CN111269977A - Application of miRNA200 cluster as marker for diagnosing and/or treating Alzheimer disease - Google Patents
Application of miRNA200 cluster as marker for diagnosing and/or treating Alzheimer disease Download PDFInfo
- Publication number
- CN111269977A CN111269977A CN202010112719.XA CN202010112719A CN111269977A CN 111269977 A CN111269977 A CN 111269977A CN 202010112719 A CN202010112719 A CN 202010112719A CN 111269977 A CN111269977 A CN 111269977A
- Authority
- CN
- China
- Prior art keywords
- mirna200
- cluster
- mir
- disease
- alzheimer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The invention provides application of miRNA200 cluster microRNA in diagnosis and treatment of Alzheimer's disease, through AD model cells, AD model animals, natural aging animals and clinical serum samples, the expression level of miRNA200 cluster microRNA in human body is detected by using a primer aiming at miRNA200 cluster microRNA markers, the expression of miRNA200 cluster microRNA in the process of Alzheimer's disease is found to be remarkably reduced, and the generation of A β, tau protein over-phosphorylation and apoptosis-like degeneration in AD lesion are improved by targeting BACE1 and PRKACB, so miRNA200 cluster microRNA can be used as a novel Alzheimer's disease marker for auxiliary diagnosis and treatment of Alzheimer's disease.
Description
Technical Field
The invention relates to the technical field of biology, in particular to application of miRNA200 cluster as a marker for diagnosing and/or treating Alzheimer's disease.
Background
Alzheimer's Disease (AD) is the most common form of dementia affecting the elderly 65 years and older 65 years, and the main pathological features of the AD are senile plaques formed by extracellular amyloid deposition and neurofibrillary tangles formed by intracellular tau protein hyperphosphorylation, which are mainly manifested by memory impairment, aphasia, disuse, agnosion, visual-spatial skill impairment, executive dysfunction, personality and behavior change.
At present, the following problems mainly exist in AD control: lack of simple non-invasive early screening means; the pathogenesis is complex, and the effect of the drug with a single target point on AD is not obvious. Therefore, the search for reliable AD diagnosis markers, the elucidation of the pathogenesis of AD and the search for multi-target therapeutic drugs are the urgent scientific problems to be solved for the prevention and treatment of AD. Researches show that the mutation of presenilin 1(PSEN1) gene, presenilin 2(PSEN2) gene and APP gene is closely related to the occurrence and development of familial AD, and can be found through early gene screening, but no related gene report exists for sporadic AD occupying most of AD, which brings great difficulty to the screening and prevention of AD. Therefore, the research on the change of related genes in sporadic AD has important significance for the prevention and treatment of AD and the discovery of clinical biomarkers.
Disclosure of Invention
To this end, the present invention provides the use of the miRNA200 cluster as a marker for diagnosing and/or treating alzheimer's disease.
In order to achieve the above purpose, the invention provides the following technical scheme:
application of miRNA200 cluster as marker for diagnosing and/or treating Alzheimer's disease.
In one embodiment of the invention, the miRNA200 cluster is selected from hsa-miR-200a, and the nucleotide sequence of the miRNA200 cluster is shown in SEQ ID No. 1;
the miRNA200 cluster is selected from hsa-miR-200a-3p, and the nucleotide sequence of the miRNA is shown in SEQ ID NO. 2.
In one embodiment of the invention, the primer of the miRNA200 cluster is used for preparing a detection kit;
the test kit is useful for providing a diagnosis of Alzheimer's disease, predicting the risk of developing Alzheimer's disease, or predicting the outcome of Alzheimer's disease in a patient suffering from or at risk of developing Alzheimer's disease.
In one embodiment of the invention, the primers are used to determine the expression level of the miRNA200 cluster in a sample.
In one embodiment of the invention, the sample is serum of a patient.
In one embodiment of the invention, the expression level of the miRNA200 cluster is the expression level of the miRNA200 cluster of the patient and the reference expression level of the healthy miRNA200 cluster;
if the expression level of the miRNA200 cluster is significantly reduced compared to a reference expression level of a healthy human miRNA200 cluster, the patient is indicated to have or be at risk of developing Alzheimer's disease.
In one embodiment of the invention, the determination of the expression level of the miRNA200 cluster is a sequencing-based method, an array-based method or a PCR-based method.
The application of the miRNA200 cluster agonist in the preparation of the medicament for treating the Alzheimer disease also belongs to the protection scope of the invention.
In the invention, the expression of the miRNA200 cluster microRNA is reduced in Alzheimer's disease, and the nerve cell apoptosis is reduced by inhibiting BACE1 and PRKACB mediated beta amyloid protein and tau protein phosphorylation. Wherein, the micro RNA of miRNA200 cluster is:
(1) the microRNA of miRNA200 cluster is selected from the following characteristics: (a) miRNA200 a type microRNA of miRNA type microRNA is selected from hsa-miR-200a, the sequence of the miRNA200 a type microRNA is shown in SEQ ID NO.1 ccgggccccuggccauucuuaccggacaagugcuuuucccuagcuuccuucuuacaccuccuguuaac gauguucaaa ggugacccgc, and the default mature body (hsa-miR-200a-3p) sequence is shown in SEQ ID NO. 2: uaacacugucugguaacgaugu; (b) modified miRNA micro RNA derivatives; or microRNA or modified miRNA derivative with the length of 18-26nt and the function same as or basically same as miRNA microRNA;
the invention also provides a preparation and a medicament, and the preparation and the medicament are agonists of the micro RNA in the step (1).
The invention has the following advantages:
the invention finds that the miRNA200 cluster microRNA has effects in the aspects of Alzheimer disease diagnosis and treatment, and the expression level of the miRNA200 cluster microRNA in a human body is detected by using a primer and/or a probe aiming at the miRNA200 cluster microRNA marker through AD mode cells, AD mode animals, naturally aged animals and clinical serum samples, so that the expression of the miRNA200 cluster microRNA is remarkably reduced in the process of Alzheimer disease, and the miRNA200 cluster microRNA can be used as a new Alzheimer disease marker for the auxiliary diagnosis of Alzheimer disease;
the invention finds that the micro RNA of the miRNA200 cluster participates in the pathological process of AD and plays a neuroprotective effect of resisting A β toxicity through two ways of (1) directly acting on BETA CE1 mRNA to reduce the excessive generation and accumulation of cells A β, (2) acting on PRKACB to inhibit the hyperphosphorylation of cell tau protein and improve the apoptosis caused by A β toxicity and the activation of caspase-3 and Bax signal molecules.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below. It should be apparent that the drawings in the following description are merely exemplary, and that other embodiments can be derived from the drawings provided by those of ordinary skill in the art without inventive effort.
FIG. 1 shows that the miRNA chip technology of the invention detects the differential expression of miR-200a in brain tissues of APP/PS1 dual transgenic animals and wild animals;
FIG. 2 shows the expression detection of miR-200a of the invention in the serum of AD model cells, AD model animals, naturally aged animals and AD patients;
FIG. 3 is a graph of the effect of miR-200a of the present invention on neural cell viability and neural cell apoptosis;
FIG. 4 is a diagram showing that miR-200a of the invention negatively regulates the expression of BACE1 mRNA 3' UTR through specific targeting;
FIG. 5 is a diagram showing that miR-200a of the present invention negatively regulates the expression thereof by specifically targeting PRKACB mRNA 3' UTR;
FIG. 6 is a graph of the effect of miR-200a expression up-or down-regulation on apoptosis-associated protein, beta amyloid production, and tau protein phosphorylation levels of the present invention;
FIG. 7 is a graph showing the effect of over-expressing BACE1 or PRKACB reversible miR-200a of the present invention on the regulation of neuronal apoptosis, beta amyloidogenesis and tau protein phosphorylation.
Detailed Description
Other advantages and features of the present invention will become readily apparent to those skilled in the art from the following detailed description, wherein it is to be understood that the invention is not limited to the specific embodiments disclosed, but is to be construed as limited only by the appended claims. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
In the context of the present invention, the term "expression level" refers to a measured expression level compared to a value from a reference nucleic acid (e.g., from a control), or compared to a calculated average expression value (e.g., in an RNA chip analysis). A certain "expression level" can also be determined as a result (result) and by comparison and measurement of several nucleic acids of interest disclosed below, and exhibits the relative abundance of these transcripts with respect to each other. Expression levels can also be assessed relative to expression in different tissues, patients versus healthy controls, and the like.
In the context of the present invention, a "sample" or "biological sample" is a sample that originates from or has been contacted with a biological student object. Examples of biological samples are: cells, tissues, body fluids, biopsy samples, blood, urine, saliva, sputum, plasma, serum, cell culture supernatant, and the like.
A "gene" is a nucleic acid segment that contains the information necessary to produce a functional RNA product in a controlled manner. A "gene product" is a biological molecule, such as an mRNA or translated protein, produced by transcription or expression of a gene.
"miRNA" is a short, naturally occurring RNA molecule and should have a general meaning as understood by those skilled in the art. "miRNA-derived molecules" are molecules, such as cDNAs, that are chemically or enzymatically obtained from miRNA templates.
As used herein, the term "array" refers to an arrangement of addressable locations on a device (e.g., a chip device). The number of locations may vary from a few to at least several hundred or thousand. Each position represents an independent reaction site. Arrays include, but are not limited to, nucleic acid arrays, protein arrays, and antibody arrays. "nucleic acid array" refers to an array containing nucleic acid probes (such as oligonucleotides, polynucleotides, or larger portions of genes). The nucleic acids on the array are preferably single stranded.
"PCR-based method" refers to a method comprising polymerase chain reaction PCR. This is a method for the exponential amplification of nucleic acids "such as DNA or RNA" by enzymatic replication in vitro using one, two or more primers. For RNA amplification, reverse transcription can be used as the first step. PCR-based methods include kinetic or quantitative PCR (qpcr), which is particularly suitable for analyzing expression levels. When it is effected the determination of the expression level, it is possible, for example, to use a PCR-based method for detecting the presence of a given mRNA, which reverse transcribes a complete mRNA pool (the so-called transcriptome) into cDNA with the aid of a reverse transcriptase, and detects the presence of a given cDNA with the aid of corresponding primers. This method is commonly referred to as reverse transcriptase pcr (rtpcr).
In the present invention, the term "PCR-based method" encompasses both endpoint PCR applications and kinetic/real-time PCR techniques employing special fluorophores or intercalating dyes that emit fluorescent signals as a function of the amplified target and allow monitoring and quantification of the target.
In the present invention, the term "marker" or "biomarker" refers to a biological molecule, e.g., a nucleic acid, peptide, protein, hormone, etc., whose presence or concentration can be detected and correlated with a known condition (such as a disease state) or clinical outcome (such as response to treatment).
Example 1 detection of differential expression of miR-200a in brain tissues of AD model animals and wild type animals by miRNA chip technology
Selecting 1, 3, 6 and 9-month-old APP/PS1 double-transgenic mice respectively, extracting brain tissue RNA of the mice and carrying out Hy3TM and Hy5TM fluorescent labeling on miRNA, wherein the miRNA200 a cluster microRNA is hsa-miR-200a, and the sequence of the miRNA200 a cluster microRNA is shown in SEQ ID NO. 1: ccgggccccu gugagcaucu uaccggacag ugcuggauuu cccagcuugacucuaacacugucugguaac gauguucaaa ggugacccgc are provided. The sequence of a default mature body (hsa-miR-200a-3p) is shown in SEQ ID NO. 2: uaacacuguc ugguaacgau gu, respectively. Wherein, mature body (hsa-miR-200a-3p) miRNA reverse transcription primer: SEQ ID NO. 3: gtcgtatcca gtgcagggtc cgaggtattc gcactggatacgacacatcg, respectively; quantitative pcr (qpcr) forward primer: SEQ ID NO. 4: gcgcgtaaca ctgtctggta a, respectively; reverse primer: SEQ ID No. 5: agtgcagggt ccgaggtatt are provided. The samples were then hybridized to miRCURYTM Array chips, the chips scanned using the Axon GenePix 4000B chip scanner, and raw data analysis was performed using GenePix pro V6.0 software. As shown in the results of the chip in FIG. 1, miR-200a has continuous down-regulation expression in the brains of APP/PS1 mice at 1, 3, 6 and 9 months of age compared with the brains of the control groups at the same age (mean + -SEM, n is 3, fold change > 2).
Example 2 expression Change of miR-200a in AD mode cells
The method comprises the steps of stably transfecting Swedish mutant APP genes into SH-SY5Y cells to construct an APPswe cell stable transformant, wherein the APPswe cells generate A β in a large amount under the stimulation of copper ions to cause apoptosis, and the APPswe cell stable transformant is one of cell models commonly used for AD.A 300 mu M copper ion-damaged APPswe cells are used for establishing an AD cell model, and cell RNA is extracted to detect the expression quantity of miR-200 a.As shown in A in figure 2, compared with normal control SH-SY5Y cells, the expression of miR-200a in the APPswe cells is remarkably reduced (mean +/-SEM, n is 3, and P is less than 0.01), and the miR-200a is related to A β damage.
Example 3 expression Change of miR-200a in AD model animals and naturally aging animals
APP/PS1 mice are a common transgenic mouse model of AD, and the SAMP8 mice belong to naturally aging mice and are commonly used to detect the altered characteristics and associated mechanisms of degenerative diseases in aging-related studies. RNA was extracted from hippocampal tissue of 3, 6, and 9 month-old APP/PS1 double transgenic mice and their Wild Type (WT) control mice (purchased from Nanjing university institute of model animals), SAMP8 mice and their control mice (SAMR1) (provided by institute of genetics and development biology, Chinese academy of sciences), and miR-200a expression was detected by qPCR. As shown in fig. 2B, miR-200a expression was decreased in hippocampus of APP/PS1 mice at 3, 6, and 9 months of age, with significant differences at 9 months of age compared to WT mice at the same month of age (mean ± SEM, n ═ 3, × P < 0.05); as shown in fig. 2C, the content of miR-200a was significantly reduced in the hippocampus of SAMP8 mice at 3, 6, and 9 months of age, compared to SAMR1 mice at the same month of age (mean ± SEM, n ═ 3, × P <0.05, × P < 0.01).
Example 4 expression Change of miR-200a in serum of AD patient
Since miRNA is only about 20 bases, can freely cross blood brain barrier, and can be widely distributed in tissue fluid such as blood, cerebrospinal fluid and the like, blood detection is also an ideal detection means. In order to verify the change of miR-200a in blood of AD patients, serum of 7 patients clinically diagnosed with AD and 5 healthy old people with similar ages were extracted and verified by a qPCR (quantitative polymerase chain reaction) technology. The detection result is shown in D in figure 2, the content of free miR-200a in the serum of the AD patient is obviously lower than that of a healthy person (mean + -SEM, n is 5-7, and P is less than 0.05). Therefore, miR-200a has a close relationship with the onset of AD, the pathological mechanism involved in miR-200a is deeply researched, and experimental basis can be provided for the new target point of diagnosis and treatment of AD.
Example 5 Effect of miR-200a expression changes on neural cell viability
In order to determine whether the miR-200a plays a role in neuroprotection, miR-200amimics or inhibitor is transfected in an APPswe cell, and an MTS colorimetric method is selected for cell viability detection. As shown in a in fig. 3, overexpression of miR-200a significantly increased cell survival (mean ± SEM, n ═ 3 × P <0.01), while inhibition of miR-200a expression significantly decreased cell survival (mean ± SEM, n ═ 3 × P < 0.001).
Example 6 Effect of miR-200a expression changes on apoptosis of neural cells
And detecting the effect of miR-200a on APPswe cell apoptosis by a flow cytometer. As shown in fig. 3B-C, miR-200a overexpression can significantly inhibit apoptosis of APPswe cells, including early, late and total apoptosis (mean ± SEM, n ═ 3, P <0.05), whereas inhibition of expression of miR-200a significantly promotes apoptosis of cells (mean ± SEM, n ═ 3, P < 0.001).
Example 7 binding of miR-200a to BACE1
BACE1(β -secretase 1), also known as amyloid precursor protein β catabolic enzyme 1, was first discovered using bioinformatics software analysis to bind to site of miR-200a, which is conserved in human, rat, mouse, pig, cow, cat, dog, etc., as shown in A in FIG. 4. based on the binding site, as shown in B in FIG. 4, wild-type luciferase reporter gene expression plasmid (Luc-BACE1-WT) and mutant expression plasmid (Luc-BACE1-MUT) were constructed to verify the specificity of miR-200a binding to BACE 13' UTR sequence. after co-transfecting the expression plasmid with miR-200a mimics into HEK293 cells for 36h, FIREFlY and Renilla luciferase activity was detected using dual luciferase reporter gene detection system (Promega). As shown in C in FIG. 4, miR-200a was found to significantly reduce the signal value of the Luc-1-plasmid, but did not affect the specific binding of BACE-200. BACE < BACE + 9. the mutant protein No. 10 + SEM 19.
Example 8 regulatory Effect of miR-200a on BACE1
miR-200a mimics/inhibitor is transfected in an AD mode cell to establish a cell model with miR-200a expression up-regulated or down-regulated, and the change of BACE1 mRNA and protein expression in the cell is detected. As shown in D-F in fig. 4, miR-200a overexpression significantly reduced expression of BACE1 protein, while inhibition of miR-200a significantly increased expression of BACE1 protein (mean ± SEM, n ═ 3, × P <0.05, × P <0.01) compared to the control group; however, miR-200a had no effect on BACE1 mRNA expression (mean ± SEM, n ═ 3). This suggests that miR-200a regulates BACE1 protein levels at post-transcriptional levels, but has no effect at the genetic level.
Example 9 binding of miR-200a to human cAMP-dependent protein kinase catalytic subunit β Gene (PRKACB)
Similarly, miR-200a has recognition sites with PRKACB 3' UTR and is conserved in various species as shown in A in FIG. 5, analyzed by bioinformatics prediction software such as TargetScan and MiRanda. Luc-PRKACB-WT and Luc-PRKACB-MUT expression plasmids were constructed as B in FIG. 5, and the specificity of miR-200a binding to PRKACB 3' UTR terminal was verified. As shown in fig. 5C, miR-200a overexpression significantly reduced the signal value of the wild-type plasmid (Luc-PRKACB-WT) luciferase, while there was no effect on the luciferase signal value of the post-mutation plasmid (Luc-PRKACB-MUT) (mean ± SEM, n ═ 4,. P <0.001), demonstrating that miR-200a can specifically bind to PRKACB.
Example 10 Regulation of PRKACB by miR-200a
Similarly, to examine the effect of miR-200a on PRKACB transcription, as shown in D-F in fig. 5, miR-200a overexpression significantly decreased PRKACB mRNA and protein content, while miR-200a knock-down significantly increased PRKACBmRNA and protein levels (mean ± SEM, n ═ 3, × P <0.01, × P <0.001) compared to the control group. Therefore, miR-200a can simultaneously regulate PRKACB gene and protein level, and cause gene degradation and translation inhibition.
Example 11, upregulation or downregulation of miR-200a expression on apoptosis-related protein, A β1-42Production and Effect of tau phosphorylation levels
Based on the influence of the miR-200a on apoptosis, apoptosis factors are further detected. As shown in A-C in FIG. 6, miR-200a is over-expressed in the APPswe cell, and the expression of caspase-3 and Bax and the expression of active caspase-3 are remarkably reduced; conversely, when miR-200a expression decreased, caspase-3 and Bax expression also increased significantly (mean ± SEM, n ═ 4,. P <0.05,. P <0.01,. P < 0.001).
Aβ1-42The recombinant plasmid is generated by sequentially cutting BETA ALPHA CE1 and gamma-secretase, can cause intracerebral inflammatory reaction, causes apoptosis and even death of nerve cells, and is one of main causes of AD, as shown in D in figure 6, APPswe cells are transfected with miR-200a mimics, and compared with a control group, the recombinant plasmid remarkably inhibits A β1-42The transfection of miR-200ainhibitor obviously improves the intracellular A β1-42Content of (mean + -SEM, n-4, P)<0.05). The results suggest that miR-200a regulates A β in APPswe cells1-42The expression of (a) exerts a neuroprotective effect.
tau protein hyperphosphorylation is another important pathological feature of AD, expression levels of key phosphorylation sites of tau protein phosphorylation sites Ser202/Thr205(AT8), Ser214, Ser396 and Ser356 and the like are detected by using Western blot, and the effect of miR-200a on tau protein phosphorylation is researched. As shown in E-F in fig. 6, overexpression of miR-200a significantly down-regulated the expression of phosphorylated tau at the above sites; inhibition of miR-200a expression resulted in a significant increase in the expression of the phosphorylated tau protein described above (mean ± SEM, n ═ 4,. P <0.05,. P <0.01,. P < 0.001). The results prove that miR-200a can regulate phosphorylation of tau protein.
Example 12 overexpression of BACE1 or PRKACB reversible miR-200 modulates neuronal apoptosis, A β1-42Effect of Generation and phosphorylation levels of tau protein
BACE1 and PRKACB were first overexpressed in APPunwe cells, respectively, and changes in miR-200a neuroprotective effect were observed. As shown in a-B flow results in fig. 7, the apoptosis rate of nerve cells was significantly increased after overexpression of BACE1 and PRKACB, and when miR-200a acted simultaneously with BACE1 or PRKACB, BACE1 and PRKACB could reverse the anti-apoptotic effect of miR-200a (mean ± SEM, n is 3, P is P, P is n ═ P, n is 3, P is n is P, n is P is n is P, n is<0.05,**P<0.01,***P<0.001,$P<0.05). Also, as shown in C-D in fig. 7, simultaneous overexpression of miR-200a with BACE1 or PRKACB in APPswe cells reversed the reduction of intracellular active caspase-3 (mean ± SEM, n-4, P ═ P)<0.001,$$$P<0.001). Thus, BACE1 and PRKACB are specific target genes of miR-200a playing neuroprotective effect.
Secondly, miR-200a and BACE1 or PRKACB are transfected in APPswe cells at the same time, and the relevance of inhibiting A β generation and tau protein phosphorylation by miR-200a and targeting BETA CE1 and PRKACB is verified, as shown in E-G in FIG. 7, (1) BACE1 can specifically reverse the effect of miR-200a in antagonizing A β generation (mean + -SEM, n-4, P-P)<0.05,$P<0.05); (2) PRKACB can reverse the effect of miR-200a in inhibiting phosphorylation levels of tau protein Ser202/Thr205, Ser214, Ser396 and Ser356 sites (mean + -SEM, n is 3, P is one of<0.01,***P<0.001,$P<0.05,$$P<0.01) it is thus clear that the neuroprotective effect of miR-200a in the pathological progression of AD is achieved by reducing a β production by targeting BETA CE1 and reducing tau hyperphosphorylation by targeting PRKACB.
The test results of embodiments 1 to 12 of the present invention show that the expression of the microRNA of the miRNA200 cluster is significantly reduced in the pathological process of Alzheimer's disease, and the generation of A β, tau protein hyperphosphorylation and apoptosis-like degeneration in AD pathology are improved by negatively regulating the expression of BACE1 and PRKACB, and the microRNA of the miRNA200 cluster is expected to become a new target for Alzheimer's disease diagnosis and treatment.
Although the invention has been described in detail above with reference to a general description and specific examples, it will be apparent to one skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Reference documents:
[1]Ulep,M.G.,Saraon,S.K.,McLea,S.(2018).Alzheimer Disease.J NursePrac 14(3):129-135.doi:10.1016/j.nurpra.2017.10.014
[2]Ratnadiwakara,M.,Mohenska,M.,
M.L.(2018)Splicing factors asregulators of miRNA biogenesis-links to human disease.Semin.Cell Dev Biol.79:113-122.doi:10.1016/j.semcdb.2017.10.008
[3]Yan,R.,Vassar,R.(2014)Targeting theβsecretase BACE1 for Alzheimer's disease therapy.Lancet Neurol 13(3):319-329.doi:10.1016/S1474-4422(13)70276-X.
[4]Mondragon-Rodriguez,S.,Perry,G.,Luna-Munoz,J.,Acevedo-Aquino,M.C.,Williams,S.(2014).Phosphorylation of tau protein at sites Ser(396-404)is oneof the earliest events in Alzheimer’s disease and Down syndrome.Neuropathol.Appl.Neurobiol.40(2),121-135.doi:10.1111/nan.12084
[5]Martin,L.,Latypova,X.,Wilson,C.M.,Magnaudeix,A.,Perrin,M.L.,Yardin,C.,Terro,F.(2013)Tau protein kinases:Involvement in Alzheimer'sdisease.Ageing Res Rev.12(1):289-309.doi:10.1016/j.arr.2012.06.003.
[6]Jicha,G.A.,Weaver,C.,Lane,E.,Vianna,C.,Kress Y.,Rockwood,J.,Davies,P.(1999)cAMP-Dependent Protein Kinase Phosphorylations on Tau inAlzheimer’s Disease.J Neurosci.19(17):7486-7494.
[7]Bilkei-Gorzo,A.(2014)Genetic mouse models of brain ageing andAlzheimer's disease.Pharmacol Ther.142(2):244-257.doi:10.1016/j.pharmthera.2013.12.009.
[8]Butterfield,D.A.,Poon,H.F.(2005)The senescence-accelerated pronemouse(SAMP8):a model of age-related cognitive decline with relevance toalterations of the gene expression and protein abnormalities in Alzheimer'sdisease.Exp Gerontol.40(10):774-783.doi:10.1016/j.exger.2005.05.007.
sequence listing
<110> institute of medical and Biotechnology of Chinese academy of medical sciences
Application of <120> miRNA200 cluster as marker for diagnosing and/or treating Alzheimer's disease
<130>GG20734504A
<160>5
<170>SIPOSequenceListing 1.0
<210>1
<211>90
<212>RNA
<213>Homo sapiens
<400>1
ccgggccccu gugagcaucu uaccggacag ugcuggauuu cccagcuuga cucuaacacu 60
gucugguaac gauguucaaa ggugacccgc 90
<210>2
<211>22
<212>RNA
<213>Homo sapiens
<400>2
uaacacuguc ugguaacgau gu 22
<210>3
<211>50
<212>DNA
<213>Artificial Sequence
<400>3
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacacatcg 50
<210>4
<211>21
<212>DNA
<213>Artificial Sequence
<400>4
gcgcgtaaca ctgtctggta a 21
<210>5
<211>20
<212>DNA
<213>Artificial Sequence
<400>5
Claims (8)
- Use of the miRNA200 cluster as a marker for diagnosis and/or treatment of alzheimer's disease.
- 2. The use according to claim 1,the miRNA200 cluster is selected from hsa-miR-200a, and the nucleotide sequence of the miRNA is shown in SEQ ID No. 1;the miRNA200 cluster is selected from hsa-miR-200a-3p, and the nucleotide sequence of the miRNA is shown in SEQ ID NO. 2.
- 3. The use according to claim 1,the miRNA200 cluster primer is used for preparing a detection kit;the test kit is useful for providing a diagnosis of Alzheimer's disease, predicting the risk of developing Alzheimer's disease, or predicting the outcome of Alzheimer's disease in a patient suffering from or at risk of developing Alzheimer's disease.
- 4. The use according to claim 3,the primers are used to determine the expression level of the miRNA200 cluster in a sample.
- 5. The use according to claim 4,the sample is serum of a patient.
- 6. The use according to claim 4,the expression level of the miRNA200 cluster is the expression level of the miRNA200 cluster of the patient and the reference expression level of the healthy miRNA200 cluster;if the expression level of the miRNA200 cluster is significantly reduced compared to a reference expression level of a healthy human miRNA200 cluster, the patient is indicated to have or be at risk of developing Alzheimer's disease.
- 7. The use according to claim 4,the determination of the expression level of the miRNA200 cluster is a sequencing-based method, an array-based method, or a PCR-based method.
- Application of an agonist of miRNA200 cluster in preparation of a medicament for treating Alzheimer disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010112719.XA CN111269977A (en) | 2020-02-24 | 2020-02-24 | Application of miRNA200 cluster as marker for diagnosing and/or treating Alzheimer disease |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010112719.XA CN111269977A (en) | 2020-02-24 | 2020-02-24 | Application of miRNA200 cluster as marker for diagnosing and/or treating Alzheimer disease |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111269977A true CN111269977A (en) | 2020-06-12 |
Family
ID=70995393
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010112719.XA Pending CN111269977A (en) | 2020-02-24 | 2020-02-24 | Application of miRNA200 cluster as marker for diagnosing and/or treating Alzheimer disease |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111269977A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115192710A (en) * | 2022-05-27 | 2022-10-18 | 华南理工大学 | Application of miRNA-200s protective agent in preparation of nervous system disease drugs, drugs and model construction method |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008153692A2 (en) * | 2007-05-22 | 2008-12-18 | The Brigham And Women's Hospital, Inc. | Microrna expression profiling of cerebrospinal fluid |
| WO2009009457A1 (en) * | 2007-07-06 | 2009-01-15 | University Of Louisville Research Foundation, Inc. | Alzheimer's disease-specific micro-rna microarray and related methods |
| WO2011127625A1 (en) * | 2010-04-13 | 2011-10-20 | 江苏命码生物科技有限公司 | Method for regulating microrna content in organisms and uses thereof |
| US20140303025A1 (en) * | 2013-03-15 | 2014-10-09 | The Translational Genomics Research Institute | Methods for the diagnosis and prognosis of neurodegenerative diseases |
| WO2015012541A2 (en) * | 2013-07-26 | 2015-01-29 | 경상대학교산학협력단 | Kit for early diagnosis of alzheimer's dementia |
| WO2017186719A1 (en) * | 2016-04-25 | 2017-11-02 | Instytut Biologii Doswiadczalnej Im. Marcelego Nenckiego Polska Akademia Nauk | Microrna biomarkers in blood for diagnosis of alzheimer's disease |
| CN110791560A (en) * | 2019-11-06 | 2020-02-14 | 中国医学科学院医药生物技术研究所 | miRNA marker for diagnosing and/or treating Alzheimer disease |
-
2020
- 2020-02-24 CN CN202010112719.XA patent/CN111269977A/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008153692A2 (en) * | 2007-05-22 | 2008-12-18 | The Brigham And Women's Hospital, Inc. | Microrna expression profiling of cerebrospinal fluid |
| WO2009009457A1 (en) * | 2007-07-06 | 2009-01-15 | University Of Louisville Research Foundation, Inc. | Alzheimer's disease-specific micro-rna microarray and related methods |
| WO2011127625A1 (en) * | 2010-04-13 | 2011-10-20 | 江苏命码生物科技有限公司 | Method for regulating microrna content in organisms and uses thereof |
| US20140303025A1 (en) * | 2013-03-15 | 2014-10-09 | The Translational Genomics Research Institute | Methods for the diagnosis and prognosis of neurodegenerative diseases |
| WO2015012541A2 (en) * | 2013-07-26 | 2015-01-29 | 경상대학교산학협력단 | Kit for early diagnosis of alzheimer's dementia |
| WO2017186719A1 (en) * | 2016-04-25 | 2017-11-02 | Instytut Biologii Doswiadczalnej Im. Marcelego Nenckiego Polska Akademia Nauk | Microrna biomarkers in blood for diagnosis of alzheimer's disease |
| CN110791560A (en) * | 2019-11-06 | 2020-02-14 | 中国医学科学院医药生物技术研究所 | miRNA marker for diagnosing and/or treating Alzheimer disease |
Non-Patent Citations (2)
| Title |
|---|
| NINA ZIDAR 等: "Down-regulation of microRNAs of the miR-200 family and up-regulation of Snail and Slug in inflammatory bowel diseases — hallmark of epithelial mesenchymal transition", 《J. CELL. MOL. MED.》 * |
| SALIMIAN, N.等: "Modulation in miR-200a/SIRT1axis is associated with apoptosis in MPP(+)-induced SH-SY5Y cells.", 《GENE》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115192710A (en) * | 2022-05-27 | 2022-10-18 | 华南理工大学 | Application of miRNA-200s protective agent in preparation of nervous system disease drugs, drugs and model construction method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111518884B (en) | Application of miRNA30 cluster as Alzheimer disease diagnostic marker | |
| CN110791560B (en) | miRNA marker for diagnosing and/or treating Alzheimer disease | |
| KR20180039629A (en) | Detection of chromosomal interactions | |
| WO2004003198A1 (en) | Method of examining allergic disease and drug for treating the same | |
| CN109837340B (en) | Peripheral blood gene marker for noninvasive diagnosis of lung cancer | |
| KR101873249B1 (en) | Method for diagnosing dementia using blood-derived cellular gene expression pattern | |
| AU2021101144A4 (en) | Use of miRNA 148 Cluster as Marker for Diagnosing and/or Treating Cognitive Impairment-Associated Diseases | |
| US20060040315A1 (en) | Methods for detecting neurological disorders | |
| KR101939368B1 (en) | Diagnostic biomarker for alzheimer's disease and use thereof | |
| WO2009144480A1 (en) | Treatment and diagnosis of behavioural disorders | |
| KR101998457B1 (en) | A biomarker for diagnizing alzheimers disease | |
| CN111269977A (en) | Application of miRNA200 cluster as marker for diagnosing and/or treating Alzheimer disease | |
| KR102105016B1 (en) | Method for Diagnosing Alzheimer's disease Using microRNA-485-3p | |
| AU2020103707A4 (en) | miRNA MARKER FOR DIAGNOSIS AND TREATMENT OF ALZHEIMER'S DISEASE | |
| US20090260092A1 (en) | Methods of diagnosing alzheimer's disease and markers identified by set association | |
| EP1514118A2 (en) | Diagnostic and therapeutic use of ras-gtpase-activating sh3-domain-binding protein 2 (g3bp2) for neurodegenerative diseases | |
| CN111944809B (en) | Diagnostic marker for Parkinson's disease and application thereof | |
| KR100944636B1 (en) | A novel dopaminergic neuronal dj-1 knockout cell line for diognostic markers | |
| KR20200043322A (en) | Method for Diagnosing Alzheimer's disease Using microRNA-485-3p | |
| KR20180078783A (en) | A novel miRNA for diagnosing Alzheimer’s disease | |
| KR102320882B1 (en) | Biomarker for diagnosing alcoholism according to gender and Use thereof | |
| KR101130886B1 (en) | A novel dopaminergic neuronal DJ-1 knockout cell line for diognostic markers | |
| CN115838721A (en) | lncRNA-HRAT and application thereof | |
| Wong et al. | microRNA and mRNA expression networks in Duchenne muscular dystrophy | |
| KR20100107385A (en) | A novel dopaminergic neuronal dj-1 knockout cell line for diognostic markers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200612 |