DE102009056944A1 - RNA aptamers that specifically bind the soluble interleukin-6 receptor - Google Patents

Abstract

The invention relates to a target molecule specific binding aptamers. The object of the invention is to provide diagnostic and / or therapeutic agents for use in the detection and / or prevention or treatment of inflammatory processes, cancers and infections. To accomplish this task provides the RNA aptamers that specifically bind the human soluble interleukin-6 receptor (sIL-6R).

Description

The invention relates to aptamers which specifically bind a target molecule.

It is known that cytokines, for example interleukins such as interleukin-6 (IL-6), play an important role in the information transfer between different cells of an organism. The biological effect of cytokines on the target cells is mediated by specific, usually membrane-bound receptors. The cytokine interleukin-6 (IL-6), for example, acts on a variety of different cells and plays a central role, especially in inflammatory processes. Cytokine IL-6 is known to be involved in a number of diseases, e.g. Inflammatory autoimmune diseases such as rheumatoid arthritis.

Of many membrane-bound cytokine receptors, soluble forms also exist which consist of the extracellular domains of the membrane-like forms and also possess the ability to bind ligand, albeit at a reduced affinity to the membrane-like form. Soluble receptors can neutralize ligands, for example, by virtue of their comparatively high concentration, and in this way act antagonistically. For the soluble receptors of some cytokines but also an agonistic effect is described. In the case of the soluble interleukin-6 receptor (sIL-6R), for example, the complex of IL-6 and sIL-6R causes a dimerization of the membrane-bound gp130 ( Tags, T. et al. (1989), Cell, 58, 573-581 ; Mackiewicz, A. et al. (1992) J. Immunol., 149, 2021-2027 ; Scheller and Rose-John, Med. Microbiol. Immunol. (2006), 195, 173-183 ; Rose-John et al., (2006), JJ Leukocyte Biol. 80, 227-235 ; Jones et al. (2001), The FASER Journal 15, 43-57 ), which initiates signal transduction. Unlike the membrane-bound IL-6 receptor, gp130 is found in almost all organs, e.g. Heart, kidneys, spleen, liver, lung, placenta, and brain (e.g. Saito, M. et al. (1992 J. Immunol., 148, 4066-4071 ). In the presence of sIL6-R, the interleukin-6 can therefore also act on cells which do not express the membrane-bound interleukin-6 receptor but the glycoprotein gp130 ( Hirota, H. et al., (1995) Proc. Natl. Acad. Sci. USA, 92, 4862-4866 ).

Because of the importance of cytokines outlined above, attempts have been made in the prior art to influence disease progression by targeted inhibition of cytokine receptors. One approach is, for example, the use of antibodies against cytokine receptors. Tocilizumab (Actemra ^®) is for example a monoclonal antibody, which is currently used for the treatment of rheumatoid arthritis. Tocilizumab (Actemra ^® ) exerts its action via the blockade of the human IL-6 receptor, thereby preventing the binding of IL-6 to the receptor and a resulting inflammatory response.

However, the use of antibodies is often associated with undesirable side effects. The most common adverse events associated with antibody treatment are infections, predominantly upper respiratory tract infections. In addition, a slight increase in liver function and lipid metabolism has often been observed in their use. Other side effects include gastrointestinal perforation, hypersensitivity reactions including anaphylaxis, headache and high blood pressure.

For some time, attempts have also been made to use so-called aptamers as therapeutic and diagnostic agents (see, for example, US Pat. Osborne et al. (1997), Curr. Opin. Chem. Biol. 1, 5-9 ). Aptamers are artificial DNA or RNA molecules that contain another molecule, e.g. As a protein can bind specifically. With high specificity and affinity as well as chemical stability, aptamers have low immunogenicity compared to antibodies. For example, aptamers can be selected by a method called SELEX (systematic evolution of ligands by exponential enrichment) ( Ellington and Szostak (1990), Nature 346, 818-822 ; Gopinath (2007), Anal. Bioanal. Chem. 387, 171-182 ; WO 91/19813 ).

However, despite the intensive efforts to date, there is still a great need for diagnostic and / or therapeutic agents for use in the detection and / or prevention or treatment of inflammatory processes, cancers and infections. The object of the present invention is to provide such means.

The problem is solved by the subject matter of claim 1 and the other independent claims. Advantageous embodiments of the invention are specified in the subclaims.

In a first aspect, the invention provides an RNA aptamer that specifically binds the human soluble interleukin-6 receptor. The soluble human interleukin-6 receptor (sIL-6R) shows 339 Amino acids (AS) has a molecular weight of about 50 kDa. The amino acid sequence of sIL-6R is shown in SEQ ID NO: 11. The amino acid sequence of the sIL-6R is identical to that of the extracellular domain of the membrane-bound interleukin-6 receptor (IL-6R), so that the invention of course also specifically binds the IL-6R. Any reference to the sIL-6R should therefore also include the IL-6R, unless expressly stated otherwise.

The RNA aptamer according to the invention is affine and specific for the human sIL-6 receptor and is unlikely or not immunogenic. It provides a promising means to treat or prevent diseases involving the soluble IL-6 receptor. It is also simple and inexpensive to produce, durable and storable.

The RNA aptamer according to the invention can be used in a variety of ways to diagnose or influence states or diseases of humans in which IL-6 and / or the soluble and / or the membrane-bound interleukin-6 receptor are directly or indirectly involved , It can be used, for example, to prepare a drug or diagnostic agent that can be used to diagnose, prevent and / or treat inflammatory conditions or diseases, cancers or infections. Examples of diseases in which the RNA aptamer according to the invention can be used include rheumatoid arthritis, sepsis, asthma, Crohn's disease, multiple sclerosis, depression, breast cancer, multiple myeloma and HIV infection.

The RNA aptamer according to the invention can also be used to introduce other molecules, for example peptides, proteins, oligonucleotides, dyes, diagnostic agents, etc. into a cell. For this purpose, these molecules are coupled to the RNA aptamer with the aid of techniques which are familiar to the person skilled in the art. The molecule coupled to the RNA aptamer according to the invention can then be introduced into the cell by means of the sIL-6R or the IL-6R and be released intracellularly. The molecules can also be biologically or medically active substances, so that the RNA aptamer can also have a function as part of a prodrug.

By an "RNA aptamer" is meant here an isolated single-stranded RNA (ssRNA) which is a target molecule, e.g. A protein, specifically binds. In particular, by the term "RNA aptamer", ssRNA oligonucleotides having at most 150, preferably at most 130, at most 110, at most 100, at most 90, at most 80, at most 70, at most 60, at most 50, at most 40, at most 30, at most 20 , at most 15 or at most 10 nucleotides understood.

By a "nucleotide" are here in particular the basic building blocks of nucleic acids, d. H. understood organic molecules consisting of a sugar residue, usually a pentose, z. As deoxyribose or ribose, an organic base (nucleobase) and phosphoric acid. The phosphoric acid is regularly linked to the sugar via an ester bond, the sugar to the nucleobase via an N-glycosidic bond. In deoxyribonucleic acid (DNA), the nucleobases adenine (A), cytosine (C), guanine (G) and thymine (T) regularly occur, while in ribonucleic acid (RNA) the base uracil (U) is substituted for thymine. The phosphoric acid is usually present in RNA and DNA as monophosphate. The linkage of nucleotides with one another usually takes place via a phosphodiester bond between the 5'-C atom of a pentose and the 3'-C atom of an adjacent pentose.

A "target molecule" is understood here preferably to be non-RNA and non-DNA molecules, for example proteins, peptides and glycoproteins. By "binding" is meant a bond that does not rely on the Watson-Crick pairing between nucleotides. It is preferably a non-covalent bond. An RNA aptamer which specifically binds the human sIL-6 receptor or a fragment thereof is understood to mean an RNA aptamer or RNA aptamer fragment which has a dissociation constant (IQ) of not more than 7 × 10 ^-6 M (mol / mol). l), preferably not more than 5 x 10 ^-6 M, preferably not more than 3 x 10 ^-6 M, preferably at most 2 x 10 ^-6 M, preferably not more than 10 ^-6 M, a maximum of 8 x 10 ^-7 M, more than 5 x 10 ^{- 7} M, a maximum of 3 × 10 ^-7 M, a maximum of 10 ^-7 M, a maximum of 8 × 10 ^-8 M, a maximum of 5 × 10 ^-8 M or a maximum of 3 × 10 ^-8 M has. In particular, an RNA aptamer or RNA aptamer fragment which specifically binds the human sIL-6 receptor is understood as meaning an RNA aptamer or RNA aptamer fragment which has a dissociation constant of at most 1000 nM (nmol / l), preferably at most 500 nM, more preferably at most 250 nM and particularly preferably at most 150 nM. When referring to dissociation constants herein, this preferably refers to averages of a magnitude determined using the one-site binding model described below using filter binding studies. As noted above, the notion of hsIL-6 receptor-specific binding also encompasses specific binding to the hIL-6 receptor, ie, the human IL-6 receptor in the membrane.

By a "diagnostic agent" is meant herein a product that can be used in a diagnostic procedure. The term also includes products, such as reagents or kits of reagents, with the aid of which outside of the human or animal body a certain state and / or the deviation from a normal state, eg. B. a different concentration sIL-6R, can be detected.

In a preferred embodiment, the RNA aptamer according to the invention comprises the nucleotide sequence ggkgnggcwguggwgwggg (SEQ ID NO: 1). The letters indicate the bases of the nucleotides in the usual coding: a = adenine, c = cytosine, g = guanine, u = uracil, n = any nucleotide, preferably a, c, g or u, k = g or u, w = a or u.

In further preferred embodiments, the RNA aptamer according to the invention comprises the nucleotide sequence ggkghggcwguggwgwggg (SEQ ID NO: 2), ggggnggcwguggwgwggg (SEQ ID NO: 3) or gggghggcwguggwgwggg (SEQ ID NO: 4). The letters k, n and w are as defined above, h is a, c or u. The sequence of SEQ ID NO: 2 differs from the sequence according to SEQ ID NO: 1 in that there is no g at position 5, the sequence of SEQ ID NO: 3 differs from the sequence according to SEQ ID NO: 1 in that that at position 3 is a g, and the sequence of SEQ ID NO: 4 differs from the sequence according to SEQ ID NO: 1 in that at position 3 is a g and at position 5 no g.

In a further preferred embodiment, the RNA aptamer according to the invention comprises one of the sequences given in SEQ ID NO: 5-10 or SEQ ID NO: 13-18 or a fragment thereof which specifically binds the human soluble interleukin-6 receptor. One or more, possibly also all bases of the nucleotides of the RNA aptamer or of the RNA aptamer fragment can be modified. This may be advantageous, for example, to reduce the sensitivity to nucleases in vivo, to improve uptake into the cell or to prevent rapid renal absorption. The modification may be, for example, that the 2'-OH group of a nucleotide base is replaced by a fluoro, amino or methoxy group. Advantageously, in a purine base, the 2'-OH group is replaced by a methoxy group, in a pyrimidine base by a fluoro or amino group. Other modifications are possible and within the skill of the artisan.

The RNA aptamer according to the invention can also be combined with other compounds, eg. As cholesterol or polyethylene glycol (PEG), coupled or multimerized, for example, to increase bioavailability, reduce degradation or excretion. For protection against attack by exonucleases, for example, a 3'-3'-dT cap (dT = deoxythymidine) may be provided at the 3 'end.

A fragment of an RNA aptamer according to the invention preferably comprises at least 14, 15, 16, 17, 18, 19 or at least 20, more preferably at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55 and particularly preferably 60 consecutive nucleotides of any of the sequences given in SEQ ID NO: 5-10 or SEQ ID NO: 13-18. In the case of SEQ ID NO: 13-18, the fragment may also comprise at least 70, 80, 90, 100 or 106 contiguous nucleotides. Particularly preferably, a fragment comprises at least one of the sequences according to SEQ ID NO: 1-4. Examples of fragments within the meaning of the present invention are given in the sequences with SEQ ID NO: 19-21.

In a preferred embodiment, the aptamer of the present invention non-competitively binds to human sIL-6R. This does not affect the binding of interleukin 6 (IL-6) to the sIL-6R. Optionally, however, the signal transduction can be modified or prevented. This can be effected, for example, by attaching the gp130 or else the IL6 sterically or otherwise by means of an antibody directed against the RNA aptamer or, for example, by a molecule coupled to the RNA aptamer, e.g. As a peptide, a nucleic acid or another compound is hindered. Another possibility is, for example, that the bound to the receptor aptamer in turn by a binding molecule, eg. As a directed against the aptamer antibody is bound. In this case, an indirect mechanism can also be used so that, for example, a molecule coupled to the RNA aptamer (eg biotin or an antigen) is bound by another molecule (eg avidin or an antibody). It may also be advantageous in diagnostic methods if the RNA aptamer binds non-competitively to the sIL-6R.

In another aspect, the present invention provides a pharmaceutical composition comprising an aptamer according to the invention. The pharmaceutical composition moreover preferably comprises suitable carrier material, excipients and the like. Optionally, the drug may also have one or more others Contain active ingredients. The active compounds can also be coupled to the RNA aptamer, ie, covalently or noncovalently bound. Suitable formulations and dosage forms are known to those skilled in the art or may be routinely prepared according to the prior art. The aptamers according to the invention can, for example, also be bound to nanoparticles which are loaded with other active substances, thereby allowing a targeted delivery of the active substances.

In a further aspect, the invention also relates to the use of an aptamer according to the invention for the manufacture of a medicament, as indicated above, preferably a medicament for the treatment of a condition or disease which is associated with non-normal levels of sIL-6R in body fluid, e.g. As blood, or is associated with a deviating from the normal state occurrence of IL-6R, or a diagnostic agent, eg. For example, to diagnose a disease associated with non-normal levels of sIL-6R in body fluid, e.g. As blood, or are associated with a non-normal occurrence of IL-6R. The drug is preferably for the treatment of inflammatory conditions, cancer or infections, eg. Rheumatoid arthritis, sepsis, asthma, Crohn's disease, multiple sclerosis, depression, breast cancer, multiple myeloma, or HIV infection.

The invention is explained in more detail below with reference to embodiments and the accompanying figures for illustrative purposes.

1 Binding of aptamer 16-3 to the target molecule sIL-6R. The proportion of bound RNA aptamer 16-3 (in%) was determined at defined sIL-6R concentrations in filter binding studies and plotted as a function of the sIL-6R concentration (logarithmic plot). The measurement points and error bars shown result from the averages and standard deviations of ten independent studies. The dissociation constants were calculated using a one-site binding model.

2 Gel-shift assay to analyze the interaction between aptamer 16-3 and sIL-6R. The interaction of radioactively labeled aptamer 16-3 with increasing concentrations of sIL-6R (0 nM-300 nM) was detected by gel-shift assay (5% native PAA gel).

3 Gel shift assay to analyze the specific interaction between aptamer 16-3 and the target molecule sIL-6R using two control proteins. The aptamer 16-3 was tested for interaction with the control proteins CEACAM1 (lanes 2-5: 10 nM-300 nM) and lysozyme (lanes 7-10: 10 nM-300 nM) by gel shift assay in a 5% assay , native PAA gel analyzed. The positive control used was an approach with sIL-6R (75 nM, lane 6).

4 Gel-shift analysis of the specific interaction between aptamer 16-3 and the target molecule sIL-6R with associated controls. In addition to the interaction of the labeled aptamer 16-3 (<1 nM, lanes 1 and 5) with the sIL-6R (75 nM, lanes 2 and 6), additional competition between labeled and unlabelled aptamer (lanes 3 and 7) and labeled aptamer and unlabeled control RNA R24 (lane 8). Lane 4 shows the binding of an anti-His-AK to sIL-6R aptamer complexes, in lane 9 the interaction between aptamer and anti-His-AK. After incubation and gel electrophoresis (5%, native PAA gel;), the bands could be detected by autoradiography. The gels of two independent assays are put together.

5 Filter binding study of RNA aptamer 16-3 on sIL-6R in the presence or absence of IL-6. A: The protein sIL-6R was in increasing concentration (0-300 nM) with radiolabelled aptamer 16-3 in the presence of 740 nM IL-6 (+ IL-6) or in the absence of IL-6 (-IL- 6) and filtered. The amounts of labeled RNA remaining on the filter are illustrated. To calculate the percentage of bound RNA, a defined amount (125%) of RNA was applied to the membrane in each case. B: The proportion of bound RNA aptamer 16-3 (in%) at defined sIL-6R concentrations in the presence of 740 nM IL-6 (+ IL-6) or in the absence of IL-6 (-IL-6 ) was determined by filter binding studies and plotted (logarithmic plot). The dissociation constants were calculated using a one-site binding model. It was a double determination.

6 Gel shift assay to analyze a possible competition between aptamer 16-3 and IL-6 for binding to sIL-6R. The sIL-6R (75 nM) and the aptamer 16-3 (<1 nM) were tested for interaction in the presence of increasing concentrations of IL-6 (0 nM-150 nM). The separation of the aptamer-protein mixtures was carried out in 5% native PAA gel. Detection was by autoradiography.

7 The fusion protein Hyper-IL-6. Schematically shown is the hyper IL-6 fusion construct consisting of the N- and C-terminal truncated sIL-6R (AS 113-323) and IL 6, which are linked together via a flexible linker. Left amino acids are given in single letter code.

8th Gel shift study to analyze the interaction between aptamer 16-3 and the interaction partners Hyper-IL-6 and sgp130Fc. Hyper-IL-6 (lane 2), sgp130Fc (lane 3) and both proteins in mixture (lane 4) were incubated with radiolabeled aptamer 16-3 (<1 nM). After gel electrophoresis (5%, native PAA gel) and drying of the gel, the bands were detected by autoradiography.

9 Shortening aptamer 16-3 based on the predicted secondary structure using the mfold web server program. A. In addition to the secondary structure of the "wild type" aptamer 16-3 (SEQ ID NO: 17), the variants 16-3 A, 16-3_B and 16-3_C (SEQ ID NO 19-21) based thereon are abbreviated. B. RNA sequences of the truncated variants of the sIL-6R-specific aptamer 16-3 in the 5'-3 'direction.

10 Binding of aptamer 16-3 and truncated variants of sIL-6R. The proportion of bound RNA (in%) at defined sIL-6R concentrations was determined in filter binding studies and shown as a function of the sIL-6R concentration (logarithmic plot). The measurement points and error bars shown represent mean values and standard deviations from at least three independent studies. The dissociation constants were calculated using a one-site binding model.

11 Sequences of the truncated sIL-6R specific aptamer 16-3_B and mutant variants. Starting from the sIL-6R binding variant 16 3_B, guanine residues possibly involved in the consensus sequence (in 16_3_B in normal font size) were replaced by uracil residues (bold) at the G quartet. The mutation of G at position 15 characterizes variant 16 3_B_M1. In order to switch off the other four GG pairs, additional variants were created: 16 3_B_M2-16-3_B_M5. Subscript numbers exemplify the position of the individual bases.

12 Mutation analysis for the binding of aptamers 16-3, 16-3_B and five variants of hyper-IL-6. The proportion of relative RNA binding (in%) was determined at a defined sIL-6R concentration of 300 nM using filter binding studies. The measurement points and error bars shown represent mean values and standard deviations from two independent studies. The relative binding of the aptamer 16-3_B and the variants refers to the binding of the "wild-type" aptamer 16-3.

13 Gel shift assay for the analysis of variants of the aptamer 16-3_B. The analysis of the interaction between Hyper-IL-6 (330 nM) and the aptamer 16-3_B or its variants (16-3_B_M1-16-3_B_M5) was carried out by means of native PAGE (5% PAA gel). The detection of the bands was carried out by autoradiography.

Examples

1. In vitro selection of RNA aptamers using magnetic beads

For the selection of RNA aptamers, an in vitro selection process (SELEX) was designated as SELEX (Systematic Evolution of Ligands by Exponential Enrichment) ( Tuerk, C. and L. Gold, Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science, 1990. 249 (4968): pp. 505-10 ) used. In this process, iterative cycles of steps (1) incubation of a nucleic acid library with the target molecule, (2) separation of binding from non-binding nucleic acids and (3) amplification of binding species, ie an enrichment of binding nucleic acids.

At the beginning of the first round of selection was carried out incubating a RNA library high diversity (about 10 ¹³ different molecules) with the on magnetic particles (Dynabeads ^®) immobilized sIL-6R (the amino acid sequence of sIL-6R see SEQ ID NO: 11) soluble variant of the membrane-bound interleukin-6 receptor (IL-6R). To immobilize the sIL-6R was biotinylated and subsequently immobilized via a biotin-streptavidin interaction on the surface of streptavidin-coupled Dynabeads ^®. The protein-coupled particles were used for aptamer selection. After separation of non-binding nucleic acids by means of magnetic separation and washing steps, binding RNA species were eluted by heating and amplified by means of an RT-PCR reaction. Subsequent T7 transcription formed the transition to the following round of selection. After about 6-20 of these iterative cycles, the enriched library was cloned and sequenced.

An RNA start library of sufficiently high sequence diversity was produced. A synthetically prepared ssDNA library R1 (Metabion, Munich) served as the basis for this. The ssDNA library R1 had the following basic structure:

ermöglichte, die im SELEX-Verfahren eingesetzt wurde.The sequence of the ssDNA library R1 was characterized by a randomized region of 60 nucleotides flanked by 47 and 21 nucleotide constant regions at both the 3 'and 5' ends. These were used to attach two complementary oligonucleotides, the T7 primer R1 and the RT primer R1, to create a library of dsDNA molecules with a length of 128 base pairs (bp). The T7 primer region included the sequence of the T7 promoter (TAATACGACTCACTATAGG), which served as the recognition sequence of the T7 RNA polymerase, and transcribed the dsDNA into the ssRNA start library (106 nt, (~ 3.6 x 10 ¹³ molecules ) with the basic structure

which was used in the SELEX process.

After each selection cycle, the eluted RNA molecules were transcribed into cDNA after addition of the RT primer R1 by means of reverse transcription and filled in a subsequent PCR to dsDNA and amplified.

In the first round of selection, a defined amount of starting RNA library R1 (500 pmol) directly with the immobilized on Dynabeads ^® sIL-6R (100 pmol) in 1 × selection buffer B (1 X PBS (0.137 M NaCl, 2.7 mM KCl , 6.5 mM Na ₂ HPO ₄ , 15 mM KH ₂ PO ₄ ), 3 mM MgCl ₂ , pH 7.4) for 30 min at room temperature (RT). The RNA molecules binding to the target were separated from non-binding molecules by magnetic separation, the supernatant was discarded, and the RNA-target complexes were washed once with 100 μl of 1 × selection buffer B. The elution of binding nucleic acids was carried out after careful resuspension in 55 μl of distilled water. under heat at 80 ° C for 3 min.

This eluate was subjected directly to RT-PCR without further purification steps. The success of RT-PCR was monitored by PAGE (10% native polyacrylamide (PAA) gel). From the second round of selection, the RT-PCR product was directly subjected to in vitro T7 transcription using T7 RNA polymerase. Without further purification, 20 ul of the transcription reaction were incubated with the immobilized on Dynabeads ^® sIL-6R. After separation of non-binding RNA molecules, the beads were washed twice with 100 .mu.l of 1 × selection buffer B, with increasing the number of washing steps increased to four with increasing round of selection. After sixteen rounds, the selection was ended.

The dsDNA library of selection round 9 as well as the final round 16 were according to the manufacturer in the vector pCR ^® 2.1-TOPO ^® TA Cloning ^® Kit (Invitrogen). Subsequently, eight clones of the 9th round of selection and twelve clones of the 16th round of selection were sequenced. Sequencing revealed the following six aptamer sequences: aptamer SEQ ID NO: 9-5 13 9-6 14 16-1 15 16-2 16 16-3 17 16-8 18

The sequences given include both the 60 nucleotide randomized region and the flanking 5 'and 3' primer regions except for the T7 promoter sequence (TAATACGACTCACTATAGG), which contains only the two terminal G nucleotides. The number in front of the hyphen indicates the selection round (9 or 16).

2. Characterization and analysis of the aptamer-sIL-6R interaction

To study the interaction of the enriched RNA library with the target molecule sIL-6R and to determine dissociation constants (K _d values), filter binding studies were performed under radioactive conditions. In addition, gel-shift studies were performed by polyacrylamide gel electrophoresis (PAGE) and competition studies using the filter binding technique.

2.1 Analytical Filter Binding Studies

The study of aptamer-protein interactions and the determination of dissociation constants (Kd values) were performed using filter binding studies. A constant amount (<1 nM) of radioactively labeled RNA (labeled by incorporation of α- [ ³² P] -ATP (0.1 μCi / μl, 100 nM) during T7 transcription) was used with increasing concentrations ( 1 nM to 300 nM) to protein for 20 min at RT. Unless otherwise stated, the buffer used was the 1 × selection buffer B (1 × PBS (0.137 M NaCl, 2.7 mM KCl, 6.5 mM Na ₂ HPO ₄ , 15 mM KH ₂ PO ₄ ), 3 mM MgCl 3 ₂ , pH 7.4). A nitrocellulose membrane was pretreated for 10 min with aminohexanoic acid buffer (20% methanol, 40 mM aminohexanoic acid (C ₆ H ₁₃ NO ₂ )), clamped in a 96-well dot blot apparatus (Schleicher & Schull) and washed twice under vacuum 200 .mu.l of 1 × selection buffer B washed.

wobei B_max den maximal möglichen Anteil gebundener RNA darstellt.The reactions were filtered through the nitrocellulose membrane. Protein binding RNA molecules were retained on the membrane. Non-binding RNA molecules were removed by washing four times with 1X Selection Buffer B. The nitrocellulose membrane was dried and the amounts of radioactively labeled substances remaining on the membrane were quantified using a phosphorimager (BioRad). The evaluation of the data obtained was carried out using the software Quantity One ^® (BioRad). To graph the binding curves GraphPad Prism ^® program (GraphPad Software, Inc., USA) was used. The dissociation constant (K _d ) was determined according to a one-site binding model based on the following equation:

where B _{max represents} the maximum possible proportion of bound RNA.

For the four aptamers 16-1, 16-2, 16-3 and 16-8 (SEQ ID NO: 15-18) binding to the sIL-6R was analyzed. For the aptamer 16-3 (SEQ ID NO: 17) is exemplified the result of the study in 1 shown. The amount of radioactively labeled nucleic acids remaining on the nitrocellulose membrane after carrying out the binding study was quantified as described above and used to determine the dissociation constants.

Using the filter binding studies it could be shown that all investigated RNA aptamers could bind their target molecule in solution and show similar binding properties. The determined associated dissociation constants were approximately on the order of magnitude (see Table 1).

Table 1: Characteristics of aptamers 16-1, 16-2, 16-3 and 16-8. The dissociation constants (K _d ) and the proportion of maximally bound RNA, determined in each case in two (16-1, 16-2, 16-8) and ten (16-3) independent filter binding studies, are shown. aptamer SEQ ID NO: Proportion of maximum binding [%] K _d [nM] Number of studies 16-1 15 61.4 125 ± 32 2 16-2 16 74.5 420 ± 290 2 16-3 17 47.9 ± 2.8% 19.8 ± 4.2 10 16-8 18 68.2 106 ± 47 2

The aptamer 16-3 exhibited a very affinity binding to the sIL-6R with a significantly lower dissociation constant (IQ). The maximum amount of RNA binding to the sIL-6R is given for each aptamer in Table 1. Since the RNA was present in clear deficit to study the interaction between RNA and protein, it is assumed that a maximum of one RNA molecule bound per sIL-6R.

2.2 Analysis of aptamer-protein interactions by gel-shift

For further analysis of the specific aptamer-sIL-6R interaction, gel-shift experiments were carried out by way of example with the aptamer 16-3 (SEQ ID NO: 17). To this end, the radiolabeled aptamer 16-3 was treated with increasing amounts of recombinant sIL-6R (0 nM-300 nM) in 1 × selection buffer B (1 × PBS (0.137 M NaCl, 2.7 mM KCl, 6.5 mM Na ₂ HPO ₄ , 15 mM KH ₂ PO ₄ ); 3 mM MgCl ₂ ; pH 7.4). The separation of the aptamer-protein mixtures was carried out via a 5% native polyacrylamide (PAA) gel by means of polyacrylamide gel electrophoresis (PAGE). Due to their size, aptamer-protein complexes formed under native conditions have a delayed migration behavior in the gel. The complexes therefore migrate more slowly than the corresponding free RNA molecules and are therefore detectable as so-called "shift" in the gel.

Equal amounts (~ 1 nM) of α- [ ³² P] radiolabelled RNA were incubated with increasing amounts of protein (1 nM-300 nM) in 1 × selection buffer B (see above) for 30 min at RT. Samples were spiked with 6X DNA sample buffer (50% w / v sucrose, 1% w / v SDS, 0.1% w / v Orange G) and purified by native PAGE using a 5% PAA gel (1 × TBE (89 mM Tris-HCl, 89 mM boric acid, 2 mM EDTA); acrylamide: bisacrylamide 37.5: 1 5% (w / v); TEMED (N, N, N ', N 'Tetramethylethylenediamine) 0.1% (v / v); APS (ammonium persulfate) 0.1% (w / v)). The electrophoretic separation was carried out at 80 V and 4 ° C in 1 × TBE. After completion of the electrophoresis, the gel was dried by applying a vacuum. The radioactive bands were detected by autoradiography.

The specific binding of the RNA to the target molecule slowed the running behavior compared to the aptamer alone by formation of the aptamer-protein complexes. These complexes were evident in the gel as a so-called "shift". By means of autoradiography the resulting bands could be visualized (s. 2 ).

The aptamer 16-3 clearly showed an interaction with the sIL-6R, since the gel showed a "shift" caused by the complex formation (s. 2 ). The intensity of this slowed band increased with increasing sIL-6R concentration ( 2 , left to right). In the area of gel pockets, a concentration-dependent signal increase is also recognizable. Presumably this was the aptamer 16-3, which was complexed with precipitated sIL-6R.

To demonstrate that the interaction of the selected RNA aptamers was specific for the target molecule sIL-6R, a gel-shift experiment was performed under native conditions with two recombinantly-produced control proteins. These proteins were, on the one hand, CEACAM1, a cell adhesion molecule which carried a C-terminal His tag analogously to sIL-6R. The other protein was lysozyme, an enzyme that can cleave polysaccharides of prokaryotic cell walls. Both proteins should not interact with the sIL-6R specific ribonucleic acids.

To analyze the specificity, increasing amounts (10 nM-300 nM) of CEACAM1 ( 3 5.21, lanes 2-5) or lysozyme ( 3 , Lanes 7-10) were incubated with radiolabelled aptamer 16-3 (<1 nM) in 1 × selection buffer B (s.o) and separated on a 5% native PAA gel. The positive control used was an approach with 75 nM sIL 6R ( 3 , Lane 6). None of the control proteins examined showed any interaction with the RNA aptamer 16-3. In contrast, a complex formation between sIL-6R and the aptamer occurred, which was indicated by the shift ( 3 , Lane 6).

Evidence that the RNA-band retarded in their behavior was indeed due to a specific interaction between aptamer and sIL-6R was obtained by two additional gel-shift experiments (s. 4 ). In addition to the radiolabeled aptamer 16-3 ( 4 Lane 1 and Lane 5) complexed with sIL-6R (lane 2, lane 6) was added> 1000 fold molar excess of unlabelled aptamer (lane 3, lane 7). The labeled and unlabeled RNA molecules competed for binding to the soluble IL-6R, resulting in the weakening of the retarded band (competition). As a control, a competition between aptamer 16-3 and unlabelled non-specific RNA R24 (GGGAGGACGAUGCGGGAUUGUUGAGUGGUGCGAAACGCUUUUGCCCCACUUCGCGUCGGGCGAGUCGUCUG-3 ', SEQ ID NO: 12;> 1,000-fold molar excess) was examined (lane 8). This RNA did not induce attenuation of the aptamer-sIL-6R interaction.

To identify the protein bound by the aptamer further experiments were carried out with a specific anti-His antibody. Since the target protein sIL-6R carried a His tag, the antibody was able to bind the protein to His tag. The aptamer-protein-antibody complexes were carried through in the gel a supershift clearly, ie an even more delayed band compared to the aptamer-protein complex (lane 4). The anti-His antibody showed no interaction with the aptamer 16-3 alone ( 4 , Lane 9).

2.3 Competition studies

In in vitro competition studies, the interaction between the selected RNA aptamers and the sIL-6R was investigated in the presence of its natural ligands IL-6 and gp 130 as well as of hyper-IL-6.

2.3.1 Competition analysis between aptamer 16-3 and interleukin-6 (IL-6)

The ability of aptamer 16-3 (SEQ ID NO: 17) to compete with the natural ligand of sIL-6R, interleukin 6, to compete for a binding site was analyzed in filter binding studies performed as described above ( 5 ).

In the filter binding studies, the interaction of the sIL-6R with the aptamer 16-3 in the presence or absence of the ligand IL-6 was investigated. To determine the percent RNA binding, a defined amount of aptamer 16-3 (125%) was applied to the nitrocellulose membrane ( 5A ). Evaluation of this experiment showed that IL-6 had no appreciable effect on the interaction between aptamer 16-3 and sIL-6R. The determination of the respective dissociation constants led to comparable values.

The finding that there was no competition between aptamer 16-3 and IL-6 was checked by gel-shift assays. For this, the aptamer (<1 nM) was incubated with the sIL-6R (75 nM). Increasing amounts of ligand IL-6 (0-150 nM) as a competitor were added to the binding assays. The separation of the aptamer-protein complexes was carried out in the native PAA gel (see above). 6 clearly shows that, despite increasing IL-6 concentrations, the clear interaction between aptamer and sIL-6R was maintained, ie, the slowed-down aptamer-sIL-6R complexes were not disturbed. The aptamer 16-3 and IL-6 thus did not have the same binding site on the receptor.

In a second gel shift experiment, the concentration of IL-6 was increased to 1.5 μM. Also, this high ligand concentration had no influence on the aptamer bond.

2.3.2 Interaction of aptamer 16-3 with hyper-IL-6 (H-IL-6) and sgp130Fc

A possible competition between IL-6 and aptamer has also been demonstrated by analysis of the interaction between aptamer 16-3 (SEQ ID NO: 17) and Hyper-IL-6 (s. 7 ). Hyper-IL-6 is a bioactive fusion protein of IL-6 and sIL-6R, where both interaction partners are linked by a flexible polypeptide linker. This linker is composed of the 16 N-terminal non-helical amino acids of IL-6 and thirteen other amino acids, predominantly glycine and serine. In order to minimize the size of this fusion protein, the N-terminal immunoglobulin-like domain D1 and the C-terminus of the sIL-6R have been dispensed with since both are not required for the bioactivity of the IL 6 / sIL-6R complex ( Fischer, M., et al., I. A bioactive cytokine designer for human hematopoietic progenitor cell expansion. Nat Biotechnol, 1997. 15 (2): p. 142-5 ) so that only amino acids 113-323 of sIL-6 were used in the fusion protein. The result is a 408 amino acid fusion protein with a molecular weight of about 57 kDa (s. 7 ).

Furthermore, the influence of aptamer binding on the interaction between Hyper-IL 6 and sgp130Fc was investigated. Hyper-IL-6 as active form of the IL-6 / sIL-6R complex binds besides gp130 also its alternatively spliced, soluble form sgp130. By genetically fusing this protein with the constant portion of an IgG1 antibody, a highly active form of this receptor subunit was created: sgp130Fc (FIG. Scheller, J., Grötzinger, J., and Rose-John, Stefan, cytokine signals via soluble and membranous receptors. Biospektrum, 2007, 13th year: pp. 250-253 ; Jostock, T., et al., Soluble gp130 is the natural inhibitor of soluble interleukin-6 receptor trans-signaling responses. Eur J Biochem, 2001. 268 (1): pp. 160-7 ). This monomeric form dimerizes due to the respective Fc portion (~ 189 kDa).

A gel-shift experiment was used to study the interaction between Hyper IL 6 and aptamer 16-3. After incubation of Hyper-IL-6 with radiolabeled aptamer and electrophoretic separation by native PAGE, the bands could be detected by autoradiography ( 8th ). A clearly recognizable shift suggested an interaction ( 8th ; Lane 2). This confirms again that aptamer 16-3 interacts with the receptor at a region other than the IL-6 binding site.

In a further reaction, the binding of the aptamer to a complex of hyper-IL-6 and sgp130Fc was detected ( 8th ; Lane 4). An even more slowed-down band indicated a complex formation of all three interaction partners. The aptamer thus interacted with hyper-IL-6 at a region unequal to the sgp130Fc binding site. The aptamer did not interact with sgp130Fc alone ( 8th ; Lane 3).

In filter binding studies, a similar affinity for sIL-6R between aptamer 16-3 and hyper-IL-6 was confirmed.

3. Investigation of the binding activity of RNA aptamer fragments

Based on secondary structure predictions using the mfold web server ( Version 3.2, Zuker, M., Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Research, 2003. 31 (13): p. 3406-3415 ), the sequence of the aptamer 16-3 (SEQ ID NO: 17) has been shortened (see FIG. 9 ). First, the primer areas were removed. The aptamer was further shortened, with a G-rich consensus sequence (SEQ ID NO: 4) always being conserved.

First, aptamer 16-3 was truncated to a 19mer (16-3_A; SEQ ID NO: 19) which retained only the conserved, G-rich region of the aptamer. The truncated RNA 16-3_B (47 nt; SEQ ID NO: 20) contained, in addition to the G-rich region, the stabilizing, double-stranded region consisting of nine base pairs. The third truncated RNA, the 63mer 16-3_C (SEQ ID NO: 20), was characterized by the absence of the constant primer regions of the original sequence (the sequence contained three additional G nucleotides at the 5 'end of the randomized region of 60 nucleotides in length). ,

To analyze the binding properties of these truncated RNA molecules, filter binding studies were performed as described above (see FIG. 10 ). As based on the 10 As can be seen, all truncated RNAs showed binding to the target molecule sIL-6R. On this basis, this variant was chosen for further experiments to characterize the aptamer-sIL-6R interaction.

For variant 16-3_B a K _d value of about 26.4 nM (Table 2) could be determined. Despite a shortening of 59 nucleotides, the affinity of the 47mer 16-3_B was in the range of the "wild-type" aptamer. This significant shortening thus had no influence on the affinity for the receptor. Even the variant 16-3_A reduced to the G-rich region, which only consisted of 19 nucleotides, could bind the protein, but with reduced binding affinity (Kd ~ 446 nM) compared to 16-3. The absence of the primer regions in 16 3_C also weakened the affinity for the target protein (Kd ~ 117 nM). The values given for the aptamer variants 16 3_A and 16-3_C are only indicative, however, since the saturation range of the RNA-protein interaction required for the exact K _d determination is not complete at a maximum sIL-6R concentration of 300 nM could be achieved.

Table 2 K _d values and maximum binding ratios (B _max ) of aptamer 16-3 and truncated variants of sIL-6R determined in filter binding studies. Mean values and standard deviations were calculated from at least three independent measurements. aptamer SEQ ID NO: Kd [nM] Proportion of maximum binding [%] 16-3 17 19.7 ± 4.2 47.9 ± 2.8 16-3_A 19 446 ± 200 54.4 ± 16.4 16-3_B 20 26.4 ± 7.1 43.1 ± 3.4 16-3_C 21 117 ± 30 34.7 ± 4.0

In further experiments, mutation analyzes were carried out with the Aptamers 16-3_B to determine whether the guanine bases, which are conspicuously common in the consensus motif of aptamers, could possibly form the G-quadruplex structures stabilizing RNA molecules. The studies replaced important guanine bases possibly involved in the G-quartet with uracil. Within the consensus motif of the selected RNA aptamers, there were five potential GG pairs. If the G-rich region were indeed capable of forming G-quartets, four of the five G-doublets would be indispensable for binding.

Starting from the 47mer 16-3_B (SEQ ID NO: 20), which was characterized by a potentially stabilizing, double-stranded strain in addition to the conserved G-rich region (see FIG. 10 ), mutations were introduced in the conserved region. The guanine residues at positions 15, 17, 21, 27, and 32 were replaced by uracil residues, producing five different mutants, 16 3_B_M1 to 16 3_B_M5 (s 10 ).

Mutation within the GG pairs involved in the quadruplex formation should result in loss of binding to the hyper-IL-6 protein. The mutational analyzes were in the form of filter binding studies as described above. The binding of the truncated variants was compared in each case with the binding portion of the aptamer 16-3. The result of the analysis is 12 refer to.

The aptamers 16-3 and 16-3_B resembled each other in their strong binding behavior towards hyper-IL-6. In comparison, the exchange of defined guanine residues within the three mutants 16-3_B_M3, 16-3_B_M4 and 16-3_B_M5 led to a loss of function. The ability to interact with Hyper-IL-6 was significantly reduced. The mutant 16-3_B_M1 was characterized by a greatly reduced binding. 16-3_B_M2, on the other hand, appeared to be unaffected by base exchange and showed comparable or even better binding to hyper-IL-6.

The results of the mutation analyzes are consistent with the assumption of possible formation of a G-quadruplex structure. The loss of function of the four mutants 16-3_B_M1, 16-3_B_M3, 16-3_B_M4 and 16-3_B_M5 indicates that the guanine residues 15, 21, 27 and 32 of the aptamer 16-3_B are essential for the aptamer bond and perhaps in the formation of G Quartets are involved.

To verify this result, the analysis of the interactions between Hyper-IL-6 and the aptamer variants in a gel shift assay ( 13 ). This experiment also showed that the aptamer 16-3_B and the mutant 16-3_B_M2 were able to interact clearly with hyper-IL-6. Thus, a mutation of guanine at position 17 did not lead to a loss of function of the aptamer. The other four mutants showed a significantly reduced ability to interact in comparison.

4. Binding of fluorescently labeled aptamers to IL-6R bearing cells

Using flow cytometry, the binding of the sIL-6R-specific aptamers 16-3 and 16-3_B to the native IL-6R was investigated. The unselected RNA pool R1 and the non-binding variant 16-3_B_M5 (see above) were used as controls. For this purpose, the interaction of fluorescence-labeled RNAs with the two cell lines BAF / gp130 and BAF / gp130 / IL6R / TNF was investigated. The cell lines BAF / gp130 and BAF / gp130 / IL6R / TNF were derived from the murine pre-B cell line BAF / 3, an immortalized, bone marrow-derived pro-B cell line whose growth and proliferation were dependent on the presence of the cytokine IL- 3 is dependent. The growth of the BAF / 3 cells used here was dependent on IL-6. Cells of this cell line were stably transfected with cDNA for gp130 (BAF / gp130) or the cDNAs for gp130, TNF and IL-6R (BAF / gp130 / IL6R / TNF). The BAF / gp130 / IL-6R / TNF cells were also able to produce TNF in addition to the production of gp130 and the IL-6R, but this was not essential in the context of subsequent aptamer studies.

The BAF / gp130 and BAF / gp130 / IL-6R / TNF cell lines were cultured in 25 cm ² bottles and kept in the incubator at 37 ° C. The culture medium used was DMEM (Dulbecco's Modified Eagle Medium 1 ×, Invitrogen) supplemented with fetal calf serum FKS (10%) and 1 × Pen / Strep (62.5 μg penicillin G sodium salt / ml, 100 μg streptomycin / ml, 90 μg NaCl / ml in dist. water). Hyper IL 6 (10 ng / ml) was additionally added to the BAF / gp130 cells, the BAF / gp130 / IL-6R / TNF cells additionally the cytokine IL 6 (10 ng / ml) and the antibiotic puromycin (12 μg / ml). ml). As a control, the growth of the cells was also observed in the absence of the cytokines, since without these stimuli cell growth was not possible.

The presence of the interleukin 6 receptor on the surface of the BAF / gp130 / IL6R / TNF cells was monitored using a murine monoclonal IL-6R specific IgG1 antibody (not shown).

500,000 BAF / gp130 cells or IL-6R-bearing BAF / gp130 / IL6R / TNF cells were washed twice with 500 μl of 1 × selection buffer B (see above), resuspended in 350 μl of the same buffer and incubated with 8-10 pmol of to be examined, fluorescently labeled RNA (fluorophore: Alexa Fluor ^® 488 C5 maleimide, Invitrogen) incubated for 5 min at RT. Separation of unbound RNA molecules was followed by centrifugation of the cells at 500 g for 5 min. The pellet was washed twice with 500 μl of 1X Selection Buffer B. After resuspension in 350 μl of 1 × selection buffer B, the aptamer binding was analyzed on the flow cytometer by measuring 10,000 cells each.

For the AlexaFluor 488-labeled aptamers ^® 16-3 and 16-3_B interaction with the IL6R-bearing BAF / gp130 / IL-6R / TNF cells could be detected, since there was a shift in fluorescence intensity. The control RNAs Pool R1 and 16 3_B_M5 showed no binding to the BAF / gp130 / IL6R / TNF cells. The fact that none of the labeled nucleic acids showed non-specific binding to the IL-6R-deficient BAF / gp 130 cells confirmed that the aptamers bound exclusively to the surface of the BAF / gp130 / IL6R / TNF cells.

5. Competition between aptamer 16-3 and an anti-hIL-6R antibody

For the specificity of the aptamers according to the invention, competition experiments were carried out, whereby a possible competition between the aptamers according to the invention and an anti-hIL-6R antibody for the binding to the IL-6R was investigated by means of flow cytometry. To this end, binding to BAF / gp130 / IL6R / TNF cells previously incubated with a specific murine anti-hIL-6R antibody and a secondary FITC-conjugated goat anti-mouse AK was analyzed.

BAF / gp130 / IL6R / TNF cells were cultured in 25 cm ² culture flasks (see above). For harvest, the cells were centrifuged for 5 min at 500 g and RT. The supernatant was discarded, the pellet was taken up in 5 ml of DMEM (without FCS) and the cell count determined using a Neubauer counting chamber. Subsequently, 500,000 BAF / gp130 / IL6R / TNF cells were washed once with 500 μl of 1 × selection buffer B (see above), resuspended in 250 μl of the same buffer and with a hIL-6R-specific murine antibody (2 μg / ml ) for 30 min at 4 ° C. Excess antibody was separated by centrifugation at 500 g for 5 min. The pellet was washed once with 500 μl of 1 × Selection Buffer B. Resuspension in 250 μl of buffer was followed by the addition of a secondary FITC-conjugated goat anti-mouse antibody (Sigma) and incubation for 30 minutes at 4 ° C. After removal of the excess antibody (AK), the cells were pipetted into suitable measuring tubes. Analysis of aptamer binding to the BAF / gp130 / IL6R / TNF cells was done as described above using the fluorescently labeled aptamer 16-3. Fluorescent labeling of RNA was here with Alexa Fluor ^® 647 (Invitrogen).

The anti-hIL-6R antibody in combination with the goat anti-mouse secondary AK blocked the specific interaction of the aptamer with the BAF / gp130 / IL6R / TNF cells. This result demonstrates simultaneously the specific binding of the aptamer to the native IL-6R on the surface of BAF / gp130 / IL6R / TNF cells, since the anti-hIL-6R antibody was directed against the IL-6R. Non-specific binding to IL-6R-deficient BAF / gp130 control cells was not observed.

Sequence Listing - free text and translation of English terms

• Artificial Sequence = artificial sequence
• consensus sequence = consensus sequence
• misc_feature = other feature
• k is g or u = k is g or u
• n is any nucleotide, preferably a, c, g or u = n is any nucleotide, preferably a, c, g, or u
• h is a, c or u = h is a, c or u
• w is a or u = w is a or u
• RNA aptamer = RNA aptamer
• randomized region = randomized area
• 3 'primer region = 3' primer region
• 5 'primer region = 5' primer region
• randomized region plus 5 'and 3' primer region = randomized area plus 5 'and 3' primer areas

This is followed by a sequence protocol according to WIPO St. 25. This can be downloaded from the official publication platform of the DPMA.

QUOTES INCLUDE IN THE DESCRIPTION

This list of the documents listed by the applicant has been generated automatically and is included solely for the better information of the reader. The list is not part of the German patent or utility model application. The DPMA assumes no liability for any errors or omissions.

Cited patent literature

• WO 91/19813 [0006]

Cited non-patent literature

• Tags, T. et al. (1989), Cell, 58, 573-581 [0003]
• Mackiewicz, A. et al. (1992) J. Immunol., 149, 2021-2027 [0003]
• Scheller and Rose-John, Med. Microbiol. Immunol. (2006), 195, 173-183 [0003]
• Rose-John et al., (2006), JJ Leukocyte Biol. 80, 227-235 [0003]
• Jones et al. (2001), The FASER Journal 15, 43-57 [0003]
• Saito, M. et al. (1992 J. Immunol., 148, 4066-4071 [0003]
• Hirota, H. et al., (1995) Proc. Natl. Acad. Sci. USA, 92, 4862-4866 [0003]
• Osborne et al. (1997), Curr. Opin. Chem. Biol. 1, 5-9 [0006]
• Ellington and Szostak (1990), Nature 346, 818-822 [0006]
• Gopinath (2007), Anal. Bioanal. Chem. 387, 171-182 [0006]
• Tuerk, C. and L. Gold, Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science, 1990. 249 (4968): p. 505-10 [0039]
• Fischer, M., et al., I. A bioactive cytokine designer for human hematopoietic progenitor cell expansion. Nat Biotechnol, 1997. 15 (2): p. 142-5 [0068]
• Scheller, J., Grötzinger, J., and Rose-John, Stefan, cytokine signals via soluble and membranous receptors. Biospektrum, 2007, Volume 13: pp. 250-253 [0069]
• Jostock, T., et al., Soluble gp130 is the natural inhibitor of soluble interleukin-6 receptor trans-signaling responses. Eur J Biochem, 2001. 268 (1): p. 160-7 [0069]
• Version 3.2, Zuker, M., Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Research, 2003. 31 (13): p. 3406-3415 [0073]

Claims (12)

RNA aptamer that specifically binds the human soluble interleukin-6 receptor. RNA aptamer according to claim 1, characterized in that the RNA aptamer comprises the sequence according to SEQ ID NO: 1. RNA aptamer according to claim 2, characterized in that the RNA aptamer comprises one of the sequences according to SEQ ID NO: 2-4. An RNA aptamer according to any one of the preceding claims, characterized in that the RNA aptamer is one of the sequences given in SEQ ID NO: 5-10 or SEQ ID NO: 13-18 or a fragment thereof which is human soluble Interleukin-6 receptor specifically binds. RNA aptamer according to one of the preceding claims, characterized in that the 2'-OH group of at least one of the nucleotide bases of the RNA aptamer or the RNA aptamer fragment is replaced by a fluoro, amino or methoxy group. RNA aptamer according to one of claims 4 or 5, characterized in that the fragment at least 14, 15, 16, 17, 18, 19 or at least 20, more preferably at least 25, at least 30, at least 35, at least 40, at least 45, at least 50 or at least 55 and more preferably at least 60 consecutive nucleotides of the sequences indicated in SEQ ID NO: 5-10 or in SEQ ID NO: 13-18. RNA aptamer according to claim 6, characterized in that the fragment comprises at least one of the sequences according to SEQ ID NO: 1-4. RNA aptamer according to one of the preceding claims, characterized in that the RNA aptamer non-competitively binds to the human soluble interleukin-6 receptor. A pharmaceutical composition comprising an RNA aptamer according to any one of claims 1 to 8. Use of an aptamer according to any one of claims 1 to 8 for the manufacture of a medicament or a diagnostic agent. Use according to claim 10, characterized in that the medicament is intended for the treatment of inflammatory conditions, cancer or infections. Use according to claim 10 or 11, characterized in that the medicament is intended for the treatment of rheumatoid arthritis, sepsis, asthma, Crohn's disease, multiple sclerosis, depression, breast cancer, multiple myeloma or HIV infection.

Images