WO2011069486A1

WO2011069486A1 - Rna aptamers that specifically bind to the soluble interleukin-6 receptor

Info

Publication number: WO2011069486A1
Application number: PCT/DE2010/001412
Authority: WO
Inventors: Ulrich Hahn; Stefan Rose-John; Cindy Meyer; Tijana Zivkovic
Original assignee: Universität Hamburg; Christian-Albrechts-Universität Zu Kiel
Priority date: 2009-12-07
Filing date: 2010-12-06
Publication date: 2011-06-16
Also published as: DE102009056944A1

Abstract

The invention relates to aptamers specifically binding to a target molecule. The aim of the invention is to prepare diagnostic and/or therapeutic agents for use in the recognition and/or prevention or treatment of inflammatory processes, of cancerous diseases and of infections. To achieve this aim, the invention provides RNA aptamers that specifically bind to the human soluble interleukin-6 receptor (sIL-6R).

Description

RNA APTAMERS SPECIFICALLY BINDING THE SOLUBLE INTERLEUKIN-6 RECEPTOR

The invention relates to aptamers which specifically bind a target molecule.

It is known that cytokines, for example interleukins such as interleukin-6 (IL-6), play an important role in the information transfer between different cells of an organism. The cytokine interleukin-6 (IL-6), for example, acts on a variety of different cells and plays a central role in inflammatory processes in particular. Cytokine IL-6 is known to be involved in a variety of diseases, e.g. inflammatory autoimmune diseases such as rheumatoid arthritis. Of many membrane-bound cytokine receptors, soluble forms also exist which consist of the extracellular domains of the membrane-like forms and also possess the ability to bind ligand, albeit at a reduced affinity to the membrane-like form. Soluble receptors can neutralize ligands, for example, by their comparatively high concentration and act in this way

antagonistic. For the soluble receptors of some cytokines but also an agonistic effect is described. For example, in the case of the soluble interleukin-6 receptor (sIL-6R), the complex of EL-6 and sIL-6R causes dimerization of the membrane-bound gpl30 (Taga, T. et al. (1989) Cell, 58, 573-581 Mackiewicz, A. et al., (1992) J. Immunol., 149, 2021-2027; Scheller and Rose-John, Med. Microbiol Immunol. (2006), 195, 173-183; Rose-John et al. , (2006), JJ Leukocyte Biol. 80, 227-235; Jones et al. (2001), The FASEB Journal 15, 43-57) to initiate signal transduction. Unlike the membrane-bound IL-6 receptor, gpl30 is present in almost all organs, e.g. Heart, kidneys, spleen, liver, lung, placenta, and brain (Saito, M. et al., 1992, J. Immunol., 148, 4066-4071) .In the presence of sIL6-R, interleukin-6 may therefore also act on cells which do not express the membrane-bound mterleukin-6 receptor but the glycoprotein gp 130 (Hirota, H. et al., (1995) Proc Natl Acad., USA, 92, 4862-4866).

CONFIRMATION COPY Because of the above-outlined importance of cytokines, approaches have already been pursued in the prior art by targeted inhibition of cytidine receptors

Disease course to take. One approach is, for example, the use of antibodies against cytokine receptors. For example, tocilizumab (Actemra®) is a monoclonal antibody currently used to treat rheumatoid arthritis. Tocilizumab (Actemra®) exerts its action via the blockade of the human IL-6 receptor, resulting in the binding of IL-6 to the receptor and a consequent

Inflammatory reaction is prevented. However, the use of antibodies is often associated with undesirable side effects. The most common adverse events associated with antibody treatment are infections, predominantly upper respiratory tract infections. In addition, their use has often been associated with a slight increase in liver function and

Lipid metabolism observed. Other side effects include gastrointestinal perforation, hypersensitivity reactions including anaphylaxis, headache and

High blood pressure.

For some time now also tried, so-called Aptamere as therapeutic and

for example, Osborne et al., (1997) Curr. Opin. Chem. Biol., 1, 5-9). Aptamers are artificial DNA or RNA molecules that contain another molecule, e.g. a protein, specifically bind. With high specificity and affinity as well as chemical

Stability, aptamers have a low immunogenicity compared to antibodies. For example, aptamers may be selected by a method termed SELEX (Evolutionary Evolutionary Ligations by Exponential Enrichment) (Ellington and Szostak (1990), Nature 346, 818-822, Gopinath (2007), Anal. Bioanal Chem 387, 171-182, WO 91/19813).

However, despite the intensive efforts to date, there is still a great need for diagnostic and / or therapeutic agents for use in the detection and / or prevention or treatment of inflammatory processes, cancers and infections. The object of the present invention is to provide such means. The problem is solved by the subject matter of claim 1 and the other independent claims. Advantageous embodiments of the invention are in the

Subclaims specified. In a first aspect, the invention provides an RNA aptamer that specifically binds the human soluble interleukin-6 receptor. The soluble human mlelevikin-6 receptor (sIL-6R) has a molecular weight of about 50 kDa at 339 amino acids (AA). The amino acid sequence of sIL-6R is shown in SEQ ID NO: 11. The

Amino acid sequence of the sEL-6R is identical to that of the extracellular domain of the membrane-bound interleukin-6 receptor (IL-6R), so that the inventive

Of course, aptamer also specifically binds the IL-6R. Any reference to the sIL-6R should therefore also include the IL-6R, unless expressly stated otherwise.

The RNA aptamer according to the invention is affine and specific for the human sIL-6 receptor and is unlikely or not immunogenic. It provides a promising means to treat or prevent diseases involving the soluble IL-6 receptor. It is also simple and inexpensive to produce, durable and storable. The RNA aptamer of the invention can be used in a variety of ways to

Conditions or diseases of humans, in which IL-6 and / or the soluble and / or the membrane-bound interleukin-6 receptor are directly or indirectly involved, to diagnose or influence. It can be used, for example, to prepare a drug or diagnostic agent that can be used to diagnose, prevent and / or treat inflammatory conditions or diseases, cancers or infections. Examples of diseases in which the inventive RNA aptamer

Applications include rheumatoid arthritis, sepsis, asthma, Crohn's disease, multiple sclerosis, depression, breast cancer, multiple myeloma, and HIV infection. The RNA aptamer according to the invention can also be used to introduce other molecules, for example peptides, proteins, oligonucleotides, dyes, diagnostic agents, etc. into a cell. To do this, these molecules are prepared using techniques that are familiar to those skilled in the art are common, coupled to the RNA aptamer. The molecule coupled to the RNA aptamer according to the invention can then be introduced into the cell by means of the sIL-6R or the IL-6R and be released intracellularly. The molecules can also be biologically or medically active substances, so that the RNA aptamer can also have a function as part of a prodrug.

By an "RNA aptamer" is meant here an isolated single-stranded RNA (ssRNA) comprising a target molecule, e.g. a protein that specifically binds. In particular, under the term "RNA aptamer", ssRNA oligonucleotides having at most 150, preferably at most 130, at most 110, at most 100, at most 90, at most 80, at most 70, at most 60, at most 50, at most 40, at most 30, at most 20 , at most 15 or at most 10 nucleotides understood.

By a "nucleotide" are here in particular the basic building blocks of nucleic acids, i. organic molecules derived from a sugar residue, usually a pentose, e.g. Deoxyribose or ribose, an organic base (nucleobase) and phosphoric acid. The phosphoric acid is regularly linked to the sugar via an ester bond, the sugar to the nucleobase via an N-glycosidic bond. In deoxyribonucleic acid (DNA), the nucleobases adenine (A), cytosine (C), guanine (G) and thymine (T) regularly occur, while in ribonucleic acid (RNA) the base uracil (U) is substituted for thymine. The phosphoric acid is usually present in RNA and DNA as monophosphate. The

Linking of nucleotides with each other usually takes place via a

Phosphordiester bond between the 5'-C atom of a pentose and the 3'-C atom of an adjacent pentose.

A "target molecule" is understood here preferably to be non-RNA and non-DNA molecules, for example proteins, peptides and glycoproteins. By "binding" is meant a bond that does not rely on the Watson-Crick pairing between nucleotides. It is preferably a non-covalent bond. By a human sIL-6 receptor specifically binding RNA aptamer or a fragment thereof is here understood an RNA aptamer or RNA aptamer fragment, a related

Dissociation constant (K _< j) of at most 7Ί0 ^"6 M (mol / l), preferably at most 5'IGT ⁶ M, preferably a maximum of 3 × KT ⁶ M, preferably a maximum of 2 × KT ⁶ M, preferably a maximum of KT ⁶ M, a maximum of 8 × KT ⁷ M, a maximum of 5 × 1 (Γ ⁷ M, a maximum of 3 × 10 ^-7 M, a maximum of 10 ^-7 M, a maximum of 8 x 1 ( ⁸ M, a maximum of 5 x 10 ^-8 M or a maximum of 3 x KT ⁸ M. In particular, under the human sIL-6 receptor specifically binding RNA aptamer or RNA aptamer fragment RNA aptamer or RNA aptamer fragment understood that has a dissociation constant of at most 1000 nM (nmol / 1), preferably at most 500 nM, more preferably at most 250 nM and particularly preferably at most 150 nM. this preferably refers to averages of a size determined using the one-site binding model described below using filter binding studies As noted above, the notion of hsIL-6 receptor specific binding also encompasses specific binding to the hIL-6 receptor, ie the membrane-bound human IL-6 receptor.

A "diagnostic emitter ^1" is understood here to mean a product that can be used in a diagnostic method. The term also encompasses products, for example

Reagents or kits of reagents by means of which, outside the human or animal body, a particular condition and / or deviation from a normal condition, e.g. a deviating sIL-6R concentration can be detected. In a preferred embodiment, the RNA aptamer according to the invention comprises

Nucleotide sequence ggkgnggcwguggwgwggg (SEQ ID NO: 1). The letters indicate the bases of the nucleotides in the usual coding: a = adenine, c = cytosine, g = guanine, u = uracil, n = any nucleotide, preferably a, c, g or u, k = g or u, w = a or u. In further preferred embodiments, the RNA aptamer according to the invention comprises the nucleotide sequence ggkgnggcwguggwgwggg (SEQ ID NO: 2), ggggnggcwguggwgwggg (SEQ ID NO: 3) or ggggnggcwguggwgwggg (SEQ ID NO: 4). The letters k, n and w are as defined above, h is a, c or u. The sequence of SEQ ID NO: 2 differs from the sequence according to SEQ ID NO: 1 in that there is no g at position 5, the sequence of SEQ ID NO: 3 differs from the sequence according to SEQ ID NO: 1 in that that at position 3 is a g, and the sequence of SEQ ID NO: 4 differs of the sequence according to SEQ ID NO: 1, characterized in that at position 3 is a g and at position 5 no g.

In a further preferred embodiment, the RNA aptamer according to the invention comprises one of the sequences indicated in SEQ ID NO: 5-10 or SEQ ID NO: 13-18 or a fragment thereof which specifically binds the human soluble interleukin-6 receptor. One or more, possibly also all bases of the nucleotides of the RNA aptamer or of the RNA aptamer fragment can be modified. This can be beneficial to

for example, to reduce the sensitivity to nucleases in vivo, to improve uptake into the cell, or to prevent rapid renal absorption. The modification may be, for example, that the 2'-OH group of a nucleotide base is replaced by a fluoro, amino or methoxy group. In a purine base, the 2-OH group is advantageous by a methoxy group, in a pyrimidine base by a fluoro or

Replaced amino group. Other modifications are possible and within the skill of the artisan.

The RNA aptamer of the invention may also be combined with other compounds, e.g. Cholesterol or polyethylene glycol (PEG), or may be timed, for example, to increase bioavailability, reduce degradation or excretion. For protection against attack by exonucleases, for example, a 3 '-3' dT cap (dT = deoxythymidine) may be provided at the 3 'end.

A fragment of an RNA aptamer according to the invention preferably comprises at least 14, 15, 16, 17, 18, 19 or at least 20, more preferably at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55 and particularly preferably 60 consecutive nucleotides of any of the sequences given in SEQ ID NO: 5-10 or SEQ ID NO: 13-18. In the case of SEQ ID NO: 13-18, the fragment may also comprise at least 70, 80, 90, 100 or 106 contiguous nucleotides. Particularly preferably, a fragment comprises at least one of the sequences according to SEQ ID NO: 1-4. Examples of fragments within the meaning of the present invention are given in the sequences with SEQ ID NO: 19-21. In a preferred embodiment, the aptamer of the present invention non-competitively binds to human sIL-6R. This does not affect the binding of mterleukin 6 (IL-6) to sIL-6R. Optionally, however, the signal transduction can be modified or prevented. This can be effected, for example, by attaching the gpl30 or the IL6 sterically or otherwise by means of an antibody directed against the RNA aptamer or, for example, by a molecule coupled to the RNA aptamer, for example a peptide, a nucleic acid or another compound, is hampered. Another possibility, for example, is that the aptamer bound to the receptor in turn is bound by a binding molecule, for example an antibody directed against the aptamer. In this case, an indirect mechanism can also be used so that, for example, a molecule coupled to the RNA aptamer (eg biotin or an antigen) is in turn bound by another molecule (eg avidin or an antibody). It may also be advantageous in diagnostic methods if the RNA aptamer binds non-competitively to the sIL-6R.

In another aspect, the present invention provides a pharmaceutical composition comprising an aptamer of the invention. The pharmaceutical composition moreover preferably comprises suitable carrier material, excipients and the like. Optionally, the drug may also contain one or more other active ingredients. The active ingredients may also be coupled to the RNA aptamer, i. covalently or non-covalently bound. Suitable formulations and dosage forms are known to those skilled in the art or may be routinely prepared according to the prior art. The

Aptamers according to the invention can, for example, also be bound to nanoparticles which are loaded with other active substances, thereby allowing a targeted delivery of the active substances.

In a further aspect, the invention also relates to the use of a

Aptamers according to the invention for the preparation of a medicament, as indicated above, preferably a medicament for the treatment of a condition or a disease associated with non-normal concentrations of the sIL-6R in body fluid, eg blood, or with a non-normal occurrence of IL-6R , or a diagnostic agent, for example, to diagnose a disease with the normal state deviating concentrations of sIL-6R in body fluid, such as blood, or are associated with a non-normal occurrence of IL-6R. The medicament is thereby preferably intended for the treatment of inflammatory conditions, cancer or infections, for example rheumatoid arthritis, sepsis, asthma, Crohn's disease, multiple sclerosis, depression, breast cancer, multiple myeloma or an HTV infection.

The invention is explained in more detail below with reference to embodiments and the accompanying figures for illustrative purposes. Fig. 1 Binding of the aptamer 16-3 to the target molecule sEL-6R. The proportion of bound RNA aptamer 16-3 (in%) was at defined sIL-6R concentrations in

Filter binding studies were determined and plotted as a function of the sIL-6R concentration (logarithmic plot). The measurement points and error bars shown result from the averages and standard deviations of ten independent studies. The dissociation constants were calculated using a "one-site-modeling" model.

Fig. 2 Gel shift assay for analyzing the interaction between aptamer 16-3 and sIL-6R. The interaction of radioactively labeled aptamer 16-3 with increasing concentrations of sIL-6R (0 nM - 300 nM) was detected by gel-shift assay (5% native PAA gel).

Fig. 3 Gel shift assay to analyze the specific interaction between aptamer 16-3 and the target molecule sIL-6R using two control proteins. The aptamer 16-3 was tested for interaction with the control proteins CEACAM1 (lanes 2-5: 10 nM - 300 nM) and lysozyme (lanes 7-10: 10 nM - 300 nM) by gel shift assay in a 5% , native PAA gel analyzed. The positive control used was an approach with sIL-6R (75 nM, lane 6).

Fig. 4 gel-shift analysis of the specific interaction between aptamer 16-3 and the

Target molecule sIL-6R with associated controls. In addition to the interaction of the labeled aptamer 16-3 (<1 nM, lanes 1 and 5) with the sIL-6R (75 nM, lanes 2 and 6), additional competition between labeled and unlabelled aptamer (lanes 3 and 7) and labeled aptamer and unlabeled control RNA R24 (lane 8). In Lane 4 shows the binding of an anti-His-AK to sIL-6R aptamer complexes, in lane 9 the interaction between aptamer and anti-His-AK. After incubation and done

Gel electrophoresis (5%, native ΡΑΑ gel;) the bands could be detected by autoradiography. The gels of two independent assays are put together.

Figure 5 Filter binding study of RNA aptamer 16-3 on sIL-6R in the presence and absence of IL-6. A: The protein sIL-6R was in increasing concentration (0-300 nM) with radiolabelled aptamer 16-3 in the presence of 740 nM IL-6 (+ IL-6) or in the absence of IL-6 (-IL- 6) and filtered. The amounts of labeled RNA remaining on the filter are illustrated. To calculate the percentage of bound RNA, a defined amount (125%) of RNA was applied to the membrane in each case. B: The proportion of bound RNA aptamer 16-3 (in%) at defined sIL-6R concentrations in the presence of 740 nM IL-6 (+ IL-6) or in the absence of IL-6 (-IL-6 ) was determined by filter binding studies and plotted (logarithmic plot). The dissociation constants were calculated using a one-site binding model. It was a double determination.

Fig. 6 Gel-shift assay for analysis of possible competition between aptamer 16-3 and IL-6 for binding to sIL-6R. The sIL-6R (75 nM) and the aptamer 16-3 (<1 nM) were tested for interaction in the presence of increasing concentrations of IL-6 (0 nM-150 nM). The separation of the aptamer-protein mixtures was carried out in 5% native PAA gel. Detection was by autoradiography.

Fig. 7 The fusion protein Hyper-IL-6. Schematically shown is the hyper IL-6 fusion construct consisting of the N- and C-terminal truncated sIL-6R (AS 113-323) and IL 6, which are linked together via a flexible linker. Linker amino acids are given in single letter code.

Fig. 8 Gel shift study analyzing the interaction between aptamer 16-3 and the

Interaction partners Hyper-IL-6 and sgpl30Fc. Hyper-IL-6 (lane 2), sgpl30Fc (lane 3) and both proteins in mixture (lane 4) were radiolabeled with aptamer 16-3 (<1 nM). incubated. After gel electrophoresis (5%, native PAA gel) and drying of the gel, the bands were detected by autoradiography.

Fig. 9 Shortening of the aptamer 16-3 on the basis of the predicted secondary structure using the mfold web server program. A. In addition to the secondary structure of the "wild type" aptamer 16-3 (SEQ ID NO: 17), the variants 16-3 A, 16-3_B and 16-3_C (SEQ ID NO 19-21) based thereon are abbreviated. B. RNA sequences of the truncated variants of the sIL-6R-specific aptamer 16-3 in the 5 '-3' direction. Fig. 10 Binding of the aptamer 16-3 and truncated variants of sIL-6R. The proportion of bound RNA (in%) at defined sIL-6R concentrations was in

Filter binding studies determined and presented as a function of the sIL-6R concentration (logarithmic plot). The measurement points and error bars shown represent mean values and standard deviations from at least three independent studies. The dissociation constants were calculated using a one-site binding model.

Figure 11 Sequences of the truncated sIL-6R specific aptamer 16-3B and mutated

Variants. Starting from the sIL-6R binding variant 16 3B, guanine residues possibly involved in the consensus sequence (in 16 3 B in normal writing) were replaced by uracil residues (bold). The mutation of the G at position 15 characterizes variant 16 3 B M1. To turn off the other four GG pairs, additional variants were created: 16 3 B M2 - 16-3_B_M5. Subscript numbers exemplify the position of the individual bases.

Fig. 12 Mutation analysis for the binding of aptamers 16-3, 16-3 B and five variants of hyper-IL-6. The proportion of relative RNA binding (in%) was determined at a defined sIL-6R concentration of 300 nM using filter binding studies. The measurement points and error bars shown represent mean values and standard deviations from two independent studies. The relative binding of the aptamer 16-3 B and the variants relates to the binding of the "wild-type" aptamer 16-3. Fig. 13 Gel shift assay for analysis of variants of aptamer 16-3B. Analysis of the interaction between hyper-IL-6 (330 nM) and the aptamer 16-3B or its variants (16-3_B_M1-16 -3_B_M5) was carried out by native PAGE (5% PAA gel). The detection of the bands was carried out by autoradiography.

Examples

1. In Vitro Selection of RNA Aptamers Using Magnetic Beads For the selection of RNA aptamers, one was selected as SELEX (Systematic Evolution of

Ligands by exponential enrichment) in vitro selection process (Tuerk, C. and L. Gold, Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase, Science, 1990. 249 (4968): p. 10) used. In this process, in steps of iterative cycles, (1) incubation of a nucleic acid library with the target molecule, (2) separation of binding from non-binding nucleic acids, and (3) amplification of binding species, i. an accumulation of binding

Nucleic acids.

At the beginning of the first round of selection was carried out incubating a RNA library high diversity (about 10 ¹³ different molecules) with the on magnetic particles (Dynabeads ^®) immobilized sIL-6R (the amino acid sequence of sIL-6R see SEQ ID NO: 11) soluble variant of the membrane-bound interleukin-6 receptor (IL-6R). to

Immobilization was biotinylated of sIL-6R and then immobilized interaction on the surface of streptavidin-coupled Dynabeads ^® via a biotin-streptavidin. The protein-coupled particles were used for aptamer selection. After separation of non-binding nucleic acids by means of magnetic separation and washing steps, binding RNA species were eluted by heating and amplified by means of an RT-PCR reaction. Subsequent T7 transcription formed the transition to the following round of selection. After about 6-20 of these iterative cycles, the enriched library was cloned and sequenced. An RNA start library of sufficiently high sequence diversity was produced. A synthetically prepared ssDNA library Rl (Metabion, Munich) was used for this purpose

Basis. The ssDNA library Rl had the following basic structure: 5'-AATGCTAATACGACTCACTATAGGAAGAAAGAGGTCTGAGACATTCT-N60- CnCTGGAGTTGACGnGCTT-3 '

The sequence of the ssDNA library Rl was characterized by a randomized region of 60 nucleotides flanked by 47 and 21 nucleotide constant regions at both the 3 'and 5' ends. These served to attach two

complementary oligonucleotides, the T7 primer R1 and the RT primer R1, to create a library of dsDNA molecules of 128 base pairs (bp) in length. The T7 primer region included the sequence of the T7 promoter (TAATACGACTCACTATAGG), which served as the recognition sequence of the T7 RNA polymerase, and transcribed the dsDNA into the ssRNA start library (106 nt, -3.6 x 10 ¹³ molecules ) with the basic structure

S'-GGAAGAAAGAGGUCUGAGACAUUCU-NeQ-CUUCUGGAGUUGACGUUGCUU-S ', which was used in the SELEX process.

After each selection cycle, the eluted RNA molecules were transcribed into cDNA after addition of the RT primer RI by means of reverse transcription and in a

subsequent PCR to dsDNA filled and amplified. In the first round of selection, a defined amount of RNA starting library Rl (500 pmol) directly with the immobilized on Dynabeads ^® sIL-6R (100 pmol) in lx

Selection Buffer B (10x PBS (0.137 M NaCl, 2.7 mM KCl, 6.5 mM Na ₂ HP0 ₄ , 15 mM KH ₂ PO ₄ ); 3 mM MgCl ₂ ; pH 7.4) for 30 min at room temperature (RT ). The binding to the target RNA molecules were separated by magnetic separation of non-binding molecules, discarded the supernatant and the RNA-target complexes washed once with 100 .mu.l x selection buffer B. The elution of binding nucleic acids was carried out after careful resuspension in 55 μΐ aqua dest. under heat at 80 ° C for 3 min. This eluate was subjected directly to RT-PCR without further purification steps. The success of RT-PCR was monitored by PAGE (10% native polyacrylamide (PAA) gel). From the second round of selection, the RT-PCR product was directly subjected to in vitro T7 transcription using T7 RNA polymerase. Without further purification, 20 were incubated μΐ of the transcription approach with the immobilized on Dynabeads ^® sIL-6R. After separation of non-binding RN A molecules, the beads were washed twice with 100 μl lx selection buffer B, the number of washing steps increasing to four with increasing round of selection. After sixteen rounds, the selection was ended. The dsDNA library of round 9 and final round 16 decreased

Manufacturer data cloned in the vector pCR ^® 2.1-TOPO ^{* of} the TA Cloning ^® kit (Invitrogen). Subsequently, eight clones of the 9th round of selection and twelve clones of the 16th

Selection round sequenced. Sequencing yielded the following six aptamer sequences: aptamer SEQ ED NO:

9-5 13

9-6 14

16-1 15

16-2 16

16-3 17

16-8 18

The sequences given include both the 60 nucleotide randomized region and the flanking 5 'and 3' primer regions, except for the T7 promoter sequence (TAATACGACTCACTATAGG), of which only the two terminal G nucleotides are included. The number in front of the hyphen indicates the selection round (9 or 16).

2. Characterization and analysis of the aptamer-sIL-6R interaction

To study the interaction of the enriched RNA library with the

Target molecule sIL-6R and to determine dissociation constants (Kd values) Filter binding studies performed under radioactive conditions. In addition, gel-shift studies using polyacrylamide gel electrophoresis (PAGE) and

Competition studies carried out using the Filterbmdungstechnik. 2.1 Analytical Filter Binding Studies

The study of aptamer-protein interactions and the determination of

Dissociation constants (Kd values) were carried out by means of filter binding studies. For this purpose, a constant amount (<1 nM) of radioactively labeled RNA (the labeling was carried out by incorporation of <x- [ ³² P] -ATP (0.1 μθ / μΐ, 100 nM) during T7 transcription) with increasing concentrations (1 nM to 300 nM) of protein incubated for 20 min at RT. Unless otherwise stated, the buffer used was the lx selection buffer B (1 × PBS (0.137 M NaCl, 2.7 mM KCl, 6.5 mM Na ₂ HPO ₄ , 15 mM KH ₂ PO ₄ ), 3 mM MgCl ₂ ; pH 7.4). A nitrocellulose membrane was pretreated for 10 minutes with aminohexanoic acid buffer (20% methanol, 40 mM aminohexanoic acid (C ₆ H ₁₃ N0 ₂ )), clamped in a 96-well dot blot apparatus (Schleicher & Schull) and under vacuum twice with 200 μΐ lx selection buffer B washed.

The reactions were filtered through the nitrocellulose membrane. Protein binding RNA molecules were retained on the membrane. Non-binding RNA molecules were removed by washing four times with lx Selection Buffer B. The

The nitrocellulose membrane was dried and the amounts of radioactively labeled substances remaining on the membrane were quantified using a phosphorimager (BioRad). The evaluation of the data obtained was carried out using the software Quantity One ^® (BioRad). For the plot of binding curves the program GraphPad Prism® (GraphPad Software, Inc., USA) was used. The dissociation constant (K _d ) was determined according to a one-site binding model based on the following equation:

B. max * Q protein

RNA bound,

^ d ^{+ c} protein where B _{max represents} the maximum possible amount of bound RNA. For the four aptamers 16-1, 16-2, 16-3 and 16-8 (SEQ ID NO: 15-18) binding to the sIL-6R was analyzed. For the aptamer 16-3 (SEQ ID NO: 17), the result of the study in FIG. 1 is shown by way of example. After conducting the binding study on the

Nitrocellulose membrane remaining amount of radiolabeled nucleic acids was quantified as described above and used to determine the dissociation constant.

Using the filter binding studies, it was shown that all investigated RNA aptamers could bind their target molecule in solution and show similar binding properties. The determined associated dissociation constants were approximately on the order of magnitude (see Table 1).

Table 1: Characteristics of aptamers 16-1, 16-2, 16-3 and 16-8. The dissociation constants (K _d ) and the proportion of maximally bound RNA, determined in each case in two (16-1, 16-2, 16-8) and ten (16-3) independent filter binding studies, are shown.

Aptamer SEQ DD NO: Proportion of maximal binding [%] K _d [nM] Number of studies 16-1 15 61.4 125 ± 32 2

16-2 16 74.5 420 ± 290 2

16-3 17 47.9 ± 2.8% 19.8 ± 4.2 10

16-8 18 68,2 106 ± 47 2

The aptamer 16-3 exhibited a very affinity binding to the sIL-6R with a significantly lower dissociation constant (K _d ). The maximum amount of RNA binding to the sIL-6R is given for each aptamer in Table 1. Since the RNA was present in clear deficit to study the interaction between RNA and protein, it is assumed that a maximum of one RNA molecule bound per sIL-6R.

2.2 Analysis of aptamer-protein interactions by gel-shift

For further analysis of the specific aptamer-sIL-6R interaction, gel-shift experiments were carried out by way of example with the aptamer 16-3 (SEQ ID NO: 17). For this purpose, the radiolabeled aptamer 16-3 with increasing amounts of recombinant sD _-- 6R (0 nM - 300 nM) in lx selection buffer B (1 × PBS (0.137 M NaCl, 2.7 mM KCl, 6.5 mM

Na ₂ HP0 ₄ , 15 mM KH ₂ PO ₄ ); 3mM MgCl ₂ ; pH 7.4). The separation of the aptamer protein mixtures was carried out by means of a 5% native polyacrylamide (PAA) gel

Polyacrylamide gel electrophoresis (PAGE). Due to their size, aptamer-protein complexes formed under native conditions have a delayed migration behavior in the gel. The complexes therefore migrate more slowly than the corresponding free RNA molecules and are therefore detectable as so-called "shift" in the gel.

Equal amounts (~ 1 nM) a- [ ³² P] radiolabelled RNA were incubated with increasing amounts of protein (1 nM - 300 nM) in lx selection buffer B (see above) for 30 min at RT. Samples were seeded with 6x DNA sample buffer (50% (w / v) sucrose; 1% (w / v) SDS; 0.1% (w / v) orange

G) and purified by native PAGE using a 5% PAA gel (1 x TBE (89 mM Tris-HCl, 89 mM boric acid, 2 mM EDTA); acrylamide-bis-acrylamide 37.5: 1 5% (w / v);

TEMED (Ν, Ν, Ν ^ Ν'-tetramemyl-enylenediamine) 0.1% (v / v); APS (ammonium persulfate) 0.1% (w / v)). The electrophoretic separation was carried out at 80 V and 4 ° C in lx TBE. After completion of the electrophoresis, the gel was dried by applying a vacuum. The radioactive bands were detected by autoradiography.

The specific binding of the RNA to the target molecule slowed the running behavior compared to the aptamer alone by formation of the aptamer-protein complexes. These

Complexes appeared in the gel as a so-called "shift." The resulting bands could be visualized by autoradiography (see Fig. 2).

The aptamer 16-3 clearly showed an interaction with the sIL-6R, since the gel showed a "shift" caused by the complex formation (see Fig. 2). The intensity of this slowed band increased with increasing concentration of sIL-6R (Figure 2, from left to right). In the area of gelatine is also a concentration-dependent

Signal increase recognizable. Presumably this was the aptamer 16-3, which was complexed with precipitated sIL-6R.

To demonstrate that the interaction of the selected RNA aptamers was specific for the target molecule sIL-6R, a gel Smft experiment was performed under native conditions with two recombinantly-produced control proteins. These proteins were, on the one hand, CEACAM1, a cell adhesion molecule which carried a C-terminal His tag analogously to sIL-6R. The other protein was lysozyme, an enzyme that can cleave polysaccharides of prokaryotic cell walls. Both proteins should not interact with the sIL-6R specific ribonucleic acids.

To analyze specificity, increasing amounts (10 nM - 300 nM) of CEACAM1 (Figure 3, 5.21, lanes 2-5) and lysozyme (Figure 3, lanes 7-10) were radiolabeled with aptamer 16-3 (< 1 nM) in lx selection buffer B (see above) and separated on a 5% native PAA gel. The positive control used was a batch of 75 nM sEL 6R (FIG. 3, lane 6). None of the control proteins studied showed any interaction with the RNA aptamer 16-3. In contrast, complex formation occurred between sIL-6R and the aptamer, as evidenced by the shift (Figure 3, lane 6). Evidence that the RNA band retarded in their behavior was indeed due to a specific interaction between aptamer and sIL-6R was made by two additional gel-shift experiments (see Fig. 4). In addition to the radioactively labeled aptamer 16-3 (FIG. 4, lane 1 and lane 5) in complex with sIL-6R (lane 2, lane 6), a> 1000-fold molar excess of unlabelled aptamer was added (lane 3, lane 7) ). The labeled and unlabeled RNA molecules competed for binding to the soluble IL-6R, resulting in the weakening of the retarded band (competition). As a control, a competition between aptamer 16-3 and unlabelled, non-specific RNA R24

(GGGAGGACGAUGCGGGAUUGUUGAGUGGUGCGAAACGCUUUUGCCCCUUCG CGUCGGGCGAGUCGUCUG-3 ', SEQ ID NO: 12;> 1,000-fold molar excess) (lane 8). This RNA did not induce attenuation of the aptamer-sIL-6R interaction.

To identify the protein bound by the aptamer, further experiments were carried out with a specific anti-His antibody. Since the target protein sIL-6R carried a His tag, the antibody was able to bind the protein to His tag. The aptamer protein

Antibody complexes were evident in the gel by a supershift, ie an even stronger one delayed band compared to the aptamer-protein complex (lane 4). The anti-His antibody showed no interaction with the aptamer 16-3 alone (Figure 4, lane 9).

2.3 Competition studies

In in vitro competition studies, the interaction between the selected RNA aptamers and the sIL-6R was investigated in the presence of its natural ligands IL-6 and gpl30 as well as of hyper-IL-6. 2.3.1 Competition analysis between aptamer 16-3 and interleukin-6 (IL-6)

The ability of aptamer 16-3 (SEQ ID NO: 17) to compete with the natural ligand of sIL-6R, interleukin 6, to compete for binding was reported in

Filter binding studies performed as described above are analyzed (Figure 5).

In the filter binding studies, the interaction of the sIL-6R with the aptamer 16-3 in the presence or absence of the ligand IL-6 was investigated. To determine the percent RNA binding, a defined amount of aptamer 16-3 (125%) was applied to the nitrocellulose membrane (FIG. 5 A). The evaluation of this experiment showed that IL-6 was based on the

Interaction between the aptamer 16-3 and sIL-6R had no appreciable influence. The determination of the respective dissociation constants led to comparable values.

The finding that there was no competition between aptamer 16-3 and IL-6 was checked by gel-shift assays. For this, the aptamer (<1 nM) was incubated with the sIL-6R (75 nM). Increasing amounts of ligand IL-6 (0-150 nM) as a competitor were added to the binding assays. The separation of the aptamer-protein complexes was carried out in the native PAA gel (see above). FIG. 6 clearly shows that despite increasing IL-6 concentrations, the clear interaction between aptamer and sIL-6R was retained, ie, the slowed-down aptamer-sIL-6R complexes were not disturbed. The aptamer 16-3 and IL-6 thus did not have the same binding site on the receptor. In a second gel-shift experiment, the concentration of IL-6 was increased to 1.5 μΜ. Also, this high ligand concentration had no influence on the aptamer bond.

2.3.2 Interaction of aptamer 16-3 with hyper-IL-6 (H-IL-6) and sgpl30Fc

A possible competition between IL-6 and aptamer was further investigated by analyzing the interaction between aptamer 16-3 (SEQ ID NO: 17) and Hyper-IL-6 (see Figure 7). Hyper-IL-6 is a bioactive fusion protein of IL-6 and sIL-6R, where both interaction partners are linked by a flexible polypeptide linker. This linker is composed of the 16 N-terminal non-helical amino acids of IL-6 and thirteen other amino acids, predominantly glycine and serine. In order to minimize the size of this fusion protein, the N-terminal immunoglobulin-like domain Dl and the C-terminus of the sIL-6R have been omitted, since both are not suitable for the

Bioactivity of the IL 6 / sIL-6R complex (Fischer, M., et al., I. A bioactive designer cytokines for human hematopoietic progenitor cell expansion., Nat Biotechnol, 1997. 15 (2): p.142-5 ) so that only amino acids 113-323 of sIL-6 were used in the fusion protein. This results in a 408 amino acid fusion protein with a

Molecular weight of about 57 kDa (see Fig. 7). Furthermore, the influence of aptamer binding on the interaction between Hyper-IL 6 and sgpl30Fc was investigated. Hyper-IL-6 as an active form of the IL-6 / sIL-6R complex binds gpl30 as well as its alternatively spliced, soluble form sgpl30. By genetically fusing this protein with the constant portion of an IgG1 antibody, a highly active form of this receptor subunit was created: sgpl30Fc (Scheller, J., Grötzinger, J., and Rose-John, Stefan, cytokine signals via soluble and membrane-bound receptors. 2007, Volume 13: pp. 250-253, Jostock, T., et al., Soluble gpl30 is the natural inhibitor of soluble interleukin-6 receptor trans-signaling responses, Eur J Biochem, 2001. 268 (1): p.160 -7). This monomeric form dimerizes due to the respective Fc portion (-189 kDa). A gel-shift experiment was used to study the interaction between Hyper IL 6 and aptamer 16-3. After incubation of Hyper-IL-6 with radiolabeled aptamer and electrophoretic separation by native PAGE, the bands could be analyzed by means of Autoradiography can be detected (Fig. 8). A clearly recognizable shift suggested interaction (Figure 8, lane 2). This confirms again that aptamer 16-3 interacts with the receptor at a region other than the IL-6 binding site. In another reaction, binding of the aptamer to a complex of hyper-IL-6 and sgpl30Fc was detected (Figure 8, lane 4). An even stronger in her

Running behavior slowed gang indicated complex formation of all three

Interaction partner. The aptamer thus interacted with hyper-IL-6 at a region unequal to the sgpl30Fc binding site. The aptamer did not interact with sgpl30Fc alone (Figure 8, lane 3).

In filter binding studies, a similar affinity for sIL-6R between aptamer 16-3 and hyper-IL-6 was confirmed. 3. Investigation of the binding activity of RNA aptamer fragments

Based on secondary structure predictions using the mfold web server program (version 3.2, Zuker, M., Mfold web Server for nucleic acid folding and hybridization prediction, Nucleic Acids Research, 2003. 31 (13): p., 3406-3415), the sequence became of aptamer 16-3 (SEQ ID NO: 17) (see Fig. 9). First, the primer areas were removed. The aptamer was further shortened, with a G-rich consensus sequence (SEQ ID NO: 4) always being conserved.

First, aptamer 16-3 was truncated to a 19mer (16-3A; SEQ ID NO: 19) which retained only the conserved, G-rich region of the aptamer. The truncated RNA 16-3B (47 nt; SEQ ID NO: 20) included, in addition to the G-rich region, the stabilizing, double-stranded region consisting of nine base pairs. The third truncated RNA, 63mer 16-3C (SEQ ID NO: 20), was characterized by the absence of the constant primer regions of the original sequence (the sequence contained three additional G nucleotides at the 5 'end of the randomized region of 60 nucleotides in length ). 16-3_A (19 nucleotides, see SEQ ID NO: 19):

S 'GGGGAGGCUGUGGUGAGGG-S'

16-3_B (47 nucleotides, see SEQ TD NO: 20)

5'-GGGAUUCUCUUAUAGGGGAGGCUGUGGUGAGGGAAUAUUAAGAGAAU-3 '

16-3_C (63 nucleotides, see SEQ ID NO: 21)

5'-GGGCUUAUAGGGGAGGCUGUGGUGAGGGAAUAUUAAGAGAAUUACGGUCUA GUUCACCUCGA-3 '

To analyze the binding properties of these truncated RNA molecules were

Filter binding studies as described above (see Fig. 10). As can be seen from FIG. 10, all truncated RNAs showed binding to the target molecule sIL-6R. On this basis, this variant was chosen for further experiments to characterize the aptamer-sIL-6R interaction.

For variant 16-3 B, a Ka value of about 26.4 nM (Table 2) could be determined. Despite a shortening of 59 nucleotides, the affinity of the 47mer 16-3 B was in the range of the "wild-type" aptamer. This significant shortening thus had no influence on the affinity for the receptor. Even the variant 16-3 A reduced to the G-rich region, which only consisted of 19 nucleotides, could bind the protein, but with reduced binding affinity (Kd ~ 446 nM) compared to 16-3. The absence of the primer regions in 16 3_C also weakened the affinity for the target protein (Kd - 117 nM). The values given for the aptamer variants 16 3_A and 16-3 C are only indicative, however, since the saturation region of the RNA-protein interaction, which is necessary for accurate K ^ determination, does not exist at a maximum sIL-6R concentration of 300 nM could be achieved completely.

Table 2 Ka values and percent maximal binding (Bmax) of aptamer 16-3 and truncated variants of sIL-6R determined in filter binding studies. Mean values and standard deviations were calculated from at least three independent measurements. Aptamer SEQ ID NO: Kd [nM] proportion of maximal binding [%]

16-3 17 19.7 ± 4.2 47.9 ± 2.8

16-3 A 19 446 ± 200 54.4 ± 16.4

16-3 B 20 26.4 ± 7.1 43.1 ± 3.4

16-3 C 21 117 ± 30 34.7 ± 4.0

In further experiments, mutation analyzes were carried out with the Aptamers 16-3 B to determine whether the guanine bases, which are conspicuously common in the consensus motif of aptamers, could possibly form the G-quadruplex structures stabilizing RNA molecules. The studies replaced important guanine bases possibly involved in the G-quartet with uracil. Within the consensus motif of the selected RNA aptamers, there were five potential GG pairs. If the G-rich region were indeed capable of forming G-quartets, four of the five G-doublets would be indispensable for binding.

Starting from the 47mer 16-3B (SEQ ID NO: 20), which was characterized by a possibly stabilizing, double-stranded strain adjacent to the conserved G-rich region (see Figure 10), mutations were introduced in the region of the conserved region. The guanine residues at positions 15, 17, 21, 27, and 32 were replaced by uracil residues, thus producing five different mutants, 16 3 B M1 to 16 3 B M5 (see FIG. 10).

Mutation within the GG pairs involved in the quadruplex formation should result in loss of binding to the hyper-IL-6 protein. The mutational analyzes were in the form of filter binding studies as described above. The binding of the truncated variants was compared in each case with the binding portion of the aptamer 16-3. The result of the analysis is shown in FIG. 12.

The aptamers 16-3 and 16-3 B resembled each other in their strong binding behavior towards hyper-IL-6. In comparison, the exchange of defined guanine residues within the three mutants 16-3_B_ M3, 16-3_B_M4 and 16-3 B M5 led to one

Loss of function. The ability to interact with Hyper-IL-6 was significantly reduced. The mutant 16-3 B Ml was characterized by greatly reduced binding. 16-3 B M2 on the other hand, it seemed to be unaffected by the base exchange and showed comparable or even better binding to hyper-IL-6.

The results of the mutation analyzes are consistent with the assumption of a possible formation of a G-Quaclmplex Srruktur. The loss of function of the four mutants 16-3 B M1, 16-3_B_M3, 16-3_B_M4 and 16-3JB M5 indicates that the guanine residues 15, 21, 27 and 32 of the aptamer 16-3 B are essential for the aptamer bond and perhaps in the

Training of G-quartets are involved. To verify this result, the analysis of the interactions between Hyper-IL-6 and the aptamer variants was carried out in a gel-shift assay (FIG. 13). This experiment also showed that the aptamer 16-3 B and the mutant 16-3 B M2 were able to interact clearly with hyper-IL-6. Thus, a mutation of guanine at position 17 did not lead to a loss of function of the aptamer. The other four mutants showed a significantly reduced ability to interact in comparison.

4. Binding of fluorescently labeled aptamers to IL-6R bearing cells

Using flow cytometry, the binding of sIL-6R-specific aptamers 16-3 and 16-3 B to the native IL-6R was investigated. As a control, the unselected RNA

Pool Rl and the non-binding variant 16-3 B M5 (see above). For this purpose, the interaction of the fluorescently labeled RNAs with the two cell lines BAF / gpl30 and

BAF / gpl30 / IL6R / TNF examined. The cell lines BAF / gpl30 and BAF / gp 130 / IL6R / TNF were derived from the murine pre-B cell line BAF / 3, an immortalized, the

Bone marrow-derived pro-B cell line whose growth and proliferation depends on the presence of the cytokine IL-3. The growth of the BAF / 3 cells used here was dependent on IL-6. Cells of this cell line were probed with cDNA for gp 130

(BAF / gpl30) or the cDNAs for gpl30, TNF and IL-6R (BAF / gp 130 / IL6R / TNF) stably transfected. The BAF / gp 130 / IL-6R TNF cells were able to produce TNF, in addition to the production of gpl30 and IL-6R, but this was not essential in the context of subsequent aptamer studies. The BAF / gpl30 and BAF / gpl30 / IL-6R / TNF cell lines were cultured in 25 cm ² bottles and kept in the incubator at 37 ° C. The culture medium DMEM (Dulbecco's

Modified Eagle Medium I, Invitrogen) supplemented with fetal calf serum FKS (10%) and lx Pen / Strep (62.5 μg penicillin G sodium salt ml; 100 μg streptomycin / ml; 90 μg NaCl / ml in aqua des). Hyper IL 6 (10 ng / ml) was additionally added to the BAF / gpl30 cells, the BAF / gpl30 / IL-6R / TNF cells additionally the cytokine IL 6 (10 ng / ml) and the antibiotic puromycin (12 μg / ml). ml). As a control, the growth of the cells was also observed in the absence of the cytokines, since without these stimuli cell growth was not possible. The presence of the interleukin 6 receptor on the surface of the BAF / gp 130 / IL6R / TNF cells was controlled using a murine monoclonal IL-6R specific IgG1 antibody (not shown).

500,000 BAF / gpl30 cells or IL-6R-carrying BAF / gp 130 / IL6R / TNF cells were washed twice with 500 μl lx selection buffer B (see above), resuspended in 350 μl of the same buffer and incubated with 8-10 pmol of the to be examined, fluorescently labeled RNA

(Fluorophore: Alexa ^Fluor® 488 C5 maleimide, Invitrogen) for 5 min at RT. Separation of unbound RNA molecules was followed by centrifugation of the cells at 500 g for 5 min. The pellet was washed twice with 500 μl of Selection Buffer B. To

Resuspension in 350 μl lx selection buffer B was the aptamer binding on

Flow cytometer analyzed by measuring every 10,000 cells.

For the AlexaFluor® 488-labeled aptamers 16-3 and 16-3 B, interaction with the IL-6R-bearing BAF / gp 130 / IL6R / TNF cells could be detected as the fluorescence intensity shifted. The control RNAs Pool Rl and 16 3 B M5 showed no binding to the BAF / gpl30 / IL6R / TNF cells. The fact that none of the labeled nucleic acids showed non-specific binding to the IL-6R-deficient BAF / gpl30 cells confirmed that the aptamers bound exclusively to the surface of the

BAF / gpl30 / IL6R TNF cells bound.

5. Competition between aptamer 16-3 and an anti-hIL-6R antibody For the specificity of the aptamers according to the invention, competition experiments were carried out, with a possible competition between the aptamers according to the invention and an anti-hIL-6R antibody for the binding to the IL-6R being investigated by flow cytometry. For this purpose, the binding to BAF / gpl30 / IL6R TNF cells, which had previously been incubated with a specific murine anti-hIL-6R antibody and a secondary FITC-conjugated goat anti-mouse AK, was analyzed.

BAF / gpl30 / IL6R / TNF cells were cultured in 25 cm ² culture bottles (see above). For harvest, the cells were centrifuged for 5 min at 500 g and RT. The supernatant was discarded, the pellet was taken up in 5 ml of DMEM (without FCS) and the cell count determined using a Neubauer counting chamber. Subsequently, 500,000 BAF / gpl30 / IL6R / TNF cells were washed once with 500 μl lx selection buffer B (see above), resuspended in 250 μl of the same buffer and with a hIL-6R-specific murine antibody (2 μg ml) for 30 min incubated at 4 ° C. Excess antibody was separated by centrifugation at 500 g for 5 min. The pellet was washed once with 500 μl of selection buffer B. To

Resuspension in 250 μM buffer was followed by the addition of a secondary FITC-conjugated goat anti-mouse antibody (Sigma) and incubation for 30 min at 4 ° C. After removal of the excess antibody (AK), the cells were pipetted into suitable measuring tubes. Analysis of aptamer binding to the BAF / gpl30 / IL6R / TNF cells was done as described above using the fluorescently labeled aptamer 16-3. The

Fluorescence labeling of the RNA was carried out here with AlexaFluor® 647 (Invitrogen).

The anti-hIL-6R antibody in combination with the goat anti-mouse secondary AK blocked the specific interaction of the aptamer with the BAF / gpl30 / IL6R / TNF cells. This result demonstrates simultaneously the specific binding of the aptamer to the native IL-6R on the surface of BAF / gpl30 / IL6R TNF cells, since the anti-hIL-6R antibody was directed against the IL-6R. Nonspecific binding to IL-6R deficient BAF / gpl30 control cells was not observed. Sequence Listing - free text and translation of English terms

Artificial Sequence = artificial sequence

consensus sequence = consensus sequence

miscjfeature - other feature

k is g or u = k is g or u

n is any nucleotide, preferably a, c, g or u = n is any nucleotide, preferably a, c, g, or u

h is a, c or u = h is a, c or u

w is a or u = w is a or u

RNA aptamer = RNA aptamer

randomized region = randomized area

3 * primer region = 3 'primer region

5 'primer region = 5' primer region

randomized region plus 5 'and 3' primer regions = randomized area plus 5 'and 3'

primer regions

Claims

RNA aptamer that specifically binds the human soluble interleukin-6 receptor.

RNA aptamer according to claim 1, characterized in that the RNA aptamer comprises the sequence according to SEQ ID NO: 1.

RNA aptamer according to claim 2, characterized in that the RNA aptamer comprises one of the sequences according to SEQ ID NO: 2-4.

An RNA aptamer according to any one of the preceding claims, characterized in that the RNA aptamer is one of the sequences given in SEQ ID NO: 5-10 or SEQ ID NO: 13-18 or a fragment thereof which is human soluble Interleukin-6 receptor specifically binds.

RNA aptamer according to one of the preceding claims, characterized in that the 2'-OH group of at least one of the nucleotide bases of the RNA aptamer or the RNA aptamer fragment is replaced by a fluoro, amino or methoxy group.

RNA aptamer according to one of claims 4 or 5, characterized in that the fragment at least 14, 15, 16, 17, 18, 19 or at least 20, more preferably at least 25, at least 30, at least 35, at least 40, at least 45, at least 50 or at least 55 and more preferably at least 60 consecutive nucleotides of the sequences indicated in SEQ ID NO: 5-10 or in SEQ ID NO: 13-18.

RNA aptamer according to claim 6, characterized in that the fragment comprises at least one of the sequences according to SEQ ID NO: 1-4.

8. RNA aptamer according to any one of the preceding claims, characterized in that the RNA aptamer non-competitively binds to the human soluble Interleukin-6 receptor.

9. A pharmaceutical composition comprising an RNA aptamer according to any one of claims 1 to 8.

10. Use of an aptamer according to any one of claims 1 to 8 for the manufacture of a medicament or a diagnostic agent.

11. Use according to claim 10, characterized in that the medicament for

Treatment of inflammatory conditions, cancer or infections is provided.

12. Use according to claim 10 or 11, characterized in that the medicament is intended for the treatment of rheumatoid arthritis, sepsis, asthma, Crohn's disease, multiple sclerosis, depression, breast cancer, multiple myeloma or HIV infection.