AU2020103933A4 - USE OF miRNA30a CLUSTER AS DIAGNOSTIC MARKER AND THERAPEUTIC TARGET FOR ALZHEIMER'S DISEASE - Google Patents

Abstract

The disclosure provides use of a miRNA30a cluster as a diagnostic marker and a therapeutic target for Alzheimer's disease (AD). The miRNA30a cluster of the disclosure plays a role in the diagnosis and treatment of AD. Primers and/or probes for the miRNA30a cluster are used to detect the relative expression of the miRNA3Oa cluster in the human body through AD model cells, AD model animals and natural aging animals, and clinical blood samples. The miRNA30a cluster of the disclosure has a significantly increased expression during the development of AD and negatively regulates the expression of ADAM10 and SIRT Iat the transcription and translation levels; meanwhile, the miRNA3Oa cluster inhibits ADAM10-mediated non-amyloidogenic pathway and SIRT1 deacetylation-mediated amyloid degradation pathway; thus, excessive accumulation of amyloid in the brain that promotes the occurrence and development of AD is regulated negatively by the action of miRNA30a cluster. Therefore, the miRNA30a cluster can be used as a new marker in the auxiliary diagnosis and treatment of AD. 1 /6 1.06 miR-30a 1.05 miR-30a 1.04 miR-30a 1.03 1.02 1-month-old 3-month-old 6-month-old 9-month-old APP/PSI mice APP/PSI mice APP/PSI mice APP/PSI mice vs.WT mice vs.WT mice vs.WT mice vs.WT mice FIG.1

Description

1 /6

1.06 miR-30a 1.05 miR-30a 1.04 miR-30a 1.03

1.02 1-month-old 3-month-old 6-month-old 9-month-old APP/PSI mice APP/PSI mice APP/PSI mice APP/PSI mice vs.WT mice vs.WT mice vs.WT mice vs.WT mice

FIG.1

USE OF miRNA30a CLUSTER AS DIAGNOSTIC MARKER AND THERAPEUTIC TARGET FOR ALZHEIMER'S DISEASE

TECHNICAL FIELD The disclosure relates to the field of biotechnology, and in particular, to the use of a miRNA30a cluster as a diagnostic marker and therapeutic target for Alzheimer's disease.

BACKGROUND Alzheimer's disease (AD) is a chronic neurodegenerative disease of the cortex and hippocampus. The clinical manifestations mainly include progressive memory and cognitive dysfunction, emotional disorders, social deficit, and other neurological symptoms. The principal pathological mechanism is the deposition of senile plaques caused by amyloid-beta peptide (AP) aggregation, neurofibrillary tangles caused by tau protein hyperphosphorylation, synaptic dysfunction, nerve cell inflammation, cerebral cortex atrophy, etc. There are still problems and challenges in the diagnosis and/or treatment of AD due to the lack of efficient and precise screening and detection technology, unclear pathogenesis, and slow progress in drug target research. At present, clinical research drugs and marketed drugs can only relieve mild to moderate patients' symptoms, but cannot fundamentally prevent and cure this disease. Therefore, seeking reliable diagnostic markers and therapeutic targets for AD and elucidating the pathogenesis of AD are major scientific problems that need to be solved urgently in the prevention and treatment of AD so far. Studies have shown that mutations in genes such as PSEN1, PSEN2, and APP are closely related to the occurrence of familial AD. Early genetic screening can reveal familial AD with less than 10% of the incidence. Still, the genetic pathology of sporadic AD with an incidence greater than 90% and the regulation mechanism of related signaling pathways are complicated, and there is no substantially relevant gene in clinical application. In the study of sporadic AD, it is of great significance to investigate the changes in non-coding microRNA genes in transcriptomics to prevent and treat this disease and discover clinical biomarkers.

SUMMARY To this end, the examples of the disclosure provide a miRNA biomarker for diagnosis and/or treatment of Alzheimer's disease, so as to solve the problem that there is no diagnostic marker for Alzheimer's disease at the gene level in the prior art. To achieve the foregoing objective, the examples of the disclosure provide the following technical solutions: a miRNA biomarker for diagnosing and/or treating Alzheimer's disease is provided, where the miRNA biomarker is a miRNA3Oa cluster. In an example of the disclosure, the miRNA30a cluster is selected from hsa-miR-30a and has a nucleotide sequence shown in SEQ ID NO. 1; the miRNA30a cluster is selected from hsa-miR-30a-5p and has a nucleotide sequence shown in SEQ ID NO.2. The disclosure further provides use of a primer in the preparation of a kit, where the primer is a specific primer for the miRNA biomarker described above. In an example of the disclosure, the kit is used to diagnose Alzheimer's disease in patients suffering from or at risk of developing Alzheimer's disease, predict the risk of developing Alzheimer's disease, or predict the outcome of Alzheimer's disease. In an example of the disclosure, the primer is used to determine an expression level of the miRNA biomarker in a sample. In an example of the disclosure, the sample is serum. In an example of the disclosure, the expression level of the miRNA biomarker is based on a patient's miRNA biomarker expression level and a healthy subject's miRNA biomarker reference expression level. In an example of the disclosure, the expression level of the miRNA biomarker is determined by a sequencing-based method, an array-based method, or a PCR-based method. Use of an inhibitor for the miRNA biomarker described above in the preparation of a medicament for treating Alzheimer's disease further belongs to the protection scope of the disclosure. In the disclosure, the miRNA30a cluster has a significantly increased expression in Alzheimer's disease, binds to 3'UTR of ADAM10, and inhibits ADAM10 as a non-amyloid pathway for a-secretase to produce soluble AP. The miRNA3Oa cluster binds to 3'UTR of SIRT1, inhibits SIRT1 to deacetylate the retinoic acid P receptor, and activate the amyloid degradation pathway of ADAM10 transcription; the miRNA30a cluster inhibits the biological activity of SIRTI, activates the activity of p-secretase in the NF-KB signaling pathway, and promotes the production of insoluble amyloid AP. At the same time, the miRNA30a cluster inhibits SIRT1-mediated deacetylation of hyperphosphorylated tau protein, which leads to neurofibrillary tangles and the death of oligodendrocytes. Specifically, the microRNAs of the miRNA30a cluster are as follows: (1) The miRNA30a cluster is selected from the following features: (a) classification of microRNAs, where miRNA 30a is selected from hsa-miR-30a, having a sequence shown in SEQ ID NO. 1: gcgacuguaaacauccucgacuggaagcugugaagccacagaugggcuuucagucggauguuugcagcugc; a default mature body thereof (hsa-miR-30a-5p) has a sequence shown in SEQ ID NO. 2: gaaggucagcuccuacaaaugu; (b) modified microRNA derivatives; or miRNA microRNAs or modified miRNA derivatives with 18-26 nt in length and with the same or basically the same function as microRNAs. The example of the disclosure provides a preparation and a medicament, which are inhibitors of the microRNA in (1). The examples of the disclosure have the following advantages: The miRNA30a cluster of the disclosure plays a role in the diagnosis and treatment of Alzheimer's disease. Primers and/or probes for the microRNA marker of the miRNA30a cluster are used to detect the relative expression of the miRNA30a cluster in the human body through AD model cells, AD model animals, natural aging animals, and clinical blood samples. Because the miRNA30a cluster of the disclosure has a significantly increased expression during the progress of AD, the miRNA3Oa cluster can be used as a new marker for Alzheimer's disease in the auxiliary diagnosis of the disease. The examples of the disclosure find that up-regulation of microRNA expression in the miRNA30a cluster can simultaneously negatively regulate the expression of ADAM10 and SIRT1, leading to the excessive deposition of AP and neuronal apoptosis; down-regulation of the expression of the miRNA30a cluster significantly lowers the deposition level of AP and reduces neuronal apoptosis; the miRNA3Oa cluster negatively regulates the expression of ADAM10 and SIRT Ito aggravate the pathological process of AD. The examples of the disclosure reveal the functions of the miRNA30a cluster. Based on the above findings, the miRNA30a cluster has a specific multi-target effect. It can be used as a new diagnostic and therapeutic target for AD, providing a new idea for targeted therapy using the miRNA3Oa cluster as a biomarker for AD.

BRIEF DESCRIPTION OF THE DRAWINGS To more clearly illustrate the examples of the disclosure or the technical solutions in the prior art, the following will briefly introduce the drawings that need to be used to describe the examples or the prior art. Obviously, the drawings in the following description are only exemplary. For those of ordinary skill in the art, other implementation drawings can be derived from the provided drawings without creative work. FIG. 1 illustrates the detection of differentially expressed microRNAs in the pathological process of AD using high-throughput microarray technology according to an example of the disclosure; FIG. 2 illustrates the detection of the expression of miR-30a in AD model cells, AD model animals and natural aging animals, and AD patients'blood. A: In the AD cell model, the expression of miR-30a significantly increases compared with the control group. B: In the cortex of AD animal model mice, the expression of miR-30a is significantly higher in wild-type (WT) mice than in the control group. C: In the hippocampus of AD animal model mice, the expression of miR-30a is significantly higher in WT mice than in the control group. D: In the serum of AD patients, the expression of miR-30a is significantly higher than that of the normal control group; FIG. 3 illustrates the effect of miR-30a on the neuronal cell viability of an AD cell model as an example of the disclosure; FIG. 4 illustrates the effect of miR-30a on -amyloid (AP) in an example of the disclosure; FIG. 5 illustrates specific targeting of miR-30a to mRNA 3'UTRs ofADAM10 and SIRTI according to an example of the disclosure, where: A illustrates that ADAM10 and miR-30a binding sequence is highly conserved in a plurality of species; B illustrates that SIRT Iand miR-30a binding sequence is highly conserved in a plurality of species; C schematically illustrates the construction of Luc-ADAM1O-WT/Luc-ADAM10-MUT dual-luciferase reporter gene vector diagram; D schematically illustrates the construction of Luc-SIRT1-WT/Luc-SIRT1-MUT dual-luciferase reporter gene vector; E illustrates the verification of the specificity of targeted binding of miR-30a to ADAM10; F illustrates verification of the specificity of targeted binding of miR-30a to SIRTI; FIG. 6 illustrates that miR-30a specifically negatively regulates the expression of two specific targets of ADAM10 and SIRT Iat the transcription and translation levels according to an example of the disclosure, where: A illustrates that miR-30a negatively regulates the expression levels of ADAM10 and SIRT Iat the mRNA level; B illustrates that miR-30a negatively regulates the expression levels of ADAM10 and SIRT Iat the translation level (Western blot); C illustrates that miR-30a negatively regulates the expression level of ADAM10 at the translation level (relative quantification); D illustrates that miR-30a negatively regulates the expression level of SIRT Iat the translation level (relative quantification).

DETAILED DESCRIPTION The implementation of the disclosure will be illustrated below in conjunction with specific examples. Those skilled in the art can easily understand the other advantages and effects of the disclosure from the content disclosed in this specification. Obviously, the described examples are a part of, not all of, the examples of the disclosure. All other examples obtained by persons of ordinary skill in the art based on the example of the disclosure without creative efforts shall fall within the scope of the present invention. In the examples of the disclosure, the term "expression level" refers to a measured expression level compared with a reference nucleic acid (for example, from a control), or a calculated average expression value (for example, in RNA microarray analysis). A certain "expression level" can also be used as a result and determined by the comparison and measurement of a plurality of nucleic acids of interest disclosed below, and show the relative abundance of these transcripts with each other. The expression level can also be evaluated relative to the expression of different tissues, patients versus healthy controls, etc. In the context of the disclosure, a "sample" or "biological sample" is a sample that is derived from or has been in contact with a biological organism. Examples of biological samples are cells, tissues, body fluids, biopsy samples, blood, urine, saliva, sputum, plasma, serum, cell culture supernatant, etc. "Gene" is a nucleic acid segment that contains the information necessary to produce a functional RNA product in a controlled manner. A "gene product" is a biomolecule produced by gene transcription or expression, such as mRNA or translated protein. "MiRNA" is a short, naturally occurring RNA molecule and should have the general meaning understood by those skilled in the art. A "miRNA-derived molecule" is a molecule obtained from a miRNA template chemically or enzymatically, such as cDNA. In the examples of the disclosure, the term "array" refers to an arrangement of addressable positions on a device (such as a chip device). The number of locations can vary from a few to at least hundreds or thousands. Each position represents an independent reaction site. Arrays include, but are not limited to, nucleic acid arrays, protein arrays, and antibody arrays. "Nucleic acid array" refers to an array containing nucleic acid probes, such as oligonucleotides, polynucleotides, or larger portions of genes. The nucleic acids on the array are preferably single-stranded. "PCR-based method" refers to a method involving polymerase chain reaction (PCR). This is a method of exponentially amplifying nucleic acids "such as DNA or RNA" using one, two, or more primers to replicate enzymatically in vitro. For RNA amplification, reverse transcription can be used as the first step. PCR-based methods include kinetic or quantitative PCR (qPCR), particularly suitable for analyzing expression levels. When it achieves the determination of the expression level, for example, a PCR-based method can be used to detect the presence of a given mRNA, which reverse transcribes a complete mRNA library (the so-called transcriptome) into cDNA with the help of reverse transcriptase. The presence of a given cDNA is detected with the help of corresponding primers. This method is commonly referred to as reverse transcriptase PCR (RT-PCR). In the examples of the disclosure, the term "PCR-based method" includes both end-point PCR applications and kinetic/real-time PCR techniques using special fluorophores or intercalating dyes, which emit fluorescent signals as functions of amplification targets and allows monitoring and quantification of the target. In the examples of the disclosure, the term "marker" or "biomarker" refers to a biomolecule whose presence or concentration can be detected and associated with a known condition (such as a disease state) or clinical outcome (such as response to treatment), such as nucleic acids, peptides, proteins, hormones, etc. Example 1. The detection of differentially expressed microRNAs in the pathological process of AD by high-throughput microarray technology Double transgenic mice that were stably transfected with APP and PS1 genes (named APP/PS1 mice), aged 1, 3, 6, and 9 months (experimental group), and age-matched wild-type mice (WT control mice), were used. Using the principle of Northern blotting, the high-throughput genomics expression profile biochip of "high-density, flexible customization, and micro-samples" was used. The Trizol method was used to extract RNA from mouse brain tissue and separate and label it. The miRNA30a cluster, according to the example of the disclosure, was hsa-miR-30a, having a sequence shown in SEQ ID NO. 1: gcgacuguaaacauccucgacuggaagcugugaagccacagaugggcuuucagucggauguuugcagcugc. The default mature body (hsa-miR-30a-5p) thereof had a sequence shown in SEQ ID NO. 2: gaaggucagcuccuacaaaugu. Among them, mature body (hsa-miR-30a-5p) miRNA reverse transcription primer was shown in SEQ ID NO. 3: gtcgtatccagtgcagggtccgaggtattcgcactggatacgacacattt; quantitative PCR (qPCR) forward primer was shown in SEQ ID NO. 4:cgcggaaggtcagctcctac; reverse primer was shown in SEQ ID NO .5: agtgcagggtccgaggtatt. Labeled samples were pre-hybridized, hybridized, and washed with the miRCURYTM LNAArray (v.18.0). The microarray was scanned with the Axon GenePix 4000B Microarray Scanner, and the data were statistically analyzed by GenePixpro V6.0 software. As shown in FIG. 1, compared with wild-type (WT) mice, the expression of miR-30a in the brain tissues of APP/PS1 mice aged at different months is significantly increased (mean SEM, n = 3, fold change > 2). Example 2. The expression of miRNA30a cluster in AD model cells The human neuroblastoma cells (SH-SY5Y cells) stably transfected with the human-mouse chimeric APP gene were established as an AD in vitro model due to the excessive production of AP derived from the over-expression of the APP gene. In this cell model, copper ions (copper sulfate, CuSO4) were used to amplify the APP gene further, subsequently forming a chelate with APP and AP, aggravating the production and deposition of AP, and inducing the oxidative stress reaction and neuronal apoptosis. Therefore, the in vitro model was used to simulate the pathological state of AD cells and investigate the function and mechanism of the miRNA30a cluster. RT-PCR and qPCR techniques were used for reverse transcription and real-time fluorescence quantitative detection of miR-30a expression changes in the pathological process of AD cell models. As shown in FIG. 2A, the expression of miR-30a was significantly increased compared with that of the control group (mean SEM, n =3, **p < 0.01). Example 3. The expression of miRNA30a cluster in AD associated-animal models APP/PS1 mice and senescence-accelerated mouse/prone 8 (SAMP8) mice were used for evaluating the expression of miRNA30a cluster. Hippocampal and cortical tissues were extracted from 1, 3, 6, and 9-month-old APP/PS1 mice and SAMP8 mice, respectively, and the total mRNA of mouse cortex and hippocampus was extracted by the Trizol method, and concentration and purity were determined by the ultraviolet (UV) absorption method. RT-PCR and qPCR techniques were used to detect the expression changes of miR-30a in the pathological process of AD. As shown in FIG. 2B and 2C, in the cortical or hippocampal tissues of the AD-associated animal models, the expression level of miR-30a was increased significantly compared with the control mice at the ages of 1, 3, 6, and 9 months. (Mean SEM, n = 4, **p < 0.01, ***p < 0.001). Example 4. The expression of miRNA30a cluster in AD patients The differential expression of a miRNA has good diagnostic sensitivity and specificity for AD patients. Serum was obtained from the patients with clinically diagnosed AD, and those healthy volunteers of the same age were identified as normal control. The total RNA was extracted from the serum of patients and normal control. The RNA concentration and purity were verified using the UV absorption method and a microplate reader. The qPCR technique was used to detect the level of miR-30a in the serum of AD patients. As shown in FIG. 2D, levels of miR-30a in the serum of AD patients were significantly higher than those of healthy volunteers of the same age. (Mean SEM, n = 5 to 7, **p < 0.01). Example 5. The effect of up-regulation and down-regulation of miRNA30a cluster on cell viability The AD cell model was transfected with miRNA mimics and miRNA inhibitor by liposome to establish the up-regulation and down-regulation of the miR-30a cluster. MTS colorimetric assay was used to detect cell viability at 12, 24, and 48 h. As shown in FIG. 3, down-regulation of miR-30a alleviated copper-induced injury, increased the viability of AD cells, and had a neuroprotective effect; up-regulation of miR-30a reduced the viability of AD cells. (Mean SEM, n = 3, *p < 0.05, **p < 0.01, ***p < 0.001). Example 6. The effect of up-regulation and down-regulation of miRNA30a cluster on intracellular p-amyloid (AP) level The AD cell model was transfected with miRNA mimics and miRNA inhibitor by liposome to establish the up-regulation and down-regulation of the miR-30a cluster. The cellular AP level was detected by the immunofluorescence technique. As shown in FIG. 4, the up-regulation of miR-30a significantly increased the excessive deposition of AP, leading to neuronal death; down-regulation of miR-30a significantly inhibited the excessive deposition of AP and reduced neuronal death, which exerted a neuroprotective effect. (Mean SEM, n=3). Example 7. The binding of miR-30a cluster to ADAM10 and SIRTI Bioinformatics software TargetScan, miRanda, and miRBase were used to predict binding sites of miR-30a to ADAM10 and SIRT Itargets. The binding sequence was confirmed highly conserved in human, mouse, rabbit, and other species, as shown in FIG. 5A. Using dual-luciferase reporter gene assay, fragments of about 150 bp were intercepted from the upstream and downstream of miR-30a/ADAM1O and miR-30a/SIRT1 binding sites and cloned to the downstream of a dual-luciferase reporter gene to construct the dual-luciferase reporter gene vectors Luc-ADAM1-WT and Luc-SIRT1-WT; the mutant dual-luciferase reporter vectors Luc-ADAM-MUT and Luc-SIRTI-MUT were constructed using base mutation, as shown in FIG. 5B and 5C. Luc-ADAM1O-WT and Luc-ADAM1O-MUT reporter vectors and miR-30a mimics were co-transfected into HEK293 cells by liposome transfection. A dual-luciferase reporter gene system was used to detect the activity of Firefly and Renilla luciferases after 36 h and calculate the relative fluorescence intensity. Similarly, Luc-SIRT1-WT or Luc-SIRTI-MUT with miR-30a mimics was co-transfected using liposome, and the relative fluorescence intensity was calculated. As shown in FIG.5B, after co-transfecting Luc-ADAM1O-WT and miR-30a mimics, the up-regulation of miR-30a significantly reduced the luciferase activity, but after mutation of the binding sites, miR-30a lost the inhibitory effect on luciferase activity. As shown in FIG.5C, after co-transfecting Luc-SIRT1-WT and miR-30a mimics, the up-regulation of miR-30a also significantly reduced the luciferase activity, while after mutation of the binding sites, miR-30a lost the inhibitory effect on luciferase activity. Therefore, miR-30a targeted ADAM10 and SIRT Ispecifically at the same time. (Mean SEM, n = 3, *p < 0.05, ***p < 0.001).

Example 8. Specific regulation of the expression of ADAM10 and SIRT Iby the miR-30a cluster at the transcription level The AD cell model was transfected with miRNA mimics and miRNA inhibitor by liposome to establish the up-regulation and down-regulation of the miR-30a cluster. Total RNA was extracted by the Trizol method, and the qPCR technique was used to detect the level of intracellular ADAM10 and SIRT I mRNA. As shown in FIG.6A, up-regulation of miR-30a negatively regulated the expression of two specific targets, ADAM10 and SIRT1 at the mRNA level; down-regulation of miR-30a expression simultaneously promoted the expression of ADAM10 and SIRT Iat the mRNA level. (Mean SEM, n = 3, *p < 0.05, ***p < 0.001). Example 9. Specific regulation of the expression of ADAM10 and SIRT Iby the miR-30a cluster at the translation level The AD cell model was transfected with miRNA mimics and miRNA inhibitor by liposome to establish the up-regulation and down-regulation of the miR-30a cluster. Western blot was used to detect the protein expression of ADAM10 and SIRT Iin the cells at the translational level. As shown in FIG. 6B to 6D, miR-30a negatively regulated the expression of ADAM10 and SIRTI at the translation level, illustrated by reducing the protein expression of ADAM10 and SIRT Iwhen miR-30a was up-regulated and promoting the expression of ADAM10 and SIRTI when miR-30a was down-regulated. (Mean SEM, n = 3, *p < 0.05, ***p < 0.001). Examples 1 to 9 of the disclosure show that the expression of the miRNA30a cluster is significantly increased in the pathological process of Alzheimer's disease; moreover, ADAM10-mediated non-amyloidogenic pathway and SIRTI deacetylation-mediated amyloid degradation pathway are negatively regulated by the expression of miR-30a cluster; thus, the excessive accumulation of AP protein derived from the ADAM10 and SIRT1 pathways, which leads to neuronal injury and cognitive dysfunction, is regulated by the miR-30a cluster. Regarding these observations, down-regulation of the activity or expression of the miRNA30a cluster promotes the high expression of the dual targets ADAM10 and SIRTI, reduces senile plaques caused by the excessive deposition of AP, and thereby delays the pathological process. Therefore, the miRNA30a cluster is expected to become a new target for the diagnosis and treatment of Alzheimer's disease. Although the disclosure has been described in detail above with general descriptions and specific examples, it will be apparent to those skilled in the art that some modifications or improvements can be made on the basis of the disclosure. Therefore, all these modifications or variations made without departing from the spirit of the invention fall within the scope of the invention.

References:

[1] Ulep, M.G., Saraon, S.K., McLea, S. (2018). Alzheimer Disease. JNurse Prac 14(3):

129-135. doi: 10.1016/j.nurpra.2017.10.014

[2] Ratnadiwakara, M., Mohenska, M., Ank6, M.L. (2018) Splicing factors as regulators of

miRNA biogenesis - links to human disease. Semin. Cell Dev Biol. 79:113-122. doi:

10.1016/j.semcdb.2017.10.008

[3] Yan, R., Vassar, R. (2014) Targeting the P secretase BACE1 for Alzheimer's disease therapy.

LancetNeurol 13(3): 319-329. doi: 10.1016/S1474-4422(13)70276-X.

[4] Mondragon-Rodriguez, S., Perry, G., Luna-Munoz, J., Acevedo-Aquino, M. C., Williams, S.

(2014). Phosphorylation of tau protein at sites Ser (396-404) is one of the earliest events in

Alzheimer's disease and Down syndrome. Neuropathol. Apple. Neurobiol. 40(2), 121-135. doi:

10.1111/nan.12084

[5] Martin, L., Latypova, X., Wilson, C.M., Magnaudeix, A., Perrin, M.L., Yardin, C., Terro, F.

(2013) Tau protein kinases: Involvement in Alzheimer's disease. Ageing Res Rev. 12(1): 289-309.

doi: 10.1016/j.arr.2012.06.003.

[6] Jicha, G.A., Weaver, C., Lane, E., Vianna, C., Kress Y, Rockwood, J., Davies, P. (1999)

cAMP-Dependent Protein Kinase Phosphorylations on Tau in Alzheimer's Disease. JNeurosci.

19(17): 7486-7494.

[7] Bilkei-Gorzo, A. (2014) Genetic mouse models of brain ageing and Alzheimer's disease.

PharmacolTher. 142(2): 244-257. doi: 10.1016/j.pharmthera.2013.12.009.

[8] Butterfield, D.A., Poon, H.F. (2005) The senescence-accelerated prone mouse (SAMP8): a

model of age-related cognitive decline with relevance to alterations of the gene expression and

protein abnormalities in Alzheimer's disease. Exp Gerontol. 40(10): 774-783. doi:

10.1016/j.exger.2005.05.007.

SEQUENCE LISTING 07 Dec 2020

<110> Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences <120> USE OF miRNA30a CLUSTER AS DIAGNOSTIC MARKER AND THERAPEUTIC TARGET FOR ALZHEIMER'S DISEASE <130> GG20756636A <160> 5 <170> PatentIn version 3.5 <210> 1 <211> 71 2020103933

<212> RNA <213> Artificial Sequence <400> 1 gcgacuguaa acauccucga cuggaagcug ugaagccaca gaugggcuuu cagucggaug 60 uuugcagcug c 71

<210> 2 <211> 22 <212> RNA <213> Artificial Sequence <400> 2 gaaggucagc uccuacaaau gu 22

<210> 3 <211> 50 <212> DNA <213> Artificial Sequence <400> 3 gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacacattt 50

<210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 cgcggaaggt cagctcctac 20

<210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 agtgcagggt ccgaggtatt 20

Claims (5)

What is claimed is:

1. A miRNA biomarker for diagnosing and/or treating Alzheimer's disease, wherein the miRNA biomarker is a miRNA3Oa cluster.

2. The miRNA biomarker for diagnosing and/or treating Alzheimer's disease according to claim 1, wherein: the miRNA30a cluster is selected from hsa-miR-30a and has a nucleotide sequence shown in SEQ ID NO. 1; the miRNA30a cluster is selected from hsa-miR-30a-5p and has a nucleotide sequence shown in SEQ ID NO.2.

3. Use of a primer in the preparation of a kit, wherein the primer is a specific primer for the miRNA biomarker according to claim 1 or 2.

4. The use according to claim 3, wherein the kit is used to provide a diagnosis of Alzheimer's disease in patients suffering from or at risk of developing Alzheimer's disease, predict the risk of developing Alzheimer's disease, or predict the outcome of Alzheimer's disease; the primer is used to determine an expression level of the miRNA biomarker in a sample; the sample is serum; the expression level of the miRNA biomarker is based on a patient's miRNA biomarker expression level and a healthy subject's miRNA biomarker reference expression level; the expression level of the miRNA biomarker is determined by a sequencing-based method, an array-based method, or a PCR-based method.

5. Use of an inhibitor for the miRNA biomarker according to claim 1 in the preparation of a medicament for treating Alzheimer's disease

1 /6

FIG. 1

2 /6

FIG. 2

3 /6

FIG. 3

4 /6

FIG. 4

5 /6

FIG. 5

6 /6

FIG. 6