or similar vectors.

Also, recombinant immunoglobulins may be produced using procedures known in 20 the art (see, for example, US Patent 4,816,567 and Hodgson J. (1991)).

The antibodies may be used with or without modification. Frequently, antibodies will be labeled by joining, either covalently or non-covalently, a substance which provides for a detectable signal. A wide variety of labels and conjugation techniques 25 are known and are reported extensively in the literature. Suitable labels include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent agents, chemiluminescent agents, magnetic particles and the like. Patents teaching the use of such labels include US Patents 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4,366,241.

The immunological assay in which the antibodies are employed can involve any convenient format known in the art.

The nucleotide sequence information provided herein may be used to design probes 35 and primers for probing or amplification of parts of the smez-2, spe-g, spe-h and 13 spe-j genes. An oligonucleotide for use in probing or PCR may be about 30 or fewer nucleotides in length. Generally, specific primers are upwards of 14 nucleotides in length. For optimum specificity and cost effectiveness, primers or 16-24 nucleotides in length are preferred. Those skilled in the art are well versed in the design of 5 primers for use in processes such as PCR.

If required, probing can be done with entire polynucleotide sequences provided herein as SEQ ID NOS 1, 3, 5 and 7, optionally carrying revealing labels or reporter molecules. 0 Such probes and primers also form aspects of the present invention.

Probing may employ the standard Southern blotting technique. For instance, DNA may be extracted from cells and digested with different restriction enzymes. 5 Restriction fragments may then be separated by electrophoresis on an agarose gel, before denaturation and transfer to a nitrocellulose filter. Labelled probes may be hybridised to the DNA fragments on the filter and binding determined. DNA for probing may be prepared from RNA preparations from cells. Probing may optionally be done by means of so-called "nucleic acid chips" (see Marshall and Hodgson 0 (1998) Nature Biotechnology 16:27-31).

In addition to diagnostic applications, another application of the superantigens is reliant upon their ability to bind to other cells.

One of the most important features of superantigens is that they bind a large number or T cell receptor molecules by binding to the VP domain. They are the most potent of all T cell mitogens and are therefore useful to recruit and activate T cells in a relatively non-specific fashion. 0 This ability enables the formation of constructs in which the superantigen (or at least the T-cell binding portion of it) is coupled to a cell-targeting molecule, particularly an antibody, more usually a monoclonal antibody.

When a monoclonal antibody that targets a specific cell surface antigen (such as a 5 tumor specific antigen) is coupled to a superantigen in such a construct, this generates a reagent that on the one hand will bind specifically to the tumor cell, and 14 on the other hand recruit and selectively active T cells for the purpose of killing the targeted cell.

Bi-specific constructs of this type have important applications in therapy 5 (particularly cancer therapy) and again may be prepared by means known to those skilled in art. For example SMEZ-2 may be coupled to a tumor specific monoclonal antibody. The constructs may be incorporated into conventional carriers for pharmaceutically-active proteins.

Various aspects of the invention will now be described with reference to the following experimental section, which is included for illustrative purposes.

EXAMPLE SECTION A: SUPERANTIGEN IDENTIFICATION AND CHARACTERISATION Materials and Methods Identification of novel SAGs 20 The novel superantigens were identified by searching the S. pyogenes Ml genome database at the University of Oklahoma (http://www.genome.ou.edu/strep.html) with highly conserved p5 and a4regions of streptococcal and staphylococcal superantigens, using a TBlastN search programme.

The open reading frames were defined by translating the DNA sequences around the matching regions and aligning the protein sequences to known superantigens using the computer programes Gap. Multiple alignments and dendrograms were performed with Lineup and Pileup. The FASTA programme was used for searching the SwissProt (Amos Bairoch, Switzerland) and PIR (Protein Identification Resource, 30 USA) protein databases.

The leader sequences of SPE-G and SPE-H were predicted using the SP Scan programme All computer programmes are part of the GCG package (version 8).

WO 00/39159 PCT/NZ99/00228 Cloning of smez, smez-2, spe-g and spe-h.

Fifty nanograms of S.pyogenes Ml (ATCC 700294) or S.pyogenes 2035 genomic DNA was used as a template to amplify the smez DNA fragment and the smez-2 DNA fragment, respectively, by PCR using the primers 5 smez-forward (TGGGATCCTTAGAAGTAGATAATA) and smez-reverse (AAGAATTCTTAGGAGTCAATTTC) and Taq Polymerase (Promega). The primers contain a terminal tag with the restriction enzyme recognition sequences BamHI and EcoRI, respectively. The amplified DNA fragment, encoding the mature protein without the leader sequence (Kamezawa et al, 1997 Infect. Immun. 65 10 no9:38281-33) was cloned into a T-tailed pBlueScript SKII vector (Stratagene).

Spe-g and spe-h were cloned in a similiar approach, using the primers spe-g-fw (CTGGATCCGATGAAAATTTAAAAGATTTAA) and spe-g-rev (AAGAATTCGGGGGGAGAATAG), and primers spe-h-fw 15 (TTGGATCCAATTCTTATAATACAACC) and spe-h-rev (AAAAGCTTTTAGCTGATTGACAC), respectively.

The DNA sequences of the subcloned toxin genes were confirmed by the dideoxy chain termination method using a Licor automated DNA sequencer. As the DNA 20 sequences from the genomic database are all unedited raw data, 3 subclones of every cloning experiment were analyzed to ensure that no Taq polymerase related mutations were introduced.

Expression and purification of rSMEZ, rSMEZ-2, rSPE-G and rSPE-H.

Subcloned smez, smez-2 and spe-g fragments were cut from pBlueScript SKII vectors, using restriction enzymes BamHI and EcoRI (LifeTech), and cloned into pGEX-2T expression vectors (Pharmacia). Due to an internal EcoRI restriction site within the spe-H gene, the pBlueScript:spe-h subclone was digested with BamHI and Hindlll and the spe-h fragment was cloned into a modified pGEX-2T vector that 30 contains a Hindlll 3'cloning site.

Recombinant SMEZ, rSMEZ-2 and rSPE-H were expressed in E.coli DH5a cells as glutathione-S-tranferase (GST) fusion proteins. Cultures were grown at 37° C and induced for 3-4 h after adding 0.2 mM isopropyl-p-D-thiogalactopyranoside (IPTG). 35 GST - SPE-G fusion protein was expressed in cells grown at 28° C.

WO 00/39159 PCT/NZ99/00228 16 The GST fusion proteins were purified on glutathione agarose as described previously (Li et al, 1997) and the mature toxins were cleaved off from GST by trypsin digestion. All recombinant toxins, except rSMEZ, were further purified by 5 two rounds of cation exchange chromatography using carboxy methyl sepharose (Pharmacia). The GST-SMEZ fusion protein was trypsin digested on the GSH-column and the flow through containing the SMEZ was collected.

Gel electrophoresis All purified recombinant toxins were tested on a 12% SDS-polyacrylamide gel according the procedure of Laemmli. The isoelectric point of the recombinant toxins was determined by isoelectric focusing on a 5.5% polyaciylamide gel using-ampholine pH 5-8 (Pharmacia Biotech). The gel was run for 90 min at 1 W constant power.

Toxin proliferation assay Human peripheral blood lymphocytes (PBL) were purified from blood of a healthy donor by Histopaque Ficoll (Sigma) fractionation. The PBL were incubated in 96-well round bottom microtiter plates at 105 cells per well with RPMI-10 (RPMI with 10% 20 fetal calf serum) containing varying dilutions of recombinant toxins. The dilution series was performed in 1:5 steps from a starting concentration of 10 ng/ml of toxin. Pipette tips were changed after each dilution step. After 3 days 0.1 |aCi [3H]thymidine was added to each well and cells were incubated for another 24 h. Cells were harvested and counted on a scintillation counter.

Mouse leukocytes were obtained from spleens of 5 different mouse strains (SJL, BIO.M, BIO/J, C3H and BALB/C). Splenocytes were washed in DMEM-10, counted in 5% acetic acid and incubated on microtiter plates at 105 cells per well with DMEM-10 and toxins as described for human PBLs.

TcR Vp analysis.

VP enrichment analysis was performed by anchored multiprimer amplification (Hudson et al, 1993, J exp Med 177:175-185). Human PBLs were incubated with 20 pg/ml of recombinant toxin at 106 cells/ml for 3 d. A two-fold volume expansion of 35 the culture followed with medium containing 20 ng/ml IL-2. After another 24h, 17 stimulated and resting cells were harvested and RNA was prepared using Trizol reagent (Life Tech). A 500 bp p-chain DNA probe was obtained by anchored multiprimer PCR as described previously (38), radiolabeled and hybridized to del (36) individual VPs and a Cp DNA region dot blotted on a Nylon membrane. The 5 membrane was analysed on a Molecular Dynamics Storm Phosphor imager using ImageQuant software. Individual Vps were expressed as a percentage of all the VPs determined by hybridization to the Cp probe.

Jurkat cell assay 0 Jurkat cells (a human T cell line) and LG-2 cells (a human B lymphoblastoid cell line, homozygous for HLA-DR1) were harvested in log phase and resuspended in RPMI-10. One hundred microliter of the cell suspension, containing 1x10s Jurkat cells and 2xl04 LG-2 cells were mixed with 100 |j.l of varying dilutions of recombinant toxins on 96 well plates. After incubating overnight at 37° C, 100 jil 5 aliquots were transfered onto a fresh plate and 100 (J. (lxlO4) of Sel cells (IL-2 dependent murine T cell line) per well were added. After incubating for 24 h, 0.1 jiCi [3H]thymidine was added to each well and cells were incubated for another 24 h. Cells were harvested and counted on a scintillation counter. As a control, a dilution series of IL-2 was incubated with Sel cells. 0 Computer aided modelling of protein structures Protein structures of SMEZ-2, SPE-G and SPE-H were created on a Silicon Graphics computer using Insightll/Homology software. The superantigens SEA, SEB and SPE-C were used as reference proteins to determine structurally conserved regions 5 (SCRs). Coordinate files for SEA (1ESF), for SEB (1SEB) and for SPE-C (1AN8) were downloaded from the Brookhaven Protein Database. The primary amino acid sequences of the reference proteins and SMEZ-2, SPE-G and SPE-H, respectively, were aligned and coordinates from superimposed SCR's were assigned to the model proteins. The loop regions between the SCRs were generated by random choice. 0 MolScript software (PJ Kraulis, 1991, J App Critallography 24:946-50) was used for displaying the computer generated images.

Radiolabeling and LG-2 binding experiments Recombinant toxin was radioiodinated by the chloramine T method as previously 5 described (by Li et al. 1997). Labeled toxin was seperated from free iodine by size 18 exclusion chromatography using Sephadex G25 (Pharmacia). LG2 cells were used for cell binding experiments, as described (Li et al. 1997). Briefly, cells were harvested, resuspended in RPMI-10 and mixed at 106 cells/ml with 125I-tracer toxin (1 ng) and 0.0001 to 10 |ag of unlabeled toxin and incubated at 37° C for 1 h. After 5 washing with ice cold RPMI-1 the pelleted cells were analyzed in a gamma counter. For zinc binding assays the toxins were incubated in either RPMI-10 alone, in RPMI-10 with 1 mM EDTA or in RPMI-10 with ImM EDTA, 2 mM ZnCh- Scatchard analysis was performed as described by Cunningham et al. (1989). For 10 competitive binding studies, 1 ng of 125I-tracer toxin (rSMEZ, rSMES-2, rSPE-G, rSPE-H, rSEA, rSPE-C, or rTSST) was incubated with 0.0001 to 10 |ig of unlabeled toxin (rSMEZ, rSMES-2, rSPE-G, rSPE-H, rSEA, rSEB, rSPE-C, and rTSST) for lh. For SEB inhibition studies, 20 ng of 125I-rSEB was used as tracer and samples were incubated for 4h.

Results Identification and sequence analysis of superantigens.

The Oklahoma University Streptococcus pyogenes M1 genome database is accessible 20 via the internet and contains a collection of more than 300 DNA sequence contigs derived from a shot gun plasmid library of the complete S. pyogenes Ml genome. The currently available DNA sequences cover about 95% of the total genome. This database was searched with a highly conserved superantigen peptide sequence, using a search program that screens the DNA database for peptide sequences in all 25 6 possible reading frames. 8 significant matches and predicted the open reading frames (ORFs) were found by aligning translated DNA sequences to complete protein sequences of known SAgs.

Five matches gave complete ORFs with significant homology to streptococcal and 30 staphylococcal superantigens. Three of these ORFs correlate to SPE-C, SSA and the recently described SMEZ (Kamezawa et al. 1997), respectively. The remaining two ORFs could not be correlated to any known protein in the SwissProt and PIR databases. These novel putative superantigen genes were named spe-g and spe-h (see Figs 3 and 4). One ORF could not be generated completely due to its location 35 close to the end of a contig. The DNA sequence of the missing 5'-end is located on 19 another contig, and individual contigs have yet to be be assembled in the database. However, the available sequence shows an ORF for the 137 COOH-terminal amino acid residues of a putative novel superantigen which could not be found in the existing protein databases. This gene was named spe-j (see Fig. 5).

In two cases a complete ORF could not be defined due to several out-of-frame mutations. Although DNA sequencing errors on the unedited DNA sequences cannot be completely ruled out, the high frequency of inserts and deletions probably represent natural mutation events on pseudogenes, which are no longer used.

To produce recombinant proteins of SMEZ, SPE-G and SPE-H, individual genes (coding for the mature toxins without leader sequence) were amplified by PCR, and subcloned for DNA sequencing. Both, Str pyogenes Ml and Str. pyogenes 2035 genomic DNA were used and individual toxin gene sequences compared between the 15 two strains. The spe-h gene was isolated from Ml strain, but could not be amplified from strain 2035 genomic DNA suggesting a restricted strain specificity for this toxin. The spe-g gene was cloned from both Ml and 2035, and DNA sequence analysis of both genes showed no differences. The full length smez gene was isolated from both strains, but DNA sequence comparison revealed some striking 20 differences. The smez gene of strain 2035 showed nucleotide changes in 36 positions (or 5%) compared to smez from strain Ml (Fig. 1). The deduced protein sequences differed in 17 amino acid residues (or 8.1%). This difference was sufficient to indicate a new gene. This gene was named smez-2, because it is 95% homologous to smez (see Fig. 2).

The most significant difference between SMEZ and SMEZ-2 is an exchanged pentapeptide sequence at position 96-100, where the EEPMS sequence of SMEZ is converted to KTSIL in SMEZ2 (Fig. 1). A second cluster is at position 111-112, where an RR dipeptide is exchanged for GK in SMEZ-2. The remaining 10 different 30 residues are spread over almost the entire primary sequence.

A revised superantigen family tree, based on primary amino acid sequence homology now shows 3 general subfamilies; group A comprises SPE-C, SPE-J, SPE-G, SMEZ and SMEZ-2, group B comprises SEC 1-3, SEB, SSA, SPE-A and SEG and group C comprises SEA, SEE, SED, SEH and SEI. Two superantigens, TSST and SPE-H do not belong to any one of those subfamilies.

SMEZ, SMEZ-2, SPE-G and SPE-J are most closely related to SPE-C, increasing the 5 number of this subfamily from 2 to 5 members. SPE-G shows the highest protein sequence homology with SPE-C (38.4% identity and 46.6% similarity). The homology of SPE-J to SPE-C is even more significant (56% identity and 62% similarity), but this comparison is only preliminaiy due to the missing NH2-terminal sequence. SMEZ shows 30.9% / 40.7% homology to SPE-C and SMEZ-2 is 92% / 10 93% homologous to SMEZ.

SPE-H builds a new branch in the family tree and is most closely related to SED, showing 25% identity and 37.3% similarity.

Multiple alignment of SAg protein sequences (Fig. 1) shows that similarities are clustered within structure determining regions, represented by a4, a5, (34 and p5 regions. This applies to all toxins of the superantigen family (data not shown) and explains why superantigens like SPE-C and SEA have very similar overall structures despite their rather low sequence identity of 24.4 %.

Although SPE-H is less related to SPE-C it shows 2 common features with the "SPE-C subfamily": (I) a truncated NH2-terminus, lacking the al region and (II) a primary zinc binding motif (H-X-D) at the C-terminus (Fig. 1). It has been shown for several superantigens that this motif is involved in a zinc coordinated binding to the p-chain 25 of HLA-DR1.

Fusion proteins of GST-SMEZ, GST-SMEZ-2 and GST-SPE-H were completely soluble and gave yields of about 30 mg per liter. The GST-SPE-G fusion was insoluble when grown at 37° C, but mostly soluble when expressed in cells growing 30 at 28° C. Although soluble GST-SPE-G yields were 20-30 mg per liter, solubility decreased after cleavage of the fusion protein with trypsin. Soluble rSPE-G was achieved by diluting the GST-SPE-G to less than 0.2 mg/ml prior to cleavage. After cation exchange chromatography, purified rSPE-G could be stored at about 0.4 mg/ml.

Recombinant SMEZ could not be separated from GST by ion exchange chromatography. Isoelectric focusing revealed that the isoelectric points of the two proteins are too similar to allow separation (data not shown). Therefore, rSMEZ was released from GST by cleaving with trypsin while still bound to the GSH agarose 5 column. Recombinant SMEZ was collected with the flow through.

The purified recombinant toxins were applied to SDS-PAGE and isoelectric focusing (Fig. 6). Each toxin ran as a single band on the SDS PAA gel confirming their purity and their calculated molecular weights of 24.33 (SMEZ), 24.15 (SMEZ-2), 24.63 10 (SPE-G) and 23.63 (SPE-H) (Fig. 6A). The isoelectric focusing gel (Fig. 6B) shows a significant difference between rSMEZ and rSMEZ-2. Like most other staphylococcal and streptococcal toxins, rSMEZ-2 possesses a slightly basic isoelectric point at pH 7-8, but rSMEZ is acidic with an IEP at pH 6-6.5.

T cell proliferation and. VfS specificity To ensure the native conformation of the purified recombinant toxins, a standard [3H]thymidine incorporation assay was performed to test for their potency to stimulate peripheral blood lymphocytes (PBLs). All toxins were active on human T cells (Fig. 7). Recombinant SEA, rSEB, rSPE-C and rTSST were included as 20 reference proteins. The mitogenic potency of these toxins was lower than described previously, but is regarded as a more accurate figure. In previous studies, a higher starting concentration of toxin (100 ng/ml) was used and tips were not changed in between dilutions. This led to significant carryover across the whole dilution range. On this occasion, the starting concentration was 10 ng/ml and tips were changed in 25 between dilutions preventing any carryover.

The half maximal response for rSPE-G and rSPE-H was 2 pg/ml and 50 pg/ml, respectively. No activity was detected at less than 0.02 pg/ml and 0.1 pg/ml, respectively. Both toxins are therefore less potent than rSPE-C. Recombinant SMEZ 30 was similar in potency to rSPE-C, with a Pso% value of 0.08 pg/ml and no detectable proliferation at less than 0.5 fg/ml. Recombinant SMEZ-2 showed the strongest mitogenic potency of all toxins tested or, as far as can be determined, described elsewhere. The Pso% value was determined at 0.02 pg/ml and rSMEZ-2 was still active at less than 0.1 pg/ml. All Pso% values are summarized in Table 1. 22 TABLE 1 POTENCY OF RECOMBINANT TOXINS ON HUMAN AND MOUSE T CELLS.

PROLIFERATION POTENTIAL Pso% [pg/ml] TOXIN HUMAN SJL B10.M B10/J C3H BALB/C SEA 0.1 12 1.8 19 1000 SEE 0.2 12 1.5 50 SEB 0.8 7000 80,000 5000 ,000 1000 TSST 0.2 1000 1.2 100 SPE-C 0.1 >100,000 >100,000 >100,000 >100,000 >100,000 SMEZ 0.08 80 80 100 9000 200 SMEZ-2 0.02 100 800 18 SPE-G 2 >100,000 >100,000 >100,000 >100,000 >100,000 SPE-H 50 800 5000 100 1000 Human PBLs and mouse T cells were stimulated with varying amounts of recombinant toxin. The Pso% value 5 reflects the concentration of recombinant toxin required to induce 50% maximal cell proliferation. No proliferation was detected for rSPE-C and rSPE-G at any concentration tested on murine T cells. 23 Murine T cells from 5 different mouse strains were tested for their mitogenic response to rSMEZ, rSMEZ-2, rSPE-G and rSPE-H (Table 1). Recombinant SPE-G showed no activity against any of the mouse strains tested. Recombinant SPE-H, rSMEZ and rSMEZ-2 showed varied potency depending on the individual mouse 5 strain. For example, rSMEZ-2 was 500-fold more potent than rSPE-H in the BIO/J strain, while rSPE-H was 7.5-fold more active than rSMEZ-2 in the SJL strain.

The most consistently potent toxiii on murine T cells was rSMEZ-2 with Pso% values of 10 pg/ml in B10/J and 800 pg/ml in C3H. Recombinant SMEZ varied between 80 10 pg/ml in SJL and B10.M and 9000 pg/ml in C3H. The Pso% value for rSPE-H was between 15 pg/ml in SJL and 5000 pg/ml in B10/J. 24 TABLE 2 VP SPECIFICITY OF RECOMBINANT TOXINS ON HUMAN PBLS.

PERCENT Vp ENRICHMENT vp Resting SMEZ SMEZ-2 SPE-G SPE-H 1.1 0.2 0.3 0.4 1.2 1 2.1 0.4 8.4 1 17.9 8.6 3.2 4.8 3.1 2.5 3 2.4 4.1 3.5 24.8 14.4 11.2 .2 .1 6.2 1.4 2.5 .7 2.2 .3 .6 2.2 4.1 4.7 4.1 6.3 3 0.8 2.3 4.7 3.5 6.4 .4 2.1 .9 9.6 .6 6.9 6.9 3.5 9.3 19.1 12.2 7.3 3.5 .3 7.3 3.2 12.6 7.4 9 13.5 11.7 2.9 6.3 8.1 8.7 .7 36 4.5 2.4 9.1 0.3 0.05 0 1.2 2.3 12.3 0.8 1.6 2 3.2 2.6 12.5 3 1.2 2 3 2.3 .1 0.6 0.5 0.7 1.2 0.8 23.1 0.2 0.1 0.3 0.8 1 total 62.1 99.7 102.8 97.1 75.2 Human PBLs were incubated with 20 pg/ml of recombinant toxin for <ld. Relative enrichment of Vp cDNAs was analyzed from RNA of stimulated and rcting PBLs by anchored primer PCR and reverse dot blot to a panel of 17 5 different Vp cDNAs.

The values representing the highest Vp enrichment are underlined.

The human TcR VJ3 specificity of the recombinant toxins was determined by multiprimer anchored PCR and dot blot analysis using a panel of 17 human Vp DNA regions. The VP enrichment after stimulation with toxin was compared to the VP profile of unstimulated PBLs (Table 2). The sum total of all VPs stimulated by 5 rSMEZ, rSMEZ-2 and rSPE-G was close to 100 % suggesting that the Vps used in the panel represent all the targeted VPs. On the other hand, the total of the Vps stimulated by rSPE-H was only 75%. It is therefore likely that rSPE-H also stimulated some less common VPs, which are not represented in the panel. The most dramatic response was seen with all toxins, except rSMEZ2, on VP2.1 bearing 10 T cells (21-fold for rSMEZ, 45-fold for rSPE-G and 22-fold for rSPE-H). In contrast, rSMEZ2 gave only a 2.5-fold increase of VP2.1 T-cells. SPE-G also targeted Vp4.1, Vp6.9, Vp9.1 and Vpi2.3 (3-4 fold). A moderate enrichment of Vpi2.6, VP9.1 and Vp23.1 (4-8 fold) was observed with rSPE-H. Both, rSMEZ and rSMEZ2, targeted VP4.1 and Vp8.1 with similiar efficiency (3-7-fold). This finding is of particular 15 interest, because VP8.1 activity had been found in some, but not all Str. pyogenes culture supematants and in crude preparations of SPE-A and SPE-C. Moreover, SPE-B has often been claimed to have Vp8 specific activity, but has since been shown to be a contaminant previously called SpeX. The ability of rSMEZ and rSMEZ-2 to stimulate the VP8.1 Jurkat cell line was tested (Fig. 8) Recombinant 20 SMEZ was less potent than the control toxin (rSEE), showing a half maximal response of 0.2 ng/ml, compared to 0.08 ng/ml with rSEE, but rSMEZ-2 was more potent than rSEE (0.02 ng/ml). No proliferation activity was observed with the negative control toxin rSEA.

MHC class II binding To determine if there were significant structural differences, the protein structures of SMEZ-2, SPE-G and SPE-H were modelled onto the superimposed structurally conserved regions of SEA, SEB and SPE-C. The models showed that in all three proteins, the 2 amino acid side chains of the COOH-terminal primary zinc binding 30 motif are in close proximity to a third potential zinc ligand to build a zinc binding site, similar to the zinc binding site observed in SEA and SPE-C.

The zinc binding residues in SPE-C are H167, H201, D203, and it is thought that H81 from the HLA-DR1 p-chain binds to the same zinc cation to form a regular 35 tetrahedral complex. The two ligands of the primary zinc binding motif, H201 and 26 D203, are located on the p 12 strand, which is part of the p-grasp motif, a common structural domain of superantigens. The third ligand, H167, comes from the piO strand (Roussel et al. 1997).

In the model of SPE-G three potential zinc binding ligands (H167, H202 and D204) are located at corresponding positions. In the SMEZ-2 and the SPE-H models, the two corresponding p 12 residues are H202, D204 and H198, D200, respectively. The third ligand in SPE-H (D160) and in SMEZ-2 (H162) comes from the P9 strand and is most similar to H187 in SEA. It has been shown from crystal structures that H167 10 of SPE-C and H187 of SEA are spatially and geometrically equivalent sites (Scad et al. 1997, Embo J 14 no 14:3292-301; Roussel et al. 1997).

All superantigens examined so far, except SPE-C, bind to a conserved motif in the MHC class II a 1-domain. In SEB and TSST, hydrophobic residues on the loop 15 between the pi and P2 strand project into a hydrophobic depression in the MHCII al-domain. This loop region has changed its character in SPE-C, where the hydrophobic residues ( F44, L45, Y46 and F47 in SEB) are substituted by the less hydrophobic residues T33, T34 and H35. A comparison of this region on the computer generated models revealed that the generic HLA-DR1 a-chain binding site 20 might also be missing. As the loop regions are generated by random choice, no conclusions can be drawn from their conformation in the models. However, in none of the three models does the pi-p2-loop have the required hydrophobic features observed in SEB and TSST Swaminathan, S. et al., Nature 359, No. 6398:801-6 (1992), Achaiya et al., Nature 367, No. 6458: 94-7 (1994). The residues are 125, D26, 25 F27, K28, T29 and S30 in SMEZ-2, T31, T32, N33, S34 in SPE-G and K28, N29, S30, P31, D32, 133, V34 and T35 in SPE-H.

SMEZ-2 differs from SMEZ in only 17 amino acids. In the model of SMEZ-2 with the position of those 17 residues, most of the exchanges are located on loop regions, 30 most significantly on the P5-P6 loop with 5 consecutive residues replaced. The potential zinc binding site and the pi-p2 loop are not affected by the replaced amino acids.

The TcR Vp specificity differs between SMEZ and SMEZ-2 by one Vp. SMEZ strongly 35 stimulates VP2 T cells, but SMEZ-2 does not (Table 2). One or more of the 17 WO 00/39159 PCT/NZ99/00228 27 exchanged residues in SMEZ/SMEZ-2 may therefore be directly involved in TcR binding. The exact position of the TcR binding site can not be predicted from the model as several regions have been implicated in TcR binding for different toxins. Crystal structures of SEC2 and SEC3, complexed with a TcR P-chain indicated the 5 direct role of several residues located on a2, the P2-P3 loop, the P4-P5 loop and a4 (Fields et al. 1996 Nature 384 no 6605:188-92). On the other hand, binding of TSST to the TcR involves residues from a4, the p7-p8 loop and the a4-P9 loop (Acharya et al. 1994, Nature 367 no 6548:94-7). The SMEZ-2 model shows 3 residues, which may contribute to TcR binding. In SMEZ, Lys is exchanged for Glu at position 80 10 and Thr is exchanged for lie at position 84, both on the P4-P5 loop. On the COOH-terminal end of the a4 helix, Ala is replaced by Ser at position 143.

The results from the computer modelled protein structures suggest that all 4 toxins, SMEZ, SMEZ-2, SPE-G and SPE-H, might bind to the HLA-DR1 p-chain in a zinc 15 dependent fashion, similar to SEA and SPE-C, but might not be able to interact with the HLA-DR1 a-site, a situation that has so far only been observed with SPE-C (Roussel et al. 1997; Li et al. 1997).

To find out whether or not zinc is required for binding of the toxins to MHC class II, 20 a binding assay was performed using human LG-2 cells (which are MHC class II expressing cells homozygous for HLA-DR1). Direct binding of 125I-labeled toxins was completely abolished in the presence of 1 mM EDTA (Fig. 9, Table 3). When 2 mM ZnCl2 was added, binding to the LG-2 cells could be restored completely. These results show that the toxins bind in a zinc dependent mode, most likely to the HLA-25 DR1 p-chain similar to SEA and SPE-C. However, it does yet not exclude the possibility of an additional binding to the HLA-DR1 a-chain. 28 TABLE 3 BINDING AFFINITIES AND ZINC DEPENDENCIES FOR SUPERANTIGENS TO HUMAN CLASS II TOXIN MHC CLASS II BINDING kd [nM] ZINC DEPENDENCY SEA 36/1000 ++ SEB 340 - TSST 130 - SPE-C 70 ++ SMEZ 65/1000 ++ SMEZ-2 /1000 ++ SPE-G 16/1000 ++ SPE-H 37/2000 ++ The binding affinities of the toxins to MHC class II were determined by Scatchard analysis using LG-2 cells. Zinc dependency was determined by binding of recombinant toxins to LG-2 cells in the presence and absence of 5 EDTA, as described in the Materials and Methods section.

The biphasic binding of SEA to HLA-DR1 can be deduced from Scatchard analysis. It shows that SEA possesses a high affinity binding site of 36 nM (which is the zinc dependent P-chain binding site) and a low affinity binding site of 1 p.M (a-chain 10 binding site). On the other hand, only one binding site for HLA-DR 1 was deduced from Scatchard analysis with SEB, TSST and SPE-C, respectively (Table 3).

Therefore, Scatchard analysis was performed with radiolabeled rSMEZ, rSMEZ-2, rSPE-G and rSPE-H using LG-2 cells. All four toxins showed multiphasic curves 15 with at least 2 binding sites on LG-2 cells, a high affinity site of 15-65 nM and a low affinity site of 1-2 (J.M (Fig. 10, Table 3). 29 In a further attempt to determine the orientation of the toxins on MHC class II competition binding experiments were performed. The recombinant toxins and reference toxins (rSEA, rSEB, rSPE-C and rTSST) were radiolabeled and tested with 5 excess of unlabeled toxin for binding to LG-2 cells. The results are summarized in Fig. 11. Both, rSEA and rSPE-C, inhibited binding of labeled rSMEZ, rSMEZ-2, rSPE-G and rSPE-H, respectively. However, rSPE-C only partially inhibited binding (50%) of the labeled rSMEZ-2 (Fig. 12). Recombinant SEB did not compete with any other toxin, even at the highest concentration tested. Recombinant TSST was only 10 slightly competitive against 12SI-labeled rSMEZ, rSMEZ-2 and rSPE-G, respectively, and did not inhibit rSPE-H binding at all.

Reciprocal competition experiments were performed. Recombinant SMEZ, rSMEZ-2 and rSPE-H prevented 125I-rSEA from binding to LG-2 cells. However, only partial 15 competition (50%) was observed even at the highest toxin concentrations (10,000 fold molar excess). Recombinant SPE-G did not prevent binding of 125I-rSEA and 125I-rTSST binding was only partially inhibited by rSMEZ, rSMEZ-2 and rSPE-H, but not by rSPE-G. Significantly, none of the toxins inhibited 125I-rSEB binding, even at the highest concentration tested.

In a further set of competition binding experiments, rSMEZ, rSMEZ-2, rSPE-G and rSPE-H were tested for competition against each other. Both, rSMEZ and rSMEZ-2 competed equally with each other and also prevented binding of labeled rSPE-G and rSPE-H. In contrast, rSPE-G and rSPE-H did not inhibit any other toxin binding 25 suggesting that these toxins had the most restricted subset of MHC class II molecules, which represent specific receptors.

SECTION B: GENOTYPING Genotyping of S.pyogenes isolates Purified genomic DNA from all Str. Pyogenes isolates was used for PCR with specific primers for the smez, spe-g and spe-h genes as described above and by Proft (1999). In addition, a primer pair specific to a DNA region encoding the 23S rRNA, oiigo 23rRNA forward (GCTATTTCGGAGAGAACCAG) and oligo 23rRNA reverse 35 (CTGAAACATCTAAGTAGCTG) was designed and used for PCR as a positive control.

Southern blot analysis About 5ug of genomic DNA was digested using restriction enzyme Hindlll (GIBCO) and loaded onto a 0.7% agarose gel. The DNA was transferred from the gel to a 5 Hybond-N+ nylon membrane (Amersham) as described by Maniatis (1989). A 640 bp DNA fragment of the smez-2 gene was radiolabeled using the RadPrime Labeling System (GIBCO) and a 32P-dCTP (NEN). The nylon blots were hybridized with the radiolabeled probe in 2x SSC, 0.5% SDS, 5x Denhards overnight at 65°C. After washing twice in 0.2x SSC, 0.1% SDS at 65°C the blots were analysed on a Storm 0 Phosphorlmager.

RESULTS PCR based genotyping was performed in order to determine the frequency of the 5 genes smez, spe-g and spe-h in streptococcal isolates (Table 4). The PCR primers for smez were designed to anneal with both genes, semz and smez-2. 103 isolates were collected between 1976 and 1998 from vaiying sites in patients with vaiying infections, although the majority were from sore throats. They comprised 94 group A Streptococcus (GAS) and 9 non-GAS, which were S. agalactiae (group B), S. equis 0 (group C) and Streptococcus spp (group C). There are 25 distinct M/emm types represented among the GAS isolates, 13 isolates are M non-typable (MNT) and in 2 cases the M type is unknown. The analysis was undertaken blinded to the details of each isolate and 2 duplicate isolates were included (95/31 and 4202) to demonstrate the reproducibility of the testing procedure. The isolates are listed in 2 5 groups. Group 1 contained isolates collected within a large time frame (1976 to 1996). Group 2 comprised of isolates collected within a short time (1998).

All of the 9 non-GAS isolates (belonging to groups B, C and G) were negative for the tested sag genes. The frequencies for smez, spe-g and spe-h within the GAS isolates 0 were 95.6%, 100% and 23.9% respectively. A correlation between a certain M/emm type and the presence of the spe-h gene could not be established. The deficiency in this current set was that only 5M/emm types were represented by more than one isolate. The most frequent serotype was M/emm 12 with 13 isolates, from which 7 were positive and 6 were negative for spe-h suggesting genetic diversity within the 31 M/emml2 strain. In contrast, all 12 tested NZ1437/M89 isolates were negative for spe-h.

The high frequencies of smez and spe-g is of particular interest as this has not been 5 described for any other streptococcal sag gene thus far. Other spe genes, like speA, speC and ssa are found at much lower frequencies and horizontal gene transfer might explain the varying frequencies of these genes in different strains. In contrast, both smez and spe-g were found in virtually all tested GAS isolates. Only 4 GAS isolates (11152, 11070, 94/229 and 11610) tested negative for smez. These 10 were PT2612, emm65, M49 and emm57. Southern hybridisation was performed to find out if the negative PCR results were due to lack of the smez gene or to lack/alteration of the primer binding site(s). Hindlll digested genomic DNA of selected streptococcal isolates was probed with a 640 bp radiolabeled smz-2 PCR fragment (Fig. 13). The smez gene is located on a 1953 bp Hindlll fragment of about 15 4kb (fragment B), but not to the SMEZ bearing fragment A (lanes 4, 6, 9, 10). In addition, the smez probe bound to a second DNA fragment of about 4.2 kb (fragment C) in isolate 11152 (lane 4). In the Ml reference strain (lane 1) and in isolate 4202 (lane 8) the smez probe also bound to fragment B, in addition to fragment A. Fragment B in the Ml strain contains a 180 bp region that shares 97% sequence 20 homology with the 3' end of the smez gene. These results suggest that the 4 PCR negative isolates possess a truncated smez gene or a smez-like sequence, but not a complete smez gene. 32 Table 4 Group 1: Isolates collected between 1976 and 1996 Strain No.

Group M/emm Site Disease Rib.DNA Spe-g Spe-h Smez Vp8 FP 1943 A M53 ts ST + + - + - FP 2658 A M59 ts ST + + - + - FP 4223 A M80 ts ST + + - + + FP 5417 A M41 ts ST + + - + + FP 5847 A Ml ts ST + + - + + FP 5971 A M57 ts ST + + + + - 1/5045 A M4 ts ST + + - + + 79/1575 A Ml ts Tcarriage + + + + + 81/3033 A M12 ts ST + + + + + 82/20 A M4 sk ulcer + + - + 82/532 A M12 ts ST + + + + + 82/675 A NZ1437 § ws wound + + - + + 84/141 A M12 ts ST + + + + 84/1733 A M4 ts ST + + - + + 84/781 A NZ1437§ ts ST + + - + + 85/1 A M12 ts ST + + - + + 85/167 A M12 ts ST + + + + + 85/314 A NZ1437 § ws wound + + - + 85/437 A M81 ws ii if eczema + + - + + 85/722 A n.d. ? ? + + - + - 86/435 A M4 ts RF + + - + + 87/169 A M12 ts ST + + + + + 87/19 A M12 ts ST + + + + + 87/781 A M12 ts ST + + - + + 88/627 A M12 sk wound + + - + - 89/22 A M12 ts fever + +• - + + 89/25 A M12 UT eiysipelas + + + + + 89/26 A Ml ts AGN + + - + + 89/54 A NZ1437 § ts ST + - + 90/306 A M5 ear otorrhoea + + - + 90/424 A M4 ts ST + + - + + 91/542 A M12 ts ST + + - + + 94/11 A NZ1437 § ps abscess + + - + + 94/229 A M49 hvs endometr. + + + - - 94/330 A M4 ts SF + + - + + 94/354 A M12 ts ST + + - + + 94/384 A M4 sk wound + + - + + 94/712 A NZ1437 § ws cellulitis + + - + + 95/127 A NZ1437§ be. cellulitis + + - + + 33 95/31 1 A NZ1437 § ws abscess + + - + + 95/31(2) 1 A NZ1437 § ws abscess + + - + + 95/361 A NZ1437 § ps abscess + + - + + 96/1 A n.d. ? ? + + - + + 96/364 A NZ1437 § be burns + + - + + 96/551 A M4 eye eye infect + + - + + 96/610 A M4 ts SF + + - + + D21 A Ml ts Tcarriage + + - + + RC4063 C - ts ST + - - - - SP9205 C - ts ST 4 - - - - NI6174 G - ts ST + - " - - N16192 B - ts ST + - " - - VC4141 G - ts ST + - - - " Group 2: Isolates collected in 1998 Strain No. student ID group M/emm site disease rib.DNA spe-g spe-h smez Vp8 4202 * 3310 A NZ5118II ts ST + + - + . + 4202(2) 3310 A NZ5118n ts ST + + - •f + 9606 2252 A MNT ts ST + + - + - 9639 2184 A MNT ts ST + + + + + 9779 3230 A cmm56 ts ST + + ■ + + 9893 6144 A FT 180 ts ST + + + + 9894 6564 A emm59 ts ST + + - + + 10019 6264 A emm44 ts ST + + + + - 10028 9366 A emm41 ts ST + + - + + 10134 1880 A ST4547 ts ST + + - + - 10303 3564 A emm59 ts ST + + ■ + - 10307 4850 A NZ5118n ts ST + + - + + 10438 4904 A ST3018 ts ST + + - + + 10463 TSP A emm49 ts ST + + - + - 10649 11510 A ST2267 ts ST + + ■- + + 10730 11503 A MNT ts ST + + - + - 10742 3374 A ST809 ts ST + + - + + 10761 3254 A MNT ts ST + + - + - 10763 6614 FT 3875 ts ST + + + 1078 2 4850 A MNT ts ST + + + + + 10791 10290 A MNT ts ST + + + + + 10792 10308 A MNT ts ST + + + + - 10846 8854 A NZ1437 § ts ST + + - + + 34 10902 6264 A NZ5118n ts ST + + - + + 10989 5194 A PT2841 ts ST + + - + - 11070 1434 A emm65 ts ST + + + - - 11072 1880 A ST4547 ts ST + + - + - 11083 4538 A MNT ts ST + + - + - 11093 9791 A MNT ts ST + + + + + 11152 2030 A FT2612 ts ST + + + - - 11222 4928 A NZ5118I1 ts ST + + + + + 11227 8854 A emml4 ts ST + - + - 11244 2252 A ST4547 ts ST + + - + - 11276 4524 A MNT ts ST + + - + - 11299 2950 A emm80 ts ST + + - + + 11574 3186 A ST809 ts ST + + - + + 11580 3280 A emmo3 ts ST + + - + - 11610 2424 A <nniiKi7 ts ST + + + - - 11646 1880 A ST4547 ts ST + + - + - 11681 3564 A emml2 ts ST + + - + + 11686 5528 A PT5757 ts ST + + - + + 11745 12397 A emm59 ts ST + + - + - 11789 1568 A MNT ts ST + + - + - 11802 3266 A MNT ts ST + + - + - 11869 2950 A ST4547 ts ST + + - + - 11961 4916 A MNT ts ST + + - + - 12015 12373 A emm59 ts ST + + + + - 7625 8215 B - ts ST + - - - - 8011 3238 B - ts ST + - - - - 10388 1653 G - ts ST + - - - - O12633 5395 B - ts ST + - - - - Table 4: Genotyping of streptococcal isolates. The isolates were collected between 1976 and 1996 (group 1) and in 1998 (group 2) from patients with varying diseases. The results are based on PCR analysis using purified genomic DNA and specific 5 primers for each of the sag genes.

The non Gas are: B, S. agalactiae; C, S. equis\ G, Streptococcus spp.

MNT, M non typable: ts, throat site; ws, wound site; sk, skin; ps, pus site; hvs, high vaginal site; be, blood culture; ST, sore throat; SF, scarlet fever; RF, rheumatic 10 fever; AGN, acture glomerulonephritis; T carriage, throat carriage.

M1§43 * and j, duplicate isolates;!, recently assigned as M89; n, recently assigned as M92. INDUSTRIAL APPLICATION The superantigens of the invention, polynucleotides which encode them and antibodies which bind them have numerous applications. A number of these are discussed above (including Streptococci subtyping, diagnostic applications and therapeutic applications) but it will be appreciated that these are but examples. Other applications will present themselves to those skilled in the art and are in no way excluded from the scope of the invention.

It will also be appreciated that the foregoing examples are illustrations of the invention. The invention may be carried out with the numerous variations and modifications as will be apparent to those skilled in the art. For example, a native superantigen may be replaced by a synthetic superantigen with on or more deletions, insertions and/or substitutions relative to the corresponding natural superantigen, provided that the superantigen activity is retained. Likewise there are many variations in the way in which the invention can be used in other aspects of it.

Unless the context clearly requires otherwise, throughout the description and the claims, the words "comprise", "comprising", and the like, are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense, that is to say, in the sense of "including, but not limited to".

The reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that that prior art forms part of the common general knowledge in the field of endeavour to which the invention relates.

REFERENCES Marrack, P., and J. Kappler. 1990. The staphylococcal enterotoxins and their relatives. Science 248:705-711.

Huber, B.T., P.N. Hsu, and N. Sutkowski. 1996. Virus-encoded superantigens. Microbiol. Rev. 60, no. 3:473-82.

Alouf, J.E., H. Knoell, and W. Koehler. 1991. The family of mitogenic, shock-inducing and superantigenic toxins from staphylococci and streptococci. Sourcebook of bacterial protein toxins., eds. J.E. Alouf and J.H. Freer. Academic Press, San Diego. 367-414 pp 36 Betley, M. J., D.W. Borst, and L.B. Regassa. 1992. Staphylococcal enterotoxins, toxic shock syndrome toxin and streptococcal exotoxins: a comparative study of their molecular biology. Chem. Immunol. 55:1-35.

Ren, K., J.D. Bannan, V. Pancholi, A.L. Cheung, J.C. Robbins, V.A. Fischetti, and J.B. Zabriskie. 1994. Characterization and biological properties of a new staphylococcal exotoxin. J. Exp. Med. 180, no. 5:1675-83.

Munson, S.H., M.T. Tremaine, M.J. Betley, and R.A. Welch. 1998. Identification and 10 Characterization Of Staphylococcal Enterotoxin Types G and I From Staphylococcus Aureus. Infect. Immun. 66, no. 7:3337-3348.

Herman, A., J.W. Kappler, P. Marrack, and A.M. Pullen. 1991. Superantigens: mechanism of T-cell stimulation and role in immune responses. Annu. Rev. Immunol. 15 9:745-772.

Janeway, C.J., J. Yagi, P.J. Conrad, M.E. Katz, B. Jones, S. Vroegop, and S. Buxser. 1989. T-cell responses to Mis and to bacterial proteins that mimic its behavior. Immunol. Rev. 107:61-68.

Fast, D.J., P.M. Schlievert, and R.D. Nelson. 1989. Toxic shock syndrome-associated staphylococcal and streptococcal pyrogenic toxins are potent inducers of tumor necrosis factor production. Infect. Immun. 57, no. 1:291-4.

Kotzin, B.L., D.Y. Leung, J. Kappler, and P. Marrack. 1993. Superantigens and their potential role in human disease. Adv. Immunol. 54, no. 99:99-166.

Bohach, G.A., D.J. Fast, R.D. Nelson, and P.M. Schlievert. 1990. Staphylococcal and streptococcal pyrogenic toxins involved in toxic shock syndrome and related 30 illnesses. Crit. Rev. Microbiol. 17, no. 4:251-72.

Weeks, C.R., and J.J. Ferretti. 1986. Nucleotide Sequence of the Type A Streptococcal Exotoxin (Eiythrogenic Toxin) Gene from Streptococcus pyogenes Bacteriophage T12. Infect. Immun. 52:144-150. 37 Goshom, S.C., G.A. Bohach, and P.M. Schlievert. 1988. Cloning and characterization of the gene, speC, for pyrogenic exotoxin type C from Streptococcus pyogenes. Mol. Gen. Genet 212, no. 1:66-70.

Mollick, J.A., G.G. Miller, J.M. Musser, R.G. Cook, D. Grossman, and R.R. Rich. 1993. A novel superantigen isolated from pathogenic strains of Streptococcus pyogenes with aminoterxninal homology to staphylococcal enterotoxins B and C. J. Clin Invest. 92, no. 2:710-9.

Van Den Busche, R.A., J.D. Lyon, and G.A. Bohach. 1993. Molecular evolution of the staphylococcal and streptococcal pyrogenic toxin gene family. Mol. Phylogenet Evol. 2:281-292.

Dellabona, P., J. Peccoud, J. Kappler, P. Marrack, C. Benoist, and D. Mathis. 1990. 15 Superantigens interact with MHC class II molecules outside of the antigen groove. Cell 62, no. 6:1115-21.

Fraser, J.D. 1989. High-affinity binding of staphylococcal enterotoxins A and B to HLA-DR. Nature 339, no. 6221:221-3.

Fleischer, B., and H. Schrezenmeier. 1988. T cell stimulation by staphylococcal enterotoxins. Clonally variable response and requirement for major histocompatibility complex class II molecules on accessory or target cells. J. Exp. Med, 167, no. 5:1697-707.

Mollick, J.A., R.G. Cook, and R.R. Rich. 1989. Class II MHC molecules are specific receptors for staphylococcus enterotoxin A. Science 244, no. 4906:817-20.

Schad, E.M., I. Zaitseva, V.N. Zaitsev, M. Dohlsten, T. Kalland, P.M. Schlievert, D.H. 30 Ohlendorf, and L.A. Svensson. 1995. Crystal structure of the superantigen staphylococcal enterotoxin type A. EMBOJ. 14, no. 14:3292-301.

Swaminathan, S., W. Furey, J. Pletcher, and M. Sax. 1992. Crystal structure of staphylococcal enterotoxin B, a superantigen. Nature 359, no. 6398:801-6. 38 Papageorgiou, A.C., K.R. Achaiya, R. Shapiro, E.F. Passalacqua, R.D. Brehm, and H.S. Tranter. 1995. Crystal structure of the superantigen enterotoxin C2 from Staphylococcus aureus reveals a zinc-binding site. Structure 3, no. 8:769-79.

Sundstrom, M., L. Abrahmsen, P. Antonsson, K. Mehindate, W. Mourad, and M. Dohlsten. 1996. The crystal structure of staphylococcal enterotoxin type D reveals Zn2+-mediated homodimerization. EMBOJ. 15, no. 24:6832-40.

Achaiya, K.R., E.F. Passalacqua, E.Y. Jones, K. Harlos, D.I. Stuart, R.D. Brehm, and 10 H.S. Tranter. 1994. Structural basis of superantigen action inferred from crystal structure of toxic-shock syndrome toxin-1. Nature 367, no. 6458:94-7.

Roussel, A., B.F. Anderson, H.M. Baker, J.D. Fraser, and E.N. Baker. 1997. Crystal structure of the streptococcal superantigen SPE-C: dimerization and zinc binding 15 suggest a novel mode of interaction with MHC class II molecules. Nat Struct Biol. 4, no. 8:635-43.

Kim, J., R.G. Urban, J.L. Strominger, and D.C. Wiley. 1994. Toxic shock syndrome toxin-1 complexed with a class II major histocompatibility molecule HLA-DR 1. 20 Science 266, no. 5192:1870-4.

Hurley, J.M., R. Shimonkevitz, A. Hanagan, K. Enney, E. Boen, S. Malmstrom, B.L. Kotzin, and M. Matsumura. 1995. Identification of class II major histocompatibility complex and T cell receptor binding sites in the superantigen toxic shock syndrome 25 toxin 1. J. Exp. Med. 181, no. 6:2229-35.

Seth, A., L.J. Stern, T.H. Ottenhoff, I. Engel, M.J. Owen, J.R. Lamb, R.D. Klausner, and D.C. Wiley. 1994. Binaiy and ternary complexes between T-cell receptor, class II MHC and superantigen in vitro. Source (Bibliographic Citation): Nature 369, no. 30 6478:324-7.

Li, P.L., R.E. Tiedemann, S.L. Moffat, and J.D. Fraser. 1997. The superantigen streptococcal pyrogenic exotoxin C (SPE-C) exhibits a novel mode of action. J. Exp. Med. 186, no. 3:375-83. 39 Hudson, K.R., R.E. Tiedemann, R.G. Urban, S.C. Lowe, J.L. Strominger, and J.D. Fraser. 1995. Staphylococcal enterotoxin A has two cooperative binding sites on major histocompatibility complex class II. J. Exp. Med. 182, no. 3:711-20.

Kozono, H., D. Parker, J. White, P. Marrack, and J. Kappler. 1995. Multiple binding sites for bacterial superantigens on soluble class II MHC molecules. Immunity 3, no. 2:187-96.

Tiedemann, R.E., and J.D. Fraser. 1996. Cross-linking of MHC class II molecules by 10 staphylococcal enterotoxin A is essential for antigen-presenting cell and T cell activation. J. Immunol. 157, no. 9:3958-66.

Braun, M.A., D. Gerlach, U.F. Hartwig, J.H. Ozegowski, F. Romagne, S. Carrel, W. Kohler, and B. Fleischer. 1993. Stimulation of human T cells by streptococcal 15 "superantigen" eiythrogenic toxins (scarlet fever toxins). J. Immunol. 150, no. 6:2457-66.

Kline, J.B., and C.M. Collins. 1997. Analysis of the interaction between the bacterial superantigen streptococcal pyrogenic exotoxin A (SpeA) and the human T-cell 20 receptor. Mol. Microbiol. 24, no. 1:191-202.

Fleischer, B., A. Necker, C. Leget, B. Malissen, and F. Romagne. 1996. Reactivity of mouse T-cell hybridomas expressing human Vbeta gene segments with staphylococcal and streptococcal superantigens. Infect Immun. 64, no. 3:987-94.

Toyosaki, T., T. Yoshioka, Y. Tsuruta, T. Yutsudo, M. Iwasaki, and R. Suzuki. 1996. Definition of the mitogenic factor (MF) as a novel streptococcal superantigen that is different from streptococcal pyrogenic exotoxins A, B, and C. Eur. J. Immunol. 26, no. 11:2693-701.

Kamezawa, Y., T. Nakahara, S. Nakano, Y. Abe, J. Nozaki-Renard, and T. Isono. c 1997. Streptococcal mitogenic exotoxin Z, a novel acidic superantigenic toxin produced by a T1 strain of Streptococcus pyogenes. Infect. Immun. 65, no. 9:3828-33. 40 Hudson, K.R., H. Robinson, and J.D. Fraser. 1993. Two adjacent residues in Staphylococcal enterotoxins A an E determine Tcell receptor V beta specificity. J. Exp. Med. 177:175-185.

Kraulis, P.J. 1991. MOLSCRIPT": a program to produce both detailed and schematic plots of protein structures. J. Appl. Critallography 24:946-950.

Cunningham, B.C., P. Jhurani, P. Ng, and J.A. Wells. 1989. Receptor and Antibody epitopes in human growth hormone identified by homologue scanning mutagenesis. 10 Science 243:1330-1336.

Fields, B.A., E.L. Malchiodi, H. Li, X. Ysern, C.V. StaufFacher, P.M. Schlievert, K. Kaijalainen, and R.A. Mariuzza. 1996. Crystal structure of a T-cell receptor beta-chain complexed with a superantigen [see comments]. Nature 384, no. 6605:188-92.

Wen, R., G.A. Cole, S. Surman, M.A. Blackman, and D.L. Woodland. 1996. Major histocompatibility complex class II-associated peptides control the presentation of bacterial superantigens to T cells. J. Exp. Med. 183, no. 3:1083-92.

Thibodeau, J., I. Cloutier, P.M. Lavoie, N. Labrecque, W. Mourad, T. Jardetzky, and R.P. Sekaly. 1994. Subsets of HLA-DRl molecules defined by SEB and TSST-1 binding. Science 266, no. 5192:1874-8.

Abe, J., B.L. Kotzin, K. Jujo, M.E. Melish, M.P. Glode, T. Kohsaka, and D.Y. Leung. 25 1992. Selective expansion of T cells expressing T-cell receptor variable regions V beta 2 and V beta 8 in Kawasaki disease. PNAS 89, no. 9:4066-70.

Kawasaki, T. 1967. Acute febrile mucocutaneous syndrome with lymphoid involvement with specific desquamation of the fingers and toes in children. Jpn. J. 30 Allergol. 16:178.

Leung, D.Y., R.C. Giomo, L.V. Kazemi, P.A. Flynn, and J.B. Busse. 1995. Evidence for superantigen involvement in cardiovascular injuiy due to Kawasaki syndrome. J. Immunol 155, no. 10:5018-21. 41 Cockerill, F.R., R.L. Thompson, J.M. Musser, P.M. Schlievert, J. Talbot, K.E. Holley, W.S. Harmsen, D.M. Ilstrup, P.C. Kohner, M.H. Kim, B. Frankfort, J.M. Manahan, J.M. Steckelberg, F. Roberson, and W.R. Wilson. 1998. Molecular, Serological, and Clinical Features Of 16 Consecutive Cases Of Invasive Streptococcal Disease. Clin. 5 Infect. Dis. 26, no. 6:1448-1458.

Kapur, V., K.B. Reda, L.L. Li, L.J. Ho, R.R. Rich, and J.M. Musser. 1994. Characterization and distribution of insertion sequence IS 1239 in Streptococcus pyogenes. Gene 150, no. 1:135-40.

T. Proft, S.L. Moffatt, C.J. Berkahn, and J.D. Fraser (1999). Identification and characterisation of novel superantigens from Streptoccocus pyogenes. Journal of Experimental Medicine 189, No. 1:89-102.

T. Maniatis, E.F. Fritsch, and J. Sambrook. (1989). Molecular cloning: a laboratory manual. Cold Spring Harbour Laboratoiy, Cold Spring Harbour, NY, USA.

B.A. Roe, S.P. Linn, L. Song, X. Yuan, S. Clifton, M. McShan and J. Ferretti, (1999). Str. Pyogenes Ml genome sequencing project at Oklahoma University. Web: http: / /www.genome. ou.edu.

Claims (39)

42 What we claim is: | § ^4j I|>

1. A superantigen selected from any one of SMEZ-2, SPE-G, SPE-H and SPE-J, or a functionally equivalent variant thereof.

2. A superantigen which is SMEZ-2 and which has an amino acid sequence of SEQ ID NO. 2, or a functionally equivalent variant thereof.

3. A superantigen which is SPE-G and which has an amino acid sequence of SEQ ID NO. 4, or a functionally equivalent variant thereof.

4. A superantigen which is SPE-H and which has an amino acid sequence of SEQ ID NO. 6, or a functionally equivalent variant thereof.

5. A superantigen which is SPE-J and which has an amino acid sequence which includes SEQ ID NO. 8, or a functionally equivalent variant thereof.

6. A polynucleotide comprising a nucleotide sequence encoding SMEZ-2 or a variant thereof as claimed in claim 2.

7. A polynucleotide according to claim 6 in which said nucleotide sequence is or includes SEQ ID NO. 1.

8. A polynucleotide comprising a nucleotide sequence encoding SPE-G or a variant thereof as claimed in claim 3.

9. A polynucleotide according to claim 8 in which said nucleotide sequence is or includes SEQ ID NO. 3.

10. A polynucleotide comprising a nucleotide sequence encoding SPE-H or a variant thereof as claimed in claim 4.

11. A polynucleotide according to claim 10 in which said nucleotide sequence is or includes SEQ ID NO 5.

12. A polynucleotide comprising a nucleotide sequence encoding SPE-J or a variant thereof as claimed in claim 5. INTELLECTUAL PROPERTY OFRCE OF N.Z 2 * FES 2003 RECEIVED 43 R1 1 Q I, 1 J 1 | •?

13. A polynucleotide according to claim 12 in which said nucleotide sequence includes SEQ ID NO. 7.

14. A method of subtyping Streptococci which includes the step of detecting the presence or absence of a superantigen as claimed in any one of claims 2 to 5.

15. A method of subtyping Streptococci which includes the step of detecting the presence or absence of a polynucleotide as claimed in any one of claims 6 to 13.

16. A construct which comprises a superantigen or variant thereof as claimed in any one of claims 2 to 5 and a cell-targeting molecule.

17. A construct according to claim 15 in which said cell-targeting molecule specifically binds a tumour cell.

18. A construct according to claim 15 or claim 16 in which said cell-targeting molecule is an antibody.

19. A pharmaceutical composition which includes a construct as claimed in any one of claims 15 to 17.

20. An antibody which binds superantigen SMEZ-2 as claimed in claim 2.

21. An antibody which binds superantigen SPE-G as claimed in claim 3.

22. An antibody which binds superantigen SPE-H as claimed in claim 4.

23. An antibody which binds superantigen SPE-J as claimed in claim 5.

24. A kit which includes an antibody as claimed in any one of claims 19 to 22.

25. A nucleic acid molecule which hybridises under stringent conditions to a polynucleotide of claim 7.

26. A nucleic acid molecule which hybridises under stringent conditions to a polynucleotide of claim 9. 2 4 FEB 2003 _Received

27. A nucleic acid molecule which hybridises under stringent conditions to a polynucleotide of claim 11. \

28. A nucleic acid molecule which hybridises under stringent conditions to a polynucleotide of claim 13.

29. A kit which includes a nucleic acid molecule as claimed in any one of claims 25 to 28.

30. A method of diagnosing a disease which is caused or mediated by expression of a superantigen as claimed in claim 1 which includes the step of detecting the presence of said superantigen using an antibody as claimed in any one of claims 19 to 22, or detecting the presence of a polynucleotide encoding said superantigen using a nucleic acid molecule as claimed in any one of claims 25 to 28, and wherein the method excludes in vivo diagnosis.

31. A superantigen selected from any one of SMEZ-2, SPE-G, SPE-H or SPE-J substantially as hereinbefore described with reference to the examples, accompanying figures, and/or sequence listing.

32. A polynucleotide comprising a nucleotide sequence encoding SMEZ-2 or SPE-G or SPE-H or SPE-J or variants thereof substantially as hereinbefore described with reference to the examples, accompanying figures, and/or sequence listing.

33. A method of subtyping Streptococcci substantially as hereinbefore described with reference to the examples accompanying figures, and/or sequence listing.

34. A construct comprising any one of SMEZ-2, SPE-G, SPE-H or SPE-J substantially as hereinbefore described with reference to the examples, accompanying ( figures, and/or sequence listing.

35. A pharmaceutical composition which includes a construct substantially as hereinbefore described with reference to the examples, accompanying figures, and/or sequence listing.

36. An antibody which binds SMEZ-2, SPE-G, SPE-H or SPE-J substantially as hereinbefore described with reference to the examples, accompanying figures, and/or sequence listing. 44a 1 \

37. A method of diagnosing a disease which is caused or mediated'Dy expression of a superantigen SMEZ-2, SPE-G, SPE-H or SPE-J substantially as hereinbefore described with reference to the examples, accompanying figures, and/or sequence listing.

38. A nucleic acid molecule which hybridises under stringent conditions to a polynucleotide of claim 7, or claim 9, or claim 11, or claim 13 substantially as hereinbefore described with reference to the examples, accompanying figures, and/or sequence listing.

39. A kit substantially as hereinbefore described with reference to the examples, accompanying figures, and/or sequence listing. AUCKLAND UNISERVICES LIMITED By its Attorney BALDWll/SHELSTON WATERS INTELLECTUAL PROPERTY OFRCE OF |\|.Z 2 4 FEB 2003 received WO 00/39159 PCT/NZ99/00228 SEQUENCE LISTING <110> Auckland UniServices Limited <120> Superantigens <130> 25426 MRB <140> <141> <150> NZ 333589 <151> 1998-12-24 <160> 8 <170> Patentln Ver. 2.1 <210> 1 <211> 702 <212> DNA <213> Streptococcus pyogenes <220> <221> CDS <222> (1) . . (699) <400> 1 atg aaa aaa aca aaa ctt att ttt tct ttt act tea ata ttc att gca 48 Met Lys Lys Thr Lys Leu lie Phe Ser Phe Thr Ser lie Phe lie Ala 15 10 15 ata att tct cgt cct gtg ttt gga tta gaa gta gat aat aat tcc ctt 96 lie lie Ser Arg Pro Val Phe Gly Leu Glu Val Asp Asn Asn Ser Leu 20 25 30 eta agg aat ate tat agt acg att gta tat gaa tat tea gat ata gta 144 Leu Arg Asn lie Tyr Ser Thr lie Val Tyr Glu Tyr Ser Asp lie Val 35 40 45 att gat ttt aaa acc agt cat aac tta gtg act aag aaa ctt gat gtt 192 lie Asp Phe Lys Thr Ser His Asn Leu Val Thr Lys Lys Leu Asp Val 50 55 60 aga gat get aga gat ttc ttt att aac tcc gaa atg gac gaa tat gca 240 Arg Asp Ala Arg Asp Phe Phe lie Asn Ser Glu Met Asp Glu Tyr Ala 65 70 75 80 1 WO 00/39159 PCT/NZ99/00228 gcc aat gat ttt aaa act gga gat aaa ata get gtg ttc tcc gtc cca 288 Ala Asn Asp Phe Lys Thr Gly Asp Lys lie Ala Val Phe Ser Val Pro 85 90 95 ttt gat tgg aac tat tta tea aaa gga aaa gtc aca gca tat acc tat 336 Phe Asp Trp Asn Tyr Leu Ser Lys Gly Lys Val Thr Ala Tyr Thr Tyr 100 105 110 ggt gga ata aca ccc tac caa aaa act tea ata cct aaa aat ate cct 3 84 Gly Gly lie Thr Pro Tyr Gin Lys Thr Ser lie Pro Lys Asn lie Pro 115 120 125 gtt aat tta tgg att aat gga aag cag ate tct gtt cct tac aac gaa 432 Val Asn Leu Trp lie Asn Gly Lys Gin lie Ser Val Pro Tyr Asn Glu 130 135 140 ata tea act aac aaa aca aca gtt aca get caa gaa att gat eta aag 480 lie Ser Thr Asn Lys Thr Thr Val Thr Ala Gin Glu lie Asp Leu Lys 145 150 155 160 gtt aga aaa ttt tta ata gca caa cat caa tta tat tct tct ggt tct 528 Val Arg Lys Phe Leu lie Ala Gin His Gin Leu Tyr Ser Ser Gly Ser 165 170 175 age tac aaa agt ggt aga ctg gtt ttt cat aca aat gat aat tea gat 576 Ser Tyr Lys Ser Gly Arg Leu Val Phe His Thr Asn Asp Asn Ser Asp 180 185 190 aaa tat tct ttc gat ctt ttc tat gta gga tat aga gat aaa gaa agt 624 Lys Tyr Ser Phe Asp Leu Phe Tyr Val Gly Tyr Arg Asp Lys Glu Ser 195 200 205 ate ttt aaa gta tac aaa gac aat aaa tct ttc aat ata gat aaa att 672 lie Phe Lys Val Tyr Lys Asp Asn Lys Ser Phe Asn He Asp Lys lie 210 215 220 ggg cat tta gat ata gaa att gac tcc taa 702 Gly His Leu Asp lie Glu lie Asp Ser 225 230 <210> 2 <211> 233 <212> PRT <213> Streptococcus pyogenes <400> 2 Met Lys Lys Thr Lys Leu lie Phe Ser Phe Thr Ser lie Phe lie Ala 2 WO 00/39159 PCT/NZ99/00228 15 10 15 lie lie Ser Arg Pro Val Phe Gly Leu Glu Val Asp Asn Asn Ser Leu 20 25 30 Leu Arg Asn lie Tyr Ser Thr lie Val Tyr Glu Tyr Ser Asp lie Val 35 40 45 lie Asp Phe Lys Thr Ser His Asn Leu Val Thr Lys Lys Leu Asp Val 50 55 60 Arg Asp Ala Arg Asp Phe Phe lie Asn Ser Glu Met Asp Glu Tyr Ala 65 70 75 80 Ala Asn Asp Phe Lys Thr Gly Asp Lys lie Ala Val Phe Ser Val Pro 85 90 95 Phe Asp Trp Asn Tyr Leu Ser Lys Gly Lys Val Thr Ala Tyr Thr Tyr 100 105 110 Gly Gly lie Thr Pro Tyr Gin Lys 115 120 Val Asn Leu Trp lie Asn Gly Lys 130 135 He ser Thr Asn Lys Thr Thr Val 145 150 Val Arg Lys Phe Leu lie Ala Gin 165 Ser Tyr Lys Ser Gly Arg Leu Val 180 Lys Tyr Ser Phe Asp Leu Phe Tyr 195 200 lie Phe Lys Val Tyr Lys Asp Asn 210 215 Gly His Leu Asp lie Glu lie Asp 225 230 Thr Ser lie Pro Lys Asn lie Pro 125 Gin lie Ser Val Pro Tyr Asn Glu 140 Thr Ala Gin Glu lie Asp Leu Lys 155 160 His Gin Leu Tyr Ser Ser Gly Ser 170 175 Phe His Thr Asn Asp Asn Ser Asp 185 190 Val Gly Tyr Arg Asp Lys Glu Ser 205 Lys Ser Phe Asn lie Asp Lys lie 220 Ser <210> 3 <211> 705 3 WO 00/39159 PCT/NZ99/00228 <212> DNA <213> Streptococcus pyogenes <220> <221> CDS <222> (1)..(702) <400> 3 atg aaa aca aac att ttg aca att ate ata tta tea tgt gtt ttt age 48 Met Lys Thr Asn lie Leu Thr lie lie lie Leu Ser Cys Val Phe Ser 15 10 15 tat gga agt caa tta get tat gca gat gaa aat tta aaa gat tta aaa 96 Tyr Gly Ser Gin Leu Ala Tyr Ala Asp Glu Asn Leu Lys Asp Leu Lys 20 25 30 aga agt tta aga ttt gcc tat aat att acc cca tgc gat tat gaa aat 144 Arg Ser Leu Arg Phe Ala Tyr Asn lie Thr Pro Cys Asp Tyr Glu Asn 35 40 45 gta gaa att gca ttt gtt act aca aat age ata cat att aat act aaa 192 Val Glu lie Ala Phe Val Thr Thr Asn Ser lie His lie Asn Thr Lys 50 55 60 caa aaa aga teg gaa tgt att ctt tat gtt gat tct att gta tct tta 240 Gin Lys Arg Ser Glu Cys lie Leu Tyr Val Asp Ser lie Val Ser Leu 65 70 75 80 ggc att act gat cag ttt ata aaa ggg gat aag gtc gat gtt ttt ggt 288 Gly lie Thr Asp Gin Phe lie Lys Gly Asp Lys Val Asp Val Phe Gly 85 90 95 ctc cct tat aat ttt tcc cca cct tat gta gat aat att tat ggt ggt 336 Leu Pro Tyr Asn Phe Ser Pro Pro Tyr Val Asp Asn lie Tyr Gly Gly 100 105 110 att gta aaa cat teg aat caa gga aat aaa tea tta cag ttt gta gga 3 84 lie Val Lys His Ser Asn Gin Gly Asn Lys Ser Leu Gin Phe Val Gly 115 120 125 att tta aat caa gat ggg aaa gaa act tat ttg ccc tct gag get gtt 432 lie Leu Asn Gin Asp Gly Lys Glu Thr Tyr Leu Pro Ser Glu Ala Val 130 135 140 cgc ata aaa aag aaa cag ttt act tta cag gaa ttt gat ttt aaa ata 480 Arg lie Lys Lys Lys Gin Phe Thr Leu Gin Glu Phe Asp Phe Lys lie 145 150 155 160 4 WO 00/39159 PCT/NZ99/00228 aga aaa ttt eta atg gaa aaa tac aat ate tat gat teg gaa teg cgt 528 Arg Lys Phe Leu Met Glu Lys Tyr Asn lie Tyr Asp Ser Glu Ser Arg 165 170 175 tat aca teg ggg age ctt ttc ctt get act aaa gat agt aaa cat tat 57 6 Tyr Thr Ser Gly Ser Leu Phe Leu Ala Thr Lys Asp Ser Lys His Tyr 180 185 190 gaa gtt gat tta ttt aat aag gat gat aag ctt tta agt cga gac agt 624 Glu Val Asp Leu Phe Asn Lys Asp Asp Lys Leu Leu Ser Arg Asp Ser 195 200 205 ttc ttt aaa agg tat aaa gat aat aag att ttt aat agt gaa gaa att 672 Phe Phe Lys Arg Tyr Lys Asp Asn Lys lie Phe Asn Ser Glu Glu lie 210 215 220 agt cat ttt gat ate tac tta aaa acg cac tag 705 Ser His Phe Asp lie Tyr Leu Lys Thr His 225 230 <210> 4 <211> 234 <212> PRT <213> Streptococcus pyogenes <400> 4 Met Lys Thr Asn lie Leu 1 5 Tyr Gly Ser Gin Leu Ala 20 Arg Ser Leu Arg .Phe Ala 35 Val Glu He Ala Phe Val 50 Gin Lys Arg Ser Glu Cys 65 70 Gly lie Thr Asp Gin Phe 85 Leu Pro Tyr Asn Phe Ser 100 105 110 5 Thr lie lie lie Leu Ser Cys Val Phe Ser 10 15 Tyr Ala Asp Glu Asn Leu Lys Asp Leu Lys 25 30 Tyr Asn lie Thr Pro Cys Asp Tyr Glu Asn 40 45 Thr Thr Asn Ser lie His He Asn Thr Lys 55 60 lie Leu Tyr Val Asp Ser lie Val Ser Leu 75 80 lie Lys Gly Asp Lys Val Asp Val Phe Gly 90 95 Pro Pro Tyr Val Asp Asn lie Tyr Gly Gly WO 00/39159 lie Val Lys His Ser Asn Gin Gly Asn 115 120 lie Leu Asn Gin Asp Gly Lys Glu Thr 130 135 Arg lie Lys Lys Lys Gin Phe Thr Leu 145 150 PCT/NZ99/00228 Lys Ser Leu Gin Phe Val Gly 125 Tyr Leu Pro Ser Glu Ala Val 140 Gin Glu Phe Asp Phe Lys lie 155 160 Arg Lys Phe Leu Met Glu Lys Tyr Asn lie Tyr Asp Ser Glu Ser Arg 165 170 175 Tyr Thr Ser Gly Ser Leu Phe Leu Ala Thr Lys Asp Ser Lys His Tyr 180 185 190 Glu Val Asp Leu Phe Asn Lys Asp Asp Lys Leu Leu Ser Arg Asp Ser 195 200 205 Phe Phe Lys Arg Tyr Lys Asp Asn Lys lie Phe Asn Ser Glu Glu lie 210 215 220 Ser His Phe Asp lie Tyr Leu Lys Thr His 225 230 <210> 5 <211> 711 <212> DNA <213> Streptococcus pyogenes <220> <221> CDS <222> (1)..(708) <400> 5 atg aga tat aat tgt cgc tac tea cat att gat aag aaa ate tac age 48 Met Arg Tyr Asn Cys Arg Tyr Ser His lie Asp Lys Lys lie Tyr Ser 15 10 15 atg att ata tgt ttg tea ttt ctt tta tat tcc aat gtt gtt caa gca 96 Met lie lie Cys Leu Ser Phe Leu Leu Tyr Ser Asn Val Val Gin Ala 20 25 30 aat tct tat aat aca acc aat aga cat aat eta gaa teg ctt tat aag 144 Asn Ser Tyr Asn Thr Thr Asn Arg His Asn Leu Glu Ser Leu Tyr Lys 35 40 45 6 WO 00/39159 PCT/NZ99/00228 cat gat tct aac ttg att gaa gcc gat agt ata aaa aat tct cca gat 192 His Asp Ser Asn Leu lie Glu Ala Asp Ser lie Lys Asn Ser Pro Asp 50 55 60 att gta aca age cat atg ttg aaa tat agt gtc aag gat aaa aat ttg 240 lie Val Thr Ser His Met Leu Lys Tyr Ser Val Lys Asp Lys Asn Leu 65 70 75 80 tea gtt ttt ttt gag aaa gat tgg ata tea cag gaa ttc aaa gat aaa 288 Ser Val Phe Phe Glu Lys Asp Trp lie Ser Gin Glu Phe Lys Asp Lys 85 90 95 gaa gta gat att tat get eta tct gca caa gag gtt tgt gaa tgt cca 336 Glu Val Asp lie Tyr Ala Leu Ser Ala Gin Glu Val Cys Glu Cys Pro 100 105 110 ggg aaa agg tat gaa gcg ttt ggt gga att aca tta act aat tea gaa 384 Gly Lys Arg Tyr Glu Ala Phe Gly Gly lie Thr Leu Thr Asn Ser Glu 115 120 125 aaa aaa gaa att aaa gtt cct gta aac gtg tgg gat aaa agt aaa caa 432 Lys Lys Glu lie Lys Val Pro Val Asn Val Trp Asp Lys Ser Lys Gin 130 135 140 cag ccg cct atg ttt att aca gtc aat aaa ccg aaa gta acc get cag 480 Gin Pro Pro Met Phe lie Thr Val Asn Lys Pro Lys Val Thr Ala Gin 145 150 155 160 gaa gtg gat ata aaa gtt aga aag tta ttg att aag aaa tac gat ate 528 Glu Val Asp lie Lys Val Arg Lys Leu Leu lie Lys Lys Tyr Asp lie 165 170 175 tat aat aac egg gaa caa aaa tac tct aaa gga act gtt acc tta gat 576 Tyr Asn Asn Arg Glu Gin Lys Tyr Ser Lys Gly Thr Val Thr Leu Asp 180 185 190 tta aat tea ggt aaa gat att gtt ttt gat ttg tat tat ttt ggc aat 624 Leu Asn Ser Gly Lys Asp lie Val Phe Asp Leu Tyr Tyr Phe Gly Asn 195 200 205 gga gac ttt aat age atg eta aaa ata tat tcc aat aac gag aga ata 672 Gly Asp Phe Asn Ser Met Leu Lys lie Tyr Ser Asn Asn Glu Arg lie 210 215 220 gac tea act caa ttt cat gta gat gtg tea ate age taa 711 Asp Ser Thr Gin Phe His Val Asp Val Ser lie Ser 225 230 235 7 WO 00/39159 PCT/NZ99/00228 <210> 6 <211> 236 <212> PRT <213> Streptococcus pyogenes <400> 6 Met Arg Tyr Asn Cys Arg Tyr Ser His lie Asp Lys Lys lie Tyr Ser 15 10 15 Met lie lie Cys Leu Ser Phe Leu 20 Asn Ser Tyr Asn Thr Thr Asn Arg 35 40 Leu Tyr Ser Asn Val Val Gin Ala 25 30 His Asn Leu Glu Ser Leu Tyr Lys 45 His Asp Ser Asn Leu lie Glu Ala Asp Ser lie Lys Asn Ser Pro Asp 50 55 60 lie Val Thr Ser His Met Leu Lys Tyr Ser Val Lys Asp Lys Asn Leu 65 70 75 80 Ser Val Phe Phe Glu Lys Asp Trp lie Ser Gin Glu Phe Lys Asp Lys 85 90 95 Glu Val Asp lie Tyr Ala Leu Ser Ala Gin Glu Val Cys Glu Cys Pro 100 105 110 Gly Lys Arg Tyr Glu Ala Phe Gly Gly lie Thr Leu Thr Asn Ser Glu 115 120 125 Lys Lys Glu lie Lys Val Pro Val Asn Val Trp Asp Lys Ser Lys Gin 130 135 140 Gin Pro Pro Met Phe lie Thr Val Asn Lys Pro Lys Val Thr Ala Gin 145 150 155 160 Glu Val Asp lie Lys Val Arg Lys Leu Leu lie Lys Lys Tyr Asp lie 165 170 175 Tyr Asn Asn Arg Glu Gin Lys Tyr Ser Lys Gly Thr Val Thr Leu Asp 180 185 190 Leu Asn Ser Gly Lys Asp lie Val Phe Asp Leu Tyr Tyr Phe Gly Asn 195 200 205 Gly Asp Phe Asn Ser Met Leu Lys lie Tyr Ser Asn Asn Glu Arg lie 210 215 220 8 WO 00/39159 PCT/NZ99/00228 Asp Ser Thr Gin Phe His Val Asp Val Ser lie Ser 225 230 235 <210> 7 <211> 414 <212> DNA <213> Streptococcus pyogenes <220> <221> CDS <222> (1)..(411) <400> 7 ctt ccg tac ata ttt act cgt tat gat gtt tat tat ata tat ggt ggg 48 Leu Pro Tyr lie Phe Thr Arg Tyr Asp Val Tyr Tyr lie Tyr Gly Gly 1 5 10 15 gtt aca cca tea gta aac agt aat teg gaa aat agt aaa att gta ggt 96 Val Thr Pro Ser Val Asn Ser Asn Ser Glu Asn Ser Lys lie Val Gly 20 25 30 aat tta eta ata gat gga gtc cag caa aaa aca eta ata aat ccc ata 144 Asn Leu Leu lie Asp Gly Val Gin Gin Lys Thr Leu lie Asn Pro lie 35 40 45 aaa ata gat aaa cct att ttt acg att caa gaa ttt gac ttc aaa ate 192 Lys lie Asp Lys Pro lie Phe Thr lie Gin Glu Phe Asp Phe Lys lie 50 55 60 aga caa tat ctt atg caa aca tac aaa att tat gat cct aat tct cca 240 Arg Gin Tyr Leu Met Gin Thr Tyr Lys lie Tyr Asp Pro Asn Ser Pro 65 70 75 80 tac ata aaa ggg caa tta gaa att gcg ate aat ggc aat aaa cat gaa 288 Tyr lie Lys Gly Gin Leu Glu lie Ala lie Asn Gly Asn Lys His Glu 85 90 95 agt ttt aac tta tat gat gca acc tea tct agt aca agg agt gat att 336 Ser Phe Asn Leu Tyr Asp Ala Thr Ser Ser Ser Thr Arg Ser Asp lie 100 105 110 ttt aaa aaa tat aaa gac aat aag act ata aat atg aaa gat ttc age 384 Phe Lys Lys Tyr Lys Asp Asn Lys Thr lie Asn Met Lys Asp Phe Ser 115 120 125 9 WO 00/39159 PCT/NZ99/00228 cat ttt gat att tac ctt tgg act aaa taa 414 His Phe Asp lie Tyr Leu Trp Thr Lys 130 135 <210> 8 <211> 137 <212> PRT <213> Streptococcus pyogenes <400> 8 Leu Pro Tyr lie Phe Thr Arg Tyr Asp Val Tyr Tyr lie Tyr Gly Gly 1 5 10 15 Val Thr Pro Ser Val Asn Ser Asn Ser Glu Asn Ser Lys lie Val Gly 20 25 30 Asn Leu Leu lie Asp Gly Val Gin Gin Lys Thr Leu lie Asn Pro lie 35 40 45 Lys lie Asp Lys Pro lie Phe Thr lie Gin Glu Phe Asp Phe Lys lie 50 55 60 Arg Gin Tyr Leu Met Gin Thr Tyr Lys lie Tyr Asp Pro Asn Ser Pro 65 70 75 80 Tyr lie Lys Gly Gin Leu Glu lie Ala lie Asn Gly Asn Lys His Glu 85 90 95 Ser Phe Asn Leu Tyr Asp Ala Thr Ser Ser Ser Thr Arg Ser Asp lie 100 105 110 Phe Lys Lys Tyr Lys Asp Asn Lys Thr lie Asn Met Lys Asp Phe Ser 115 120 125 His Phe Asp lie Tyr Leu Trp Thr Lys 130 135 10