WO2011120398A1 - Joint detection method for leukemia fusion genes and diagnostic kits thereof - Google Patents

Abstract

The invention discloses a joint detection method for leukemia fusion genes and diagnostic kits thereof. After primers and probes for the mRNA of leukemia fusion genes SIL-TAL1(type II, type III), MLL-AF4(e9/e5, e9/e4) and CBFB-MYH11(type D) are designed, the probes are covalently bonded to the beads to form probe-bead mixtures, which are hybridized with the RT-PCR amplification products. After streptavidin-phycoerythrin is added, fluorescent signals from different beads can be detected, and it can be determined whether or not the sample to be detected contains the leukemia fusion genes, as well as the expression profiles of the fusion genes.

Description

[Name of invention established by ISA according to Rule 37.2] Combined detection method of leukemia fusion gene and diagnostic kit thereof Technical Field

 The invention relates to the technical field of in vitro diagnostic detection, in particular to a liquid phase chip combined detection method for a plurality of fusion genes related to leukemia and a diagnostic kit thereof.

Background Art

Leukemia is a hematopoietic malignant tumor caused by abnormal differentiation of hematopoietic stem cells and malignant hyperplasia. It is one of the most common malignant tumors in China. With the continuous development of leukemia research, many leukemia patients have found specific chromosomal translocations, leading to the production of new fusion genes, which have become molecular and biological markers of different types of leukemia. In 2000, WHO's criteria for leukemia typing further classified some common abnormal genes into the criteria for basic diagnosis of leukemia. Therefore, the detection of leukemia-associated fusion genes at the molecular level can not only provide an important basis for leukemia diagnosis, classification, clinical treatment selection and prognosis, but also provide a basis for detection of minimal residual disease in leukemia. .

Common fusion genes in leukemia include BCR-ABL (b2a2) and BCR-ABL (b3a2) in chronic myeloid leukemia (CML); BCR-ABL (e1a2) and E2A- in acute lymphocytic leukemia (ALL). PBX1, TEL-AML1, MLL-AF4 (e10/e4, e9/e5, e9/e4); CBFB-MYH11 (type in acute myeloid leukemia (AML) A, type D), AML1-ETO; PML-RARA (L form), PML-RARA (S) in acute promyelocytic leukemia (APL) Form); SIL-TAL1 (type II, type III) in T cell acute lymphoblastic leukemia (T-ALL).

At present, leukemia mainly relies on cell morphology, immunology, cytogenetics, molecular biology and other detection methods for diagnosis and detection. Cell morphology is influenced by subjective factors, and the coincidence rate of clinical diagnosis is only about 70%. Cytogenetic methods such as karyotyping and banding techniques are screened for chromosomal translocations at the genome-wide level, and are susceptible to the detection of minor abnormalities in many chromosomes. Immunological methods have high false positive rates and false negative rates, and early diagnosis is not possible. Among the methods widely used in molecular biology to detect leukemia fusion genes at home and abroad, fluorescence in situ hybridization (FISH) can only perform qualitative detection and complex operation; fluorescence quantitative PCR has limitations in detecting flux, so it is not yet Really meet the needs of clinical diagnostic testing. Traditional solid-phase biochip technology (Biochip) technology has outstanding weaknesses such as poor repeatability, insufficient sensitivity, and cumbersome operation. Therefore, there is a need for a detection method in the clinic. Rapid, stable and accurate combined detection of multiple fusion genes of leukemia, liquid phase chip (xMAP) technology is such a new detection technology.

The liquid phase chip, also known as the liquid chip, can perform qualitative and quantitative detection on a small number of samples, and has the outstanding advantages of high throughput, simple operation, good repeatability, high sensitivity, and wide linear range. The system is composed of many microspheres as the main matrix. In the manufacturing process of the microspheres, two different red-classified fluorescences are incorporated. According to the ratio of the two kinds of fluorescence, the spherical matrix is divided into 100 types, which can be marked with 100. Different probe molecules can simultaneously detect up to 100 different target molecules in a sample. Depending on the analyte, the surface of the microsphere can be covalently bound to a variety of nucleic acid detection probes. Fluorescent labeling is added as the hybridization reaction proceeds. Different detection microspheres can be added simultaneously in the same reaction system. This allows for rapid, high-throughput testing with a small number of samples. After the reaction, the microspheres are arranged into a single column and flow through the liquid phase chip detector by microfluidic technology. Each microsphere can be detected by two lasers at the same time, and the red laser excites the red classified fluorescence on the microsphere. , the different reactions are distinguished and characterized; the green laser stimulates the fluorescent label bound to the sample to be tested for quantification. When the labeled sample to be tested is combined with the probe on a specific microsphere, The light excited by both lasers can be detected. Finally, through the computer's high-speed digital signal processor, The average fluorescence intensity on a particular microsphere can be automatically statistically analyzed to determine the type and amount of the analyte.

The invention is based on the high-throughput, simple operation, good repeatability, high sensitivity and wide linear range of the liquid phase chip technology, and the combined parallel detection of various fusion genes of leukemia can obtain better clinical detection. application.

Technical Problem

The technical problem to be solved by the present invention is to provide a combined detection method and a diagnostic kit for a leukemia-associated fusion gene. The method and kit comprise SIL-TAL1 (type II, type III), MLL-AF4 (e9/e5, e9/e4), CBFB-MYH11 (type D) Combined detection of multiple fusion genes can clinically classify T cell acute lymphoblastic leukemia (T-ALL), acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), and observe the efficacy and prognosis of patients. And dynamic monitoring of small residual diseases. The detection method and the diagnostic kit have the advantages of high sensitivity, high specificity, high accuracy, and rapid detection.

Technical Solution

 In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

 In one aspect of the invention, a method for detecting a leukemia-associated fusion gene is provided, comprising the steps of:

(1) Containing a variety of different fluorescently encoded carboxyl (-COOH) microspheres (beads), numbered 11, 15, 17 respectively; each microsphere is covalently bound to three fusions for chromosomal translocation in leukemia a specific nucleic acid probe designed by the mRNA of the gene;

 (2) The upstream and downstream primers were designed for the mRNAs of various fusion genes formed by chromosomal translocations in different leukemia types, and the corresponding products were amplified by reverse transcription PCR for different fusion gene mRNAs;

(3) After the microspheres containing the specific nucleic acid probe are hybridized with the reverse transcription amplification product of the fusion gene mRNA, streptavidin-PE is added, and the fluorescent signal is detected by liquid phase chip method xMAP. ;

(4) Comparing the detected fluorescent signal with the fluorescent signal of the reference gene to determine whether the test sample contains a leukemia-related fusion gene, and/or the expression status of the fusion gene in the sample.

 The microspheres described in the above detection methods may have an average diameter of 5.6 μ m, polyphenylene microspheres combined with different fluorescent dyes, ie color-coded microspheres (color-coded The fusion gene formed by the chromosomal translocation in the leukemia is a combination comprising any one or more of the following fusion genes or a combination of other fusion genes: SIL-TAL1 (type II, type III), MLL-AF4 (e9) /e5,e9/e4), CBFB-MYH11(type D).

 The specific nucleic acid probe covalently bound to the microspheres includes the following sequence (wherein the 5' end contains an amino group modification):

SIL-TAL1 (type II, type III): 5'-Aminolinker C12AGTTACGCTGCGGTGTGGTC-3', such as SEQ ID As shown in NO.1;

MLL-AF4 (e9/e5, e9/e4): 5'-Aminolinker C12TATTGCTGTCAAAGGAGGCGG-3', as SEQ ID NO. 2 Shown

 CBFB-MYH11(type D): 5'-Aminolinker C12TGTCCTTCTCCGAGCCTCTTCA-3', as shown in SEQ ID NO.

 Or a sequence comprising the above sequence (including a complementary sequence) extending to the 5' end or/and the 3' end;

 Or a sequence having greater than 85% homology to the above sequence (comprising a complementary sequence);

 Or a base complementary sequence to the above sequence;

 Alternatively, any one or a combination of more than one of the above sequences may be used.

The upstream and downstream primers designed for mRNAs of different fusion genes include the following sequences (wherein the upstream primer contains a biotin tag at the 5' end):

SIL-TAL1 (type II, type III): upstream primer 5'-biotinCCTGCAAACAGACCTCAGCTC-3', as SEQ ID NO. 4 Shown; downstream primer 5'-CGAGGAAGAGGATGCACAC-3', as shown in SEQ ID NO.

MLL-AF4 (e9/e5, e9/e4): upstream primer 5'-biotinTCCAGAGCAGAGCAAACAG-3', as shown in SEQ ID NO. The downstream primer 5'-CCTTGCTGAGAATTTGAGTG-3', as shown in SEQ ID NO.

 CBFB-MYH11(type D) : upstream primer 5'-biotinGAGGATGCATTAGCACAACAG-3', as shown in SEQ ID NO. 8; downstream primer 5'- GAAGCAACTCCTGGGTGTC -3' , as shown in SEQ ID NO.

 Or a sequence comprising the above sequence (including a complementary sequence) extending to the 5' end or/and the 3' end;

 Or a sequence having greater than 85% homology to the above sequence (comprising a complementary sequence);

 Or a base complementary sequence to the above sequence;

 Alternatively, any one or a combination of more than one of the above sequences may be used.

 The primer and probe sequences of the internal reference gene Abelson gene are as follows:

 Upstream primer 5' -biotin GCGCAAAATGTTGGAGATC -3' as SEQ ID As shown in NO.10;

 Downstream primer 5' -GGAGCTTTTCACCTTTAGTTATGC-3' as SEQ ID As shown in NO.11;

 Probe 5' - AminolinkerC12 CTGAAGGGCTTCTTCCAGAT -3' , As shown in SEQ ID NO.

 Or a sequence comprising the above sequence (including a complementary sequence) extending to the 5' end or/and the 3' end;

 Or a sequence having greater than 85% homology to the above sequence (comprising a complementary sequence);

 Or a base complementary sequence to the above sequence;

 Alternatively, any one or a combination of more than one of the above sequences may be used.

In another aspect of the present invention, a diagnostic kit for detecting a plurality of fusion genes associated with leukemia, comprising a microsphere mixture covalently bound to a leukemia fusion gene mRNA-specific probe, and a microsphere binding to an Abelson gene probe , upstream and downstream primers of leukemia fusion gene mRNA, upstream and downstream primers of Abelson gene, streptavidin-PE, control substance (negative control and positive control).

The control contained in the above kit contains a positive control and a negative control, wherein the positive control is a mixed solution containing various fusion gene plasmids (including a plasmid containing the Abelson gene), and the negative control product does not contain the fusion gene and the Abelson gene. The plasmid solution; the microsphere mixture is freely combined according to the needs of different test samples.

In another aspect of the present invention, a diagnostic kit for detecting a plurality of fusion genes associated with leukemia is provided for detecting in vitro samples, for leukemia typing, early diagnosis, therapeutic observation, prognosis, and dynamic monitoring of minimal residual diseases. Applications, as well as applications for early diagnosis, classification, efficacy observation, and prognosis of other related diseases.

Advantageous Effects

Since the invention utilizes the liquid phase chip technology, the detection method and the kit have the advantages of high sensitivity, high specificity, high throughput, good stability, rapid detection and accuracy, and can qualitatively and quantitatively detect the leukemia fusion gene. Can be better applied in clinical testing.

Description of Drawings

Best Mode

 Example 2: Liquid-phase chip combined parallel detection method for three kinds of fusion genes related to leukemia

 The specific detection method includes the following steps:

 One. Detect SIL-TAL1 (type II , type III), Preparation of microsphere mixture of MLL-AF4 (e9/e5, e9/e4) and CBFB-MYH11 (type D) fusion genes

 1. Synthesize oligonucleotide probes according to the following sequence:

SIL-TAL1 (type II, type III): 5'-Aminolinker C12AGTTACGCTGCGGTGTGGTC-3', such as SEQ ID As shown in NO.1;

 MLL-AF4 (e9/e5, e9/e4): 5'- AminolinkerC12 TATTGCTGTCAAAGGAGGCGG -3', as shown in SEQ ID NO. 2;

 CBFB-MYH11(type D) :5'- AminolinkerC12 TGTCCTTCTCCGAGCCTCTTCA -3', as shown in SEQ ID NO.

 Abelson gene: 5' - AminolinkerC12 CTGAAGGGCTTCTTCCAGAT -3' , as shown in SEQ ID NO.

 2 . The above amino-modified oligonucleotide probes were coupled to four carboxyl microspheres numbered 11, 15, 17, and 21, respectively.

 2.1 Take out a small portion of fresh dry powdered EDC stored at -20 ° C to equilibrate to room temperature;

2.2 Dissolve SIL-TAL1 (type II, type III), MLL-AF4 (e9/e5, e9/e4), CBFB-MYH11 (type D), Abelson oligonucleotide probes with dH ₂ O at a concentration of 1 mM ( 1nmol/μl);

 2.3 4 kinds of carboxyl microsphere storage suspensions with full-speed vortex numbers 11, 15, 17, 21, respectively, for at least 3 min, resulting in a uniform microsphere suspension;

2.4 Take 2.5×10 ⁶ microspheres to store the suspension into 4 centrifuge tubes;

 2.5 10,000g, centrifuged, 1-2min;

 2.6 Remove the supernatant with 50 μl 0.1M MES , pH 4.5 coupling buffer, resuspend the microspheres, vortex for 20 seconds;

2.7 Four concentrations of 1 mM oligonucleotide probes were diluted with d H ₂ O at a ratio of 1:10 to a concentration of 0.1 nmol/μl;

 2.8 2 μl of each probe (concentration 0.1 nmol/μl) ) to the corresponding microspheres that are mixed, vortex mixing;

2.9 Dispose 10 mg/ml fresh EDC solution with d H ₂ O (Note: keep the EDC powder dry to facilitate the use of the next EDC);

 2.10 Add 2.5 μl of 10 mg/ml EDC in fresh EDC solution to 4 microspheres (25 μg Final concentration of about 0.5 μg / μl) vortex mixing;

 2.11 Incubate at room temperature for 30 min in the dark;

2.12 Configure a second 10 mg/ml EDC fresh solution with d H ₂ O (Note: EDC powder should be discarded if deliquescent, it is recommended to use fresh EDC powder for each step of the coupling process);

 2.13 Add 2.5 μl of 10 mg/ml EDC fresh solution to each of the 4 microspheres and vortex to mix;

 2.14 Incubate at room temperature for 30 min in the dark;

 2.15 Add 1 ml 0.02% Tween-20 to each of the four coupled microspheres;

 2.16 10,000g, centrifuged, 1-2min;

 2.17 Remove the supernatant, resuspend the four coupled microspheres with 1 ml of 0.1% SDS, and mix by shaking;

 2.18 10,000g, centrifuged, 1-2min;

 2.19 Remove the supernatant, add 100 μl TE, pH 8.0, vortex for 20 s, and resuspend the microspheres;

 2.20 counting four microspheres coupled with an oligonucleotide probe using a cell counter;

a. The coupled microspheres were diluted 1:100 with d H ₂ O;

 b. Vortex and shake thoroughly;

 c. Take 10 μl onto the cell counter;

 d. The total number of microspheres in the four corners of the number cell counter;

 e. Microspheres / μl = (4 large microspheres total) × 2.5 × 100 (dilution factor).

 3. Configuration of microsphere mixture

 The above microspheres coupled with an oligonucleotide probe are as follows: SIL-TAL1 (type II, type III) Probe microsphere 11, MLL-AF4 (e9/e5, e9/e4) probe microsphere 15, CBFB-MYH11 (type D) probe microsphere 17, Abelson probe microsphere 21, In a proportional mixture, the final concentration of each microsphere is 1500 / μl, and it is stored at 2-8 °C in the dark.

 two. Sample preparation

 The clinical samples of leukemia patients 1-15 were separately extracted with RNA: The preparation method was the same as the preparation steps 1-13 of the sample in Example 1.

 three. Multiple RT-PCR

 Multiple reverse transcription PCR amplification of mRNA from samples 1-15 above was performed as follows:

 1. Method for synthesizing the first strand of cDNA: The method for synthesizing the first strand of cDNA in the same manner as in Example 1.

 2. Multiplex PCR

 2.1 Synthesize primers according to the following sequence:

 SIL-TAL1 (type II , type III) : upstream primer 5'-biotinCCTGCAAACAGACCTCAGCTC -3' , as shown in SEQ ID NO. 4; downstream primer 5'- CGAGGAAGAGGATGCACAC -3' as shown in SEQ ID NO. 5;

 MLL-AF4 (e9/e5, e9/e4): upstream primer 5'-biotin TCCAGAGCAGAGCAAACAG -3' , as shown in SEQ ID NO. 6; downstream primer 5'-CCTTGCTGAGAATTTGAGTG -3', As shown in SEQ ID NO. 7;

 CBFB-MYH11(type D): upstream primer 5'-biotin GAGGATGCATTAGCACAACAG-3', as shown in SEQ ID NO. 8; downstream primer 5'-GAAGCAACTCCTGGGTGTC-3', As shown in SEQ ID NO.

 Abelson gene: upstream primer 5' -biotin GCGCAAAATGTTGGAGATC -3' , as shown in SEQ ID NO. 10; downstream primer 5'-GGAGCTTTTCACCTTTAGTTATGC-3', such as SEQ ID NO. Shown.

 2.2 PCR reaction system: same as the PCR reaction system in Example 1

 four. Hybridization of oligonucleotide probes and PCR products

 A method of hybridization of the oligonucleotide probe and the PCR product in the same manner as in Example 1 (IV).

 Fives. Test results and analysis

 The test results (fluorescence MFI values) are shown in Table 3:

 table 3

Patient/gene	MLL-AF4 (e9/e5, e9/e4)	CBFB-MYH11(type D)	SIL-TAL1 (type II , type III)	Abelson reference gene
1	83	2437	104	2562
2	1793	70	59	1953
3	136	92	3159	2847
4	64	88	2208	2316
5	112	3516	75	2790
6	67	96	2435	2628
7	2085	48	61	1874
8	3439	126	98	3181
9	86	2748	72	2509
10	79	2960	85	2437
11	2674	102	68	2351
12	76	51	2147	2063
13	63	1852	46	2125
14	1926	54	69	1842
15	2891	80	117	3076
Positive control	2503	3384	2956	2619
Negative control	57	95	71	84

 The results are analyzed as shown in Table 4:

 Table 4

Patient/gene	MLL-AF4 (e9/e5, e9/e4)	CBFB-MYH11(type D)	SIL-TAL1 (type II, type III)
1	negative	Positive	negative
2	Positive	negative	negative
3	negative	negative	Positive
4	negative	negative	Positive
5	negative	Positive	negative
6	negative	negative	Positive
7	Positive	negative	negative
8	Positive	negative	negative
9	negative	Positive	negative
10	negative	Positive	negative
11	Positive	negative	negative
12	negative	negative	Positive
13	negative	Positive	negative
14	Positive	negative	negative
15	Positive	negative	negative
Positive control	Positive	Positive	Positive
Negative control	negative	negative	negative

 Types 1, 5, 9, 10, and 13 are leukemia fusion gene CBFB-MYH11 (type D) positive

 Type 2, 7, 8, 11, 14, 15 patients were leukemia fusion gene MLL-AF4 (e9/e5, e9/e4) Positive

 Type 3, 4, 6, and 12 are leukemia fusion gene SIL-TAL1 (type II, type III) Positive

At the same time, the expression of the fusion gene can be obtained by comparing the fluorescence MFI value of the patient positive fusion gene with the fluorescence MFI value of the internal reference Abelson gene.

Mode for Invention

The invention is described in detail below with reference to specific embodiments, but is not to be construed as limiting. The examples described are merely illustrative of nucleic acid probes, kits, and methods of making and using them without limitation. Various variations are contemplated as being within the scope of the invention and the scope of the invention.

 Experimental material

 Primers and probes were synthesized by invitrogen; Trizol was purchased from invitrogen The company; reverse transcription cDNA synthesis kit, PCR reagent purchased from Fermentas; different numbers of microspheres (surface carboxyl modification), streptavidin-phycoerythrin were purchased at QIAGEN; 1-ethyl-(3- Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) was purchased from Pierce; 2-(N-morpholine)-ethanesulfonic acid (MES), sodium N-lauroyl sulphate (Sarkosyl), and tetramethylammonium chloride (TMAC) were purchased from Sigma.

 Buffer and hybridization configuration:

 Coupling buffer, pH 4.5 250 ml

 MES 4.88g ;

 1.5 × TMAC Hybrid Solution 250 ml

 5M TMAC 225 ml

 20% Sarkosyl 1.88 ml

 1M Tris-HCl, pH 8.0 18.75 ml

 0.5M EDTA, pH 8.0 3.0 ml

H ₂ O 1.37 ml ;

 1.5 × TMAC Hybrid Solution 250 ml

 5M TMAC 150 ml

 20% Sarkosyl 1.25 ml

 1M Tris-HCl, pH 8.0 12.5 ml

 0.5M EDTA, pH 8.0 2.0 ml

H ₂ O 84.25 ml ;

 TE buffer, pH 8.0 500 ml

 1M Tris-HCl, pH 8.0 5 ml

 0.5M EDTA, pH 8.0 1 ml

H ₂ O 444 ml

 Example 1: Liquid-phase chip combined parallel detection method for two kinds of fusion genes related to leukemia

 The specific detection method includes the following steps:

 One. Detection SIL-TAL1 (type II , type III), MLL-AF4 (e9/e5 , e9/e4) Preparation of microsphere mixture of fusion gene

1. Oligonucleotide probes were synthesized according to the following sequence:

 SIL-TAL1 (type II, type III): 5'-Aminolinker C12AGTTACGCTGCGGTGTGGTC -3', as SEQ ID NO. Shown

 MLL-AF4 (e9/e5, e9/e4): 5'- AminolinkerC12 TATTGCTGTCAAAGGAGGCGG -3', as shown in SEQ ID NO. 2;

 Abelson gene: 5' - AminolinkerC12 CTGAAGGGCTTCTTCCAGAT -3' , as shown in SEQ ID NO.

 2 . The above amino-modified oligonucleotide probes were coupled to three carboxyl microspheres numbered 11, 15, and 21, respectively.

 2.1 Take out a small portion of fresh dry powdered EDC stored at -20 ° C to equilibrate to room temperature;

2.2 Dissolve SIL-TAL1 (type II, type III), MLL-AF4 (e9/e5, e9/e4), Abelson oligonucleotide probes with d H ₂ O at a concentration of 1 mM ( 1 nmol/μl);

 2.3 Three kinds of carboxyl microsphere storage suspensions with full-speed vortex numbers 11, 15, 21 are respectively at least 3 min, resulting in a uniform microsphere suspension;

2.4 Take 2.5×10 ⁶ microspheres to store the suspension into 3 centrifuge tubes;

 2.5 10,000g, centrifuged, 1-2min;

 2.6 Remove the supernatant with 50 μl 0.1M MES , pH 4.5 coupling buffer, resuspend the microspheres, vortex for 20 seconds;

2.7 Three kinds of 1 mM oligonucleotide probes were diluted with d H ₂ O at a ratio of 1:10 to a concentration of 0.1 nmol/μl;

 2.8 2 μl of each probe (concentration 0.1 nmol/μl) ) to the corresponding microspheres that are mixed, vortex mixing;

2.9 Dispose 10 mg/ml fresh EDC solution with d H ₂ O (Note: keep the EDC powder dry to facilitate the use of the next EDC);

 2.10 Add 2.5 μl of 10 mg/ml EDC in fresh EDC solution to 4 microspheres (25 a final concentration of μg of about 0.5 μg/μl) vortex to mix;

 2.11 Incubate at room temperature for 30 min in the dark;

2.12 Configure a second 10 mg/ml EDC fresh solution with d H ₂ O (Note: EDC powder should be discarded if deliquescent, it is recommended to use fresh EDC powder for each step of the coupling process);

 2.13 Add 2.5 μl of 10 mg/ml EDC fresh solution to each of the 3 microspheres and vortex to mix;

 2.14 Incubate at room temperature for 30 min in the dark;

 2.15 Add 1 ml 0.02% Tween-20 to each of the three coupled microspheres;

 2.16 10,000g, centrifuged, 1-2min;

 2.17 Remove the supernatant, resuspend the three coupled microspheres with 1 ml of 0.1% SDS, and mix by shaking;

 2.18 10,000g, centrifuged, 1-2min;

 2.19 Remove the supernatant, add 100 μl TE, pH 8.0, vortex for 20 s, and resuspend the microspheres;

 2.20 Counting three microspheres coupled with an oligonucleotide probe using a cell counter;

a. The coupled microspheres were diluted 1:100 with d H ₂ O;

 b. Vortex and shake thoroughly;

 c. Take 10 μl onto the cell counter;

 d. The total number of microspheres in the four corners of the number cell counter;

 e. Microspheres / μl = (4 large microspheres total) × 2.5 × 100 (dilution factor).

 3. Configuration of microsphere mixture

 The above microspheres coupled with an oligonucleotide probe are as follows: SIL-TAL1 (type II, type III) Probe microsphere 11, MLL-AF4 (e9/e5, e9/e4) probe microsphere 15, Abelson probe microsphere 21, mixed in equal proportion, the final concentration of various microspheres is 1500 / μ l, 2-8 °C protected from light.

 two. Sample preparation

 The clinical samples of patients with leukemias 1-10 were extracted according to the following steps:

 1. Lymphocyte extraction: Take 2 ml of fresh whole blood and 1 ml of 3 % sodium citrate, mix and mix 3000 r/min Centrifugation, 10 min, 4 °C, taking the light yellow layer on the blood cell layer is the lymphocyte;

 2. Take 1 tube (treated with DEPC water) and add 150 μl of lymphocyte solution, then add 1 ml. TRIZOL, placed at room temperature for 5 min, allowing it to fully lyse;

 3. Centrifuge at 12,000 rpm for 5 min, and take the supernatant;

 4. Add 200 μl per 1 ml Trizol Chloroform, mixed with shaking and allowed to stand at room temperature for 15 min;

 5. Centrifuge at 12,000g for 15min at 4°C;

 6. Pipette the upper aqueous phase into another centrifuge tube;

 7. Add 500 μl of isopropanol per 1 ml of Trizol and mix at room temperature for 5-10 min;

 8. Centrifuge at 12,000g for 10min at 4°C, discard the supernatant, and sink the RNA at the bottom of the tube;

 9. Add 1 ml 75% per 1 ml Trizol Ethanol, gently shake the centrifuge tube, and suspend the precipitate;

 10. Centrifuge at 8,000g for 4min at 4 °C, discard the supernatant as much as possible;

 11. Dry at room temperature or vacuum dry for 5-10min;

12. Dissolve the RNA sample with 50 ul H ₂ O , TE buffer or 0.5% SDS, 55-60 ° C, 5-10 min (H ₂ O, TE or 0.5% SDS must be treated with DEPC and high pressure);

 13. Measure the OD value to quantify the RNA concentration.

 three. Multiple RT-PCR

 The multiplex PCR was performed on the mRNA of the above sample No. 1-10 as follows:

 1. Synthesis of cDNA first strand

 1 Take a DEPC-treated microcentrifuge tube and place it on ice to establish the following reaction system;

 Total RNA 5 ~ 10 μg / 3 μl

 Oligo(dT)18 Primer (0.5μg/μl) 1 μl

 EDPC-treated water forward to 12 μl

 Mix the reaction solution gently, and centrifuge the centrifuge to collect the reaction solution on the tube wall to the bottom of the tube;

 2 The tube was incubated at 70 ° C for 5 minutes, then quickly taken out and cooled in ice, and the reaction liquid on the tube wall was collected by a centrifugal centrifuge to the bottom of the tube;

 3 Place the centrifuge tube on ice and add the following reaction solutions in order;

 5×reaction buffer 4 μl

 RNase Inhibitor (20 U/μl ) 1 μl

 10mM dNTPs Mix 2 μl

 Mix the reaction solution gently, and centrifuge the centrifuge to collect the reaction solution on the tube wall to the bottom of the tube;

 4 centrifuge tube at 37 ° C for 5 minutes;

 5 Add 1 μl of RevertAidTM Reverse Transcriptase (200 U / μl ) , the final volume is 20 μl ;

 6 centrifuge tube at 42 ° C for 60 minutes;

 7 The tube is heated at 70 ° C for 10 minutes to terminate the reaction, then quickly taken out and placed in ice to cool;

 2. Multiplex PCR

 2.1 Synthesize primers according to the following sequence:

 SIL-TAL1 (type II , type III) : upstream primer 5'-biotinCCTGCAAACAGACCTCAGCTC -3', as shown in SEQ ID NO. a downstream primer 5'-CGAGGAAGAGGATGCACAC-3', as shown in SEQ ID NO.

 MLL-AF4 (e9/e5, e9/e4): upstream primer 5'-biotin TCCAGAGCAGAGCAAACAG -3' , as shown in SEQ ID NO. 6; downstream primer 5'-CCTTGCTGAGAATTTGAGTG -3', As shown in SEQ ID NO. 7;

 Abelson gene: upstream primer 5' -biotin GCGCAAAATGTTGGAGATC -3', as shown in SEQ ID NO. 10; downstream primer 5'-GGAGCTTTTCACCTTTAGTTATGC-3', such as SEQ ID NO. Shown.

 2.2 PCR reaction system is as follows

 cDNA 10 μl

 10 × PCR Buffer 10 μl

 MgCl2 (25 mmol/L) 4 μl

 dNTPs (10mM) 0.5 μl

 Taq Polymerase (5 u/μl ) 0.5 μl

 Primer mix 11 μl

Dd H ₂ O 14 μl

 Final volume is 50 μl

 PCR amplification procedure: 95 ° C for 10 min; 95 ° C for 30 s, 64-50 ° C for 1 min, 72 ° C 30 Min; the first 14 cycles, once per cycle, the annealing temperature is reduced by 1 ° C, after 21 cycles, the annealing temperature is maintained at 50 ° C; 72 ° C 7 min; 4 ° C insulation.

 four. Hybridization of oligonucleotide probes and PCR products

 1 . Selecting the oligonucleotide probe microsphere mixture configured in step one;

 2 . Vortex for 20s, mix the microspheres;

 3 . Prepare the microsphere working solution, dilute the coupled microspheres with a 1.5×TMAC hybridization solution to a concentration of 150 microspheres/μl (Note: 33 μl of microsphere working solution is required for each reaction);

 4 . Vortex for 20s, mix the microsphere working solution;

 5 . Add 33 μl of microsphere working solution to the sample well, positive control well and negative control well respectively;

6. Add PCR amplification product and TE solution (pH 8.0) of patient sample 1-10 to each sample well, the total volume is 17 μl;

 7. Dip up and down with a lance and gently mix the reaction solution;

 8. Cover the reaction cover to avoid evaporation, incubate at 95-100 ° C for 1-3 min, so that the oligonucleotides in the sample remove the secondary structure;

 9. Incubate the reaction plate at the hybridization temperature for 15 min;

 10. Prepare a fresh test mixture and dilute the streptavidin phycoerythrin solution to 10 μg/ml with 1×TMAC hybridization solution. (25 μl of detection mixture is required for each reaction);

 11. Add 25 μl of the test mixture to each well, pipe up and down, and mix gently;

 12. Incubate for 5 min at the hybridization temperature;

 The above steps can be combined by the PCR program according to the following scheme:

 95 ° C, 1-3 min;

 Hybridization temperature

 13. In the liquid chip device (LiquiChip 200 or Luminex 200 On the above, the hybridization temperature was maintained, and each reaction well was subjected to detection and analysis, and the fluorescence MFI value was measured.

 Fives. Test results and analysis

 The test results (fluorescence MFI values) are shown in Table 1:

 Table 1

Patient/gene	MLL-AF4 (e9/e5, e9/e4)	SIL-TAL1 (type II , type III)	Abelson reference gene
1	93	3058	2796
2	2816	84	2318
3	3274	123	3475
4	67	2691	2560
5	110	2425	1842
6	2563	89	2937
7	61	1932	2183
8	2149	56	2641
9	3380	108	3029
10	116	2615	2357
Positive control	2705	3247	2928
Negative control	89	53	71

 The results are analyzed as shown in Table 2:

 Table 2

Patient/gene	MLL-AF4 (e9/e5, e9/e4)	SIL-TAL1 (type II, type III)
1	negative	Positive
2	Positive	negative
3	Positive	negative
4	negative	Positive
5	negative	Positive
6	Positive	negative
7	negative	Positive
8	Positive	negative
9	Positive	negative
10	negative	Positive
Positive control	Positive	Positive
Negative control	negative	negative

 Type 2, 3, 6, 8, and 9 are leukemia fusion gene MLL-AF4 (e9/e5, e9/e4) Positive

 Type 1 , 4, 5, 7, and 10 are leukemia fusion gene SIL-TAL1 (type II, type III) Positive

 At the same time, the patient is positive The expression of the fusion gene can be obtained by comparing the fluorescence MFI value of the fusion gene with the fluorescence MFI value of the internal reference Abelson gene.

 Example 2: Liquid-phase chip combined parallel detection method for three kinds of fusion genes related to leukemia

 The specific detection method includes the following steps:

One. Detection of SIL-TAL1 (type II, type III), MLL-AF4 (e9/e5, e9/e4), CBFB-MYH11 (type D) Preparation of microsphere mixture of fusion gene

 1. Synthesize oligonucleotide probes according to the following sequence:

 SIL-TAL1 (type II, type III): 5'-Aminolinker C12AGTTACGCTGCGGTGTGGTC -3', as SEQ ID NO. Shown

 MLL-AF4 (e9/e5, e9/e4): 5'- AminolinkerC12 TATTGCTGTCAAAGGAGGCGG -3', as shown in SEQ ID NO. 2;

 CBFB-MYH11(type D) :5'- AminolinkerC12 TGTCCTTCTCCGAGCCTCTTCA -3', as shown in SEQ ID NO.

 Abelson gene: 5' - AminolinkerC12 CTGAAGGGCTTCTTCCAGAT -3' , as shown in SEQ ID NO.

 2 . The above amino-modified oligonucleotide probes were coupled to four carboxyl microspheres numbered 11, 15, 17, and 21, respectively.

 2.1 Take out a small portion of fresh dry powdered EDC stored at -20 ° C to equilibrate to room temperature;

2.2 Dissolve SIL-TAL1 (type II, type III), MLL-AF4 (e9/e5, e9/e4), CBFB-MYH11 (type D), Abelson oligonucleotide probes with dH ₂ O at a concentration of 1 mM ( 1nmol/μl);

 2.3 4 kinds of carboxyl microsphere storage suspensions with full-speed vortex numbers 11, 15, 17, 21, respectively, for at least 3 min, resulting in a uniform microsphere suspension;

2.4 Take 2.5×10 ⁶ microspheres to store the suspension into 4 centrifuge tubes;

 2.5 10,000g, centrifuged, 1-2min;

 2.6 Remove the supernatant with 50 μl 0.1M MES , pH 4.5 coupling buffer, resuspend the microspheres, vortex for 20 seconds;

2.7 Four concentrations of 1 mM oligonucleotide probes were diluted with d H ₂ O at a ratio of 1:10 to a concentration of 0.1 nmol/μl;

 2.8 2 μl of each probe (concentration 0.1 nmol/μl) ) to the corresponding microspheres that are mixed, vortex mixing;

2.9 Dispose 10 mg/ml fresh EDC solution with d H ₂ O (Note: keep the EDC powder dry to facilitate the use of the next EDC);

 2.10 Add 2.5 μl of 10 mg/ml EDC in fresh EDC solution to 4 microspheres (25 a final concentration of μg of about 0.5 μg/μl) vortex to mix;

 2.11 Incubate at room temperature for 30 min in the dark;

2.12 Configure a second 10 mg/ml EDC fresh solution with d H ₂ O (Note: EDC powder should be discarded if deliquescent, it is recommended to use fresh EDC powder for each step of the coupling process);

 2.13 Add 2.5 μl of 10 mg/ml EDC fresh solution to each of the 4 microspheres and vortex to mix;

 2.14 Incubate at room temperature for 30 min in the dark;

 2.15 Add 1 ml 0.02% Tween-20 to each of the four coupled microspheres;

 2.16 10,000g, centrifuged, 1-2min;

 2.17 Remove the supernatant, resuspend the four coupled microspheres with 1 ml of 0.1% SDS, and mix by shaking;

 2.18 10,000g, centrifuged, 1-2min;

 2.19 Remove the supernatant, add 100 μl TE, pH 8.0, vortex for 20 s, and resuspend the microspheres;

 2.20 counting four microspheres coupled with an oligonucleotide probe using a cell counter;

a. The coupled microspheres were diluted 1:100 with d H ₂ O;

 b. Vortex and shake thoroughly;

 c. Take 10 μl onto the cell counter;

 d. The total number of microspheres in the four corners of the number cell counter;

 e. Microspheres / μl = (4 large microspheres total) × 2.5 × 100 (dilution factor).

 3. Configuration of microsphere mixture

 The above microspheres coupled with an oligonucleotide probe are as follows: SIL-TAL1 (type II, type III) Probe microsphere 11, MLL-AF4 (e9/e5, e9/e4) probe microsphere 15, CBFB-MYH11 (type D) probe microsphere 17, Abelson probe microsphere 21, In a proportional mixture, the final concentration of each microsphere is 1500 / μl, and it is stored at 2-8 °C in the dark.

 two. Sample preparation

 RNA samples from leukemia patients 1-15 were extracted separately: The preparation method is the same as the preparation steps 1-13 of the sample in Example 1.

 three. Multiple RT-PCR

 Multiple reverse transcription PCR amplification of mRNA from samples 1-15 above was performed as follows:

 1. Method for synthesizing the first strand of cDNA: The method for synthesizing the first strand of cDNA in the same manner as in Example 1.

 2. Multiplex PCR

 2.1 Synthesize primers according to the following sequence:

 SIL-TAL1 (type II , type III) : upstream primer 5'-biotinCCTGCAAACAGACCTCAGCTC -3' , as shown in SEQ ID NO. 4; downstream primer 5'- CGAGGAAGAGGATGCACAC -3' as shown in SEQ ID NO. 5;

 MLL-AF4 (e9/e5, e9/e4): upstream primer 5'-biotin TCCAGAGCAGAGCAAACAG -3' , as shown in SEQ ID NO. 6; downstream primer 5'-CCTTGCTGAGAATTTGAGTG -3', As shown in SEQ ID NO. 7;

 CBFB-MYH11(type D): upstream primer 5'-biotin GAGGATGCATTAGCACAACAG-3', as shown in SEQ ID NO. 8; downstream primer 5'-GAAGCAACTCCTGGGTGTC-3', As shown in SEQ ID NO.

 Abelson gene: upstream primer 5' -biotin GCGCAAAATGTTGGAGATC -3', as shown in SEQ ID NO. 10; downstream primer 5'-GGAGCTTTTCACCTTTAGTTATGC-3', such as SEQ ID NO. Shown.

 2.2 PCR reaction system: same as the PCR reaction system in Example 1

 four. Hybridization of oligonucleotide probes and PCR products

 A method of hybridization of the oligonucleotide probe and the PCR product in the same manner as in Example 1 (IV).

 Fives. Test results and analysis

 The test results (fluorescence MFI values) are shown in Table 3:

 table 3

Patient/gene	MLL-AF4 (e9/e5, e9/e4)	CBFB-MYH11(type D)	SIL-TAL1 (type II , type III)	Abelson reference gene
1	83	2437	104	2562
2	1793	70	59	1953
3	136	92	3159	2847
4	64	88	2208	2316
5	112	3516	75	2790
6	67	96	2435	2628
7	2085	48	61	1874
8	3439	126	98	3181
9	86	2748	72	2509
10	79	2960	85	2437
11	2674	102	68	2351
12	76	51	2147	2063
13	63	1852	46	2125
14	1926	54	69	1842
15	2891	80	117	3076
Positive control	2503	3384	2956	2619
Negative control	57	95	71	84

 The results are analyzed as shown in Table 4:

 Table 4

Patient/gene	MLL-AF4 (e9/e5, e9/e4)	CBFB-MYH11(type D)	SIL-TAL1 (type II, type III)
1	negative	Positive	negative
2	Positive	negative	negative
3	negative	negative	Positive
4	negative	negative	Positive
5	negative	Positive	negative
6	negative	negative	Positive
7	Positive	negative	negative
8	Positive	negative	negative
9	negative	Positive	negative
10	negative	Positive	negative
11	Positive	negative	negative
12	negative	negative	Positive
13	negative	Positive	negative
14	Positive	negative	negative
15	Positive	negative	negative
Positive control	Positive	Positive	Positive
Negative control	negative	negative	negative

 Type 1, 5, 9, 10, and 13 patients are leukemia fusion gene CBFB-MYH11 (type D) Positive

 Type 2, 7, 8, 11, 14, 15 patients were leukemia fusion gene MLL-AF4 (e9/e5, e9/e4) Positive

 Type 3, 4, 6, and 12 are leukemia fusion gene SIL-TAL1 (type II, type III) Positive

 Simultaneously, The expression of the fusion gene can be obtained by comparing the fluorescent MFI value of the patient-positive fusion gene with the fluorescent MFI value of the internal reference Abelson gene.

Various modifications or variations of the present invention, including various variations of the primers or probes, may be made by those skilled in the art after reading the above description of the present invention. These equivalents also belong to the appended claims. The scope defined in the request.

Industrial Applicability

Since the invention utilizes the liquid phase chip technology, the detection method and the kit have the advantages of high sensitivity, high specificity, high throughput, good stability, rapid detection and accuracy, and can qualitatively and quantitatively detect the leukemia fusion gene. Can be better applied in clinical testing.

Sequence List Text

 Sequence table

 <110> Jiangsu Maidi Gene Biotechnology Co., Ltd.

 <120> Combined detection method and diagnostic kit for leukemia-associated fusion gene

 <130> DAPCT-1591

 <160> 12

 <170> PatentIn version 3.3

 <210> 1

 <211> 20

 <212> DNA

 <213> Artificial sequence

 <220>

 <221> misc_feature

 <223> (1)...(20)

 <400> 1

 Agttacgctg cggtgtggtc 20

 <210> 2

 <211> 21

 <212> DNA

 <213> Artificial sequence

 <220>

 <221> misc_feature

 <223> (1)...(21)

 <400> 2

 Tattgctgtc aaaggaggcg g 21

 <210> 3

 <211> 22

 <212> DNA

 <213> Artificial sequence

 <220>

 <221> misc_feature

 <223> (1)...(22)

 <400> 3

 Tgtccttctc cgagcctctt ca 22

 <210> 4

 <211> 21

 <212> DNA

 <213> Artificial sequence

 <220>

 <221> misc_feature

 <223> Primers

 <400> 4

 Cctgcaaaca gacctcagct c 21

 <210> 5

 <211> 19

 <212> DNA

 <213> Artificial sequence

 <220>

 <221> misc_feature

 <223> Primers

 <400> 5

 Cgaggaagag gatgcacac 19

 <210> 6

 <211> 19

 <212> DNA

 <213> Artificial sequence

 <220>

 <221> misc_feature

 <223> Primers

 <400> 6

 Tccagagcag agcaaacag 19

 <210> 7

 <211> 20

 <212> DNA

 <213> Artificial sequence

 <220>

 <221> misc_feature

 <223> Primers

 <400> 7

 Ccttgctgag aatttgagtg 20

 <210> 8

 <211> 21

 <212> DNA

 <213> Artificial sequence

 <220>

 <221> misc_feature

 <223> Primers

 <400> 8

 Gaggatgcat tagcacaaca g 21

 <210> 9

 <211> 19

 <212> DNA

 <213> Artificial sequence

 <220>

 <221> misc_feature

 <223> Primers

 <400> 9

 Gaagcaactc ctgggtgtc 19

 <210> 10

 <211> 19

 <212> DNA

 <213> Artificial sequence

 <220>

 <221> misc_feature

 <223> Primers

 <400> 10

 Gcgcaaaatg ttggagatc 19

 <210> 11

 <211> 24

 <212> DNA

 <213> Artificial sequence

 <220>

 <221> misc_feature

 <223> Primers

 <400> 11

 Ggagcttttc acctttagtt atgc 24

 <210> 12

 <211> 20

 <212> DNA

 <213> Artificial sequence

 <220>

 <221> misc_feature

 <223> (1)...(20)

 <400> 12

 Ctgaagggct tcttccagat 20

Claims (1)

A method for detecting a leukemia-associated fusion gene, characterized in that:

(1) a plurality of different fluorescently encoded microspheres, Beads, each of which specifically binds to a specific nucleic acid probe designed for mRNAs of various fusion genes formed by chromosomal translocations in leukemia;

(2) Designing upstream and downstream primers for the mRNAs of various fusion genes formed by chromosomal translocations in different leukemia types, and amplifying the corresponding products by reverse transcription PCR for different fusion gene mRNAs; The fusion gene formed by chromosomal translocation comprises any one or more of the following fusion genes or a combination of other fusion genes: SIL-TAL1 (type II, type III), MLL-AF4 (e9/e5, e9/e4), CBFB-MYH11(type D);

(3) the microspheres containing the specific nucleic acid probe are hybridized with the reverse transcription amplification product of the fusion gene mRNA, and after adding streptavidin-PE, the fluorescence signal is detected by liquid phase chip method xMAP;

(4) Comparing the detected fluorescent signal with the fluorescent signal of the reference gene to determine whether the leukemia fusion gene is present in the test sample and the expression status of the fusion gene in the sample.

The method for detecting a leukemia-associated fusion gene according to claim 1, wherein the microsphere is a color-coded microsphere Color-coded Beads, and polyphenylene microspheres that combine different fluorescent dyes.

3. The method for detecting a leukemia-associated fusion gene according to claim 1, wherein the three specific nucleic acid probes covalently bound to the microspheres include the following sequences, wherein the 5' end contains an amino group. Modification:

SIL-TAL1 (type II, type III): 5'-Aminolinker C12AGTTACGCTGCGGTGTGGTC-3', As shown in SEQ ID NO.

MLL-AF4 (e9/e5, e9/e4): 5'-AminolinkerC12TATTGCTGTCAAAGGAGGCGG-3' , as shown in SEQ ID NO. 2;

CBFB-MYH11(typeD): 5'-AminolinkerC12TGTCCTTCTCCGAGCCTCTTCA-3' , as shown in SEQ ID NO. 3;

Or a sequence comprising the above sequence (including a complementary sequence) extending to the 5' end or/and the 3' end;

Or a sequence having greater than 85% homology to the above sequence (comprising a complementary sequence);

Or a base complementary sequence to the above sequence;

Alternatively, any one or a combination of more than one of the above sequences may be used.

The method for detecting a leukemia-associated fusion gene according to claim 1, wherein The upstream and downstream primers designed for mRNAs of different fusion genes include the following sequences, wherein the upstream primer has a biotin tag at the 5' end:

SIL-TAL1 (typeII, type III):

Upstream primer 5'-biotinCCTGCAAACAGACCTCAGCTC -3' as SEQ ID Shown as NO.4; downstream primer 5'-CGAGGAAGAGGATGCACAC-3', as shown in SEQ ID NO.

MLL-AF4 (e9/e5, e9/e4):

Upstream primer 5'-biotinTCCAGAGCAGAGCAAACAG -3' as SEQ ID NO.6; downstream primer 5'-CCTTGCTGAGAATTTGAGTG-3', as shown in SEQ ID NO.

CBFB-MYH11(typeD):

Upstream primer 5'-biotinGAGGATGCATTAGCACAACAG -3' as SEQ ID Shown as NO.8; downstream primer 5'-GAAGCAACTCCTGGGTGTC-3', as shown in SEQ ID NO.

Or a sequence comprising the above sequence (including a complementary sequence) extending to the 5' end or/and the 3' end;

Or a sequence having greater than 85% homology to the above sequence (comprising a complementary sequence);

Or a base complementary sequence to the above sequence;

Alternatively, any one or a combination of more than one of the above sequences may be used.

5. The method of claim 1 A method for detecting a leukemia-associated fusion gene, characterized in that the internal reference gene is Abelson gene, and the primers and probe sequences thereof are as follows:

Upstream primer 5'-biotin GCGCAAAATGTTGGAGATC -3' as SEQ ID NO. Shown

Downstream primer 5'-GGAGCTTTTCACCTTTAGTTATGC-3' as SEQ ID NO.11 Shown

Probe 5' - AminolinkerC12 CTGAAGGGCTTCTTCCAGAT -3' , as SEQ ID As shown in NO.12;

Or a sequence comprising the above sequence (including a complementary sequence) extending to the 5' end or/and the 3' end;

Or a sequence having greater than 85% homology to the above sequence (comprising a complementary sequence);

Or a base complementary sequence to the above sequence;

Alternatively, any one or a combination of more than one of the above sequences may be used.

6. A diagnostic kit for detecting a leukemia-associated fusion gene, comprising the microsphere mixture of the covalently bound leukemia fusion gene-specific probe of claim 1 and a microbe incorporating the Abelson gene probe The ball, the upstream and downstream primers of the leukemia fusion gene mRNA according to claim 1, the upstream and downstream primers of the Abelson gene, streptavidin-phycoerythrin, and the control substance.

7. A diagnostic kit for detecting a leukemia-associated fusion gene according to claim 6, wherein said microsphere mixture is freely combined according to the needs of different test samples.

8. The diagnostic kit for detecting a leukemia-associated fusion gene according to claim 6, wherein the control comprises a positive control and a negative control, wherein the positive control is a mixed solution containing various fusion gene plasmids, including A plasmid containing the Abelson gene; the negative control contained no fusion gene and Abelson gene Plasmid solution.

9. A diagnostic kit for detecting a leukemia-associated fusion gene according to claim 6 for detecting an in vitro sample for the classification, early diagnosis, therapeutic observation, prognosis and dynamic monitoring of minimal residual disease of leukemia.