CN103667453B - Method, primers and probe for detecting relative expression quantity of 11q23/MLL fusion genes - Google Patents
Method, primers and probe for detecting relative expression quantity of 11q23/MLL fusion genes Download PDFInfo
- Publication number
- CN103667453B CN103667453B CN201310577447.0A CN201310577447A CN103667453B CN 103667453 B CN103667453 B CN 103667453B CN 201310577447 A CN201310577447 A CN 201310577447A CN 103667453 B CN103667453 B CN 103667453B
- Authority
- CN
- China
- Prior art keywords
- mll
- probe
- primer
- abl
- kinds
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for detecting the relative expression quantity of 4 fusion genes belonging to 11q23/MLL series, and primers and a probe for detecting the relative expression quantity of 4 fusion genes of 16 fusion types in total belonging to 11q23/MLL series. Through test, the primers and the probe are good in specificity, high in sensitivity and simple and convenient to operate, the data which is obtained on the basis of double-standard curve method of house-keeping gene and target gene by utilizing a real-time fluorescence quantification PCR method of the Taqman probe can be used for detecting the relative expression level of the fusion genes belonging to 11q23/MLL series in patients with ALL (Acute Lymphoblastic Leukemia), AML (Acute Myeloblastic Leukemia) and MDS (Myelodysplastic Syndrome), the high-risk groups can be accurately screened, the detection time can be effectively saved, and the detection precision can be enhanced.
Description
Technical field
The invention belongs to life science and biological technical field, particularly a kind of 4 kinds of fusion genes for detecting 11q23/MLL series amount to the primer of the relative expression quantity of 16 kinds of fused type, probe and detection method.
Background technology
MLL (mixed lineage leukemia, MLL) gene is positioned at No. 11 chromosome long arm 2 districts 3 and is with on (11q23), one of gene often involved in Hematological Malignancies, the therefore abnormal own important factor being broadly considered acute leukemia prognosis of 11q23/MLL.Up to now, numerous partner gene be positioned on karyomit(e) 11q23 is own to be determined, defines nearly more than 70 fusion genes of planting, wherein has at least 50 to be cloned on a molecular scale.Nearest research shows 11q23/MLL acute leukemia (11q23/MLL acute leukemia, 11q23/MLL AL) different partner gene, leukemia cell's classification, age and the therapeutic strategy prognosis difference of patient are very large, and these patients are how not good to conventional chemotherapy curative effect, the survival rate of 3 years is less than 10%.The scientists Molecular pathogenesis that oneself has to 11q23/MLL acute leukemia understanding is limited, adopts existing methods for the treatment of can not cure 11q23/MLL leukemia, and therefore this disease is a leukemia hypotype also to be captured.In addition, the minimal residual of fusion gene is the major cause of leukemia relapse, is thus badly in need of a kind of hypersensitivity, high specific, method that high automation degree, Environmental capacity are good detect the fusion gene mRNA that 11q23/MLL is relevant is residual.
MLL-AF4, MLL-AF6, MLL-AF9, MLL-ENL fusion gene is modal 4 kinds of fused type in MLL rearrangement clinically, wherein MLL-AF4 and MLL-AF6 has more in present children acute lymphoblastic leukaemia (ALL) patient, then comparatively rare in acute myeloblastic leukemia (AML) patient; And MLL-AF9 has more in present children and adult AML patient; MLL-ENL then occurs children and adult AML and ALL patient.MLL-AF4 is by t (4; 11) (q21; Q23) formed, merged by 4 exons of 8 exons of the mll gene of upstream and the AF4 gene in 10 exons and downstream and 7 exons respectively, thus corresponding generation MLLex8-AF4ex4 MLLex10-AF4ex4 MLLex8-AF4ex7 the common fused type of MLLex10-AF4ex7 tetra-kinds; MLL-AF6 is by t (6; 11) (q27; Q23) formed, merged by 8 exons of the mll gene of upstream and 2 exons of 10 exons and downstream AF6 gene respectively, thus corresponding produce MLLex8-AF6ex2 the common fused type of MLLex10-AF6ex2 two kinds; MLL-AF9 is by t (9; 11) (p21 – 22; Q23) formed, merged by 4 exons of 8 exons of the mll gene of upstream and 10 exons and downstream AF9 gene, 5 exons and 9 exons respectively, thus corresponding generation MLLex8-AF9ex4 MLLex8-AF9ex5 MLLex8-AF9ex9 MLLex10-AF9ex4 MLLex10-AF9ex5 MLLex10-AF9ex9 totally six kinds of common gene fusion types; MLL-ENL is by t (11; 19) (q23; P13.3) formed, merged by 8 exons of the mll gene of upstream and 2 exons of 10 exons and downstream ENL gene and 7 exons respectively, thus corresponding generation MLLex8-ENLex2 MLLex8-ENLex7 MLLex10-ENLex2 the common fused type of MLLex10-ENLex7 tetra-kinds.
Current detection 11q23/MLL series track fusion level has a variety of method, respectively has its relative merits.Wherein, 1) traditional dyeing body banding technique visual result, but need good cell division phases and chromosome morphology, for the repetition of karyomit(e) small segment, disappearance or inversion, minute translocation all cannot interpretation, and can not detect the exception of tandem sequence repeats dup11q23.2) fluorescence in situ hybridization technique (fluorescence in situhybridization, FISH) is although detection sensitivity is higher, can only know that common chromosome abnormalty detects, be not suitable for rare and unknown abnormal detection for oneself.3) multiplex nested RT-PCR uses the method being widely used in the most and detecting all kinds of fusion gene now, multiple common MLL fusion gene can be detected on a large scale, but qualitative or rough quantitative result (sxemiquantitative) can only be provided, and sensitivity limits by methodology, there is undetected possibility in the detection for minimal residual, the more important thing is, RT-Nested PCR requires higher for experimental situation, the crossed contamination that easy generation is serious, causes the appearance of false positive results.
Real-Time Fluorescent Quantitative PCR Technique (real time quantitative PCR, RQ-PCR) has higher sensitivity and specificity, and can detect in real time amplified production.Common Real-Time Fluorescent Quantitative PCR Technique has SYBR Green I dye method, two probe hybridization method and Taqman probe method etc.Wherein SYBR Green I is owing to adopting unsaturation dyestuff, can both produce non-specific binding for any DNA double spirane structure, and must judge its specificity by observing solubility curve, thus specificity is undesirable; Two probe hybridization method is owing to employing 2 probes, although specificity is very good, cost is too expensive.And Taqman probe method, adopt 1 Taqman probe, utilize reporter group, the interaction of quenching group, both ensure that the specificity of reaction, well control cost simultaneously, this method integrative biology, zymetology and fluorescence chemical are in one, all carry out under PCR reaction tubes closed state from amplification to interpretation of result, solve PCR primer pollute and cause false-positive problem, also improve susceptibility simultaneously, its result copy number represents, achieve the accurate quantitative analysis to PCR primer, be easy to unified standard, compared with qualitative PCR technology, there is specific degree good, highly sensitive, linear relationship is good, simple to operate, level of automation is high, anti-pollution, there are the advantages such as larger linearity range.For great amount of samples, especially high risk population examination there is great realistic meaning.
Summary of the invention
In view of the deficiency detecting 11q23/MLL series fusion gene mRNA relative expression levels in prior art, the present invention devises detection internal reference/goal gene primer, probe sequence, and the 4 kinds of fusion genes adopting fluorescent quantitative PCR technique to detect 11q23/MLL amount to the relative expression quantity of 16 kinds of fused type.By adjustment primer and concentration and probe concentration and ratio, the reaction system of optimize PCR and reaction conditions, can make amplification efficiency and speed all reach best.
An object of the present invention is to provide a kind of oligonucleotide of MLL-AF4, MLL-AF6, MLL-AF9 and MLL-ENL4 kind fusion gene relative expression quantity for detecting 11q23/MLL series, described oligonucleotide comprises primer and probe, wherein:
(1) shared upstream primer MLL-F1, MLL-F2 of 4 kinds of fusion genes of 11q23/MLL series and shared probe P1, P2 is detected; Wherein
MLL-F1：CAGCACTGGTCATCCCGCCTC
MLL-F2：CAATAAGCAGGAGAATGCAG
P1：FAM-ACTACAGGACCGCCAAGAAAAGAAGTTCC-TAMRA
P2：FAM-AGCACTCTCTCCAATGGCAATAGTTCTAAG–TAMRA；
(2) downstream primer AF4-R1, AF4-R2 of 4 kinds of fused type of MLL-AF4 is detected, wherein:
AF4-R1：CTTCGAGCATGGATGACGT
AF4-R2：GCCATGAATGGGTCATTTC
(3) the downstream primer AF6-R of 2 kinds of fused type of MLL-AF6 is detected, wherein:
AF6-R：CTTTCTCCGCTGACATGCACTTCA
(4) downstream primer AF9-R1, AF9-R2, AF9-R3 of 6 kinds of fused type of MLL-AF9 is detected, wherein:
AF9-R1：GATCTGCTGCAGAATGTGTCT
AF9-R2：GGACTGGGTTGTTCAGAAT
AF9-R3：TGCTGCTGCTGCTGCTGGTAT
(5) downstream primer AF9-R1, AF9-R2, AF9-R3 of 4 kinds of fused type of MLL-ENL is detected, wherein:
ENL-R1：TTGGACGGGCTTGACTGGG
ENL-R2：GCTTCTTGCGCAGTTGGG
(6) the primer abl-F of reference gene abl is detected, abl-R, probe abl-Probe; Wherein,
abl-F：GCCGTGAAGACCTTGAAGGAG
abl-R：ATGATATAGAACGGGGGCTC
abl-Probe：FAM-ACCTGGTGCAGCTCCTTGGG-TAMRA。
Further, the mol ratio of MLL-AF4 upstream primer, downstream primer and probe is 2:2:1, that is: the mol ratio of MLL-F1:AF4-R1:P1 or MLL-F1:AF4-R2:P1 or MLL-F2:AF4-R1:P2 or MLL-F2:AF4-R2:P2 is 2:2:1.The mol ratio of LL-AF6 upstream primer, downstream primer and probe is 2:2:1.Namely the mol ratio of MLL-F1:AF6-R:P1 or MLL-F2:AF4-R:P2 is 2:2:1.The mol ratio of MLL-AF9 upstream primer, downstream primer and probe is 2:2:1.Namely the mol ratio of MLL-F1:AF9-R1:P1 or MLL-F1:AF9-R2:P1 or MLL-F1:AF9-R3:P1 or MLL-F2:AF9-R1:P2 or MLL-F2:AF9-R2:P2 or MLL-F2:AF9-R3:P2 is 2:2:1.The mol ratio of MLL-ENL upstream primer, downstream primer and probe is 2:2:1.Namely the mol ratio of MLL-F1:ENL-R1:P1 or MLL-F1:ENL-R2:P1 or MLL-F2:ENL-R1:P2 or MLL-F2:ENL-R2:P2 is 2:2:1.
Further, the mol ratio of reference gene abl-F:abl-R:abl-Probe is 2:2:1.
Further, 4 kinds of fused type of described MLL-AF4 respectively: MLLex8-AF4ex4, MLLex10-AF4ex4, MLLex8-AF4ex7, MLLex10-AF4ex7.
Further, 2 kinds of fused type of described MLL-AF6 are respectively: MLLex8-AF6ex2, MLLex10-AF6ex2.
Further, 6 kinds of fused type of described MLL-AF9 are respectively: MLLex8-AF9ex4, MLLex8-AF9ex5, MLLex8-AF9ex9, MLLex10-AF9ex4, MLLex10-AF9ex5, MLLex10-AF9ex9.
Further, 4 kinds of fused type of described MLL-ENL are respectively: MLLex8-ENLex2, MLLex8-ENLex7, MLLex10-ENLex2, MLLex10-ENLex7.
Present invention also offers a kind of method detecting MLL-AF4, MLL-AF6, MLL-AF9 and MLL-ENL4 kind fusion gene of 11q23/MLL series, comprise the following steps:
(1) RNA is organized in extracting blood;
(2) RNA is reversed to cDNA;
(3) detection system PCR reaction solution configuration;
(4) application of sample;
(5) detect;
(6) result reads;
(7) report the test;
Wherein said detection system PCR reaction solution comprises: THUNDERBIRD Probe qPCR Mix, ROX Reference Dye (50 ×), RNase-free dH
2primer abl-F, abl-R of O and upstream primer MLL-F1, MLL-F2, probe P1, P2, downstream primer AF4-R1, AF4-R2, AF6-R, AF9-R1, AF9-R2, AF9-R3, AF9-R1, AF9-R2, AF9-R3, detection reference gene abl and probe abl-Probe.
Present invention also offers a kind of test kit detecting MLL-AF4, MLL-AF6, MLL-AF9 and MLL-ENL4 kind fusion gene of 11q23/MLL series, comprising:
Erythrocyte cracked liquid;
Trizol；
Chloroform;
Dehydrated alcohol;
Detection system PCR reaction solution, it primer comprised and probe are:
4 kinds of fused type of testing goal gene M LL-AF4 comprise: upstream primer is MLL-F1 and MLL-F2, and downstream primer is AF4-R1 and AF4-R2, probe P1 and P2;
2 kinds of fused type of testing goal gene M LL-AF6 comprise: upstream primer is MLL-F1 and MLL-F2, and downstream primer is AF6-R, probe P1, P2;
6 kinds of fused type of testing goal gene M LL-AF9 comprise: upstream primer is MLL-F1 and MLL-F2, and downstream primer is AF9-R1, AF9-R2, AF9-R3, probe P1 and P2;
4 kinds of fused type of testing goal gene M LL-ENL comprise: upstream primer is MLL-F1 and MLL-F2, and downstream primer is ENL-R1 and ENL-R2, probe P1 and P2;
Abl reference gene: upstream primer is abl-F, downstream primer is abl-R, probe abl-Probe.
Further, test kit also comprises and comprising for the standard substance built needed for reference gene and goal gene " two typical curve ": (1) comprises abl reference gene and detects sequence and the plasmid solution of concentration known; (2) comprise MLL-AF4 fusion gene 4 kinds of fused type and detect sequence and the plasmid solution of concentration known; (3) comprise MLL-AF6 fusion gene 2 kinds of fused type and detect sequence and the plasmid solution of concentration known; (4) comprise MLL-AF9 fusion gene 6 kinds of fused type and detect sequence and the plasmid solution of concentration known; (5) comprise MLL-ENL fusion gene 4 kinds of fused type and detect sequence and the plasmid solution of concentration known.
Beneficial effect of the present invention: real-time fluorescence PCR technology is combined with Taqman probe by the present invention, utilize the method for two typical curve, build the quantitation curves that reference gene abl and goal gene 11q23/MLL series 4 kinds of fusion genes amount to 16 kinds of fused type respectively, in detection testee body, certain fusion gene of 11q23/MLL is relative to the expression level of reference gene.The present invention enumerates 16 kinds of fused type in 4 common large class fusion genes of 11q23/MLL, and like product more on the market, the type of covering is wider.Except qualitatively screening, the present invention can also quantize the mrna expression situation of fusion gene, makes result more specifically, intuitively, more comprehensive to the guidance of diagnosis.This invention, compared to the method for traditional dyeing body banding technique, fluorescence in situ hybridization, multiplex nested RT-PCR, has that conformability is strong, broad covered area, accuracy of detection are high, and Environmental capacity is good, result is convenient to the advantages such as interpretation.Compared to the SYBR Green I dye method being all quantitative fluorescent PCR, this invention not only promotes detection specificity after adopting Taqman probe greatly, also effective detection time is shortened to 1 hours by original 2.5-3 hour, thus substantially increase accuracy and the detection efficiency of detected result.In addition, after introducing reference gene and goal gene " dual " quantitation curves, with △ △ now
cTanalytical method is compared, both eliminated different with goal gene amplification efficiency by reference gene caused by error, also reduce environmental factors to resultant uncertainty, thus fundamentally improve the stability of test-results.In addition the primer needed for reaction system, probe are carried out rational proportioning and optimization, made experiment condition reach best, thus eliminated loaded down with trivial details condition and grope link, greatly improve conventional efficient.This primer and probe after tested specificity are good, highly sensitive, easy and simple to handle.The method contributes to ALL(acute lymphoblastic leukemia clinically), AML(acute myeloblastic leukemia) and MDS(myelodysplastic syndrome) the 11q23/MLL series examination of fusion gene and the detection of mRNA relative expression levels thereof in patient body, early screening can also be carried out to high risk population simultaneously, effectively can save detection time, improve accuracy of detection.Timely therapeutic intervention is avoided hematology to recur, adjusts treatment plan, evaluates result for the treatment of, predicts prognosis, prevented clinical recurrence all significant.
Accompanying drawing explanation
Fig. 1 is sample 1MLL-AF4 examination group fluorescent quantitative PCR curve.
Fig. 2 is sample 1MLL-AF6 examination group fluorescent quantitative PCR curve.
Fig. 3 is sample 1MLL-AF9 examination group fluorescent quantitative PCR curve.
Fig. 4 is sample 1MLL-ENL examination group fluorescent quantitative PCR curve.
Fig. 5 is sample 2MLL-AF4 examination group fluorescent quantitative PCR curve.
Fig. 6 is sample 2MLL-AF6 examination group fluorescent quantitative PCR curve.
Fig. 7 is sample 2MLL-AF9 examination group fluorescent quantitative PCR curve.
Fig. 8 is sample 2MLL-ENL examination group fluorescent quantitative PCR curve.
Fig. 9 is sample 3MLL-AF4 examination group fluorescent quantitative PCR curve.
Figure 10 is sample 3MLL-AF6 examination group fluorescent quantitative PCR curve.
Figure 11 is sample 3MLL-AF9 examination group fluorescent quantitative PCR curve.
Figure 12 is sample 3MLL-ENL examination group fluorescent quantitative PCR curve.
Figure 13 is abl reference gene quantitation curves.
Figure 14 is MLL-AF4 fusion gene quantitation curves.
Figure 15 is MLL-AF6 fusion gene quantitation curves.
Figure 16 is MLL-AF9 fusion gene quantitation curves.
Figure 17 is MLL-ENL fusion gene quantitation curves.
Embodiment
Embodiment 1
ALL(acute lymphoblastic leukemia on adjuvant clinical), AML(acute myeloblastic leukemia) and MDS(myelodysplastic syndrome) 11q23/MLL series fusion gene MLL-AF4, MLL-AF6, MLL-AF9 and MLL-ENL4mRNA relative expression levels detects in patient body test kit, comprising:
Erythrocyte cracked liquid;
Trizol；
Chloroform;
Dehydrated alcohol;
Detection system PCR reaction solution: ReverTra Ace qPCR RT Kit(TOYOBO company); THNDERBIRD Probe qPCR Mix(2 ×).
Primer, probe combinations be divided into MLL-AF4 MLL-AF6 MLL-AF9 MLL-ENL.Wherein:
4 kinds of fused type examination groups of testing goal gene M LL-AF4: each 0.8uM of upstream and downstream primer, probe 0.4uM.Wherein upstream primer is MLL-F1 and MLL-F2, and downstream primer is AF4-R1 and AF4-R2, and upstream primer followed by probe, that is: P1 and MLL-F1 combination, P2 and MLL-F2 combines.Upstream and downstream primer combination of two, forms MLL-F1/AF4-R1 altogether, MLL-F1/AF4-R2, MLL-F2/AF4-R1, MLL-F2/AF4-R tetra-kinds combination, wherein:
MLL-F1：CAGCACTGGTCATCCCGCCTC；
MLL-F2：CAATAAGCAGGAGAATGCAG；
AF4-R1：CTTCGAGCATGGATGACGT；
AF4-R2：GCCATGAATGGGTCATTTC；
P1：FAM-ACTACAGGACCGCCAAGAAAAGAAGTTCC-TAMRA；
P2：FAM-AGCACTCTCTCCAATGGCAATAGTTCTAAG–TAMRA；
2 kinds of fused type examination groups of testing goal gene M LL-AF6: each 0.8 μM of upstream and downstream primer, probe 0.4 μM.Wherein upstream primer is MLL-F1 and MLL-F2, and downstream primer is AF6-R, and upstream primer followed by probe, that is: P1 and MLL-F1 combination, P2 and MLL-F2 combines.Upstream and downstream primer combination of two, forms MLL-F1/AF6-R altogether, MLL-F2/AF6-R two kinds combination.Wherein:
MLL-F1：CAGCACTGGTCATCCCGCCTC；
MLL-F2：CAATAAGCAGGAGAATGCAG；
AF6-R：CTTTCTCCGCTGACATGCACTTCA
P1：FAM-ACTACAGGACCGCCAAGAAAAGAAGTTCC-TAMRA；
P2：FAM-AGCACTCTCTCCAATGGCAATAGTTCTAAG–TAMRA；
6 kinds of fused type examination groups of testing goal gene M LL-AF9: each 0.8 μM of upstream and downstream primer, probe 0.4 μM.Wherein upstream primer is MLL-F1 and MLL-F2, and downstream primer is AF9-R1, AF9-R2, AF9-R3, and upstream primer followed by probe, that is: P1 and MLL-F1 combination, P2 and MLL-F2 combines.Upstream and downstream primer combination of two, forms MLL-F1/AF9-R1, MLL-F1/AF9-R2, MLL-F1/AF9-R3, MLL-F2/AF9-R1, MLL-F2/AF9-R2, MLL-F2/AF9-R3 six kinds combination altogether.Wherein:
MLL-F1：CAGCACTGGTCATCCCGCCTC；
MLL-F2：CAATAAGCAGGAGAATGCAG；
AF9-R1：GATCTGCTGCAGAATGTGTCT
AF9-R2：GGACTGGGTTGTTCAGAAT
AF9-R3：TGCTGCTGCTGCTGCTGGTAT
P1：FAM-ACTACAGGACCGCCAAGAAAAGAAGTTCC-TAMRA；
P2：FAM-AGCACTCTCTCCAATGGCAATAGTTCTAAG–TAMRA；
4 kinds of fused type examination groups of testing goal gene M LL-ENL: each 0.8uM of upstream and downstream primer, probe 0.4uM.Wherein upstream primer is MLL-F1 and MLL-F2, and downstream primer is ENL-R1 and ENL-R2, and upstream primer followed by probe, that is: P1 and MLL-F1 combination, P2 and MLL-F2 combines.Upstream and downstream primer combination of two, forms MLL-F1/ENL-R1 altogether, MLL-F1/ENL-R2, MLL-F2/ENL-R1, MLL-F2/ENL-R2 tetra-kinds combination.Wherein:
MLL-F1：CAGCACTGGTCATCCCGCCTC；
MLL-F2：CAATAAGCAGGAGAATGCAG；
ENL-R1：TTGGACGGGCTTGACTGGG
ENL-R2：GCTTCTTGCGCAGTTGGG
P1：FAM-ACTACAGGACCGCCAAGAAAAGAAGTTCC-TAMRA；
P2：FAM-AGCACTCTCTCCAATGGCAATAGTTCTAAG–TAMRA；
Abl reference gene: each 0.8 μM of upstream and downstream primer, probe 0.4 μM.Wherein upstream primer is abl-F, and downstream primer is abl-R, probe abl-Probe.Wherein:
abl-F：GCCGTGAAGACCTTGAAGGAG
abl-R：ATGATATAGAACGGGGGCTC
abl-Probe：FAM-ACCTGGTGCAGCTCCTTGGG-TAMRA。
Positive reference substance: respectively containing MLL-AF4 fusion gene 4 kinds of fused type, MLL-AF6 fusion gene 2 kinds of fused type, MLL-AF9 fusion gene 6 kinds of fused type, the solution of MLL-ENL fusion gene 4 kinds of fused type;
Negative controls: not containing the solution of above-mentioned 16 kinds of 11q23/MLL fused type.
Comprise for the standard substance built needed for reference gene and goal gene " two typical curve ": (1) comprises abl reference gene and detects sequence and the plasmid solution of concentration known; (2) comprise MLL-AF4 fusion gene 4 kinds of fused type and detect sequence and the plasmid solution of concentration known; (3) comprise MLL-AF6 fusion gene 2 kinds of fused type and detect sequence and the plasmid solution of concentration known; (4) comprise MLL-AF9 fusion gene 6 kinds of fused type and detect sequence and the plasmid solution of concentration known; (5) comprise MLL-ENL fusion gene 4 kinds of fused type and detect sequence and the plasmid solution of concentration known.
Embodiment 2
Detect operating process:
(1) RNA is organized in extracting blood: in the centrifuge tube of the 1.5ml of cleaning, add 1ml erythrocyte cracked liquid, get anticoagulation 0.5ml and mix.Room temperature leaves standstill 10min; The centrifugal 5min of 5000rpm, abandons supernatant, collects the cell of bottom; Again add 0.5ml erythrocyte cracked liquid, the centrifugal 5min of 5000rpm, abandons supernatant, collects the cell of bottom; In cell, add 1mlTrizol, piping and druming is until precipitation is dissolved completely repeatedly, the static 5min of room temperature; Add 0.2ml chloroform, concussion evenly; 14000rpm4 DEG C of centrifugal 10min, draws supernatant layer and is transferred in another new centrifuge tube; Add isopyknic Virahol, fully mix up and down, room temperature leaves standstill 10min; 14000rpm4 DEG C of centrifugal 10min, abandons supernatant, adds 75% ethanol 1ml, and turn upside down washing tube wall gently; 14000rpm4 DEG C of centrifugal 5min, abandons ethanol; Drying at room temperature 10-15min, adds 20 μ lRNase-free water dissolution precipitations.
(2) with reference to the Rever Tra Ace qPCR RT Kit test kit specification sheets of TOYOBO company, RNA is reversed to cDNA.
(3) detection system PCR reaction solution configuration: by detecting people's number configuration detection system PCR reaction solution each X μ l, every person-portion 23 μ l packing, composed as follows:
MLL-AF4
MLL-AF9
MLL-AF6
MLL-ENL
X=23ul reaction solution × (8 parts of reference genes (typical curve)+8 parts of goal gene (typical curve)+n part sample+1 part of positive control+1 part of negative controls+1 part of blank);
(4) application of sample: respectively to adding gained cDNA in 2 μ l steps (2) in MLL-AF4, MLL-AF6, MLL-AF9, MLL-ENL detection system PCR reaction solution; Positive control and negative control directly add 2 μ l positive reference substance and negative controls; Blank adds 2 μ l physiological saline.
(5) detect: detect and carry out on real-time fluorescence PCR instrument, available instrumentation comprises ABI7300, Applied Biosystems company of the 7500(U.S.) etc.Reaction conditions: 95 DEG C of denaturation 1min; 95 DEG C of 15s, 58 DEG C of 35sec, 40 circulations, fluorescent signal gathers when 58 DEG C of 35sec.
(6) result reads: threshold line is adjusted to more than background signal and negative amplification line, system calculates copy number automatically according to typical curve and CT value.Calculate before copy number, please first contrast following annotation (1) and (2) validity to result is passed judgment on, further result is qualitatively judged.
1), when internal reference is positive, detected result just thinks effective;
2) positive judging criterion: the Ct<35 of goal gene, is the positive; 35≤Ct≤38 are the doubtful positive, need again to verify; Ct > 38 is feminine gender.
(7) report the test: the goal gene copy number being judged to the sample of positive findings is made ratio with the copy number of reference gene, draws fusion gene mRNA relative expression levels.
Embodiment 3
Fetch and deliver each 20 examples of ALL, AML, MDS clinical samples of inspection, extract by method described in embodiment 2 and organize RNA, and be cDNA by extracted RNA reverse transcription of organizing, preparation detection system PCR reaction solution also detects.
This reverse transcription of every increment is cDNA, and adds the cDNA sample of 2 μ l in detection system PCR reaction solution.Do the positive simultaneously, negative, blank, each 1 part of the typical curve of reference gene/goal gene.Each sample repeats for 2 times, 1 part of positive control, 1 part of negative control and 1 part of blank.Detection time is 100 minutes.
Experimental result of the present invention and △ △
cTthe result of method is compared, and determines the accuracy rate of pattern detection.Result is as shown in table 1, table 2 and table 3:
Table 1:20 example ALL patient detected result
Table 2:20 example AML patient detected result
Table 3:20 example MDS patient detected result
Table 1-table 3 is detected result of the present invention and popular △ △ now
cTmethod detected result compares, in all 60 routine tested samples, only 1 example (4550) there are differences on result judges, and after empirical tests, 4550 are the weak positive and for minimal residue, although the detection expression amount result of other samples is numerically variant, after statistical analysis, difference all not significantly (P>0.05), judges to produce great effect for result.Therefore, two kinds of overall coincidence rates of method Comparability test result reach more than 98.0%.Detection kit of the present invention and △ △ popular now
cTanalytical procedure is compared, and not only detected result accuracy is high, and has higher recall rate for the sample that track fusion amount is low, has stopped minimal residual detection leakage phenomenon, has improve accuracy of detection.In detection time, △ △
cTneed to spend about 2.5-3 hour, adopt method of the present invention to shorten to 1 hours detection time.Therefore the Clinical Laboratory requirement that detection limit increases day by day can be met better on detection efficiency.With △ △ conventional now
cTanalytical method is compared, and has both eliminated by reference gene caused error different from goal gene amplification efficiency, has also reduced environmental factors to resultant uncertainty, thus fundamentally improve the stability of test-results.In addition the primer needed for reaction system, probe are carried out rational proportioning and optimization, made experiment condition reach best, thus eliminated loaded down with trivial details condition and grope link, greatly improve conventional efficient.
Embodiment 4
Get clinical sample to be checked 3 parts, extract by method described in embodiment 2 and organize RNA, be cDNA by the RNA reverse transcription of organizing extracted, and prepare detection system PCR reaction solution.The cDNA sample of 2 μ l is added in detection system PCR reaction solution.Do the positive simultaneously, negative, each portion of blank.Detect with fluorescent PCR instrument, the time is 100 minutes.
Sample 1 through genetic map analysis, find there is t (4; 11) (q21; , namely there is MLL-AF4 fusion gene in q23) chromosome translocation.The result utilizing the method for the invention to detect as shown in figures 1-4, during 11q23/MLL series detects, only has MLL-AF4 examination group to occur fluorescent signal, consistent with genetic map analytical results, advises row allotransplantation as early as possible.
Sample 2 through genetic map analysis, find there is t (11; 19) (q23; , namely there is MLL-ENL fusion gene in P13.1) chromosome translocation.The result utilizing the method for the invention to detect as shown in figures 5-8, during 11q23/MLL series detects, only has MLL-ENL examination group to occur fluorescent signal, consistent with genetic map analytical results, advises row allotransplantation as early as possible.
Sample 3 through genetic map analysis, find there is t (6; 11) (q27; , namely there is MLL-AF6 fusion gene in q23) chromosome translocation.The result utilizing the method for the invention to detect as shown in figs. 9 to 12, during 11q23/MLL series detects, only has MLL-AF6 examination group to occur fluorescent signal, consistent with genetic map analytical results, advises row allotransplantation as early as possible.From detected result comparative analysis, primer of the present invention, probe, test kit and detection method, acquired results accurately, reliable, stable, detection efficiency is high.
SEQUENCE LISTING
<110> Fuzhou Adicon Clinical Laboratory, Inc.
<120> detects the method for 11q23/MLL fusion gene relative expression quantity, primer and probe
<130>
<160> 15
<170> PatentIn version 3.3
<210> 1
<211> 21
<212> DNA
<213> artificial sequence
<400> 1
cagcactggt catcccgcct c 21
<210> 2
<211> 20
<212> DNA
<213> artificial sequence
<400> 2
caataagcag gagaatgcag 20
<210> 3
<211> 29
<212> DNA
<213> artificial sequence
<400> 3
actacaggac cgccaagaaa agaagttcc 29
<210> 4
<211> 30
<212> DNA
<213> artificial sequence
<400> 4
agcactctct ccaatggcaa tagttctaag 30
<210> 5
<211> 19
<212> DNA
<213> artificial sequence
<400> 5
cttcgagcat ggatgacgt 19
<210> 6
<211> 19
<212> DNA
<213> artificial sequence
<400> 6
gccatgaatg ggtcatttc 19
<210> 7
<211> 24
<212> DNA
<213> artificial sequence
<400> 7
ctttctccgc tgacatgcac ttca 24
<210> 8
<211> 21
<212> DNA
<213> artificial sequence
<400> 8
gatctgctgc agaatgtgtc t 21
<210> 9
<211> 19
<212> DNA
<213> artificial sequence
<400> 9
ggactgggtt gttcagaat 19
<210> 10
<211> 21
<212> DNA
<213> artificial sequence
<400> 10
tgctgctgct gctgctggta t 21
<210> 11
<211> 19
<212> DNA
<213> artificial sequence
<400> 11
ttggacgggc ttgactggg 19
<210> 12
<211> 18
<212> DNA
<213> artificial sequence
<400> 12
gcttcttgcg cagttggg 18
<210> 13
<211> 21
<212> DNA
<213> artificial sequence
<400> 13
gccgtgaaga ccttgaagga g 21
<210> 14
<211> 20
<212> DNA
<213> artificial sequence
<400> 14
atgatataga acgggggctc 20
<210> 15
<211> 20
<212> DNA
<213> artificial sequence
<400> 15
acctggtgca gctccttggg 20
Claims (8)
1., for detecting primer and the probe of MLL-AF4, MLL-AF6, MLL-AF9 and MLL-ENL 4 kinds of fusion gene relative expression quantities of 11q23/MLL series, it is characterized in that: described primer and probe comprise:
(1) shared upstream primer MLL-F1, MLL-F2 of 4 kinds of fusion genes of 11q23/MLL series and shared probe P1, P2 is detected; Wherein
MLL-F1：CAGCACTGGTCATCCCGCCTC
MLL-F2：CAATAAGCAGGAGAATGCAG
P1：FAM-ACTACAGGACCGCCAAGAAAAGAAGTTCC-TAMRA
P2：FAM-AGCACTCTCTCCAATGGCAATAGTTCTAAG–TAMRA；
(2) downstream primer AF4-R1, AF4-R2 of 4 kinds of fused type of MLL-AF4 is detected, wherein:
AF4-R1：CTTCGAGCATGGATGACGT
AF4-R2：GCCATGAATGGGTCATTTC
(3) the downstream primer AF6-R of 2 kinds of fused type of MLL-AF6 is detected, wherein:
AF6-R：CTTTCTCCGCTGACATGCACTTCA
(4) downstream primer AF9-R1, AF9-R2, AF9-R3 of 6 kinds of fused type of MLL-AF9 is detected, wherein:
AF9-R1：GATCTGCTGCAGAATGTGTCT
AF9-R2：GGACTGGGTTGTTCAGAAT
AF9-R3：TGCTGCTGCTGCTGCTGGTAT
(5) downstream primer AF9-R1, AF9-R2, AF9-R3 of 4 kinds of fused type of MLL-ENL is detected, wherein:
ENL-R1：TTGGACGGGCTTGACTGGG
ENL-R2：GCTTCTTGCGCAGTTGGG
(6) the primer abl-F of reference gene abl is detected, abl-R, probe abl-Probe; Wherein,
abl-F：GCCGTGAAGACCTTGAAGGAG
abl-R：ATGATATAGAACGGGGGCTC
abl-Probe：FAM-ACCTGGTGCAGCTCCTTGGG-TAMRA。
2. primer as claimed in claim 1 and probe, is characterized in that:
The mol ratio of MLL-AF4 upstream primer, downstream primer and probe is 2:2:1;
The mol ratio of MLL-AF6 upstream primer, downstream primer and probe is 2:2:1;
The mol ratio of MLL-AF9 upstream primer, downstream primer and probe is 2:2:1;
The mol ratio of MLL-ENL upstream primer, downstream primer and probe is 2:2:1.
3. primer as claimed in claim 1 and probe, is characterized in that the mol ratio of reference gene abl-F:abl-R:abl-Probe is 2:2:1.
4. primer as claimed in claim 1 and probe, is characterized in that, 4 kinds of fused type of described MLL-AF4 respectively: MLLex8-AF4ex4, MLLex10-AF4ex4, MLLex8-AF4ex7, MLLex10-AF4ex7.
5. primer as claimed in claim 1 and probe, is characterized in that, 2 kinds of fused type of described MLL-AF6 respectively: MLLex8-AF6ex2, MLLex10-AF6ex2.
6. primer as claimed in claim 1 and probe, it is characterized in that, 6 kinds of fused type of described MLL-AF9 respectively: MLLex8-AF9ex4, MLLex8-AF9ex5, MLLex8-AF9ex9, MLLex10-AF9ex4, MLLex10-AF9ex5, MLLex10-AF9ex9.
7. primer as claimed in claim 1 and probe, is characterized in that, 4 kinds of fused type of described MLL-ENL respectively: MLLex8-ENLex2, MLLex8-ENLex7, MLLex10-ENLex2, MLLex10-ENLex7.
8. a method for MLL-AF4, MLL-AF6, MLL-AF9 and MLL-ENL 4 kinds of fusion genes of the detection 11q23/MLL series of non-diseases diagnostic purpose, comprises the following steps:
(1) RNA is organized in extracting blood;
(2) RNA is reversed to cDNA;
(3) detection system PCR reaction solution configuration;
(4) application of sample;
(5) detect;
(6) result reads;
(7) report the test;
Wherein said detection system PCR reaction solution comprises: THUNDERBIRD Probe qPCR Mix, ROX Reference Dye (50 ×), RNase-free dH
2o and upstream primer MLL-F1, MLL-F2, probe P1, P2, downstream primer AF4-R1, AF4-R2, AF6-R, AF9-R1, AF9-R2, AF9-R3, ENL-R1, ENL-R2, detect primer abl-F, abl-R and the probe abl-Probe of reference gene abl;
Wherein, MLL-F1:CAGCACTGGTCATCCCGCCTC
MLL-F2：CAATAAGCAGGAGAATGCAG
P1：FAM-ACTACAGGACCGCCAAGAAAAGAAGTTCC-TAMRA
P2：FAM-AGCACTCTCTCCAATGGCAATAGTTCTAAG–TAMRA
AF4-R1：CTTCGAGCATGGATGACGT
AF4-R2：GCCATGAATGGGTCATTTC
AF6-R：CTTTCTCCGCTGACATGCACTTCA
AF9-R1：GATCTGCTGCAGAATGTGTCT
AF9-R2：GGACTGGGTTGTTCAGAAT
AF9-R3：TGCTGCTGCTGCTGCTGGTAT
ENL-R1：TTGGACGGGCTTGACTGGG
ENL-R2：GCTTCTTGCGCAGTTGGG
abl-F：GCCGTGAAGACCTTGAAGGAG
abl-R：ATGATATAGAACGGGGGCTC
abl-Probe：FAM-ACCTGGTGCAGCTCCTTGGG-TAMRA。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310577447.0A CN103667453B (en) | 2013-11-18 | 2013-11-18 | Method, primers and probe for detecting relative expression quantity of 11q23/MLL fusion genes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310577447.0A CN103667453B (en) | 2013-11-18 | 2013-11-18 | Method, primers and probe for detecting relative expression quantity of 11q23/MLL fusion genes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103667453A CN103667453A (en) | 2014-03-26 |
| CN103667453B true CN103667453B (en) | 2015-06-17 |
Family
ID=50306221
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310577447.0A Active CN103667453B (en) | 2013-11-18 | 2013-11-18 | Method, primers and probe for detecting relative expression quantity of 11q23/MLL fusion genes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103667453B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105044168A (en) * | 2015-06-03 | 2015-11-11 | 福建医科大学 | Method for detecting acute promyelocytic PML/RAR alpha gene sequence on basis of dual-channel sensor with fluoro nucleic acid probe |
| CN105803087A (en) * | 2016-04-29 | 2016-07-27 | 广州蓝吉生物技术有限公司 | Kit for detecting expression of fusion gene MLL-ENL mRNA and application of kit |
| CN108034702B (en) * | 2017-11-10 | 2021-09-17 | 济南艾迪康医学检验中心有限公司 | Oligonucleotide for detecting expression condition and fusion type of fusion gene MLL/CBP and application |
| CN109593850B (en) * | 2018-12-18 | 2019-09-20 | 武汉迪安医学检验实验室有限公司 | It is a kind of for detecting the kit of MLL-AF4 fusion |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101955991A (en) * | 2010-03-31 | 2011-01-26 | 江苏迈迪基因生物科技有限公司 | Joint detection method of fusion genes related to leukemia and diagnosis kit |
| CN102251031A (en) * | 2011-06-30 | 2011-11-23 | 北京思尔成生物技术有限公司 | TaqMan MGB probe real-time fluorescence PCR detection method for leukemia fusion genes, and special primers, probes and kit used by same |
-
2013
- 2013-11-18 CN CN201310577447.0A patent/CN103667453B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101955991A (en) * | 2010-03-31 | 2011-01-26 | 江苏迈迪基因生物科技有限公司 | Joint detection method of fusion genes related to leukemia and diagnosis kit |
| CN102251031A (en) * | 2011-06-30 | 2011-11-23 | 北京思尔成生物技术有限公司 | TaqMan MGB probe real-time fluorescence PCR detection method for leukemia fusion genes, and special primers, probes and kit used by same |
Non-Patent Citations (2)
| Title |
|---|
| Efficient and easy detection of MLL-AF4, MLL-AF9 and MLL-ENL fusion gene transcripts by multiplex real-time quantitative RT-PCR in TaqMan and LightCycler;MWJC Jansen等;《Leukemia》;20050908;第19卷;2016-2018 * |
| 急性白血病MLL融合基因新检测方法的建立和应用;赵晓明等;《中国实验血液学杂志》;20121231;第20卷(第4期);852-856 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103667453A (en) | 2014-03-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103667453B (en) | Method, primers and probe for detecting relative expression quantity of 11q23/MLL fusion genes | |
| Yin et al. | Peripheral blood circulating microRNA‐4636/− 143 for the prognosis of cervical cancer | |
| CN108949961A (en) | For detecting kit and its screening of adenovirus pneumonia | |
| CN106701962B (en) | Primer group, probe and kit for detecting Kawasaki disease | |
| CN103627802B (en) | Detect primer and the method for leukemia BCR/ABL m-bcr fusion gene relative expression quantity | |
| CN105420393A (en) | Primers, probe, and kit for detecting BRCA1 gene expression | |
| CN104450702B (en) | A kind of Serum miRNA biomarker composition and application | |
| CN110396542A (en) | A kind of LncRNA marker and its application in diabetes | |
| CN112522415B (en) | Reagent and kit for diagnosing slow granule acute phase based on LGALS3 splice variant | |
| CN102094070A (en) | mRNA in-situ hybridization kit for detecting overexpression of HER2 | |
| CN108424962A (en) | The miRNA detection markers and its diagnostic kit of mesangial proliferative glomerulonephritis | |
| CN101624622A (en) | Kit for quantitatively detecting PML/RARalpha mRNA level | |
| KR102505617B1 (en) | Urinary exosome-derived miRNA gene biomarkers for diagnosis of T cell-mediated rejection in kidney allografts and use thereof | |
| CN104975075B (en) | System, method and establishment of method for IgA nephropathy detection | |
| CN102758006B (en) | Kit for detecting relative expression of leukemia BCR/ABL (b3a2, b2a2) fusion gene | |
| KR20210024986A (en) | Urinary exosome-derived miRNA gene biomarkers for diagnosis of antibody-mediated rejection in kidney allografts and use thereof | |
| CN101624620A (en) | Kit for quantitatively detecting AML1/ETO mRNA level | |
| CN103805698B (en) | Detect primer and the method for AML1-ETO fusion gene relative expression quantity | |
| CN103667457B (en) | The primer of detection leukemia BCR/ABL b3a2, b2a2 fusion gene relative expression quantity and method | |
| KR102545543B1 (en) | Urinary exosome-derived miRNA gene biomarkers for diagnosis of BK virus nephropathy in kidney allografts and use thereof | |
| CN109628594A (en) | One kind long-chain non-coding RNA relevant to liver cancer and its application | |
| CN109321640A (en) | Detect oligonucleotides, method and the kit of PSF-TFE3 fusion in sample | |
| CN103451303A (en) | Kit for detecting expression level of human ERCC1 (excision repair cross complementation 1) through PCR (polymerase chain reaction) method | |
| CN103436621A (en) | Method and kit for quickly detecting expression quantity of CK19 mRNA (messenger ribonucleic acid) | |
| CN102776282B (en) | Kit for detecting relevant expression quantity of AML-EVI1 (acute myelocytic leukemia-ecotropic virus integration site 1) fusion gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP01 | Change in the name or title of a patent holder |
Address after: Building 3, No. 53, Yangqi Road, Gaishan Town, Fuzhou City, Fujian Province 350008 Patentee after: Fuzhou aidikang medical laboratory Co.,Ltd. Address before: Building 3, No. 53, Yangqi Road, Gaishan Town, Fuzhou City, Fujian Province 350008 Patentee before: FUZHOU ADICON CLINICAL LABORATORIES, Inc. |
|
| CP01 | Change in the name or title of a patent holder |