AU2020103896A4 - A detection kit and method for haemophilus parasuis - Google Patents
A detection kit and method for haemophilus parasuis Download PDFInfo
- Publication number
- AU2020103896A4 AU2020103896A4 AU2020103896A AU2020103896A AU2020103896A4 AU 2020103896 A4 AU2020103896 A4 AU 2020103896A4 AU 2020103896 A AU2020103896 A AU 2020103896A AU 2020103896 A AU2020103896 A AU 2020103896A AU 2020103896 A4 AU2020103896 A4 AU 2020103896A4
- Authority
- AU
- Australia
- Prior art keywords
- hps
- detection kit
- pcr
- mvin
- results
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a detection kit and method for Haemophilusparasuis, it belongs
to the technical field of molecular biology. The detection kit comprises primer pairs,
PCR Mix, positive control and ddH20. In the invention, the primer pair designed aiming
at mviN gene sequences with highly conserved regions, has good specificity, It can
accurately distinguish Haemophilus parasuis LC strain from Haemophilus
paragallinarum, Actinobacillus pleuropneumoniae, Pasteurella, Cryptococcus
pyogenes, Staphylococcus aureus and Streptococcus suis; In addition, the detection kit
and method provided by the invention have high sensitivity, short time consumption
and high accuracy, and are of great significance for monitoring the reproduction,
occurrence and prevalence of the bacteria and timely prevention and treatment of
diseases.
-1/5
M 1 2 3 4 5 6
2000bp
1000bp) S3h
750hp
500bp
250bp
100hp
Fig. 1
Selection results of test primers
Description
-1/5
M 1 2 3 4 5 6 2000bp S3h 1000bp) 750hp 500bp 250bp 100hp
Fig. 1
Selection results of test primers
The invention relates to a test kit, specifically to a detection kit and method for
Haemophilusparasuis,it belongs to the technical field of molecular biology.
Haemophilusparasuis (HPS) is a kind of NAD-dependent, immobile Gram-negative
parvobacillus, belonging to Haemophilus of Pastteurellaceafamily, with 15 serotypes,
and 20% of the serotypes of the strains can not be determined. This bacteria can cause
porcine polyserositis, arthritis and meningitis, and Haemophilus parasuis disease
caused by this strain is also called Glisser's disease. HPS can affect pigs aged from 2
weeks to 4 months, mainly before and after weaning and in nursery stage. It is common
in 5-8 weeks old, with an incidence rate of 40% and the mortality rate can reach 50%
when the situation is severe. With the development of large-scale pig farms in China,
HPS infection has an obvious increasing trend, which has become one of the important
reasons for the increase of morbidity and mortality of piglets in pig farms, causing huge
economic losses to pig industry in China every year. Therefore, the establishment of a
detection technology for HPS is of great significance for monitoring the reproduction,
occurrence and prevalence of the disease and timely prevention and treatment of the
disease.
Conventional physiological and biochemical methods can accurately identify the
strains samples, but they are cumbersome and time consuming. China patent
CN102220426A discloses a PCR test kit for HPS, which is a primer designed for the
traditional 16SrRNA sequence, and has poor specific effect on other members of
Pasteurella family and Haemophilus genus (such as Pasteurella, Haemophilus
paragallinarum,etc.), and its sensitivity still needs to be improved.
Aiming at the problems of the existing technologies, the invention aims to provide a
detection kit for HPS with strong specificity, high sensitivity, short time consumption,
high accuracy and effectiveness.
The technical scheme adopted by the invention in order to realize the above purpose is
as follows: the invention provides a detection kit of HPS, which comprises a primer
pair Fl and R with a sequence shown as SEQ ID NO: 1-2, each of which is 100pL,
1.25mL of 2 X PCR Mix, 200pL of positive control HPS DNA and 2 X 1.25mL of
ddH20;
The sequence of that primer pair is as follows:
mviN-F1 5'GGTATGACCCTACTTTCTCG 3'
mviN-R1 5'TTAATTTACCTTGAATGATCTTATT 3'
The use times of the test kit are 100 times.
Furthermore, the PCR Mix includes PCR buffer solution, dNTP, Pfu DNA
polymerase.
The invention also provides a test method for HPS, which is a method for testing HPS
by using the above test kit.
The test method including the following steps:
a, sample DNA extraction: extract DNA from the sample to be tested for later use;
b, gene amplification: the extracted sample DNA is added into the test kit, and operate
PCR amplification to the DNA in the sample to be tested.
c, result detection: the results of DNA amplification are detected by agarose gel
electrophoresis.
Furthermore, in step a, the sample to be detected is a bacterial isolated culture, a tissue
grinding fluid or a blood sample.
Furthermore, in step b, the conditions of PCR amplification are: 95C 5min; 95C
s; 55C 45s; 72C 90s, 32 cycles; 72°C 10min; 4C preservation.
In the test kit of the invention, the negative control is sterilized water (ddH20), and
the positive control is HPS DNA.
The primer with good specificity and high sensitivity in the invention is the key factor
for realizing the purpose of the invention. In order to overcome the disadvantage of
poor specificity of the results of traditional primers designed for 16SrRNA sequence
on testing Pasteurella multocida, Haemophilus paragallinarumand so on, in the
invention, a primer with good specificity and high sensitivity is designed aiming at the
mviN gene sequence, and the mviN gene has its own uniqueness, exists in many
microorganisms which are pathogenic to humans, animals and plants, and has a highly
conservative region, so that the accuracy is high when being used for HPS detection.
The advantages and beneficial effects of the invention are that the primers designed
for mviN gene sequences with highly conserved regions have good specificity and can
accurately distinguish HPS LC strain from Haemophilus paragallinarum,
Actinobacillus pleuropneumoniae, Pasteurella, Cryptococcus pyogenes,
Staphylococcus aureus and Streptococcus suis; In addition, the kit provided by the
invention has high sensitivity, can detect samples with the DNA of HPS not less than
100 * 10-5ng/pL, and has short time consumption and high accuracy and effectiveness
of detection.
Fig. 1: Selection results of test primers
M: Marker DL2000; 1: Solid culture (primer pair Fl/Ri); 2: Liquid culture (primer
pair Fl/Ri); 3: Solid culture (primer pair F2/R2); 4: Liquid culture (primer pair
F2/R2); 5: Positive control; 6: Negative control.
Fig. 2: PCR specificity test results of mviN gene of HPS
M: Marker DL2000; 1: HPS LC strain; 2: Haemophilus paragallinarum;3: Porcine
Actinobacillus pleuropneumoniae; 4: Pasteurella; 5: Arcanobacterium pyogenes; 6:
Staphylococcus aureus; 7: Streptococcus suis; 8: Negative control.
Fig. 3: PCR sensitivity test results of mviN gene of HPS
M: Marker DL2000; 1: 100x 1Ing/pL; 2: OOx10-2ng/pL; 3: OOxO-3ng/L; 4:
100x10-4ng/pL; 5: 1OOx1O-5ng/pL; 6: 1OOx1O-6 ng/pL; 7: OOx1O-7ng/pL; 8: Negative
control.
Fig. 4: Detection results of HPS in dead pig tissue samples
M: Marker DL2000; 1: Tissue sample of dead pig No.1; 2: Tissue sample of dead pig
No.2; 3: Negative control; 4: Positive control.
Fig. 5: Sequencing results of tissue amplification products of dead pig No.1.
The above content of the present invention will be further described in detail with
specific examples of embodiments below, but it does not mean that the scope of the
above subject matter of the present invention is limited to the following embodiments.
Materials and reagents required by the invention
1. Strains
HPS LC strain, Haemophilus paragallinarum, Porcine Actinobacillus
pleuropneumoniae, Pasteurella,Arcanobacterium pyogenes, Staphylococcus aureus,
Streptococcus suis were isolated, identified and preserved in our laboratory.
2. Reagents
TSA culture medium: 40g of TSA powder is weighed and added into 940ml distilled
water, and sterilized at 121°C for 15min. Cool to about 50°C, add 50ml of newborn
bovine serum and 10ml of 0.1% coenzyme (NAD) solution, shake well, and pour it
into a plate.
TSB culture medium: Weigh 30g TSB powder and add it into 940ml distilled water,
and sterilize it at 121°C for 15min. Add 50ml newborn bovine serum and 10ml
filtered and sterilized NAD solution with concentration of 0.1% before use, mix
evenly for preparation.
PCR mix (PCR buffer solution 800pL, dNTP 400pL, Pfu DNA polymerase 50pL),
SDS solution, protease K, Tris saturated phenol, Trichloromethane, isoamyl alcohol
and absolute ethanol.
Embodiment 1
1. Preparation of DNA template
Liquid culture: The liquid of HPS LC strain was centrifuged at 100OOr/min for 5min,
the supernatant was discarded, resuspended with sterilized water, boiled in boiling
water for 10min, frozen at -20°C, centrifuged at 10000r/min for 5min after melting,
and the supernatant was taken as DNA template.
Solid culture: Several colonies were selected and suspended in 100pL sterilized water.
After evenly blowing, sucking and mixing, boiled in boiling water for 10min, frozen
at -20°C, centrifuged at 100OOr/min for 5min after melting, and the supernatant was
taken as DNA template.
2. Primer design
According to the HPS mviN gene sequence (CP001321.1) published by GenBank,
two pairs of specific primers were designed and sent to Shanghai Sangon Biotech Co.,
Ltd. for synthesis, see Table 1 for the sequence of PCR primer pairs.
Table 1
Phimers (Sequence 5'-3) Fragment length
Primerpair 1 mviN-F1 GGTATGACCCTACTTTCTCG 1533bp mviN-RI TTAATTTACCTTGAATGATCTTATT Primerpair 2 mviN-F2 AATTCCTATTCCAAATCCCT 947bp mviN-R2 TTAATTTACCTTGAATGATCTTATT
2. PCR amplification
The extracted DNA template was amplified by PCR using the designed primers, and
the negative control was ddH20, and the PCR reaction system was 25pL.
The 25pL reaction system is as shown in Table 2
Table2
Components Content Final concentration 2xPCR Mix 12.5pL 1x mviN-F1/F2 (0QpM) 1 iL 0.4pM
mviN-R1/R2 (10pM) 1pL 0.4pM
nA ampter paitl ma 2pL (O.5-5pg) ddH2 O Addto 25mL
PCR amplification reaction procedures are as follows:
°C 5min; 95°C 45s, 55 °C 45s, 72 °C 90s, 32 cycles; 72 °C 10min; 4 °C preservation.
3. Detection and result analysis of PCR products
Adding 5tL amplification product into the sampling hole, and carry out electrophoresis
on 1% agarose gel under the condition of constant voltage of1OOV. Use 1 x TAE buffer solution as electrophoresis solution, put it in the gel imaging system to observe the PCR amplification results, and take photo. The experimental results of primer pairs Fl/Ri and F2/R2 are shown in Fig. 1. The blank control has no amplified bands. Using DNA extracted from solid culture and liquid culture as templates, primer pairs Fl/Ri can amplify the target bands of 1533bp, while primer pairs F2/R2 have no target bands. It can be seen from the experimental results that the design of primers is difficult and the requirements are very high.
The experiment proved that the primer pair Fl/Ri of the invention can accurately
amplify mviN gene of HPS.
4. Detection of primer specificity
Using the designed primer pair Fl/Ri, DNA extracted from HPS LC strain,
Haemophilus paragallinarum, Actinobacillus pleuropneumoniae, Pasteurella,
Cryptococcus pyogenes, Staphylococcus aureus and Streptococcus suis are used as
templates respectively, then operate PCR amplification, and the negative control is
sterilized water, then 5 L of PCR amplification products are added to the sampling
hole, and operate electrophoresis on 1% agarose gel under the condition of constant
pressure of 1OOV, and using 1 x TAE buffer solution as electrophoresis solution, the
PCR amplification results are observed under gel imaging system, and take photo.
As shown in Fig. 2, only HPS showed the target band with the size of 1533bp, while the
other six strains and negative control did not amplify any bands.
The experiment proved that the detection method provided by the invention has strong
specificity and can accurately distinguish HPS from other bacteria.
5. Detection of primer sensitivity
HPS was streak-inoculated into TSA culture medium, cultured at 37°C for 24-48h, and
then washed and mixed with PBS to prepare DNA template. The DNA concentration of
HPS LC strain was detected as 1OOng/pL and gradient dilution was operated according
to 1Ox10Ing/pL, 10x10-2 ng/pL, 10x10 3 ng/pL, 1OOx10-4ng/pL, 10x10 5 ng/pL,
6 1OOx10-ng/pL, 1OOx10-7ng/pL respectively. PCR amplification was carried out by
using the multiple diluted genomic DNA of HPS as template. The template of negative
control was sterilized water. Add 5pL amplification product into the sampling hole, and
carry out electrophoresis on 1% agarose gel under the condition of constant voltage of
1OOV. Use 1x TAE buffer solution as electrophoresis solution, put it in the gel imaging
system to observe the PCR amplification results, and take photo.
The testresults are showninFig. 3. Whenthe template concentrationis 10x10-5 ng/L,
clear target bands can be obtained, and when the template concentration is less than
1OOx10-5ng/4L, no band appears. Therefore, the minimum DNA template
concentration for accurate detection of HPS is 1OOx10-5ng/4L. The test kit provided by
the invention can accurately detect samples of DNA of HPS with a concentration not
less than 1OOx1O-5ng/4L.
The minimum DNA template concentration for accurate detection of HPS is
1OOxO-5ng/L. Which shows that the sensitivity of the detection method of HPS
provided in the invention is high.
Embodiment 2
Using the test kit with good specificity and high sensitivity in Embodiment 1 to detect
HPS in dead animal tissues and blood samples.
1. Preparation of DNA template
DNA templates were prepared from the infected dead pig No.1 and the uninfected dead
pig No.2 respectively. The specific preparation method was as follows: Take out heart,
lung and lymph nodes, add PBS for grinding, incubate at room temperature for 10min,
centrifuge at 5000r/min for 5min, and extract tissue DNA from supernatant. Blood clots
are discarded first, and the liquid is taken for DNA extraction. Add 50pL 10% SDS
solution and 10pL 20ug/ml proteinase K into 500pL tissue supernatant or blood, and
water bath at 56°C for 2h; Add 500pL Tris saturated phenol, mix well, centrifuge at
12000r/min for 15min. Take the supernatant, add the same amount of Tris saturated
phenol : Trichloromethane : Isoamyl alcohol (25:24:1), mix well, centrifuge at 12000
r/min for 15min; Take the supernatant, add the same amount of Trichloromethane :
Isoamyl alcohol (24:1), mix well, centrifuge at 12000r/min for 15min; Collect
supernatant, add 2 times volume of absolute ethanol, standing at -20°C for 20min,
centrifuge at 12000r/ min for 15min, and discard supernatant; Add 70% ethanol to wash
the sediment surface and pipe wall, discard the ethanol, add 20pL sterilized water after
drying to dissolve the sediment, and store it at -20°C for later use.
2. PCR amplification
Respectively take the mentioned DNA as templates, and set a positive control and a
negative control, wherein the positive control template is HPS DNA and the negative control template is sterilized water. Use the test kit provided by the invention, the components are shown in Table 3.
Table 3
Reagents Content
2xPCR Mix 123 pL mviN-F1/R1 (10pM) lpUL
DNATemplates 2pL (0.05-05pg) ddH2O Add to 25mL
PCR amplification reaction procedures are as follows:
°C 5min; 95°C 45s, 55 °C 45s, 72 °C 90s, 32 cycles; 72 C 10min; 4 °C preservation.
3. Detection and result analysis of PCR products
Add 5tL amplification product into sampling hole, and carry out electrophoresis on 1%
agarose gel under the condition of constant voltage of OOV. Use 1xTAE buffer
solution as electrophoresis solution, put it in the gel imaging system to observe the PCR
amplification results, and take photo. Results as shown in Fig. 4, the target band
appeared in the positive control, but not in the negative control. HPS was detected in
pig No.1, but not in pig No.2.
4. Sequencing
The amplified product of dead pig No.1 tissue was sent to Shanghai Sangon Biotech
Co., Ltd. for sequencing, as shown in Figure 5, the sequencing results showed that the
homology of the product band sequence with mviN gene sequence in the whole genome
sequence of HPS SHO165 strain was 99%, and it was identified as HPS.
In the invention, the result of PCR detection is consistent with that of sequencing
method, which shows that PCR method can effectively detect HPS from clinical
samples.
The above embodiments are preferred embodiments of the present invention, but the
operation procedure of the present invention are not limited by the embodiments. Any
other changes, modifications, combinations, substitutions and simplifications made
without departing from the spirit and principles of the present invention shall be
equivalent alternatives, which are included in the scope of protection of the present
invention.
Claims (2)
1. A detection kit and method for Haemophilus parasuis which is characterized by
that it includes primer pair Fl/R1 100pL each, 2 X PCR Mix 1.25mL, positive control
HPS DNA 200pL and ddH20 2 X 1.25mL;
The sequence of the primer pair is as follows:
mviN-F1 5'GGTATGACCCTACTTTCTCG 3'
mviN-RI 5'TTAATTTACCTTGAATGATCTTATT 3'
2. The detection kit and method for Haemophilus parasuis according to Claim 1
which is characterized by that the mentioned 2 X PCR Mix includes PCR buffer
solution, dNTP and Pfu DNA polymerase.
-1/5- 04 Dec 2020 2020103896
Fig. 1
Selection results of test primers
-2/5- 04 Dec 2020 2020103896
Fig. 2
PCR specificity test results of mviN gene of HPS
-3/5- 04 Dec 2020 2020103896
Fig. 3
PCR sensitivity test results of mviN gene of HPS
-4/5- 04 Dec 2020 2020103896
Fig. 4
Detection results of HPS in dead pig tissue samples
-5/5- 04 Dec 2020 2020103896
Fig. 5
Sequencing results of tissue amplification products of dead pig No.1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2020103896A AU2020103896A4 (en) | 2020-12-04 | 2020-12-04 | A detection kit and method for haemophilus parasuis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2020103896A AU2020103896A4 (en) | 2020-12-04 | 2020-12-04 | A detection kit and method for haemophilus parasuis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| AU2020103896A4 true AU2020103896A4 (en) | 2021-02-11 |
Family
ID=74502262
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| AU2020103896A Active AU2020103896A4 (en) | 2020-12-04 | 2020-12-04 | A detection kit and method for haemophilus parasuis |
Country Status (1)
| Country | Link |
|---|---|
| AU (1) | AU2020103896A4 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114805554A (en) * | 2022-04-13 | 2022-07-29 | 西南民族大学 | Refined yolk antibody injection for resisting streptococcus suis and haemophilus parasuis and preparation method thereof |
-
2020
- 2020-12-04 AU AU2020103896A patent/AU2020103896A4/en active Active
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114805554A (en) * | 2022-04-13 | 2022-07-29 | 西南民族大学 | Refined yolk antibody injection for resisting streptococcus suis and haemophilus parasuis and preparation method thereof |
| CN114805554B (en) * | 2022-04-13 | 2023-08-18 | 西南民族大学 | Refined egg yolk antibody injection for resisting streptococcus suis and haemophilus parasuis and preparation method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Waites et al. | Mycoplasma and ureaplasma | |
| Hu et al. | Rapid and sensitive detection of Escherichia coli O157: H7 in bovine faeces by a multiplex PCR | |
| Båverud et al. | Real-time PCR for detection and differentiation of Streptococcus equi subsp. equi and Streptococcus equi subsp. zooepidemicus | |
| CN111118226A (en) | Novel coronavirus whole genome capture method, primer group and kit | |
| CN103642910B (en) | The primer of detection by quantitative Klebsiella pneumonia and probe and application thereof | |
| Gabinaitiene et al. | Mycoplasma bovis and bacterial pathogens in the bovine respiratory tract. | |
| CN101144775B (en) | Bacteria real-time fluorescence quantitative polymerase chain reaction detection reagent kit | |
| Christopher-Hennings et al. | Comparison of two DNA extractions and nested PCR, real-time PCR, a new commercial PCR assay, and bacterial culture for detection of Mycobacterium avium subsp. paratuberculosis in bovine feces | |
| AU2020103896A4 (en) | A detection kit and method for haemophilus parasuis | |
| CN104711359B (en) | Haemophilus parasuis detection kit and detection method thereof | |
| CN107988405B (en) | PCR detection kit for Salmonella indiana and non-diagnostic detection method thereof | |
| KR20200060070A (en) | Human alphacoronavirus universal primer sets for whole genome amplification method and diagnosis kit | |
| CN105154584A (en) | HRM (high-resolution melting) label-free probe method, primer and probe for quickly differentiating PRRSV (porcine reproductive and respiratory syndrome virus) classical strains and mutant strains | |
| CN104531860B (en) | A kind of molecular detecting method of Shigella and its application | |
| AU2020104066A4 (en) | Double fluorescent quantitative RT-PCR detection method for Classical swine fever virus and Bovine viral diarrhea virus | |
| AU2020103778A4 (en) | Primer Set for Detection of Streptococcus agalactiae, Detection Kit and Multiplex PCR Detection Method | |
| CN111334613B (en) | RPA primer pair, probe, kit and detection method for detecting canine adenovirus | |
| CN102154466B (en) | Nucleotides with specificity to internal transcribed spacer(ITS) of neisseria meningitidis and application thereof | |
| CN102424837B (en) | Kit for identifying and distinguishing types of human taeniasis | |
| CN104313163A (en) | Method and kit for triple PCR detection of porcine infectious actinobacillus pleuropneumonia serum types 2, 3 and 6 and application of porcine infectious actinobacillus pleuropneumonia serum types 2, 3 and 6 | |
| EP3438280A1 (en) | Haemoplasma detection method | |
| LU501970B1 (en) | Raa fluorescent primer, probe and detection method for detecting borrelia burgdorferi | |
| Zhang et al. | Development of a dual PCR method for detection of Pasteurella multocida and Haemophilus parasuis | |
| CN111549157B (en) | SYBR Green I fluorescent quantitative PCR detection method of mycoplasma bovis | |
| CN1771331B (en) | stn gene oligonucleotide primers for detecting salmonella species and detection process using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FGI | Letters patent sealed or granted (innovation patent) |