CN101955991B - Joint detection method of fusion genes related to leukemia and diagnosis kit - Google Patents
Joint detection method of fusion genes related to leukemia and diagnosis kit Download PDFInfo
- Publication number
- CN101955991B CN101955991B CN201010137451.1A CN201010137451A CN101955991B CN 101955991 B CN101955991 B CN 101955991B CN 201010137451 A CN201010137451 A CN 201010137451A CN 101955991 B CN101955991 B CN 101955991B
- Authority
- CN
- China
- Prior art keywords
- leukemia
- seq
- fusion gene
- gene
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57426—Specifically defined cancers leukemia
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Hematology (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Biomedical Technology (AREA)
- Oncology (AREA)
- Microbiology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Hospice & Palliative Care (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Urology & Nephrology (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- General Physics & Mathematics (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Food Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a joint detection method of fusion genes related to leukemia and a diagnosis kit. The method comprises the following steps of: designing a primer and a probe through a fusion gene mRNA (the fusion genes related to the leukemia are SIL-TAL1(type II, type III), MLL-AF4(e9/e5,e9/e4) and CBFB-MYH11(type D)) related to the leukemia; hybridizing a probe and microsphere mixture formed by the covalent bonding of the probe and microspheres with an RT-PCR (Reverse Transcription-Polymerase Chain Reaction) amplification product; and adding phycoerythrin as streptavidin biotin to detect fluorescent signals of different microspheres so as to confirm whether a sample to be detected contains a leukemia fusion gene as well as the expression conditions of the fusion gene. The method and the kit of the invention have the advantages of high sensitivity and flux, rapid and accurate detection, and the like and can be used for simultaneously, qualitatively and quantitatively detecting various leukemia fusion genes.
Description
Technical field
The present invention relates to in-vitro diagnosis detection technique field, be specifically related to liquid-phase chip associated detecting method and the diagnostic kit thereof of the multiple fusion gene that leukemia is relevant.
Background technology
Leukemia is the Hematopoietic Malignancies causing due to hemopoietic stem cell prosoplasia and neoplasm, is one of modal malignant tumour of China.Along with the continuous progress of leukemia research, find that many leukaemics have specific chromosome translocation, cause new fusion gene to produce, these aberrant genes have become dissimilar leukemic molecular biology specificity marker.Within 2000, WHO is about the standard that especially some Common Abnormity genes is summarized as to leukemia basic diagnosis in the standard of leukemia classification.Therefore, at the level of molecule and gene, the relevant fusion gene of leukemia is detected, not only can, for leukemia diagnosis, somatotype, clinical treatment selection and prognosis judgement provide important evidence, also provide detection basic for Minimal Residual Disease of Leukemia becomes simultaneously.
Fusion gene common in leukemia has: BCR-ABL (b2a2), BCR-ABL (b3a2) in chronic myelocytic leukemia (CML); BCR-ABL (ela2) in acute lymphoblastic leukemia (ALL), E2A-PBX1, TEL-AML1, MLL-AF4 (e10/e4, e9/e5, e9/e4); CBFB-MYH11 (type A, type D), AML1-ETO in acute myeloblastic leukemia (AML); PML-RARA (Lform), PML-RARA (S form) in acute promyelocytic leukemia (APL); SIL-TAL1 (type II, type III) in T cell Acute Lymphoblastic Leukemia (T-ALL).
At present, leukemia is mainly to rely on the detection methods such as morphocytology, immunology, cytogenetics, molecular biology to carry out diagnosis and detection somatotype.Morphocytology is affected by subjective factor, and the concordance rate of clinical diagnosis is only 70% left and right.The cytogenetic methods such as karyotyping and banding technique is at full genomic level examination chromosome translocation, easily undetected many chromosomal minor anomalies.Immunological method has higher false positive rate and false negative rate, and cannot accomplish early diagnosis.In the method for the outer widely used molecular Biological Detection leukemia fusion gene of Present Domestic, fluorescence in situ hybridization technique (FISH) can only be carried out qualitative detection, complicated operation; Quantitative fluorescent PCR exists the limitation that detects flux, so all can't really meet the needs that clinical diagnosis detects.Traditional solid phase biological chip (Biochip) technology exist repeatable poor, insufficient sensitivity good and the outstanding weakness of complex operation.Therefore need clinically to have a kind of detection method, can be rapidly, stable, exactly leukemic multiple fusion gene is carried out to associating parallel detection, liquid-phase chip technology (xMAP) is a kind of so novel detection technique just.
Liquid-phase chip can carry out qualitative and quantitative analysis to a small amount of sample, has the outstanding advantages such as high-throughput, easy and simple to handle, reproducible, highly sensitive, linearity range is wide.This system is that main matrix forms by many microballoons, in the middle of the manufacturing processed of microballoon, two kinds of different redness classification fluorescence are mixed, according to the ratio difference of these two kinds of fluorescence, sphere matrix is divided into 100 kinds, 100 kinds of different probe molecules on can mark, can be simultaneously in a sample nearly 100 kinds of different target molecules detect.According to detecting the difference of thing, microsphere surface can the various detection of nucleic acids probes of covalent attachment, add fluorescent mark in the time that hybridization carries out.In same reaction system, can add different detection microballoons simultaneously, so just can utilize a small amount of sample to carry out quick, high-throughout detection.After reaction finishes, by micro-fluidic technologies by microballoon defiled Rapid Flow through liquid-phase chip detector, each microballoon can be arrived by two bundle laser detection simultaneously, red laser excites the redness classification fluorescence on microballoon, each different reaction zone is separated and qualitative; Green laser excites the fluorescent mark being combined on sample to be tested to carry out quantitatively.In the time that the probe on the good sample to be tested of mark and specific microballoon combines, the light that two bundle laser excite all can be detected.Finally, by the high speed digital signal processor of computer, can automatic statistical analysis draw the average fluorescent strength on specific microballoon, thereby determine the kind and the quantity that detect thing.
The present invention is based on the high-throughput of liquid-phase chip technology, the outstanding advantages such as easy and simple to handle, reproducible, highly sensitive, linearity range is wide, leukemic multiple fusion gene is carried out to associating parallel detection, can in clinical detection, better be applied.
Summary of the invention
The technical issues that need to address of the present invention are to provide a kind of associated detecting method and diagnostic kit of leukemia correlation fusion gene.The method and test kit comprise SIL-TAL1type II and type III fusion gene, MLL-AF4e9/e5 and e9/e4 fusion gene, many kinds of fusion gene joint-detection of CBFB-MYH11type D, can carry out clinical classification to T cell Acute Lymphoblastic Leukemia (T-ALL), acute lymphoblastic leukemia (ALL), acute myeloblastic leukemia (AML), patient be carried out to observation of curative effect, prognosis and small residual disease simultaneously and carry out dynamic monitoring.This detection method and diagnostic kit have the advantages such as highly sensitive, high specific, split hair caccuracy, detection be rapid.
For solving the problems of the technologies described above, the technical solution used in the present invention is as follows:
In one aspect of the invention, provide the associated detecting method of the fusion gene that a kind of leukemia is relevant, comprise the following steps:
(1) comprise 3 kinds of carboxyl microballoon beads that difference is fluorescence-encoded, numbering is respectively 11,15,17; The designed specific dna probe of mRNA of 3 kinds of fusion genes that on every kind of microballoon, covalent attachment forms for chromosome translocation in leukemia respectively;
(2) mRNA of 3 kinds of fusion genes that form for chromosome translocation in different type of leukemia, designs respectively upstream and downstream primer, to different fusion gene mRNAs, amplifies corresponding product by reverse transcription PCR;
(3) after the reverse transcription amplification product hybridization of the microballoon that contains specific dna probe and fusion gene mRNA, add SA-PE (Streptavidin-PE), detect fluorescent signal by Luminex xMAP;
(4) fluorescent signal of the fluorescent signal detecting and reference gene is compared, thereby determine and detect in sample whether contain the fusion gene that leukemia is relevant, and/or the expression situation of fusion gene in sample.
Microballoon described in above detection method is that mean diameter is 5.6 μ m, combines the polyphenyl alkene microballoon of different fluorescence dyes, i.e. color-code microballoon (color-coded beads); The fusion gene that in leukemia, chromosome translocation forms is for following multiple fusion gene that can independent assortment: SIL-TAL1 type II and type III fusion gene, MLL-AF4 e9/e5 and e9/e4 fusion gene, CBFB-MYH11 type D.
Described be covalently bonded in 3 specific dna probes on microballoon, comprise following sequence (wherein 5 ' end is containing amido modified):
SIL-TAL1type II and type III fusion gene: 5 '-AminolinkerC12AGTTACGCTGCGGTGTGGTC-3 ', as shown in SEQ ID NO.1;
MLL-AF4e9/e5 and e9/e4 fusion gene: 5 '-AminolinkerC12TATTGCTGTCAAAGGAGGCGG-3 ', as shown in SEQ ID NO.2;
CBFB-MYH11type D:5 '-AminolinkerC12TGTCCTTCTCCGAGCCTCTTCA-3 ', as shown in SEQ ID NO.3;
Or include holding or/and the sequence that 3 ' end extends to 5 ' of above-mentioned sequence (containing complementary sequence);
Or with the above-mentioned sequence sequence that (containing complementary sequence), homology was greater than 85%;
Or the complementary base sequences thereof with above-mentioned sequence;
Or use any one or more than one the combination in above-mentioned all sequences.
The upstream and downstream primer that the described mRNA for fusion genes is designed, comprises following sequence (wherein upstream primer 5 ' end is containing biotin label):
SIL-TAL1type II and type III fusion gene: upstream primer 5 '-biotin CCTGCAAACAGACCTCAGCTC-3 ', as shown in SEQ ID NO.4; Downstream primer 5 '-CGAGGAAGAGGATGCACAC-3 ', as shown in SEQ ID NO.5;
MLL-AF4e9/e5 and e9/e4 fusion gene: upstream primer 5 '-biotin TCCAGAGCAGAGCAAACAG-3 ', as shown in SEQ ID NO.6; Downstream primer 5 '-CCTTGCTGAGAATTTGAGTG-3 ', as shown in SEQ ID NO.7;
CBFB-MYH11type D: upstream primer 5 '-biotin GAGGATGCATTAGCACAACAG-3 ', as shown in SEQ ID NO.8; Downstream primer 5 '-GAAGCAACTCCTGGGTGTC-3 ', as shown in SEQ ID NO.9;
Or include holding or/and the sequence that 3 ' end extends to 5 ' of above-mentioned sequence (containing complementary sequence);
Or with the above-mentioned sequence sequence that (containing complementary sequence), homology was greater than 85%;
Or the complementary base sequences thereof with above-mentioned sequence;
Or use any one or more than one the combination in above-mentioned all sequences.
Primer and the probe sequence of described reference gene Abelson gene are as follows:
Upstream primer 5 ' biotin GCGCAAAATGTTGGAGATC-3 ', as shown in SEQ ID NO.10;
Downstream primer 5 '-GGAGCTTTTCACCTTTAGTTATGC3 ', as shown in SEQ ID NO.11;
Probe 5 '-AminolinkerC12CTGAAGGGCTTCTTCCAGAT-3 ', as shown in SEQ ID NO.12;
Or include holding or/and the sequence that 3 ' end extends to 5 ' of above-mentioned sequence (containing complementary sequence);
Or with the above-mentioned sequence sequence that (containing complementary sequence), homology was greater than 85%;
Or the complementary base sequences thereof with above-mentioned sequence;
Or use any one or more than one the combination in above-mentioned all sequences.
In another aspect of this invention, provide a kind of diagnostic kit that detects the multiple fusion gene that leukemia is relevant, the comprised covalent attachment mixture of microspheres of leukemia fusion gene mRNA specific probe, the microballoon that combines Abelson gene probe, the upstream and downstream primer of leukemia fusion gene mRNA, the upstream and downstream primer of Abelson gene, SA-PE Streptavidin-PE, quality control product (negative control and positive control).
Quality control product described in above test kit comprises positive control and negative control, wherein positive control is the mixed solution (comprising the plasmid containing Abelson gene) that contains various fusion gene plasmids, and negative control product are the plasmid solution that does not contain fusion gene and Abelson gene; Described mixture of microspheres, according to the independent assortment that needs of difference detection sample.
In another aspect of this invention, provide a kind of diagnostic kit that detects the multiple fusion gene that leukemia is relevant detecting vitro samples, leukemia is carried out to somatotype, early diagnosis, observation of curative effect, the application in the dynamic monitoring of prognosis and small residual disease.
Because the present invention has utilized liquid-phase chip technology, make detection method and test kit there is the outstanding advantages such as highly sensitive, high specific, high-throughput, good stability, detection be rapid, accurate, can carry out quantitative and qualitative analysis detection to leukemia fusion gene, can in clinical detection, better be applied.
Embodiment
Describe the present invention in detail below in conjunction with specific embodiment, but can not be interpreted as limitation of the present invention.Described embodiment only provides and illustrates nucleic acid probe, test kit and Production and application method thereof and not by it is limited.Various versions are expected in the scope of the present invention and described claim during this time.
1. experiment material
Primer and probe are synthetic by invitrogen company; Trizol is purchased from invitrogen company; Reverse transcription cDNA synthetic agent box, PCR reagent are purchased from Fermentas company; Microballoon (surperficial carboxyl modified), the SA-PE of different numberings are all purchased the company in QIAGEN; 1-ethyl-(3-dimethylaminopropyl)-3-ethyl-carbodiimide hydrochloride (EDC) is purchased the company in Pierce; 2-(N-morpholine)-ethyl sulfonic acid (MES), N-lauroyl propylhomoserin sodium (Sarkosyl), tetramethyl ammonium chloride (TMAC) are all purchased the company in sigma.
The configuration of damping fluid and hybridization solution:
Coupling buffer, PH4.5 250ml
MES 4.88g；
The concrete detection method of liquid-phase chip combined parallel detecting method of the multiple fusion gene that embodiment 1:3 kind leukemia is relevant comprises the steps:
One. detect the preparation of the microballoon mixed solution of SIL-TAL1type II and type III fusion gene, MLL-AF4e9/e5 and e9/e4 fusion gene, CBFB-MYH11type D fusion gene
1. according to following sequence synthetic oligonucleotide probe:
SIL-TAL1type II and type III fusion gene: 5 '-AminolinkerC12AGTTACGCTGCGGTGTGGTC-3 ', as shown in SEQ ID NO.1;
MLL-AF4e9/e5 and e9/e4 fusion gene: 5 ' AminolinkerC12TATTGCTGTCAAAGGAGGCG6-3 ', as shown in SEQ ID NO.2;
CBFB-MYH11type D:5 '-AminolinkerC12TGTCCTTCTCCGAGCCTCTTCA-3 ', as shown in SEQ ID NO.3;
Abelson gene: 5 '-AminolinkerC12CTGAAGGGCTTCTTCCAGAT-3 ', as shown in SEQ ID NO.12;
By contain above amido modified oligonucleotide probe respectively with the 4 kinds of carboxyl microballoons coupling that is numbered 11,15,17, No. 21
The 2.1 fresh dry powder EDC that take out aliquot-20 ℃ preservation equilibrate to room temperature;
2.2 use dH
2o dissolves respectively the oligonucleotide probe of SIL-TAL1type II and type III SIL-TAL1, MLL-AF4e9/e5 and e9/e4SIL-TAL1, CBFB-MYH11type D, Abelson, and concentration is that (1nmol/ μ l) for 1mM;
2.3 respectively at full speed vortex be numbered 4 kinds of carboxyl microballoons of 11,15,17, No. 21 and store at least 3min of suspension, produce the microballoon suspension of homogeneous;
2.4 get respectively 2.5 × 10
6microballoon stores in suspension to 4 centrifuge tube;
2.510,000g, centrifugal, 1-2min;
2.6 remove supernatant liquor, with 50 μ l0.1M MES, and the coupling buffer of pH4.5, resuspended microballoon, vortex concussion 20 seconds;
2.7 is that 1mM oligonucleotide probe is used respectively dH by 3 kinds of concentration
2o was with the dilution proportion of 1: 10, and making its concentration is 0.1nmol/ μ l;
2.8 every kinds of probes add 2 μ l (concentration be 0.1nmol/ μ l) in the corresponding microballoon mixing, vortex mixed;
2.9 use dH
2the fresh EDC solution (noting: keep EDC powder for drying, be convenient to the use of next step EDC) of O configuration 10mg/ml;
2.10 add 2.5 μ l10mg/ml EDC fresh EDC solution divide and be clipped in 4 kinds of microballoons (25 μ g final concentrations be about 0.5 μ g/ μ l) vortex mix;
2.11 room temperature lucifuges are hatched 30min;
2.12 use dH
2the EDC fresh solution (noting: if EDC powder deliquescence should abandon, advise that each step coupling process all uses fresh EDC powder) of second part of 10mg/ml of O configuration;
The EDC fresh solution that respectively adds 2.5 μ l10mg/ml in 2.13 4 kinds of microballoons, vortex mixes;
2.14 room temperature lucifuges are hatched 30min;
2.15 respectively add 1ml0.02%Tween-20 in 4 kinds of coupling microballoons;
2.16 10,000g is centrifugal, 1-2min;
2.17 remove supernatant, use respectively the resuspended 4 kinds of coupling microballoons of 1ml0.1%SDS, and vibration mixes;
2.18 10,000g is centrifugal, 1-2min;
2.19 remove supernatant, add respectively 100 μ l TE, PH8.0, vortex mixed 20s, resuspended microballoon;
4 kinds of couplings of 2.20 use cell counters countings the microballoon of oligonucleotide probe;
A. use dH
2o dilutes coupling microballoon with 1:100;
B. vortex concussion fully mixes;
C. get 10 μ l to cell counter;
D. count the microballoon total amount of 4 large lattice in angle on cell counter;
E. microballoon/μ l=(4 large lattice microballoon total amount) × 2.5 × 100 (extension rates).
3. the configuration of microballoon mixed solution
By above-mentioned coupling the microballoon of oligonucleotide probe, as following: SIL-TAL1type II and type III fusion gene probe microballoon 11, MLL-AF4e9/e5 and e9/e4 fusion gene probe microballoon 15, CBFB-MYH11typeD probe microballoon 17, Abelson probe microballoon 21, equal proportion is mixed, the final concentration of various microballoons is 1500/μ l, and 2-8 ℃ keeps in Dark Place.
Two. the preparation of sample
1-15 leukaemic's clinical sample extracts respectively RNA according to the following steps:
1. lymphocyte extracts: get fresh whole blood 2ml and add 1ml3% Trisodium Citrate, mix rear 3000r/min centrifugal, 10min,, gets pale yellow chromatograph on blood cell layer and be lymphocyte by 4 ℃;
2. get 1 centrifuge tube (through DEPC water treatment) and add lymphocyte liquid 150 μ l. then to add 1ml TRIZOL, room temperature is placed 5min, makes its abundant cracking;
3.12 the centrifugal 5min of 000rpm, gets supernatant;
4. in every 1ml Trizol, add 200 μ l chloroforms, acute vibration mixes rear room temperature and places 15min;
5.4 ℃ 12, the centrifugal 15min of 000g;
6. draw upper strata water, to another centrifuge tube;
7. in every 1ml Trizol, add 500 μ l Virahols to mix, room temperature is placed 5-10min;
8.4 ℃ 12, the centrifugal 10min of 000g, abandons supernatant, and RNA is sunken to the pipe end;
9. by adding 1ml75% ethanol in every 1ml Trizol, gentle vibration centrifuge tube, suspends and precipitates;
10.4 ℃ 8, the centrifugal 5min of 000g abandons supernatant as far as possible;
11. room temperatures are dried or vacuum-drying 5-10min;
12. can use 50ul H
2o, TE buffer or 0.5%SDS dissolve RNA sample, 55-60 ℃, 5-10min (H
2o, TE or 0.5%SDS must process and high pressure with DEPC);
13. survey the quantitative RNA concentration of OD value.
Three. multiple RT-PCR
As follows the mRNA of above-mentioned 1-15 sample is carried out to multiple reverse transcription pcr amplification:
Synthesizing of 1.cDNA the first chain
1. get the Eppendorf tube of processing once DEPC, be placed on ice, set up following reaction system;
Total RNA 5～10μg/3μl
Oligo(dT)18Primer(0.5μg/μl) 1μl
EDPC－treated water forword to 12μl
Mix gently reaction solution, arrive and manage at the end with the reaction solution on the centrifugal a little collection tube wall of refrigerated centrifuge;
2. centrifuge tube is in 70 ℃ of incubations 5 minutes, takes out rapidly afterwards that to be placed in ice cooling, with the reaction solution on the centrifugal a little collection tube wall of refrigerated centrifuge to the pipe end;
3. centrifuge tube is positioned on ice, is sequentially added into following reaction solution;
5×reaction buffer 4μl
RNase Inhibitor(20U/μl) 1μl
10mM dNTPs Mix 2μl
Mix gently reaction solution, arrive and manage at the end with the reaction solution on the centrifugal a little collection tube wall of refrigerated centrifuge;
4. centrifuge tube was in 37 ℃ of incubations 5 minutes;
5. (l), final volume is 20 μ l to 200U/ μ to add 1 μ l RevertAidTM Reverse Transcriptase;
6. centrifuge tube was in 42 ℃ of reactions 60 minutes;
7. centrifuge tube is in 10 minutes termination reactions of 70 ℃ of heating, and it is cooling that rapid taking-up is afterwards placed in ice;
2. multiplex PCR
2.1 according to following sequence synthesized primer thing:
SIL-TAL1type II and type III fusion gene: upstream primer 5 '-biotin CCTGCAAACAGACCTCAGCTC-3 ', as shown in SEQ ID NO.4; Downstream primer 5 '-CGAGGAAGAGGATGCACAC-3 ', as shown in SEQ ID NO.5;
MLL-AF4e9/e5 and e9/e4 fusion gene: upstream primer 5 '-biotin TCCAGAGCAGAGCAAACAG-3 ', as shown in SEQ ID NO.6; Downstream primer 5 '-CCTTGCTGAGAATTTGAGTG-3 ', as shown in SEQ ID NO.7;
CBFB-MYH11type D: upstream primer 5 '-biotin GAGGATGCATTAGCACAACAG-3 ', as shown in SEQ ID NO.8; Downstream primer 5 '-GAAGCAACTCCTGGGTGTC-3 ', as shown in SEQ ID NO.9;
Abelson gene: upstream primer 5 '-biotinGCGCAAAATGTTGGAGATC-3 ', as shown in SEQ ID NO.10; Downstream primer 5 '-GGAGCTTTTCACCTTTAGTTATGC-3 ', as shown in SEQ ID NO.11.
2.2PCR reaction system is as follows
Final volume is 50 μ l
Pcr amplification program: 95 ℃ of 10min; 95 ℃ of 30s, 64-50 ℃ of 1min, 72 ℃ of 30min; Front 14 circulations, every circulation primary, annealing temperature reduces by 1 ℃, rear 21 circulations, annealing temperature remains in 50 ℃ carries out; 72 ℃ of 7min; 4 ℃ of insulations.
Four. the hybridization of oligonucleotide probe and PCR product
1. the oligonucleotide probe mixture of microspheres of configuration in selecting step one;
2. vortex concussion 20s, mixes microballoon;
3. prepare microballoon working fluid, diluting coupling microballoon to concentration with 1.5 × TMAC hybridization solution is 150 microballoon/μ l.(note: the microballoon working fluid of each reaction needed 33 μ l);
4. vortex concussion 20s, mixes microballoon working fluid;
5. in sample aperture, positive control hole, negative control hole, add respectively 33 μ l microballoon working fluids;
6. to the pcr amplification product and the TE solution (PH is 8.0) that add respectively 1-15 clinical samples in each sample well, cumulative volume is 17 μ l;
7. inhale up and down and beat with the volley of rifle fire, tenderness mixes reaction solution;
8. cover reaction lid and avoid evaporation, at 95-100 ℃, hatch 1-3min, make the oligonucleotide in sample remove secondary structure;
9. incubation reaction plate 15min under hybridization temperature;
10. the fresh detection mixed solution of preparation, with 1 × TMAC hybridization solution dilution Streptavidin phycoerythrin solution to 10 μ g/ml (the detection mixed solutions of each reaction needed 25 μ l);
11. add the detection mixed solution of 25 μ l to every hole, inhale up and down and beat with the volley of rifle fire, and tenderness mixes;
12. hatch 5min under hybridization temperature;
Above-mentioned steps can be programmed its merging by following scheme by PCR instrument:
95℃，1-3min；
Hybridization temperature, forever;
13. is upper at liquid-phase chip instrument (LiquiChip200, QIAGEN company), keeps hybridization temperature, and each reacting hole is detected to analysis, measures fluorescence MFI value.
Five. detected result and analysis
Detected result (fluorescence MFI value) is as follows:
Interpretation of result:
1,5,9,10, No. 13 patient's types are the leukemia fusion gene CBFB-MYH11type D positive 2,7,8,11, and 14, No. 15 patient's types are leukemia fusion gene MLL-AF4e9/e5 and the e9/e4 fusion gene positive
3,4,6, No. 12 patient's types are leukemia fusion gene SIL-TAL1type II and the type III fusion gene positive
Meanwhile, compared with the positive patient fluorescence MFI value of fusion gene and the fluorescence MFI value of internal reference Abelson gene, can draw the expression situation of fusion gene.
More than having read, about after those set forth of the present invention, those skilled in the art can do various modifications or variation to the present invention, and these equivalent form of values belong to the scope defined in the application's appended claims equally.
Sequence table
Mai Dijiyin bio tech ltd, <110> Jiangsu
The associated detecting method of the fusion gene that <120> leukemia is relevant and diagnostic kit
<130>NP-10-14090
<160>12
<170>PatentIn version 3.3
<210>1
<211>20
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<223>(1)...(20)
<400>1
agttacgctg cggtgtggtc 20
<210>2
<211>21
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<223>(1)...(21)
<400>2
tattgctgtc aaaggaggcg g 21
<210>3
<211>22
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<223>(1)...(22)
<400>3
tgtccttctc cgagcctctt ca 22
<210>4
<211>21
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<223> primer
<400>4
cctgcaaaca gacctcagct c 21
<210>5
<211>19
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<223> primer
<400>5
cgaggaagag gatgcacac 19
<210>6
<211>19
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<223> primer
<400>6
tccagagcag agcaaacag 19
<210>7
<211>20
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<223> primer
<400>7
ccttgctgag aatttgagtg 20
<210>8
<211>21
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<223> primer
<400>8
gaggatgcat tagcacaaca g 21
<210>9
<211>19
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<223> primer
<400>9
gaagcaactc ctgggtgtc 19
<210>10
<211>19
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<223> primer
<400>10
gcgcaaaatg ttggagatc 19
<210>11
<211>24
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<223> primer
<400>11
ggagcttttc acctttagtt atgc 24
<210>12
<211>20
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<223>(1)...(20)
<400>12
ctgaagggct tcttccagat 20
Claims (2)
1. a diagnostic kit that detects the fusion gene that leukemia is relevant, is characterized in that, comprises:
Covalent attachment the microballoon of the designed specific dna probe of the mRNA of multiple fusion gene that forms for chromosome translocation in leukemia; The fusion gene that in described leukemia, chromosome translocation forms is for following multiple fusion gene that can independent assortment: SIL-TAL1 (type II, type III), MLL-AF4 (e9/e5, e9/e4), CBFB-MYH11 (type D) and
Combine the microballoon of reference gene Abelson gene probe; And
Upstream and downstream primer, SA-PE, the quality control product of the upstream and downstream primer of leukemia fusion gene mRNA and reference gene Abelson gene;
Described quality control product comprises positive control and negative control, and wherein positive control is the mixed solution of the plasmid that contains described fusion gene, comprises the plasmid containing Abelson gene; Negative control is the plasmid solution that does not contain fusion gene and Abelson gene;
The designed specific dna probe of mRNA of the described multiple fusion gene forming for chromosome translocation in leukemia, is following sequence, and wherein 5 ' end is containing amido modified:
SIL-TAL1 (type II, type I II): 5 '-Aminol inkerC12AGTTACGCTGCGGTGTGGTC-3 ', as shown in SEQ ID NO.1;
MLL-AF4 (e9/e5, e9/e4): 5 '-AminolinkerC12TATTGCTGTCAAAGGAGGCGG-3 ', as shown in SEQ ID NO.2;
CBFB-MYH11 (type D): 5 '-AminolinkerC12TGTCCTTCTCCGAGCCTCTTCA-3 ', as shown in SEQ ID NO.3;
Or the base fully-complementary sequence with above-mentioned probe sequence;
The upstream and downstream primer of described leukemia fusion gene mRNA, is following sequence, and wherein upstream primer 5 ' end contains biotin label:
SIL-TAL1 (type II, type III): upstream primer 5 '-biotin CCTGCAAACAGACCTCAGCTC-3 ', as shown in SEQ ID NO.4; Downstream primer 5 '-CGAGGAAGAGGATGCACAC-3 ', as shown in SEQ ID NO.5;
MLL-AF4 (e9/e5, e9/e4): upstream primer 5 '-biotin TCCAGAGCAGAGCAAACAG-3 ', as shown in SEQ ID NO.6; Downstream primer 5 '-CCTTGCTGAGAATTTGAGTG-3 ', as shown in SEQ ID NO.7;
CBFB-MYH11 (type D): upstream primer 5 '-biotin GAGGATGCATTAGCACAACAG-3 ', as shown in SEQ ID NO.8; Downstream primer 5 '-GAAGCAACTCCTGGGTGTC-3 ', as shown in SEQ ID NO.9;
Or the base fully-complementary sequence with above-mentioned primer sequence;
Upstream and downstream primer and the probe sequence of described Abelson gene are as follows:
Upstream primer 5 '-biotin GCGCAAAATGTTGGAGATC-3 ', as shown in SEQ ID NO.1O;
Downstream primer 5 '-GGAGCTTTTCACCTTTAGTTATGC-3 ', as shown in SEQ ID NO.11;
Probe 5 '-Aminol inkerC12CTGAAGGGCTTCTTCCAGAT-3 ', as shown in SEQ ID NO.12;
Or with the upstream and downstream primer of above-mentioned Abelson gene and the base fully-complementary sequence of probe sequence.
2. the diagnostic kit of the fusion gene that detection leukemia as claimed in claim 1 is relevant, is characterized in that, described mixture of microspheres, according to the independent assortment that needs of difference detection sample.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010137451.1A CN101955991B (en) | 2010-03-31 | 2010-03-31 | Joint detection method of fusion genes related to leukemia and diagnosis kit |
| PCT/CN2011/072139 WO2011120398A1 (en) | 2010-03-31 | 2011-03-30 | Joint detection method for leukemia fusion genes and diagnostic kits thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010137451.1A CN101955991B (en) | 2010-03-31 | 2010-03-31 | Joint detection method of fusion genes related to leukemia and diagnosis kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101955991A CN101955991A (en) | 2011-01-26 |
| CN101955991B true CN101955991B (en) | 2014-05-28 |
Family
ID=43483577
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201010137451.1A Active CN101955991B (en) | 2010-03-31 | 2010-03-31 | Joint detection method of fusion genes related to leukemia and diagnosis kit |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN101955991B (en) |
| WO (1) | WO2011120398A1 (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101955991B (en) * | 2010-03-31 | 2014-05-28 | 江苏迈迪基因生物科技有限公司 | Joint detection method of fusion genes related to leukemia and diagnosis kit |
| CN103667453B (en) * | 2013-11-18 | 2015-06-17 | 福州艾迪康医学检验所有限公司 | Method, primers and probe for detecting relative expression quantity of 11q23/MLL fusion genes |
| CN104278093B (en) * | 2014-09-28 | 2016-11-23 | 南京百捷生物科技有限公司 | Manganic pyrophosphate complex initiation method detection SIL-TAL1 fusion primer to and kit |
| CN107151699A (en) * | 2017-06-01 | 2017-09-12 | 武汉艾迪康医学检验所有限公司 | Detect the kit and method of NUP214 ABL1 gene relative expression quantities |
| CN114480456A (en) * | 2021-12-21 | 2022-05-13 | 安徽医科大学第二附属医院 | Standard plasmid for detecting multiple fusion genes and detection kit |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009124901A1 (en) * | 2008-04-07 | 2009-10-15 | Erasmus University Medical Center Rotterdam | Methods and kits for detecting tumor-specific fusion proteins |
| CN101624623A (en) * | 2008-07-11 | 2010-01-13 | 秦亚溱 | Kit for quantitatively detecting ABL mRNA level |
| GB2463401A (en) * | 2008-11-12 | 2010-03-17 | Caris Mpi Inc | Diagnostic methods using exosomes |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101955991B (en) * | 2010-03-31 | 2014-05-28 | 江苏迈迪基因生物科技有限公司 | Joint detection method of fusion genes related to leukemia and diagnosis kit |
-
2010
- 2010-03-31 CN CN201010137451.1A patent/CN101955991B/en active Active
-
2011
- 2011-03-30 WO PCT/CN2011/072139 patent/WO2011120398A1/en active Application Filing
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009124901A1 (en) * | 2008-04-07 | 2009-10-15 | Erasmus University Medical Center Rotterdam | Methods and kits for detecting tumor-specific fusion proteins |
| CN101624623A (en) * | 2008-07-11 | 2010-01-13 | 秦亚溱 | Kit for quantitatively detecting ABL mRNA level |
| GB2463401A (en) * | 2008-11-12 | 2010-03-17 | Caris Mpi Inc | Diagnostic methods using exosomes |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101955991A (en) | 2011-01-26 |
| WO2011120398A1 (en) | 2011-10-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101838682A (en) | Leukemia fusion gene combined parallel detecting method and diagnostic reagent kit | |
| Gold et al. | Do circulating tumor cells, exosomes, and circulating tumor nucleic acids have clinical utility?: a report of the association for molecular pathology | |
| CN101955995B (en) | Combined detection method and diagnostic kit of fusion genes related to lymphoma | |
| AU2011274789B2 (en) | Diagnosis and treatment of breast cancer | |
| CN101955991B (en) | Joint detection method of fusion genes related to leukemia and diagnosis kit | |
| AU2007317306A1 (en) | SPINK1 as a prostate cancer marker and uses thereof | |
| CN101942523B (en) | Liquid-phase chip method for detecting PCA3 gene and PSA gene and diagnostic reagent kit thereof | |
| CN101955994B (en) | Joint detection method and diagnostic kit of NPM1 (Nucleophosmin 1) gene mutation | |
| US20130130928A1 (en) | Methods for predicting or monitoring whether a patient affected by a cancer is responsive to a treatment with a molecule of the taxoid family | |
| US20140178869A1 (en) | Detection of immunoglobulin light chain restriction by rna in situ hybridization | |
| CN106868204A (en) | A kind of biomarker for sdenocarcinoma of stomach diagnosis | |
| CN101886122B (en) | Method for detecting chlamydia pneumoniae by loop-mediated isothermal amplification and detection kit | |
| US20120244531A1 (en) | Method for providing information for diagnosing cancer using quantitative real-time pcr and kit for diagnosing cancer for the same | |
| CN108342464A (en) | One-step method detects the kit and its detection method of HER2/neu gene expression amounts | |
| CN104694623A (en) | Plasma miRNA marker for diagnosis of lung cancer and application | |
| Hamada et al. | Diagnostic usefulness of PCR profiling of the differentially expressed marker genes in thyroid papillary carcinomas | |
| CN203021568U (en) | Combined parallel detection and diagnosis kit of leukemia-fused gene | |
| KR101371697B1 (en) | Patient-Tailored Cancer Chemotherapy | |
| Basu et al. | Novel omics technology driving translational research in precision oncology | |
| CN102399899A (en) | Liquid phase chip method and kit for detecting polymorphism of cytochrome P450 1A2 (CYP1A2) genes | |
| WO2010041755A1 (en) | METHOD FOR MEASURING SURVIVIN mRNA | |
| US20110201512A1 (en) | Biomarkers Indicative of Colon Cancer and Metastasis and Diagnosis and Screening Therapeutics Using the Same | |
| CN109593835B (en) | Method, kit and application for evaluating trace FFPE RNA sample | |
| JP2020072705A (en) | Urine markers for detection of bladder cancer | |
| CN104131103B (en) | AMZ1 gene is preparing the purposes in diagnostic kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |