WO2011069487A2

WO2011069487A2 - Dna aptamers that specifically bind to the soluble interleukin-6 receptor

Info

Publication number: WO2011069487A2
Application number: PCT/DE2010/001413
Authority: WO
Inventors: Ulrich Hahn; Stefan Rose-John; Cindy Meyer; Tijana Zivkovic
Original assignee: Universität Hamburg; Christian-Albrechts-Universität Zu Kiel
Priority date: 2009-12-07
Filing date: 2010-12-06
Publication date: 2011-06-16
Also published as: DE102009056945A1; WO2011069487A3

Abstract

The invention relates to aptamers specifically binding to a target molecule. The aim of the invention is to provide diagnostic and/or therapeutic agents for use in the recognition and/or prevention or treatment of inflammatory processes, of cancerous diseases and of infections. To achieve this aim, the invention provides a DNA aptamer that specifically binds to the human soluble interleukin-6 receptor (sIL-6R), said aptamer comprising the sequence GGGNGGGHGGGWGGG however with the exception of GGGTGGGTGGGTGGGT. N = A, T, TT or TTT, H = A, C or T, and W = A or T.

Description

DNA APTAMERS SPECIFICALLY BINDING THE SOLUBLE INTERLEUKIN-6 RECEPTOR

The invention relates to aptamers which specifically bind a target molecule.

It is known that cytokines, for example interleukins such as interleukin-6 (IL-6), play an important role in the information transfer between different cells of an organism. The biological effect of cytokines on the target cells is mediated by specific, usually membrane-bound receptors. The cytokine interleukin-6 (IL-6), for example, acts on a variety of different cells and plays a central role, especially in inflammatory processes. Cytokine IL-6 is known to be involved in a variety of diseases, e.g. inflammatory autoimmune diseases such as rheumatoid arthritis. Of many membrane-bound cytokine receptors, soluble forms also exist which consist of the extracellular domains of the membrane-like forms and also possess the ability to bind ligand, albeit at a reduced affinity to the membrane-like form. Soluble receptors can neutralize ligands, for example, by their comparatively high concentration and act in this way

antagonistic. For the soluble receptors of some cytokines but also an agonistic effect is described. For example, in the case of the soluble interleukin-6 receptor (sIL-6R), the complex of IL-6 and sIL-6R causes dimerization of the membrane gpl30 (Taga, T. et al. (1989) Cell, 58, 573-581 Mackiewicz, A. et al., (1992) J. Immunol., 149, 2021-2027; Scheller and Rose-John, Med. Microbiol Immunol. (2006), 195, 173-183; Rose-John et al. , (2006), JJ Leukocyte Biol. 80, 227-235; Jones et al. (2001), The FASEB Journal 15, 43-57) to initiate signal transduction. Unlike the membrane-bound IL-6 receptor, gpl30 is present in almost all organs, e.g. Heart, kidneys, spleen, liver, lung, placenta, and brain (Saito, M. et al., 1992, J. Immunol., 148, 4066-4071) .In the presence of sIL6-R, interleukin-6 may therefore also act on cells which do not express the membrane-bound interleukin-6 receptor but the glycoprotein gp 130 (Hirota, H. et al., (1995) Proc Natl Acad., USA, 92, 4862-4866).

CONFIRMATION COPY Because of the above-outlined importance of cytokines, approaches have already been pursued in the art by targeted inhibition of cytokine receptors

Disease courses influence. One approach is, for example, the use of antibodies against cytokine receptors. For example, tocilizumab (Actemra®) is a monoclonal antibody currently used to treat rheumatoid arthritis. Tocilizumab (Actemra®) exerts its action via the blockade of the human IL-6 receptor, resulting in the binding of IL-6 to the receptor and a consequent

Inflammatory reaction is prevented. However, the use of antibodies is often associated with undesirable side effects. The most common adverse events associated with antibody treatment are infections, predominantly upper respiratory tract infections. In addition, their use has often been associated with a slight increase in liver function and

Lipid metabolism observed. Other side effects include gastrointestinal perforation, hypersensitivity reactions including anaphylaxis, headache and

High blood pressure.

For some time now also tried, so-called Aptamere as therapeutic and

for example, Osborne et al., (1997) Curr. Opin. Chem. Biol., 1, 5-9). Aptamers are artificial DNA or RNA molecules that contain another molecule, e.g. a protein, specifically bind. With high specificity and affinity as well as chemical

Stability, aptamers have a low immunogenicity compared to antibodies. For example, aptamers may be selected by a method termed SELEX (Evolutionary Evolutionary Ligations by Exponential Enrichment) (Ellington and Szostak (1990), Nature 346, 818-822, Gopinath (2007), Anal. Bioanal Chem 387, 171-182, WO 91/19813).

However, despite the intensive efforts to date, there is still a great need for diagnostic and / or therapeutic agents for use in the detection and / or prevention or treatment of inflammatory processes, cancers and infections. The object of the present invention is to provide such means. The problem is solved by the subject matter of claim 1 and the other independent claims. Advantageous embodiments of the invention are in the

Subclaims specified. In a first aspect, the invention provides a DNA aptamer which specifically binds the human soluble interleukin-6 receptor and comprises the sequence GGGNGGGHGGGWGGG (SEQ ID NO: 1). However, DNA aptamers containing the sequence are excluded

GGGTGGGTGGGTGGGT (abbreviated (G ₃ T) ₄ , see SEQ ID NO: 6). The letters indicate the bases of the nucleotides in the usual coding: A = adenine; C = cytosine; G = guanine; T = thymine; H = A, C or T; W = A or T. N is A, T, TT or TTT.

The soluble human interleukin-6 receptor (sIL-6R) has a molecular weight of about 50 kDa at 339 amino acids (AA). The amino acid sequence of sIL-6R is shown in SEQ ID NO: 7. The amino acid sequence of the sIL-6R is identical to that of the extracellular domain of the membrane-bound interleukin-6 receptor (IL-6R), so that the aptamer according to the invention naturally also specifically binds the IL-6R. Any reference to the sIL-6R should therefore also include the IL-6R, unless expressly stated otherwise. The DNA aptamer according to the invention is affine and specific for the human sIL-6 receptor and is unlikely or not immunogenic. It provides a promising means to treat or prevent diseases involving the soluble IL-6 receptor. It is also simple and inexpensive to produce, durable and storable.

The DNA aptamer according to the invention can be used in a variety of ways to diagnose or influence conditions or diseases of humans in which IL-6 and / or the soluble and / or the membrane-bound interleukin-6 receptor are directly or indirectly involved , It can be used, for example, to prepare a drug or diagnostic agent that can be used to diagnose, prevent and / or treat inflammatory conditions or diseases, cancers or infections. Examples of diseases in which the inventive DNA aptamer Applications include rheumatoid arthritis, sepsis, asthma, Crohn's disease, multiple sclerosis, depression, breast cancer, multiple myeloma, and HIV infection.

The DNA aptamer according to the invention can also be used to introduce other molecules, for example peptides, proteins, oligonucleotides, dyes, diagnostic agents etc., into a cell. For this purpose, these molecules are coupled to the DNA aptamer using techniques that are familiar to those skilled in the art. The molecule coupled to the DNA aptamer according to the invention can then be introduced into the cell by means of the sIL-6R or the IL-6R and re-released intracellularly. The molecules can also be biologically or medically active substances, so that the DNA aptamer can also have a function as part of a prodrug.

By a "DNA aptamer" is meant here an isolated single-stranded DNA (ssDNA) containing a target molecule, e.g. a protein that specifically binds. In particular, by the term "DNA aptamer", ssDNA oligonucleotides having at most 150, preferably at most 130, at most 110, at most 100, at most 90, at most 80, at most 70, at most 60, at most 50, at most 40, at most 30, at most 20 , at most 15 or at most 10 nucleotides understood. By a "nucleotide" are here in particular the basic building blocks of nucleic acids, i. organic molecules derived from a sugar residue, usually a pentose, e.g. Deoxyribose or ribose, an organic base (nucleobase) and phosphoric acid. The phosphoric acid is regularly linked to the sugar via an ester bond, the sugar to the nucleobase via an N-glycosidic bond. In deoxyribonucleic acid (DNA), the nucleobases adenine (A), cytosine (C), guanine (G) and thymine (T) regularly occur, while in ribonucleic acid (RNA) the base uracil (U) is substituted for thymine. The phosphoric acid is usually present in RNA and DNA as monophosphate. The

Linkage of nucleotides with each other usually takes place via a phosphodiester bond between the 5 '-C atom of a pentose and the 3'C atom of an adjacent pentose. A "target molecule" is understood here preferably to be non-RNA and non-DNA molecules, for example proteins, peptides and glycoproteins. By "binding" is meant a bond that does not rely on the Watson-Crick pairing between nucleotides. It is preferably a non-covalent bond. A DNA aptamer or a fragment thereof which binds specifically to the human sIL-6 receptor is here understood as meaning a DNA aptamer or DN A-aptamer fragment which has a related function

Dissociation constant (K _< j) of at most 7 · KT ⁶ M (mol / 1), preferably at most 5 · KT ⁶ M, preferably at most 3 · KT ⁶ M, preferably at most 2 · KT ⁶ M, preferably at most KT ⁶ M, maximum 8 · 10 ^-7 M, maximum 5 · 10 ^-7 M, maximum 3 · 10 ^-7 M, maximum 10 ^-7 M, maximum Z'ICT * M, maximum 5 · 1 (Γ ⁸ M or maximum 3 · 1 ( Γ ⁸ M. In particular, a DNA aptamer or DNA aptamer fragment which specifically binds the human sIL-6 receptor is understood as meaning a DNA aptamer or DNA aptamer fragment which has a dissociation constant of at most 1000 nM (nmol / l preferably at most 500 nM, more preferably at most 250 nM and particularly preferably at most 150 nM If reference is made here to dissociation constants, this preferably refers to average values of a one-site binding described in more detail below. Size as determined by filter binding studies As already indicated above, the term includes an hsEL-6 receptor specific binding also to the hIL-6 receptor, ie the membrane-bound human IL-6 receptor.

By a "diagnostic agent" is meant herein a product that can be used in a diagnostic procedure. The term also includes products, such as reagents or kits of reagents, used to determine outside the human or animal body a particular condition and / or deviation from a normal condition, e.g. a deviating sIL-6R concentration can be detected.

The DNA aptamer according to the invention is distinguished by the presence of four G triplets which are also characterized by an adenine, thymine or cytosine nucleotide, if appropriate, in particular in the case of the first and second G triplet viewed from the S 'direction are linked together by two or three TTiymin nucleotides. In a preferred embodiment, the DNA aptamer according to the invention comprises the nucleotide sequence GGGNGGGHGGGWGGGW (SEQ ID NO: 2). In further preferred embodiments, the DNA aptamer according to the invention comprises the nucleotide sequence VGGGNGGGHGGGWGGG (SEQ ID NO: 3), VGGGNGGGHGGGWGGGW (SEQ ID NO: 4) or GGGTGGGCGGGTGGGT (SEQ ID NO: 5). The meaning of the letters C, G, T, N, H and W is as indicated above. V = A, G or C. Except in each case a DNA aptamer which has or comprises the sequence GGGTGGGTGGGTGGGT (SEQ ID NO: 6). In the case of the DNA aptamers having the sequences according to SEQ ID NO: 2 and SEQ ID NO: 4, N, H and W are preferably not simultaneously A. Also in the case of the sequences according to SEQ ID NO: 1 and 3, it is preferred that N, H and W are not all A at the same time. In case of

Aptamers having the sequences of SEQ ID NO: 3 and SEQ ID NO: 4, it is further preferred that at the 5 'end, i. at position 1 of the above sequences, G or C, i. S instead of V, stands.

In a further preferred embodiment, the DNA aptamer according to the invention comprises one of the sequences given in SEQ ID NO: 8-12 or SEQ ID NO: 13-17 or a fragment thereof which specifically binds the human soluble meleleukin-6 receptor. One or more, possibly also all bases of the nucleotides of the DNA aptamer or of the DNA aptamer fragment can be modified. This can be beneficial to

for example, to reduce the sensitivity to nucleases in vivo, to improve uptake into the cell, or to prevent rapid renal absorption. Making appropriate modifications is within the skill of the artisan.

The DNA aptamer of the invention may also be combined with other compounds, e.g. Cholesterol or polyethylene glycol (PEG), coupled or multimerized, for example, to increase bioavailability, reduce degradation or excretion. For protection against the attack of exonucleases, for example, a 3'-3'-dT cap (dT = deoxythymidine) may be provided at the 3 'end.

A fragment of a DNA aptamer according to the invention preferably comprises at least 15, 16, 17, 18, 19 or 20, more preferably at least 25, 30, 35, 40, 45, 50, 55 or 60 consecutive nucleotides of any of the sequences shown in SEQ NO: 8-12 or the sequences given in SEQ ID NO: 13-17. In the case of SEQ ID NO: 13-17, the fragment may also be at least 70, 80, 90, 100 or 101 consecutive nucleotides. Particularly preferably, a fragment comprises at least one of the sequences according to SEQ ID NO: 1-5.

The DNA aptamer according to the invention preferably has a sequence as given in any one of SEQ ID Nos. 18-32, i. In these embodiments, the DNA aptamer according to the invention consists of a nucleic acid having one of the sequences shown in SEQ ID NO: 18-32

indicated nucleotide sequences.

In a preferred embodiment, the aptamer according to the invention binds non-competitively to the human soluble interleukin-6 receptor. This will cause the bond of

Interleukin 6 (IL-6) on the sDL-6R is not affected in principle. Optionally, however, the signal transduction can be modified or prevented. This can be effected, for example, by attaching the gpl30 or else the IL-6 sterically or otherwise by means of an antibody directed against the DNA aptamer or, for example, by a molecule coupled to the DNA aptamer, e.g. a peptide, nucleic acid or other compound is hindered. Another possibility is, for example, that the aptamer bound to the receptor in turn depends on a binding molecule, e.g. an antibody directed against the aptamer. It can also be an indirect

Mechanism such that, for example, a molecule coupled to the DNA aptamer (e.g., biotin or an antigen) is in turn bound by another molecule (e.g., avidin or an antibody). It can also be advantageous in diagnostic methods if the DNA aptamer binds non-competitively to the sIL-6R.

In another aspect, the present invention provides a pharmaceutical composition comprising an aptamer according to the invention. The pharmaceutical composition moreover preferably comprises suitable carrier material, excipients and the like. Optionally, the drug may also contain one or more other active ingredients. The drugs may also be coupled to the DNA aptamer, i. covalently or non-covalently bound. Suitable formulations and dosage forms are known to those skilled in the art or may be routinely prepared according to the prior art. The

aptamers according to the invention can also be bound to nanoparticles, for example, which are loaded with other active ingredients, whereby a targeted supply of the active ingredients is made possible.

In a further aspect, the invention also relates to the use of a DNA aptamer according to the first aspect of the invention for the manufacture of a medicament, preferably a medicament for the treatment of a condition or disease associated with non-normal levels of the sIL-6R in body fluid, e.g. Blood, or associated with a non-normal occurrence of IL-6R, or a diagnostic agent, e.g. to diagnose a disease associated with the normal condition

differing concentrations of sIL-6R in body fluid, e.g. Blood, or a non-normal occurrence of IL-6R. Preferably, the medicament is for treatment and the diagnostic agent is for diagnosing inflammatory conditions, cancer or infections, for example rheumatoid arthritis, sepsis, asthma, Crohn's disease, multiple sclerosis, depression, breast cancer, multiple myeloma or HIV infection.

In a still further aspect, the invention relates to the use of the sequence (G ₃ T) 4 (SEQ ID NO: 6), the sequence of SEQ ID NO: 11 or SEQ ID NO: 16

comprehensive DNA aptamers for the manufacture of a medicament for the treatment of

Inflammatory conditions or cancer, preferably for the treatment of rheumatoid arthritis, sepsis, asthma, Crohn's disease, multiple sclerosis, depression, breast cancer or multiple myeloma.

The invention is explained in more detail below with reference to embodiments and the accompanying figures for illustrative purposes.

Figure 1 Binding of aptamers 13-5, 13-11, 13-15, 13-27 and 13-32 to the target molecule sIL-6R. The proportion of bound DNA aptamer (in%) was determined at defined sIL-6R concentrations in filter binding studies and plotted as a function of the sIL-6R concentration (logarithmic plot). The measurement points and error bars shown result from the averages and standard deviations of three independent of each other Studies. The dissociation constants were calculated using a one-site binding model.

Fig. 2 The fusion protein Hyper-IL-6. Schematically shown is the hyper IL-6 fusion construct consisting of the N- and C-terminal truncated sIL-6R (AS 113-323) and IL 6, which are linked together via a flexible linker. Linker amino acids are given in single letter code.

Fig. 3 Filter binding studies to analyze the specificity of the interaction between the aptamers 13-15, 13-27 and 13-32 and the target molecule sIL-6R. Aptamers 13-15, 13-27 and 13-32 were exposed to increasing concentrations of the sIL-6R (see Figure 3B above) and the control proteins CEACAM1 (A) and IL6 (A and B).

Examples

1. In vitro selection of DNA aptamers using magnetic beads

For selection of DNA aptamers, an in vitro selection process termed SELEX (Systematic Evolution of Ligands by Exponential Enrichment) (Ellington and Szostak (1990), Nature 346, 818-822, Gopinath (2007), Anal., Bioanal. Chem 387, 171-182, WO 91/19813). In this process, in steps of iterative cycles, (1) incubation of a nucleic acid library with the target molecule, (2) separation of binding from non-binding nucleic acids, and (3) amplification of binding species, i. a

Enrichment of binding nucleic acids.

At the beginning of the first round of selection, the incubation of a DNA library of high diversity (up to 10 ¹⁵ different molecules) was carried out with the magnetic particles

(Dynabeads ^®) immobilized sIL-6R (the amino acid sequence of sIL-6R see SEQ ID NO: 7), the soluble version of the membrane-bound mterleukin-6 receptor (IL-6R). To immobilize the sIL-6R was biotinylated and subsequently immobilized via a biotin-streptavidin interaction on the surface of streptavidin-coupled Dynabeads ^®. The protein-coupled particles were used for aptamer selection. After separation non- binding nucleic acids by magnetic separation and washing steps, binding DNA species were eluted by heating and amplified by means of a PCR reaction. After strand separation followed the next round of selection. For strand separation, the dsDNA was denatured by NaOH addition and the aptamer strand was was coupled from the complementary template strand with the help of magnetic Dynabeads ^® to which streptavidin separately. The corresponding reverse primer was previously biotinylated. The resulting ssDNA was neutralized by a defined amount of HCl. After 13 rounds, the

enriched library is cloned and sequenced. The ssDNA output library Dl had the following basic structure:

5'-G; CTGT GTGAGCCTCCTAAC-N60-CATGCTTATTCTTGTCTCCC-3 '

The sequence of ssDNA library Dl was characterized by a randomized region of 60 nucleotides flanked by 21 and 20 nucleotide constant regions at both the 3 'and 5' ends. The constant regions were used for attachment of the PCR primer.

In the first round of selection, a defined amount of DNA starting library Dl (500 pmol) directly with the immobilized on Dynabeads ^® sIL-6R (480 nmol) in lx

Selection buffer B (lx PBS (0.137 M NaCl, 2.7 mM KCl, 6.5 mM Na ₂ HP0 ₄ , 15 mM KH ₂ PO ₄ ); 3 mM MgCl ₂ ; pH 7.4) for 30 min at room temperature (RT ). The DNA molecules binding to the target were separated from non-binding molecules by magnetic separation, the supernatant discarded, and the DNA-target complexes washed once with 100 μl of selection buffer B (see above). The elution of binding nucleic acids was carried out after careful resuspension in 55 μΐ aqua dest. under heat at 80 ° C for 3 min. This eluate was subjected directly to a PCR without further purification steps. The success of the PCR was monitored by PAGE (10% native polyacrylamide (PAA) gel). The number of washing steps after separation of the non-binding DNA molecules was increased up to 12 with increasing number of selection rounds. After thirteen rounds, the

Selection finished. The dsDNA library obtained after the final round 13 was cloned into the vector pUC19 (New England BioLabs, Beverly, Mass., USA) and positive clones were subsequently sequenced. Sequencing gave the following five aptamer sequences: aptamer SEQ ID NO:

13-5 13

13-11 14

13-15 15

13-27 16

13-32 17

The sequences given include both the 60 nucleotide randomized region and the flanking 5 'and 3' primer regions. The number before the hyphen indicates the selection round (13). The aptamer. 13-27 includes the known sequence motif (G ₃ T) ₄ .

2. Characterization and analysis of the aptamer-sIL-6R interaction

To study the interaction of the enriched DNA library with the

Target molecule sIL-6R and to determine dissociation constants (Kj values), filter binding studies were performed under radioactive conditions. In addition, gel-shift studies using polyacrylamide gel electrophoresis (PAGE) as well as

Competition studies carried out using the filter binding technique. 2.1 Analytical Filter Binding Studies

The study of aptamer-protein interactions and the determination of

Dissociation constants (Kd values) were carried out by means of filter binding studies. For this purpose, a constant amount (<0.2 nM) of radiolabeled DNA (the labeling was carried out by incorporation of γ- [ ³² Ρ] -ΑΤΡ (0, 1 μθϊ / μΐ, 100 nM) using the T4 polynucleotide kinase) with increasing concentrations (up to 1000 nM) of protein for 45 min at 37 ° C incubated. Unless otherwise stated, the lx selection buffer B (lx PBS (0.137 M NaCl, 2.7mM KCl, 6.5mM Na ₂ HP0 ₄ , 15mM KH ₂ PO ₄ ); 3mM MgCl ₂ ; pH 7.4). A nitrocellulose membrane was pretreated for 15 minutes with KOH to reduce unspecific DNA binding, clamped in a 96-well-dot blot apparatus (Schleicher & Schull) and washed twice with 200 μl of selection buffer B under vacuum.

The reactions were filtered through the nitrocellulose membrane. DNA molecules binding to the protein were retained on the membrane. Non-binding DNA molecules were removed by washing four times with lx selection buffer B. The

The nitrocellulose membrane was dried and the amounts of radioactively labeled substances remaining on the membrane were quantified using a phosphorimager (BioRad). The evaluation of the data obtained was carried out using the software Quantity One ^® (BioRad). For the plot of binding curves the program GraphPad Prism® (GraphPad Software, Inc., USA) was used. The dissociation constant (K _< j) was determined according to a one-site-binding model based on the following equation:

B

DNA max * C protein

bound

K _d + c protein wherein Bmax is the maximum possible proportion of bound DNA. For the five aptamers 13-5, 13-11, 13-15, 13-27, and 13-32 (SEQ ID NO: 13-17), binding to the sIL-6R was analyzed (see Figure 1). The amount of radioactively labeled nucleic acids remaining on the nitrocellulose membrane was quantified as described above and used to determine the dissociation constants. Filter binding studies showed that all DNA aptamers tested were able to bind their target molecule in solution and had similar binding properties. The determined associated dissociation constants were approximately on the order of magnitude (see Table 1). Table 1: Binding properties of aptamers 13-5, 13-11, 13-15, 13-27 and 13-32.

The dissociation constants (K _< i) and the proportion of maximally bound DNA, determined in three independent filter binding studies, are shown. Aptamer SEQ ID NO: Proportion of maximal binding [%] K _< j [nM] number of studies

13-5 13 73.5 1163 3

13-11 14 88.5 507 3 -

13-15 15 100 434 3

13-27 16 69.5 284 3

13-32 17 100 472 3

The aptamers 13-15 (SEQ ID NO: 15) and 13-27 (SEQ ID NO: 16) were further examined in the following. For this purpose, filter binding studies were carried out, again the binding to SIL-6R, but also the binding to Hyper-IL6 was investigated. Hyper-IL-6 is a bioactive fusion protein of IL-6 and slL-6R, both of which

Interaction partners are connected to each other via a flexible polypeptide linker. This linker is composed of the 16 N-terminal non-helical amino acids of IL-6 and thirteen other amino acids, predominantly glycine and serine. In order to minimize the size of this fusion protein, the N-terminal immunoglobulin-like domain Dl and the C-terminus of the sIL-6R have been omitted, since both are not suitable for the

Bioactivity of the IL 6 / sIL-6R complex (Fischer, M., et al., I. A bioactive designer cytokines for human hematopoietic progenitor cell expansion, Nat Biotechnol, 1997. 15 (2): pp. 142-5 ) so that only amino acids 113-323 of sIL-6 were used in the fusion protein. This results in a 408 amino acid fusion protein with a

Molecular weight of about 57 kDa (see Fig. 2).

Seven independent filter binding studies on the binding of aptamer 13-15 to sIL-6R revealed an average percentage of maximal binding (BMAX) of 76.4% and one

average dissociation constant K _< j of 381 nM. At six independent

Filter binding studies on the binding of aptamer 13-15 to hyper-IL6 resulted

average percentage of maximal binding (BMAX) of 35.8% and an average dissociation constant K _< i of 167 nM. In the case of aptamer 13-27 resulted in the Binding to sIL-6R values for BMAX of 100% and for K _< i of 331 nM (7 parallels), for binding to hyper-IL6 values for BMAX of 22.6% and for K _d of 388 nM (3 parallels)

To investigate the specificity of the aptamer-proteme interaction, the aptamers 13-15, 13-27 and 13-32 filter binding studies with two control proteins, IL6 and

CEACAMl, a cell adhesion molecule that carries a C-terminal His tag analogously to sIL-6R. No binding of the aptamer to IL-6 or CEACAM1 could be detected (see Fig. 3). In contrast, a markedly concentration-dependent binding of the aptamers to the sIL-6R was observed (see Fig. 3 B, top).

Further filter binding studies were performed on fragments of the isolated DNA aptamers. By way of example, the aptamers 13-15 (SEQ ID NO: 15) and 13-27 (SEQ ID NO: 16) were used for this purpose. The following fragments were examined for their binding properties:

13-15_SeqA (60 nucleotides, see SEQ ID NO: 10)

CTTCAACGTACTCCCGGGGGTTTGGGTGGGTGGGTATCGGGAGTAGGCCGCAACTG CCTG 13-15_SeqB (35 nucleotides, see SEQ DD NO: 18)

ACTCCCGGGGGTTTGGGTGGGTGGGTATCGGGAGT

13-15_SeqC (71 nucleotides, see SEQ ID NO: 19)

GT GTGAGCCTCCTAACCTTCAACGTACTCCCGGGGGTTGGGTGGGTGGGTATCGGGAGTAGGCCGCAAC

13-15_SeqD (19 nucleotides, see SEQ ID NO: 20)

GGGGGTTTGGGTGGGTGGG 13-15_SeqDl (18 nucleotides, see SEQ DD NO: 21)

GGGTTTGGGTGGGTGGGT

13-27_SeqA (60 nucleotides, see SEQ ID NO: 11) GAAGGACACGGTTTAGGGGTGGGTGGGTGGGTAGCTACCGGTGCCTTGGTTGGGG GTGGG

13-27_SeqB (60 nucleotides, see SEQ ID NO: 22)

CCTAACGAAGGACACGGTTTAGGGGTGGGTGGGTGGGTAGCTACCGGTGCCTTGGT TGGG

13-27_SeqC (34 nucleotides, see SEQ ID NO: 23)

ACGGTTTAGGGGTGGGTGGGTGGGTAGCTACCGG

13-27_SeqD (16 nucleotides, see SEQ DD NO: 6)

GGGTGGGTGGGTGGGT

13-5 / 32_SeqD (16 nucleotides, see SEQ DD NO: 5)

GGGTGGGCGGGTGGGT

13-1 l_SeqD (17 nt, see SEQ ID NO: 24)

GGGTTGGGTGGGTGGGT The sequence of fragment 13-27_SeqD corresponds to the known DNA aptamer (G ₃ T) ₄ .

The results of the filter binding studies are shown in Table 2:

Table 2 Binding properties of fragments of aptamers 13-15 and 13-27.

The dissociation constants (K _< j) and the proportion of maximal bound DNA (BMAX) determined in the specified number of independent filter binding studies are shown. Target protein was Hyper-IL6.

Aptamer fragment SEQ TD NO: BMAX [%] Kd tnM] Number of studies

13-15_SeqA 10 35.5 343 4

13-15_SeqB 18 61 1310 4

13-15_SeqC 19 26,7 252 4

13-15_SeqD 20 55.3 1639 3 13-15_SeqDl 21 93.7 418 8

13-27_SeqA 11 30.4 848 3

13-27_SeqB 22 97.8 1100 3

13-27_SeqC 23 100 5553 3

13-27_SeqD 6 31,9 221 5

13-5 / 32_SeqD 5 27.4 204 4

13-l l_SeqD 24 32.9 458 4

Still further filter binding studies were performed with modified DNA aptamer fragments. For this purpose, the following fragment variants of the DNA aptamer 13-27 were used:

13-27_SeqD + Tl (16 nucleotides, see SEQ TD NO: 25)

TGGGTGGGTGGGTGGG

13-27_SeqD + TlT16 (17 nucleotides, see SEQ TD NO: 26)

TGGGTGGGTGGGTGGGT

13-27_SeqD-T (15 nucleotides, see SEQ TD NO: 27)

GGGTGGGTGGGTGGG

13-27_SeqD-T4A (16 nucleotides, see SEQ ID NO: 28)

GGGAGGGTGGGTGGGT 13-27_SeqD-T8A (16 nucleotides, see SEQ TD NO: 29)

GGGTGGGAGGGTGGGT

13-27_SeqD-T12A (16 nucleotides, see SEQ TD NO: 30)

GGGTGGGTGGGAGGGT

13-27_SeqD-T16A (16 nucleotides, see SEQ ID NO: 31)

GGGTGGGTGGGTGGGA 13-27_SeqD-A (16 nucleotides, see SEQ ID NO: 32)

GGGAGGGAGGGAGGGA In the variants 13-27_SeqD-T4A, 13-27_SeqD-T8A, 13-27_SeqD-T12A, 13-27_SeqD-T16A and 13-27_SeqD-A, thymine bases have been replaced by adenine bases, with variants 13-27_SeqD-T4A, 13 -27_SeqD-T8A, 13-27_SeqD-T12A and 13-27_SeqD-T16A each a single TA exchange at different locations, ie at positions 4, 8, 12 and 16, respectively, whereas in variant 13-27_SeqD-A all thymidine nucleotides were exchanged for adenine nucleotides.

The results of the filter binding studies are shown in Table 3:

Table 3 Binding properties of modified fragments of aptamer 13-27.

The dissociation constants (IQ) and the proportion of maximal bound DNA (BMAX) determined in the specified number of independent filter binding studies are shown. Target protein was Hyper-IL6.

Aptamer Fragment SEQ ID NO: BMAX [%] K _d [nM] Number of Studies 13-27_SeqD + Tl 25 42.6 1969 4

13-27_SeqD + TlT16 26 - - 5

13-27_SeqD-T 27 48.7 146 3

13-27_SeqD-T4A 28 17 504 3

13-27_SeqD-T8A 29 55,4 285 3

13-27_SeqD-T12A 30 36.1 191 3

13-27_SeqD-T16A 31 33.6 914 3

13-27_SeqD-A 32 76.7 2604 3

The results show that the fragments or fragment variants also specifically bind the sIL-6R. The fragment 13-27_SeqD-A, which was provided at the positions 4, 8, 12 and 16 respectively adenine instead of thyrnine nucleotides, showed a comparatively bad tie up. The fragment 13-27_SeqD + TlT16 also tied badly.

Reliable values for BMAX and K _< j could not be determined.

2.2 Analysis of aptamer-protein interactions by gel-shift

For further analysis of the specific aptamer-sIL-6R interaction, gel shift experiments were carried out by way of example with the aptamer 13-15 (SEQ ID NO: 15) and the fragment 13-15_SeqDl (SEQ ID NO: 21). For this purpose, the radiolabeled aptamer 13-15 and 13-15_SeqDl with increasing amounts of Hyper-IL6 in lx selection buffer B (lx PBS (0.137 M NaCl, 2.7 mM KCl, 6.5 mM Na ₂ HP0 ₄ , 15 mM KH ₂ P0 ₄ ); 3 mM MgCl ₂ ; pH 7.4). The separation of the aptamer-protein mixtures was carried out via a 5% native polyacrylamide ^ AA) gel by means of polyacrylamide gel electrophoresis (PAGE). Due to their size, aptamer-protein complexes formed under native conditions have a delayed migration behavior in the gel. The complexes therefore migrate more slowly than the corresponding free DNA molecules and are therefore detectable as so-called "shift" in the gel.

Equal amounts of [ ³² P] radiolabelled DNA were incubated with increasing amounts of protein (0-1000 nM Hyper-IL6) in lx selection buffer B (see above) for 45 min at 37 ° C. Samples were spiked with 6x DNA sample buffer (50% (w / v) sucrose, 1% (w / v) SDS, 0.1% (w / v) orange G) and native PAGE using a 5% PAA gels (lx TBE (89mM Tris-HCl, 89mM boric acid, 2mM EDTA); Acrylamide: bisacrylamide 37.5: 1 5% (w / v); TEMED (, N, NN ^, -tetamethyl-e-lecl amine ) 0.1% (v / v); APS (ammonium persulfate) 0.1% (w / v)). The electrophoretic separation was carried out at 80 V and 4 ° C in lx TBE. After completion of the electrophoresis, the gel was dried by applying a vacuum. The radioactive bands were detected by autoradiography.

The specific binding of the DNA to the target molecule (Hyper-IL6) slowed the running behavior compared to the aptamer alone by formation of the aptamer-protein complexes. These complexes were revealed in the gel as a so-called "shift." By means of

Autoradiography could be visualized the resulting bands. The aptamer 13-15 and the aptamer fragment 13-15_SeqDl clearly showed an interaction with hyper-IL6, whereby a concentration-dependent signal was observed (not shown).

2.3 Competition studies

In in vitro competition studies, the interaction between selected D A aptamers and sIL-6R was studied in the presence of its natural ligands IL-6 and gpl30 as well as of hyper-IL-6. For this purpose, the radiolabelled "full length" DNA aptamers 13-15 (SEQ ID NO: 15) and 13-27 (SEQ ID NO: 16) and the fragments were used

13-15_SeqD1 (SEQ ID NO: 21) and 13-27_SeqD (SEQ ID NO: 6). It was found that none of the aptamers tested compete with IL-6 for binding to the receptor.

Sequence Listing - free text and translation of English terms

Artificial Sequence = artificial sequence

consensus sequence = consensus sequence

misc feature = other feature

Common sequence motif of DNA aptamers 13-5 and 13-32 = Common sequence motif of DNA aptamers 13-5 and 13-32

Fragment of DNA aptamer = fragment of the DNA aptamer

Variant of a fragment of DNA aptamer 13-27 = variant of a fragment of DNA aptamer 13-27

h is a, c or t = h is a, c or t

n is a, t, tt or ttt = n is a, t, tt or ttt

v is a, g or c = v is a, g or c

w is a or t = w is a or t

DNA aptamer = DNA aptamer

randomized region = randomized area

3 'primer region = 3' primer region

5 'primer region = 5' primer region

randomized region plus 5 'and 3' primer regions = randomized region plus 5 'and 3' primer regions

Claims

claims

A DNA aptamer which specifically binds the human soluble interleukin-6 receptor and comprises a sequence according to SEQ ID NO: 1, but excluding a sequence according to SEQ ID NO: 6.

DNA aptamer according to claim 1, characterized in that the DNA aptamer comprises one of the sequences according to SEQ ID NO: 2-5.

DNA aptamer according to one of the preceding claims, characterized in that the DNA aptamer one of the in SEQ ID NO: 8-12 or SEQ ID NO: 13-17

or a fragment thereof which specifically binds the human soluble interleukin-6 receptor.

DNA aptamer according to claim 3, characterized in that the fragment at least 15, preferably at least 16, 17, 18, 19 or 20, more preferably at least 25, 30, 35, 40, 45, 50 or 55 and particularly preferably at least 60 successive comprises the following nucleotides of the sequences given in SEQ ID NO: 8-12 or SEQ ID NO: 13-17.

DNA aptamer according to claim 4, characterized in that the fragment comprises at least one of the sequences according to SEQ ID NO: 1-5.

DNA aptamer according to one of the preceding claims, characterized in that the DNA aptamer has the sequence according to one of SEQ ID NO: 18-32.

7. A DNA aptamer according to any one of the preceding claims, characterized in that the DNA aptamer non-competitively binds to the human soluble interleukin-6 receptor.

8. A pharmaceutical composition comprising a DNA aptamer according to any one of claims 1 to 7.

9. Use of a DNA aptamer according to any one of claims 1 to 7 for the manufacture of a medicament or a diagnostic agent.

10. Use of a DNA aptamer according to any one of claims 1 to 7 for the manufacture of a medicament for the treatment of inflammatory conditions, cancer or infections.

11. Use according to claim 9 or 10, characterized in that the medicament is intended for the treatment of rheumatoid arthritis, sepsis, asthma, Crohn's disease, multiple sclerosis, depression, breast cancer, multiple myeloma or HIV infection.

12. Use of a DNA aptamer comprising the sequence of SEQ ID NO: 6, SEQ DD NO: 11 or SEQ ID NO: 16 for the manufacture of a medicament for the treatment of inflammatory conditions or cancer.