DE10122847A1 - New nucleic acid that binds to staphylococcal enterotoxin B, useful for treating and diagnosing e.g. septic shock, identified by the SELEX method - Google Patents

Abstract

Nucleic acid (I) that binds to enterotoxin B (Eb) of Staphylococcus, especially S. aureus, is new. Independent claims are also included for the following: (1) preparing and/or identifying nucleic acids (Ia), particularly (I), that bind to an Eb-derived target molecule; (2) preparing L-nucleic acid (Ib) that binds to an Eb-derived target having the natural configuration; (3) complexes of Eb, especially from S. aureus, and (I); and (4) kit for detecting Eb, especially from S. aureus, that comprises (I).

Description

The present invention relates generally to enterotoxin B-binding nucleic acids as well Process for the preparation and / or identification of nucleic acids linked to enterotoxin B method for the production of L-nucleic acids which bind to enterotoxin B, ver various uses of the enterotoxin B-binding nucleic acids and composition containing enterotoxin B-binding nucleic acids.

Enterotoxin B from Staphylococcus, also referred to herein as "Staphylococcal Enterotoxin B") SEB is a monomeric 28 kDa protein with a length of 239 amino acids and an isoelectric point of 8.6. Enterotoxin B is derived from various Staphylococcus aureus strains synthesized as an inactive 266 amino acid long precursor molecule and during transport across the cell membrane of the producing bacterium N-terminal and activated (Huang, I.Y., et al. (1970) J Biol Chem 245: 3518-25; Jones, C.L., et al. (1986) J Bacteriol 166: 29-33; Tweten, R.K., and J.J. Iandolo. (1981) Infect Immun 34: 900-7) The toxin causes food poisoning (Marrack, P., and J. Kappler. (1990) [published erratum appears in Science 1990 Jun 1; 248 (4959): 1066] Science 248: 705-11)  and is co-responsible for symptoms of septic shock (Crass, B.A., and M.S. Bergdoll. (1986) J Clin Microbiol 23: 1138-9). It is related to the Autoimmune disease rheumatoid arthritis (Howell, M.D., et al. (1991) Proc Natl Acad Sci USA 88: 10921-5; Uematsu, Y., et al. (1991) Proc Natl Acad Sci USA 88: 8534-8) and, according to more recent findings, there is a correlation between the evidence of the toxin in the skin lesions of patients with eczema and the severity of these Lesions (Breuer, K., M. et al. (2000) Allergy 55: 551-5; Bunikowski, R., et al. (1999) J Allergy Clin Immunol 103: 119-24; Herz, U., et al. (1999) Int Arch Allergy Immunol 118: 240- 1). SEB is one of the so-called superantigens, ie a group of proteins that has a polyclonal immune response through direct and independent binding to MHC-II molecules and induce T cell receptors without having been previously internalized and processed (Herman, A., et al., (1991) Annu Rev Immunol 9: 745-72; Misfeldt, M.L. (1990) Infect Immun 58: 2409-13).

For these reasons, enterotoxin B represents an important target molecule for both diagnostic as well as for therapeutic applications. A response of enterotoxin B and the By enterotoxin mediated effects may be due to a direct interaction of a By means of, in particular a chemical compound, be achieved with enterotoxin B.

It is therefore an object of the present invention to provide a means to be compatible with En terotoxin B interacts. In particular, it is an object of the present invention tion to provide an agent with specific or high affinity and specificity It interacts with enterotoxin B.

Another object of the invention is to provide a means for detecting To provide enterotoxin B.

Furthermore, the present invention is based on the object generally a method to provide for the generation of target nucleic acid binding nucleic acids.

The object is achieved in a first aspect according to the invention by a nucleic acid binding to enterotoxin B of Staphylococcus, in particular of Staphylococcus aureus.  

In a first embodiment it is provided that the nucleic acid to an amino acid Sequence of enterotoxin B of Staphylococcus aureus binds, with the amino acid sequence comprises the sequence according to SEQ.ID.No.83.

In a further embodiment it is provided that the nucleic acid is an Is nucleic acid.

In a further embodiment it is provided that the nucleic acid is selected from the group that includes DNA and RNA.

In yet another embodiment it is provided that the binding constant of the nuc 1 μM or less, preferably 500 nM or less, and more preferably 250 nM or less.

In one embodiment, it is provided that the nucleic acid is a nucleic acid sequence which is selected from the group comprising SEQ.ID.NO.1 to SEQ.ID.NO.82.

In a further embodiment it is provided that the nucleic acid sequence has a length which is selected from the group consisting of 15 to 150 nucleotides, 20 to 120 nucleotides de, 30 to 120 nucleotides, 40 to 100 nucleotides, 40 to 70 nucleotides and 50 to 70 nucleotides includes tide.

The object is achieved in a second aspect by a method according to the invention for producing and / or identifying nucleic acids which bind to a target molecule, preferably a nucleic acid according to the invention, wherein

• a) a heterogeneous population of nucleic acids is generated;
• b) the population of step a) is brought into contact;
• c) the nucleic acids that do not interact with the target molecule to be separated;
• d) the nucleic acids interacting with the target molecule optionally abge abge to be separated; and  
• e) the nucleic acids that interact with the target molecule are optional be sequenced

characterized in that the target molecule has an amino acid sequence of enterotoxin B of Staphylococcus, preferably of Staphylococcus aureus, wherein the Ami nosäuresequenz is preferably the sequence according to SEQ.ID.No.83

The object is achieved in another aspect by a method according to the invention for the production and / or identification of nucleic acids which bind to a target molecule before zugterweise a nucleic acid according to the invention, wherein

• a) a heterogeneous population of nucleic acids is generated;
• b) the population of step a) is brought into contact;
• c) the nucleic acids that do not interact with the target molecule to be separated;
• d) the nucleic acids interacting with the target molecule optionally abge abge to be separated; and
• e) the nucleic acids that interact with the target molecule are optional be sequenced

characterized in that the target molecule has an amino acid sequence of enterotoxin B of Staphylococcus, preferably of Staphylococcus aureus, wherein the Ami Nucleic acid sequence at least 5 or more, preferably 10 or more and more preferred 15 or more consecutive amino acids of Enterotoxin B Staphylococcus, preferably of Staphylococcus aureus.

The object is achieved in a still further aspect by an inventive method for the production and / or identification of nucleic acids which bind to a target molecule, preferably of a nucleic acid according to the invention

• a) a heterogeneous population of nucleic acids is generated;
• b) the population of step a) is brought into contact;  
• c) the nucleic acids that do not interact with the target molecule to be separated;
• d) the nucleic acids interacting with the target molecule optionally abge abge to be separated; and
• e) the nucleic acids that interact with the target molecule are optional be sequenced

characterized in that

• The target molecule is present as a mixture of a plurality of individual target molecules, and that
• The single target molecule has an amino acid sequence of the enterotoxin B of staphyloc coccus, preferably of Staphylococcus aureus, wherein the amino acid resequence at least 5 or more, preferably 10 or more and preferred 15 or more consecutive amino acids of Enterotoxin B Staphy lococcus, preferably of Staphylococcus aureus, and
• A single target molecule of the mixture of another single target mole of the mixture by its sequence, whereby the sequences of the both target molecules with a number of amino acids forming the sequences overlap, where the number is at least 1 and at most the number of the sequencers zen forming amino acids less one amino acid.

In one embodiment, it is provided that, following step c) of the method according to the invention, the following step

• a) Amplification of nucleic acids that interact with target molecule are

he follows.

In a preferred embodiment it is provided that the steps b) to d) of the inventions to be repeated according to the invention.  

In a particularly preferred embodiment it is provided that the target molecule a Amino acid sequence of the enterotoxin B of Staphylococcus, preferably of staphyloc coccus aureus, wherein the amino acid sequence is the amino acid sequence of Enteroto xin B of Staphylococcus, preferably of Staphylococcus aureus

In a fifth aspect, the object is achieved by a method according to the invention for producing L-nucleic acids which bind to a target molecule which occurs in the natural configuration, wherein

• a) a heterogeneous population of D-nucleic acids is generated;
• b) the population of step a) with the optical antipode of the target molecule in contact is brought;
• c) the D-nucleic acids that do not interfere with the optical antipode of the target molecule in Wech to be separated;
• d) the D-nucleic acids interacting with the optical antipode of the target molecule have been sequenced; and
• e) L-nucleic acids in their sequence with those in step d) for the D-nucleic acids identified sequences are identical to be synthesized,

characterized in that the target molecule has an L-amino acid sequence of enterotoxin B of Staphylococcus, preferably of Staphylococcus aureus, wherein the Ami nosäuresequenz is preferably the sequence according to SEQ.ID.No.83, and the optical Antipode of the target molecule, a D-amino acid sequence of Enterotoxin B from Staphylococ cus, preferably of Staphylococcus aureus, wherein the amino acid sequence Preferably, the sequence is according to SEQ.ID.No.83

In a sixth aspect, the object is achieved by a method according to the invention for producing L-nucleic acids which bind to a target molecule which occurs in the natural configuration, wherein

• a) a heterogeneous population of D-nucleic acids is generated;
• b) the population of step a) with the optical antipode of the target molecule in contact is brought;  
• c) the D-nucleic acids that do not interfere with the optical antipode of the target molecule in Wech to be separated;
• d) the D-nucleic acids interacting with the optical antipode of the target molecule have been sequenced; and
• e) L-nucleic acids in their sequence with those in step d) for the D-nucleic acids identified sequences are identical to be synthesized,

characterized in that the target molecule has an amino acid sequence of enterotoxin B of Staphylococcus, preferably of Staphylococcus aureus, wherein the Ami Nucleic acid sequence at least 5 or more, preferably 10 or more and more preferred 15 or more consecutive amino acids of Enterotoxin B Staphylococcus, preferably of Staphylococcus aureus.

In a seventh aspect, the object is achieved by a method according to the invention for producing L-nucleic acids which bind to a target molecule which occurs in the natural configuration, wherein

• a) a heterogeneous population of D-nucleic acids is generated;
• b) the population of step a) with the optical antipode of the target molecule in contact is brought
• c) the D-nucleic acids that do not interfere with the optical antipode of the target molecule in Wech to be separated;
• d) the D-nucleic acids interacting with the optical antipode of the target molecule have been sequenced; and
• e) L-nucleic acids in their sequence with those in step d) for the D-nucleic acids identified sequences are identical to be synthesized,

characterized in that

• The target molecule is present as a mixture of a plurality of individual target molecules, and
• The single target molecule has an amino acid sequence of the enterotoxin B of staphyloc coccus, preferably of Staphylococcus aureus, wherein the amino acid at least 5 or more, preferably 10 or more and more preferably  15 or more consecutive amino acids of Enterotoxin B of Staphylococcus, preferably of Staphylococcus aureus, and
• A single target molecule of the mixture of another single target mole of the mixture by its sequence, whereby the sequences of the both target molecules with a number of amino acids forming the sequences overlap, where the number is at least 1 and at most the number of the sequencers zen forming amino acids less one amino acid.

In one embodiment, it is provided that, following step c) of the method according to the invention, the following step is inserted:

• a) Amplification of D-nucleic acids with the optical antipode of the target molecule interacted.

In a preferred embodiment it is provided that steps b) to e) are repeated become.

In a particularly preferred embodiment it is provided that the target molecule a Amino acid sequence of the enterotoxin B of Staphylococcus, preferably of staphyloc coccus aureus, wherein the amino acid sequence is the amino acid sequence of Enteroto xin B of Staphylococcus, preferably of Staphylococcus aureus

In a further embodiment it is provided that the heterogeneous population of Nuk lineinsic acids comprises a nucleic acid according to the invention.

In one aspect, the object is achieved in that the nucleic acid according to the invention used for the manufacture of a medicament.

In one embodiment it is provided that the medicament according to the invention be used for Be treatment of diseases caused by enterotoxin B of Staphylococcus, more preferred be caused by Staphylococcus aureus.  

In a preferred embodiment it is provided that the disease is selected from the group that includes septic shock, rheumatoid arthritis and atopic dermatitis.

In a ninth aspect, the object is achieved by a combination according to the invention tion, preferably a pharmaceutical composition comprising a fiction Nucleic acid and a pharmaceutically acceptable carrier.

In a tenth aspect, the object is achieved by a complex according to the invention comprising enterotoxin B of Staphylococcus, preferably of Staphylococcus aureus, and a nucleic acid according to the invention.

In an eleventh aspect, the object is achieved by the use of the inventive Nucleic acid for the detection of enterotoxin B of Staphylococcus, preferably of Staphylococcus aureus ,.

In a twelfth aspect, the object is achieved by a kit according to the invention for Detection of enterotoxin B, preferably Staphylococcus aureus, comprising nucleic acid according to the invention.

The invention is based on the surprising finding that it is possible to nucleic acid provide with a very high affinity and specificity to enterotoxin B, esp especially of Staphylococcus aureus. As a result of this bonding behavior, the Nucleic acids according to the invention both to therapeutic and to diagnostic or be used for preparative purposes. It is in almost all applications FITS ders preferred when the nucleic acids of the invention completely from L-nucleotides are constructed.

The nucleic acids according to the invention can be used as ligands for the production of an affin tätsmatrix be used. Such an affinity matrix can be used, for example are used in patients with septic shock to toxin in an apheresis procedure blood circulation (Stegmayr, B.G. et al. (2000) Blood Purif 18: 149-55). septi Scher shock has a mortality of more than 50%, so that such a procedure is an effective therapeutic measure. Both the apharesis method as such  as well as the required support materials and devices are those skilled in the art known in the field. The preparation of the affinity matrix according to the invention is the Also known to those skilled in the art. The immobilization of the inventions takes place Nucleic acids according to the invention preferably by covalent immobilization. Next to the direk Immobilization is also an indirect immobilization of the nucleic acid according to the invention acids in the context of the present invention, preferably by interposition suitable spacer (English "spacer") between the actual substrate and the Nucleic acids is interposed.

Another application of the nucleic acids according to the invention in the therapeutic field as a drug is due to the fact that they bind to the area of the enterotoxin, the responsible for the effect of enterotoxin as a superantigen. As a result of this specifi binding and the concomitant blockade or abolition of the superantigen Property opens up further applications of the nucleic acids according to the invention. the Thus, they can be used as a pharmaceutically active agent in all those cases in which suppresses or eliminates the effect of enterotoxin B as a superantigen that should. Due to the particular biological stability of the nucleic acid according to the invention acids, especially when they are present as so-called spiegelmers, they can both be used systemically as well as locally.

A typical indication that provides for the use of the nucleic acids according to the invention is the treatment of atopic dermatitis. It is provided in particular that the inventions Nucleic acids according to the invention are administered locally and thereby directly the toxins in the Skin lesions are neutralized. Other applications can be found in the treatment of Food poisoning or septic shock by systemic application of the invention Nucleic acids according to the invention. In general, the nucleic acids according to the invention can be used in the Related to all those diseases or indications, including for the prevention of those diseases caused by enterotoxin B, in particular SEB, defined form group belong.

As a result of the specific binding properties, the nucleic acid according to the invention can may also be used in screening procedures. For example, the Screening procedures to determine a connection, which one opposite  the nucleic acids of the invention has increased affinity or specificity and this displaced the complex with the enterotoxin B.

A broad application of the nucleic acids according to the invention can be found in their diagnostic use for the detection of enterotoxin B. The inventive Nucleic acids represent an advantageous alternative to the state of the art antibodies used (Kijek, T.M. et al. (2000) J Immunol Mehtods 236: 9-17; Jaya Sena S.D. (1999), 45: 1628-50; Nedelkov, D (2000), Int J Food Microbiol 60: 1-13; Rowe Taitt, C.A. (2000), Biosens Bioelectron. 14: 785-94).

Nucleic acids according to the invention are also to be understood as meaning those which belong to are homologous to the sequences substantially disclosed herein. Below essentially ho molog should be understood to mean those sequences or nucleic acids whose homologues based on the primary sequence 70% and preferably 80% and preferred 90%.

Furthermore, as nucleic acids according to the invention, all nucleic acids should also be mentioned herein which comprise parts of the nucleic acid sequence disclosed herein, as far as these parts are involved in the binding of enterotoxin B, especially SEB.

The nucleic acids according to the invention can be used either as D-nucleic acids or as L-nucleic acids. Nucleic acids are present. Preferably, the nucleic acids according to the invention are as L-nucleic acids. Furthermore, it is possible that one or more parts of the nucleic acid acids as D and one or more parts of the nucleic acids are present as L-nucleic acids. The term part of the nucleic acid should be understood as little as a nucleotide. Such nucleic acids are referred to herein as D, L nucleic acids. It is thus in the Within the scope of the present invention, the nucleic acids according to the invention are part of a are longer nucleic acid, these longer nucleic acid consist of several parts, wherein at least a part is one of the nucleic acids according to the invention. The other part the This longer nucleic acid can be used either as D-nucleic acid or as L-nucleic acid. Nucleic acid be formed. This other part of the longer nucleic acid can have different functions. One possible function is that one Interaction with other molecules is possible.  

By L-nucleic acids are meant herein nucleic acids consisting of L-nucleotides, are preferably completely composed of L-nucleotides.

By D-nucleic acids are meant herein nucleic acids derived from D-nucleic acids. Nucleotides, preferably completely composed of D-nucleotides.

The embodiment of the nucleic acids according to the invention as L-nucleic acid is characterized a number of reasons particularly advantageous. L-nucleic acids are the Enantiomers of the naturally occurring D-nucleic acids. D-nucleic acids are However, in aqueous solutions and in particular in biological systems or biological Samples not very stable due to the widespread use of nucleases. The course before nucleases, especially those in animal cells, are unable to To break down nucleic acids. This increases the half-life of the L-nucleic acids in Such systems quite considerably, so in an animal or human body. Due to the lack of degradability of L-nucleic acids is also avoided that form under the influence of nucleases degradation products, which in turn undesirable May have side effects. This aspect distinguishes L-nucleic acids in general and the L-nucleic acids according to the invention of virtually all other active ingredients, such as they are used in connection with the therapy of diseases caused by Enterotoxin B, especially SEB; belong to a defined group of forms.

Moreover, it is within the scope of the present invention that the inventive Nucleic acids, whether they are present as D- or L- or D, L-nucleic acids, may be present as DNA or as RNA, in each case double- or single-stranded. Typischerwei the nucleic acids according to the invention are single-stranded nucleic acids However, the secondary structures defined by their primary sequence and thus can also train tertiary structures. In the secondary structure are in a variety of Nucleic acids according to the invention also double-stranded sections. The erfindungsge However, nucleic acids may also be double-stranded in the sense that two mutually complementary strands are hybridized with each other. This can become a stabili tion of the nucleic acids, which is particularly advantageous when the nucleic acid acids in the D-form, d. H. the naturally occurring form.  

The nucleic acids according to the invention may be modified. Such modification can refer to the individual nucleotides of the nucleic acids and are in the Technique well known. Examples of such modifications can be found, for. In Kusser, W. (2000) J Biotechnol. 74: 27-38; Aurup, H. et al. (1994) Nucleic Acids Res, 22, 20-4; cum mins, L.L. et al. (1995) Nucleic Acids Res, 23, 2019-24; Eaton, B.E. et al. (1995) Chem Biol, 2, 633-8; Green, L.S. et al., (1995) Chem Biol, 2, 683-95; Kawasaki, A.M. et al., (1993) J Med Chem, 36, 831-41; Lesnik, E.A. et al., (1993) Biochemistry, 32, 7832-8; Miller, L.E. et al., (1993) J Physiol, 469, 213-43.

The determination of the binding constants can in principle be carried out using the soge called equilibrium dialysis done, which is known in the art. Another possibility It is possible to determine the binding constants by using a so-called Biacore device known to those skilled in the art and in the examples herein is described.

The method disclosed herein for the production and identification of nucleic acids which bind to enterotoxin B and in particular the further features disclosed herein and egg properties, is based on the so-called SELEX method, which is subject matter of US Pat. No. 5,475,096. The exact implementation of the SELEX process is the Known to those skilled in the art.

Typically, in the context of the SELEX method, an amplification of the individual takes place nucleic acids binding to the target molecule using the polymerase chain Reaction. It can be caused by a suitable reaction control that the poly Merase has an increased error rate, which is a change of the primary sequence of the denden nucleic acid leads. As a result of this change, new Se is generated sequences which show a changed binding behavior compared to the starting sequences, for example, increased affinity or specificity. It is within the scope of the present Er find that the sequences of the invention completely or partially from such parts the nucleic acid library used as a starting or starting material derived from come from the randomized area of the individual members of the nucleic acid library. However, it is also within the scope of the present invention that the sequences according to the invention  completely or partially from such parts of the starting or starting material used nucleic acid library derived from the non-randomized area of the individual members of the nucleic acid library. Such a non- For example, the randomized region is the region that serves as the binding site for the Amplification primer is used.

The method also disclosed herein for the production of L-nucleic acids attached to duck rotoxin B is based on the method of Fürste et al., which is the subject of inter National Patent Application WO 98/08856. The exact implementation of this procedure is known to those skilled in the art.

In the context of the present invention, enterotoxin B is used as the target molecule. The optical antipode in the context of the present invention is the Enantiomers of the naturally occurring enterotoxin B, d. H. about that from D-amino acids existing enterotoxin B.

In the context of the present invention, the agents according to the invention can thus be combined used with other pharmaceutically active agents. Bit look at the microbial origin of Enteretoxin B can, for example, an anti Staphylococcus Reus directed antibiotic administered.

The application or use of the nucleic acids according to the invention can be described as pharma ceutical composition or as part of the manufacture of a medicament, in which case the nucleic acids according to the invention, optionally together with others pharmaceutically active compounds, even as pharmaceutically active agents act. Such drugs usually include at least at least one phar pharmaceutically acceptable carrier. Such a carrier may for example be a solvent such as water, a buffer, starch, sugar, gelatin or the like. Such carriers are known to those skilled in the art.

Another use of the nucleic acids according to the invention may be that these themselves are the starting material for drug development. Beside other be There are two basic possibilities. First, the screening of compound libraries,  Preferably, these are libraries of low molecular weight Compounds, and the rational design of drugs based on the inventions Nucleic acids according to the invention.

In the case of the rational design of active ingredients can be based on the inventions Nucleic acids according to the invention have a structure, preferably a three-dimensional structure, which are then incorporated into the design, d. H. Sequence of nucleic acids flows, the from the sequence of the nucleic acids specifically disclosed herein or those disclosed herein can be obtained by the method according to the invention differ, but nevertheless after as shown before the disclosed binding behavior of the nucleic acids according to the invention. In Another step in the rational design of drugs is Enterotoxin binding - three-dimensional - structure mimicked by chemical groups, the various those are from nucleotides or nucleic acids.

In the case of the screening of compound libraries, the procedure is that at For example, by competitive tests known to those skilled in the art, suitable GnRH- Analogous, GnRH agonsites or GnRH antagonists can be detected. Such a For example, a test could be constructed as follows: The spiegelmer becomes a solid phase coupled. To identify GnRH analogs, labeled GnRH can be used in the assay to admit. A potential analogue would displace the GnRH molecules from the spiegelmer, which would be accompanied by a reduction of the signal due to the marking.

For screening for agonists or antagonists, a cell culture test can be used as it is known to those skilled in the art, especially in a deratigen test format the functionality can be determined.

In the kit according to the invention can be provided that this one or more of he Nucleic acids according to the invention. The kit may also contain one or more positive or negative controls. A positive control can be, for example, enterotoxin B, preferably in liquid form. Furthermore, the kit may have one or more Buffer include. The individual components may be in dried or lyophilized form or in dissolved form in a fluid. The kit may include one or more vessels that may contain one or more of the components of the kit.  

In another aspect, the invention is based on the surprising finding that it possible, starting from the overall structure of a molecule, or in the case of proteins or polypeptides, from the entire or complete sequence, a partial structure or part sequence for the generation of a to the total or total sequence of a molecule to use binding nucleic acid. The evolutionary ones known in the art Procedures such. As the so-called SELEX method, as described for example in US Patent US 5,475,096, or the method for generating so-called mirror as is the subject of international patent application WO 98/08856 thus modified in the light of the present invention to the effect that these now with part of the structure or sequence of a target molecule can be performed NEN. Other methods in which such substructures or subsequences are used are the so-called phage display method or the ribosomal display method. The Use of only a partial structure or a partial sequence of a molecule according to the invention Within the scope of said or similar procedures, this is also referred to as a domain approach ("domain approach").

After the synthesis and thus the availability of target molecules a limiting Fak may constitute a means of carrying out the said procedures, in particular if: When the target molecule is a protein, the domain approach thus allows for processing in the context of said methods of previously inaccessible molecules. This aspect is all the more serious, than that a variety of pharmaceutically interesting Zielmolekü len have a size, the immediate chemical synthesis of the same very difficult and in some cases virtually impossible. The use of biotechnological A method comprising cloning the proteins of interest is also not always possible and very expensive in view of the comparatively small amounts required. In addition, in the context of biotechnological production of this protein from the naturli chen form, in particular in their sequence deviating derivatives arise, the Verwen tion in the said methods may affect further. In addition, the biotechnological production, in particular in the context of the process for the production of Spiegelmeren no alternative, since in the process for the production of Spiegelmeren the non-natural enantiomer of the target molecule, d. H. the D-shape is used, the can not be produced by any biological expression system.  

In light of the present disclosure, those known in the art to date may be used Constraints are thus overcome and new target molecules using the said procedures are processed.

The domain approach must be performed separately for each target molecule. there is based on a number of considerations, which are presented below should. On the basis of these considerations, the necessary measures can then be taken men for the target molecule in question in a shortening of the target molecule or using corresponding substructures or subsequences thereof the. The following description is given by way of example with reference to the shortening of proteins or polypeptides, but applies mutatis mutandis to different moles molecule or classes of molecules.

In the shortening of a protein with the purpose of using this shortened protein in a SELEX process or a process for the production of Spiegelmeren (Domä NEN approach) is the stabilization of the truncated protein (with) secondary education structures or secondary structure elements in the foreground. The shortened protein can be there be at different lengths, both the absolute size and the relative size to As far as full-length protein is concerned. Typical lengths for the shortened protein are less than 150 Amino acids, less than 100 amino acids, less than 75 amino acids, less than 50 Amino acids, less than 50 amino acids, less than 40 amino acids, less than 25 A. minosäuren. The truncated protein may also be a peptide. Typically, this includes the Pep tid less than 25 amino acids, less than 20 amino acids, less than 15 amino acids or less than 10 amino acids. The term peptide is used herein unless otherwise stated is generally used so that it contains both the peptides as described above as well as the truncated proteins as defined above.

In the stabilization of the peptide (with) secondary structures or secondary structural elements, there is a restriction of conformational diversity with the aim of as possible to achieve the conformation that occupies the peptide in the protein context. To Typically, modifications to the peptide backbone are used or additional  covalent bonds, especially those bonds that lead to a cyclic Structure lead, inserted.

The simplest secondary structural element are the so-called β-turns or reverse turns. Ways of stabilizing this structural element are described in the prior art (Rizo, J. et al., (1992), Annu Rev Biochem 61, 387-418). Stabilization of the peptide di rectly on β-turn can be carried out by the following measures:

• Use of a D-amino acid instead of the corresponding L-amino acid
• - Use of modified peptide bonds
• - Use of proline
• - Replacement of alanine by α-aminobutyric acid
• - Cyclic linkage of the α-C atom of an amino acid with the α-N atom of adjacent amino acid through an S-γ-lactam group
• - Replacement of possible hydrogen bonds by hydrazone bonds
• - Use of norbornene units
• - Use of β-amino acids

Replacement of possible hydrogen bonds by hydrazone bonds, for example, resulted for the cyclization of a small peptide derived from HIV surface protein gp 120 (ca. bezas E. et al. (2000), Biochemistry 39, 14377-91). This cyclization has turned β-turns stabilized in the peptide.

The use of norbornene units or β-amino acids is for example described by North et al. (North, M. (2000) J Pept Sci 6, 301-13), where it is below the Influence of these measures locally induced the formation of β-turns in peptides.

With the same molecules, d. H. Norbornene units and β-amino acids can be also induce the more complex β-sheet secondary structure in peptides, however basically problematic in small peptides, since this structure is often used here Formation of peptide aggregates (Rizo, J. et al., (1992), Annu Rev Biochem 61, 387- 418). Nevertheless, for 10mer and 12mer peptides, one could be on the surface  derived from the human renin located β-hairpin structure, the cyclization via a disulfide bridge of two artificial terminal cysteine residues stabilized the structure of the peptides to correspond to the structure in the native protein. Anti-renin antibodies recognized only the cyclic, but not the linear variants of the Peptides (Rizo, J. et al., (1992), Annu Rev Biochem 61, 387-418).

The following possibilities exist for stabilizing α-helical structures in small peptides (Rizo, J. et al., (1992), Annu Rev Biochem 61, 387-418):

• - Replacement of alanine by α-aminobutyric acid
• - Bridging of the side chains between the amino acids i and i + 4 by a covalent lactam bridge or by noncovalent ionic interactions between the side chains and metal ions
• - Attaching a cyclic proline dipeptide to the N-terminus of a peptide sequence as a so-called template for the induction of α-helix secondary structure.

In addition to the various possibilities of stabilizing the secondary structures or secondary element structures shown above, the following aspects are advantageously to be taken into account in determining the portion of the target molecule to be used in the said evolutionary methods:

• - The portion of the target molecule is easily accessible in the total protein.
• The subregion of the target molecule is structured by your or several disulfide bridges stabilized and is most likely as well folded as free peptide, as in the context of the total protein.
• A basic nucleic acid isoelectric point of the peptide leads to a for the selection process using nucleic acids to a basic affinity this compared to the peptide as a basis for the selection of specific nucleic acids, ins special Spiegelmers.
• - The availability of X-ray structures of cocrystals with biological interactions from which the subregions of the target molecule can be seen that are responsible for biolo may be responsible for the adverse effects of the target area.

Within the domain approach, these measures can be applied individually as well as in be applied to any combination.

In a further aspect, the invention relates to the further embodiment of, more preferably wise inventive method for preparing and / or identifying nucleic acid which bind to a target molecule and those for the production of L-nucleic acids, the bind to a target molecule occurring in the natural configuration. With all these ver can drive as the target molecule used in the reaction mixtures instead of the complete target molecule or a partial or partial sequence (domain Approach) formed according to the teachings disclosed herein.

In yet another aspect, the invention relates to the further embodiment of, before zugterweise invention, method for producing and / or identifying Nuk linolenic acids which bind to a target molecule and those for the production of Nucleic acids that bind to a target molecule that occurs in the natural configuration. It is provided in one embodiment that in the method, the target molecule or a substructure or subsequence, hereinafter for simplicity referred to as target molecule, only more than immobilized on a support material is present and this immobilization takes place during the synthesis of the target molecule. As suitable Trä Germaterials can serve as beads such as the so-called Macrobeads or planar Surfaces, also referred to as chips or biochips. Suitable carrier material Lien are, for example, glass, cellulose or nitrocellulose.

In a particularly preferred embodiment of the method using a planar Surface is provided that the target molecule in substructures or subsequences is dissected and these substructures or subsequences then on the surfaces immobilized and in the context of the process for the preparation and / or identification of nucleic acids which bind to a target molecule and those for the production of L- Nucleic acids that bind to a target molecule occurring in the natural configuration, be used. This aspect of the present invention is for purposes of Veran but not for purposes of limitation by reference to a target molecule Protein is (hereinafter referred to as target protein) illustrated.  

The target molecule is broken down into a number of individual peptides that overlap each other penden partial sequences of the target protein in their sequence correspond. The length of the parts is from 10 to 40 amino acids, preferably 14 to 35 amino acids and before zugtererweise 14 to 25 amino acids. Typically, the subsequences are the same length. The the minimal extent of the overlap of two consecutive subsequences is n-1, where n is the length of the partial sequences expressed as number of amino acids. Bevozug The extent of the overlap is at least n-6.

The thus formed peptides are then on a support, preferably a planar support immobilized or immobilized on such. Letz teres can be done, for example, that the synthesis of the respective peptide directly location-specific on the carrier. However, it is also possible that a site-specific Immobilization takes place. The site-specific presence of peptides of known sequence is associated with a number of advantages. Thus, for example, so that the course of Selection still be tracked during the actual selection, d. H. be determined which of the peptides for the selection process under the particular conditions in particular suitable is.

Furthermore, it is possible in the context of the present invention, all from a target protein derived and as such prepared peptides in a reaction to unite and for the selection used to add oligonucleotide library to this reaction. In In a further alternative embodiment, it is possible for each individual peptide add the oligonucleotide library used, and thus one for each peptide to carry out own selection, similar to the conditions of carrying out the selection a planar carrier. Under planar support, a so-called microtiter Plate understood.

In yet another embodiment, it may be provided that starting from a Nucleic acid, which has a certain binding behavior with the target molecule or a part quence has shown, immobilized on a support material and the entirety or a Part of the peptides is brought into contact with this nucleic acid. After binding a Pep tids to the immobilized nucleic acid, this can be determined. This can be, for example  be carried out by immobilizing the nucleic acid by means of a cleavable linker is, which is then split. By binding of the or a peptide to the nucleic acid changes the mass of the nucleic acid, which then after cleavage of the linker, for example can be determined by MALDI-TOF.

The invention will now be described with reference to the following figures and examples and the Sequenzpro Tokolls further exemplifies making up more benefits, features and execution forms of the invention. It shows

Fig. 1 is a schematic representation of the structure of SEB;

Figure 2 shows the result of a selection of aptamers against the D-peptide of SEB;

FIG. 3 shows an alignment of the randomized regions of the different clones of the aptamer family 1 determined during the selection; FIG.

Figure 4 is an alignment of the randomized regions of the various clones of the identified in the selection aptamer family. 2;

FIG. 5 shows an alignment of the randomized regions of the different clones of the aptamer family 3 determined during the selection; FIG.

Fig. 6 shows a possible secondary structure of the two stereoisomers of clone B 12b10-65;

Figure 7 shows the binding behavior of an aptamer / Spiegelmer D-peptide / L peptide.

Figure 8 shows the binding curve of a Spiegelmer against SEB in solution. and

Fig. 9 shows the result of an experiment to determine the specificity of binding between Spielgelmer and SEB.

The following clones or sequences mentioned herein may be assigned to the following SEQ ID No:

Clone / sequence SEQ ID No A8c3I 82 A8c3II 7 AE11a5I 22 AE11a5II 23 B12e7I 64 B12e7II 65 B12d10I 56 B12d10II 57 A8g1I 16 A8g1II 17 B12a10I 36 B12a10II 37 B12b10I 44 B12b10II 45 A8a1I 5 A8a1II 6 B12c7I 52 B12c7II 53 B12b8I 46 B12b8II 47 B12f12I 68 B12f12II 69 AE11b6I 24 AE11b6II 25 AE11g4I 32 AE11g4II 33 A8d1I 8th A8d1II 9 AE11g5I 34 AE11g5II 35 A8g2I 18 A8g2II 19 A8e3I 12 A8e3II 13 AE11d4I 28 AE11d4II 29 AE11d6I 30 AE11d6II 31 B12e10I 60 B12e10II 61 B12g9I 78 B12g9II 79 A8e1I 10 A8e1II 11 B12b9I 48 B12b9II 49 B12f11I 66 B12f11II 67 A8f3I 14 A8f3II 15 AE11a4I 20 AE11a4II 21 AE11c4I 26 AE11c4II 27 B12a8I 42 B12a8II 43 B12h7I 80 B12h7II 81 B12c9I 54 B12c9II 55 B12d12I 58 B12d12II 59 B12a11I 38 B12a11II 39 B12c10I 50 B12c10II 51 B12g12I 76 B12g12II 77 B12f9I 72 B12f9II 73 B12e11I 62 B12e11II 63 B12a12I 40 B12a12II 41 B12g11I 74 B12g11II 75 B12f7I 70 B12f7II 71

Supplement I or II in the context of the above sequences refer to the case the denomination with II the sequence of the randomized area of the single clone or the nucleic acid library used in the selection, in the case of the designation with I die Sequence which comprises the or a primer moiety via the sequence designated II.

example 1 Domain approach in the selection of Spiegelmeres against SEB

The three-dimensional structure of SEB is due to crystallization and subsequent X-ray structure analysis (Papageorgiou A.C. et al (1998), J Mol Biol 27: 61-79).

In Fig. 1, the structure is shown schematically. The protein folds into an N-terminal and a C-terminal domain. In the N-terminal domain exists a long "loop", at the base of which is a structure-stabilizing disulfide bridge (marked in Fig. 1). The loop was chosen as a target for the selection of aptamers against SEB, and a 25-amino acid peptide was synthesized as a D-isomer, which was cyclized via the two existing cysteine residues by disulfide bonding.

In accordance with the domain approach disclosed herein, the following criteria have been considered for the selection of the protein region used or mirrored as a D-peptide:

• - The area is easily accessible in the total protein.
• - The area is structurally stabilized by the disulfide bridge and is highly true It seems as if the free peptide is folded as well as in the context of the total protein.
• - The isoelectric point of the peptide of 8.5 leads to a basic affinity of the nucleic acid acids to the peptide as a basis for the selection of specific spiegelmers.
• As is known from the X-ray structure of cocrystals with MHCII and T cell receptor Jardetzky, T.S. et al. (1994), Nature 368: 711-8; Reinherz, E.L. et al. (1999), Science 286: 1913-21), the region of SEB selected for selection interacts both MHCII and the T cell receptor, and is therefore believed to be of biological relevance be for the effect of SEB as a toxin.

Example 2 Production of the peptides used in the selection

Peptides were prepared as 25mers with the sequence YYYQCYFSKKTNDINSHQTDKRKTC (SEQ ID No 83) according to the f-moc standard solid-phase synthesis as D-isomers and as L-isomers (Jerini Bio Tools, Berlin, Germany). For biotinylated peptides, biotin was N-terminally coupled to the peptide via an aminohexanoic acid linker. The SEB protein was obtained as a lyophilisate with a purity of greater than 95% from Toxin Technology via Alexis (Grünberg, Germany) and rehydrated with H ₂ O to a concentration of 1 μg / μl. Oligonucleotides were synthesized according to the standard phosphoramidite method (Nox xon Pharma, Berlin, Germany). NeutrAvidin agarose was from Pierce and was purchased via KMF (St. Augustin, Germany).

Example 3 Carrying out the in vitro selection

The starting point for the selection was the single-stranded DNA pool AL ₆₀ with 60 randomized, internal positions and constant, flanking sequences for annealing the primers (5'-TCAGCTGGACGTCTTCGAAT- [60N] -TGTCAGGAGCTCGAATTCCC-3 '). The pool was purified by gel electrophoresis (8% PAA / 8 M urea) and PCR primed with the primer A-DNA (TTTTTTTTTTTTTTTTTTTTTXXACTATAGGGAATTCGAGCTCCTGACA) and primer B (TCAGCTGGACGTCTTCGAAT) with a 126 nt strand and a 106 nt strand and a complexity of 1 × 10 ¹⁵ different molecules (X stands for spacer 9 from Glen Research, based on Eurogentec, Herstal, Belgium).

The shorter DNA strand, radiolabeled internally by incorporation of ³² P-dCTP, was isolated by denaturing gel electrophoresis and formed the start library for selection. Twofold amount of biotinylated D-peptide (based on DNA) was added to NeutrAvidin agarose in selection buffer (20 mM Tris pH 7.4, 250 mM NaCl, 5 mM KCl, 2 mM CaCl ₂ , 1 mM MgCl ₂ , 0.005% Triton X-100) in 1.5 ml mini columns (MoBiTec, Göttingen, Germany) and the de-and renaturierte DNA (5 min. 94 ° C and 20 min. At room temperature) was for 30-60 min. At room temperature in duplicate Column volume incubated with the immobilized peptide. The column was washed with n column volumes of selection buffer until the last wash fraction contained less than 1% of the DNA used.

The bound DNAs were in excess with free D-peptide in three The following fractions are eluted specifically from the column by affinity elution. In the first Fraction was the column with ten times the amount of free peptide in a column volume Binding buffer for 10 min. At room temperature and then eluted. For the second Fraction was the column 1 hour with the double column volume and twenty times Amount of free D-peptide incubated and eluted. For the third fraction, the column with one column volume and ten times the amount of free D-peptide and one column volume Binding buffer washed without peptide.

The eluates were precipitated with EtOH and PCR by primers A-DNA and B amplified. In the first round, 1 nmol of D-peptide was added to 100 μl of NeutrAvidin agarose coupled and incubated with 500 .mu.mol single-stranded DNA, without the DNA was preselected. In the further rounds of selection, the DNA was pre-reacted with the immobilized peptide pre-selected on underivatized NeutrAvidin agarose. The binding sequences were after the 12th round of selection with the primers A (TTCTAATACGACTCACTATAGGGAATTCGAGCTCCTGACA) and B are amplified and cloned and sequenced by Seqlab (Göttingen, Germany).  

Example 4 Biacore measurements of the binding of aptamers and spiegelmers

Binding of Aptamers and Spiegelmers to SEB Peptides (as Prepared in Example 2) was determined at Biacore 2000 (Freiburg, Germany). For this purpose, biotinylated D- Peptides or L-peptides on the SA chip (coupled to the chip surface via dextran) Streptavidin) and binding of the free aptamers, spiegelmers. The Binding of the spiegelmer to the full length protein was with biotin-streptavidin immobilized spiegelmer and free SEB. For the determination of Binding constants became the competition of binding of free SEB to immobilized Spiegelmer exploited by free Spiegelmer.

Example 5 NeutrAvidin agarose "bead assay" to test the specificity of the spiegelmer

30 μl NeutrAvidin agarose were loaded with 0.5 nmol biotinylated L-peptide. The Spiegelmer B12b10-65L labeled with ³² P at the 5 'end by T4 polynucleotide kinase was preincubated after de-renaturation with or without free SEB for 1 hour at room temperature and with the peptide-loaded agarose beads for a further hour in the final volume of 100 incubated. The test was carried out in selection buffer with 1% casein (blocking reagent, Roche Diagnostics, Mannheim, Germany) as foreign protein or in selection buffer without additional foreign protein. The decrease in radioactivity in the supernatant of the binding reactions served as a measure of the binding of the Spiegelmer to the immobilized peptide. As a control, the binding of the Spiegelmer to uncharged NeutrAvidin agarose beads was measured.

Example 6 Results of the selection

The single-stranded DNA library (complexity: 1 x 10 ¹⁵ different molecules) with 60 internal randomized positions was subjected to in vitro selection for 13 cycles ( Figure 2). The DNAs were incubated with NeutrAvidin agarose immobilized D-peptide and binding molecules were specifically eluted by an excess of free D-peptide, amplified and used for the next round of selection.

In the course of the selection rounds, there is an increase in the binding of the DNA pools from the 7th. Selection round to watch until the 12th round. Because in the 13th round no further increase was recorded in the binding, the selected DNA of the 12th round was cloned and the Sequence of 96 clones determined.

sequence families

The primary sequences were analyzed with the multiple alignment program Clustal X as well as with the motive search program motif 111. After analysis, the sequenced aptamer clones could be classified into three families. The randomized regions of the aptamers from the three families are shown in Figs. 3-5 listed. In the first sequence family there are 7 clones containing a highly conserved, 20-21 nt sequence section ( Figure 3). Characteristic of this section is the appearance of four doubly occurring guanosines. This motif is believed to be responsible for the formation of the required specificity of binding of the sequences. In that regard, a nucleic acid according to the invention is also any such that this motif in its general form
GG n4 GG n4 GG n2 GG (SEQ.ID.No.1) or
GG n4 GG n4 GG n2 GGTCT (SEQ.ID.No.2) or
GGCATTGGCNYAGGWYGGTCT (SEQ.ID.No.3)
includes. It stands
N for any nucleotide,
Y for T or C or a missing nucleotide and
W for A or T,
as also apparent from Fig. 3.

Figure 4 shows the 17 members of the second family, all of which contain a 10 nt long conserved motif, which, as also shown in Figure 4, reads as follows:
GACATGTTAT (SEQ ID No. 4)

The third family is formed by 15 aptamers which are not similar to each other and to the aptamers of the other two families ( Figure 5).

Example 7 Binding of aptamers or Spiegelmers to SEB peptides

Sequenced clones were tested for binding to immoblated D-peptide after PCR amplification (Biacore 2000). Binding aptamers were shortened and synthetically produced. The binding of the truncated aptamer to the D-peptide was retested and the clone B12b10 was synthesized as a 65 nt molecule as L-DNA in a mirrored form. FIG. 6 shows a proposal for the secondary structure of the two stereoisomers of B12b10-65. The consensus motif and the rest of the primer B remaining in the truncated molecule are marked.

The binding of the aptamer B12b10-65D and the Spiegelmer B12b10-65L to the D-peptide or to the L-peptide was measured on immobilized peptides on the Biacore 2000 ( FIG. 7). As can be seen in Figure 7, the 65 nt aptamer binds B12b10-65D with high affinity to the D-peptide and not to the L-peptide. Conversely, the spiegelmer B12b10-65L binds to the L-peptide but not to the D-peptide. The binding constant KD for the binding of the aptamer to the D-peptide is 200 nM. The binding constant for the binding of the spiegelmer to the L-peptide is also 200 nM.

Example 8 Binding of the Spiegelmer to SEB

For the detection of the binding of the spiegelmer to the total protein, B12b10-65L - biotinylated at the 3 'end - was immobilized on a streptavidin matrix and the binding of the free SEB was measured (Biacore 2000). The binding constant was determined by completing the binding of SEB to immobilized spiegelmer by increasing amounts of free spiegelmer. FIG. 8 shows the decrease in binding with increasing concentration of free spiegelmer. The kinetic evaluation of the binding of the free spiegelmer to SEB in solution yields a dissociation constant K _D 420 nM.

To make sure that the spiegelmer also displays the enterotoxin in front of a high background Foreign protein recognizes, was the specificity of the binding in a "bead assay" with immobilized L-peptide, free spiegelmer and competing free SEB. The Test was performed in the presence of 1% casein as a model for a high protein background carried out. This is about a 35-fold higher concentration of foreign protein in the Comparison set to the concentration of the target.

From Fig. 9 it can be seen that, on the one hand, the binding of the Spiegelmer to immobilized target molecule (English) is not disturbed by the high concentration of foreign protein, and moreover, the binding to free target takes place even before the high background of foreign protein.

Those disclosed in the foregoing description, the sequence listing and the claims The features of the invention can be used individually as well as in any combination for the realization of the invention in its various embodiments essential his. The disclosure of the claims is hereby incorporated by reference.  

SEQUENCE LISTING

Claims (26)

1. Nucleic acid binding to enterotoxin B of Staphylococcus, especially staphyloc coccus aureus. 2. Nucleic acid according to claim 1, characterized in that the nucleic acid to a Amino acid sequence of Enterotoxin B of Staphylococcus aureus binds, the amino acid sequence comprising the sequence according to SEQ.ID.No.83. 3. Nucleic acid according to claim 1 or 2, characterized in that the nucleic acid a L-nucleic acid is. 4. Nucleic acid according to one of claims 1 to 3, characterized in that the Nuk Lactic acid is selected from the group that includes DNA and RNA.   5. Nucleic acid according to one of claims 1 to 4, characterized in that the Bin constant of the nucleic acid 1 μM or less, preferably 500 nM or less and more preferably 250 nM or less. 6. Nucleic acid according to one of claims 1 to 5, characterized in that the Nuk lineatic acid comprises a nucleic acid sequence selected from the group consisting of SEQ.ID.NO.1 to SEQ.ID.NO.82. 7. A method for producing and / or identifying nucleic acids that bind to a Zielmo lekül, in particular of a nucleic acid according to any one of claims 1 to 6, comprising the steps

• a) generating a heterogeneous population of nucleic acids;
• b) contacting the population of step a);
• c) separating the nucleic acids that do not interact with the target molecule;
• d) optionally separating the nucleic acids that interact with the target molecule; and
• e) optionally sequencing the nucleic acids that have interacted with the target molecule,

characterized in that the target molecule comprises an amino acid sequence of the enterotoxin B of Staphylococcus, in particular of Staphylococcus aureus, wherein the amino acid sequence is in particular the sequence according to SEQ.ID.No.83 8. A method for producing and / or identifying nucleic acids that bind to a Zielmo lekül, in particular nucleic acid according to any one of claims 1 to 6, comprising the steps

• a) generating a heterogeneous population of nucleic acids;
• b) contacting the population of step a);
• c) separating the nucleic acids that do not interact with the target molecule;
• d) optionally separating the nucleic acids that interact with the target molecule; and
• e) optionally sequencing the nucleic acids that have interacted with the target molecule,

characterized in that the target molecule comprises an amino acid sequence of the enterotoxin B of Staphylococcus, in particular of Staphylococcus aureus, wherein the amino acid sequence at least 5 or more, preferably 10 or more, and more preferably 15 or more consecutive amino acids of the enterotoxin B Staphylococcus, in particular of Staphylococcus aureus. 9. A method for producing and / or identifying nucleic acids that bind to a Zielmo lekül, in particular nucleic acid according to any one of claims 1 to 6, comprising the steps

• a) generating a heterogeneous population of nucleic acids;
• b) contacting the population of step a);
• c) separating the nucleic acids that do not interact with the target molecule;
• d) optionally separating the nucleic acids that interact with the target molecule; and
• e) optionally sequencing the nucleic acids that have interacted with the target molecule,

characterized in that
the target molecule is present as a mixture of a plurality of individual target molecules,
the single target molecule comprises an amino acid sequence of the enterotoxin B of Staphylococcus, in particular of Staphylococcus aureus, wherein the amino acid sequence comprises at least 5 or more, preferably 10 or more and more preferably 15 or more consecutive amino acids of the enterotoxin B Staphylococcus, in particular of Staphylococcus aureus .
a single target molecule of the mixture differs from another single target molecule of the mixture by its sequence, the sequences of the two target molecules overlapping with a number of amino acids forming the sequences, the number being at least 1 and at most the number of amino acids forming the sequences minus one amino acid. 10. The method according to any one of claims 7 to 9, characterized in that following step c) of the subsequent step

• a) amplification of the nucleic acids which interact with the target molecule

he follows. 11. The method according to any one of claims 7 to 10, characterized in that the steps b) to d) are repeated. 12. The method according to any one of claims 7, 10 and 11, characterized in that the Target molecule an amino acid sequence of the enterotoxin B of Staphylococcus, in particular of Staphylococcus aureus, wherein the amino acid sequence is the amino acid sequence of Enterotoxin B of Staphylococcus, in particular of Staphylococcus aureus 13. A process for producing L-nucleic acids which bind to a target molecule occurring in the natural confi guration, comprising the following steps:

• a) generating a heterogeneous population of D-nucleic acids;
• b) contacting the population of step a) with the optical antipode of the target molecule;
• c) separating the D-nucleic acids that have not interacted with the optical antipode of the target molecule;
• d) sequencing the D-nucleic acids that have interacted with the optical antipode of the target molecule; and
• e) synthesis of L-nucleic acids which are identical in their sequence to those determined in step d) for the D-nucleic acids,

characterized in that the target molecule comprises an L-amino acid sequence of the enterotoxin B of Staphylococcus, in particular of Staphylococcus aureus, wherein the amino acid sequence is in particular the sequence according to SEQ.ID.No.83, and the optical antipode of the target molecule is a D-amino acid sequence of the enterotoxin B of Staphylococcus, in particular of Staphylococcus aureus, wherein the amino acid sequence is in particular the sequence according to SEQ.ID.No.83. 14. A process for producing L-nucleic acids which bind to a target molecule occurring in the natural confi guration, comprising the following steps:

• a) generating a heterogeneous population of D-nucleic acids;
• b) contacting the population of step a) with the optical antipode of the target molecule;
• c) separating the D-nucleic acids that have not interacted with the optical antipode of the target molecule;
• d) sequencing the D-nucleic acids that have interacted with the optical antipode of the target molecule; and
• e) synthesis of L-nucleic acids which are identical in their sequence to those determined in step d) for the D-nucleic acids,

characterized in that the target molecule comprises an amino acid sequence of the enterotoxin B of Staphylococcus, in particular of Staphylococcus aureus, wherein the amino acid sequence at least 5 or more, preferably 10 or more, and more preferably 15 or more consecutive amino acids of the enterotoxin B Staphylococcus, in particular of Staphylococcus aureus. 15. A method for the production of L-nucleic acids which bind to a target molecule occurring in the natural confi guration, comprising the following steps:

• a) generating a heterogeneous population of D-nucleic acids;
• b) contacting the population of step a) with the optical antipode of the target molecule;
• c) separating the D-nucleic acids that have not interacted with the optical antipode of the target molecule;
• d) sequencing the D-nucleic acids that have interacted with the optical antipode of the target molecule; and
• e) synthesis of L-nucleic acids which are identical in their sequence to those determined in step d) for the D-nucleic acids,

characterized in that
the target molecule is present as a mixture of a plurality of individual target molecules,
the single target molecule comprises an amino acid sequence of the enterotoxin B of Staphylococcus, in particular of Staphylococcus aureus, the amino acid sequence having at least 5 or more, preferably 10 or more and more preferably 15 or more consecutive amino acids of the enterotoxin B of Staphylococcus, in particular Staphylococcus aureus, includes,
a single target molecule of the mixture differs from another single target molecule of the mixture by its sequence, the sequences of the two target molecules overlapping with a number of amino acids forming the sequences, the number being at least 1 and at most the number of amino acids forming the sequences minus one amino acid. 16. The method according to any one of claims 13 to 15, characterized in that at the end of step c), the following step is inserted:

• a) Amplification of the D-nucleic acids that have interacted with the optical antipode of the target molecule.

17. The method according to any one of claims 13 to 16, characterized in that the steps b) to e) are repeated.   18. The method according to any one of claims 13, 16 or 17, characterized in that the Target molecule an amino acid sequence of the enterotoxin B of Staphylococcus, in particular of Staphylococcus aureus, wherein the amino acid sequence is the amino acid sequence of Enterotoxin B of Staphylococcus, in particular of Staphylococcus aureus. 19. The method according to any one of claims 7 to 18, characterized in that the hetero gene of a nucleic acid according to any one of claims 1 to 6 summarizes. 20. Use of the nucleic acid according to any one of claims 1 to 6 for the preparation of a Drug. 21. Use according to claim 20, characterized in that the medicament Be Disease is caused by enterotoxin B of Staphylococcus, in particular caused by Staphylococcus aureus. 22. Use according to claim 21, characterized in that the disease out Selects is from the group that has septic shock, rheumatoid arthritis and eczema includes. 23. Composition, in particular pharmaceutical composition comprising a A nucleic acid according to any one of claims 1 to 6 and a pharmaceutically acceptable carrier ger. 24. Complex comprising enterotoxin B from Staphylococcus, in particular Staphylococ cus aureus, and a nucleic acid according to any one of claims 1 to 6. 25. Use of the nucleic acid according to any one of claims 1 to 6 for the detection of En terotoxin B of Staphylococcus, in particular of Staphylococcus aureus. 26. Kit for the detection of enterotoxin B of Staphylococcus, in particular of staphyloc coccus aureus, comprising a nucleic acid according to any one of claims 1 to 6.