CN107151699A - Detect the kit and method of NUP214 ABL1 gene relative expression quantities - Google Patents
Detect the kit and method of NUP214 ABL1 gene relative expression quantities Download PDFInfo
- Publication number
- CN107151699A CN107151699A CN201710402890.2A CN201710402890A CN107151699A CN 107151699 A CN107151699 A CN 107151699A CN 201710402890 A CN201710402890 A CN 201710402890A CN 107151699 A CN107151699 A CN 107151699A
- Authority
- CN
- China
- Prior art keywords
- nup214
- abl1
- probe
- abl
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kind of kit of detection NUP214 ABL1 gene relative expression quantities, and with real-time fluorescence PCR technology for detection NUP214 ABL1 fusions.Including PCR reaction solutions, the PCR reaction solutions include the primer and probe for being used to expand NUP214 ABL1 fusions.The kit is specific good after tested, and sensitivity is high, easy to operate.Contribute to the detection of NUP214 ABL1 fusions in clinically Pancytopenia patient body, it is all significant for adjustment therapeutic scheme, evaluation therapeutic effect, prediction prognosis, prevention clinical recurrence.
Description
Technical field
The invention belongs to the field of disease gene detection, more particularly to using probe for real-time fluorescence PCR technology to the mankind
NUP214-ABL1 expression quantity is detected in Pancytopenia kit and method.
Technical background
Pancytopenia (T-cell acute lymphoblastic leukemia, T-ALL) is a kind of
The hematological system tumor being characterized is bred with T lymphocytes malignant clone, the incidence of disease accounts for ALL
25% or so of (acute lymphoblastic leukemia, ALL).T-ALL is apt to occur in beyond children and person between twenty and fifty, patient
All Leukocyte Counts increase extremely, the rise of initial cell ratio is principal character, easily occur T lymphocytes bone marrow infiltration, chest
The complication such as film oozes out, Central Nervous System Infiltration and mediastinum tumor, the state of an illness is dangerous, and prognosis is not good enough.
Research in the past finds that more than 50% T-ALL patient can detect chromosome abnormalities, and cytogenetics detection turns into T-
Diagnosis index important ALL.As FISH (FISH), quantitative fluorescent PCR equimolecular biology techniques are examined in clinic
Extensive use in disconnected, it was recognized that the cell such as the prognosis of T-ALL patient and chromosome translocation, missing, gene mutation and point
Sub- science of heredity changes closely related.Recent study finds can occur NUP214-ABL1 Gene Fusions in T-ALL patient, occurs
Rate about 6%, including adult and children T-ALL, Most patients therapeutic effect are bad, poor prognosis.According to the literature, companion
The positive T-ALL patient of NUP214-ABL1 fusions, its fusion protein has tyrosine kinase activity, T lymphs can be promoted thin
The propagation and apoptosis of born of the same parents, treats sensitive to TKIs, and TKIs treatments can improve curative effect and the prognosis of such patient to a certain extent.
The expression of NUP214-ABL1 fusions can provide reference and foundation for TKIs treatment in detection T-ALL patient's body, contribute to
The selection and formulation of T-ALL individualized treatment schemes.
Clinically NUP214-ABL1 fusions have been regard it as a kind of selection of T-ALL individualized treatments scheme at present
With formulation foundation.The common technology of NUP214-ABL1 fusions detection has fluorescence in situ hybridization technique (FISH), RQ-PCR etc.
Method.FISH testing results are more directly perceived, but process of the test is cumbersome, and it is various to be related to reagent type, wastes time and energy, and result is needed
Seasoned professional carrys out interpretation, and as a result interpretation has larger subjectivity.RQ-PCR is fixed using Taqman fluorescence probes
Amount technology, integrative biology, zymetology and fluorescence chemical are in one, from amplification to interpretation of result in PCR reaction tube closed states
It is lower to carry out, the problem of solving PCR primer pollution and cause false positive, while susceptibility is also improved, its result copy number
Represent, realize the accurate quantitative analysis to PCR primer, it is easy to seek unity of standard, good with specificity compared with qualitative PCR technology, spirit
Sensitivity is high, and linear relationship is good, and simple to operate, automaticity is high, anti-pollution, there is the larger range of linearity.It can expire
The detection of sufficient NUP214-ABL1 fusions, it is considered to be presently preferred detection method, for evaluating therapeutic effect, prediction in advance
Afterwards.Therefore this research is applied to NUP214-ABL1 genetic test using real-time fluorescence PCR technology combination Taqman sonde methods.
The content of the invention
The present invention devises detection internal reference/target gene primer, probe sequence, uses real-time fluorescence PCR technology for detection
NUP214-ABL1 fusions.By adjusting primer, concentration and probe concentration and ratio, optimize PCR reaction system and reaction condition,
Amplification efficiency and speed is set to reach most preferably.
The invention provides a kind of primer and probe of detection NUP214-ABL1 fusion relative expression quantities,.
Further, the primer and probe also includes the primer and probe of amplification ABL reference genes.
Reacted present invention also offers a kind of kit of detection NUP214-ABL1 gene relative expression quantities, including PCR
Liquid, the PCR reaction solutions include the primer and probe for being used to expand NUP214-ABL1 fusions
Further, the kit also includes the primer and probe of amplification ABL reference genes.
Further, the kit also includes negative controls and blank control product.
Present invention also offers a kind of method of NUP214-ABL1 fusions relative expression quantity, comprise the following steps：
(1) RNA in sample is extracted；
(2) the RNA reverse transcriptions for extracting (1) are cDNA, and produced cDNA is added in reaction tube；
(3) detection reference gene Abl sense primer Abl-F, anti-sense primer Abl-R and probe Abl-Probe is added；
(4) sense primer, anti-sense primer and the probe of the detection fusion are added；
(5) pcr amplification reaction is carried out；
(6) relative expression quantity of the fusion is calculated,
Further, methods described also includes the primer and probe of the Abl reference genes,
It is described amplification fusion primer and probe be respectively：
NUP214-ABL1(ex23)-F：AGCACTCAGGCGGCAGAT；
NUP214-ABL1(ex29)-F：ACCACAACAGCAGCAACCTC；
NUP214-ABL1(ex31)-F：CAGTCAGGATGCAGCCAACA；
NUP214-ABL1(ex32)-F：TGGAGGAGGAAGTGTGGCAT；
NUP214-ABL1(ex34)-F：GGACCCAGAGTAGCGGATTC；
NUP214-ABL1-R：ACGAGCGGCTTCACTCAGA；
NUP214-ABL1-Probe：FAM-CCCTTCAGCGGCCAGTAGCATCT-TAMRA.
The primer and probe of the Abl reference genes, be respectively：
Abl-F:GATACGAAGGGAGGGTGTACCA
Abl-R:CTCGGCCAGGGTGTTGAA
Abl-Probe:FAM-TGCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA。
Beneficial effects of the present invention：
Sense primer is designed for the different extrons of NUP214 genes；Anti-sense primer has been shared positioned at ABL1 the 2nd
One section of nucleotide sequence on extron；Probe has shared one section of nucleotide sequence on ABL1 exon 2s, and being so designed that can
Reduce the synthesis cost of primer and discussion.In design of primers we try one's best avoid primer 3' ends using A bases and repeat 3
Above base, reduces the mispairing probability of primer；Simultaneously when screening primer and probe, we, which try one's best, avoids between two primers
And the complementary pairing between primer and probe, the specificity of primer and probe can be so improved, the amplification efficiency of primer is improved.Amplification
We try one's best control in below 200bp to the size of product, can ensure amplification efficiency well.The present invention is by real-time fluorescence PCR skill
Art, which is combined, uses Tapman probes, and using the method for double standard curves, reference gene ABL and NUP214-ABL1 mesh is built respectively
Gene quantitation curves, detection testee's body in NUP214-ABL1 expression.Compared to conventional FISH and △
△ CT methods, the kit has precision high, the advantages of being as a result easy to interpretation.The kit is specific good after tested, and sensitivity is high,
It is easy to operate.Contribute to the detection of NUP214-ABL1 fusions in clinically Pancytopenia patient body, it is right
It is all significant in adjustment therapeutic scheme, evaluation therapeutic effect, prediction prognosis, prevention clinical recurrence.
Brief description of the drawings
Fig. 1 NUP214-ABL1 (ex23) positive plasmid amplification curve diagram；
Fig. 2 NUP214-ABL1 (ex29) positive plasmid amplification curve diagram；
Fig. 3 NUP214-ABL1 (ex31) positive plasmid amplification curve diagram；
Fig. 4 NUP214-ABL1 (ex32) positive plasmid amplification curve diagram；
Fig. 5 NUP214-ABL1 (ex34) positive plasmid amplification curve diagram；
No. 4 sample amplification curve diagrams of Fig. 6 NUP214-ABL1 (ex23)；
No. 4 sample amplification curve diagrams of Fig. 7 NUP214-ABL1 (ex29)；
No. 4 sample amplification curve diagrams of Fig. 8 NUP214-ABL1 (ex31)；
No. 4 sample amplification curve diagrams of Fig. 9 NUP214-ABL1 (ex32)；
No. 4 sample amplification curve diagrams of Figure 10 NUP214-ABL1 (ex34).
Embodiment
Embodiment 1
The present invention is used for Pancytopenia (T-cell acute lymphoblastic on adjuvant clinical
Leukemia, T-ALL) individualized treatment solution formulation method.Mainly include following reagent：Erythrocyte cracked liquid；
TRIzol；Chloroform；Isopropanol；Absolute ethyl alcohol；
Detection architecture PCR reaction solutions：ReverTra Ace qPCR RT Kit (TOYOBO companies)；THUNDERBIRD
Probe qPCR Mix (2 ×), ABL reference genes and NUP214-ABL1 target gene primer and probe are 10 μM；
Reference gene ABL and target gene NUP214-ABL1 primer and probe is wherein detected, is respectively：
Positive reference substance：The solution of the genome containing NUP214-ABL1；
Negative controls：Solution without NUP214-ABL1 genomes.
Embodiment 2
The operating process of the inventive method：
(1) total serum IgE in extracting blood：1ml erythrocyte cracked liquids are added in clean 1.5ml centrifuge tube, are taken anti-
Blood coagulation 0.5ml is mixed.It is stored at room temperature 10min；1500rpm centrifuges 5min, abandons supernatant, collects the cell of bottom；Add again
0.5ml erythrocyte cracked liquids, 1500rpm centrifugation 5min, abandon supernatant, collect the cell of bottom；1ml is added into cell
TRIzol, repeatedly piping and druming is completely dissolved until precipitating, the static 5min of room temperature；0.2ml chloroforms are added, concussion is uniform；14000rpm
4 DEG C of centrifugation 10min, draw supernatant layer and are transferred in another new centrifuge tube；Isometric isopropanol is added, it is fully mixed up and down
It is even, it is stored at room temperature 10min；4 DEG C of centrifugation 10min of 14000rpm, abandon supernatant, add 75% ethanol 1ml, gently turn upside down and wash
Wash tube wall；4 DEG C of centrifugation 5min of 14000rpm, abandon ethanol；Drying at room temperature 10-15min, adds the dissolving of 20ulRNase-free water
Precipitation.
(2) with reference to the Rever Tra Ace qPCR RT Kit kit specifications of TOYOBO companies, RNA is reversed to
cDNA。
(3) reagent is configured：By detection people's number configuration each X μ L of detection architecture PCR reaction solutions, per the μ L of person-portion 23 packing：
X=23 μ L reaction solutions × (8 parts of internal references (standard curve)+8 parts of target gene (standard curve)+1 part of sun of+n parts of samples
Property control+1 part of negative control+1 part of blank control)；
(4) it is loaded：Add 2 μ L cDNA in detection architecture PCR reaction solutions；Positive control and negative control are directly plus 2 μ L are positive
Property reference substance and negative controls；Blank control adds 2 μ L physiological saline or is not added with any material.
(5) detect：Detection is carried out on real-time fluorescence PCR instrument, can include ABI7300, the 7500 (U.S. with instrument
Applied Biosystems companies) etc..Reaction condition：95 DEG C of pre-degeneration 1min；95 DEG C of 15s, 58 DEG C of 35sec40 circulations,
Fluorescence signal is gathered when 58 DEG C of 35sec.
(6) result judges：Threshold line is adjusted to more than background signal and negative amplification line, system according to standard curve and
CT values calculate copy number automatically.
1) when internal reference is positive, testing result just thinks effective；
2) positive criterion：Ct<36, it is positive；35≤Ct≤38, are the doubtful positive, it is necessary to verify again；Ct ＞
38, it is negative.
Embodiment 3
People taking physical examination sample is detected using nucleic acid detection method of the present invention
12, health examination sample to be checked is taken, genome, reagent preparation is extracted by the methods described of embodiment 2 and detects.
Every part of sample adds 2 μ L in detection architecture PCR reaction solutions.The positive is done simultaneously, negative, blank control, reference gene/
Each portion of standard curve of target gene.The fluorescent PCR instrument in one 96 hole can detect 12 parts of samples, each 2 weights of sample simultaneously
It is multiple, a positive control, a negative control, detection time is only 100 minutes.The abl of all samples in 12 examination samples
Equal initial line, but NUP214-ABL1 does not have sample initial line occur.As a result as shown in table 1 and Fig. 1-5
1 12 health examination sample NUP214-ABL1mRNA expressions of table
Embodiment 4
Clinical samples are detected using nucleic acid detection method of the present invention
Clinical sample to be checked 12 is taken, genome, reagent preparation is extracted by the methods described of embodiment 2 and detects.
Every part of sample adds 2 μ L in detection architecture PCR reaction solutions.The positive is done simultaneously, negative, blank control, reference gene/
Each portion of standard curve of target gene.The fluorescent PCR instrument in one 96 hole can detect 12 parts of samples, each 2 weights of sample simultaneously
It is multiple, a positive control, a negative control, detection time is only 100 minutes.The abl of all samples in 12 examination samples
Equal initial line, but NUP214-ABL1 does not have sample initial line occur.Experimental result is as shown in table 2 below and Fig. 6-10：
2 12 clinical sample NUP214-ABL1mRNA expressions of table
SEQUENCE LISTING
<110>Wuhan Aidikang Medical Lab Ltd.
<120>Detect the kit and method of NUP214-ABL1 gene relative expression quantities
<130>
<160> 10
<170> PatentIn version 3.5
<210> 1
<211> 18
<212> DNA
<213>Artificial sequence
<400> 1
agcactcagg cggcagat 18
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence
<400> 2
accacaacag cagcaacctc 20
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence
<400> 3
cagtcaggat gcagccaaca 20
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence
<400> 4
tggaggagga agtgtggcat 20
<210> 5
<211> 20
<212> DNA
<213>Artificial sequence
<400> 5
ggacccagag tagcggattc 20
<210> 6
<211> 19
<212> DNA
<213>Artificial sequence
<400> 6
acgagcggct tcactcaga 19
<210> 7
<211> 23
<212> DNA
<213>Artificial sequence
<400> 7
cccttcagcg gccagtagca tct 23
<210> 8
<211> 22
<212> DNA
<213>Artificial sequence
<400> 8
gatacgaagg gagggtgtac ca 22
<210> 9
<211> 18
<212> DNA
<213>Artificial sequence
<400> 9
ctcggccagg gtgttgaa 18
<210> 10
<211> 29
<212> DNA
<213>Artificial sequence
<400> 10
tgcttctgat ggcaagctct acgtctcct 29
Claims (5)
1. the kit of NUP214-ABL1 gene relative expression quantities is detected, including PCR reaction solutions, it is characterised in that PCR reacts
Liquid includes the primer and probe for being used to expand NUP214-ABL1 fusions, is respectively：
NUP214-ABL1(ex23)-F：AGCACTCAGGCGGCAGAT；
NUP214-ABL1(ex29)-F：ACCACAACAGCAGCAACCTC；
NUP214-ABL1(ex31)-F：CAGTCAGGATGCAGCCAACA；
NUP214-ABL1(ex32)-F：TGGAGGAGGAAGTGTGGCAT；
NUP214-ABL1(ex34)-F：GGACCCAGAGTAGCGGATTC；
NUP214-ABL1-R：ACGAGCGGCTTCACTCAGA；
NUP214-ABL1-Probe：FAM-CCCTTCAGCGGCCAGTAGCATCT-TAMRA.
2. kit according to claim 1, it is characterised in that also including the primer and probe for expanding ABL reference genes,
Respectively：
Abl-F:GATACGAAGGGAGGGTGTACCA
Abl-R:CTCGGCCAGGGTGTTGAA
Abl-Probe:FAM-TGCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA。
3. kit according to claim 1, it is characterised in that also including negative controls and blank control product.
4. a kind of method of NUP214-ABL1 fusions relative expression quantity, comprises the following steps：
(1) RNA in sample is extracted；
(2) the RNA reverse transcriptions for extracting (1) are cDNA, and produced cDNA is added in reaction tube；
(3) detection reference gene Abl sense primer Abl-F, anti-sense primer Abl-R and probe Abl-Probe is added；
(4) sense primer, anti-sense primer and the probe of the detection fusion are added；
(5) pcr amplification reaction is carried out；
(6) relative expression quantity of the fusion is calculated,
Characterized in that, the primer and probe for expanding the fusion is respectively：
NUP214-ABL1(ex23)-F：AGCACTCAGGCGGCAGAT；
NUP214-ABL1(ex29)-F：ACCACAACAGCAGCAACCTC；
NUP214-ABL1(ex31)-F：CAGTCAGGATGCAGCCAACA；
NUP214-ABL1(ex32)-F：TGGAGGAGGAAGTGTGGCAT；
NUP214-ABL1(ex34)-F：GGACCCAGAGTAGCGGATTC；
NUP214-ABL1-R：ACGAGCGGCTTCACTCAGA；
NUP214-ABL1-Probe：FAM-CCCTTCAGCGGCCAGTAGCATCT-TAMRA.
5. the gene expression quantity measuring method according to patent requirements 4, it is characterised in that also including the Abl reference genes
Primer and probe, be respectively：
Abl-F:GATACGAAGGGAGGGTGTACCA
Abl-R:CTCGGCCAGGGTGTTGAA
Abl-Probe:FAM-TGCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710402890.2A CN107151699A (en) | 2017-06-01 | 2017-06-01 | Detect the kit and method of NUP214 ABL1 gene relative expression quantities |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710402890.2A CN107151699A (en) | 2017-06-01 | 2017-06-01 | Detect the kit and method of NUP214 ABL1 gene relative expression quantities |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107151699A true CN107151699A (en) | 2017-09-12 |
Family
ID=59795936
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710402890.2A Pending CN107151699A (en) | 2017-06-01 | 2017-06-01 | Detect the kit and method of NUP214 ABL1 gene relative expression quantities |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107151699A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117385039A (en) * | 2023-11-07 | 2024-01-12 | 上海市第一人民医院 | NAP1L1 MLLT10 fusion gene, primer probe composition, kit and application |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005121335A1 (en) * | 2004-06-08 | 2005-12-22 | Vib Vzw | Episomal fusion gene |
| CN101955991A (en) * | 2010-03-31 | 2011-01-26 | 江苏迈迪基因生物科技有限公司 | Joint detection method of fusion genes related to leukemia and diagnosis kit |
| US20110263609A1 (en) * | 2007-11-15 | 2011-10-27 | Alfonso Quintas-Cardama Lee | Methods of Identifying and Treating Individuals Exhibiting NUP214-ABL1 Positive T-Cell Malignancies with Protein Tyrosine Kinase Inhibitors and Combinations Thereof |
| CN103757101A (en) * | 2013-12-23 | 2014-04-30 | 成都艾迪康医学检测实验室有限公司 | Method for detecting relative expression quantity of fusion gene ATIC-ALK and oligonucleotide |
-
2017
- 2017-06-01 CN CN201710402890.2A patent/CN107151699A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005121335A1 (en) * | 2004-06-08 | 2005-12-22 | Vib Vzw | Episomal fusion gene |
| US20110263609A1 (en) * | 2007-11-15 | 2011-10-27 | Alfonso Quintas-Cardama Lee | Methods of Identifying and Treating Individuals Exhibiting NUP214-ABL1 Positive T-Cell Malignancies with Protein Tyrosine Kinase Inhibitors and Combinations Thereof |
| CN101955991A (en) * | 2010-03-31 | 2011-01-26 | 江苏迈迪基因生物科技有限公司 | Joint detection method of fusion genes related to leukemia and diagnosis kit |
| CN103757101A (en) * | 2013-12-23 | 2014-04-30 | 成都艾迪康医学检测实验室有限公司 | Method for detecting relative expression quantity of fusion gene ATIC-ALK and oligonucleotide |
Non-Patent Citations (2)
| Title |
|---|
| C.GRAUX等: "Fusion of NUP214 to ABL1 on amplified episomes in T-cell acute lymphoblastic leukemia", 《NATURE GENETICS》 * |
| W DEENIK等: "Rapid complete cytogenetic remission after upfront dasatinib monotherapy in a patient with a NUP214-ABL1-positive T-cell acute lymphoblastic leukemia", 《LEUKEMIA》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117385039A (en) * | 2023-11-07 | 2024-01-12 | 上海市第一人民医院 | NAP1L1 MLLT10 fusion gene, primer probe composition, kit and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107663533A (en) | A kind of lung cancer EGFR L858R and 19Del ddPCR detection methods and application | |
| CN105543408B (en) | coronary heart disease early diagnosis marker | |
| CN105483218A (en) | Seminal plasma piRNA markers or their combination for detecting and/or predicting male reproductive dysfunction and application thereof | |
| CN105506115A (en) | DNA library for detection and diagnosis of hereditary cardiomyopathy causing genes and application thereof | |
| CN105986028A (en) | Method for detecting HER 2 positivity of breast cancer through ddPCR technology | |
| CN101608240A (en) | Be used to detect primer, probe and the using method thereof of human EGFR gene sudden change | |
| CN108277263A (en) | A kind of the primer combination of probe object and its detection method of detection BRAF gene V600E | |
| CN104830989A (en) | Detection kit for fusion mutation of ROS1 and various genes | |
| CN108949979A (en) | A method of judging that Lung neoplasm is good pernicious by blood sample | |
| CN103627802B (en) | Detect primer and the method for leukemia BCR/ABL m-bcr fusion gene relative expression quantity | |
| CN107312865B (en) | Purposes of the LOC100130111 in preparation osteosarcoma diagnostic products, therapeutic agent | |
| CN107574246A (en) | Detect TBLR1 RAR α and PRKAR1A RAR alpha fusion gene relative expression quantity primed probe methods | |
| CN107385038A (en) | Detect oligonucleotides, method and the kit of ZNF198 FGFR1 fusions in sample | |
| CN106906288A (en) | Detect the primer and method of leukaemia CDX2 gene expression doses | |
| CN107151699A (en) | Detect the kit and method of NUP214 ABL1 gene relative expression quantities | |
| CN110551821B (en) | Primers, probe and kit for detecting MEF2D gene rearrangement by using fluorescent quantitative PCR | |
| CN114350812A (en) | NSCLC-free RNA-3 related to oxicetitinib drug resistance and application thereof | |
| RU2665965C1 (en) | Method for screening malignant neoplasms in humans | |
| CN101921863A (en) | MiRNA expression model for diagnosing hepatic diseases independently | |
| CN110511995A (en) | One group of tuberculosis marker and its application | |
| CN102286615B (en) | Molecular marker for predicting curative effect of platinum chemo-treatment on later non-small cell lung cancer and application thereof | |
| CN110527721A (en) | A kind of oldness tuberculosis marker and its application | |
| CN108728542A (en) | Detect the preparation and its application process of long-chain non-coding RNA BC200 | |
| CN109207595A (en) | A kind of Human epidermal growth factor receptor gene T790M mutation detection kit and its detection method | |
| CN110229891A (en) | The product of non-invasive diagnosis Male Osteoporosis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170912 |