JP2021040641A - Agents for treatment of cancer diseases expressing claudin - Google Patents

Abstract

To provide novel agents and methods for therapies of cancer diseases.SOLUTION: The present invention discloses binding agents that contain a binding domain that is specific for CD3 allowing binding to T cells and a binding domain that is specific for a tumor-associated claudin molecule, and use of nucleic acids encoding the binding agents for cancer treatment.SELECTED DRAWING: None

Description

Claudins are endogenous membrane proteins located within the tight junctions of the epithelium and endothelium. The claudin is expected to have four transmembrane segments with two extracellular loops, as well as N- and C-termini located in the cytoplasm. The claudin (CLDN) family of transmembrane proteins play a very important role in maintaining tight junctions in the epithelium and endothelium, and may also play a role in cytoskeletal maintenance and cellular signaling. ..

The claudin 18 (CLDN18) molecule is surrounded by four transmembrane hydrophobic regions and two extracellular loops (loop 1 surrounded by hydrophobic region 1 and hydrophobic region 2; hydrophobic region 3 and hydrophobic region 4). It is an endogenous transmembrane protein (tetraspanin) having a loop 2). There are two different splice variants in CLDN18, which have been described in mice and humans (Niimi, Mol. Cell. Biol., 21: 7380-90, 2001). These splice variants (Genbank accession number: splice variant 1 (CLDN18.1): NP_057453, NM_016369, and splice variants 2 (CLDN18.2): NM_00102026, NP_00102026) have a molecular weight of approximately 27.9 kD / 27. , 72 kD. The splice variants CLDN 18.1 and CLDN 18.2 differ in the N-terminal portion containing the first transmembrane (TM) region and loop 1, whereas the C-terminal primary protein sequence is identical.

In normal tissues, no detectable expression of CLDN 18.2 is observed except in the stomach, where CLDN 18.2 is exclusively expressed on the surface of short-lived differentiated gastric epithelial cells. CLDN18.2 is maintained in the process of malignant transformation and is therefore often presented on the surface of human gastric cancer cells. Moreover, this pantumor antigen is ectopically activated at significant levels in esophageal, pancreatic and lung adenocarcinomas. The CLDN18.2 protein also localizes to lymph node metastases of gastric cancer adenocarcinoma, and in particular to distal metastases into the ovary (so-called Krkenberg tumors).

CLDN6 is expressed in a series of different human cancer cells, while expression in normal tissues is limited to the placenta.

Differential expression of various claudins (eg, CLDN18.2 and CLDN6) between cancer cells and normal cells, their membrane localization, and most of the normal tissue associated with toxicity Their absence makes these molecules attractive targets for cancer immunotherapy, and therefore high levels of antibody-based therapies for targeting claudins. Treatment specificity is expected.
Efforts to use the potential of T cells for the treatment of cancer include vaccination with tumor-derived proteins, RNA or peptide antigens, and injection of tumor-derived exvivo-enlarged T cells (this is called adoptive transfer). ), T cell receptor gene transfer, or direct involvement of T cells by bispecific or trispecific antibodies. Similarly, many stimulants of T cell responses have been clinically tested in combination or as monotherapy, such as ligands for Toll-like receptors, antibodies that block CTLA-4 on T cells, immune stimuli. Antibodies that neutralize sex cytokines or molecules involved in immune evasion of cancer cells (eg, TGF-beta or B7-H1) are being clinically tested. The intensive development of T cell-based therapies is motivated by the finding that if a patient's tumor is infiltrated by T cells, the patient appears to survive significantly longer. Moreover, numerous mouse models have shown that even large tumors can be eradicated by the involvement of T cells by various means, and some T cell therapies have made significant progress in recent years with various cancers. It brings about in treating the indication.

Niimi, Mol. Cell. Biol. , 21: 7380-90, 2001

It was one of the objects of the present invention to provide novel agents and methods for the treatment of cancer diseases.

The solution to the underlying problem of the present invention is based on the idea of creating a binder containing a binding domain that is specific for the claudin molecule associated with the tumor, i.e., for cancer cells. Other binding domains are specific for CD3, which allows them to bind to T cells, and allow T cells to be drawn into the complex, thus allowing the cells of T cells. It allows the injurious effects to be directed at the target cancer cells. The formation of this complex can induce signal transduction in cytotoxic T cells either by themselves or in combination with co-cells, which leads to the release of cytotoxic mediators. ..

We report for the first time that claudin and CD3 targeting binders are capable of inducing potent T cell-mediated cell lysis and are effective in treating tumor diseases. ..

In one aspect, the invention relates to a binding agent comprising at least two binding domains, the first binding domain binding to claudin and the second binding domain binding to CD3. Binders of the invention may bind to cytotoxic cells (by associating with the CD3 receptor) and to cancer cells expressing CLDN that will be destroyed as targets.

In one embodiment, the binder is a bispecific molecule, such as a bispecific antibody, specifically a bispecific single chain antibody. In one embodiment, the claudin is expressed in cancer cells. In one embodiment, the claudin is expressed on the surface of cancer cells. In one embodiment, the claudin is selected from the group consisting of claudin 18.2 and claudin 6. In one embodiment, the first binding domain binds to the extracellular domain of the claudin. In one embodiment, the first binding domain binds to a native epitope of CLDN present on the surface of living cells. In one embodiment, the first binding domain binds to the first extracellular loop of CLDN. In one embodiment, the second binding domain binds to the epsilon chain of CD3. In one embodiment, the CD3 is expressed on the surface of T cells. In one embodiment, binding of the binding agent to CD3 on a T cell causes proliferation and / or activation of the T cell, provided that the activated T cell causes a cytotoxic factor. (Eg, perforin and granzyme) are preferably released and cytolysis and apoptosis of cancer cells are initiated. In one embodiment, the binding to claudin and / or the binding to CD3 is a specific binding.

In one embodiment, the binder is in the form of a full-length antibody or antibody fragment. In one embodiment, the binder comprises four antibody variable domains with at least two binding domains, where at least one binding domain binds to claudin and at least one binding domain is on CD3. Join. In one embodiment, the binding agent is an immunoglobulin heavy chain variable domain (VH), a variable domain having specificity for a claudin antigen (VH (CLDN)), and an immunoglobulin light chain variable domain (VH). VL), variable domain with specificity for claudin antigen (VL (CLDN)), variable domain of immunoglobulin heavy chain (VH), variable domain with specificity for CD3 (VH (CD3)), and , Variable domain (VL) of the light chain of immunoglobulin, which comprises a variable domain (VL (CD3)) having specificity for CD3.

In one embodiment, the binder is in the form of a diabodies comprising a heavy chain variable domain linked to a light chain variable domain in the same polypeptide chain so that these two domains are not paired. To. In one embodiment, the diabodies contain two polypeptide chains, where one polypeptide contains VH (CLDN) and VL (CD3) and the other polypeptide chain contains VH (CD3) and VL ( CLDN) is included.

In one embodiment, the binding agent is in the form of a bispecific single chain antibody consisting of two scFv molecules linked via a linker peptide, provided that the heavy chain variable region (VH) and its corresponding. The light chain variable region (VL) is preferably N-terminal to C-terminal in the order of VH (CLDN) -VL (CLDN) -VH (CD3) -VL (CD3), VH (CD3) -VL (CD3)-. It is arranged in the order of VH (CLDN) -VL (CLDN) or VH (CD3) -VL (CD3) -VL (CLDN) -VH (CLDN). In one embodiment, the heavy chain variable region (VH) and its corresponding light chain variable region (VL) are preferably via a long peptide linker, preferably the amino acid sequence of (GGGGS) 3 or VE (GGGGS) 2GGVD. It is linked via a peptide linker containing. In one embodiment, the two VH-VL-type scFv units or VL-VH-type scFv units are linked via a short peptide linker, preferably via a peptide linker containing the amino acid sequence of SGGGGS or GGGGS.

In one embodiment, the CLDN is CLDN 18.2, the VH (CLDN) comprises the amino acid sequence represented by SEQ ID NO: 8 or a fragment thereof, or a variant of the amino acid sequence or fragment, and said VL. (CLDN) comprises the amino acid sequence represented by SEQ ID NO: 15 or a fragment thereof or a variant of the amino acid sequence or fragment.

In one embodiment, the CLDN is CLDN 18.2, the VH (CLDN) comprises the amino acid sequence represented by SEQ ID NO: 6 or a fragment thereof, or a variant of the amino acid sequence or fragment, and said VL. (CLDN) includes the amino acid sequence represented by SEQ ID NO: 11 or a fragment thereof, or a variant of the amino acid sequence or fragment.

In one embodiment, the CLDN is CLDN6, the VH (CLDN) comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, or a variant of the amino acid sequence or fragment, and the VL (CLDN). ) Contains the amino acid sequence represented by SEQ ID NO: 23 or a fragment thereof, or a variant of the amino acid sequence or fragment.

In one embodiment, the CLDN is CLDN6, the VH (CLDN) comprises the amino acid sequence or fragment thereof represented by SEQ ID NO: 22, or a variant thereof, and the VL (CLDN). ) Contain the amino acid sequence represented by SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99 or SEQ ID NO: 100 or a fragment thereof, or a variant of the amino acid sequence or fragment.

In one embodiment, the VH (CD3) comprises the amino acid sequence or fragment thereof represented by SEQ ID NO: 36, SEQ ID NO: 94 or SEQ ID NO: 95 or a variant thereof and the VL ( CD3) comprises the amino acid sequence represented by SEQ ID NO: 37 or SEQ ID NO: 96 or a fragment thereof or a variant of the amino acid sequence or fragment.

In one embodiment, the VH (CD3) comprises the amino acid sequence or fragment thereof represented by SEQ ID NO: 36 or a variant thereof, and the VL (CD3) is according to SEQ ID NO: 37. Includes the amino acid sequence represented or a fragment thereof or a variant of the amino acid sequence or fragment.

In one embodiment, the VH (CD3) comprises the amino acid sequence or fragment thereof represented by SEQ ID NO: 95 or a variant thereof, and the VL (CD3) is according to SEQ ID NO: 96. Includes the amino acid sequence represented or a fragment thereof or a variant of the amino acid sequence or fragment.

In one aspect, the binding agent of the invention is in the form of a bispecific single chain antibody comprising two scFv molecules linked via a linker peptide, provided that the heavy chain variable region (VH) and its counterparts thereof. The light chain variable region (VL) is arranged from the N-terminal to the C-terminal in the order of VH (CLDN) -VL (CLDN) -VH (CD3) -VL (CD3). In one embodiment, the VH (CD3) and VL (CD3) are linked via a peptide linker consisting of 15 to 20, preferably 15 or 20 amino acids (preferably glycine and / or serine). , Preferably, they are linked via a peptide linker containing the amino acid sequence (GGGGS) 4. In one embodiment, the VH (CLDN) and VL (CLDN) are linked via a peptide linker consisting of 15 to 20, preferably 15 or 20 amino acids (preferably glycine and / or serine). , Preferably, they are linked via a peptide linker containing the amino acid sequence (GGGGS) 4. In one embodiment, the two VH-VL-type scFv units are linked via a linker peptide containing the amino acid sequence SGGGGS. One or both of the two VH-VL type scFv units may include one or more interconnected disulfide bridges.

In one aspect, the binding agent of the invention is in the form of a bispecific single chain antibody comprising two scFv molecules linked via a linker peptide, provided that the heavy chain variable region (VH) and its counterparts thereof. The light chain variable region (VL) is arranged from the N-terminal to the C-terminal in the order of VL (CLDN) -VH (CLDN) -VH (CD3) -VL (CD3). In one embodiment, the VH (CD3) and VL (CD3) are linked via a peptide linker consisting of 15 to 20, preferably 15 or 20 amino acids (preferably glycine and / or serine). , Preferably, they are linked via a peptide linker containing the amino acid sequence (GGGGS) 4. In one embodiment, the VL (CLDN) and VH (CLDN) are linked via a peptide linker consisting of 20 to 25, preferably 20 or 25 amino acids (preferably glycine and / or serine). , Preferably, they are linked via a peptide linker containing the amino acid sequence (GGGGS) 5. In one embodiment, the VL-VH-type scFv unit and the VH-VL-type scFv unit are linked via a linker peptide containing the amino acid sequence SGGGGS. One or both of the two VL-VH-type scFv units or VH-VL-type scFv units may include one or more interconnected disulfide bridges.

In one aspect, the binding agent of the invention is in the form of a bispecific single chain antibody comprising two scFv molecules linked via a linker peptide, provided that the heavy chain variable region (VH) and its counterparts thereof. The light chain variable region (VL) is arranged from the N-terminal to the C-terminal in the order of VH (CLDN) -VL (CLDN) -VL (CD3) -VH (CD3). Preferably, the VL (CD3) -VH (CD3) scFv unit comprises one or more interconnected disulfide bridges. In one embodiment, the VL (CD3) and VH (CD3) are linked via a peptide linker consisting of 20 to 25, preferably 20 or 25 amino acids (preferably glycine and / or serine). , Preferably, they are linked via a peptide linker containing the amino acid sequence (GGGGS) 5. In one embodiment, the VH (CLDN) and VL (CLDN) are linked via a peptide linker consisting of 15 to 20, preferably 15 or 20 amino acids (preferably glycine and / or serine). , Preferably, they are linked via a peptide linker containing the amino acid sequence (GGGGS) 4. In one embodiment, the VH-VL type scFv unit and the VL-VH type scFv unit are linked via a linker peptide containing the amino acid sequence SGGGGS. The VH (CLDN) -VL (CLDN) scFv unit may include one or more interconnected disulfide bridges.

In one aspect, the binding agent of the invention is in the form of a bispecific single chain antibody comprising two scFv molecules linked via a linker peptide, provided that the heavy chain variable region (VH) and its counterparts thereof. The light chain variable region (VL) is arranged from the N-terminal to the C-terminal in the order of VL (CLDN) -VH (CLDN) -VL (CD3) -VH (CD3). Preferably, the VL (CD3) -VH (CD3) scFv unit comprises one or more interconnected disulfide bridges. In one embodiment, the VL (CD3) and VH (CD3) are linked via a peptide linker consisting of 20 to 25, preferably 20 or 25 amino acids (preferably glycine and / or serine). , Preferably, they are linked via a peptide linker containing the amino acid sequence (GGGGS) 5. In one embodiment, the VL (CLDN) and VH (CLDN) are linked via a peptide linker consisting of 20 to 25, preferably 20 or 25 amino acids (preferably glycine and / or serine). , Preferably, they are linked via a peptide linker containing the amino acid sequence (GGGGS) 5. In one embodiment, the two VL-VH-type scFv units are linked via a linker peptide containing the amino acid sequence SGGGGS. The VL (CLDN) -VH (CLDN) scFv unit may include one or more interconnected disulfide bridges.

In one embodiment of any of the above aspects, the CLDN is CLDN 18.2. Preferably, the VH (CLDN) comprises the amino acid sequence or fragment thereof represented by SEQ ID NO: 8 or a variant of the amino acid sequence or fragment, and the VL (CLDN) is represented by SEQ ID NO: 15. Includes an amino acid sequence or a fragment thereof or a variant of the amino acid sequence or fragment. Alternatively, said VH (CLDN) comprises the amino acid sequence or fragment thereof represented by SEQ ID NO: 6 or a variant of said amino acid sequence or fragment, and said VL (CLDN) is represented by SEQ ID NO: 11. Includes an amino acid sequence or a fragment thereof or a variant of the amino acid sequence or fragment. In one embodiment, the VH (CD3) comprises the amino acid sequence or fragment thereof represented by SEQ ID NO: 95 or a variant thereof, and the VL (CD3) is according to SEQ ID NO: 96. Includes the amino acid sequence represented or a fragment thereof or a variant of the amino acid sequence or fragment.

In one aspect, the binding agent of the invention is in the form of a bispecific single chain antibody comprising two scFv molecules linked via a linker peptide, provided that the heavy chain variable region (VH) and its counterparts thereof. The light chain variable region (VL) is from N-terminal to C-terminal in the order of VH (CLDN) -VL (CLDN) -VH (CD3) -VL (CD3) or VH (CD3) -VL (CD3) -VH ( It is arranged in the order of CLDN) -VL (CLDN). In one embodiment, the VH (CLDN) and VL (CLDN) are linked via a peptide linker consisting of 15 to 20, preferably 15 or 20 amino acids (preferably glycine and / or serine). , Preferably, they are linked via a peptide linker containing the amino acid sequence (GGGGS) 3. In one embodiment, the VH (CD3) and VL (CD3) are linked via a peptide linker consisting of 15 to 20, preferably 15 or 20 amino acids (preferably glycine and / or serine). , Preferably linked via a peptide linker containing the amino acid sequence GGGGS (GGS) 3GGGS. In one embodiment, the two VH-VL-type scFv units are linked via a linker peptide containing the amino acid sequence SGGGGS.

In one embodiment of the above aspect, the CLDN is CLDN6. Preferably, the VH (CLDN) comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof or a variant of the amino acid sequence or fragment. Preferably, the VL (CLDN) comprises the amino acid sequence represented by SEQ ID NO: 98, SEQ ID NO: 99 or SEQ ID NO: 100 or a fragment thereof or a variant of the amino acid sequence or fragment. Most preferably, the VL (CLDN) comprises the amino acid sequence or fragment thereof represented by SEQ ID NO: 99 or a variant of the amino acid sequence or fragment. In one embodiment, the VH (CD3) comprises the amino acid sequence or fragment thereof represented by SEQ ID NO: 95 or a variant thereof, and the VL (CD3) is according to SEQ ID NO: 96. Includes the amino acid sequence represented or a fragment thereof or a variant of the amino acid sequence or fragment.

In one embodiment, the CLDN is CLDN 18.2 and the binder of the present invention is an amino acid sequence selected from the group consisting of SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40 and SEQ ID NO: 41. Includes the fragment or variant.

In one embodiment, the CLDN is CLDN 18.2, and the binding agent of the present invention is SEQ ID NO: 103, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: No. 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83. , SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92 and SEQ ID NO: 93. Includes the fragment or variant. In one embodiment, the CLDN is CLDN 18.2 and the binders are SEQ ID NO: 103, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: An amino acid sequence or fragment thereof selected from the group consisting of 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92 and SEQ ID NO: 93. Includes variants, however, said amino acid sequence lacks and / or the sequence according to SEQ ID NO: 51 if a secretory signal, such as an N-terminal secretory signal, is specifically present. , His tag, for example, the C-terminal His tag, specifically, if the His tag is present, lacks the _{sequence Gly-Gly-Ser- (His) 6} or the sequence (His) _6.

In one embodiment, the CLDN is CLDN6, and the binder of the present invention is an amino acid sequence or fragment thereof selected from the group consisting of SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 and SEQ ID NO: 45. Or include variants.

In one embodiment, the CLDN is CLDN6, and the binder of the present invention is SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64. And a fragment or variant thereof of the amino acid sequence selected from the group consisting of SEQ ID NO: 65. In one embodiment, the CLDN is CLDN6 and the binding agents are SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64 and SEQ ID NO: It comprises an amino acid sequence selected from the group consisting of 65 or a fragment or variant thereof, provided that the amino acid sequence specifically contains a secretory signal, such as an N-terminal secretory signal. , And / or a His tag, such as a C-terminal His tag, specifically, if the sequence according to SEQ ID NO: 51 is present, the sequence Gly-Gly-Ser- (His). _{Missing 6} or sequence (His) ₆ .

In one embodiment, the cancer cells expressing CLDN18.2 include gastric cancer, esophageal cancer, pancreatic cancer, lung cancer (eg, non-small cell lung cancer (NSCLC), etc.), breast cancer, ovarian cancer, colon cancer, and the like. Cancer cells selected from the group consisting of liver cancer, head and neck cancer, bile sac cancer, and their metastases, Krkenberg tumors, peritoneal metastases, and / or lymph node metastases.

In one embodiment, the cancer cells expressing CLDN6 are bladder cancer, ovarian cancer (particularly ovarian adenocarcinoma and ovarian malformation cancer), lung cancer (small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC)). ), Especially squamous epithelial lung cancer and squamous epithelial lung adenocarcinoma), gastric cancer, breast cancer, liver cancer, pancreatic cancer, skin cancer (particularly basal cell cancer and squamous epithelial cancer), malignant melanoma, head and neck cancer (Especially malignant polymorphic adenoma), sarcoma (especially synovial sarcoma and synovial cancer sarcoma), bile duct cancer, bladder cancer (especially transition epithelial cancer and transition epithelial papillary cancer), kidney cancer (especially kidney) Renal cell cancer including clear cell cancer and papillary renal cell cancer), colon cancer, small intestinal cancer (including ileal cancer, especially small intestinal adenocarcinoma and ileal gland cancer), testicular fetal cancer, placental chorionic villus cancer, Cervical cancer, testicular cancer (particularly testicular seminoma, testicular malformation and embryonic testicular cancer), uterine cancer, embryonic cell tumor (eg, malformed cancer or embryonic cancer, especially testicular embryonic cell tumor), and , A cancer cell of cancer selected from the group consisting of those metastatic forms.

In one embodiment, the binder has an N-terminal secretory signal and / or a C-terminal histidine epitope tag (preferably 6 epitope tags for hisidin).

In one aspect, the invention relates to a recombinant nucleic acid encoding a binder of the invention. In one embodiment, the recombinant nucleic acid is in the form of a vector. In one embodiment, the recombinant nucleic acid is RNA.

In one aspect, the invention relates to a host cell containing the recombinant nucleic acid of the invention.

In one aspect, the invention is a binder of the invention, a recombinant nucleic acid of the invention, or a recombinant nucleic acid of the invention, for use in treatment, especially in treating or preventing cancer. Related to the host cell.

In one aspect, the invention relates to a pharmaceutical composition comprising a binder of the invention, a recombinant nucleic acid of the invention or a host cell of the invention.

In one aspect, the invention relates to a method of treating or preventing a cancer disease, comprising administering to a patient the pharmaceutical composition of the invention.

In one embodiment, the cancer cells express a claudin to which the binder can bind.

In one embodiment, the claudin is CLDN18.2 and the cancers are gastric cancer, esophageal cancer, pancreatic cancer, lung cancer (eg, non-small cell lung cancer (NSCLC), etc.), breast cancer, ovary. It is selected from the group consisting of cancer, colon cancer, liver cancer, head and neck cancer, cancer of the bile sac, and their metastases, Krkenberg tumors, peritoneal metastases and / or lymph node metastases.

In one embodiment, the claudin is CLDN6 and the cancers are bladder cancer, ovarian cancer (particularly ovarian adenocarcinoma and ovarian malformation cancer), lung cancer (small cell lung cancer (SCLC) and non-small). Includes cellular lung cancer (NSCLC), but in particular squamous cell lung cancer and squamous epithelial lung adenocarcinoma), gastric cancer, breast cancer, liver cancer, pancreatic cancer, skin cancer (particularly basal cell cancer and squamous cell carcinoma), malignant Melanoma, head and neck cancer (particularly malignant polymorphic adenoma), sarcoma (particularly synovial sarcoma and synovial cancer sarcoma), bile duct cancer, bladder cancer (particularly transitional epithelial cancer and transitional epithelial papillary carcinoma), kidney Cancer (particularly clear kidney cell cancer and renal cell cancer including papillary renal cell cancer), colon cancer, small intestinal cancer (including ileal cancer, particularly small intestinal adenocarcinoma and ileal adenocarcinoma), testicular fetal cancer, Placemental chorionic villus cancer, cervical cancer, testicular cancer (particularly testicular seminoma, testicular malformation and embryonic testicular cancer), uterine cancer, embryonic cell tumor (eg, malformation cancer or embryonic cancer), especially testicular embryo It is selected from the group consisting of cell tumors) and their metastatic forms.

In one embodiment, the invention is a binder as described herein for use in the procedures described herein, or in the specification encoding the binder. Provided are nucleic acids as described in, or host cells as described herein. In one embodiment, the invention provides a pharmaceutical composition as described herein for use in the treatment methods described herein.

According to the present invention, CLDN 18.2 preferably has an amino acid sequence according to SEQ ID NO: 1, and CLDN 6 preferably has an amino acid sequence according to SEQ ID NO: 2 or SEQ ID NO: 3.

Other features and advantages of the invention will be apparent from the detailed description and claims below.

A module layout illustrating the design of a recombinant bi-scFv protein that targets TAA CLDN 18.2. Design of bi-scFv at (A) N-terminal and (B) C-terminal positions for anti-TAA variable regions. The VH and VL regions of the anti-CLDN18.2 are made from the sequence of the monoclonal CLDN18.2 antibody (mCLDN18.2ab). Anti-CD3 comprehensively represents the VH and VL regions made from the following monoclonal CD3 antibody sequences: UCHT1-HU (humanized mAB), UCHT1, CLB-T3, TR66, 145-2C11. Bi-scFv indicates a bispecific single chain variable fragment; His indicates a hexahistidyl tag; HU indicates humanized; LL indicates a long linker (15-18 amino acids) ); Sec indicates a secretory signal; SL indicates a short linker (5-6 amino acids); TAA indicates a tumor-related antigen; V indicates the heavy (H) chain and light (L) of the antibody. The variable region of the chain is shown. Effects of domain orientation and anti-CD3-scFv selection on specific target cell lysis: 1BiMAB and no. Of 5'-mCLDN18.2abVH-VL_TR66VH-VL-3'type bi-scFv. 15 is the most powerful variant. Several bi-scFv variants directed against CLDN18.2 and CD3 were transiently expressed in HEK293T cells to compare their potency in cytotoxicity assays and using a Ni-NTA column. Small-scale purification. Among the NugC4 cells that endogenously express CLDN18.2, NugC4 cells that stably express luciferase were selected as target cells. Human T cells and target cells were incubated in 96-well format with 5 ng / ml of each bi-scFv protein in a 5: 1 E: T ratio. As a negative control, no. Targeting unexpressed TAA. 35, as well as no. 11 and no. 16 (both of which target mouse T cells rather than human T cells) were selected. Each test sample was placed in 6 stations, and _{the control sample for L min} was placed in 9 stations. The co-incubation time before analysis was 8 hours, 16 hours and 24 hours. After adding the luciferin solution at a given time point, luminescence was measured with an Infinite M200 TECAN reader. Specific target cell lysis was performed by controlling bi-scFv no. Calculated by normalization for samples using 35 (L _min). The most potent bi-scFv proteins, namely 1BiMAB and no. 15 has the same domain orientation and anti-CD3 origin of mAB TR66, but differs in their codon optimizations (HS and CHO, respectively) and long linker sequences. CHO indicates Chinese hamster ovary; mAB indicates monoclonal antibody; HU indicates humanized; TAA indicates tumor-related antigen. Coomassiegel and Western blot analysis of bi-scFv protein 1 BiMAB. The FCS-free supernatant of monoclonal HEK293 cells stably expressing 1BiMAB was purified by Ni-NTA affinity chromatography (IMAC). Aliquots from various purification steps were loaded onto 4-12% Bis-Tris gels. (A) Coomass stain of cell supernatant, eluate pass-through fraction and 8 fractions. Discard the fraction of the first eluted peak and pool the fraction of the second eluted peak for further study, dialyze against PBS, followed by 200 mM arginine buffer. I dialyzed. (Lane 1: HEK293 / 1 BiMAB SN; Lane 2: IMAC pass-through fraction; Lanes 3 to 4: Fractions of elution peak 1 (these were discarded); Lanes 5 to 10: Fractions of elution peak 2 (These were pooled)) (B) Western blot analysis of 0.5 μg of 1 BiMAB obtained from 3 independent purifications (lane 1, lane 2, lane 3). Detection was performed with a primary monoclonal anti-His antibody and a secondary peroxidase-conjugated anti-mouse antibody. IMAC indicates immobilized metal affinity chromatography; PBS indicates phosphate buffered saline; SN indicates supernatant; WB indicates Western blot. The bi-scFv protein 1 BiMAB efficiently and specifically binds to CLDN 18.2 expression target cells and human T cells. The bi-scFv protein 1 BiMAB efficiently and specifically binds to CLDN 18.2 expression target cells and human T cells. The bi-scFv protein 1 BiMAB efficiently and specifically binds to CLDN 18.2 expression target cells and human T cells. The bi-scFv protein 1 BiMAB efficiently and specifically binds to CLDN 18.2 expression target cells and human T cells. (A) 2.5 × 10 ⁵ NugC4 cells endogenously expressing CLDN18.2, 50 μg / ml 1BiMAB, or 10 μg / ml mCLDN18.2ab as a positive control, and their counterparts. Incubated with APC-conjugated secondary antibody. For control staining, a single secondary APC-conjugated antibody (ga-h, g-am), anti-His and g-am APC, or 1BiMAB and g-am APC. Was included. The analysis was performed by flow cytometry. The MFI of the APC signal was calculated by the FlowJo software. (B) 1 × 10 ⁵ NugC4 cells endogenously expressing CLDN18.2 were stained with increasing 1BiMAB concentration (20 pg / ml-20 μg / ml), anti-His and g-am APC. As a negative control, cells were incubated with anti-His and g-am APC. As positive controls, mCLDN 18.2ab and g-ah APC were used. The MFI of the APC signal was calculated by the FlowJo software. (C) 1 × 10 ⁶ human T cells were incubated with increasing 1BiMAB concentration (2 ng / ml-2 μg / ml), anti-His and g-am APC. As a negative control, cells were incubated with anti-His and g-am APC, or g-am APC alone. The MFI of the APC signal was calculated by the FlowJo software. (D) 1 × 10 ⁵ CLDN18.2 negative PA-1 cells were incubated with increasing 1BiMAB concentration (10 ng / ml-10 μg / ml), anti-His and g-am APC. As a negative control, cells were stained with anti-His and g-am APC, or g-ah APC alone. Using 10 μg / ml mCLDN18.2ab and g-ah APC, cells were confirmed to be CLDN18.2 negative. g-ah indicates goat anti-human; g-am indicates goat anti-mouse; MFI indicates average fluorescence intensity; TL indicates T lymphocytes. The bi-scFv protein 1 BiMAB causes T cell clustering on the surface of CLDN 18.2 positive target cells. NugC4 cells endogenously expressing CLDN18.2 were incubated in 6-well plates with 1 ng / ml and 1 μg / ml 1 BiMAB and human T cells at a 5: 1 effector to target ratio. T cells alone (TL), target cells alone (NugC4), and human T cells with target cells (-CTRL) were selected as control samples. After 24 hours, the sample was photographed with a Nikon Eclipse Ti microscope at a magnification of 200x. White arrows indicate clusters of T cells on target cells. TL indicates T lymphocytes. 1BiMAB mediates T cell activation in a dose-dependent manner. NugC4 cells endogenously expressing CLDN18.2 in a 24-well format with increasing concentrations of bi-scFv protein 1BiMAB (0.001 ng / ml-1000 ng / ml) and an effector-to-target ratio of 5: 1. Incubated with human T cells for 24 and 48 hours. As a control, human T cells were incubated with 1 ng / ml to 1000 ng / ml 1 BiMAB without NugC4 target cells to confirm target-dependent activation of T cells mediated by 1 BiMAB. After 24 hours (A) and 48 hours (B), T cells were collected, labeled with anti-CD3-FITC, anti-CD25-PE and anti-CD69-APC and analyzed by flow cytometry. TL indicates T lymphocytes. 1BiMAB mediates strictly target-dependent T cell activation, even after long-term incubation with high-expression, low-expression and non-expressing cell lines of CLDN18.2. (A) RT-PCR data from the total RNA of 6 tumor cell lines are shown. The Ct value of CLDN18.2 expression normalized to the housekeeping gene HPRT has been calculated from two independent experiments. The breast cancer cell line MCF7 (gray bar) was selected as the negative CLDN18.2 expression control cell line. (B) 5 ng / ml bi-scFv protein with or without human T cells in a 5: 1 effector-to-target ratio in duplicate with the cancer cell lines from (A) in a 6-well format. Incubated with 1 BiMAB for 144 hours. T cells are labeled with anti-CD3-FITC, anti-CD25-PE and anti-CD69-APC to flowsite the entire T cell population (CD3), early activation (CD69) and late activation (CD25) of T cells. Analyzed by metric. TL indicates T lymphocytes. 1BiMAB induces T cell proliferation and granzyme B up-regulation only in the presence of CLDN 18.2 positive target cells. (A) Human T cells are CFSE stained and used alone (TL), in the presence of 1 ng / ml 1 BiMAB (TL + 1 ng / ml 1 BiMAB), in the presence of NugC4 cells (TL + NugC4), or with NugC4 cells and 1 ng /. The cells were cultured for 120 hours in the presence of 1 ml of 1BiMAB (TL + 1 ng / ml 1BiMAB + NugC4). A 5: 1 effector to target ratio was selected. The decrease in CFSE signal, which indicates T cell proliferation, was analyzed by flow cytometry. (B) Human T cells were incubated with or without NugC4 target cells and with or without 5 ng / ml bi-scFv 1BiMAB protein. The effector to target ratio was 5: 1 in the 6-well format. After 96 hours of co-incubation, T cells were collected, intracellularly stained with anti-GrB-PE and analyzed by flow cytometry. The MFI of the anti-GrB-PE signal was calculated by FlowJo software. Signals from unstained samples (TL + NugC4 + 5ng / ml 1BiMAB) were subtracted from all samples. CFSE indicates carboxyfluorescein succinimidyl ester; GrB indicates granzyme B; MFI indicates average fluorescence intensity; PE indicates phycoerythrin; TL indicates T lymphocytes. _{EC 50} for 1BiMAB for specific target cell lysis after 48 hours is about 10 pg / ml. In NugC4 cells endogenously expressing CLDN18.2, NugC4 cells stably expressing luciferase are expanded in a 96-well format in triplets with human T cells in a 5: 1 effector to target ratio. Incubated with bi-scFv protein 1 BiMAB at concentrations (0.001 ng / ml to 1000 ng / ml) for 24 and 48 hours. As a minimal lysis (L _min ) control, effector cells and target cells were placed without bi-scFv 1 BiMAB. _{Maximum lysis (L max} ) for normalization to natural luminescence counts was applied to control wells containing effector cells and target cells in the absence of bi-scFv immediately prior to luciferin addition of Triton X-100. Achieved by adding. After adding the luciferin solution, luminescence was measured after 24 and 48 hours with an Infinite M200 Tecan microplate reader. Specific target cell lysis was calculated by the following formula:% specific lysis = [1- (luminescence test sample-L _max ) / (L _min- L _max )] x 100. Values were plotted against log 10 at 1 BiMAB concentration. EC ₅₀ indicates 50% maximum effective concentration; L indicates dissolution. 1 BiMAB demonstrates in vivo therapeutic efficacy in advanced SC tumor models. 1 BiMAB demonstrates in vivo therapeutic efficacy in advanced SC tumor models. 1 BiMAB demonstrates in vivo therapeutic efficacy in advanced SC tumor models. 1 BiMAB demonstrates in vivo therapeutic efficacy in advanced SC tumor models. NOD. Cg-Prkdscid IL2rgtm1Wjl / SzJ (NSG) mice were SC-injected with ^{1 × 10 7 HEK293 mice that stably express CLDN18.2.} Five days later, 2 × 10 ⁷ human PBMC effector cells were IP-injected into the G3 and G4 groups, and the control groups (G1 and G2) received PBS only. Daily IP application of 5 μg of bi-scFv protein 1 BiMAB per animal or vehicle as a control was started the next day. Treatment was given over 22 days, tumor volume was measured using calipers and calculated by the following formula: mm ³ = length (mm) x width (mm) x (width (mm) / 2). (A) Tumor volume of individual mice and median per group are shown for treatment days 0 and 15 (upper row) and 3 and 13 days (lower row) after the end of treatment. (B) The average tumor volume of the two treatment groups into which human effector cells are transplanted is shown. The dash symbol indicates the slaughtered animal. (C) Kaplan-Meier survival curve showing all groups from the day of tumor inoculation to the 41st day. Animals were sacrificed as soon as the tumor volume ^{exceeded 500 mm 3.} After day 41, all surviving animals were sacrificed to analyze human effector cell engraftment in mouse spleen. (D) All mouse splenocytes were isolated and stained with anti-CD45-APC and anti-CD3-FITC to detect human T cells by flow cytometry. Median engraftment is shown in a box plot. G indicates group; IP indicates intraperitoneal; PBMC indicates peripheral blood mononuclear cells; PBS indicates phosphate buffered saline; SC indicates subcutaneous. A module layout illustrating the design of a recombinant bi-scFv protein that targets TAA CLDN6. Design of bi-scFv at (A) N-terminal and (B) C-terminal positions for anti-TAA variable regions. The VH and VL regions of the anti-CLDN6 are made from the sequence of the monoclonal CLDN6 antibody (mCLDN6ab). The VH and VL regions of the anti-CD3 are made from the sequence of the monoclonal CD3 antibody TR66. Bi-scFv indicates a bispecific single chain variable fragment; His indicates a hexahistidyl tag; LL indicates a long linker (15-18 amino acids); Sec indicates a secretory signal; SL indicates a short linker (5 amino acids); TAA indicates a tumor-related antigen; V indicates the variable regions of the heavy (H) and light (L) chains of the antibody. The bi-scFv proteins 6PHU5 and 6PHU3 cause T cell clustering on the surface of CLDN6-positive target cells. PA-1 cells endogenously expressing CLDN6 were incubated in 6-well plates with 50 ng / ml 6PHU5 or 6PHU3 and human T cells at a 5: 1 effector to target ratio for 24 hours. T cells alone (TL), target cells alone (PA-1), and human T cells with target cells (-CTRL) were selected as control samples. After 24 hours, the sample was photographed with a Nikon Eclipse Ti microscope at a magnification of 200x. White arrows indicate clusters of T cells on target cells. TL indicates T lymphocytes. Effect of Domain Orientation on Efficacy: The bi-scFv protein 6PHU3 is slightly more efficient than 6PHU5 in inducing T cell activation. PA-1 cells endogenously expressing CLDN6 in a 6-well format, double, increasing concentrations (5 ng / ml to 200 ng / ml) of 6PHU5 or 6PHU3 and 5: 1 effector-to-target ratio human T cells And incubated for 44 hours. As a control, human T cells were incubated with 100 ng / ml and 200 ng / ml 6PHU5 or 6PHU3 without target cells. After 44 hours, T cells were collected and labeled with anti-CD3-FITC, anti-CD25-PE and anti-CD69-APC. Dose-dependent T cell activation was analyzed by flow cytometry. Hu indicates human; TL indicates T lymphocytes. Coomassie gel and Western blot analysis of 6PHU3 protein. The FCS-free supernatant of polyclonal HEK293 cells stably expressing 6PHU3 was purified by Ni-NTA affinity chromatography (IMAC). Aliquots from various purification steps were loaded onto 4-12% Bis-Tris gels. (A) Coomass stain of cell supernatant, eluate pass-through fraction and 9 fractions. Discard the fractions of the first eluted peaks, pool the fractions of the second and third eluted peaks for further study, dialyze against PBS, followed by 200 mM arginine buffer. Was dialyzed against. (Lane 1: HEK293 / 6PHU3 SN; Lane 2: IMAC pass-through fraction; Lanes 3 to 5: Fractions of elution peak 1 (these were discarded); Lane 6 to Lane 11: Elution peak 2 and elution peak Fractions of 3 (these were pooled)) (B) Western blot analysis of 0.5 μg of 6 PHU3 obtained from two independent purifications. Detection was performed with a primary monoclonal anti-His antibody and a secondary peroxidase-conjugated anti-mouse antibody. IMAC indicates immobilized metal affinity chromatography; PBS indicates phosphate buffered saline; SN indicates supernatant; WB indicates Western blot. The bi-scFv protein 6PHU3 efficiently and specifically binds to CLDN6 expression target cells and human T cells. The bi-scFv protein 6PHU3 efficiently and specifically binds to CLDN6 expression target cells and human T cells. The bi-scFv protein 6PHU3 efficiently and specifically binds to CLDN6 expression target cells and human T cells. The bi-scFv protein 6PHU3 efficiently and specifically binds to CLDN6 expression target cells and human T cells. (A) 1 × 10 ⁵ PA-1 and OV-90 cells endogenously expressing CLDN6 with increasing concentrations of 6PHU3 or control bi-scFv of 1BiMAB (10 ng / ml-10 μg / ml) and 10 μg. Incubated with / ml mCLDN6ab or control mAB mCLDN18.2ab and their corresponding APC-conjugated secondary antibodies. Control staining was a single secondary APC-conjugated antibody (ga-h, g-am). The analysis was performed by flow cytometry. The MFI of the APC signal was calculated by the FlowJo software. (B) 5 × 10 ⁵ human T cells were incubated with increasing 6PHU3 concentrations (100 ng / ml-10 μg / ml), anti-His and g-a-mPE. As a negative control, cells were incubated with anti-His and g-a-mPE, or g-a-mPE alone. The MFI of the PE signal was calculated by FlowJo software. (C) 1 × 10 ⁵ CLDN6-negative NugC4 cells were incubated with increasing 6PHU3 and 1BiMAB concentrations (10 ng / ml-10 μg / ml), anti-His and g-am APCs. As a negative control, cells were incubated with g-am APC alone. Using 10 μg / ml mCLDN6ab and g-ah APC, cells were confirmed to be CLDN6 negative. As positive controls, mCLDN 18.2ab and g-ah APC were used. The MFI of the APC signal was calculated by the FlowJo software. APC indicates allophycocyanin; g-ah indicates goat anti-human; g-am indicates goat anti-mouse; mAB indicates monoclonal antibody; MFI indicates average fluorescence intensity; PE indicates phycoerythrin Indicates; TL indicates T lymphocytes. 6PHU3 mediates T cell activation in a dose-dependent manner. PA-1 cells endogenously expressing CLDN6 in a 24-well format with increasing concentrations of bi-scFv protein 6PHU3 (0.001 ng / ml to 1000 ng / ml) and an effector to target ratio of 5: 1. Incubated with human T cells for 24 and 48 hours. As a control, human T cells were incubated with 1 ng / ml to 1000 ng / ml 6 PHU3 without PA-1 target cells to confirm target-dependent activation of T cells mediated by 6 PHU3. After 24 hours (A) and 48 hours (B), T cells were collected, labeled with anti-CD3-FITC, anti-CD25-PE and anti-CD69-APC and analyzed by flow cytometry. TL indicates T lymphocytes. _{EC 50} for 6PHU3 for specific target cell lysis is approximately 10 pg / ml after 48 hours. PA-1 cells endogenously expressing CLDN6, which stably express luciferase, are tripled in a 96-well format with increased concentrations (0) with human T cells in an effector-to-target ratio of 5: 1. Incubated with 6PHU3 protein at (0.01 ng / ml to 1000 ng / ml) for 24 and 48 hours. As a minimal lysis control (L _min ), effector cells and target cells were placed without bi-scFv 6PHU3. _{Maximum lysis (L max} ) for normalization to natural luminescence counts was applied to control wells containing effector cells and target cells in the absence of bi-scFv immediately prior to luciferin addition of Triton X-100. Achieved by adding. After adding the luciferin solution, luminescence was measured after 24 and 48 hours with an Infinite M200 Tecan microplate reader. Specific target cell lysis was calculated by the following formula:% specific lysis = [1- (luminescence test sample-L _max ) / (L _min- L _max )] x 100. Values were plotted against log 10 at a concentration of 6 PHU3. EC ₅₀ indicates 50% maximum effective concentration; L indicates dissolution. 6PHU3 demonstrates in vivo therapeutic efficacy in advanced SC tumor models. 6PHU3 demonstrates in vivo therapeutic efficacy in advanced SC tumor models. 6PHU3 demonstrates in vivo therapeutic efficacy in advanced SC tumor models. 6PHU3 demonstrates in vivo therapeutic efficacy in advanced SC tumor models. NOD. Cg-Prkd ^scid IL2rg ^tm1Wjl / SzJ (NSG) mice were SC-injected with ^{1 × 10 7 PA-1s that endogenously express CLDN6.} After 15 days, with 2 × 10 ⁷ human PBMC injected IP into G3 group and G4 groups, control group (G1 and G2) are received only PBS. Daily IP application of 5 μg of 6 PHU3 per animal, or 1 BiMAB of control bi-scFv as a control, or a vehicle alone was started 5 days after PBMC infusion. Treatment was given over 25 days, tumor volume was measured using calipers and calculated by the following formula: mm ³ = length (mm) x width (mm) x (width (mm) / 2). (A) Tumor volume of individual mice and median per group are shown for treatment days 0 and 14 (top) and treatment days 21 and 25 (bottom). (B) The average tumor volume of all treatment groups is shown. The dash symbol indicates the slaughtered animal. (C) Kaplan-Meier survival curves for all groups from the date of tumor inoculation to day 45 are shown. Animals were sacrificed when the tumor volume ^{exceeded 1500 mm 3.} After day 45, all surviving animals were sacrificed in mice to analyze human effector cell engraftment in the spleen. (D) All mouse splenocytes were isolated and stained with anti-CD45-APC and anti-CD3-FITC to detect human T cells by flow cytometry. Median engraftment is shown in a box plot. IP indicates intraperitoneal; PBMC indicates peripheral blood mononuclear cells; PBS indicates phosphate buffered saline; SC indicates subcutaneous. 6 Increased T cell infiltration into SC PA-1 tumors in response to PHU3 treatment. 6 Increased T cell infiltration into SC PA-1 tumors in response to PHU3 treatment. 6 Increased T cell infiltration into SC PA-1 tumors in response to PHU3 treatment. NSG mice were SC-injected with ^{1 × 10 7} PA-1s that endogenously express CLDN6. After 15 days, with 2 × 10 ⁷ human PBMC injected IP into G3 group and G4 groups, control group (G1 and G2) are received only PBS. Daily IP application of 5 μg of 6 PHU3 per animal, or 1 BiMAB of control bi-scFv as a control, or a vehicle alone was started 5 days after PBMC infusion. Tumors were dissected when they reached 1500 mm ³ in size or when the experiment was completed and stored in 4% buffered formaldehyde solution for paraffin embedding. Paraffin-embedded tumor tissue of SC PA-1 tumors was subjected to immunohistochemical staining. Serial sections were stained with either anti-claudin 6 or anti-human CD3 of the polyclonal primary antibody. The primary antibody was detected using a secondary HRP-conjugated anti-rabbit antibody. The upper row of A to E shows the CLDN6 stain, and the lower row shows the CD3 stain. Images were captured using a Mirax scanner. (A) and (B) show G1 and G2 of the PBS control group that received no human effector cells and received vehicle or bi-scFv 6PHU3, respectively. (C) shows control group G3 treated with human effector cells and vehicles. (D) shows group G4 treated with human effector cells and bi-scFv 6PHU3. (E) shows human effector cells and control group G5 that received control bi-scFv 1BiMAB. A positive signal appears as a red stain. The black arrow shows an example of a CD3 signal. IP indicates intraperitoneal; PBMC indicates peripheral blood mononuclear cells; PBS indicates phosphate buffered saline; SC indicates subcutaneous. Schematic illustration of an IVT-RNA molecule encoding a bi-scFv antibody that targets TAA CLDN 18.2. Schematic of an in vitro transcribed RNA sequence encoding an anti-CLDN18.2bi-scFv antibody. (A) IVT-mRNA at 5'and 3'positions with respect to the anti-TAA variable region. (B) IVT alpha virus replicon at the 5'side position with respect to the anti-TAA variable region. The VH and VL regions of anti-CLDN18.2 were made from the sequences of the monoclonal CLDN18.2 antibody (mCLDN18.2ab). "Cap" is used uniformly in place of ARCA, Beta-S-ARCA (D1) or Beta-S-ARCA (D2). In (A), "anti-CD3" comprehensively represents the VH and VL regions made from the following monoclonal CD3 antibody sequences: UCHT1-HU (humanized mAB), UCHT1, CLB-T3, TR66, 145-2C11. In (B), "anti-CD3" represents only VH and VL derived from TR66. A indicates adenine; bi-scFv indicates a bispecific single chain variable fragment; hAg indicates a 5'-UTR of human alphaglobin; hBg indicates a 3'-UTR of human betaglobin; His Hexahistidyl tags are indicated; VT indicates in vitro transcription; LL indicates long linkers (15-18 amino acids); nsP1-4 indicate unstructured proteins 1-4; Sec Indicates a secretory signal; sgP indicates a subgenome promoter; SL indicates a short linker (5-6 amino acids); TAA indicates a tumor-related antigen; UTR indicates an untranslated region; V indicates an antibody The variable regions of the heavy (H) and light (L) chains of. Effects of domain orientation and anti-CD3-scFv selection on target-dependent T cell activation and specific target cell lysis. NugC4 cells that endogenously express CLDN18.2 are transiently affected by several bi-scFv variants directed against CLDN18.2 and CD3 to compare their potency in cytotoxicity assays. Transfected. For each variant, 5 × 10 ⁶ NugC4 cells were electroporated with 20 μg / ml IVT-mRNA. Transfected target cells were counted, 1 × 10 ⁵ cells were seeded per 6-well plate, and human cytotoxic T cells (CD8 ⁺ selected T cells) at a 5: 1 E: T ratio. Incubated with. Negative controls include bi-scFv IVT-mRNA (CTRL), which targets unexpressed TAA, and chCLDN18.2ab (CTRL IgG), the original IgG mAB that targets CLDN18.2 but does not target T cells. I chose. 1 BiMAB protein served as a positive control at a concentration of 5 ng / ml. Electroporated target cells were seeded without T cells as a reference for dead cells in the background, and T cells were seeded without T cells as a reference for activation in the background. Sown. Each sample was sown in duplicate. After 48 hours, T cells and target cells were collected, labeled with anti-CD3-FITC, anti-CD25-PE, anti-CD69-APC and 7-AAD for life-and-death staining and analyzed by flow cytometry. (A) TAA-dependent bi-scFv-mediated T cell activation was observed with all anti-CLDN18.2 bi-scFv variants. (B) Specific target cell lysis was determined by subtracting the 7-AAD reference group from the 7-AAD sample target cell population. Bi-scFv antibodies that cause slightly larger target cell lysis, namely 1BiMAB and no. 5 has the same domain orientation and anti-CD3 origin of mAB TR66, but differs in their codon optimizations (HS and CHO, respectively) and long linker sequences. bi-scFv indicates bispecific single chain variable fragment; CTRL indicates control; IgG indicates immunoglobulin G; IVT indicates in vitro transcription; mRNA indicates messenger RNA; TL indicates T Shows lymphocytes. Co-incubation of human T cells with target cells transfected with 1 BiMAB IVT-mRNA causes T cell clustering. NugC4 cells endogenously expressing CLDN18.2 were transiently transfected by electroporation with 80 μg / ml 1BiMAB IVT-mRNA and human cells in a 96-well plate at a 5: 1 effector-to-target ratio. It was co-incubated with cytotoxic T cells ( ^{selected T cells of CD8 +).} As a negative control sample, NugC4 target cells (-CTRL) transfected with bi-scFv IVT-mRNA targeting unexpressed TAA, co-incubated with human cytotoxic T cells, were used (upper row). ,left). The lower row shows NugC4 cells transfected with control bi-scFv IVT-mRNA (left side) or 1BiMAB IVT-mRNA (right side) without human T cells. After 24 hours of co-incubation, samples were photographed with a Nikon Eclipse Ti microscope at a magnification of 200x. White arrows indicate clusters of T cells on target cells. CTL indicates cytotoxic T lymphocytes; CTRL indicates control; hu indicates humans. 1BiMAB secreted by target cells after transfection with IVT-mRNA mediates T cell activation in a concentration-dependent manner. NugC4 cells endogenously expressing CLDN18.2 are electroporated with a total of 40 μg / ml IVT-mRNA containing 0.4 μg / ml to 40 μg / ml of 1 BiMAB IVT-mRNA and an appropriate amount of luciferase IVT-mRNA. Transfected by. Transfected target cells were co-incubated in double on 6-well plates with human cytotoxic T cells (CD8 ⁺ selected T cells) at a 5: 1 effector to target ratio. As a reference for T cell activation, human T cells were co-incubated with NugC4 target cells transfected with 40 μg / ml luciferase IVT-mRNA (0.0 μg / ml 1BiMAB IVT-mRNA). After 24 hours (A) and 48 hours (B), T cells were collected, labeled with anti-CD3-FITC, anti-CD25-PE and anti-CD69-APC and analyzed by flow cytometry. The graph reveals the percentage of positively stained cytotoxic human T cells when determined using FlowJo software. IVT indicates that it was transcribed in vitro; mRNA indicates messenger RNA; TL indicates T lymphocytes. 1BiMAB secreted by target cells after transfection with IVT-mRNA causes concentration-dependent target cell lysis. NugC4 cells endogenously expressing CLDN18.2 with a total of 40 μg / ml IVT-mRNA containing 0.4 μg / ml-40 μg / ml of 1 BiMAB IVT-mRNA and an appropriate amount of luciferase IVT-mRNA, or Transfection was transient by electroporation with only 40 μg / ml luciferase IVT-mRNA as a reference sample. ^{Transfected target cells are seeded with human cytotoxic T cells (CD8 +} selected T cells) at a 5: 1 effector to target ratio, or in the background of each individual electroporation. Seeded without effector cells to determine the percentage of dead target cells. All samples were double cultured in 6-well plates. After 24 hours (A) and 48 hours (B), T cells were collected, labeled with propidium iodide (PI) for life-and-death staining, and analyzed by flow cytometry. Percentages of dead (PI ⁺ ) target cells were determined by FlowJo software. The values were further normalized for each individual background sample and for the reference sample. IVT indicates that it was transcribed in vitro; mRNA indicates messenger RNA; TL indicates T lymphocytes. T cell proliferation is specifically induced in the presence of CLDN 18.2 in response to 1BiMAB secretion by target cells. Human T cells were CFSE stained for assay. T cells are not targeted (+ ctrl) or 5 ng / ml in combination with 5 μg / ml OKT3 as a positive activation control and 2 μg / ml αCD28 without target cells (T cells). Cultivated with control bi-scFv (-ctrl protein) or with 5 ng / ml 1 BiMAB protein (1 BiMAB protein). T cells and NugC4 target cells overexpressing CLDN18.2 (T cells + CLDN18.2 positive target cells) with nothing (simulated) or 5 ng / ml 1BiMAB protein (1BiMAB protein) Incubated with. To test IVT-mRNA, NugC4 cells are transfected with 20 μg / ml 1BiMAB IVT-mRNA (1BiMAB mRNA) or bi-scFv IVT-mRNA (-ctrl mRNA) that targets unexpressed TAA. , Incubated with T cells. In addition, NugC4 cells transfected with bi-scFv IVT-mRNA targeting unexpressed TAA were combined with 5 ng / ml 1BiMAB protein (-ctrl mRNA + 1BiMAB protein). As a further specificity control, samples were included with target cell line MDA-MB-231 not expressing CLDN18.2 with T cells (T cells + CLDN18.2 negative target cells). MDA-MB-231 used untreated and without any involvement (simulation) or incubated with 5 ng / ml control bi-scFv protein (-ctrl protein) or 5 ng / ml 1 BiMAB protein (1 BiMAB protein) Alternatively, MDA-MB-231 was transfected with 20 μg / ml 1BiMAB IVT-mRNA (1BiMAB mRNA) or bi-scFv IVT-mRNA (-protein mRNA) targeting unexpressed TAA. The assay was performed in 96 wells with a 5: 1 effector to target ratio, with each sample in triplets and an incubation time of 72 hours. The decrease in CFSE signal indicating T cell proliferation was analyzed by flow cytometry, calculated by FlowJo software and plotted as% proliferative T cells. CFSE indicates carboxyfluorescein succinimidyl ester; IVT indicates in vitro transcription; mRNA indicates messenger RNA. 1 T cell activation and T cell-mediated target cell lysis in response to BiMAB secretion begin with an effector to target ratio of 0.3: 1. NugC4 cells endogenously expressing CLDN18.2 were transiently transfected by electroporation with 40 μg / ml 1BiMAB IVT-mRNA. ^{Human cytotoxic T cells (CD8 +} selected T cells) with the indicated effector to target ratios from 0.3: 1 to 10: 1 in duplicate transfected target cells in a 6-well plate. ) And co-incubated. For reference, human T cells were cultured in the absence of target cells ((A), 1: 0), and target cells transfected with control IVT-mRNA were cultured in the absence of effector cells ((A), 1: 0). (B), 0: 1). As a negative control, human T cells were co-incubated with NugC4 target cells (CTRL IVT-mRNA) transfected with 40 μg / ml luciferase IVT-mRNA at a 10: 1 E: T ratio ((A) and). (B) CTRL IVT-mRNA, 10: 1). After 48 hours, cells were collected, labeled with anti-CD3-FITC, anti-CD25-PE, anti-CD69-APC and propidium iodide (PI) for life-and-death staining and analyzed by flow cytometry. (A) shows the percentage of positively stained cytotoxic human T cells. (B) reveals the percentage of ^{dead (PI +) target cells.} All values were determined by FlowJo software. E: T indicates effector vs. target; IVT indicates in vitro transcription; mRNA indicates messenger RNA; TL indicates T lymphocytes. Human cytotoxic T cells can serve as recipient and producing cells of bi-scFv IVT-mRNA. Human cytotoxic T cells were freshly isolated from PBMCs by CD8 positive selection and subsequently transiently transfected by electroporation with 80 μg / ml or 240 μg / ml 1BiMAB IVT-mRNA. Transfected effector cells were co-incubated in 6-well plates in tandem with NugC4 target cells that endogenously express CLDN 18.2 in a 5: 1 effector to target ratio. For reference, untreated human T cells were cultured with target cells. As a negative control, human T cells transfected with 80 μg / ml or 240 μg / ml eGFP control IVT-mRNA were co-incubated with NugC4 target cells. After 48 hours, cells were collected, labeled with anti-CD3-FITC, anti-CD25-PE, anti-CD69-APC and propidium iodide (PI) for life-and-death staining and analyzed by flow cytometry. (A) shows the percentage of positively stained cytotoxic human T cells. In (B), the percentage of ^{dead (PI +) target cells normalized to the reference sample is plotted.} All values were determined by FlowJo software. CTRL indicates control; IVT indicates in vitro transcription; mRNA indicates messenger RNA; TL indicates T lymphocytes. CLDN18.2 negative target cells transfected with 1 BiMAB IVT-mRNA are not lysed by T cells. The CLDN18.2 negative cell line PA-1, which stably expresses luciferase, served as a target cell line. 5 × 10 ⁶ PA-1 / luc cells were electroporated with a total of 40 μg / ml IVT-mRNA. 4 μg / ml and 40 μg / ml 1BiMAB IVT-mRNA or 6RHU3 targeting endogenously expressed CLDN6 as a positive control were transfected. As a bi-scFv negative control, 40 μg / ml bi-scFv IVT-mRNA (-CTRL) targeting unexpressed TAA was transfected. This IVT-mRNA also served as RNA for fill-up in a 4 μg / ml IVT-mRNA sample (IVT-mRNA 4 μg / ml 1 BiMAB, IVT-mRNA 4 μg / ml 6RHU3). Protein control samples with 1BiMAB and 6PHU3 in combination with PA-1 / luc cells and effector cells transfected with a bi-scFv negative control were included. Transfected target cells were seeded with human cytotoxic T cells (pan-T cells) at a 5: 1 effector to target ratio. All samples were seeded in triplets in 96-well format and co-incubated for 72 hours. As a minimal lysis control (L _min ), each individual transfected target cell sample was seeded without effector cells. Maximum lysis for normalized to spontaneous emission count number _{(L max),} the Triton X-100 before addition of luciferin, control wells _{(L max1)} containing the target cells that have not been effector cells and treated, or , Achieved by adding to control wells (L _{max2) containing untreated target cells alone.} Thirty minutes after adding the luciferin solution, luminescence was measured with an Infinite M200 Tecan microplate reader. The specific target cell lysis was calculated by the following equation:% specific lysis = [1- (emission test sample _-L max1) _{/ (L min} _ test sample _{-L max2)]} × 100. CTRL indicates control; IVT indicates in vitro transcription; mRNA indicates messenger RNA. Evidence of 1BiMAB production by mammalian cells transfected with bi-scFv IVT-mRNA or bi-scFv IVT-replicon RNA. Evidence of 1BiMAB production by mammalian cells transfected with bi-scFv IVT-mRNA or bi-scFv IVT-replicon RNA. Evidence of 1BiMAB production by mammalian cells transfected with bi-scFv IVT-mRNA or bi-scFv IVT-replicon RNA. (A) 5 × 10 ⁶ BHK21 cells were transiently transfected by electroporation with 40 μg / ml 1BiMAB IVT-mRNA or 1BiMAB IVT-replicon RNA. As a simulated control, cells were electroporated without RNA. Eighteen hours after transfection, supernatants and cells were collected. The cells were lysed and the supernatant was subjected to about 50-fold concentration. The untreated and concentrated supernatants were analyzed by ELISA using Ni-NTA plates, anti-chCLDN18.2ab idiotype mAB and secondary AP-conjugated antibodies. The purified 1BiMAB protein in a dilution column ranging from 2.3 ng / ml to 37.5 ng / ml in double increments was used as the standard. (B) The concentrated supernatant, the cell lysate of (A), and 0.1 μg of purified 1BiMAB protein as a positive control were separated by SDS-PAGE. Western blot analysis was performed with a primary monoclonal anti-His antibody and a secondary peroxidase conjugated anti-mouse antibody. (C) 5 × 10 ⁶ BHK21 cells, 40 μg / ml 1BiMAB IVT-mRNA or no. It was transiently transfected by electroporation with 25 IVT-mRNA. As a simulated control, cells were electroporated without RNA. Forty-eight hours after transfection, the supernatant was collected and subjected to 40-fold concentration. SN and 0.1 μg of purified 1BiMAB protein as a positive control were separated by SDS-PAGE. Western blot analysis was performed with a primary monoclonal anti-His antibody and a secondary peroxidase conjugated anti-mouse antibody. CTRL indicates control; mAB indicates monoclonal antibody; SN indicates supernatant; WB indicates Western blot. Infusion of 1BiMAB bi-scFv IVT-mRNA or IVT-replicon RNA causes in vivo production and detectable 1BiMAB bi-scFv molecules in mice. 10 μg of 1BiMAB IVT-mRNA was IM-injected into NSG mice with or without EBK IVT-mRNA, or 10 μg of 1BiMAB IVT-replicon. Serum from blood collected 2 days, 4 days and 7 days after infusion was applied in an in vitro cytotoxicity assay. NugC4-LVT-CLDN18.2 / luc target cells stably expressing CLDN18.2 and luciferase were co-incubated with 20 μl of sample supernatant for 48 hours with human T cells in an E: T ratio of 30: 1. .. Standard 1 BiMAB protein controls, L _min and L _max , contained 20 μl of NSG simulated serum. EBK indicates vaccinia virus protein cocktail (E3, B-18R, K3); IM indicates intramuscular. Schematic illustration of an IVT-RNA molecule encoding a bi-scFv antibody that targets TAA CLDN6. Schematic of an in vitro transcribed RNA sequence encoding an anti-CLDN6 bi-scFv antibody. (A) IVT mRNA at 5'and 3'positions with respect to the anti-TAA variable region. (B) IVT alpha virus replicon at the 3'side position with respect to the anti-TAA variable region. The VH and VL regions of the anti-CLDN6 are made from the sequence of the monoclonal CLDN6 antibody (mCLDN6ab). "Cap" is used uniformly in place of ARCA, Beta-S-ARCA (D1) or Beta-S-ARCA (D2). The VH and VL regions of the anti-CD3 are made from the sequence of the monoclonal CD3 antibody TR66. A indicates adenine; bi-scFv indicates a bispecific single chain variable fragment; hAg indicates a 5'-UTR of human alphaglobin; hBg indicates a 3'-UTR of human betaglobin; His Hexahistidyl tags are indicated; VT indicates in vitro transcription; LL indicates long linkers (15-18 amino acids); nsP1-4 indicate unstructured proteins 1-4; Sec Indicates a secretory signal; sgP indicates a subgenome promoter; SL indicates a short linker (5-6 amino acids); TAA indicates a tumor-related antigen; UTR indicates an untranslated region; V indicates an antibody The variable regions of the heavy (H) and light (L) chains of. Co-incubation of human T cells with target cells transfected with anti-CLDN6 bi-scFv IVT-mRNA causes T cell clustering. PA-1 cells endogenously expressing CLDN6 were transiently transfected by electroporation with 20 μg / ml 6RHU5 IVT-mRNA or 6RHU3 IVT-mRNA and 5: 1 effector vs. target in a 6-well plate. Co-incubated with human T cells (pan-T cells) in ratio. As a negative control sample, PA-1 target cells (-CTRL) transfected with bi-scFv IVT-mRNA targeting unexpressed TAA, co-incubated with human T cells, were used (top row, row, Left photo). The middle row shows untreated PA-1 cells and human T cells with 50 μg / ml purified anti-CLDN6 bi- as a negative control without protein (simulated, left photo) or as a positive control. The case with 6PHU5 (center) or 6PHU3 (right side) of the scFv protein is shown. The lower row shows untreated PA-1 cells (left side) and human T cells (right side) alone. After 24 hours of co-incubation, samples were photographed with a Nikon Eclipse Ti microscope at a magnification of 200x. White arrows indicate clusters of T cells on target cells. bi-scFv indicates a bispecific single chain variable fragment; CTRL indicates control; hu indicates human; IVT indicates in vitro transcription; mRNA indicates messenger RNA; TL indicates T lymphocytes Shows a sphere. Effect of domain orientation on efficacy: Transfection of target cells with anti-CLDN6 bi-scFv 6RHU3 results in a greater proportion of activated T cells than with 6RHU5. PA-1 cells that endogenously express CLDN6 are combined with two bi-scFv variants (6RHU5 and 6RHU3) directed against CLDN6 and CD3 to compare their potency in a T cell activation assay. Transfected transiently. For the variants, 5 × 10 ⁶ PA-1 cells were electroporated with 20 μg / ml IVT-mRNA. Transfected target cells were recounted, 1 × 10 ⁵ cells were seeded per 6-well plate, and human cytotoxic T cells (CD8 ⁺ selected T cells) at a 5: 1 E: T ratio. ) And incubated. As negative controls, untreated target cells (hu TL + PA-1 untreated) and target cells transfected with bi-scFv IVT-mRNA targeting unexpressed TAA (hu TL + PA-1-ctrl). I chose. 6PHU5 protein served as a positive control at a concentration of 50 ng / ml (hu TL + PA-1 protein CTRL). In addition, T cells were seeded with or without the 6PHU5 protein, with or without target cells, as a reference for activation in the background. Each sample was sown in duplicate. Analysis was performed after 24 and 48 hours: T cells were collected, labeled with anti-CD3-FITC, anti-CD25-PE, anti-CD69-APC and 7-AAD for life-and-death staining and analyzed by flow cytometry. .. TAA-dependent bi-scFv-mediated T cell activation was observed with both anti-CLDN6 bi-scFv variants 24 hours (A) and 48 hours (B) after co-incubation. Transfection with bi-scFv 6RHU3 caused T cell activation of greater than approximately 20% at both time points. bi-scFv indicates a bispecific single chain variable fragment; CTRL indicates control; hu indicates human; IVT indicates in vitro transcription; mRNA indicates messenger RNA; TL indicates T lymphocytes Shows a sphere. 6RHU3 secretion mediates T cell activation in a concentration-dependent manner. PA-1 cells that endogenously express CLDN6 contain 0.2 μg / ml to 20 μg / ml of 6RHU3 IVT-mRNA and an appropriate amount of bi-scFv IVT-mRNA that targets non-expressed TAA. Transfection was transient by electroporation with 20 μg / ml IVT-mRNA. Transfection of 20 μg / ml bi-scFv IVT-mRNA (0.0 μg / ml 6RHU3 IVT-mRNA) targeting unexpressed TAA served as a specificity control. Transfected target cells were co-incubated in double on 6-well plates with human cytotoxic T cells (pan-T cells) at a 5: 1 effector to target ratio. As a reference for T cell activation, human T cells were cultured alone (hu TL-) without the 6PHU5 protein or with the 6PHU5 protein (hu TL protein CTRL). As a negative control, T cells were co-incubated with untreated PA-1 target cells (hu TL + PA-1-CTRL). 6PHU5 protein served as a positive control at a concentration of 50 ng / ml (hu TL + PA-1 protein CTRL). After 48 hours, T cells were collected, labeled with anti-CD3-FITC, anti-CD25-PE and anti-CD69-APC and analyzed by flow cytometry. The graph reveals the percentage of positively stained human T cells as determined by the FlowJo software. bi-scFv indicates a bispecific single chain variable fragment; CTRL indicates control; hu indicates human; IVT indicates in vitro transcription; mRNA indicates messenger RNA; TL indicates T lymphocytes Shows a sphere. _{EC 50} for 6RHU3 for specific target cell lysis is approximately 200 ng / ml after 48 hours. PA-1 cells endogenously expressing CLDN6, which stably express luciferase, were mixed with 6RHU3 of 0.004 μg / ml to 13.3 μg / ml and an appropriate amount of bi-scFv IVT- targeting non-expressed TAA. Transfections were transiently performed by electroporation with a total concentration of 13.3 μg / ml bi-scFv IVT-mRNA containing mRNA. Transfected target cells were seeded in triplets in a 96-well format with human T cells at a 5: 1 effector to target ratio. As a minimal lysis control (L _min ), each individual transfected target cell sample was seeded without effector cells. _{Maximum lysis (L max} ) for normalization to natural luminescence counts is achieved by adding Triton X-100 to control wells containing effector cells and untreated target cells immediately prior to luciferin addition. did. Thirty minutes after adding the luciferin solution, luminescence was measured after 24 and 48 hours with an Infinite M200 Tecan microplate reader. Specific target cell lysis was calculated by the following formula:% specific lysis = [1- (luminescence test sample-L _max ) / (L _{min_test} sample-L _max )] x 100. Values were plotted against log 10 at 6 RHU3 concentration. EC ₅₀ indicates 50% maximum effective concentration; L indicates dissolution. T cell proliferation is specifically induced in the presence of CLDN6 in response to 6RHU3 secretion by target cells. Human T cells were CFSE stained for assay. T cells, without target cells (T cells), in combination with 5 μg / ml OKT3 and 2 μg / ml αCD28 as positive activation controls (+ ctrl), or 5 ng / ml non-targeted controls It was cultured with bi-scFv (-ctrl protein) or with 5 ng / ml 6PHU3 protein (6PHU3 protein). T cells and PA-1 target cells that endogenously express CLDN6 (T cells + CLDN6 positive target cells), with nothing (simulated), or 5 ng / ml 6PHU3 protein (6PHU3 protein) Incubated with. To test IVT-mRNA, PA-1 cells are transfected with 20 μg / ml 6RHU3 IVT-mRNA (6RHU3 mRNA) or bi-scFv IVT-mRNA (-ctrl mRNA) that targets unexpressed TAA. It was transfected and incubated with T cells. In addition, PA-1 cells transfected with bi-scFv IVT-mRNA targeting unexpressed TAA were combined with 5 ng / ml 6PHU3 protein (-ctrl mRNA + 6PHU3 protein). As a further specificity control, a sample was included with a target cell line MDA-MB-231 not expressing CLDN6 with T cells (T cells + CLDN6 negative target cells). MDA-MB-231 was used untreated and incubated with nothing (simulated) or with 5 ng / ml control bi-scFv protein (-ctrl protein) or 5 ng / ml 6PHU3 (6PHU3 protein). Alternatively, MDA-MB-231 was transfected with 20 μg / ml 6RHU3 IVT-mRNA (6RHU3 mRNA) or bi-scFv IVT-mRNA (-protein mRNA) targeting unexpressed TAA. The assay was performed in 96 wells with a 5: 1 effector to target ratio, with each sample in triplets and an incubation time of 72 hours. The decrease in CFSE signal indicating T cell proliferation was analyzed by flow cytometry, calculated by FlowJo software and plotted as% proliferative T cells. CFSE indicates carboxyfluorescein succinimidyl ester; IVT indicates in vitro transcription; mRNA indicates messenger RNA. Evidence of 6RHU3 translation by mammalian cells transfected with bi-scFv IVT-mRNA or IVT-replicon RNA. Evidence of 6RHU3 translation by mammalian cells transfected with bi-scFv IVT-mRNA or IVT-replicon RNA. Evidence of 6RHU3 translation by mammalian cells transfected with bi-scFv IVT-mRNA or IVT-replicon RNA. (A) 5 × 10 ⁶ BHK21 cells were transiently transfected by electroporation with 40 μg / ml 6RHU3 IVT-mRNA or 6RHU3 IVT-replicon RNA. 40 μg / ml no. Transfection of 25 IVT-mRNA was included as an additional sample. As a simulated CTRL, cells were electroporated without RNA. Eighteen hours after transfection, supernatants and cells were collected. The cells were lysed and the supernatant was subjected to about 50-fold concentration. The untreated and concentrated supernatants were analyzed by ELISA using Ni-NTA plates, anti-mCLDN6ab idiotype mAB and secondary AP-conjugated antibodies. Purified 6PHU3 protein in dilution rows ranging from 2.3 ng / ml to 150 ng / ml in double increments was used as the standard. (B) The concentrated supernatant, the cell lysate of (A), and 0.1 μg of purified 6PHU3 protein as a positive control were separated by SDS-PAGE. Western blot analysis was performed with a primary monoclonal anti-His antibody and a secondary peroxidase conjugated anti-mouse antibody. (C) 5 × 10 ⁶ BHK21 cells, 40 μg / ml 6RHU3 IVT-mRNA or no. It was transiently transfected by electroporation with 25 IVT-mRNA. As a simulated control, cells were electroporated without RNA. Forty-eight hours after transfection, the supernatant was collected and subjected to 40-fold concentration. SN and 0.1 μg of purified 6PHU3 protein as a positive control were separated by SDS-PAGE. Western blot analysis was performed with a primary monoclonal anti-His antibody and a secondary peroxidase conjugated anti-mouse antibody. CTRL indicates control; mAB indicates monoclonal antibody; SN indicates supernatant; WB indicates Western blot. Infusion of 6RHU3 bi-scFv IVT-mRNA or IVT-replicon RNA causes in vivo translation and detectable bi-scFv molecules in mice. 10 μg of 6RHU3 IVT-mRNA was IM-injected into NSG mice with or without EBK IVT-mRNA, or 10 μg of 6RHU3 IVT-replicon. Serum from blood collected 7 days after infusion was applied in an in vitro cytotoxicity assay. PA-1 / luc target cells that endogenously express CLDN6 and stably express luciferase are co-incubated with 20 μl of sample serum for 48 hours with human T cells at a E: T ratio of 30: 1. did. Standard 6PHU3 protein controls, L _min and L _max , contained 20 μl of NSG simulated serum. EBK indicates vaccinia virus protein cocktail (E3, B-18R, K3); IM indicates intramuscular. Cytotoxic results of an anti-CLDN18.2bi-scFv protein containing the scFv anti-CD3 binding domain in the C-terminal portion of the protein. Cytotoxic results of an anti-CLDN18.2bi-scFv protein containing the scFv anti-CD3 binding domain in the C-terminal portion of the protein. Cytotoxic results of an anti-CLDN18.2bi-scFv protein containing the scFv anti-CD3 binding domain in the C-terminal portion of the protein. Cytotoxic results of an anti-CLDN18.2bi-scFv protein containing the scFv anti-CD3 binding domain in the C-terminal portion of the protein. Bi-scFv variants directed against CLDN18.2 and CD3 were transiently expressed in CHO cells and purified with protein-L resin to compare their potency in cytotoxicity assays. Among the NugC4 cells that endogenously express CLDN18.2, NugC4 cells that stably express luciferase were selected as target cells. Human T cells and target cells were incubated in 96-well format with 5000 ng / ml, 1000 ng / ml, 200 ng / ml and 40 ng / ml bi-scFv proteins at a ratio of 5: 1 E: T. Each test sample was placed in triplets and _{control samples for L min} were placed in triplets. The co-incubation time before analysis was 24 hours and 48 hours. After adding the luciferin solution at a given time point, luminescence was measured with an Infinite M200 TECAN reader. Specific target cell lysis was calculated for each concentration and specific target cell lysis was reported. a. The variable domains of anti-CD3 are the domain order of VH-VL and are separated by the LL4 peptide linker. b. The variable domains of anti-CD3 are in the order of VH-VL and are separated by the LL4 peptide linker. scFv anti-CD3 contains interconnect disulfide bridges between the VH and VL domains. c. The variable domains of anti-CD3 are in the order of VL-VH and are separated by the LL5 peptide linker. d. The variable domains of anti-CD3 are in the order of VL-VH and are separated by the LL5 peptide linker. scFv anti-CD3 contains interconnect disulfide bridges between the VL and VH domains. Assay in comparison _{The EC 50} values obtained in the luciferase cytotoxicity assay using anti-CLDN6 bi-scFv protein. A luciferase cytotoxic assay was performed on three different donors for T cell preparation. Calculated _{The EC 50} values (these 24-hour and after 48 hours of incubation, is calculated by the six tested anti-CLDN6 bi-scFv protein) is reported for each of the independent assays (A, B and C). PA-1 cells endogenously expressing CLDN6 in a 96-well format in triplets with increasing concentrations (0.025 ng / ml to 50,000 ng / ml for A and B, 0.0025 ng / ml to 5000 ng / ml for C) Incubated with anti-CLDN6 bi-scFv protein (ml) and human T cells in an effector to target ratio of 5: 1 for 24 and 48 hours. As a minimal lysis control (L _min ), effector cells and target cells were placed without the bi-scFv protein. _{Maximum lysis (L max} ) for normalization to natural luminescence counts was applied to control wells containing effector cells and target cells in the absence of bi-scFv immediately prior to luciferin addition of Triton X-100. Achieved by adding. Thirty minutes after adding the luciferin solution, luminescence was measured with an Infinite M200 Tecan microplate reader after 24 and 48 hours incubation of target and effector cells. Specific target cell lysis was calculated by the following formula:% specific lysis = [1- (luminescence test sample-L _max ) / (L _min- L _max )] x 100. EC ₅₀ of indicating a maximum of 50% effective concentration; L represents a dissolution; NA indicates not applicable.

Although the invention is described in detail below, the particular methodologies, protocols and reagents described herein are subject to change, and thus the invention is described herein. It must be understood that it is not limited to the methodologies, protocols and reagents of. Also, the terminology used herein is for the purpose of describing a particular embodiment and limits the scope of the invention, which will be limited only by the appended claims. It must also be understood that it is not intended for this. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

The components of the invention will be described below. These components are listed with specific embodiments, however, they can be combined in any form and in any number to create further embodiments. Must be understood. The various described examples and preferred embodiments should not be construed to limit the invention to the expressly described embodiments. This description must be understood to support and embrace embodiments that combine the explicitly described embodiments with any of the disclosed components and / or preferred components. Moreover, any sort and combination of all described components in this patent application must be considered to be disclosed by the description in this patent application, except where the context indicates otherwise. ..

Preferably, the term used herein is "A multilingual glossary of biotechnological terms: (IUPAC Recommendations)" (HGW Leuenberger, B. Nagal and H. Kolberg, ed., Helvet). -4010 Basel, Switzerland, (1995)).

Unless otherwise indicated, conventional methods of chemistry, biochemistry, cell biology, immunology and recombinant DNA techniques described in the literature in the art will be used in the practice of the present invention (eg, for example. , Chemistry Cloning: A Laboratory Manual, 2nd Edition (see J. Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1989).

Throughout the specification and the claims below, the words "comprise" (including) and variants (eg, "comprises" and "comprising") are used unless the context requires otherwise. A component, an integer or a process, or a group of components, an integer or a plurality of processes, but any other component, an integer or a process, or a plurality of components, a plurality of mentioned components. It will be understood to imply not excluding a group of integers or multiple steps. However, in some embodiments, such other components, integers or steps, or groups of components, integers or steps are excluded, i.e., the subject matter is one component. It may consist of an integer or a process, or a group of components, a plurality of integers or a plurality of processes. The terms "a" and the term "an" and the term "the" as used in the context of describing the invention (in particular, in the context of the claims) and similar references are given elsewhere herein. Or it must be construed to include both singular and plural, unless there is a clear contradiction in the context. The enumeration of a range of values herein is merely intended to serve as a simplified way to individually indicate each distinct value contained within that range. Unless otherwise indicated herein, each individual value is incorporated herein as if the values were individually listed herein. All methods described herein may be performed in any order and in any order as preferred, except as otherwise indicated herein or where there is a clear conflict in context. is there. The use of any example, or exemplary wording (eg, "such as" (eg, ...)), as provided herein, is solely intended to better illustrate the invention. , The present invention or claims are not limited. None of the terminology herein shall be construed as indicating any unclaimed component that is essential to the practice of the present invention.

Several documents are cited throughout the body of this specification. Each of the documents cited herein, including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc., whether above or below, is hereby. Is incorporated by reference in their entirety. Nothing in the present invention is construed as acknowledging that the prior invention does not qualify prior to such disclosure.

Claudins are a group of proteins that are the most important component of tight junctions, where in tight junctions these proteins define a paracellular barrier that controls the flow of molecules in the intercellular spaces between epithelial cells. .. Claudin is a transmembrane protein that straddles the membrane four times, with both the N-terminus and the C-terminus located in the cytoplasm. The first extracellular loop (which is called EC1 or ECL1) consists of an average of 53 amino acids, and the second extracellular loop (which is called EC2 or ECL2) consists of around 24 amino acids. Claudin family of cell surface proteins, such as CLDN6 and CLDN18.2, are expressed in tumors of various origins and their selective expression (not expressed in normal tissues associated with toxicity). And because of its localization to the plasma membrane, it is particularly suitable as a target structure in connection with antibody-mediated cancer immunotherapy.

In the context of the present invention, preferred claudins are CLDN6 and CLDN18.2. CLDN6 and CLDN18.2 have been identified as differentially expressed in tumor tissue, with the only normal tissue expressing CLDN18.2 being the stomach and the only normal tissue expressing CLDN6 in the placenta. is there.

CLDN18.2 is selectively expressed in normal tissues in differentiated epithelial cells of the gastric mucosa. CLDN18.2 is expressed in cancers of various origins, such as pancreatic cancers, esophageal cancers, gastric cancers, bronchial cancers, breast cancers and ENT tumors. CLDN18.2 is a useful target for the prevention and / or treatment of primary tumors, such as gastric cancer, esophageal cancer, pancreatic cancer, lung cancer (eg, non-small cell lung cancer (NSCLC)), ovary. Prevention and / or treatment of cancers, colon cancers, liver cancers, head and neck cancers and bile sac cancers and their metastases, such as gastric cancer metastases, such as Krkenberg tumors, peritoneal metastases and lymph node metastases. Is a useful target for.

CLDN6 has been found to be expressed in, for example, ovarian cancer, lung cancer, gastric cancer, breast cancer, liver cancer, pancreatic cancer, skin cancer, melanoma, head and neck cancer, sarcoma, bile duct cancer, renal cell cancer and bladder cancer. Has been done. CLDN6 includes ovarian cancers (particularly ovarian adenocarcinomas and ovarian malformation cancers), lung cancers (small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), but in particular squamous cell lung cancer and squamous cell lung cancer). Glandular cancer), gastric cancer, breast cancer, liver cancer, pancreatic cancer, skin cancer (especially basal cell cancer and squamous cell carcinoma), malignant melanoma, head and neck cancer (especially malignant polymorphic adenoma), sarcoma (especially slippery) Membranous sarcoma and synovial cancer sarcoma), bile duct cancer, bladder cancer (particularly transitional epithelial cancer and transitional epithelial papillary cancer), kidney cancer (particularly renal cell carcinoma including clear and papillary renal cell carcinoma) , Colon cancer, small intestine cancer (including ileal cancer, especially small intestinal gland cancer and ileal gland cancer), testicular fetal cancer, placental chorionic villus cancer, cervical cancer, testicular cancer (particularly testicular seminoma, testicular malformation) And embryonic testicular cancer), uterine cancer, embryonic cell tumors (eg, embryonic cell tumors of the testis, such as malformed cancers or embryonic cancers), and their metastatic forms for prevention and / or treatment. It is a particularly preferred target. In one embodiment, the cancerous disease associated with CLDN6 expression is selected from the group consisting of ovarian cancer, lung cancer, metastatic ovarian cancer and metastatic lung cancer. Preferably, the ovarian cancer is a cancer or adenocarcinoma. Preferably, the lung cancer is a cancer or adenocarcinoma, preferably a bronchiolar cancer, such as a bronchiolar cancer or a bronchiolar adenocarcinoma.

The term "CLDN" as used herein means claudin and includes CLDN 18.2 and CLDN 6. Preferably, the claudin is a human claudin.

The term "CLDN18" refers to claudin 18, which includes splice variant 1 of claudin 18 (claudin 18.1 (CLDN18.1)) and splice variant 2 of claudin 18 (cladin 18.2). Any variant is included, including (CLDN18.2)).

The term "CLDN18.2" is preferably related to human CLDN18.2, in particular a protein comprising an amino acid sequence according to SEQ ID NO: 1 in the sequence listing or a variant of said amino acid sequence, preferably an amino acid according to SEQ ID NO: 1 in the sequence listing. Indicates a protein consisting of a sequence or a variant of the amino acid sequence. The first extracellular loop of CLDN18.2 preferably comprises amino acids 27 to 81 of the amino acid sequence set forth in SEQ ID NO: 1, and more preferably amino acids 29 to 78 of the amino acid sequence set forth in SEQ ID NO: 1. Including. The second extracellular loop of CLDN18.2 preferably comprises amino acids 140-180 of the amino acid sequence set forth in SEQ ID NO: 1. The first extracellular loop and the second extracellular loop preferably form the extracellular portion of CLDN18.2.

The term "CLDN6" is preferably related to human CLDN6, in particular a protein comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 3 in the Sequence Listing or a variant of said amino acid sequence, preferably SEQ ID NO: 2 or sequence in the Sequence Listing. A protein consisting of the amino acid sequence of No. 3 or a variant of the amino acid sequence is shown. The first extracellular loop of CLDN6 preferably comprises amino acids 28 to 80 of the amino acid sequence set forth in SEQ ID NO: 2 or the amino acid sequence set forth in SEQ ID NO: 3, and more preferably the amino acid sequence set forth in SEQ ID NO: 2. Alternatively, it contains amino acids 28 to 76 of the amino acid sequence shown in SEQ ID NO: 3. The second extracellular loop of CLDN6 preferably comprises amino acids 138 to 160 of the amino acid sequence set forth in SEQ ID NO: 2 or the amino acid sequence set forth in SEQ ID NO: 3, preferably the amino acid sequence set forth in SEQ ID NO: 2 or It contains amino acids 141 to 159 of the amino acid sequence shown in SEQ ID NO: 3, and more preferably contains amino acids 145 to amino acids 157 of the amino acid sequence shown in SEQ ID NO: 2 or the amino acid sequence shown in SEQ ID NO: 3. The first extracellular loop and the second extracellular loop preferably form the extracellular portion of CLDN6.

The term "variant" according to the invention specifically refers to variants, splice variants, conformers, isotypes, allelic variants, species variants and species homologs, and in particular refers to those that are naturally occurring. Allelic variants are associated with variants in the normal sequence of genes, but their meaning is often unknown. Complete gene sequencing often identifies a large number of allelic variants for a given gene. A species homologue is a nucleic acid sequence or amino acid sequence having a species of origin different from the species of origin of a given nucleic acid sequence or amino acid sequence. The term "variant" shall include any post-translational modified variant and conformational variant.

The second target molecule of the binder described herein is CD3 (differentiation cluster 3). CD3 complex means an antigen expressed as part of a multimolecular T cell receptor (TCR) complex on the surface of a subset of mature human T cells, thymocytes, and natural killer cells. This T cell co-receptor is a protein complex and is composed of four different strands. In mammals, this complex contains a CD3γ chain, a CD3δ chain and two CD3ε chains. These chains associate with a molecule known as the T cell receptor (TCR) and the ζ chain to generate an activation signal in T lymphocytes. The TCR, ζ chain and CD3 molecules combine to form a TCR complex.

Human CD3 epsilon is designated by GenBank accession number NM_000733 and comprises SEQ ID NO: 4. Human CD3 gamma is indicated by GenBank accession number NM0000073. The human CD3 delta is indicated by GenBank accession number NM_000732. CD3 is involved in TCR signaling. Activation of the TCR complex by binding of MHC-presented specific antigen epitopes by kinases of the Src family, as described by Lin and Weiss (Journal of Cell Science 114, 243 to 244 (2001)). It results in phosphorylation of the immunoreceptive activation tyrosine motif (ITAM), which induces further kinase recruitment leading to T cell activation, including Ca2 + release. Clustering of CD3 on T cells, eg, clustering of CD3 with immobilized anti-CD3 antibodies, is similar to the involvement of the T cell receptor, but independent of its clone-typical specificity. Is caused.

As used herein, "CD3" embraces human CD3 and means an antigen expressed on the surface of human T cells as part of a multimolecular T cell receptor complex.

With respect to CD3, the binders of the invention preferably recognize the epsilon chain of CD3, in particular the epitope corresponding to the first 27 N-terminal amino acids of CD3 epsilon or functional fragments of this 27 amino acid range.

According to the present invention, the term "claudin-positive cancer" or a similar term means a cancer cell that expresses claudin, preferably a cancer that is associated with a cancer cell that expresses claudin on its surface.

The "cell surface" is used according to its usual meaning in the art and thus includes the outside of the cell which is accessible for binding by proteins and other molecules.

A claudin is expressed on the surface of the cell if it is located on the surface of the cell and is accessible for binding by a claudin-specific antibody applied to the cell.

In the context of the present invention, the term "extracellular portion" faces the extracellular space of a cell and is preferably from outside the cell, eg, an antigen binding molecule (eg, an antibody located outside the cell, etc.) ) Indicates a portion of a molecule (eg, protein, etc.) that can be contacted by. Preferably, the term refers to one or more extracellular loops or extracellular domains or fragments thereof.

The term "part" or the term "fragment" is used interchangeably herein to indicate a contiguous component. For example, a portion of a structure (eg, an amino acid sequence or protein) indicates a contiguous component of the structure. A portion, portion or fragment of a structure preferably comprises one or more functional properties of said structure. For example, a portion, portion or fragment of an epitope or peptide is preferably immunologically equivalent to the epitope or peptide from which they are derived. A portion or fragment of a protein sequence is preferably contiguous at least 6, in particular at least 8, at least 12, at least 15, at least 20, at least 30, at least 50 or at least 100 consecutive of the protein sequence. Contains the sequence of amino acids.

According to the present invention, CLDN18.2 is substantially not expressed in cells if the expression level is lower than that in gastric cells or tissues. Preferably, the expression level is less than 10% of expression in gastric cells or tissues, preferably less than 5%, less than 3%, less than 2%, less than 1%, less than 0.5%, 0.1%. Less than, less than 0.05%, or even lower. Preferably, CLDN18.2 is preferably expressed if the expression level exceeds the expression level in non-cancerous tissues other than the stomach by at most 2-fold, preferably at most 1.5-fold. If the expression level in the non-cancerous tissue is not exceeded, it is not substantially expressed in the cell. Preferably, CLDN18.2 is not able to allow binding by the CLDN18.2-specific antibody added to the cells if the expression level is below the detection limit and / or the expression level is too low. If so, it is not substantially expressed in the cell.

According to the present invention, the expression level of CLDN18.2 is preferably more than 2 times, preferably more than 10 times, more than 100 times, more than 1000 times the expression level in non-cancerous tissues other than the stomach. If it exceeds, or exceeds 10,000-fold, it is expressed in the cell. Preferably, if the expression level is above the detection limit and / or the expression level is high enough to allow binding by the CLDN 18.2 specific antibody added to the cell. For example, it is expressed in cells. Preferably, the CLDN 18.2 expressed in the cell is expressed or exposed on the surface of said cell.

According to the present invention, CLDN6 is substantially not expressed in cells if the expression level is lower than that in placental cells or placental tissues. Preferably, the expression level is less than 10% of expression in placental cells or placental tissues, preferably less than 5%, less than 3%, less than 2%, less than 1%, less than 0.5%, 0.1%. Less than, less than 0.05%, or even lower. Preferably, if the expression level of CLDN6 exceeds the expression level in non-cancerous tissues other than the placenta by a maximum of 2 times, preferably by a maximum of 1.5 times, the above-mentioned non-cancerous tissue is preferable. If the expression level in cancerous tissue is not exceeded, it is not substantially expressed in cells. Preferably, if the expression level of CLDN6 is below the detection limit and / or if the expression level is too low to allow binding by a CLDN6-specific antibody added to the cell, then the cell. It is not substantially expressed in.

According to the present invention, the expression level of CLDN6 is preferably more than 2 times, preferably more than 10 times, more than 100 times, more than 1000 times the expression level in non-cancerous tissues other than placenta. , Or more than 10,000-fold, it is expressed in cells. Preferably, CLDN6 is present in the cell if the expression level is above the detection limit and / or if the expression level is high enough to allow binding by the CLDN6-specific antibody added to the cell. It is expressed. Preferably, the CLDN6 expressed in the cell is expressed or exposed on the surface of the cell.

According to the present invention, the term "disease" refers to any pathological condition, including cancers, in particular such forms of cancer as described herein. Any reference herein for cancer or a particular form of cancer also includes its cancer metastases. In a preferred embodiment, the disease to be treated according to this patent application involves cells expressing claudin (CLDN), such as cells expressing CLDN 18.2 and / or CLDN 6.

"Disease associated with cells expressing CLDN" or a similar expression means that, according to the present invention, CLDN is expressed in cells of the affected tissue or organ. In one embodiment, CLDN expression in the cells of the affected tissue or organ is increased compared to the condition in a healthy tissue or organ. The increase indicates an increase of at least 10%, in particular an increase of at least 20%, an increase of at least 50%, an increase of at least 100%, an increase of at least 200%, an increase of at least 500%, an increase of at least 1000%, at least It shows an increase of 10000% or even greater. In one embodiment, expression is only found in the affected tissue, while expression in healthy tissue is suppressed. According to the present invention, diseases associated with cells expressing CLDN include cancer diseases. Moreover, according to the present invention, the cancer disease is preferably a cancer disease in which cancer cells express CLDN.

As used herein, "cancer disease" or "cancer" includes diseases characterized by abnormally regulated cell growth, cell proliferation, cell differentiation, cell adhesion and / or cell migration. .. By "cancer cell" is meant an abnormal cell that grows by rapid uncontrolled cell proliferation and continues to grow after the stimulus that initiated new growth is over. Preferably, the "cancer disease" is characterized by cells expressing CLDN, where the cancer cells express CLDN. The cells expressing CLDN are preferably cancer cells, preferably the cancerous cancer cells described herein.

The term "cancer" according to the present invention is leukemia, seminoma, melanoma, malformation, lymphoma, neuroblastoma, glioma, rectal cancer, endometrial cancer, kidney cancer, adrenal cancer, thyroid cancer, blood cancer. , Skin cancer, brain cancer, cervical cancer, intestinal cancer, liver cancer, colon cancer, stomach cancer, intestinal cancer, head and neck cancer, gastrointestinal cancer, lymph node cancer, esophageal cancer, colon-rectal cancer, pancreatic cancer, otolaryngology Includes (ENT) cancer, breast cancer, prostate cancer, uterine cancer, ovarian and lung cancer, and their metastases. Examples are lung cancers, breast cancers, prostate cancers, colon cancers, renal cell carcinomas, cervical cancers, or metastases of the cancer types or tumors described above. The term cancer, according to the invention, also includes cancer metastases.

According to the present invention, a "cancer" is a malignant tumor derived from epithelial cells. This group represents the most common cancers, including the common forms of breast, prostate, lung and colon cancers.

"Adenocarcinoma" is a cancer that originates in glandular tissue. This tissue is also part of a larger tissue category known as epithelial tissue. Epithelial tissue includes skin, glands, and various other tissues that line the cavities and organs of the body. The epithelium is embryologically derived from the ectoderm, endoderm and mesoderm. To be classified as adenocarcinoma, cells do not necessarily have to be part of a gland as long as they have secretory properties. This form of cancer can occur in some higher mammals, including humans. Well-differentiated adenocarcinomas tend to resemble the glandular tissue from which they are derived, while poorly-differentiated adenocarcinomas may not have such a tendency. By staining cells from the biopsy, the pathologist will determine if the tumor is adenocarcinoma or some other type of cancer. Various adenocarcinomas can occur in many tissues of the body due to the ubiquity of the glands within the body. Each gland may not continue to secrete the same substance, but as long as there is an exocrine function on the cell, the cell is considered to be a gland, and therefore its malignant form is called adenocarcinoma. Malignant adenocarcinomas invade other tissues and often metastasize if given sufficient time to do so. Ovarian adenocarcinoma is the most common type of ovarian cancer. This includes serous and mucinous adenocarcinomas, clear cell adenocarcinomas, and endometrioid adenocarcinomas.

"Metastasis" means that cancer cells spread from their first part to another part of the body. The formation of metastases is a very complex process, with the detachment of malignant cells from the primary tumor, invasion of the extracellular matrix, infiltration of the endothelial basement membrane for entry into body cavities and blood vessels, and then carried by the blood. After that, it depends on infiltration into the target organ. Finally, the growth of new tumors at the target site depends on angiogenesis. Tumor metastases often occur even after removing the primary tumor. This is because tumor cells or tumor components may remain and develop metastatic potential. In one embodiment, the term "metastasis" is associated with the present invention as "distal metastasis" associated with a primary tumor and metastases far from the local lymph node system. In one embodiment, the term "metastasis" is associated with lymph node metastasis according to the present invention. One particular form of metastasis that can be treated using the treatment of the present invention is metastasis originating from gastric cancer as the primary site. In a preferred embodiment, such gastric cancer metastases are Krkenberg tumors, peritoneal metastases and / or lymph node metastases.

Krkenberg tumors are rare metastatic tumors of the ovary that make up 1% to 2% of all ovarian tumors. The prognosis for Krkenberg tumors remains very poor and there is no established treatment for Krkenberg tumors. Krkenberg tumor is a metastatic signet ring cell adenocarcinoma of the ovary. The stomach is the primary site in most Krkenberg tumor cases (70%). Colon cancer, appendiceal cancer, and breast cancer (mainly invasive lobular cancer) are the next most common primary sites. Rare cases of Krkenberg tumors originating from cancers of the gallbladder, biliary tract, pancreas, small intestine, ampulla of Vater, cervix and bladder / urachus have been reported.

Preventing or eliminating the disease, including reducing the size or number of tumors in the subject by "treating"; stopping or delaying the disease in the subject; new disease Inhibiting or delaying the development of the disease in the subject; the frequency or severity and / or recurrence of the symptom in the subject currently having the disease or in the subject who has previously had the disease. To reduce; and / or to extend the life of a subject, i.e., to administer a compound or composition or a combination of compounds or compositions to a subject.

In particular, the term "treatment of a disease" includes treating the disease, shortening the duration of the disease, improving the disease, preventing the disease, slowing or inhibiting the progression or exacerbation of the disease. Includes doing, or preventing or delaying the onset or symptoms of the disease.

In the context of the present invention, terms such as "protect", "prevent", "preventive", "preventive" or "protective" refer to the prevention or treatment of the onset and / or transmission of disease in a subject. Or both, and in particular, to minimize the likelihood that the subject will develop the disease, or to slow the development of the disease. For example, a person at risk for cancer may be a candidate for treatment to prevent cancer.

By "at risk" means an object identified as having a greater than normal chance of developing a disease (especially cancer) compared to the general population. In addition, a subject who has had a disease (especially cancer), or who currently has a disease (especially cancer), is a subject who has an increased risk of developing the disease. This is because such subjects may continue to develop the disease. Subjects who have or have had cancer at this time also have an increased risk of cancer metastasis.

The term "patient", according to the invention, means a subject for treatment, particularly a subject with a disease, which includes humans, non-human primates and other animals, especially mammals. For example, cows, horses, pigs, sheep, goats, dogs, cats or rodents (eg, mice and rats) and the like. In a particularly preferred embodiment, the patient is a human.

By "target cell" is meant any undesired cell (eg, cancer cell, etc.) of any cell. In a preferred embodiment, the target cell expresses CLDN.

The term "antigen" relates to an agent (eg, protein or peptide, etc.) that contains an epitope to which an immune response is directed and / or will be directed. In a preferred embodiment, the antigen is a tumor-related antigen (eg, CLDN18.2 or CLDN6), a component of cancer cells that may be derived from the cytoplasm, cell surface and cell nucleus, particularly preferably in large amounts. , Such antigens produced intracellularly or as surface antigens on cancer cells.

In the context of the present invention, the term "tumor-related antigen" is preferably expressed specifically under normal conditions in a limited number of tissues and / or organs, or at a particular stage of development. And related to proteins that are expressed or abnormally expressed in one or more tumor tissues or cancer tissues. In the context of the present invention, tumor-related antigens are preferably associated with the cell surface of cancer cells and are not preferably or only rarely expressed in normal tissues.

The term "epitope" refers to an antigenic determinant in a molecule, i.e., a portion of a molecule recognized by the immune system, eg, a portion of a molecule recognized by an antibody. For example, an epitope is a distant three-dimensional site on an antigen that is recognized by the immune system. Epitopes usually consist of chemically active surface groups of molecules (eg, amino acids or sugar side chains), usually specific three-dimensional structural features, as well as specific. It has a charge characteristic. The conformational and non-conformational epitopes are distinguished in that the binding to the former is lost in the presence of the denaturing solvent, rather than the binding to the latter. The epitope of a protein preferably comprises a continuous or discontinuous portion of the protein, preferably an amino acid between 5 and 100 in length, preferably between 5 and 50 amino acids. , More preferably between 8 and 30, most preferably between 10 and 25 amino acids, for example, the epitopes are preferably 8 and 9, 10 in length. 11 amino acids, 12 amino acids, 13 amino acids, 14 amino acids, 15 amino acids, 16 amino acids, 18 amino acids, 19 amino acids, 20 amino acids, 22 amino acids, 23 amino acids, 24 or 25 amino acids. In some cases.

The term "antibody" refers to a glycoprotein containing at least two heavy (H) chains and two light (L) chains that are interconnected by disulfide bonds. The term "antibody" includes monoclonal antibodies, recombinant antibodies, human antibodies, humanized antibodies and chimeric antibodies. Each heavy chain is composed of a heavy chain variable region (abbreviated as VH in the present specification) and a heavy chain constant region. Each light chain is composed of a light chain variable region (abbreviated herein as VL) and a light chain constant region. The VH and VL regions are further subdivided into hypervariable regions (this are called complementarity determining regions (CDRs)), which are scattered with more conserved regions (this is called the framework regions (FR)). Can be done. Each VH and VL is composed of 3 CDRs and 4 FRs, which are arranged from the amino terminus to the carboxy terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain binding domains that interact with the antigen. The constant region of the antibody mediates the binding of immunoglobulins to host tissues or factors, including various cells of the immune system (eg, effector cells) and the first component of the classical complement system (Clq). In some cases.

The term "monoclonal antibody" as used herein refers to a preparation of antibody molecules of monomolecular composition. Monoclonal antibodies exhibit a single binding specificity and affinity. In one embodiment, the monoclonal antibody is produced by a hybridoma containing B cells obtained from a non-human animal (eg, a mouse) fused to an immortalized cell.

The term "recombinant antibody" as used herein includes all antibodies prepared, expressed, produced or isolated by recombinant means: eg, (a) immunity. Antibodies isolated from animals that are genetically or chromosomally recombinant for globulin genes (eg, mice) or from hybridomas prepared from such animals; (b) Host cells transformed to express the antibody. Antibodies isolated from, such as those isolated from transfectomas; (c) antibodies isolated from recombinant combinatorial antibody libraries; and (d) splicing immunoglobulin gene sequences into other DNA sequences. An antibody that is prepared, expressed, produced, or isolated by any other means that accompanies it.

As used herein, the term "human antibody" is intended to include antibodies having variable and constant regions derived from immunoglobulin sequences of the human germline. Human antibodies contain amino acid residues that are not encoded by immunoglobulin sequences of the human germline (eg, mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutations in vivo). In some cases.

The term "humanized antibody" is a molecule having an antigen-binding site that is substantially derived from an immunoglobulin obtained from a non-human species, and the remaining immunoglobulin structure of the molecule is the structure and / or sequence of a human immunoglobulin. Indicates a molecule based on. The antigen binding site may include either the fully variable domain fused to the constant domain or only the complementarity determining regions (CDRs) grafted into the appropriate framework region in the variable domain. The antigen binding site may be wild-type, or it may be modified by one or more amino acid substitutions, for example, it may be modified to more closely resemble human immunoglobulin. Some forms of humanized antibodies retain all CDR sequences (eg, humanized mouse antibodies containing all six CDRs derived from mouse antibodies). Other forms have one or more CDRs that are altered with respect to the original antibody.

The term "chimeric antibody" means that each one portion of the heavy and light chain amino acid sequences is homologous to the corresponding sequence in an antibody derived from a particular species or an antibody belonging to a particular class, while , Indicates such an antibody in which the remaining segment of the chain is homologous to the corresponding sequence in another antibody. Typically, the variable regions of both the light and heavy chains resemble the variable regions of an antibody from one species of mammal, while the constant portion is an antibody from another species. Is homologous to the sequence of. One distinct advantage over such chimeric forms is that the variable regions are conveniently readily available from non-human host organisms, eg, in combination with constant regions derived from human cell preparations. It means that cells or hybridomas can be used to derive from currently known sources. The variable region has the advantage of being easy to prepare and the specificity is unaffected by the source, but the constant region being human means that when the antibody is injected, the immune response is tested in humans. It is less likely to be elicited from the body than would be elicited by constant regions from non-human sources. However, the definition is not limited to this particular example.

Antibodies may come from a variety of species, including but not limited to mice, rats, rabbits, guinea pigs and humans.

Antibodies described herein include IgA antibodies (eg, IgA1 or IgA2 antibodies), IgG1 antibodies, IgG2 antibodies, IgG3 antibodies, IgG4 antibodies, IgE antibodies, IgM antibodies and IgD antibodies. In various embodiments, the antibody is an IgG1 antibody, more specifically an IgG1 kappaisotype or an IgG1 ramdysotype (ie, IgG1, κ, λ), an IgG2a antibody (eg, IgG2a, κ, λ), an IgG2b antibody. (Eg, IgG2b, κ, λ), IgG3 antibody (eg, IgG3, κ, λ) or IgG4 antibody (eg, IgG4, κ, λ).

As used herein, "heterologous antibody" is defined in relation to a genetically modified animal that produces such an antibody. The term refers to an antibody that has an amino acid sequence found in an organism that does not consist of a genetically modified organism or a corresponding nucleic acid sequence that encodes it, and is generally derived from a species other than the genetically modified organism.

As used herein, "heterohybrid antibody" refers to an antibody having light and heavy chains of different biological origin. For example, an antibody having a human heavy chain with a mouse light chain is a heterohybrid antibody.

The antibodies described herein are preferably isolated. An "isolated antibody", as used herein, is intended to represent an antibody that is substantially free of other antibodies with different antigen specificities (eg, specific to CLDN18.2). The isolated antibody that binds specifically contains no antibody that specifically binds to an antigen other than CLDN18.2. However, an isolated antibody that specifically binds to an epitope, isotype or variant of human CLDN18.2 may be, for example, another related antigen from another species (eg, a species homologue of CLDN18.2). May have cross-reactivity to. Moreover, the isolated antibody may be substantially free of other cellular and / or chemicals. In one embodiment of the invention, the combination of "isolated" monoclonal antibodies relates to the combination of various antibodies with different specificities and in a well-defined composition or mixture. ..

The term "antigen-binding portion" (or simply "binding portion") of an antibody or "antigen-binding fragment" (or simply "binding fragment") of an antibody or a similar term refers to the ability to specifically bind to an antigen. Indicates one or more fragments of the antibody to be retained. It has been shown that the antigen-binding function of an antibody can be accomplished by a fragment of a full-length antibody. Examples of binding fragments that fall within the term "antigen binding portion" of an antibody include (i) Fab fragments, i.e. monovalent fragments consisting of VL domains, VH domains, CL domains and CH domains; (Ii) F (ab') 2 fragments, i.e. divalent fragments containing two Fab fragments linked by disulfide bridges in the hinge regions; (iii) Fd fragment consisting of VH and CH domains; (iv) antibody. Fv fragment consisting of VL domain and VH domain of only one arm; (v) dAb fragment consisting of VH domain (Ward et al. (1989), Nature, 341: 544-546); (vi) isolated Complementarity determining regions (CDRs); as well as combinations of two or more isolated CDRs that may be optionally linked by (vii) synthetic linkers. Moreover, although the two domains of the Fv fragment, VL and VH, are encoded by separate genes, they are monovalent molecules in which the VL and VH regions are paired (which is a single chain). It can be linked using recombinant methods (eg, Bird et al. (1988)) by a synthetic linker that allows it to be made as a single protein chain forming (known as Fv (scFv)). , Science, 242: 423-426, and Huston et al. (1988), Proc. Natl. Acad. Sci. USA, 85: 5879-5883). Such single chain antibodies are also intended to be included within the term "antigen binding fragment" of the antibody. Further examples are (i) a binding domain polypeptide fused to an immunoglobulin hinge region polypeptide, (ii) an immunoglobulin heavy chain CH2 constant region fused to a hinge region, and (iii) fused to a CH2 constant region. It is a binding domain / immunoglobulin fusion protein containing an immunoglobulin heavy chain CH3 constant region. The binding domain polypeptide can be a heavy chain variable region or a light chain variable region. Binding domain-immunoglobulin fusion proteins are further disclosed in US Patent Application Publication Nos. 2003/0118592 and 2003/01333939. These antibody fragments are obtained using conventional techniques known to those of skill in the art, and the fragments are screened for usefulness in the same manner as intact antibodies are screened.

The term "binding domain" is characterized in the context of the present invention by structures that bind / interact with a given target structure / antigen / epitope (eg, antibody structure). Therefore, the binding domain according to the present invention indicates an "antigen interaction site".

All antibodies and derivatives of antibodies as described herein for the purposes of the present invention (eg, antibody fragments, etc.) are included by the term "antibody". The term "antibody derivative" refers to any modified form of an antibody, eg, a conjugate of an antibody with another agent or antibody, or an antibody fragment. In addition, antibodies and antibody derivatives as described herein are useful for producing the binders of the invention (eg, antibody fragments, etc.).

Naturally occurring antibodies are generally unispecific. That is, naturally occurring antibodies bind to only one antigen. The present invention provides a binder that binds to cytotoxic cells (by associating with a CD3 receptor) and also to cancer cells (by associating with CLDN). The binder of the present invention is at least bispecific or multispecific (eg, trispecific, quadrispecific, etc.).

The binder of the present invention may be in the form of an antibody molecule, an antibody-like molecule, a protein scaffold having antibody-like properties, or a cyclic peptide having at least two binding specificities. is there. Thus, the binder may include one or more antibodies or fragments thereof as described herein.

According to the present invention, bispecific molecules, especially bispecific proteins such as bispecific antibodies, have two different binding specificities and thus two different types of antigens (eg, bispecific antibodies). , CLDN and CD3, etc.). In particular, the term "bispecific antibody", as used herein, comprises two antigen binding sites, the first binding site having an affinity for the first antigen or epitope, and. , The second binding site indicates an antibody having an affinity for a second antigen or epitope that is different from the first antigen or epitope. Specifically, a bispecific antibody is composed of fragments of two different antibodies (in this case, the fragments of the two different antibodies form two binding domains), and as a result, An artificial protein that binds to two different types of antigens. Bispecific antibodies according to the invention can be used against immune cells (eg, immune effector cells, etc.), especially against T cells (eg, cytotoxic cells, etc.) (by binding to CD3). Is engineered to simultaneously bind to target cells such as cancer cells (by binding to the tumor-related antigen CLDN) to be destroyed.

The term "bispecific antibody" also includes diabodies. The diabodies use linkers in which the VH and VL domains are expressed in a single polypeptide chain, but are too short to allow pairing between these two domains in the same chain. , A bivalent bispecific antibody that forces these domains to pair with complementary domains of another strand, resulting in two antigen binding sites (eg, Holliger, P. et al. (Eg, Holliger, P. et al.). 1993), Proc. Natl. Acad. Sci. USA, 90: 6444-6448; Poljak, RJ et al. (1994), Structure, 2: 1121-1123).

A "multispecific binder" is a molecule having three or more different binding specificities.

Particularly preferred according to the present invention are bispecific antibodies comprising bispecific antibody fragments, and in particular bispecific single chain antibodies comprising bispecific single chain antibody fragments. The term "bispecific single chain antibody" means a single polypeptide chain containing two binding domains. In particular, the term "bispecific single chain antibody" or the term "single chain bispecific antibody" or related term according to the invention preferably has at least two antibody variable regions present in the complete immunoglobulin. Means an antibody construct resulting from ligation in a single polypeptide chain lacking a constant and / or Fc moiety.

For example, a bispecific single chain antibody has a total of two antibody variable regions (eg, two VH regions, each capable of specifically binding to a separate antigen) via a short polypeptide spacer. It may be a construct that is tethered to each other so that these two antibody variable regions with spacers placed between them exist as a single continuous polypeptide chain. Another example of a bispecific single chain antibody may be a single polypeptide chain having three antibody variable regions. Here, two antibody variable regions, for example, one VH and one VL, may constitute scFv in which these two antibody variable regions are linked to each other via a synthetic polypeptide linker, but in this case, The latter are often genetically engineered to be minimally immunogenic, while remaining maximally resistant to proteolysis. This scFv is linked to an additional antibody variable region (eg, VH region) that can specifically bind to a particular antigen and can bind to an antigen different from the antigen to which the scFv binds. Yet another example of a bispecific single chain antibody may be a single polypeptide chain having four antibody variable regions. Here, the first two antibody variable regions may form, for example, one scFv in which the VH region and the VL region can bind to one antigen, whereas the second VH Regions and VL regions may form a second scFv capable of binding to another antigen. Within a single contiguous polypeptide chain, individual antibody variable regions of one particularity may be conveniently separated by a synthetic polypeptide linker, whereas each scFv is conveniently separated. It may be separated by a short polypeptide spacer as described above.

According to one embodiment of the invention, the first binding domain of a bispecific antibody comprises one antibody variable domain, preferably a VHH domain. According to one embodiment of the invention, the first binding domain of a bispecific antibody comprises two antibody variable domains, preferably scFv, i.e. VH-VL or VL-VH. According to one embodiment of the invention, the second binding domain of the bispecific antibody comprises one antibody variable domain, preferably the VHH domain. According to one embodiment of the invention, the second binding domain of the bispecific antibody comprises two antibody variable domains, preferably scFv, i.e. VH-VL or VL-VH. Therefore, in its smallest form, the total number of antibody variable regions in the bispecific antibody according to the invention is only two. For example, such an antibody may include two VH domains or two VHH domains.

According to one embodiment of the invention, each of the first and second binding domains of a bispecific antibody comprises one antibody variable domain, preferably a VHH domain. According to one embodiment of the invention, each of the first and second binding domains of a bispecific antibody comprises two antibody variable domains, preferably scFv, i.e., VH-VL or VL. -Includes VH. In this embodiment, the binder of the present invention is preferably (i) the heavy chain variable domain (VH) of the CLDN antibody, (ii) the light chain variable domain (VL) of the CLDN antibody, and (iii) the heavy chain of the CD3 antibody. It contains a variable domain (VH) and a light chain variable domain (VL) of the (iv) CD3 antibody.

A bispecific full-length antibody may be obtained by covalently linking two monoclonal antibodies or by conventional hybrid-hybridoma techniques. Covalently linking two monoclonal antibodies is described in Anderson, Blood, 80 (1992), 2826-34. In the context of the present invention, one of these antibodies is specific for CLDN and the other antibody is specific for CD3.

In one embodiment, the bispecific binder has a heavy chain containing two consecutive N-terminal variable domains with different specificities and a light chain having two consecutive variable domains with different specificities. It is in the form of an antibody-like molecule that has a chain, resulting in four binding domains with two different specificities (Wu et al., Nat. Biotechnology, 2007, 25 (11)), provided that in this case, One specificity is CD3 and the other specificity is CLDN.

In a preferred embodiment, the bispecific binder of the invention is in the form of an antibody fragment.

In one embodiment, the bispecific molecule according to the invention comprises two Fab regions, one for CLDN and the other for CD3. In one embodiment, the molecule of the invention is an antigen binding fragment (Fab) 2 complex. The Fab2 complex is composed of two Fab fragments, in which case one Fab fragment contains an Fv domain specific for the CD3 antigen (ie, VH domain and VL domain) and the other Fab fragment is CLDN. Includes an Fv domain specific for. Each of these Fab fragments may consist of two single strands, i.e., a VL-CL module and a VH-CH module. In the alternative, each of the individual Fab fragments may be located in a single strand, preferably in VL-CL-CH-VH, and the individual variable and constant domains are peptide linkers. May be connected by. In general, individual single chains and Fab fragments may be linked via disulfide bonds, adhesive domains, chemically linked, and / or peptide linkers. Bispecific molecules may also contain three or more Fab fragments, in particular the molecule is a Fab3, Fab4 or multimer Fab having specificity for two, three, four or more different antigens. It may be a complex. The present invention also includes chemically linked Fabs.

In one embodiment, the binder according to the invention comprises various types of divalent and trivalent single chain variable fragments (scFv), ie fusion proteins that mimic the variable domains of the two antibodies. A single chain variable fragment (scFv) is a fusion protein in which the variable regions of the heavy and light chains (VH) and light chains (VL) of an immunoglobulin are linked by a short linker peptide of 10 to about 25 amino acids. Linkers are usually rich in glycine for flexibility and also for serine or threonine for solubility, connecting the N-terminus of VH to the C-terminus of VL, or conversely, the N-terminus of VL. Can be connected to the C-terminus of VH. A divalent, bivalent single chain variable fragment (di-scFv, bi-scFv) can be manipulated by concatenating two scFvs. This can be done by creating a single peptide chain with two VH regions and two VL regions, which results in a tandem scFv. The present invention also includes multispecific molecules containing three or more scFv binding domains. This means that the molecule contains multiple antigen specificities and is a trispecific molecule, a quadruplex specific molecule or a multispecific molecule, or two or more scFv molecules having specificity for the same antigen It allows both to be a bispecific molecule containing a binding domain. In particular, the molecule of the present invention may be a multispecific single chain Fv.

Another possibility is to use a linker peptide (about 5 amino acids) that is too short for the two variable regions to fold together, thereby creating a scFv that forces the scFV to dimerize. is there. This type is known as the diabody. Even shorter linkers (one or two amino acids) cause the formation of trimers (so-called tribodies or tribodies). Tetra bodies have also been made. They show even greater affinity for their targets than diabodies.

A particularly preferred example of a bispecific antibody fragment is diabodies (Kipryanov, Int. J. Cancer, 77 (1998), 763-772), which are small divalent and bispecific antibody fragments. The diabodies are light chains in the same polypeptide chain (VH-VL) that are linked by a peptide linker that is too short to allow pairing of heavy chain variable domains (VH) between two domains in the same chain. Included linked to a variable domain (VL). This forces pairing with the complementary domain of another strand and facilitates the assembly of dimeric molecules with two functional antigen binding sites. In order to construct the bispecific diabodies of the present invention, the V domains of the anti-CD3 antibody and the anti-CLDN antibody are two chains of VH (CD3) -VL (CLDN) and VH (CLDN) -VL (CD3). May be fused to create. Each strand alone cannot bind to its respective antigen, but reforms the functional antigen-binding sites of anti-CD3 and anti-CLDN antibodies when paired with the other strand. To this end, peptide linkers that are too short to allow pairing between two domains on the same strand are used. Together with a linker between the heavy and light chain variable domains that are too short for intramolecular dimerization, these two scFv molecules are co-expressed, self-assembled, and contradict the two binding sites. Form a bispecific molecule with.

In one embodiment, the multispecific molecule according to the invention comprises a variable domain (VH, VL) and a constant domain (C) of immunoglobulin. In one embodiment, the bispecific molecule is a minibody, preferably a minibody comprising two single VH-VL-C chains linked to each other via the constant domain (C) of each chain. Is. According to this aspect, the corresponding variable heavy chain region (VH), the corresponding variable light chain region (VL), and the constant domain (C) are VH (CLDN) -VL (CLDN) from the N-terminus to the C-terminus. )-(C) and VH (CD3) -VL (CD3) -C (in the formula, C is preferably the CH3 domain). The pairing of stationary domains results in the formation of minibodies.

According to another particularly preferred aspect, the bispecific binding agent of the present invention comprises or comprises at least two binding domains, whereby one of the domains becomes a CLDN. It is a form of bispecific single chain antibody construct that binds and the second domain binds to CD3. Such a molecule is also referred to as a "bispecific T cell engager" (BiTE) (the term BiTE refers to a bispecific molecule in which one arm is specific for CD3. It consists of two scFv molecules linked via a linker peptide).

As used herein, "bispecific single chain antibody" means a single polypeptide chain that contains two binding domains. Each binding domain contains a variable region (“VH region”) from the antibody heavy chain, where the VH region of the first binding domain specifically binds to the CLDN and the VH of the second binding domain. The region specifically binds to CD3. These two binding domains are optionally linked together by short polypeptide spacers. An unrestricted example of a polypeptide spacer is Gly-Gly-Gly-Gly-Ser (G-G-G-GS) and its repeats. Each binding domain may further include one variable region (“VL region”) from the antibody light chain, in which case the VH region and the VH region within each of the first and second binding domains. The VL regions are linked together via a polypeptide linker long enough to allow the VH and VL regions of the first binding domain and the VH and VL regions of the second binding domain to pair with each other. To.

According to this aspect, the corresponding variable heavy chain region (VH) and the corresponding variable light chain region (VL) are VH (CLDN) -VL (CLDN) -VH (CD3) -VL from the N-terminus to the C-terminus. (CD3), VH (CD3) -VL (CD3) -VH (CLDN) -VL (CLDN), or VH (CD3) -VL (CD3) -VL (CLDN) -VH (CLDN) Arranged in order. However, the bispecific single chain antibody of the present invention has other domain arrangements, such as VL (CLDN) -VH (CLDN) -VH (CD3) -VL (CD3), VL (CLDN) -VH (CLDN). -VL (CD3) -VH (CD3), VH (CLDN) -VL (CLDN) -VL (CD3) -VH (CD3), VL (CD3) -VH (CD3) -VH (CLDN) -VL (CLDN) , VL (CD3) -VH (CD3) -VL (CLDN) -VH (CLDN) and the like are also envisioned.

Long linkers generally connect the corresponding variable heavy chain region (VH) and the corresponding variable light chain region (VL) to result in a scFv binding domain, while short linkers generally connect two scFv binding domains. Linkers are generally designed to provide flexibility and protease resistance, preferably the linker contains amino acid residues of glycine and / or serine. Short peptide linkers are from 12 or less amino acids, for example from 11, 10, 9, 8, 7, 7, 6, 5, 4, 3, or 2 amino acids, preferably 5. It may consist of 6 or 6 amino acids. The short peptide linker preferably comprises the amino acid sequence of SGGGGSS or GGGGS. A long peptide linker may consist of 12 or more amino acids, eg, 15-25 amino acids or 15-20 amino acids or 15-18 amino acids. The long peptide linker preferably comprises the amino acid sequence of (GGGGS) 3 or VE (GGSGGS) 2GGVD. The longer peptide linker may contain the amino acid sequence of (GGGGS) 4, (GGGGS) 5 or GGGGS (GGS) 3GGGS.

Binders according to the invention also have an amino acid sequence to facilitate the secretion of the molecule (eg, N-terminal secretory signal, etc.) and / or one or one that facilitates binding, purification or detection of the molecule. May contain multiple epitope tags.

Preferably, the secretory signal is a signal sequence that allows sufficient passage of the secretory pathway and / or secretion of the binding agent into the extracellular environment (eg, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, A signal sequence selected from any one of SEQ ID NOs: 55). Preferably, the secretory signal sequence is cleaveable and excluded from the mature binder. The secretory signal sequence is preferably selected for the cell or organism from which the binder is produced.

The amino acid sequence of the epitope tag may be introduced at any position in the amino acid sequence of the binder, and may take the form of a loop within the encoded protein structure, or , May be fused to the binder at the N-terminus or C-terminus. Preferably, the epitope tag is fused to the binder at the C-terminus. Epitope tags may contain cleavage sites that allow the tag to be removed from the binder. The epitope tag can be any kind of epitope tag that is functional under natural and / or denaturing conditions, preferably a histidine tag, most preferably 6 histidines. It is a tag to include.

In addition to the first and second binding mains, the bispecific binding agents of the present invention may contain, for example, additional binding domains that help increase selectivity for tumor cells. This can be achieved, for example, by providing a binding domain that binds to other antigens expressed on tumor cells.

In the context of the present invention, the prepared binders are preferably capable of inducing immune effector function as described herein. Preferably, the immune effector function is for cells having the tumor-related antigen CLDN on its surface.

The term "immune effector function" is used in the context of the present invention, which is mediated by components of the immune system that result in inhibition of tumor growth and / or inhibition of tumor development, including, for example, inhibition of tumor dissemination and metastasis. Also includes such functions. Preferably, the immune effector function results in the killing of tumor cells. Such functions include complement-dependent cellular cytotoxicity (CDC), antibody-dependent cell-mediated cytotoxicity (ADCC), antibody-dependent cell-mediated phagocytosis (ADCP), and induction of apoptosis in cells carrying tumor-related antigens. , Cell lysis of cells with tumor-related antigens, and / or inhibition of proliferation of cells with tumor-related antigens. Binders may also be affected by simply binding to tumor-related antigens on the surface of cancer cells. For example, antibodies may block the function of tumor-related antigens or induce apoptosis by simply binding to tumor-related antigens on the surface of cancer cells.

The binders described herein may be conjugated to therapeutic ingredients or agents, such as cytotoxicities, drugs (eg, immunosuppressants) or radioisotopes. May occur. Cytotoxic or cytotoxic agents include any agent that is harmful to the cell and specifically kills the cell. Examples include taxol, cytocaracin B, gramicidin D, ethidium bromide, emetin, mitomycin, etoposide, tenoposide, vincristine, vinblastine, corhitin, doxorubicin, daunorubicin, dihydroxyanthracycline (dihydrocindy) Includes thoron, mitomycin, actinomachine D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, proplanolol and puromycin and their analogs and homologs. Suitable therapeutic agents for forming conjugates include, but are not limited to: metabolic antagonists (eg, methotrexate, 6-mercaptopurine, 6-thioguanine, citarabin, fludarabin, 5). -Fluorouracil decarbazine), alkylating agents (eg, mechloretamine, thioepa, chlorambucil, melphalan, carmustin (BSNU) and romustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and , Cis-dichlorodiamine platinum (II) (DDP) (cisplatin)), anthracyclines (eg, daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (eg, dactinomycin (formerly actinomycin), bleomycin) , Mitramycin and anthracycline (AMC)), and thread mitotic inhibitors (eg, vincristine and vinblastine). In a preferred embodiment, the therapeutic agent is a cytotoxic agent or a radiotoxic agent. In another embodiment, the therapeutic agent is an immunosuppressant. In yet another embodiment, the therapeutic agent is GM-CSF. In a preferred embodiment, the therapeutic agent is doxorubicin, cisplatin, bleomycin, sulfate, carmustine, chlorambucil, cyclophosphamide or lysine A.

Binders can also be conjugated to radioisotopes (eg, iodine-131, yttrium-90 or indium-111) to make cytotoxic radiopharmaceuticals.

Various techniques for conjugating such therapeutic components into antibodies are widely known. For example, Arnon et al., "Monoclonal Antibodies For Immunotarging Of Drugs In Cancer Therapy", Monoclonal Antibodies And Cancer (P. 198), R. Antibodies For Drug Delivery ", Controlled Drug Delivery (2nd edition), Robinson et al. (Ed.), pp. 623-53 (Marcel Decker, Inc., 1987); Antibody, Anti. ", Monoclonal Antibodies'84: Biological And Clinical Applications, Pinchera other (eds.), 475 pp. ~506 (1985);" Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy ", Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (Edit), pp. 303-16 (Academic Press, 1985), and Tope et al., "The Preparation And Cytotoxic Properties Antibody" Rev. , 62 (1982), 119-58.

The term "binding (sex)", according to the invention, preferably relates to a specific binding.

According to the present invention, an agent such as an antibody can bind to a given target if it has a significant affinity for the given target and binds to this given target in a standard assay. .. "Affinity" or "binding affinity" is often measured by the equilibrium dissociation constant (KD). Preferably, the term "significant affinity" is ^10-5 M or less, ^10-6 M or less, ^10-7 M or less, ^10-8 M or less, ^10-9 M or less, ^10-10 M or less, ^10-11. It is shown to bind to a given target by a dissociation constant (KD) of M or less or 10-12 M or less.

The agent has no significant affinity for the target and does not bind significantly (substantially) to this target, especially if it does not bind significantly to this label in a standard assay. ) Cannot be combined. Preferably, the agent is present if the target is present at a concentration of up to 2 μg / ml, preferably at a concentration of up to 10 μg / ml, more preferably at a concentration of up to 20 μg / ml. In particular, if present at concentrations up to 50 μg / ml or 100 μg / ml or higher, it will not detectably bind to said target. Preferably, the agent, by at least 10 times greater KD than KD for binding to a given target can be the agent binds, by 100 times greater KD by 10 ^three times larger KD by 10 ⁴ times larger KD by 10 ⁵ times larger KD, or, if it binds to the target by 10 ⁶ times greater KD, has no significant affinity for the target. For example, if the agent has a KD of ^10-7 M for binding to a target to which this agent can bind, then the KD for binding to a target to which this agent has no significant affinity is at least. It seems to be ^10-6 M, ^10-5 M, 10 ^-4 M, 10 ^-3 M, 10 ^-2 M or 10 ^{-1 M.}

If an agent such as an antibody is capable of binding to a given target, while not being able to bind to another target, that is, it has no significant affinity for the other target and , If it does not bind significantly to other targets in a standard assay, it is specific for this given target. According to the present invention, the agent is specific for CLDN if the agent is capable of binding to CLDN, but not (substantially) to other targets. Preferably, a transmembrane protein other than a protein whose affinity and binding to such other targets is not related to CLDN (eg, bovine serum albumin (BSA), casein, human serum albumin (HSA)) or claudin (eg, eg). An agent is specific for CLDN if it does not significantly exceed its affinity or binding to (such as MHC molecule or transferrin receptor) or some other designated polypeptide). Preferably, the agent is 104 minutes by KD, which is at least 1/10 of the KD for binding to a non-specific target, by KD, which is 1/100, and by KD, which is 1/103. It is specific to a given target if it binds to a given target by a KD of 1, a KD of 1/105, or a KD of 1/106. For example, if the agent has a KD of ^10-7 M for binding to a target to which this agent is specific, then the KD for binding to a target to which this agent is not specific is at least ^10-6 M. It seems to be ^10-5 M, 10 ^-4 M, 10 ^-3 M, 10 ^-2 M or 10 ^{-1 M.}

Binding of the agent to the target in any suitable method (eg, Berzofsky et al., "Antibody-Antigen Interactions", Fundamental Immunology, Paul, WE, ed., Raven Press New York, NY (1984); , Immunology, WH Freeman and Company, New York, NY (1992)) and the methods described herein can be used experimentally. Affinity using conventional techniques, such as by equilibrium dialysis; by using the BIAcore 2000 device using general procedures outlined by the manufacturer; radiolabeled target antigens. It may be readily determined by the radioimmunoassay used; or by another method known to those of skill in the art. Affinity data may be analyzed, for example, by the method of Scatchard et al. (Ann NY Acad. ScL, 51: 660 (1949)). The measured affinity of a particular antibody-antigen interaction can be different if measured under different conditions (eg, salt concentration, pH). Therefore, measurements of affinity and other antigen binding parameters (eg, KD, IC50) are preferably performed using standardized solutions of antibodies and antigens as well as standardized buffers.

As used herein, "isotype" refers to an antibody class encoded by a heavy chain constant region gene (eg, IgM or IgG1).

As used herein, "isotype switching" refers to the phenomenon in which an antibody class, i.e., an antibody isotype, changes from one Ig class to one of the other Ig classes.

The term "naturally occurring" refers to the fact that an object can be found in nature when used herein as applied to an object. For example, a polypeptide or polynucleotide sequence present in an organism (including a virus) that can be isolated from a natural source and has not been deliberately modified by humans in the laboratory is naturally present. doing.

As used herein, the term "reorganized" means that the V segment is directly adjacent to the DJ segment or J segment in a conformation that encodes an essentially complete VH or VL domain, respectively. The arrangement of the heavy chain immunoglobulin locus or the light chain immunoglobulin locus is shown. The locus of the rearranged immunoglobulin (antibody) gene can be identified by comparison to germline DNA; the rearranged locus has at least one recombinant heptamer / nonamar homology element. Will.

As the term "unreorganized arrangement" or the term "genital line arrangement" is used herein in connection with the V segment, the V segment appears to be directly adjacent to the D or J segment. Indicates a non-recombinant arrangement.

In one embodiment, the binder of the invention has the ability to bind to CLDN18.2, i.e., the ability to bind to an epitope present in CLDN18.2., preferably the extracellular domain of CLDN18.2, especially the first. It has the ability to bind to an epitope located in the extracellular loop, preferably in amino acid positions 29 to 78) of CLDN 18.2. In certain embodiments, an agent capable of binding to CLDN 18.2 binds to an epitope on CLDN 18.2 that is not present on the surface of CLDN 18.1.

Agents capable of binding to CLDN18.2 preferably bind to CLDN18.2 but not to CLDN18.1. Preferably, the agent capable of binding to CLDN 18.2 is specific for CLDN 18.2. Preferably, the agent capable of binding to CLDN 18.2 binds to CLDN 18.2 expressed on the cell surface. In certain preferred embodiments, an agent capable of binding to CLDN 18.2 binds to a native epitope of CLDN 18.2 present on the surface of living cells.

In a preferred embodiment, the agent capable of binding to CLDN 18.2 is selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 and fragments thereof. Contains a heavy chain variable region (VH) containing the amino acid sequence.

In a preferred embodiment, agents capable of binding to CLDN 18.2 are SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 18, Includes a light chain variable region (VL) containing an amino acid sequence selected from the group consisting of number 19 and fragments thereof.

In certain preferred embodiments, the agent capable of binding to CLDN18.2 is a heavy chain variable region (VH) and a light chain variable region (VH) selected from the following possibilities (i) to (ix): VL) combination included:
(I) VH comprises the amino acid sequence represented by SEQ ID NO: 5 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 12 or a fragment thereof;
(Ii) VH comprises the amino acid sequence represented by SEQ ID NO: 6 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 11 or a fragment thereof;
(Iii) VH comprises the amino acid sequence represented by SEQ ID NO: 7 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 13 or a fragment thereof;
(Iv) VH comprises the amino acid sequence represented by SEQ ID NO: 9 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 16 or a fragment thereof;
(V) VH comprises the amino acid sequence represented by SEQ ID NO: 8 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 15 or a fragment thereof;
(Vi) VH comprises the amino acid sequence represented by SEQ ID NO: 10 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 14 or a fragment thereof;
(Vii) VH comprises the amino acid sequence represented by SEQ ID NO: 10 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 17 or a fragment thereof;
(Viii) VH comprises the amino acid sequence represented by SEQ ID NO: 10 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 18 or a fragment thereof;
(IX) VH comprises the amino acid sequence represented by SEQ ID NO: 10 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 19 or a fragment thereof.

In a particularly preferred embodiment, agents capable of binding to CLDN 18.2 include the following combinations of heavy chain variable region (VH) and light chain variable region (VL):
VH comprises the amino acid sequence represented by SEQ ID NO: 8 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 15 or a fragment thereof.

In a further particularly preferred embodiment, agents capable of binding to CLDN 18.2 include the following combinations of heavy chain variable region (VH) and light chain variable region (VL):
VH comprises the amino acid sequence represented by SEQ ID NO: 6 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 11 or a fragment thereof.

The term "fragment" specifically refers to one or more of the complementarity determining regions (CDRs) of the heavy chain variable regions (VH) and / or the light chain variable regions (VL), preferably at least the heavy chain variable regions (V). The CDR3 variable regions of the VH) and / or light chain variable regions (VL) are shown. In one embodiment, said one or more of the complementarity determining regions (CDRs) are selected from a set of complementarity determining regions (CDR1, CDR2 and CDR3). In a particularly preferred embodiment, the term "fragment" refers to CDR1, CDR2 and CDR3 of the complementarity determining regions of the heavy chain variable region (VH) and / or the light chain variable region (VL).

In one embodiment, binders such as those described herein that include one or more CDRs, a set of CDRs, or a combination of multiple CDRs, said the CDRs with their intervening framework regions. Include together. Preferably, the portion will also include at least about 50% of either or both of the first and fourth framework regions, where the 50% is the C-terminal 50% of the first framework region. And 50% on the N-terminal side of the fourth framework area. The construction of the binding agent produced by recombinant DNA technology is to connect the variable regions of the invention to additional protein sequences containing immunoglobulin heavy chains, other variable domains (eg, in the production of diabodies) or protein labels. It may result in the introduction of N-terminal or C-terminal residues of the variable region encoded by the linker introduced to facilitate cloning or other manipulation steps, including the introduction of the linker.

In one embodiment, a binder as described herein comprising one or more CDRs, a set of CDRs or a combination of multiple CDRs comprises said CDRs within the human antibody framework. ..

In one embodiment, the binding agents of the invention have the ability to bind to CLDN6, i.e., the ability to bind to an epitope present in CLDN6, preferably the extracellular domain of CLDN6, particularly the first extracellular loop, preferably. Has the ability to bind to an epitope located within amino acid positions 28-76 of CLDN6, or a second extracellular loop, preferably amino acid positions 141-amino acid positions 159) of CLDN6. In certain embodiments, agents capable of binding to CLDN6 bind to an epitope on CLDN6 that is not present on the surface of CLDN9. Preferably, the agent capable of binding to CLDN6 binds to an epitope on CLDN6 that is not present on the surface of CLDN4 and / or CLDN3. Most preferably, agents capable of binding to CLDN6 bind to epitopes on CLDN6 that are not present on the surface of CLDN proteins other than CLDN6.

An agent capable of binding to CLDN6 preferably binds to CLDN6 but not to CLDN9 and preferably does not bind to CLDN4 and / or CLDN3. Preferably, the agent capable of binding to CLDN6 is specific for CLDN6. Preferably, the agent capable of binding to CLDN6 binds to CLDN6 expressed on the cell surface. In certain preferred embodiments, agents capable of binding to CLDN6 bind to the native epitope of CLDN6 present on the surface of living cells.

In a preferred embodiment, the agent capable of binding to CLDN6 is a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26 and fragments thereof. VH) is included.

In a preferred embodiment, the agents capable of binding to CLDN6 are SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99. , A light chain variable region (VL) comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 100 and fragments thereof.

In certain preferred embodiments, the agent capable of binding to CLDN6 is a heavy chain variable region (VH) and a light chain variable region (VL) selected from the following possibilities (i) to (xi): Including combinations of:
(I) VH comprises the amino acid sequence represented by SEQ ID NO: 20 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 21 or a fragment thereof;
(Ii) VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 23 or a fragment thereof;
(Iii) VH comprises the amino acid sequence represented by SEQ ID NO: 24 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 25 or a fragment thereof;
(Iv) VH comprises the amino acid sequence represented by SEQ ID NO: 26 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 27 or a fragment thereof;
(V) VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 21 or a fragment thereof;
(Vi) VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 28 or a fragment thereof;
(Vii) VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 29 or a fragment thereof;
(Viii) VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 97 or a fragment thereof;
(Ix) VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 98 or a fragment thereof;
(X) VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 99 or a fragment thereof;
(Xi) VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 100 or a fragment thereof.

In a particularly preferred embodiment, agents capable of binding to CLDN6 include the following combinations of heavy chain variable region (VH) and light chain variable region (VL):
VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 23 or a fragment thereof.

In a further particularly preferred embodiment, agents capable of binding to CLDN6 include the following combinations of heavy chain variable region (VH) and light chain variable region (VL):
VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 97 or a fragment thereof.

In a further particularly preferred embodiment, agents capable of binding to CLDN6 include the following combinations of heavy chain variable region (VH) and light chain variable region (VL):
VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 98 or a fragment thereof.

In a further particularly preferred embodiment, agents capable of binding to CLDN6 include the following combinations of heavy chain variable region (VH) and light chain variable region (VL):
VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 99 or a fragment thereof.

In a further particularly preferred embodiment, agents capable of binding to CLDN6 include the following combinations of heavy chain variable region (VH) and light chain variable region (VL):
VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 100 or a fragment thereof.

The term "fragment" specifically refers to one or more of the complementarity determining regions (CDRs) of the heavy chain variable regions (VH) and / or the light chain variable regions (VL), preferably at least the heavy chain variable regions (V). The CDR3 variable regions of the VH) and / or light chain variable regions (VL) are shown. In one embodiment, said one or more of the complementarity determining regions (CDRs) are selected from a set of complementarity determining regions (CDR1, CDR2 and CDR3). In a particularly preferred embodiment, the term "fragment" refers to CDR1, CDR2 and CDR3 of the complementarity determining regions of the heavy chain variable region (VH) and / or the light chain variable region (VL).

In one embodiment, binders such as those described herein that include one or more CDRs, a set of CDRs, or a combination of multiple CDRs, said the CDRs with their intervening framework regions. Include together. Preferably, the portion will also include at least about 50% of either or both of the first and fourth framework regions, where the 50% is the C-terminal 50% of the first framework region. And 50% on the N-terminal side of the fourth framework area. The construction of the binding agent produced by recombinant DNA technology is to connect the variable regions of the invention to additional protein sequences containing immunoglobulin heavy chains, other variable domains (eg, in the production of diabodies) or protein labels. It may result in the introduction of N-terminal or C-terminal residues of the variable region encoded by the linker introduced to facilitate cloning or other manipulation steps, including the introduction of the linker.

In one embodiment, a binder as described herein comprising one or more CDRs, a set of CDRs or a combination of multiple CDRs comprises said CDRs within the human antibody framework. ..

Anti-CD3 antibodies useful for providing the binder according to the invention include UCHT1-HS (humanized mAB), UCHT1-MM (mouse mAB), CLB-T3, TR66, 145-2C11. Not limited to these.

UCHT1 is a monoclonal IgG1 anti-CD3 monoclonal antibody that detects CD3 in human and primate sample types. CLB-T3 is a mouse monoclonal anti-CD3 antibody that is directed against the CD3 antigen and reacts with 80% to 90% of human peripheral T lymphocytes and medullary thyroid cells. TR66 is a mouse IgG1 monoclonal anti-CD3 antibody that recognizes the epsilon chain of human CD3. 145-2C11 is an Armenian hamster monoclonal anti-mouse CD3 antibody.

Preferably, the VH and VL regions of the CD3 binding domain are specific for human CD3 in the context of other TCR subunits such that they are present on the surface of activated primary human T cells that express TCR in their native arrangement. Derived from antibody / antibody molecules and antibody-like molecules that can be specifically recognized. VH and VL regions derived from antibodies specific for the CD3 epsilon chain are most preferred, said (parent) antibody in the context of an epitope or TCR complex that reflects a native or nearly native structure. It must specifically bind to the presented homologous epitope of human CD3. In a preferred embodiment of the invention, the VH and VL regions of the CD3 binding domain are derived from a CD3-specific antibody selected from the group consisting of UCHT1-HS, UCHT1-MM, CLB-T3 and TR66, preferably. Derived from TR66.

In a preferred embodiment, the agent capable of binding CD3 is an amino acid selected from the group consisting of SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 94, SEQ ID NO: 95 and fragments thereof. Includes a heavy chain variable region (VH) containing a sequence.

In a preferred embodiment, the agent capable of binding CD3 comprises a light amino acid sequence selected from the group consisting of SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 96 and fragments thereof. Includes chain variable region (VL).

In certain preferred embodiments, agents capable of binding CD3 are heavy and light chain variable regions (VH) and light chain variable regions (VL) selected from the following possibilities (i) to (ix): Including combinations of:
(I) VH comprises the amino acid sequence represented by SEQ ID NO: 30 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 31 or a fragment thereof;
(Ii) VH comprises the amino acid sequence represented by SEQ ID NO: 32 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 33 or a fragment thereof;
(Iii) VH comprises the amino acid sequence represented by SEQ ID NO: 34 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 34 or a fragment thereof;
(Iv) VH comprises the amino acid sequence represented by SEQ ID NO: 36 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 37 or a fragment thereof;
(V) VH comprises the amino acid sequence represented by SEQ ID NO: 94 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 37 or a fragment thereof;
(Vi) VH comprises the amino acid sequence represented by SEQ ID NO: 95 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 37 or a fragment thereof;
(Vii) VH comprises the amino acid sequence represented by SEQ ID NO: 36 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 96 or a fragment thereof;
(Viii) VH comprises the amino acid sequence represented by SEQ ID NO: 94 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 96 or a fragment thereof;
(IX) VH comprises the amino acid sequence represented by SEQ ID NO: 95 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 96 or a fragment thereof.

In a particularly preferred embodiment, agents capable of binding CD3 include the following combinations of heavy chain variable region (VH) and light chain variable region (VL):
VH comprises the amino acid sequence represented by SEQ ID NO: 36 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 37 or a fragment thereof.

In a further particularly preferred embodiment, agents capable of binding CD3 include the following combinations of heavy chain variable region (VH) and light chain variable region (VL):
VH comprises the amino acid sequence represented by SEQ ID NO: 94 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 37 or a fragment thereof.

In a further particularly preferred embodiment, agents capable of binding CD3 include the following combinations of heavy chain variable region (VH) and light chain variable region (VL):
VH comprises the amino acid sequence represented by SEQ ID NO: 95 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 96 or a fragment thereof.

The term "fragment" specifically refers to one or more of the complementarity determining regions (CDRs) of the heavy chain variable regions (VH) and / or the light chain variable regions (VL), preferably at least the heavy chain variable regions (V). The CDR3 variable regions of the VH) and / or light chain variable regions (VL) are shown. In one embodiment, said one or more of the complementarity determining regions (CDRs) are selected from a set of complementarity determining regions (CDR1, CDR2 and CDR3). In a particularly preferred embodiment, the term "fragment" refers to CDR1, CDR2 and CDR3 of the complementarity determining regions of the heavy chain variable region (VH) and / or the light chain variable region (VL).

In one embodiment, binders such as those described herein that include one or more CDRs, a set of CDRs, or a combination of multiple CDRs, said the CDRs with their intervening framework regions. Include together. Preferably, the portion will also include at least about 50% of either or both of the first and fourth framework regions, where the 50% is the C-terminal 50% of the first framework region. And 50% on the N-terminal side of the fourth framework area. The construction of the binding agent produced by recombinant DNA technology is to connect the variable regions of the invention to additional protein sequences containing immunoglobulin heavy chains, other variable domains (eg, in the production of diabodies) or protein labels. It may result in the introduction of N-terminal or C-terminal residues of the variable region encoded by the linker introduced to facilitate cloning or other manipulation steps, including the introduction of the linker.

In one embodiment, a binder as described herein comprising one or more CDRs, a set of CDRs or a combination of multiple CDRs comprises said CDRs within the human antibody framework. ..

According to the present invention, preferred binders targeting CLDN18.2 include amino acid sequences selected from the group consisting of SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40 and SEQ ID NO: 41 or variants thereof.

According to the present invention, further preferred binding agents targeting CLDN18.2 are SEQ ID NO: 103, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72. , SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: An amino acid sequence or fragment or variant thereof selected from the group consisting of No. 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92 and SEQ ID NO: 93. Including. In one embodiment, the amino acid sequence lacks and / or the sequence according to SEQ ID NO: 51 if a secretory signal, such as an N-terminal secretory signal, is specifically present. Specifically, if a His tag, such as a C-terminal His tag, is present, it lacks the _{sequence Gly-Gly-Ser- (His) 6} or the sequence (His) _6.

According to the present invention, preferred binders targeting CLDN6 include amino acid sequences or variants thereof selected from the group consisting of SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 and SEQ ID NO: 45.

According to the present invention, further preferred binding agents targeting CLDN6 consist of SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64 and SEQ ID NO: 65. Includes an amino acid sequence selected from the group or a fragment or variant thereof. In one embodiment, the amino acid sequence lacks and / or the sequence according to SEQ ID NO: 51 if a secretory signal, such as an N-terminal secretory signal, is specifically present. Specifically, if a His tag, such as a C-terminal His tag, is present, it lacks the _{sequence Gly-Gly-Ser- (His) 6} or the sequence (His) _6.

The binding agents described herein are by administering a nucleic acid encoding the agent (eg, RNA) and / or a host cell containing the nucleic acid encoding the agent (eg, RNA). It must be understood that it may be delivered to the patient by administration of. Thus, the nucleic acid encoding the binder, when administered to a patient, is present in a napped form or in a suitable delivery vehicle, eg, in the form of liposomes or viral particles, i.e., in a host cell. There is. The nucleic acids provided can produce the above agents over a long period of time in a sustained manner that at least partially reduces the instability observed for therapeutic antibodies (particularly bispecific antibodies). Nucleic acids for delivery to patients can be made by recombinant means. If the nucleic acid is administered to the patient without being present in the host cell, the nucleic acid is preferably taken up by the patient's cells for expression of the binding agent encoded by the nucleic acid. If the nucleic acid is administered to the patient while present in the host cell, the nucleic acid is preferably expressed by the host cell in the patient body to produce a binder encoded by the nucleic acid.

The term "recombination" means "manufactured by genetic engineering" in the context of the present invention. Preferably, "recombinants", such as recombinant nucleic acids in the context of the present invention, are not naturally present.

The term "naturally occurring", as used herein, refers to the fact that an object can be found in nature. For example, peptides or nucleic acids that are present in an organism (including viruses), can be isolated from natural sources, and have not been deliberately modified by humans in the laboratory are naturally present. There is.

As used herein, the term "nucleic acid" is intended to include DNA and RNA, such as genomic DNA, cDNA, mRNA, recombinantly produced molecules and chemically synthesized molecules. The nucleic acid may be single or double strand. RNA includes RNA transcribed in vitro (IVT RNA) or synthetic RNA.

Nucleic acid may be included in the vector. The term "vector" as used herein is a plasmid vector, cosmid vector, phage vector (eg, lambda phage, etc.), viral vector (eg, adenovirus vector or baculovirus vector, etc.) or artificial chromosome vector. Includes any vector known to those of skill in the art, including, for example, bacterial artificial chromosomes (BACs), yeast artificial chromosomes (YACs) or P1 artificial chromosomes (PACs). The vector includes an expression vector as well as a cloning vector. The expression vector comprises a plasmid, as well as a viral vector, and generally contains a desired coding sequence and a functionally linked coding sequence in a particular host cell (eg, bacterium, yeast, plant, insect or Contains the appropriate DNA sequence required for expression in a mammalian) or in an in vitro expression system. Cloning vectors are commonly used to manipulate and amplify certain desired DNA fragments and lack the functional sequences required for expression of the desired DNA fragment. May be.

In the context of the present invention, the term "RNA" relates to a molecule that comprises a ribonucleotide residue, preferably a molecule that is entirely or substantially composed of ribonucleotide residues. A "ribonucleotide" is associated with a nucleotide having a hydroxyl group at the 2'position of the β-D-ribofuranosyl group. The term includes double-stranded RNA, single-stranded RNA, isolated RNA (eg, partially purified RNA), essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well. It also includes modified RNA that differs from naturally occurring RNA by the addition, deletion, substitution and / or modification of one or more nucleotides. Such changes can include the addition of non-nucleotide material, eg, to the end of RNA, or internally, eg, to one or more nucleotides of RNA. Nucleotides in RNA molecules can also include non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs can be shown as analogs or analogs of naturally occurring RNA.

According to the present invention, the term "RNA" means "messenger RNA" and may be produced using a template of DNA and is associated with a "transcription" encoding a peptide or protein. It includes "mRNA" and is preferably associated with such "mRNA". The mRNA typically comprises a 5'untranslated region (5'-UTR), a protein or peptide coding region, and a 3'untranslated region (3'-UTR). mRNA has a limited half-time intracellularly and in vitro. Preferably, the mRNA is produced by in vitro transcription using a DNA template. In one embodiment of the invention, RNA is obtained by in vitro transcription or chemical synthesis. In vitro transcription methodologies are known to those of skill in the art. For example, there are various commercially available in vitro transfer kits.

In one embodiment of the invention, the RNA is a self-replicating RNA, such as a single-stranded self-replicating RNA. In one embodiment, the self-replicating RNA is a positive sense single-stranded RNA. In one embodiment, the self-replicating RNA is viral RNA or RNA derived from viral RNA. In one embodiment, the self-replicating RNA is an alphavirus genomic RNA or is derived from an alphavirus genomic RNA. In one embodiment, the self-replicating RNA is a viral gene expression vector. In one embodiment, the virus is a Semliki Forest virus. In one embodiment, the self-replicating RNA contains one or more transgenes, where at least one of the transgenes encodes a binder described herein. In one embodiment, if the RNA is viral RNA or derived from viral RNA, the transgene may partially or completely replace the viral sequence (eg, a viral sequence encoding a structural protein). In one embodiment, the self-replicating RNA is RNA transcribed in vitro.

The alphavirus genome is a positive-sense single-stranded RNA (ssRNA (+)) that encodes two open reading frames (ORFs) for large polyproteins. The ORF at the 5'end of the genome encodes the unstructured proteins nSP1-nSP4 (nsP1-nsP4), which are translated and processed into RNA-dependent RNA polymerases (replicases); the ORF at the 3'end is It encodes structural proteins, namely capsids and glycoproteins. Both ORFs are separated by the so-called Subgenome Promoter (SGP), which governs the transcription of this structural ORF. When used as a gene vector, the structural protein following the SGP is generally replaced by a transgene. To package such vectors into viral particles, structural proteins are generally expressed trans from helper constructs. Alphavirus replicates exclusively in the cytoplasm of infected cells at the RNA level. After infection, the ssRNA (+) genome acts as mRNA for the translation of the nsP1234 polyprotein precursor, which is autoproteolytically processed into nsP123 and nsP4 fragments in the early stages of the viral life cycle. Fragments of nsP123 and nsP4 form a (-) strand replicase complex that transcribes (-) strand RNA from a genomic RNA template. At a later stage, the nsP1234 polyprotein is fully integrated into a new (+) strand genome, as well as individual proteins that assemble into a (+) strand replicase complex that synthesizes a subgenome transcript encoding a structural protein or transgene. Be disconnected. Subgenomic RNA, like new genomic RNA, undergoes capping and polyadenylation and is therefore recognized as mRNA after target cell infection. Only new genomic RNA contains a packaging signal that guarantees exclusive packaging of genomic RNA into budding virions. The attractiveness of alphavirus replicons for vectorology is based on the positive orientation of the capped and polyadenylated RNA genome. Translateable plasmid RNA can be readily synthesized in vitro, whereby capping may be achieved by cap-analoga added to the in vitro transcription reaction, and the polyA tail It may be encoded as a poly T sequence in a plasmid template. In vitro transcribed (IVT) replicons are transfected by conventional transfection techniques, and even small amounts of starting IVT RNA are rapidly augmented. Within hours of transfer, the transgene located downstream of the SGP is transcribed to a very large number of copies of approximately 40.000 to 200.000 copies of subgenomic RNA per cell, thus recombination. It is not surprising that the protein is strongly expressed. Depending on the specific purpose, the IVT replicon may be transfected directly into the target cell or packaged in alpha virus particles with a helper vector that provides the structural gene trans. There is. Transfer into the skin or muscle results in large, sustained local expression, which is paralleled by strong induction of humoral and cell-mediated immune responses.

RNA may be modified to increase expression and / or stability of the RNA used in accordance with the present invention, preferably without altering the sequence of the expressed peptide or protein. is there.

The term "modified" includes any modification of RNA that is not naturally present in said RNA in the context of RNA as used in accordance with the present invention.

In one embodiment of the invention, the RNA used according to the invention does not have uncapped 5'-triphosphate. Removal of such uncapped 5'-triphosphate can be achieved by treating RNA with phosphatase.

RNAs according to the invention may have modified naturally occurring or synthetic ribonucleotides to increase their stability and / or reduce their cytotoxicity. For example, in one embodiment, in the RNA used according to the present invention, 5-methylcytidine is used in place of cytidine, partially or completely, preferably completely. Alternatively, or in addition, in one embodiment, in RNA used in accordance with the present invention, pseudouridine is used in place of uridine, partially or completely, preferably completely.

In one embodiment, the term "modification" relates to giving RNA a 5'-cap or 5'-cap analog. The term "5'-cap" refers to the cap structure found at the 5'end of an mRNA molecule and generally consists of guanosine nucleotides that are linked to the mRNA via an unusual 5'to 5'phosphate linkage. In one embodiment, the guanosine is methylated at position 7. The term "conventional 5'-cap" refers to the 5'-cap of naturally occurring RNA, preferably 7-methylguanosine cap (m7G). In the context of the present invention, the term "5'-cap" resembles an RNA cap structure and, if added to the RNA, preferably the ability to stabilize RNA in vivo and / or in cells. Includes 5'-cap analogs that are modified to have.

Giving the RNA a 5'-cap or 5'-cap analog may be achieved by in vitro transcription of the DNA template in the presence of the 5'-cap or 5'-cap analog, provided that in this case. The 5'-cap may be incorporated into the resulting RNA strand by co-transcription, or the RNA may be produced, for example, by in vitro transcription, and the 5'-cap may be produced, for example, using capping enzymes. , May be added to RNA after transcription using the vaccinia virus capping enzyme.

RNA may contain further modifications. For example, further modifications of the RNA used in the present invention may result in extension or shortening of the naturally occurring poly (A) tail, or changes in the 5'or 3'untranslated region (UTR), eg, Derived from, for example, a globin gene (eg, alpha2-globin, alpha1-globin, beta-globin, etc., preferably beta-globin, more preferably human beta-globin), such as the introduction of a UTR unrelated to the RNA coding region. Inserting one or more copies of the 3'-UTR, preferably two copies.

Therefore, in order to increase the stability and / or expression of RNA used in accordance with the present invention, RNA preferably has 10 to 500 adenosine residues so that it is present in conjunction with the poly A sequence. A sequence, more preferably a poly A sequence having 30 to 300 adenosine residues, even more preferably a poly A sequence having 65 to 200 adenosine residues, especially 100 to 150 adenosine residues. May be modified to be present in conjunction with the poly A sequence having. In a particularly preferred embodiment, the poly A sequence has a length of approximately 120 adenosine residues. In addition, incorporating two or more 3'untranslated regions (UTRs) into the 3'untranslated regions of an RNA molecule can result in enhancements in translation efficiency. In one particular embodiment, the 3'-UTR is derived from the human β-globin gene.

Preferably, RNA is encoded by RNA if it is delivered to a cell (particularly a cell present in vivo), i.e. if it is transfected into a cell (particularly a cell present in vivo). Express the protein, peptide or antigen to be produced.

The term "transfection" relates to the introduction of nucleic acids (particularly RNA) into cells. For the purposes of the present invention, the term "transfection" also includes the introduction of nucleic acids into cells, or the uptake of nucleic acids by such cells, except in which the cell is a subject (eg, eg). May be present in the patient). Thus, according to the invention, the cells for transfection of the nucleic acids described herein can be present in vitro or in vivo, eg, the cells are the organs, tissues and / or organisms of the patient. Can form part of. According to the present invention, transfection can be transient or stable. For some applications of transfection, transfection is sufficient if the transfected genetic material is expressed only transiently. Nucleic acids introduced in the transfection process are usually not integrated into the nuclear genome, so foreign nucleic acids will be diluted or degraded via mitosis. Dilution rates are significantly reduced in cells that allow episomal amplification of nucleic acids. Stable transfection must occur if it is desired that the transfected nucleic acid actually remain in the genome of the cell and its daughter cells. RNA can be transfected into cells to transiently express its encoded protein.

The RNA term "stability" is associated with the "half-life" of RNA. "Half-life" is related to the period required to eliminate half the activity, quantity or number of molecules. In the context of the present invention, the half-life of an RNA indicates the stability of said RNA. The half-life of RNA may affect the "duration of expression" of the RNA. It can be expected that RNA with a long half-life will be expressed over a long period of time.

In the context of the present invention, the term "transcription" relates to the process by which the genetic code in a DNA sequence is transcribed into RNA. The RNA may then be translated into protein. According to the present invention, the term "transcription" includes "in vitro transcription", where, however, the term "in vitro transcription" means that RNA (particularly mRNA) is preferably suitable cell extraction in a cell-free system. It is related to the process of in vitro synthesis using objects. Preferably, various cloning vectors are applied for transcript production. These cloning vectors are commonly referred to as transcription vectors and are included by the term "vector" according to the invention.

The term "translation", according to the invention, relates to a process in the ribosome of a cell in which a strand of messenger RNA leads to the assembly of a sequence of amino acids to make a peptide or protein.

The term "expression" is used in its most general sense according to the present invention and includes producing RNA and / or peptides or proteins, for example by transcription and / or translation. With respect to RNA, the term "expression" or term "translation" is particularly relevant to producing peptides or proteins. The term "expression" or term "translation" also includes partial expression of nucleic acids. Moreover, expression can be transient or stable. According to the present invention, the terms of expression also include "abnormal expression" or "abnormal expression".

"Unusual expression" or "unusual expression" is, according to the invention, an out-of-normal expression or normal expression of, for example, a particular protein (eg, a tumor antigen) as compared to a reference. It means that the condition is altered, preferably increased, as compared to the condition in a subject who does not have the disease associated with non-expression. Increases in expression show an increase of at least 10%, in particular at least 20%, at least 50% or at least 100% or more. In one embodiment, expression is only found in the affected tissue, while expression in healthy tissue is suppressed.

The term "specifically expressed" means that a protein is essentially only expressed in a particular tissue or organ. For example, a tumor antigen specifically expressed in the gastric mucosa is such that the protein is mainly expressed in the gastric mucosa and is not expressed in other tissues, or is not expressed to a significant extent in other tissue or organ types. Means. Thus, proteins that are exclusively expressed in gastric mucosal cells and that are expressed to a significantly lower extent in any tissue, in any tissue (eg, testis), are specifically expressed in gastric mucosal cells. To. In some embodiments, the tumor antigen is also in more than one tissue type or organ, eg, in two or three tissue types or organs, but preferably not more than three different tissue types or organs. It may be specifically expressed under normal conditions in type. In this case, the tumor antigen is then specifically expressed in these organs. For example, if a tumor antigen is expressed in the lungs and stomach, preferably to about the same extent, under normal conditions, the tumor antigen is specifically expressed in the lungs and stomach.

According to the invention, the term "RNA encoding" means that RNA produces a protein or peptide encoded by RNA if it is present in the proper environment, preferably intracellularly. It means that it can be expressed.

Some aspects of the invention are transfected in vitro with nucleic acids (eg, RNA encoding the binders described herein) and clinically reasonable cell numbers from low precursor frequencies. It is preferably after exvivo expansion to, but relies on the adoptive transfer of host cells to be transferred to the recipient (eg, patient). The host cells used for the treatment according to the invention may be self, allogeneic or syngeneic to the treated recipient.

The term "self" is used to describe anything that comes from the same subject. For example, "self-implant" refers to a tissue or organ implant derived from the same subject. Such a procedure is advantageous because it overcomes the immunological barrier that would otherwise result in rejection.

The term "same species" is used to describe whatever is derived from different individuals of the same species. Two or more individuals are said to be homologous to each other when the genes at one or more loci are not identical.

The term "synonymous" is derived from any individual or tissue having the same genotype, i.e. from the same twins or animals of the same inbreeding line or their tissues. Used to represent.

The term "heterogeneous" is used to describe something that consists of many different elements. As an example, transferring the bone marrow of one individual to another constitutes a xenotransplantation. Heterologous genes are genes derived from sources other than the subject.

According to the present invention, the term "peptide" includes oligopeptides and polypeptides, and includes 2 or more, preferably 3 or more, preferably 4 or more, preferably 6 or more, preferably 8 or more, preferably 9 or more. More than, preferably 10 or more, preferably 13 or more, preferably 16 or more, preferably 21 or more, preferably up to 8 amino acids, up to 10 amino acids, up to 20 amino acids, 30 Indicates a substance containing up to 40 amino acids, up to 40 amino acids, or up to 50 amino acids, particularly up to 100 amino acids linked by a covalent bond by a peptide bond. The term "protein" refers to a large peptide, preferably a peptide having more than 100 amino acid residues, but in general, the terms "peptide" and the term "protein" are synonymous and herein. It is used interchangeably inside.

The teachings given herein with respect to a particular amino acid sequence (eg, the amino acid sequence shown in the sequence listing) are variants of said particular sequence, eg, resulting in a sequence that is functionally equivalent to said particular sequence. It must also be construed to be relevant to amino acid sequences that are identical to or similar to the properties of a particular amino acid sequence. One important property is to retain binding to the target or to sustain effector function. Preferably, a sequence that is a variant with respect to a particular sequence is such that the antibody binds to CDDN and / or CD3 when the sequence supersedes the particular sequence in the antibody, and preferably in the present specification. Retains the function of the antibody as described in, eg, CDC-mediated lysis or ADCC-mediated lysis.

For example, the sequences shown in the sequence listing are by substituting one or more free cysteine residues, preferably all free cysteine residues, especially these cysteine residues with amino acids other than cysteine. It can be modified to remove preferably by substituting with serine, alanine, threonine, glycine, tyrosine, leucine or methionine, most preferably by substituting with alanine or serine. For example, the cysteine at position 103 of the sequence shown in SEQ ID NO: 36 of the sequence listing, or the corresponding cysteine in the sequence containing the sequence, may be modified in this way. Further cysteines that can be modified in this way are cysteine at position 178 of SEQ ID NO: 42, cysteine at position 197 of SEQ ID NO: 43, cysteine at position 427 of SEQ ID NO: 44, or cysteine at position 446 of SEQ ID NO: 45. is there.

In particular, it will be appreciated by those skilled in the art that the sequences of the CDR regions, hypervariable regions and variable regions can be modified without losing the ability to bind CLDN and / or CD3. For example, the CDR regions may either be identical or highly homologous to the regions of the antibody specified herein. By "very homologous", one to five substitutions, preferably one to four substitutions, such as one to three substitutions, or one or two substitutions, may be made in the CDR. It is intended to be. In addition, the hypervariable and variable regions may be modified to show substantial homology with the regions of the antibody specifically disclosed herein.

For the purposes of the present invention, "variants" of amino acid sequences include amino acid insertion variants, amino acid addition variants, amino acid deletion variants and / or amino acid substitution variants. Amino acid deletion variants that include deletions at the N-terminus and / or C-terminus of the protein are also referred to as N-terminal shortening variants and / or C-terminal shortening variants.

Amino acid insertion variants include the insertion of only one or more amino acids in a particular amino acid sequence. For amino acid sequence variants with insertions, one or more amino acid residues are inserted at specific sites in the amino acid sequence, but random insertion with appropriate screening of the resulting product is also possible.

Amino acid addition variants are amino-terminal fusions of one or more amino acids (eg, 1, 2, 3, 5, 10, 20, 20, 30, 50 or more amino acids, etc.) And / or contains a carboxy-terminal fusion.

Amino acid deletion variants are produced by removing one or more amino acids from the sequence, eg, 1, 2, 3, 5, 10, 20, 30, 50 or more amino acids. Characterized by the removal of. The deletion can be at any position in the protein.

Amino acid substitution variants are characterized by the removal of at least one residue in the sequence and the insertion of another residue in its place. It is preferred that the modification is in an unconserved amino acid sequence among homologous proteins or peptides, and / or that the amino acid is replaced by another amino acid of similar nature. Preferably, the amino acid changes in the protein variant are conservative amino acid changes, i.e., similar charged or uncharged amino acids are used instead. Conservative amino acid changes involve amino acid substitutions in the family of amino acids associated in their side chains. Naturally occurring amino acids are generally divided into the following four families: acidic amino acids (aspartic acid, glutamic acid), basic amino acids (lysine, arginine, histidine), non-polar amino acids (alanine, valine, leucine, isoleucine, Proline, phenylalanine, methionine, tryptophan) and uncharged polar amino acids (glycine, aspartin, glutamine, cysteine, serine, threonine, tyrosine). Phenylalanine, tryptophan and tyrosine are sometimes grouped together as aromatic amino acids.

Preferably, the degree of similarity, preferably the degree of identity, between a given amino acid sequence and an amino acid sequence that is a variant of the given amino acid sequence is at least about 60%, 65%, 70%. , 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96 %, 97%, 98% or 99%. The degree of similarity or identity is preferably at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70 of the total length of the reference amino acid sequence. %, At least about 80%, at least about 90% or about 100% given for amino acid regions. For example, if the reference amino acid sequence consists of 200 amino acids, the degree of similarity or identity is preferably at least about 20, at least about 40, at least about 60, at least about 80, at least about 100, at least. It is given for about 120, at least about 140, at least about 160, at least about 180, or about 200 amino acids (preferably contiguous amino acids). In a preferred embodiment, the degree of similarity or identity is given for the overall length of the reference amino acid sequence. Alignment for sequence similarity, preferably alignment for sequence identity, using tools known in the art, preferably using best sequence alignment, eg Gap. In this case, standard settings are used, preferably EMBOSS :: needle, Identity: Blossum62, Gap Open 10.0, Gap Extension 0.5 are used.

"Sequence similarity" refers to the percentage of these amino acids, whether they are identical amino acids or amino acids that represent conservative amino acid substitutions. "Sequence identity" between two amino acid sequences indicates the percentage of amino acids that are identical between the sequences.

The term "percentage identity" is intended to mean the percentage of amino acid residues that are identical between the two sequences to be compared, obtained after best alignment, but this percentage is purely statistical. Scientifically, the differences between these two sequences are distributed randomly and over their entire length. Sequence comparisons between two amino acid sequences have traditionally been made by optimally aligning these sequences and then comparing these sequences, except that in this case the comparison is local to sequence similarity. It is done by segment or by "comparison window" to identify and compare the target area. Optimal alignment of sequences for comparison is done manually, as well as by Neddleman and Wunsch (1970, J.) by the local homology algorithm of Smith and Waterman (1981, Adds App. Math., 2, 482). By the local homology algorithm of Mol. Biol., 48, 443), or by the similarity search method of Pearson and Lipman (1988, Proc. Natl. Acad. Sci. USA, 85, 2444), or these algorithms. Computer programs that use (GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA, which are brought to the Wisconsin Genetics Software Package (Genetics Computer Group) Included in 575 Science Drive) In some cases.

Percentage identity determines the number of identical positions between two sequences being compared, divides this number by the number of positions compared, and multiplys the results obtained by 100 to obtain these two. Calculated by trying to obtain percentage identity between sequences.

The binders of the invention can be produced intracellularly (eg, in the cytosol, in periplasma, or in inclusion bodies), then isolated from the host cells and further purified if necessary. Alternatively, the binders of the invention can be generated extracellularly (eg, in the medium in which the host cells are cultured), then isolated from the culture medium and further purified if necessary. Various methods and reagents used for recombinant production of polypeptides, such as specific suitable expression vectors, transformation or transfection methods, selectable markers, methods of inducing protein expression and culture conditions, etc. Known in the technical field. Similarly, various protein isolation and protein purification techniques are widely known to those of skill in the art.

The term "cell" or term "host cell" is preferably associated with an intact cell, i.e., a cell having an intact membrane that does not release its normal intracellular components (eg, enzymes, organelles or genetic material). To do. An intact cell is preferably a viable cell, i.e. a living cell capable of performing its normal metabolic function. Preferably, the term relates to any cell that can be transfected with an exogenous nucleic acid according to the invention. Preferably, the cells can express the nucleic acid in the recipient when transfected with the exogenous nucleic acid and transferred to the recipient. The term "cell" includes bacterial cells; other useful cells are yeast cells, fungal cells or mammalian cells. Suitable bacterial cells include Gram-negative bacterial strains such as Escherichia coli, Proteus and Pseudomonas strains, and Gram-positive bacterial strains such as Bacillus, Streptomyces, Staphylococcus and Lactococcus strains. Bacteria derived from such as are included. Suitable fungal cells include cells from species of the genera Trichoderma, Neurospora and Aspergillus. Suitable yeast cells include species of the genus Saccharomyces (eg, Saccharomyces cerevisiae), species of the genus Saccharomyces (eg, species of Schizo saccharomyces, pichia, eg, Pichia). , Pichia pastoris and Pichia yeastolid) and cells from species of the genus Pichia. Suitable mammalian cells include, for example, CHO cells, BHK cells, HeLa cells, COS cells, 293HEK and the like. However, amphibian cells, insect cells, plant cells and any other cells used in the art for the expression of heterologous proteins can be used as well. Mammalian cells are particularly preferred for adoption (eg, cells from humans, mice, hamsters, pigs, goats and primates). Cells can be derived from a large number of tissue types, including primary cells and cell lines, such as cells of the immune system, in particular antigen-presenting cells (eg, dendritic cells and T cells), stem cells (eg, eg, dendritic cells and T cells). Includes (such as hematopoietic stem cells and mesenchymal stem cells) and other cell types. Antigen-presenting cells are cells that present their antigens on their surface in the context of major histocompatibility complex. T cells may recognize this complex using its T cell receptor (TCR).

As used herein, "decrease," "decrease," or "inhibit" is preferably at a level, eg, at the level of expression, or at the level of cell proliferation, preferably 5% or more. It means that an overall reduction of 10% or more, 20% or more, more preferably 50% or more, most preferably 75% or more, or such an overall reduction can occur.

Terms such as "increase" or "enhance" are preferably about at least 10%, preferably at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, even more preferably. It is associated with an increase or enhancement of at least 80%, most preferably at least 100%, at least 200%, at least 500%, at least 1000%, at least 10000%, or even more.

Antibody-Dependent Cell-Mediated Cytotoxicity ADCC represents the cell-killing ability of effector cells (particularly lymphocytes) as described herein, although this is preferably marked by the antibody on the target cell. Need to be attached.

ADCC preferably occurs when the antibody binds to an antigen on the surface of the tumor cell and the Fc domain of the antibody associates with the Fc receptor (FcR) on the surface of the immune effector cell. Several families of Fc receptors have been identified and specific cell populations characteristically express defined Fc receptors. ADCC can be seen as a mechanism for directly inducing variable immediate tumor destruction that triggers antigen presentation and induction of T cell responses directed at the tumor. Preferably, in vivo induction of ADCC will elicit a T cell response directed to the tumor and a host-derived antibody response.

Complement-dependent cytotoxicity CDC is another method of cell killing that can be induced by antibodies. IgM is the most effective isotype for complement activation. Both IgG1 and IgG3 are also very effective in directing CDCs via the classical complement activation pathway. Preferably, in this cascade, the formation of an antigen-antibody complex results in exposure of multiple C1q binding sites in the immediate vicinity of the surface of the CH2 domain of the antibody molecule involved (eg, an IgG molecule) (eg, IgG molecule) C1q is one of the three subcomponents of complement C1). Preferably, these exposed C1q binding sites convert previously low affinity C1q-IgG interactions into high avidity interactions, thereby cascading events involving a series of other complement proteins. Triggered to trigger the proteolytic release of effector cell chemotactic / activator C3a and C5a. Preferably, the complement cascade ends with the formation of a membrane attack complex, which results in pores in the cell membrane that facilitate the free passage of water and solute into and out of the cell.

Antibodies described herein, eg, antibodies described herein for providing VL and VH regions, are conventional monoclonal antibody methodologies such as Kohler and Milstein (Nature, 256: 495). It can be produced by a variety of techniques, including the standard somatic cell hybridization technique of (1975)). Despite the preference for somatic cell hybridization procedures, in principle other techniques for producing monoclonal antibodies can be used, such as viral or carcinogenic transformation of B lymphocytes, or , Phage display techniques using a library of antibody genes can be used.

The preferred animal system for preparing hybridomas that secrete monoclonal antibodies is the mouse system. Hybridoma production in mice is a very well-established technique. Various immunization protocols and techniques for isolating immunized splenocytes for fusion are known in the art. Various fusion partners (eg, mouse myeloma cells) and fusion techniques are also known.

Other preferred animal systems for preparing hybridomas that secrete monoclonal antibodies are rat and rabbit systems (these are, for example, Spieker-Polet et al., Proc. Natl. Acad. Sci. USA, 92: 9348 (1995). See also Rossi et al., Am. J. Clin. Pathol. 124: 295 (2005)).

In yet another preferred embodiment, human monoclonal antibodies can be generated using transgenic or chromosomally recombinant mice that have a portion of the human immune system rather than the mouse system. These transgenic and chromosomally recombinant mice include mice known as HuMAb mice and KM mice, respectively, which are collectively referred to herein as "genetically modified mice." The production of human antibodies in such transgenic mice can be carried out as described in detail for CD20 in WO200403657.

Yet another strategy for producing monoclonal antibodies is to isolate the antibody-encoding gene directly from lymphocytes that produce antibodies of defined specificity. See, for example, Babcock et al. (1996, A novel strategy for generaating monoclonal antibody from single, isolated lymphocytes producing antibodies). For more information on recombinant antibody engineering, see Welschof and Kraus, Recombinant antibody for cancer therapy (ISBN-0-89603-918-8), and Bennie K. et al. C. See also Lo, Antibody Engineering (ISBN 1-58829-092-1).

To generate the antibody, as described in mice, the antigen sequence, i.e., the carrier-conjugated peptide derived from the sequence to which the antibody is directed, the recombinantly expressed antigen or fragment thereof, is enriched. It can be immunized with the prepared preparation and / or cells expressing the antigen. Alternatively, mice can be immunized with DNA encoding an antigen or fragment thereof. If immunization using a purified or enriched preparation of the antigen does not result in antibodies, the mouse will also have cells expressing the antigen (eg, cells) to enhance the immune response. Can be immunized by strain).

Immune responses can be monitored over the course of the immunization protocol in which plasma and serum samples are obtained by tail vein or orbital blood draw. Mice with sufficient titers of immunoglobulin can be used for fusion. Mice can be given additional antigen stimulation intraperitoneally or intravenously with antigen-expressing cells 3 days prior to sacrifice and spleen removal to increase the proportion of hybridomas that secrete specific antibodies.

To generate hybridomas that produce monoclonal antibodies, splenocytes and lymph node cells from immunized mice can be isolated and fused to a suitable immortalized cell line (eg, mouse myeloma cell line). it can. The resulting hybridoma can then be screened for the production of antigen-specific antibodies. Individual wells can then be screened by ELISA for antibody-secreting hybridomas. Immunofluorescence analysis and FACS analysis using antigen-expressing cells can identify antibodies that have specificity for the antigen. Antibody-secreting hybridomas can be rearranged and screened again, and if still positive for monoclonal antibodies, can be subcloned by limiting dilution. Stable subclones can then be cultured in vitro to generate the antibody in tissue culture medium for characterization.

Antibodies can also be produced in host cell transfectomas using, for example, a combination of recombinant DNA techniques and gene transfection methods as is widely known in the art (Morrison, S. et al. 1985), Science, 229: 1202).

For example, in one embodiment, the gene of interest, eg, an antibody gene, is disclosed in an expression vector (eg, an expression plasmid for eukaryotes (eg, WO 87/04462, WO 89/01036) and European Patent EP 338841. It can be ligated to (such as a eukaryotic expression plasmid used by a GS gene expression system) or other expression systems widely known in the art). Purified plasmids carrying the cloned antibody gene can be introduced into eukaryotic host cells (eg, CHO cells, NS / 0 cells, HEK293T cells or HEK293 cells, etc.) or, in alternative, plants. It can be introduced into other eukaryotic cells such as derived cells, fungal cells or yeast cells. The methods used to introduce these genes can be those described in the art, such as electroporation, lipofectin or lipofectamine. After introducing these antibody genes into host cells, cells expressing the antibody can be identified and selected. These cells then represent transfectomas that can be amplified for their expression levels and can also be scaled up to produce antibodies. Recombinant antibodies can be isolated and purified from these culture supernatants and / or cells.

Alternatively, the cloned antibody gene can be applied to other expression systems, including prokaryotic cells (eg, microorganisms), eg, E. coli. It can be expressed in colli. Furthermore, antibodies can be produced in non-human genetically modified animals, such as from sheep and rabbits in milk, from chickens to eggs, or in genetically modified plants; for example, Verma, R. et al. Et al. (1998), J. et al. Immunol. Meth. , 216: 165-181; Pollock et al. (1999), J. Mol. Immunol. Meth. , 231: 147-157; and Fisher, R. et al. Et al. (1999), Biol. Chem. 380: 825-839.

Chimeric unlabeled mouse antibodies are highly immunogenic in humans when applied repeatedly, which causes a diminished therapeutic effect. The main immunogenicity is mediated by the heavy chain constant region. If each antibody is chimerized or humanized, the immunogenicity of the mouse antibody in humans can be reduced or completely avoided. The chimeric antibody is an antibody whose various parts are derived from different animal species, for example, an antibody having a variable region derived from a mouse antibody and a constant region of human immunoglobulin. Chimerization of the antibody is described in (eg, by Kraus et al., Methods in Molecular Biology series, Recombinant antibody for cancer therapy (ISBN-0-89603-918-8)) and light chain of mouse antibody. Is achieved by connecting the variable regions of the to the constant regions of the human heavy and light chains. In a preferred embodiment, a chimeric antibody is made by linking a human kappa light chain constant region to a mouse light chain variable region. Similarly, in a preferred embodiment, the chimeric antibody can be made by linking the human lambda light chain constant region to the mouse light chain variable region. Preferred heavy chain constant regions for making chimeric antibodies are IgG1, IgG3 and IgG4. Other preferred heavy chain constant regions for producing chimeric antibodies are IgG2, IgA, IgD and IgM.

Humanized antibodies interact with target antigens primarily via amino acid residues located in the six complementarity determining regions (CDRs) of the heavy and light chains. As such, the amino acid sequences within the CDRs have greater diversity among the individual antibodies than the sequences outside the CDRs. Since the CDR sequences are involved in most antibody-antigen interactions, recombinant antibodies that mimic the properties of certain naturally occurring antibodies are grafted into framework sequences derived from different antibodies with different properties. It can be expressed by constructing an expression vector containing CDR sequences obtained from specific naturally occurring antibodies (eg, Richmann, L. et al. (1998), Nature, 332: 323-327; Jones). , P. et al. (1986), Nature, 321: 522-525; and Queen, C. et al. (1989), Proc. Natl. Acad. Sci. USA, 86: 12002-10033. thing). Such framework sequences can be obtained from publicly available DNA databases containing germline antibody gene sequences. Since these germline sequences will not contain fully assembled variable genes, which are formed by V (D) J linkage during B cell maturation, the gene sequences of mature antibodies. Would be different. The gene sequence of the germline will also differ from the sequence of the secondary repertoire antibody, which has a high affinity individually throughout the variable region.

The ability of antibodies and other binding agents to bind antigen can be determined using standard binding assays (eg, ELISA analysis, Western blot analysis, immunofluorescence analysis and flow cytometry analysis).

To purify the antibody, selected producing cell lines can be grown in a 2 liter spinner flask for purification of the recombinant antibody. Alternatively, the antibody can be produced in a dialysis-based bioreactor. The supernatant can be filtered prior to affinity chromatography with protein L-sepharose and concentrated if necessary. The eluted IgG can be examined by gel electrophoresis and high performance liquid chromatography to ensure purity. The buffer solution can be exchanged for PBS and the concentration can be determined by OD280 using the respective extinction coefficient. Recombinant antibodies can be subdivided and stored at -80 ° C.

Flow cytometry can be used to reveal that the monoclonal antibody binds to live cells expressing the antigen. Cell lines that express the antigen naturally or after transfection, and negative controls lacking antigen expression (these can be grown under standard growth conditions) in hybridoma supernatants or. It can be mixed with various concentrations of monoclonal antibody in PBS containing 1% FBS and can be incubated at 4 ° C. for 30 minutes. After washing, the anti-IgG antibody labeled with APC or Alexa647 can bind to the monoclonal antibody bound to the antigen under the same conditions as the primary antibody staining. Samples can be analyzed by flow cytometry using a FACS device that uses light and lateral scattering properties to open and close gates for individual living cells. Co-transfection methods can be used to distinguish antigen-specific monoclonal antibodies from non-specific conjugates in a single measurement. Cells transiently transfected with plasmids encoding antigens and fluorescence markers can be stained as described above. Transfected cells can be detected on different fluorescent channels than antibody-stained cells. Since the majority of transfected cells express both transgenes, antigen-specific monoclonal antibodies preferentially bind to fluorescent marker-expressing cells, whereas non-specific antibodies are non-transfect. It binds to transfection cells in a similar ratio. An alternative assay using fluorescence microscopy may be used in addition to or in place of the flow cytometry assay. Cells can be stained and examined by fluorescence microscopy exactly as described above.

Immunofluorescence microscopy analysis can be used to reveal that the monoclonal antibody binds to live cells expressing the antigen. For example, cell lines that express the antigen either spontaneously or after transfection, and negative controls lacking antigen expression are 10% fetal bovine serum (FCS), 2 mM L-glutamine, 100 IU / ml penicillin. And grown on chamber slides under standard growth conditions in DMEM / F12 medium supplemented with 100 μg / ml streptomycin. The cells can then be immobilized with methanol or paraformaldehyde, or left untreated. The cells can then react with the monoclonal antibody against the antigen at 25 ° C. for 30 minutes. After washing, cells can be reacted with Alexa555-labeled anti-mouse IgG secondary antibody (Molecular Probes) under the same conditions. The cells can then be examined by fluorescence microscopy.

Cell extracts obtained from cells expressing the antigen and appropriate negative controls can be prepared and subjected to sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis. After electrophoresis, the isolated antigen will be transcribed into a nitrocellulose membrane, blocked and probed with the monoclonal antibody being tested. IgG binding can be detected using anti-mouse IgG peroxidase and color developed by the ECL substrate.

Antibodies are further inoculated in a manner widely known to those skilled in the art, eg, from a patient during routine surgical procedures, or by a cell line that expresses the antigen spontaneously or after transfection. Immunohistochemistry using non-cancer tissue samples and paraformaldehyde-fixed frozen sections or acetone-fixed frozen sections or paraformaldehyde-fixed paraffin-embedded tissue sections from mice with heterologous transplant tumors. The reactivity with the antigen can be investigated by. Antibodies reactive to the antigen can be incubated for immunostaining, followed by horseradish peroxidase-conjugated goat anti-mouse antibody or goat anti-rabbit antibody (DAKO) according to the supplier's instructions. Can be incubated.

Preclinical Studies The binding agents described herein are also inoculated in an in vivo model, eg, a cell line expressing CLDN, to determine its efficacy in suppressing the growth of tumor cells expressing CLDN. It can be tested in immunodeficient mice with xenograft tumors.

In vivo studies after xenotransplantation of CLDN-expressing tumor cells into immunocompromised mice or other animals can be performed using the binders described herein. Binders can be administered to tumor-free mice and then infused with tumor cells to measure the effectiveness of the binder to prevent tumor formation or tumor-related symptoms. Binders can be administered to tumor-bearing mice to determine the therapeutic efficacy of each binder to reduce tumor growth, metastasis or tumor-related symptoms. The application of binding agents can be combined with the application of other substances such as cell division inhibitors, growth factor inhibitors, cell cycle inhibitors, angiogenesis inhibitors or antibodies to provide synergistic efficacy and potential toxicity of the combination. Can be sought. To analyze the toxic side effects mediated by the binder, the animal can be inoculated with a binder or control reagent, and the animal is described for symptoms that may be associated with CLDN binder therapy. Can be investigated carefully.

The mapping of the epitopes recognized by the binder are described in "Epitope Mapping Protocols" (Morris in Molecular Biology) (Glenn E. Morris, ISBN-089603-375-9) and "Epitope Mapping Ape (Epitope Mapping)). , Olwin MR Westwood, Frank C. Hay).

The compounds and agents described herein may be administered in the form of suitable pharmaceutical compositions of any composition.

The pharmaceutical compositions of the present invention are preferably sterile and, if required, with an effective amount of the binder described herein to produce the desired reaction or desired effect. Contain an effective amount of additional agents as discussed herein.

The pharmaceutical composition is usually provided in a uniform dosage form and may itself be prepared in a known manner. The pharmaceutical composition may be, for example, in the form of a solution or suspension.

Pharmaceutical compositions may include salts, buffering agents, preservatives, carriers, diluents and / or excipients, all of which are preferably pharmaceutically acceptable. The term "pharmaceutically acceptable" refers to the non-toxicity of a material that does not interact with the action of the active ingredients of the pharmaceutical composition.

Pharmaceutically unacceptable salts may be used to prepare pharmaceutically acceptable salts and are included in the present invention. Pharmaceutically acceptable salts of this type include salts prepared from the following acids in an unlimited manner: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citrate. Acids, formic acids, malonic acids and succinic acids, etc. Pharmaceutically acceptable salts may also be prepared as alkali metal salts or alkaline earth metal salts, such as sodium salts, potassium salts or calcium salts.

Suitable buffering agents for use in pharmaceutical compositions include acetate in salt, citric acid in salt, boric acid in salt, and phosphoric acid in salt.

Suitable preservatives for use in pharmaceutical compositions include benzalkonium chloride, chlorobutanol, parabens and thimerosal.

Injectable formulations may include pharmaceutically acceptable excipients such as Ringer's lactate.

The term "carrier" refers to a natural or synthetic organic or inorganic component in which the active ingredient is combined to facilitate application, enhance application, or enable application. According to the invention, the term "carrier" also includes one or more compatible solid or liquid bulking agents, diluents or encapsulating substances suitable for administration to a patient.

Possible carrier substances for parenteral administration are, for example, sterile water, Ringer, Ringer lactate, sterile sodium chloride solution, polyalkylene glycol, hydride naphthalene, and in particular biocompatible lactide polymers, lactide /. It is a glycolide copolymer or a polyoxyethylene / polyoxypropylene copolymer.

The term "excipient" as used herein is intended to refer to any substance that may be present in a pharmaceutical composition and is not an active ingredient (eg, carrier, binder). , Lubricants, thickeners, surfactants, preservatives, emulsifiers, buffers, flavor flavorants or colorants, etc.).

The agents and compositions described herein may be administered by any route via conventional routes, eg, by parenteral administration, including administration by injection or infusion. Administration is preferably parenteral, eg, intravenously, intraarterial, subcutaneously, intradermally or intramuscularly.

Compositions suitable for parenteral administration usually include sterile aqueous or non-aqueous preparations of the active compound, which are preferably isotonic to the recipient's blood. Examples of compatible carriers and solvents are Ringer's solution and isotonic sodium chloride solution. In addition, a normally sterile fixed oil is used as the solution or suspension medium.

The agents and compositions described herein are administered in effective amounts. "Effective amount" refers to an amount that achieves the desired reaction or desired effect alone or with additional doses. When treating a particular disease or condition, the desired response is preferably associated with inhibiting the course of the disease. This includes slowing the progression of the disease and, in particular, interrupting or reversing the progression of the disease. The desired response in the treatment of a disease or condition may also be to delay the onset of the disease or condition, or to prevent the onset of the disease or condition.

Effective amounts of agents or compositions described herein include the condition to be treated, the severity of the disease, the individual parameters of the patient (including age, physiological condition, size and weight). It will depend on the duration of treatment, the type of concomitant treatment (if any), the specific route of administration and a variety of similar factors. Therefore, the administered dose of the agents described herein may depend on a variety of such parameters. Larger doses (or substantially larger doses achieved by different, more localized routes of administration) may be used if the response in the patient is inadequate at the initial dose.

The agents and compositions described herein can be used in a patient, eg, in vivo, to treat or prevent a variety of disorders, such as those described herein. Can be administered. Preferred patients include human patients with disorders that can be corrected or ameliorated by administration of the agents and compositions described herein. This includes disorders with cells characterized by altered expression patterns of CLDN (eg, CLDN 18.2 and / or CLDN 6).

For example, in one embodiment, the agents described herein include those described herein that are characterized by the presence of a patient with cancer disease, eg, cancer cells expressing CLDN. It can be used to treat patients with cancer disease.

The pharmaceutical compositions and treatment methods described in accordance with the present invention may also be used for immunization or vaccination to prevent the diseases described herein.

The pharmaceutical compositions of the present invention may be administered with supplementation with an immunopotentiator (eg, one or more adjuvants), and one or more immunopotentiators further enhance their effectiveness. It may be included to increase, preferably to achieve a synergistic effect of immune stimulation. The term "adjuvant" is associated with a compound that prolongs, enhances, or promotes an immune response. Different mechanisms are possible in this regard, depending on the different types of adjuvants. For example, compounds that allow the maturation of DC, such as lipopolysaccharides or CD40 ligands, form the first category of suitable adjuvants. In general, any agent that affects the immune system of the "danger signal" type (LPS, GP96, dsRNA, etc.) or cytokine (eg, GM-CSF, etc.) controls the immune response. It can be used as an adjuvant that allows it to be enhanced and / or affected in any manner. CpG oligodeoxynucleotides can also be used in this context, if desired, but as explained above, those side effects that occur under certain circumstances must be considered. Particularly preferred adjuvants are cytokines such as monokines, phosphokines, interleukins or chemokines, such as IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-. 7, IL-8, IL-9, IL-10, IL-12, INFα, INF-γ, GM-CSF, LT-α or a growth factor (eg, hGH). Further known adjuvants are aluminum hydroxide, Freund's adjuvant, or oil (eg, Montande®), most preferred is Montandide® ISA51. Lipopeptides, such as Pam3Cys, are also suitable for use as adjuvants in the pharmaceutical compositions of the present invention.

The agents and compositions provided herein are alone or with conventional treatment regimens such as surgery, radiation, chemotherapy and / or bone marrow transplantation (self, allogeneic, allogeneic or unrelated). May be used in combination with.

Cancer treatments are frequently treated with a combination of two, three, four, or even more cancer drugs / treatments that have a much stronger synergistic effect than the effects of a monotherapy approach. Therefore, the combination strategy represents a particularly desirable area. Thus, in another embodiment of the invention, a cancer treatment utilizing a mechanism based on immunity or vaccination, eg, a cancer treatment utilizing the methods and pharmaceutical compositions of the invention, may have a similar specific mechanism or other mechanism. It may be effectively combined with various other drugs and / or methods that target specific mechanisms. Such include, for example, a combination of conventional tumor therapies, multiple epitope strategies, additional immunotherapy, and treatment approaches that target angiogenesis or apoptosis (for review, eg Andersen et al.). 2008, Cancer treatment: the cooperation of apoptosis with therapies, Cancer Immunotherapy Immunotherapy, 57 (11): 1735-1743). Sequential administration of different drugs may inhibit cancer cell growth at different checkpoints, while other drugs, for example, angiogenesis, survival or metastasis of malignant cells, which potentially make cancer a chronic disease. May interfere with conversion). The enumeration below provides some unrestricted examples of anti-cancer drugs and anti-cancer therapies that can be used in combination with the present invention:

1. 1. Chemotherapy Chemotherapy is the standard treatment for many types of cancer. The most common chemotherapeutic agents work by killing fast-dividing cells, one of the major properties of cancer cells. Thus, in combination with conventional chemotherapeutic drugs, such as alkylating agents, anti-metabolizing agents, anthracycline compounds, plant alkaloids, topoisomerase inhibitors, and other anti-anti-effects that affect either cell division or DNA synthesis. Combinations with tumor agents and the like eliminate suppressor cells, i.e. by restarting the immune system, or by making tumor cells more susceptible to immune-mediated killing, or by further cells of the immune system. Activation may significantly improve the therapeutic effect of the present invention. Numerous studies have demonstrated synergistic anti-cancer effects between chemotherapeutic drugs and vaccination-based immunotherapeutic drugs (eg, Quoix et al., 2011, Therapeutic vacation with TG4010 and first-line chemotherapy in advanced). non-small-cell lung cancer: a controllled phase 2B trial, Lancet Oncol., 12 (12): 1125-33; similarly, Liseth et al., 2010, Chemotherapy of immunotherapy. human malignancies: the hematological experience, J Biomed Biotechnol, 2010: 6920979 see also; similarly, Hirooka other, 2009, a combination therapy of gemcitabine with immunotherapy for patients with inoperable locally advanced pancreatic cancer, Pancreas, 38 (3): See also e69-74). There are hundreds of chemotherapeutic drugs available that are basically suitable for combination therapy. Some (but not limited to) examples of chemotherapeutic agents that can be combined with the present invention include carboplatin, cisplatin (Platinol, Platinol-AQ), cyclophosphamide (Cytoxan, Neosar), docetaxel (Taxotere), Doxorubicin (Adriamycin), Ellotinib (Tarceva), Etopocid (VePesid), Fluorouracil (5-FU), Gemzar, Imatinibmesylate (Gleevec), Ilimotecan (Camptosar), Irinotecan (Camptosar), Methotrexate Examples include Taxol, Abraxane, sorafinib (Nexavar), Sunitent, Hycamtin, Vincristine (Oncovin, Vincasar PFS) and Vincristine (Velban).

2. Surgery Cancer surgery, that is, surgery to remove a tumor, remains the basis of cancer treatment. Surgery can be combined with other cancer treatments to remove any residual tumor cells. Combining surgical methods with subsequent immunotherapeutic procedures is a promising effort that has been proven innumerably.

3. 3. Radiation Radiation therapy remains an important component of cancer treatment, with approximately 50% of all cancer patients receiving radiation therapy during the course of their illness. The main goal of radiation therapy is to deprive cancer cells of their ability to proliferate (cell division). Types of radiation used to treat cancer include photon radiation (X-rays and gamma rays) and particle radiation (electron beam, proton beam and neutron beam). There are two ways to deliver radiation to the location of the cancer. External beam radiation is delivered from outside the body by directing high-energy rays (photons, protons, or particle radiation) to the location of the tumor. Internal radiation or proximity radiation therapy is delivered from inside the body directly into the tumor site by a radioactive source sealed in a catheter or seed. Radiation therapy techniques applicable in combination with the present invention include, for example, split (radiotherapy delivered in a split treatment plan, eg, daily split irradiation of 1.5 Gy to 3 Gy given over several weeks). 3D radiotherapy (3DCRT; which delivers radiation according to macroscopic tumor volume); intensity-modulated radiotherapy (IMRT; computer-controlled intensity modulation of multiple radiation beams), image-guided radiotherapy (IGRT;) Techniques including pre-radiotherapy imaging that allow for correction), and stereotactic body radiotherapy (SRBT, delivering very large individual doses of radiation over only a few divided procedures). For a review of radiation therapy, see Baskar et al., 2012, Cancer and radiation therapy: currant advances and future radiation, Int. J Med Sci. , 9 (3): 193 to 199).

4. Antibodies Antibodies (preferably monoclonal antibodies) achieve their therapeutic effect on cancer cells through a variety of mechanisms. Antibodies can have a direct effect in causing apoptosis, i.e., programmed cell death. Antibodies can block components of signaling pathways (eg, growth factor receptors, etc.), thereby stopping the growth of tumor cells. In cells expressing monoclonal antibodies, the cells can result in the formation of anti-idiotype antibodies. Indirect effects include recruiting cytotoxic cells (eg, monocytes and macrophages, etc.). This type of antibody-mediated cell killing is called antibody-dependent cellular cytotoxicity (ADCC). Antibodies also bind to complement, thereby causing direct cytotoxicity known as complement-dependent cytotoxicity (CDC). Combining a surgical method with an immunotherapeutic drug or an immunotherapeutic method can be described, for example, by Gadri et al. : A successful effort, as revealed in 333-40. The enumeration below provides some unrestricted examples of anti-cancer antibodies and potential antibody targets (in parentheses) that can be used in combination with the present invention: Abagovomab (CA-125). , Absiximab (CD41), Adecatumab (EpCAM), Aftuzumab (CD20), Alacizumab pegol (VEGFR2), Altumomab Pentetate (Altumomab) MORAb-009), anatumomab mafenatox (TAG-72), apolizumab (HLA-DR), arcituximab (CEA), bavituximab (Bavituximab) (phosphatidylserine), phosphatidylserine Belimumab (BAFF), Bebashizumab (VEGF-A), Bavituximab mertansine (CD44 v6), Blinatumomab (CD19), Brentuximab vedotin (Brentuximab vedotin) Zumab mertansin (Mutin CanAg), cantumab tansin (MUC1), capromab pendetide (prostatic cancer cells), Carlumab (Callumab) (CNTO888), Katsumakisomab (Cat) , CD3), Secutuximab (EGFR), Citatuzumab bogatox (EpCAM), Sixutumab (IGF-1 receptor), Claudiximab (Claudiximab) (Claudin) Blinatumab tetraxetan (MUC1), konatumab (TRAIL-R2), dasetuzumab (CD40), darotuzumab (dalotuzumab) (insulin-like growth factor I receptor), denosumab (Denosumab) Lymphoma cells), Drozitubab (DR5), Echromeximab ( Echromeximab (GD3 ganglioside), Edrecolomab (EpCAM), Erotuzumab (SLAMF7), Enavatuzumab (PDL192), Ensituximab (Ensituximab) (NPC-1C) neu, CD3), etaracizumab (integrin αvβ3), faretzumab (folic acid receptor 1), FBTA05 (CD20), ficlatuzumab (SCH900105), figutzumab (IGF-1 receptor) Protein 75), Fresolimumab (TGF-β), Galiximab (CD80), Ganitumab (IGF-I), Gemutzumab Ozogamicin (CD33), Gebokizumab (IL-1β), Gilentuximab (Girentuximab) (Carbonated Dehydration Enzyme 9 (CA-IX)), Glembatumumab vedotin (GPNMB), Ibritsumomabuchiuxetan (CD20), Ikulucumab (VEGFR-1), Igobo Igovoma (CA-125), Indatuximab lavtansine (SDC1), Intetumumab (CD51), Inotsumumab Ozogamicin (Inotuzumab irapima) Ipilimumab (CD30), Labetzumab (CEA), Lexatumumab (TRAIL-R2), Livivirumab (Hepatitis B surface antigen), Linzzumab (CD33), Lorbotzumab mertansin (Lorvotumumab) (Lucatumab) (CD40), Lumiliximab (CD23), Mapatsuzumab (TRAIL-R1), Matsuzumab (EGFR), Mepolizumab (IL-5), Miratuzumab (CD74), Mitsumomab (Mitumomab) (GD3 Gangliomab) (GD3 Gangliomab) Moxetsu Momab Pased Tox (Mo) xetumomab pasudotox (CD22), Nacolomab tafenatox (C242 antigen), Naptumomab estaphenatox (Naptumomab estafenatox) (5T4), Narumumab estafenatox (5T4) ) (EGFR), nivolumab (IgG4), ofatumumab (CD20), olaratumab (PDGF-Rα), onartuzumab (human scattering factor receptor kinase), opoltuzumab monatox (Oportumumab) ), Oregobomab (CA-125), Oxelumab (OX-40), Panitumumab (EGFR), Patritumab (HER3), Pemtumoma (MUC1), Pertuzumab (HER2), Pertuzumab (HER2) ) (Gland cancer antigen), Pritumumab (Vimentin), Racotumomab (N-glycolylneuraminic acid), Radretumab (fibronectin extradomain-B), Rafivirmab (Rafivir) ), Ramsilumab (VEGFR2), Riotumumab (HGF), Rituximab (CD20), Robatumumab (IGF-1 receptor), Samarizumab (CD200), Sibrotumumab (CD200), Sibrotumumab (CD200) Siltuximab (IL-6), Tabalumab (BAFF), Takatsuzumab tetraxetan (alpha-fetoprotein), Tapritumomab paptox (Tapritumomab) Tenesin C), Teprotumumab (CD221), Ticilimumab (CTLA-4), Tigatuzumab (TRAIL-R2), TNX-650 (IL-13), Toshitsumomab (CD20), Truss Tuzumab (HER2 / neu), TRBS07 (GD2), Tremelimumab (CTLA-4), Tucotuzumab celmoleukin (EpCAM), Ubrituximab (Ublituximab) (MS4A1), Ubrituximab (MS4A1) , Borosiximab (integrin α5β1), botumumab (tumor antigen CTAA16.88), saltumumab (EGFR), zanolimmab (CD4).

5. Cytokines, chemokines, costimulatory molecules, fusion proteins The antigen-coding pharmaceutical compositions of the present invention can be used to induce beneficial immunomodulatory or tumor inhibitory effects by cytokines, chemokines, costimulatory molecules and / or fusions thereof. Use in combination with proteins is another embodiment of the invention. Various chemokines with C, CC, CXC and CX3C structures to increase the infiltration of immune cells into the tumor and to facilitate the movement of antigen-presenting cells into tumor-draining lymph nodes. May be used. Some of the most promising chemokines are, for example, CCR7 and its ligands CCL19 and CCL21, as well as CCL2, CCL3, CCL5 and CCL16. Other examples are CXCR4, CXCR7 and CXCL12. In addition, costimulatory or regulatory molecules such as B7 ligands (B7.1 and B7.2) are useful. Equally useful are other cytokines: for example, interleukins (eg IL-1 to IL17), interferons (eg IFNalpha1 to IFNalpha8, IFNalpha10, IFNalpha13, IFNalpha14, IFNalpha16, IFNalpha17, IFNalpha21, IFNbeta1). IFNW, IFNE1 and IFNK), hematopoietic factors, TGF (eg, TGF-α, TGF-β and other members of the TGF family), and finally members of the receptor tumor necrosis factor family and their ligands, as well as , Other cytokines, including, but not limited to, the following molecules: 4-1BB, 4-1BB-L, CD137, CD137L, CTLA-4GITR, GITRL, Fas, Fas-L. , TNFR1, TRAIL-R1, TRAIL-R2, p75NGF-R, DR6, LT. beta. R, RANK, EDAR1, XEDAR, Fn114, Troy / Trade, TAJ, TNFRII, HVEM, CD27, CD30, CD40, 4-1BB, OX40, GITR, GITRL, TACI, BAFF-R, BCMA, RELT, and CD95 ( Fas / APO-1), glucocorticoid-induced TNFR-related protein, TNF receptor-related apoptosis-mediated protein (TRAMP) and death receptor-6 (DR6). Among other things, CD40 / CD40L and OX40 / OX40L are important targets for combined immunotherapy because of their direct effect on T cell survival and proliferation. For a review, see Lechner et al., 2011, Chemokines, costimulatory tumors and fusion proteins for the immunotherapy of solid tumors, Immunotherapy, 3 (11), 13 (11), 13 (11), 13 (11).

6. Bacterial Treatment Researchers have used anaerobic bacteria (such as Clostridium novyi) to deplete the interior of oxygen-poor tumors. These anaerobes should then die when in contact with the oxygenated surface of the tumor, which means that these anaerobes would be harmless to other parts of the body. Means. Another strategy is to use anaerobic bacteria that have been transformed with enzymes that can convert non-toxic prodrugs into toxic drugs. With bacterial growth in the necrotic and hypoxic regions of the tumor, this enzyme is expressed exclusively in the tumor. Therefore, systemically applied prodrugs are metabolized to toxic drugs only in tumors. This has been shown to be effective with the non-pathogenic anaerobic bacterium Clostridium sporogenes.

7. Kinase Inhibitors Another large group of potential targets for complementary cancer treatment includes kinase inhibitors. This is because the growth and survival of cancer cells are closely linked to the deregulation of kinase activity. A wide variety of inhibitors have been used to restore normal kinase activity and thus reduce tumor growth. A group of targeted kinases include receptor tyrosine kinases such as BCR-ABL, B-Raf, EGFR, HER-2 / ErbB2, IGF-IR, PDGFR-α, PDGFR-β, c-Kit, Flt- 4, Flt3, FGFR1, FGFR3, FGFR4, CSF1R, c-Met, RON, c-Ret, ALK, cytoplasmic tyrosine kinases such as c-SRC, c-YES, Abl, JAK-2, serine / threonine kinases such as , ATM, Aurora A & B, various CDKs, mTORs, PKCi, various PLKs, b-Raf, S6K, STK11 / LKB1, and lipid kinases such as PI3K, SK1. Small molecule kinase inhibitors include, for example, PHA-739358, nilotinib, dasatinib, and PD166326, NSC734411, lapatinib (GW-5716), canetinib (CI-1033), semaxinib (SU5416), butaranib (PTK787 / ZK2284). Examples include Sunitinib (SU11248), sorafenib (BAY43-9006) and leflunomide (SU101). For further information, see, for example, Zhang et al., 2009, Targeting cancer with small molecule kinase inhibitors, Nature Reviews Cancer, 9, 28-39.

8. Toll-like Receptors Members of the Toll-like receptor (TLR) family are important links between innate and adaptive immunity, and the effects of many adjuvants rely on TLR activation. A large number of established vaccines against cancer incorporate ligands for TLRs to enhance the vaccine response. In addition to TLR2, TLR3, TLR4, especially TLR7 and TLR8, are being investigated for the treatment of cancer in passive immunotherapy efforts. The closely related TLR7 and TLR8 contribute to the antitumor response by affecting immune cells, tumor cells and the tumor microenvironment, and may be activated by nucleoside analog structures. All TLRs are used alone as immunotherapeutic agents or cancer vaccine adjuvants and may be combined synergistically with the formulations and methods of the invention. For more information, see van Duin et al., 2005, Triggering TLR signaling in vaccination. {J} See Trends in Immunology, Trends in Immunology, 27 (1): 49-55.

9. Angioplasty Inhibitors In addition to treatments that target immunomodulatory receptors affected by tumor-mediated escape mechanisms and immunosuppression, there are treatments that target the tumor environment. Angioplasty inhibitors prevent the widespread growth of blood vessels (angioplasty) that tumors require for survival. For example, angiogenesis promoted by tumor cells to meet their growing nutrient and oxygen requirements can be prevented by targeting various molecules. As a non-limiting example of angiogenesis mediators or angiogenesis inhibitors that may be combined with the present invention, soluble VEGF (VEGF isotypes VEGF121 and VEGF165, receptors VEGFR1, VEGFR2, and co-receptor neuropyrin- 1 and neuropyrin-2) 1 and NRP-1, angiopoietin 2, TSP-1 and TSP-2, angiostatin and related molecules, endostatin, vasostatin, carreticulin, platelet factor-4, TIMP and CDAI, Meth -1, Meth-2, IFN-α, IFN-β and IFN-γ, CXCL10, IL-4, IL-12 and IL-18, prothrombin (Klingle domain-2), antithrombin III fragment, prolactin, VEGI, SPARC, osteopontin, maspin, canstatin, proliferin-related protein, receptor, and drugs, such as bevasizumab, itraconazole, carboxyamide triazole, TNP-470, CM101, IFN-α, platelet factor. -4, slamin, SU5416, thrombospondin, VEGFR antagonist, angiogenesis inhibitory steroid + heparin, cartilage-derived angiogenesis inhibitor, matrix metalloproteinase inhibitor, 2-methoxyestradiol, tecogalan, tetrathiomolybdate, Examples thereof include salidomid, thrombospondin, prolactin αVβ3 inhibitor, linomide, and tasquinimod. For a review, see Schoenfeld and Dranoff, 2011, Anti-angiogenesis immunotherapy, Hum Vaccin, (9): 976-81.

10. Therapeutic Drugs Targeted by Small Molecules Therapeutic drugs targeted by small molecules are generally inhibitors of the enzyme domain in mutant proteins, overexpressed proteins or otherwise deterministic proteins in cancer cells. Prominent, unrestricted examples include the tyrosine kinase inhibitors imatinib (Gleevec / Glivec) and gefitinib (Iressa). The use of small molecules, such as sunitinib malate and / or sorafenib tosylate, which target several kinases, in combination with vaccines for the treatment of cancer has also been previously patented (US patent application published). 2009004213).

11. Viral Vaccines There are several viral cancer vaccines available or under development that can be used with the formulations of the present invention in combined therapeutic efforts. One advantage of using such a viral vector is that the inflammatory response that results from viral infection provides the warning signals necessary for immune activation and in its inherent ability to initiate an immune response. is there. The ideal viral vector must be safe and must not bring in an anti-vector immune response to allow it to enhance the antitumor specific response. Recombinant viruses such as vaccinia virus, herpes simplex virus, adenovirus, adeno-related virus, retrovirus and avipox virus have been used in animal tumor models and based on their encouraging results, human clinical practice. The test has started. A particularly important viral vaccine is a virus-like particle (VLP), a small particle containing a particular protein derived from the outer coat of the virus. Virus-like particles do not contain any genetic material derived from the virus and are unable to cause infection, but can be constructed to present tumor antigens on their coat surface. VLPs can be derived from a variety of viruses, such as hepatitis B virus, or parvoviruses (eg, adeno-related viruses), retroviruses (eg HIV) and flaviviruses (eg, hepatitis C). It can be derived from other retroviruses including viruses). For a general review, see Sorensen and Thomassen, 2007, Virus-based immunotherapy of cancer: what do we know and there are going? , APMIS, 115 (11): 1177-93; virus-like particles against cancer are reviewed below: Buonaguro et al., 2011, Developments in viruses-like vaccine-based vaccines for infectious diseases. Vaccines, 10 (11): 1569~83, as well as, Guillen other, 2010, Virus-like particles as vaccine antigens and adjuvants: application to chronic disease, cancer immunotherapy and infectious disease preventive strategies, Procedia in Vaccinology, 2 (2), 128-133.

12. Multiple Epitope Strategy The use of multiple epitopes has shown promising results for vaccination. Fast sequencing techniques combined with an intelligent algorithm system allow the use of tumor mutanomes and may provide a large number of epitopes for personalized vaccines that can be combined with the present invention. .. For further information, 2007, Vaccination of metastatic colorectal cancer patients with matured dendritic cells loaded with multiple major histocompatibility complex class I peptides, J Immunother, 30: 762~772, further, Castle other, 2012, Exploiting the mutanome for tumor vaccination , Cancer Res, 72 (5): 1081-91.

13. Adoptive T cell transfer For example, a combination of tumor antigen vaccination and T cell transfer is described below: Raportor et al., 2011, Communication immunotherapy using T-cell transfer and tumor vaccine vaccine. for myeloma, Blood, 117 (3): 788-97.

14. Peptide-Based Targeted Therapies Various peptides can bind to cell surface receptors or the affected extracellular matrix that surrounds the tumor. Radionuclides bound to these peptides (eg, various RGDs) will eventually kill cancer cells if the nuclides decay in the vicinity of the cells. Of particular interest are the oligomers or multimers of these binding motifs. This is because it can cause increased tumor specificity and avidity. For examples not limited to, see Yamada, 2011, Peptide-based cancer vaccine therapy for prostate cancer, bladder cancer, and malignant glioma, and Nihon Rinsho 16 (56), 69 (Nihon Rinsho, 69).

15. Other Therapies There are numerous other cancer therapies that can be combined with the formulations and methods of the invention to produce synergistic effects. Examples include, but are not limited to, treatments that target apoptosis, hyperthermia, hormone therapy, telomerase therapy, insulin augmentation therapy, gene therapy and photodynamic therapy.

The present invention is further exemplified by the following examples which are not construed as limiting the scope of the present invention.

Example 1: Preparation and testing of bispecific binders targeting CLDN 18.2 and CD3 a. Sequence origin, design and expression vector cloning of bi-scFv constructs A bispecific tandem single containing a binding domain that is specific for the human T cell receptor component CD3 and human tumor-related antigen (TAA). A chain antibody construct (bi-scFv) was prepared. The corresponding variable heavy chain region (VH) and the corresponding variable light chain region (VL) for each construct were specifically placed from the N-terminus to the C-terminus in the following contiguous order:

Table 1 summarizes all bi-scFv constructs made in the process of the present invention that are specific for TAA CLDN 18.2 and PLAC1. These bi-scFv constructs were made by gene synthesis with GeneArt AG (GeneArt / Life Technologies GmbH, Regensburg, Germany) using the VH and VL sequences of the corresponding antibodies. Codon optimizations, such as human (Homo sapiens) (HS), mouse (Mus musculus) (MM) or Chinese hamster ovary (CHO), were performed by GeneArt's GeneOptimizer® software. These are shown in Table 1. Information on specificity, sequence origin from monoclonal antibodies (mABs), codon frequency, additional sequence features, and references for all applied domains is summarized in Table 2. The variable domain sequence origin of each CD3 antibody is shown in Table 2. Due to the large homology of human TAA and mouse TAA, the same anti-TAA VH and VL sequences are combined with the VH and VL sequences of mouse-specific anti-CD3 antibody clone 145-2C11, except in combination. It could be used for the production of bi-scFv constructs for mouse assays.
DNA cloning and expression vector construction were performed according to standard procedures widely known by those skilled in the art (Green / Sambrook, Molecular Cloning, 2012). Briefly, the first bi-scFv DNA sequence contains a HindIII restriction site on the 5'side and an XhoI restriction site on the 3'side (HindIII and XbaI in the case of bi-scFv 1BiMAB) on the expression plasmid. Given for cloning. A secretory signal sequence was introduced upstream of the bi-scFv sequence at the 5'end for protein secretion from the cytoplasm to the culture medium. A VH domain for assembling a sequence encoding a flexible glycine-serine peptide linker of 15 to 18 amino acids, a single chain variable antibody fragment (scFv) in which one binds to CD3 and the other binds to TAA. And inserted to stitch the VL domains together. To form a bispecific single chain antibody, these two scFv domain sequences were linked by a sequence encoding a short peptide linker (GGGGS). Along with this linker sequence, a BamHI restriction site was introduced for the scFv domain exchange for upcoming cloning of the bi-scFV construct. Specifically, the 5'side scFv domain could be exchanged by HindIII and BamHI restrictions, and the 3'side scFv domain could be exchanged by BamHI and XhoI restrictions. See also Figure 1 for an overview of the structure.
All used bi-scFv antibody constructs were cloned into the standard mammalian expression vector pcDNA ™ 3.1 / myc-His (+) (Invitrogen / Life Technologies GmbH, Darmstadt, Germany). The C-terminal 6xHis tag served for metal affinity purification of the protein and for detection and analysis. All constructs were confirmed by sequencing by MWG's single-read sequence service (Eurofins MWG Operon, Ebersberg, Germany).

b. Preparation of stable production cell line To prepare stable production cell clone of CLDN18.2 specific bi-scFv protein, human embryonic kidney cell line HEK293 (ATCC CRL-1573) and Chinese hamster ovary cell line CHO-K1 (ATCC CCL-61) was used.

Transfection of HEK293 1 × 10 ⁷ HEK293 cells were placed in a 14.5 cm tissue culture dish 2 days prior to transfection in 20 ml of complete DMEM medium (10% heat-inactivated FBS and 0.5% penicillin-. DMEM / F-12 GlutaMax supplemented with streptomycin; all reagents were placed in DMEM / Life Technologies GmbH (from Darmstadt, Germany)). Prior to transfection, cells were washed with DPBS supplemented with 2 mM EDTA, followed by the addition of 20 ml non-supplemented DMEM containing neither FBS nor antibiotics. Example 1. 20 μg of linearized DNA of the construct described in a was diluted with 0.5 ml of unsupplemented DMEM / F-12 medium. 75 μl of 1 mg / ml linear PEI solution (polyethylenimine; Polysciences Europe GmbH, Eppelheim, Germany) was added to the diluted DNA and vortexed vigorously. After a 15 minute incubation at RT, the DNA / PEI complex was added dropwise to the cells and the cell culture dish was gently spun and then incubated at _{37 ° C. and 5% CO 2.} The medium was changed 24 hours after transfection. Selection of transfected cells was initiated 48 hours post-transfection with G418 sulfate (Gibco / Life Technologies GmbH, Darmstadt, Germany) at a final concentration of 0.8 mg / ml. G418 was constantly added to the culture medium for cell culture.

Transfection of CHO-K1 1 × 10 ^{1 day prior to transfection of 6} CHO-K1 cells, a 6-well tissue culture plate was supplemented with 2 ml of complete DMEM medium (10% heat-inactivated FBS) and antibiotics. DMEM / F-12 GlutaMax; all reagents were placed in DMEM / F-12 GlutaMax (obtained from Gibco / Life Technologies GmbH (Darmstadt, Germany)). Prior to transfection, cells were washed with DPBS supplemented with 2 mM EDTA, followed by the addition of 1.5 ml unsupplemented DMEM containing neither FCS nor antibiotics. Example 1. 4 μg of linearized DNA of the construct described in a was diluted with 0.25 ml of unsupplemented DMEM / F-12 medium and mixed gently. In a second reaction tube, 2.5 μl of Lipofectamine 2000 (Invitrogen / Life Technologies GmbH, Darmstadt, Germany) was diluted with 0.25 ml of unsupplemented DMEM / F12 medium, mixed gently and incubated at RT for 5 minutes. .. The DNA mix and lipofectamine mix were combined in a 1: 1 ratio, mixed gently and incubated at RT for 20 minutes. The DNA / lipofectamine 2000 complex was added dropwise to the cells and the cell culture dish was gently spun and then incubated at _{37 ° C. and 5% CO 2.} Six hours after transfection, the medium was replaced with complete DMEM / F-12 medium. The cells were divided the next day at a ratio of 1:10. Selection of transfected cells was initiated 48 hours post-transfection with G418 sulfate (Gibco / Life Technologies GmbH, Darmstadt, Germany) at a final concentration of 0.5 mg / ml. G418 was constantly added to the culture medium for cell culture.

c. Selection of HEK293 as a producing cell Example 1. Expression of bi-scFv protein by the stably transfected HEK293 and CHO-K1 cell lines described in b is detected according to standard procedures (Curent Protocols in Immunology, 2012). Therefore, it was characterized by immunofluorescence staining. Briefly, 2 × 10 ⁵ cells were grown on glass slides for 24 hours, after which the cells were infiltrated with 2% PFA. DPBS supplemented with 5% BSA and 0.2% saponin was used as blocking buffer. After washing with DPBS and blocking with blocking buffer, cells are incubated with the primary antibody Anti-HIS Epitope-Tag (Dianova GmbH, Hamburg, Germany) diluted 1: 500 in blocking buffer for 30 minutes at RT. did. After washing with blocking buffer, secondary Cy3 conjugated goat anti-mouse IgG (H + L) antibody (Jackson ImmunoResearch Europe, Suffolk, UK) diluted 1: 500 in blocking buffer was added and RT for 3 hours. Incubated. After washing with blocking buffer and H2O, cells were embedded in DAKO encapsulants (Dako, Carpinteria, CA, USA) supplemented with Hoechst 33342 dye (Pierce / Thermo Fisher Scientific, Rockford, IL, USA). Slides were examined for the presence of bi-scFv positive cells using a Nikon-Eclipse Ti fluorescence microscope and photographed (data not shown). HEK293 cells showed overall better expression of bi-scFv protein than CHO-K1 cells, and therefore HEK293 cells were selected as the producing cell line.

d. Production and Detection of Bi-scFv Protein 1BiMAB by HEK293 Clone # 28 Bi-scFv 1BiMAB was selected as the first bi-scFv protein to be produced, purified and used to establish various assays. That's right. For this purpose, a cloned cell line of HEK293 unfractionated (bulk) cells that stably express 1 BiMAB (see Example 1.b) was used in the FACSAria cell sorter (BD Biosciences, Heidelberg, Germany). Obtained by single cell selection using. After expanding and culturing approximately 40 clone strains, the best producer clone was obtained in Example 1. Selected by immunofluorescence as described in c.
Selected product clone # 28 was expanded and supplemented with 10 layers of Cell Factory (Nunc, Roskilde, Denmark), supplemented with 10% FBS, 0.5% penicillin-streptomycin and 0.8 mg / ml G418. DMEM / F-12 GlutaMax (all reagents obtained from Gibco / Life Technologies GmbH (Darmstadt, Denmark)) was cultured according to the manufacturer's guidelines. At the confluent stage, cells were washed with DPBS and the medium changed to DMEM / F-12 medium containing antibiotics but not FBS. Cell supernatants containing the bi-scFv protein 1 BiMAB were collected every 3-5 days for up to 4 weeks. The supernatant was filtered through 500 ml of Steritop Filter Unit (Merck Millipore, Billerica, MA, USA) and stored at 4 ° C. until FPLC purification.
Prior to FPLC purification, the presence of bi-scFv in cell culture supernatants was examined by polyacrylamide gel electrophoresis performed by standard methods (Curent Protocols in Protein Science, 2012), followed by Coomassie staining and Western blot analysis. The supernatant was concentrated 5 × 10 × by Centricon Centrifugal Filter Device (10K MWCO) (Merck Millipore, Billerica, MA, USA) according to the manufacturer's protocol. Concentrated and unconcentrated supernatants were separated on NuPAGE Novex 4-12% Bis-Tris gels (Invitrogen / Life Technologies GmbH, Darmstadt, Germany). The gel was then stained with Coomassie Brilliant Blue solution according to standard procedures to detect between the 50 kD to 60 kD bi-scFv protein 1BiMAB and other proteins contained in the cell culture supernatant. .. Western blot analysis was performed to specifically detect the bi-scFc protein 1BiMAB by its 6 × His tag. Briefly, the protein is blotted onto PVDF membrane, the blocking treatment is performed with PBST / 3% milk powder, and then the membrane is diluted 1: 500 in blocking buffer with the primary antibody Anti-HIS Epitope-Tag (Dianova). Incubated with GmbH, Hamburg, Germany) at 4 ° C. for 1 hour. After washing with blocking buffer, membranes are mixed with Fc-specific secondary peroxidase-conjugated goat anti-mouse IgG antibody (Sigma Aldrich, Germany) diluted 1: 10000 in blocking buffer for 1 hour at 4 ° C. Incubated. After washing with blocking buffer, the signal was visualized by the SuperSignal West Femto Chemiluminescent Substrate (Pierce / Thermo Fisher Scientific, Rockford, IL, USA) and the ImageQuant Chemiluminescence .. A bi-scFv signal was detected between 50 kD and 60 kD when compared to internal molecular weight standards (see FIGS. 3A and 3B).

e. Purification and Quantification of bi-scFv Protein 1 BiMAB Cell culture supernatant of HEK293 clone # 28 containing bi-scFv protein 1 BiMAB (as described in Example 1.d) was subjected to a standard procedure (Current Protocols in Protein Science). , 2012) for immobilized metal affinity chromatography (IMAC). Briefly, filtered cell culture supernatants were loaded onto a His Trap FF (5 ml) column coupled to an AKTA Purifier 10 FPLC system (both GE Healthcare Life Sciences, Munich, Germany). PBS wash buffer containing 10mM imidazole, PBS elution buffer contains a 500mM of NaCl, _NaH 2 PO ₄ and 250mM Imidazole 50 mM, pH was adjusted both buffer 7.4. Elution was performed with a gradual gradient. The eluted bi-scFv protein 1 BiMAB was immediately dialyzed against 1 x PBS using Slide-A-Lyzer G2 Dialysis Cassette (10K MWCO) (Pierce / Thermo Fisher Scientific, Rockford, IL, USA). After dialysis against 1 × PBS, bi-scFv was dialyzed against H2O-based 200 mM arginine buffer (L-arginine monohydrochloride; Roth, Karlsruhe, Germany).
The concentration of bi-scFv at 280 nm using NanoDrop 2000c, taking into account the extinction coefficient and molecular weight of the bi-scFv protein 1BiMAB determined by the ProtParam tool (http://web.expasy.org/protoparam/). Obtained by measurement. The purified protein was subdivided and stored at −80 ° C. for long-term storage and at 4 ° C. for immediate use.
The quality and purity of the bi-scFv protein 1 BiMAB was determined in Example 1. Examined by Coomassie staining and Western blot analysis as described in d (see also FIGS. 3A and 3B). BSA standard dilutions were included in the Coomassie procedure to roughly confirm the concentrations measured by NanoDrop (data not shown).

f. Establishment of ELISA Assay A specific ELISA assay had to be established for the quantification of 1BiMAB in the cell culture supernatant of HEK293 cells. For this purpose, Example 1. The supernatant from d and Example 1. The purified bi-scFv protein 1 BiMAB described in e was used. A Ni-NTA plate (Thermo Fisher Scientific, Rockford, IL, USA) pre-blocked with BSA was used to immobilize the bi-scFv protein 1 BiMAB with its 6 × His tag. All washing steps were performed 3 times with 200 μl of 1 × PBS / 0.05% Tween (wash buffer) per well and all steps were performed at room temperature. Purified 1BiMAB protein was used as a standard and diluted with 1 × PBS in the range of 10 ng / ml to 500 ng / ml. The supernatant was diluted 1:10 in 1 x PBS. 100 μl of diluted protein or supernatant was transferred to each well and incubated for 1 hour with shaking. After washing, the anti-idiotype antibody against the VH-VL domain of mCLDN18.2ab was diluted to a final concentration of 0.5 μg / ml in 1 × PBS / 3% BSA. 100 μl of anti-mCLDN 18.2ab solution was added per well and incubated for 1 hour with shaking. After washing, AP-conjugated anti-mouse Fc antibody (Jackson ImmunoResearch Europe, Suffolk, UK) was diluted to a final concentration of 300 ng / ml in 1 x PBS / 3% BSA. 100 μl of this secondary antibody solution was added per well and incubated for an additional hour with shaking. As negative controls, only the secondary antibody, 1BiMAB + secondary antibody, and anti-mCLDN18.2ab + secondary antibody were used. In addition, HEK293 cell fluid without bi-scFv protein was included in the assay. Finally, 50 μl of AP substrate solution (1.5 mg pNPP per 1 ml substrate buffer, AppliChem GmbH, Darmstadt, Germany) was added per well after washing. After 5 minutes, 15 minutes and 30 minutes of incubation in the dark, absorption at 405 nm using an excitation wavelength of 492 nm was measured using an Infinite M200 Tecan microplate reader (Tecan, Mannedorf, Switzerland). The concentration of bi-scFv protein from the supernatant was calculated for the standard sequence (data not shown).

g. Transfection of CLDN18.2-specific bi-scFv protein for comparative studies Preferably to transiently produce large amounts of CLDN18.2-specific bi-scFv protein, human embryonic kidney cell line HEK293T (ATCC CRL-11268) was used for transfection.
Two days prior to transfection of 1 × 10 ⁷ HEK293T cells, a 14.5 cm tissue culture dish was supplemented with 20 ml of complete DMEM medium (10% heat-inactivated FBS and 0.5% penicillin-streptomycin). DMEM / F-12 GlutaMax; all reagents were placed in Gibco / Life Technologies GmbH (obtained from Darmstadt, Germany). Prior to transfection, cells were washed with DPBS supplemented with 2 mM EDTA, followed by the addition of 20 ml non-supplemented DMEM containing neither FBS nor antibiotics. 20 μg of cyclic DNA constructs (1BiMAB, no.11-no.20 and no.35 (these are described in Example 1.b)) were diluted with 0.5 ml of unsupplemented DMEM / F-12 medium. 75 μl of 1 mg / ml linear PEI solution (polyethylenimine; Polysciences Europe GmbH, Eppelheim, Germany) was added to the diluted DNA and vortexed vigorously. After a 15 minute incubation at RT, the DNA / PEI complex was added dropwise to the cells and the cell culture dish was gently spun and then _{incubated at 37 ° C. and 5% CO 2} for 24 hours. After medium exchange with unsupplemented DMEM / F-12, cells were _{incubated at 33 ° C. and 5% CO 2 for} an additional 48 hours. Cell supernatants were collected after incubation and aseptically filtered through a 0.2 μm Ministal syringe filter (Sigma-Aldrich, Germany). Subsequently, the bi-scFv protein was purified from the cell culture supernatant on a small scale by a Ni-NTA spin column according to the manufacturer's protocol (Qiagen, Hilden, Germany). The concentration of the bi-scFv protein was determined in Example 1. Estimated by ELISA as described in f, Example 1. Confirmed by Western blot analysis as described in e (data not shown). The purified protein was stored at 4 ° C. for immediate use.

Example 2: Establishment of a functional assay to monitor specific T cell activation and target cell lysis by retargeted T cells mediated by bi-scFv protein FPLC purified bi-scFv protein 1 BiMAB Was used to establish an in vitro assay to monitor the ability of the bi-scFv protein to specifically retarget human effector cells to TAA-positive target cells. The purpose was to visualize the effects and to quantify human T cell activation and specific target cell lysis.

a. Microscopic analysis of T cells targeted to target cells by bi-scFv protein To visualize the functionality of bi-scFv protein, targeting effector cells to CLDN18.2-expressing target cells with bi-scFv protein Had to be established to show microscopically. To this end, the gastric cancer cell line NugC4 (Sahin U. et al., Clin Cancer Res, 2008 (Dec 1), 14 (23): 7624-34), which endogenously expresses relatively high levels of human CLDN18.2. ) Was used as the target cell line.
Human effector cells were freshly isolated from human blood from healthy donors according to standard procedures (Curent Protocols in Munich, 2012): Briefly, blood was diluted with DPBS and Ficoll-Paque Plus (GE Healthcare). It was layered on Life Sciences, Munich, Germany) and centrifuged. Peripheral blood mononuclear cells (PBMCs) were harvested from the interphase, washed with cold DPBS supplemented with 2 mM EDTA, and counted. Human T cells were subsequently isolated from PBMCs by Pan T Cell Isolation Kit II (Miltenyi Biotec, Teterow, Germany) by magnetically activated cell isolation (MACS) according to the manufacturer's guidelines.
1 × 10 ⁵ NugC4 cells were seeded per well on a 6-well plate for tissue culture. Human cells were prepared as described above and added in an effector to target (E: T) ratio of 5: 1. RPMI 1640 medium (Gibco / Life Technologies GmbH, Darmstadt, Germany) supplemented with 5% heat-inactivated human AB serum, 0.5% penicillin-streptomycin, 1 × NEAA and 1 mM sodium pyruvate of all cells. The final volume per well was adjusted to 2 ml / well. Control samples included target cells or T cells alone, with or without the bi-scFv protein. Tissue culture plates were subsequently incubated at 37 ° C. and 5% CO _2. Assays were continuously observed using a Wilover S inverted microscope (Hund, Wetzlar, Germany) from 6 hours to 48 hours of co-incubation. Significant effects on T cell clustering, immunological synapse formation and target cell killing on target cells in the presence of bi-scFv protein 1 BiMAB were observed at 24 hours. After 48 hours, few viable target cells were found. Photographs were taken at 24 hours using a Nikon Eclipse TS100 inverted microscope (Nikon, Japan). See also FIG.
This assay was further included as a visibility control in all cytotoxicity assays in various well formats.

b. Target-dependent T cell activation by bi-scFv protein 1 BiMAB A flow cytometry assay was established to detect specific activation of human T cells by bi-scFv protein. To detect T cell activation, early activation marker CD69 and late activation marker CD25 were selected for staining with fluorescent conjugated antibodies. CD3 on T cells was stained for detection of human T cells in a mixture of target cells and T cells.
The assay set from the above was selected (Example 2.a). Briefly, NugC4 target cells were seeded with human T cells in a 2 ml complete medium at a 5: 1 E: T ratio and the bi-scFv protein 1BiMAB was in the range of 0.001 ng / ml to 1000 ng / ml. Was added at the concentration of. Control samples contained target cells or T cells alone, with or without bi-scFv protein 1BiMAB and without bi-scFv protein 1BiMAB. After 24 and / or 48 hours (which depends on the results of visibility control), all cells were collected by gently scraping with Cell Scrapers (Sarstedt AG & Co, Nurmbrecht, Germany) and 5 ml. Transferred to round bottom tubes (BD Falcon, Heidelberg, Germany). Cells were centrifuged and washed with DPBS. Mouse anti-human CD3-FITC, mouse anti-human CD69-APC and mouse anti-human CD25-PE (all antibodies were BD Biosciences, Heidelberg, Germany) were used for cell staining. The cell pellet was resuspended in 50 μl FACS buffer containing fluorescent conjugated antibody (DPBS supplemented with 5% FBS). After incubation in the dark at 4 ° C. for 20 minutes, the sample is washed with 4 ml of DPBS and the cell pellet is prepared with propidium iodide (PI) or 7-AAD (both Sigma Aldrich) for detection of dead cells. , Germany) was resuspended in 200 μl FACS buffer containing a final dilution of 1: 1000. Samples were kept on ice and in the dark throughout the measurement period. Assays were established using FACSCalibur and subsequent measurements were performed using FACSCanto II flow cytometers (both BD Biosciences, Heidelberg, Germany). The analysis was evaluated by FlowJo software (Tree Star, San Carlos, CA, USA).
As shown in FIGS. 6A and 6B, 1BiMAB-mediated T cell activation was completely undetectable in the absence of target cells, emphasizing the strict target dependence of bi-scFv functionality. There is. Significant T cell activation in the presence of target cells occurred after 24 hours with only 0.01 ng / ml 1 BiMAB. Maximum efficiency was reached using 1 BiMAB of 100 ng / ml.
In addition to studies of T cell activation, this assay also mediates bi-scFv against target cell killing by opening and closing gates to the target cell population and estimating the proportion of PI-positive or 7-AAD-positive target cells. Allows qualitative analysis of effects (data not shown). All analyzes were performed using FlowJo software (Tree Star, San Carlos, CA, USA).

c. Luciferase Cytotoxicity Assay A sensitive assay had to be developed to reveal a subtle difference in the target cell killing ability of the bi-scFv protein directed against CLDN18.2 and CD3. The purpose was to establish an assay that could quantitatively monitor target cell killing in a high-throughput fashion. To achieve this, a luciferase cytotoxic assay was chosen. Along with this, measurement of luciferase expression by viable target cells makes it possible to indirectly determine target cell lysis mediated by cytotoxic effector cells in the presence of antibodies.
First, NugC4 cells (above) were transduced with a lentiviral vector carrying firefly luciferase, an EGFP reporter gene and an antibiotic selection marker. After selection of transduced cells with antibiotics, EGFP high-expressing cells were sorted by a FACSAria cell sorter (BD Biosciences, Heidelberg, Germany) to analyze the high expression of luciferase, followed by further study. It was expanded and cultured.
Example 2. Human effector cells. Prepared as described in a. Assay establishment was performed in the range of 1 ng / ml to 100 ng / ml of bi-scFv protein 1 BiMAB, whereby a concentration of 5 ng / ml was found to have a very efficient and reproducible effect. This concentration was further used as the standard concentration. NugC4 cells (above) that stably express luciferase were used as target cells. 1 × 10 ⁴ target cells were seeded per well on a white flat-bottomed 96-well plate. Human T cells (prepared as described in Example 2.a) were added in an E: T ratio of 5: 1. Using the medium described above (Example 2.a), the final volume per well was adjusted to 100 μl. The test sample and the control sample were placed in at least three rows.
Cell culture microplates were incubated at 37 ° C. and 5% CO ₂ for 24 and 48 hours. For analysis, 50 μl of an aqueous solution containing 1 mg / ml luciferin (BD Monolite, BD Biosciences, Heidelberg, Germany) and 50 mM HEPES was added per well, followed by incubation of the plate at 37 ° C. for 30 minutes in the dark. did. Luminescence resulting from the oxidation of luciferin by live cells expressing luciferase was measured with a microplate reader (Infinite M200, Tecan, Mannedorf, Switzerland). The percentage of specific target cell lysis was calculated by the following formula:% specific lysis = [1- (luminescence test sample-L _max ) / (L _min- L _max )] x 100, where "L" is Shows dissolution. L _min indicates the minimum lysis in the absence of bi-scFv and L _max is the maximum lysis (spontaneous luminescence) achieved by the addition of Triton X-100 (final concentration of 2%) in the absence of bi-scFv. Equal to the count number).
The potential direct effects of the bi-scFv protein on effector cell-independent target cells, including all controls (eg, L _min and L _max, etc.), place the target cells without human T cells. I asked for it.
This assay was used for further study to investigate specific T cell-mediated lysis of target cells. Various modifications were performed, for example, by altering the bi-scFv concentration, bi-scFv protein, E: T ratio or effector cells (CD8 ⁺ T cells, CD4 + T cells, PBMC).

Example 3: Selection of CLDN18.2-Specific Bi-scFv Read Candidates Luciferase Cytotoxication Assay Using Various CLDN18.2-Specific Bi-scFv Proteins to Select the Strongest Bi-scFv Variants TAA NugC4, which endogenously expresses CLDN18.2 and ectopically expresses luciferase, all 10 CHO codon-optimized constructs (no.11-no.20) specific for CLDN18.2. It was tested in a luciferase cytotoxic assay using target cells in comparison with human codon-optimized bi-scFv protein 1 BiMAB (see also Example 2.c). The characteristics of the bi-scFv protein used are detailed in Table 2. Since PLAC1 is not expressed by NugC4 cells, bi-scFv no. Specific for TAA PLAC1. 35 was used as an isotype control. FACS binding assay demonstrated binding activity to CD3 on human T cells (data not shown). All bi-scFv proteins were used in Example 1. Prepared as described in g and Example 2. Used for cytotoxicity assays set as described in c.
All bi-scFv proteins were used at a final concentration of 5 ng / ml. For _{determination of L min} , control bi-scFv protein no. 35 was seeded in nine rows with target cells and T cells, and test samples were placed in six rows. One plate per time point was prepared for analysis.
Specific lysis at each analyzed time point (8h, 16h, 24h) was plotted against the bi-scFv protein used. 1BiMAB (SEQ ID NO: 39) of the bi-scFv protein and no. 15 (SEQ ID NO: 41) (these are constructed in the same orientation and contain the same anti-CD3 sequence (TR66), differing in their codon usage frequency at the nucleic acid level and only in the linker sequence). Was found to be the most potent antibody in mediating target cell lysis (see Figure 2). 1BiMAB and no. Since 15 is equal in their efficiency, the bi-scFv protein 1BiMAB, which has been relatively well studied so far, was selected for all subsequent assays. The 18PHU3 and 18PHU5 constructs (see Tables 1 and 2) were compared to 1 BiMAB at subsequent time points. The efficiency of 18PHU5 was comparable to 1BiMAB, and 18PHU3 was not very strong (data not shown).

Example 4: Establishing a FACS-based binding assay for bi-scFv protein 1 BiMAB A flow cytometry assay was established to evaluate the binding ability of the CLDN18.2 targeting component and the CD3 targeting component of the bi-scFv protein. did. NugC4 cells endogenously expressing CLDN18.2 were used to investigate the anti-CLDN18.2 site, and human T cells were used to investigate the anti-CD3 site.
To further investigate anti-CLDN18.2 binding capacity, NugC4 cells were trypsinized, washed with complete RPMI1640 medium, followed by DPBS. All washing steps were performed by centrifugation at 1200 rpm for 6 minutes at 4 ° C. 2.5 × 10 ⁵ NugC4 cells were transferred to 5 ml round bottom tubes and incubated with 50 μg / ml FPLC-purified 1BiMAB protein in FACS buffer for 30 minutes at 4 ° C. Cells were washed with 2 ml FACS buffer and subsequently incubated with 3.3 μg / ml monoclonal antibody Anti-HIS Epitope-Tag (Dianova GmbH, Hamburg, Germany) at 4 ° C. for 30 minutes. After washing with 2 ml of FACS buffer, the cell pellet was subjected to APC-conjugated goat anti-mouse secondary antibody (Jackson ImmunoResearch Europe, Suffolk, UK) at a dilution of 1: 200 in FACS buffer and 4 in the dark. Incubated at ° C for 20 minutes. Cells were washed twice with 2 ml FACS buffer and finally resuspended in 150 μl FACS buffer supplemented with 1 μg / ml PI (Sigma Aldrich, Germany) to counterstain dead cells. Another staining by the same procedure except without the use of Anti-HIS Epitope-Tag antibody was included using 50 μg / ml 1BiMAB and APC-conjugated goat anti-mouse secondary antibody (1: 200). .. Negative control samples included a single secondary goat anti-mouse APC antibody, monoclonal antibody Anti-HIS Epitope-Tag + secondary goat anti-mouse APC antibody. As positive controls, a 10 μg / ml monoclonal CLDN18.2-specific antibody mCLDN18.2ab stained with a secondary goat anti-human APC antibody (Jackson ImmunoResearch Europe, Suffolk, UK), and a control of only the secondary antibody. Was executed.
Samples were measured using a FACSCalibur flow cytometer (BD Biosciences, Heidelberg, Germany) and analyzed by FlowJo software (Tree Star, San Carlos, CA, USA). Strong signals were detected by sequential staining with 1BiMAB, Anti-HIS Epitope-Tag and goat anti-mouse APC. Signal intensity was comparable to positive control mCLDN 18.2ab with goat anti-human APC. Low direct binding of goat anti-mouse APCs to 1 BiMAB was observed in samples stained with 1 BiMAB and goat anti-mouse APCs without the involvement of Anti-HIS Epitope-Tag (see FIG. 4A).
Sequential staining protocols with bi-scFv, Anti-HIS Epitope-Tag and goat anti-mouse APC were used for all further FACS binding assays to further investigate the binding potential of the bi-scFv protein (FIGS. 4B, 4C). And see Figure 4D). To rule out non-specific binding of 1BiMAB, target cells not expressing CLDN18.2 (data not shown), as confirmed by RT-PCR, were subjected to this FACS-based binding assay. No non-specific binding of 1BiMAB was detected as shown in FIG. 4D.

Human T cells were used to investigate the binding capacity of the anti-CD3 arm of the bi-scFv protein 1 BiMAB. Example 2. ^{1 × 10 6} T cells prepared as described in a are transferred to a 5 ml round bottom tube and FPLC-purified 1 BiMAB in the range of 0.002 μg / ml to 2 μg / ml in FACS buffer. Incubated with protein at 4 ° C. for 30 minutes. Further staining procedures were as described above. Control samples included a single secondary goat anti-mouse APC antibody and a monoclonal antibody Anti-HIS Epitope-Tag + secondary goat anti-mouse APC antibody. Measurements and analysis were performed as described above. A significant signal was obtained with 2 μg / ml 1 BiMAB (see Figure 4C).

Example 5: Investigation of highly specific target-dependent T cell activation by 1BiMAB of in vitro scFv High or low levels of CLDN 18.2 endogenously expressing cancer cell lines and CLDN 18.2 Non-cancer cell lines were selected to demonstrate the exact target dependence of bi-scFv protein 1BiMAB in an in vitro cytotoxicity assay. The cell lines selected were of two major cancer types expressing CLDN18.2: gastric cancer (NugC4, MKN7, SNU-1) and pancreatic cancer (DanG, KP-4). The breast cancer cell line MCF7 was used as a negative control.

a. RT-PCR of cancer cell line CLDN18.2
Total RNA was extracted from the cancer cell lines described above by the RNEasy Mini Kit procedure according to the manufacturer's protocol (Quiagen, Hilden, Germany). 5 μg of RNA was used for cDNA synthesis by SuperScriptII reverse transcriptase (Life Technologies GmbH, Darmstadt, Germany).
RT-PCR analysis was performed on the ABI Prism 7300 Real Time PCR System (Applied Biosystems / Life Technologies GmbH, Darmstadt, Germany) using SYbr Green dye and the following primers.
CLDN18.2, forward direction: TGGCTCTGTGTCGACACTGTG; reverse direction: GTGTCATGTTAGCTGTGGAC
HPRT, forward direction: TGACACTGGCAAAACAAAGCA; reverse direction: GGTCCTTTTCACCAGCAAGCT
Delta Ct was calculated by subtracting the Ct value of the housekeeping gene HPRT from the Ct value of CLDN18.2 (see Figure 7A for results).

b. An exclusive T cell activation cytotoxicity assay in the presence of CLDN 18.2 Example 2. It was set as described in a. Example 5. Quantitative RT-PCR. The cancer cell line examined for the CLDN18.2 transcript in a was used as the target cell. The concentration of bi-scFv protein 1 BiMAB in this assay was set to 5 ng / ml. Target cells were seeded in duplicate with human T cells and 1BiMAB to analyze T cell activation. To monitor some potential allogeneic reactivity of T cells to bi-scF protein 1BiMAB-independent target cells, target cells and T cells were seeded in duplicate without 1BiMAB. Cells were continuously observed under a microscope to confirm T cell clustering and target cell binding. In the case of the CLDN18.2 high expression cell line, NugC4, a significant effect occurred after 24 hours; after 48 hours, few viable target cells were observed. In the case of the CLDN18.2 low expression cell line DanG, the first effect was seen after 96 hours and a significant effect was seen after 120 hours. For the CLDN18.2 negative cell line, no effect indicating any T cell activation could be seen even after 144 hours. Example 2. T cells of all samples were used for the early T cell activation marker CD69 and the late activation marker CD25. Analysis was performed by flow cytometry after 144 hours of co-incubation with target cells as described in a, and T cell populations were counterstained with CD3 and dead cells were counterstained with PI. Interestingly, up to 100% of T cells co-incubated with NugC4 and 1BiMAB were CD25 positive, but CD69 negative. This indicates long-term activation of T cells for which down-regulation of CD69 has already occurred. Roughly 75% of T cells co-incubated with DanG and 1BiMAB were activated, of which about 40% co-expressed CD25 and CD69. This indicates T cell activation that is still ongoing. T cells co-incubated with the CLDN18.2 negative cell line showed no signs of T cell activation: neither CD69 nor CD25 expression was significantly elevated compared to the level of the sample without 1BiMAB. (See also Figure 7B).

Example 6: Investigation of T cell function induced by bi-scFv protein 1 BiMAB a. Induction of T cell proliferation T cell proliferation is an indicator of T cell activation. A flow cytometry assay was used to show T cell proliferation in response to bi-scFv protein 1 BiMAB in the presence of CLDN 18.2 positive target cells. Briefly, Example 2. 0.5 μM carboxyfluorescein diacetate succinimidyl ester (CellTrace CFSE, Invitrogen / Life Technologies GmbH, Germany) in which 1 × 10 ^{6 human T cells isolated as described in a are lysed in DPBS.} ) In the dark at 37 ° C. for 10 minutes. Staining was stopped by adding 5 volumes of chilled complete RPMI1640 medium. Cells were kept on ice for 5 minutes and washed 3 times with complete RPMI medium (5% heat-inactivated human AB serum, 0.5% penicillin-streptomycin, 1 x NEAA and 1 mM sodium pyruvate), followed by It was resuspended in 1 × 10 ^{5 cells / ml.} Example 2. A cytotoxicity assay as described in b was set up with NugC4 cells endogenously expressing CLDN18.2 and human T cells as effector cells. 50 U of IL-2 per 1 ml of medium was added to the cells. Samples included T cells alone, T cells with 1 ng / ml 1 BiMAB, T cells and NugC4 cells, and T cells with 1 ng / ml 1BiMAB and NugC4 cells. After 120 hours of co-incubation, T cells are collected, collected in 5 ml round bottom tubes, washed and stained with 7-AAD DPBS solution at 1: 1000 for 15 minutes at 4 ° C. Line-stained. After washing with DPBS, cells were resuspended in FACS buffer and analyzed using FACSCanto II (BD Biosciences, Heidelberg, Germany).
T cell proliferation was detected by a reduced CFSE signal only in the presence of target cells and the bi-scFv protein 1BiMAB (see also FIG. 8A).

b. Induction of Granzyme B Serine Proteases Flow cytometry to reveal upregulation of proteolytic molecules after T cell activation mediated by bi-scFv protein 1 BiMAB in the presence of CLDN18.2-positive target cells We chose to detect the serine protease Granzyme B by analysis. Example 2. A cytotoxicity assay as described in b was set up with NugC4 cells endogenously expressing CLDN18.2 and human T cells as effector cells. Samples included T cells alone, T cells with 5 ng / ml 1BiMAB, T cells and NugC4 cells, and T cells with 5 ng / ml 1BiMAB and NugC4 cells. After 96 hours of co-incubation, T cells are collected, collected in a 5 ml round bottom tube, washed and stained with 7-AAD DPBS solution at 1: 1000 for 15 minutes at 4 ° C. Line-stained. After washing with DPBS, cells were fixed at RT for 20 minutes with 100 μl Cytoperm / Cytofix solution. Cells were washed with 1 × Perm / Wash and subsequently stained with RT for 20 minutes with PE-conjugated mouse anti-human granzyme B antibody. After washing, cells were resuspended in FACS buffer and analyzed using FACSCanto II (all reagents and FACS devices were BD Biosciences, Heidelberg, Germany).
Up-regulation of Granzyme B in T cells was detected only in the presence of target cells and the bi-scFv protein 1BiMAB (see also Figure 8B).

Example 7: To determine the 50% maximum effective dose of determining luciferase cytotoxicity assays bi-scFv protein 1BiMAB _{EC 50} of the bi-scFv protein 1BiMAB in vitro cytotoxicity assays, a titration row of 1BiMAB, the main Example 2. Tested in an in vitro luciferase cytotoxic assay as described in c.
Example 2. NugC4 cells stably expressing luciferase described in c with human T cells and bi-scFv protein 1BiMAB concentration in the range of 1 pg / ml to 1 μg / ml (in 10-fold increments) or L _min value. Incubated without 1 BiMAB to determine. Live cell luminescence was measured 24 and 48 hours after assay setup using an Infinite M200 Tecan plate reader. Specific target cell lysis, Example 2. It was calculated by the formula exemplified by c.
Maximum dissolution was reached after 48 hours with 1 BiMAB of 1 ng / ml to 10 ng / ml. _{EC 50 s} were determined at 48 hours after in this assay is approximately 10 pg / ml (FIG. 9 see also). The results of this assay will also be reported by others (eg, Luterbuese, R et al., Proc. Natl. Acad. Sci. USA, 2010 (Jul 13), 107 (28): 12605-10). It is strongly dependent on the potency of human T cells, which changes according to the immune status of the donor. In addition, the target cell line used, NugC4, exhibits various expressions of CLDN18.2 that also affect the results. Accordingly, variation of _{The EC 50} values of the bi-scFv protein 1BiMAB in the range of 10pg / ml~300pg / ml have been observed during the course of the present invention.

Example 8: Efficacy in Mouse Xenograft Models To investigate the therapeutic potential of bi-scFv protein 1 BiMAB in vivo, NOD. Mouse strains of Cg-Prkd ^scid IL2rg ^tm1Wjl / SzJ or short NSG (Jackson laboratory, Bar Harbor, ME, USA) were selected. For the studies described, engraftment of human effector cells and human T lymphocytes in mice is essential for studying the effects of bi-scFv associated with T cells in vivo. The complete lack of B cells, T cells and NK cells makes mouse strain NSG suitable for this type of xenograft study. A mouse model mainly containing engrafted human T cells after PBMC injection was established as part of the invention.

a. Late initiation of advanced CLDN18.2 high-expressing tumors in mice with bi-scFv protein 1 BiMAB In an illustrated study, 40 female NSG mice at 8 weeks of age were stabilized at high levels of human CLDN18.2. 1 × 10 ⁷ HEK293 cells (HEK293-CLDN18.2) that were specifically expressed were subcutaneously inoculated. Five days after tumor cell inoculation, mice were stratified into treatment groups according to their tumor volume and mice without tumor growth were excluded. On the same day, peripheral blood mononuclear cells (PBMC) were used in Example 2. It was isolated from human blood of a healthy donor by the Ficoll density gradient technique as described in a and used as effector cells in vivo. ^{2 × 10 7} PBMCs diluted with 300 μl DPBS were injected intraperitoneally on the day of isolation into the experimental treatment group indicated by “PBMC”. The treatment group indicated by "PBS" received 300 μl of unsupplemented DPBS in the abdominal cavity instead, serving as a control without human effector cells. By the "PBS" control group, the potential effect of 1BiMAB itself on tumor growth, or any potential side effects caused by 1BiMAB or vehicle rather than by human effector cells on mouse tissue (ie, by human effector cells on mouse tissue). It was possible to investigate the investigation of the graft-versus-host reaction). The group "PBS / vehicle" contained 4 mice (n = 4), the group "PBS / 1BiMAB" contained 5 mice (n = 5), and the group "PBMC / vehicle" contained 13 mice. Included (n = 13), group "PBMC / 1BiMAB" included 15 mice (n = 15). Treatment was initiated 1 day after application of DPBS or PBMC: group "PBS / 1BiMAB" and group "PBMC / 1BiMAB" received 5 μg of purified bi-scFv protein 1BiMAB diluted with 200 μl DPBS per animal. Received intraperitoneally. Group "PBS / vehicle" and group "PBMC / vehicle" received 200 μl of vehicle buffer (200 mM L-arginine monohydrochloride dissolved in H2O, aseptically filtered) diluted with DPBS intraperitoneally. I received it. The treatment groups are summarized in Table 3. Treatment was given daily for 22 days. Tumor size was measured twice a week with a calibrated digital caliper and tumor volume was calculated according to the formula below: mm ³ = length x width x (width / 2). 10A and 10B illustrate inhibition of tumor growth and removal of tumor load in half of the mice in the "PBMC / 1BiMAB" group by antibody alone in the presence of human effector cells. Mice were sacrificed by cervical dislocation when the tumor volume ^{exceeded 500 mm 3} or in severe morbidity (graft-versus-host symptoms were noted in some mice).

b. Determining the therapeutic effect on body weight Each mouse was weighed twice a week using a laboratory scale. None of the groups of mice showed weight loss over the treatment period (data not shown). Some mice in both "PBMC" groups showed symptoms of graft-versus-host reaction 4 weeks after PBMC injection and days after treatment termination. No effect of 1BiMAB itself on body weight or any other side effects on mouse health was observed.

c. Tissue preservation and isolation of splenocytes After killing the mice, the tumor was dissected and the tissues were immediately fixed in 10 ml Roti-Histofix 4% (Carl Roth, Karlsruhe, Germany) for immunohistochemical analysis. .. Moreover, the spleen was dissected to detect human cell engraftment by flow cytometric analysis. Isolation of spleen cells is performed by grinding the spleen with a sterile plunger of a 3 ml-5 ml syringe and passing it through a 70 μm cell filter placed in a 50 ml reaction tube for repeated flushing of the cell filter with warm DPBS. By doing so immediately after spleen dissection. The isolated splenocytes were centrifuged, DPBS was removed by decantation, and pellets of splenocytes were resuspended in 1 ml of heat-inactivated fetal bovine serum supplemented with 10% DMSO. Samples were immediately frozen and stored at −80 ° C. until splenocyte samples from all mice were completed.

d. Analysis of engraftment of human T lymphocytes in mouse spleen Example 8. Spleen cells from all mice. Collected and frozen as described in c. The completed collection of splenocyte samples was thawed at once, all cells were washed twice with warm DPBS, and 1 × 10 ⁶ splenocytes per sample were fluorinated with fluorescent conjugated antibodies at 4 ° C. in the dark at 20 ° C. After a minute incubation, human cell engraftment was detected by anti-CD45 staining and the proportion of human T cells was detected by anti-CD3, anti-CD4 and anti-CD8 staining. Flow cytometric analysis was performed using FACSCalibur (BD Biosciences, Heidelberg, Germany). Engraftment of human T cells in both "PBMC" groups could be confirmed by a large proportion of double positive splenocytes of CD45-CD3, as shown in FIG. 10D.

Example 9: Preparation and Testing of Bispecific Binders Targeting CLDN6 and CD3 a. Sequence origin, design and expression vector cloning of bi-scFv constructs Bispecific tandem single chain antibody constructs (bi-scFv) are used against human T cell receptor component CD3 and human tumor-related antigens (TAA). Contains a binding domain that is specific. The corresponding variable heavy chain region (VH) and the corresponding variable light chain region (VL) are arranged specifically for each construct from the N-terminus to the C-terminus in the following contiguous order:

Table 4 summarizes all bi-scFv constructs made in the process of the present invention that are specific for TAA CLDN6. The CLDN18.2-specific bi-scFv construct 1BiMAB was used as a control antibody. These bi-scFv constructs were made by gene synthesis with GeneArt AG (GeneArt / Life Technologies GmbH, Regensburg, Germany) using the VH and VL sequences of the corresponding antibodies. Codon optimizations, such as human (Homo sapiens) (HS) or mouse (Mus musculus) (MM), were performed by GeneArt's GeneOptimizer® software. These are shown in Table 5. Information on specificity, sequence origin from monoclonal antibodies (mABs), codon frequency, additional sequence features, and references for all applied domains is summarized in Table 5. The variable domain sequence origin of each CD3 antibody is shown in Table 5. Due to the large homology of human TAA and mouse TAA, the same anti-TAA VH and VL sequences are combined with the VH and VL sequences of mouse-specific anti-CD3 antibody clone 145-2C11, except in combination. It could be used for the production of bi-scFv constructs for mouse assays.
DNA cloning and expression vector construction were performed according to standard procedures well known to those of skill in the art (Sambrook, 1989). Briefly, the bi-scFv DNA sequence was given a HindIII restriction on the 5'side and a BamHI restriction on the 3'side for cloning into an expression plasmid. A secretory signal sequence was introduced upstream of the bi-scFv sequence at the 5'end for protein secretion from the cytoplasm to the culture medium. A VH domain for assembling a sequence encoding a flexible glycine-serine peptide linker of 15 to 18 amino acids, a single chain variable antibody fragment (scFv) in which one binds to CD3 and the other binds to TAA. And inserted to stitch the VL domains together. To form a bispecific single chain antibody, these two scFv domain sequences were linked by a sequence encoding a short peptide linker (GGGGS). Along with this linker sequence, a BamHI restriction site was introduced for the scFv domain exchange for upcoming cloning of the bi-scFV construct. Specifically, the 5'side scFv domain could be exchanged by HindIII and BamHI restrictions, and the 3'side scFv domain could be exchanged by BamHI and XhoI restrictions.
All used bi-scFv antibody constructs were cloned into the standard mammalian expression vector pcDNA ™ 3.1 / myc-His (+) (Invitrogen / Life Technologies GmbH, Darmstadt, Germany). The C-terminal 6xHis tag served for metal affinity purification of the protein and for detection and analysis. All constructs were confirmed by sequencing by MWG's single-read sequence service (Eurofins MWG Operon, Ebersberg, Germany). See also Figure 11 for an overview of the structure.

b. Preparation of Stable Producing Cell Line The human embryonic kidney cell line HEK293 (ATCC CRL-1573) was used to prepare a stable producing cell clone of the CLDN6-specific bi-scFv protein.
Two days prior to transfection of 1 × 10 ⁷ HEK293 cells, a 14.5 cm tissue culture dish was supplemented with 20 ml of complete DMEM medium (10% heat-inactivated FBS and 0.5% penicillin-streptomycin). DMEM / F-12 GlutaMax; all reagents were placed in Gibco / Life Technologies GmbH (obtained from Darmstadt, Germany). Prior to transfection, cells were washed with DPBS supplemented with 2 mM EDTA, followed by the addition of 20 ml non-supplemented DMEM containing neither FBS nor antibiotics. 20 μg of linearized DNA of the constructs of pcDNA3.1 / 6PHU5 and pcDNA3.1 / 6PHU3 (these are described in Example 9.a) were diluted with 0.5 ml of unsupplemented DMEM / F-12 medium. 75 μl of 1 mg / ml linear PEI solution (polyethylenimine; Polysciences Europe GmbH, Eppelheim, Germany) was added to the diluted DNA and vortexed vigorously. After a 15 minute incubation at RT (room temperature), the DNA / PEI complex was added dropwise to the cells and the cell culture dish was gently spun and then incubated at _{37 ° C. and 5% CO 2.} The medium was changed 24 hours after transfection. Selection of transfected cells was initiated 48 hours post-transfection using G418 sulfate (Gibco / Life Technologies GmbH GmbH, Darmstadt, Germany) at a final concentration of 0.8 mg / ml. G418 was constantly added to the culture medium for cell culture.

c. Small-scale production of bi-scFv proteins 6PHU5 and 6PHU3 by polyclonal HEK293 cells Small-scale production of bi-scFv proteins 6PHU5 and 6PHU3 was performed for in vitro comparison and purified from the supernatant of polyclonal HEK293 cells.
Briefly, in a confluent state, an FBS-free supernatant was used in Example 9. Collected from the polyclonal cell line described in b and filtered through a 0.2 μm Ministal syringe filter (Sigma-Aldrich, Germany). Subsequently, the bi-scFv protein was purified from the cell culture supernatant on a small scale by a Ni-NTA spin column according to the manufacturer's protocol (Qiagen, Hilden, Germany). The concentration of the bi-scFv protein is determined by taking into account the extinction coefficients and molecular weights of 6PHU5 and 6PHU3 of the bi-scFv protein (these are determined by the ProtParam tool (http://web.expasy.org/protparam/)). It was determined by measurement at 280 nm using NanoDrop 2000c. The purified protein was stored at 4 ° C. for immediate use.
The bi-scFv protein was tested by polyacrylamide gel electrophoresis performed by standard procedures (Curent Protocols in Protein Science, 2012), followed by Coomassie staining and Western blot analysis. Small-scale purified proteins were separated on NuPAGE Novex 4-12% Bis-Tris gels (Invitrogen / Life Technologies GmbH, Darmstadt, Germany). The gel is then subjected to Coomassie Brilliant Blue solution according to standard procedures (Curent Protocols in Protein Science, 2012) to detect the bi-scFv proteins 6PHU5 and 6PHU3 and other proteins contained in the cell culture supernatant. Stained with. Western blot analysis was performed to specifically detect the bi-scFv proteins 6PHU5 and 6PHU3 by their 6xHis tags. Briefly, the protein is blotted onto PVDF membrane, the blocking treatment is performed with PBST / 3% milk powder, and then the membrane is diluted 1: 500 in blocking buffer with the primary antibody Anti-HIS Epitope-Tag (Dianova). Incubated with GmbH, Hamburg, Germany) at 4 ° C. for 1 hour. After washing with blocking buffer, membranes are mixed with Fc-specific secondary peroxidase-conjugated goat anti-mouse IgG antibody (Sigma Aldrich, Germany) diluted 1: 10000 in blocking buffer for 1 hour at 4 ° C. Incubated. After re-washing with blocking buffer, the signal was visualized by the SuperSignal West Femto Chemiluminescent Substrate (Pierce / Thermo Fisher Scientific, Rockford, IL, USA) and the ImageQuen Recorded by. Signals for the bi-scFv protein were detected between 50 kD and 60 kD when compared to internal molecular weight standards.

d. Large-scale production of bi-scFv protein 6PHU3 by polyclonal HEK293 cells A polyclonal production cell line was prepared in 10 layers of Cell Factory (Nunc, Roskilde, Denmark) with 10% FBS, 5.0% penicillin-streptomycin and 0. Cultured in DMEM / F-12 GlutaMax (all reagents obtained from Gibco / Life Technologies GmbH (Darmstadt, Denmark)) supplemented with .8 mg / ml G418 according to the manufacturer's guidelines. At the confluent stage, cells were washed with DPBS and the medium changed to DMEM / F-12 medium containing antibiotics but not FBS. Cell supernatants containing the bi-scFv protein 6PHU3 were collected every 3-5 days for up to 3 weeks. The supernatant was filtered through 500 ml of Steritop Filter Unit (Merck Millipore, Billerica, MA, USA) and stored at 4 ° C. until FPLC purification.
Prior to FPLC purification, the presence of bi-scFv in the cell culture supernatant was determined in Example 9. It was examined by polyacrylamide gel electrophoresis performed by standard procedures as briefly described in c, followed by Coomassie staining and Western blot analysis.

e. Purification and Quantification of bi-scFv Protein 6PHU3 Cell culture supernatants of polyclonal HEK293 cells containing bi-scFv protein 6PHU3 (described in Example 9.b) are subjected to standard procedures (Curent Protocols in Protein Science). , 2012) for immobilized metal affinity chromatography (IMAC). Briefly, cell culture supernatants were loaded onto a His Trap FF (5 ml) column coupled to an AKTA Purifier 10 FPLC system (both GE Healthcare Life Sciences, Munich, Germany). The PBS wash buffer contained 10 mM imidazole, the PBS elution buffer contained 500 mM NaCl, 50 mM NaH2PO4 and 250 mM imidazole, and the pH of both buffers was adjusted to 7.4. Elution was performed with a gradual gradient. The eluted bi-scFv protein 6PHU3 was immediately dialyzed against 1x PBS using Slide-A-Lyzer G2 Dialysis Cassette (10K MWCO) (Pierce / Thermo Fisher Scientific, Rockford, IL, USA). After PBS dialysis, bi-scFv was dialyzed against H2O-based 200 mM arginine buffer (L-arginine monohydrochloride; Roth, Karlsruhe, Germany).
The concentration of bi-scFv was determined by measurement at 280 nm using NanoDrop 2000c, taking into account the extinction coefficient and molecular weight of the bi-scFv protein 6PHU3. The purified protein was subdivided and stored at −80 ° C. for long-term storage and at 4 ° C. for immediate use.
The quality and purity of the bi-scFv protein 6PHU3 was determined in Example 9. Examined by Coomassie staining and Western blot analysis as described in c. BSA standard dilutions were included in the Coomassie procedure to roughly confirm the concentrations measured by NanoDrop (data not shown).

Example 10: Efficiency of 6PHU5 and 6PHU3 of bi-scFv Candidates Targeting CLDN6 a. Microscopic analysis of T cells targeted to target cells by 6PHU5 and 6PHU3 of bi-scFv protein To visualize by microscopic analysis that effector cells are targeted to CLDN6-expressing target cells by bi-scFv protein. An in vitro cytotoxicity assay was performed. Using 6PHU3 and 6PHU5 of bi-scFv proteins purified on a NiNTA column (see Example 9.c), these two variants were compared according to their efficiency. As the target cell line, the ovarian malformation cancer cell line PA-1, which endogenously expresses high levels of human CLDN6, was used.
Human effector cells were freshly isolated from human blood from healthy donors according to standard procedures (Curent Protocols in Protein Science, 2012): Briefly, blood was diluted with DPBS and Ficoll-Paque Plus (GE). It was layered on Healthcare Life Sciences (Munich, Germany) and centrifuged. Peripheral blood mononuclear cells (PBMCs) were harvested from the interphase, washed with cold DPBS supplemented with 2 mM EDTA, and counted. Human T cells were subsequently isolated from PBMCs by Pan T Cell Isolation Kit II (Miltenyi Biotec, Teterow, Germany) by magnetically activated cell isolation (MACS) according to the manufacturer's guidelines.
1 × 10 ⁵ PA-1 cells per well were seeded on a 6-well plate for tissue culture. Human cells were prepared as described above and added in an effector to target (E: T) ratio of 5: 1. MEM medium supplemented with 10% heat-inactivated human FBS, 0.5% penicillin-streptomycin, 1 × NEAA, 1 mM sodium bicarbonate and 1 mM sodium pyruvate (Gibco / Life Technologies GmbH, Darmstadt, Germany) Was used for all cells and the final volume per well was adjusted to 2 ml / well. The bi-scFv protein concentration used was 50 ng / ml in this assay. Control samples contained single target cells or T cells without the bi-scFv protein. Tissue culture plates were subsequently incubated at 37 ° C. and 5% CO _2. Assays were continuously observed using a Wilover S inverted microscope (Hund, Wetzlar, Germany) from 6 hours to 24 hours of co-incubation. Significant effects on T cell clustering, immunological synaptogenesis and killing of target cells on target cells in the presence of 6PHU5 and 6PHU3 of the bi-scFv protein were observed in 24 hours, and these effects were described by Nikon. Photographs were taken using an Immuno TS100 inverted microscope (Nikon, Japan). Both bi-scFv proteins cause strong T cell clustering and target cell killing as shown in FIG.

b. T cell activation mediated by 6PHU5 and 6PHU3 of the bi-scFv protein To detect T cell activation and to clarify the difference in efficiency between these two CLDN6-specific bi-scFv variants. A FACS-based T cell activation assay was used. Early activation marker CD69 and late activation marker CD25 were selected for staining with fluorescent conjugated antibodies. CD3 on T cells was stained for detection of human T cells in a mixture of target cells and T cells.
In general, the assay set from the above was selected (Example 10.a). Briefly, PA-1 target cells endogenously expressing CLDN6 were seeded with human T cells in a 2 ml complete medium at a 5: 1 E: T ratio to give the bi-scFv protein 6PHU5 or 6PHU3. Addition was made at concentrations in the range of 5 ng / ml to 200 ng / ml. Control samples included target cells or T cells alone, with or without the bi-scFv protein. After 24 and 48 hours, T cells were collected by flushing and transferred to 5 ml round bottom tubes (BD Falcon, Heidelberg, Germany). Cells were centrifuged and washed with DPBS. Mouse anti-human CD3-FITC, mouse anti-human CD69-APC and mouse anti-human CD25-PE (all antibodies were BD Biosciences, Heidelberg, Germany) were used for cell staining. Cell pellets were resuspended in 50 μl FACS buffer (DPBS supplemented with 5% FBS) containing fluorescent conjugated antibody and 2 μl 7-AAD (BD Biosciences, Heidelberg, Germany). After incubation in the dark at 4 ° C. for 20 minutes, the samples were washed with 4 ml DPBS and the cell pellet was resuspended in 200 μl FACS buffer. Samples were kept on ice and in the dark throughout the period of measurement using a FACSCanto II flow cytometer (both BD Biosciences, Heidelberg, Germany). The analysis was evaluated by FlowJo software (Tree Star, San Carlos, CA, USA).
Both CDLN6-specific bi-scFv variants resulted in efficient T cell activation of up to 60%. Variant 6PHU3 (bi-scFv CD3 × CLDN6) was more potent in the low concentration range of 5 ng / ml-10 ng / ml (see also Figure 13) and was therefore selected for further study.

Example 11: Binding ability of bi-scFv 6PHU3 FACS binding assay A flow cytometry assay was used to evaluate the binding ability of the CLDN6 targeting component and the CD3 targeting component of the bi-scFv protein 6PHU3. PA-1 cells and OV-90 cells that endogenously express CLDN6 were used to investigate the anti-CLDN6 site, and human T cells were used to investigate the anti-CD3 site. CLDN6-negative NugC4 cells were used as control cells.
To investigate anti-CLDN6 binding capacity in detail, CLDN6-positive cells (PA-1, OV-90) and CLDN6-negative cells (NugC4) were trypsinized, washed with complete medium, followed by DPBS. All washing steps were performed by centrifugation at 1200 rpm for 6 minutes at 4 ° C. Transfer 1 × 10 ⁵ cells to a 5 ml round bottom tube and incubate with 0.01 μg / ml-10 μg / ml FPLC-purified 6PHU3 protein or control bi-scFv protein 1BiMAB in FACS buffer for 30 minutes at 4 ° C. did. Cells were washed with 2 ml FACS buffer and subsequently incubated with 3.3 μg / ml monoclonal antibody Anti-HIS Epitope-Tag (Dianova GmbH, Hamburg, Germany) at 4 ° C. for 30 minutes. After washing with 2 ml of FACS buffer, the cell pellet was subjected to APC-conjugated goat anti-mouse secondary antibody (Jackson ImmunoResearch Europe, Suffolk, UK) at a dilution of 1: 200 in FACS buffer and 4 in the dark. Incubated at ° C for 20 minutes. Cells were washed twice with 2 ml FACS buffer and finally resuspended in 150 μl FACS buffer supplemented with 1 μg / ml PI (Sigma Aldrich, Germany) to counterstain dead cells. Negative control samples contained a single secondary goat anti-mouse APC antibody. As positive controls, control of only the 10 μg / ml monoclonal CLDN6-specific antibody mCLDN6ab stained with a secondary goat anti-human APC antibody (Jackson ImmunoResearch Europe, Suffolk, UK) and its appropriate secondary antibody was performed. did.
Samples were measured using a FACSCalibur flow cytometer (BD Biosciences, Heidelberg, Germany) and analyzed by FlowJo software (Tree Star, San Carlos, CA, USA). The signal intensity of 6PHU3 at 10 μg / ml was 1/4 to 1/9 of the positive control mCLDN6ab (see FIG. 15A). No non-specific binding of 6PHU3 to the CLDN6-negative cell line NugC4 was detected (Fig. 15C).

Human T cells were used to investigate the binding capacity of the anti-CD3 arm of the bi-scFv protein 6PHU3. 5 × 10 ⁵ T cells were transferred to a 5 ml round bottom tube and incubated with FPLC-purified 6PHU3 protein in FACS buffer in the range of 100 ng / ml to 10 μg / ml for 30 minutes at 4 ° C. Further staining procedures were as described above. Control samples included a single secondary goat anti-mouse APC antibody and a monoclonal antibody Anti-HIS Epitope-Tag + secondary goat anti-mouse PE antibody. Measurements and analysis were performed as described above. A significant signal was obtained with 100 ng / ml 6PHU3 (see also Figure 15B).

Example 12: Investigation of target-dependent T cell activation by 6PHU3 of bi-scFv Example 10. a and Example 10. A cytotoxicity assay as described in b was performed. Briefly, PA-1 target cells endogenously expressing CLDN6 were seeded with human T cells in a 2 ml complete medium at a 5: 1 E: T ratio and 0.001 ng of bi-scFv protein 6PHU3. It was added at a concentration in the range of / ml to 1000 ng / ml. To analyze the target dependence on bi-scFv-mediated T cell activation, T cells were seeded without the target cells, but with the same concentration of bi-scFv 6PHU3 as the target cell + T cell sample. Incubated. After 24 and 48 hours, T cells were collected by flushing and transferred to 5 ml round bottom tubes (BD Falcon, Heidelberg, Germany). Cell staining and analysis Example 10. It was done as described in b.
As shown in FIGS. 16A and 16B, 6PHU3-mediated T cell activation was completely undetectable in the absence of target cells, highlighting the strict target dependence of bi-scFv functionality. There is. Significant T cell activation occurred after 48 hours with only 0.1 ng / ml 6PHU3.

_{Example 13: Determination of EC 50} of bi-scFv 6PHU3 in in vitro cytotoxicity assay Luciferase cytotoxicity assay To determine the 50% maximum effective dose of bi-scFv protein 6PHU3, a titration sequence of 6PHU3 was performed on in vitro luciferase cells. Tested in a damaging assay.
PA-1 cells and human T cells that stably express luciferase have a bi-scFv protein 6PHU3 concentration in the range of 1 pg / ml to 1 μg / ml (in 10-fold increments) at an E: T ratio of 5: 1. Incubated with or without 6PHU3 to determine the L _{min value.}
Cell culture microplates were incubated at 37 ° C. and 5% CO ₂ for 24 and 48 hours. For analysis, 50 μl of an aqueous solution containing 1 mg / ml luciferin (BD Monolite, BD Biosciences, Heidelberg, Germany) and 50 mM HEPES was added per well, followed by incubation of the plate at 37 ° C. for 30 minutes in the dark. did. Luminescence resulting from the oxidation of luciferin by live cells expressing luciferase was measured using an Infinite M200 Tecan microplate reader (Tecan, Männedorf, Switzerland). The percentage of specific target cell lysis was calculated by the following formula:% specific lysis = [1- (luminescence test sample-L _max ) / (L _min- L _max )] x 100, where "L" is Shows dissolution. L _min indicates the minimum lysis in the absence of bi-scFv and L _max is the maximum lysis (spontaneous luminescence) achieved by the addition of Triton X-100 (final concentration of 2%) in the absence of bi-scFv. Equal to the count number).
The maximum lysis by 6PHU3 of 1ng / ml~10ng / ml reached after 48 hours, the _{EC 50 s} are determined after 48 hours is about 10 pg / ml (Fig. 17 see also). The results of this assay will also be reported by others (eg, Luterbuese, R et al., 2010, Proc. Natl. Acad. Sci. USA, 2010 (Jul 13), 107 (28): 12605-10. It strongly depends on the potency of human T cells, which changes according to the immune status of the donor. Accordingly, variation of _{The EC 50} values of the bi-scFv protein 6PHU3 of the difference of 3 fold is observed during the course of the present invention.

Example 14: Efficacy in a mouse xenograft model To investigate the therapeutic potential of the bi-scFv protein 6PHU3 in vivo, NOD. Mouse strains of Cg-Prkd ^scid IL2rg ^tm1Wjl / SzJ or short NSG (Jackson laboratory, Bar Harbor, ME, USA) were selected. For the studies described, engraftment of human effector cells and human T lymphocytes in mice is essential for studying the effects of bi-scFv associated with T cells in vivo. The complete lack of B cells, T cells and NK cells makes mouse strain NSG suitable for this type of xenograft study. A mouse model mainly containing engrafted human T cells after PBMC injection was established as part of the invention.

a. Late initiation treatment of advanced CLDN6 high-expressing tumors in mice with bi-scFv protein 6PHU3 High levels in 25 female NSG mice and 25 male NSG mice aged 8 to 11 weeks in an illustrated study. ^{1 × 10 7} PA-1 cells endogenously expressing human CLDN6 were subcutaneously inoculated. Fifteen days after tumor cell inoculation, mice were stratified into treatment groups according to their tumor volume and mice without tumor growth were excluded. On the same day, peripheral blood mononuclear cells (PBMCs) were isolated from healthy donor human blood by Ficoll density gradient technique and used as effector cells in vivo. ^{2 × 10 7} PBMCs diluted with 200 μl DPBS were injected intraperitoneally on the day of isolation into the experimental treatment group indicated by “PBMC”. The treatment group indicated by "PBS" received 200 μl of unsupplemented DPBS in the abdominal cavity instead, serving as a control without human effector cells. By the "PBS" control group, the potential effect of 6PHU3 itself on tumor growth, or any potential side effects caused by 6PHU3 or vehicle rather than by human effector cells on mouse tissue (ie, by human effector cells on mouse tissue). It was possible to investigate the investigation of the graft-versus-host reaction). The group "PBS / vehicle" contained 8 mice (n = 8), the group "PBS / 6PHU3" contained 8 mice (n = 8), and the group "PBMC / vehicle" contained 7 mice. Included (n = 7), group "PBMC / 6PHU3" contained 7 mice (n = 7) and group "PBMC / 1BiMAB" contained 8 mice (n = 8). Treatment was started 7 days after applying DPBS or PBMC: group "PBS / 6PHU3", group "PBMC / 6PHU3" and group "PBMC / 1BiMAB" were purified in 5 μg diluted with 200 μl DPBS per animal. Bi-scFv protein 6PHU3 or bi-scFv protein 1BiMAB was intraperitoneally received. Group "PBS / vehicle" and group "PBMC / vehicle" received 200 μl of vehicle buffer (200 mM L-arginine monohydrochloride dissolved in H2O, aseptically filtered) diluted with DPBS intraperitoneally. I received it. The treatment groups are summarized in Table 6. Treatment was given daily for 26 days. Tumor size was measured twice a week with a calibrated digital caliper and tumor volume was calculated according to the formula below: mm ³ = length x width x width / 2. 18A and 18B illustrate the inhibition of tumor growth by antibodies in the presence of human effector cells in all mice in the "PBMC / 6PHU3" group. Mice were sacrificed by cervical dislocation when the tumor volume ^{reached 1500 mm 3} or in severe morbidity (graft-versus-host symptoms were noted in some mice).

b. Determining the therapeutic effect on body weight Each mouse was weighed twice a week using a laboratory scale. None of the groups of mice showed weight loss over the treatment period (data not shown).

c. Tissue preservation and isolation of splenocytes After killing the mice, the tumor was dissected and the tissues were immediately fixed in 10 ml Roti-Histofix 4% (Carl Roth, Karlsruhe, Germany) for immunohistochemical analysis. .. Moreover, the spleen was dissected to detect human cell engraftment by flow cytometric analysis. Isolation of spleen cells is performed by grinding the spleen with a sterile plunger of a 3 ml-5 ml syringe and passing it through a 70 μm cell filter placed in a 50 ml reaction tube for repeated flushing of the cell filter with warm DPBS. By doing so immediately after spleen dissection. The isolated splenocytes were centrifuged, DPBS was removed by decantation, and pellets of splenocytes were resuspended in 1 ml of heat-inactivated fetal bovine serum supplemented with 10% DMSO. Samples were immediately frozen and stored at −80 ° C. until splenocyte samples from all mice were completed.

d. Analysis of engraftment of human T lymphocytes in mouse spleen Example 14. Spleen cells from all mice. Collected and frozen as described in c. The completed collection of splenocyte samples was thawed at once, all cells were washed twice with warm DPBS, and 1 × 10 ⁶ splenocytes per sample were fluorinated with fluorescent conjugated antibodies at 4 ° C. in the dark at 20 ° C. After a minute incubation, human cell engraftment was detected by anti-CD45 staining and the proportion of human T cells was detected by anti-CD3, anti-CD4 and anti-CD8 staining. Flow cytometric analysis was performed using FACSCalibur (BD Biosciences, Heidelberg, Germany). Engraftment of human T cells in both "PBMC" groups could be confirmed by a large proportion of double positive splenocytes of CD45-CD3, as shown in FIG. 18D.

e. Immunohistochemistry for Target Expression and T Cell Proliferation Tumors are fixed after dissection using 4% buffered formaldehyde solution (Roti-Histofix, Carl Roth, Karlsruhe, Germany) at 4 ° C. for 48 hours did. The fixed tumor was divided into two parts and transferred to an automated vacuum tissue treatment device ASP200 (Leica Microsystems GmbH, Wetzlar, Germany) for dehydration, followed by a paraffin dispenser station MPS / C (Slee Medical GmbH, Germany). It was embedded in paraffin (Paraplast, Carl Roth, Karlsruhe, Germany) with Mainz (Germany). For immunohistochemical staining, 3 μm thick sections of formalin-fixed paraffin-embedded tissue were made using a rotating microtome RM2255 (Leica Microsystems GmbH, Wetzlar, Germany). Deparaffinization and rehydration were performed in a parallel (bi-lineer) batch staining device, SteinMate Max (Thermo Fisher Scientific, Rockford, IL, USA), followed by heat-induced epitope recovery with 0.05% Tween 20. It was carried out at 120 ° C. for 10 minutes in the accompanying 10 mM citrate buffer (pH 6). Endogenous peroxidase is subsequently inactivated using a 0.3% H2O2 solution (Carl Roth) in PBS for 15 minutes, followed by 10% goat serum (PAA Laboratories GmbH / GE Healthcare, Pasching, Austria) in PBS. ) Was performed for 30 minutes to block non-specific antibody binding sites. TAA claudin 6 was detected by overnight incubation at 4 ° C. with polyclonal primary antibody anti-mouse claudin 6 (C) rabbits (IBL-America, Minneapolis, MN, USA); T cells. Polyclonal anti-CD3AB (Abcam, Cambridge, UK) was used overnight at 4 ° C. and then detected in serial sections by incubation with BrightVision polymer HRP conjugated anti-rabbit secondary antibody (ImmunoLogic, Duiven, USA). It was. The binding reaction was visualized using the Vector NovaRED kit (Vector Laboratories Ltd., Peterborough, UK) according to the manufacturer's instructions, followed by hematoxylin counterstain (Carl Roth), dehydration and fixation. Analysis and recording were performed using either the Axio Imager M2 or the Mirax scanner (both Carl Zeiss Microscopy GmbH, Göttingen, Germany).
As shown in FIG. 19, maximum T cell infiltration was detected in tumors of the "PBMC / 6PHU3" group by CD3 staining, especially in the border region of CLDN6 expression. The heterogeneous expression pattern of TAA CLDN6 in the control group (FIGS. 19A, 19B, 19C and 19D) changed to a more dense region of CLDN6 expression in tumors of the "PBMC / 6PHU3" group as a result of treatment (FIG. 19A, 19B, 19C and 19D) FIG. 19D).

Example 15: Preparation and Testing of Bispecific Binders Targeting CLDN 18.2 and CD3 a. Sequence Origin, Design and Template of bi-scFv Constructs Clone to Vector A bispecific tandem containing a binding domain that is specific for the human T cell receptor component CD3 epsilon and human tumor-related antigen (TAA). A type single chain antibody construct (bi-scFv) was prepared. The corresponding variable heavy chain region (VH) and the corresponding variable light chain region (VL) for each construct were specifically placed from the 5'end to the 3'end in the following contiguous order:

Table 7 summarizes all bi-scFv constructs made in the process of the present invention that are specific for TAA CLDN 18.2 and PLAC1. These bi-scFv constructs were made by gene synthesis with GeneArt AG (GeneArt / Life Technologies GmbH, Regensburg, Germany) using the VH and VL sequences of the corresponding antibodies. Codon optimizations, such as human (Homo sapiens) (HS), mouse (Mus musculus) (MM) or Chinese hamster ovary (CHO), were performed by GeneArt's GeneOptimizer® software. These are shown in Table 7. Information on specificity, monoclonal antibody (mAB) -derived sequence origin, codon frequency, additional sequence features, and references for all applied domains is summarized in Table 8. The variable domain sequence origin of each CD3 antibody is shown in Table 8. Due to the large homology of human TAA and mouse TAA, the same anti-TAA VH and VL sequences are combined with the VH and VL sequences of mouse-specific anti-CD3 antibody clone 145-2C11, except in combination. It could be used for the production of bi-scFv constructs for mouse assays.
DNA cloning and expression vector construction were performed according to standard procedures widely known by those skilled in the art (Green / Sambrook, Molecular Cloning, 2012). Briefly, the first bi-scFv DNA sequence was given a BsmBI restriction site on the 5'side and an XhoI restriction site on the 3'side for cloning into the pST1 plasmid. A secretory signal sequence was introduced upstream of the bi-scFv sequence at the 5'end for the secretion of bi-scFv. A VH domain for assembling a sequence encoding a flexible glycine-serine peptide linker of 15 to 18 amino acids, a single chain variable antibody fragment (scFv) in which one binds to CD3 and the other binds to TAA. And inserted to stitch the VL domains together. To form a bispecific single chain antibody, these two scFv domain sequences were linked by a sequence encoding a short peptide linker (GGGGS). Along with this linker sequence, a BamHI restriction site was introduced for the scFv domain exchange for upcoming cloning of the bi-scFv construct. Briefly, the 5'side scFv domain was exchanged by BsmBI and BamHI restrictions, and the 3'side scFv domain was exchanged by BamHI and XhoI restrictions. A C-terminal 6 × His tag was performed for detection and analysis of the translated protein. The untranslated region on the 5'side of human alpha globin and the untranslated region on the 3'side of human beta globin of the bi-scFv sequence were present in the pST1 vector (for details, see WO2007 / 036366A2; Waggoner, S. et al. (2003), Exp. Biol. Med. (Maywood), 228 (4), pp. 387-395).
For the preparation of the 1BiMAB replicon vector, a complete 1BiMAB sequence containing a secretory signal and a 6 × His tag was prepared from K. Subcloned to the 3'side of the subgenome promoter of the Semliki Forest Virus Replicon Vector (pSFV) assigned by Lundstrom (Lundstrom, K. et al. (2001), Histochem. Cell Biol., 115 (1), pp. 83- P. 91; Ehrengruber, MU et al. (1999), Proc. Natl. Acad. Sci. USA, 96 (12), pp. 7041-7046).
All constructs were confirmed by sequencing by MWG's single-read sequence service (Eurofins MWG Operon, Ebersberg, Germany) and only constructs with the correct sequence and more than 100 poly (A) tails of adenine were in vitro RNA transcription. Used for
See also Figure 20A for an overview of the structure.

b. IVT-RNA Synthesis To generate an IVT template for anti-CLDN18.2 specific bi-scFv, plasmids were linearized downstream of the poly (A) tail using class IIs endonucleases. The linearized template DNA was purified by phenol / chloroform extraction and sodium acetate precipitation as described elsewhere (Holtkamp, S. et al. (2006), Blood, 108 (13), pp. 4009- 4017).
The linearized DNA template was subjected to in vitro transcription using MEGAscript Kits (Ambion / Life Technologies, Darmstadt, Germany) according to the manufacturer's guidelines: the pST1 template was transcribed using the MEGAscript T7 Kit and the pSFV template. Was transcribed using MEGAscript SP6 Kit. Reduce GTP concentration to 1.5 mM for reaction with cap analoga, 6 mM RNA, beta-S-ARCA (D1) or beta-S-ARCA (D2) (these are described elsewhere. Synthesized to be; Kowalska, J. et al. (2008), RNA, 14 (6), pp. 1119 to 1131; Grudzien, E. et al. (2004), RNA, 10 (9), pp. 1479 to 1487. Page; Stepinski, J. et al. (2001), RNA, 7 (10), pp. 1486 to 1495) were added to the reaction solution. Purification of RNA-mRNA was performed according to the manual using MEGAclear Kit (Ambion / Life Technologies, Darmstadt, Germany). The concentration and quality of IVT-RNA were evaluated by spectrophotometry and analysis by 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA).

Example 16: T cell activation in response to bi-scFv secretion by target cells transfected with various CLDN18.2-specific bi-scFv RNA functionality of CLDN18.2-specific bi-scFv IVT-RNA To investigate, we targeted the gastric cancer cell line NugC4 (Sahin U. et al. (2008), Clin Cancer Res, 14 (23), pp. 7624-7634), which endogenously expresses relatively high levels of human CLDN18.2. Used as a cell line.
NugC4 target cells, which are routinely tested for TAA expression by FACS analysis prior to any assay, were washed twice with ice-cold X-Vivo15 medium (LONZA, Basel, Switzerland), 2 Resuspended to a density of x107 cells / ml. 250 μl of cell suspension was transferred to a pre-cooled 0.4 cm Gene Pulser / MicroPulser cuvette (Bio-Rad, Dreieich, Germany) and 20 μg / ml IVT-mRNA was added. The IVT-mRNA used was 1 BiMAB, no. 2, no. 3, no. 4, no. 5, no. 7, no. 8, no. 9 and no. It was 10. See Tables 7 and 8 for more information on the bi-scFv variants. After careful mixing, cells were transfected using a BTX ECM 830 electropolator (Harvard Apparatus, Holliston, MA, USA) using the following conditions: 250 V, 2 pulses, 12 ms pulse length. Now, the interval length of 400ms. Immediately after electroporation, the cuvette was placed on ice for a short period of time, after which the cell suspension was placed in warm assay medium for RT in a 15 ml tube (5% heat-inactivated human AB serum, 0.5% penicillin-streptomycin, Transferred to RPMI 1640 medium supplemented with 1 × NEAA and 1 mM sodium pyruvate (Gibco / Life Technologies GmbH, Darmstadt, Germany). Transfected target cells were counted ^{and adjusted to 1 × 10 5} cells / ml.
Human effector cells were freshly isolated from healthy donor human blood according to standard procedures (Curent Protocols in Munich, 2012): Briefly, blood was diluted with DPBS and Ficoll-Paque Plus (GE Healthcare Life). It was layered on Sciences, Munich, Germany) and centrifuged. Peripheral blood mononuclear cells (PBMCs) were harvested from the interphase, washed with cold DPBS supplemented with 2 mM EDTA, and counted. Human cytotoxic T cells ^{were isolated from PBMCs by CD8 +} T Cell Isolation Kit (Human) (Miltenyi Biotec, Teterow, Germany) by magnetically activated cell isolation (MACS) according to the manufacturer's guidelines. Effector cell isolates were routinely examined for successful T cell isolation by FACS analysis (CD4 staining, CD8 staining). T cells were ^{adjusted to 5 × 10 5} cells / ml in assay medium.
1 × 10 ⁵ target cells were seeded per well in a 6-well plate and human cytotoxic T cells were added to a 5: 1 E: T ratio. The final volume of the well was 2 ml. Control samples containing effector cells and target cells are available at no. It contained target cells secreting 25 (parental IgG mAB chCLDN 18.2ab) and also included 1 BiMAB protein as a positive control at a final concentration of 5 ng / ml. Controls included target cells after electroporation alone or T cells alone, with and without 1BiMAB protein. After 48 hours, T cells and target cells were collected, labeled and analyzed by flow cytometry. Briefly, all cells were collected by gently scraping with Cell Scrapers (Sarstedt AG & Co, Nurmbrecht, Germany) and transferred to a 5 ml round bottom tube (BD Falcon, Heidelberg, Germany). Cells were centrifuged and washed with DPBS. Mouse anti-human CD3-FITC, mouse anti-human CD69-APC and mouse anti-human CD25-PE (all antibodies were BD Biosciences, Heidelberg, Germany) were used for cell staining. The cell pellet was resuspended in 50 μl FACS buffer containing fluorescent conjugated antibody (DPBS supplemented with 5% FBS). After incubation in the dark at 4 ° C. for 20 minutes, the sample was washed with 4 ml of DPBS and cell pelleted with propidium iodide (PI) (Sigma Aldrich, Germany) 1: for detection of dead cells. It was resuspended in 200 μl FACS buffer containing at a final dilution of 1000. Samples were kept on ice and in the dark until measured. The assay was established using FACSCalibur (BD Biosciences, Heidelberg, Germany). The analysis was evaluated by FlowJo software (Tree Star, San Carlos, CA, USA).
As shown in FIG. 21A, each CLDN 18.2 specific IVT-mRNA resulted in the secretion of bi-scFv protein as seen in efficient T cell activation. Very strong variants with very slight differences in T cell activation, in descending order, no. 5> no. 8> no. 10> no. It was 3> 1 BiMAB. All of these variants cause more than 55% total T cell activation, whereas no. 2, no. 4, no. 7 and no. Variants of 9 caused 40% to 50% total T cell activation.
Specific target cell lysis was calculated by the following formula:% lysis = (% PI ⁺ target cell sample-% PI ⁺ target cell EP), where the "sample" is a co-incubated effector cell and target cell. And "EP reference" indicates the electroporated target cells of each individual IVT-mRNA electroporation only. As shown in FIG. 21B, in descending order of target cell lysis of more than 65%, variant 1 BiMAB> variant no. 5> Variant no. 8> Variant no. Achieved by 3. Other variants mediated 55% to 64% target cell lysis.
The most potent CLDN18.2-specific bi-scFv has the VH and VL domains of TR66 (1BiMAB, no.5, no.10) or the VH and VL domains of UCHT1 (no.3, no.8). Regarding domain orientation, in contrast to the protein bi-scFv variant, no significant difference was observed (see Example 3). Following protein studies, IVT-mRNA encoding 1 BiMAB was selected for further study.
Constructs of 18RHU5 and 18RHU3 (see Tables 7 and 8) were compared to 1 BiMAB at subsequent time points. The efficiency of 18RHU5 was comparable to 1BiMAB, and 18RHU3 was not very strong (data not shown).

Example 17: Microscopic analysis of T cells targeted to target cells that secrete 1 BiMAB of CLDN 18.2 specific bi-scFv The assay settings are essentially Example 2. It was as described in a.
Human cytotoxic T cells were isolated from freshly isolated PBMCs ^{by MACS according to the manufacturer's guidelines by CD8 +} T Cell Isolation Kit (Human) (Miltenyi Biotec, Teterow, Germany).
NugC4 target cells were prepared and 80 μg / ml 1BiMAB IVT-mRNA or 80 μg / ml no. Transfections were performed as described in Example 16 except that 25 CTRL IVT-mRNA was used. Transfected target cells were counted ^{and adjusted to 2 × 10 5} cells / ml. 1 × 10 ⁴ target cells were seeded per well in a 96-well plate and human cytotoxic T cells were added according to a 5: 1 E: T ratio. The final volume of the well was 100 μl. Control samples include target cells after transfection alone to demonstrate post-electroporation health and target cells transfected with control bi-scFv with effector cells. That's right. Tissue culture plates were subsequently incubated at 37 ° C. and 5% CO _2. Significant effects on T cell clustering, immunological synaptogenesis and killing of target cells on target cells in samples containing 1 BiMAB-transfected target cells were observed in 24 hours. Recording was performed using a Nikon Electropse TS100 inverted microscope (Nikon, Japan). T cell clustering or target cell lysis is no. Nothing was found in control samples with target cells transfected with 25, implying a strict dependence on TAA expression to induce T cell activation. See also FIG.

Example 18: Flow cytometric analysis of concentration-dependent T cell activation of CLDN18.2-specific bi-scFv by 1 BiMAB Details of bi-scFv concentration-dependent activation of T cells in the presence of TAA-expressing target cells To investigate, a 3-fold dilution series was applied to the transfection process.
NugC4 target cells were prepared and transfected as described in Example 16, but with a final IVT-mRNA concentration of 40 μg / ml. The concentration of IVT-mRNA in 1 BiMAB ranges from 0.4 μg / ml to 40 μg / ml, for the purpose of exposing all samples to the same stress level with respect to the amount of IVT-mRNA. I was satisfied.
1 × 10 ⁵ transfected target cells and human cytotoxic T cells (isolated as described in Example 16) were placed in a 6-well format in 2 ml assay medium with a ratio of 10: 1 E. : Seed at T ratio. Control samples contained target cells transfected with 40 μg / ml luciferase IVT-mRNA rather than with 1 BiMAB IVT-mRNA. After 24 and 48 hours of co-incubation of target and effector cells, cells were collected, stained and analyzed as described in Example 16.
Significant T cell activation was observed in samples containing target cells transfected with 4 μg / ml 1BiMAB IVT-mRNA, as shown in FIGS. 23A and 23B. Maximum T cell activation in this assay was reached with 40 μg / ml 1BiMAB IVT-mRNA. Expression of CD69 and CD25 changed with co-incubation time (FIGS. 23A-23B) and IVT-mRNA concentration. Larger amounts of 1 BiMAB IVT-mRNA (12 μg / ml and 40 μg / ml) are more pronounced in increased expression of CD25 compared to, for example, expression of CD69 in FIG. 23B, due to the mechanism of T cell activation. Caused a quick start. Total T cell activation did not exceed about 40%.

Example 19: Flow cytometric analysis of concentration-dependent T cell-mediated target cell lysis by 1 BiMAB of CLDN18.2 specific bi-scFv to investigate bi-scFv concentration-dependent T cell-mediated target cell lysis in detail. , The experimental settings described in Example 18 were used. In addition to co-incubation samples of effector cells and target cells (“samples”), individually electroporated target cells were also seeded alone. The latter served as a reference sample (see "EP") for drawing target cells that died by the electroporation process itself from target cells lysed by T cells.
Collection and staining were performed according to Example 18. Target cells were finally analyzed using FACSCalibur (BD Biosciences, Heidelberg, Germany) by their uptake of propidium iodide.
The rate of specific target cell lysis was determined by a two-step subtraction of dead cells in the background:
1. 1. % T cell-mediated lysis = (see% PI ⁺ target cell sample-% PI ⁺ target cell EP)
2. % Specific lysis = (% T cell-mediated lysis sample-% T cell-mediated lysis CTRL)
"% T cell-mediated lytic CTRL" is estimated from the difference in ^{PI +} target cells of the control sample (40 μg / ml luciferase IVT-mRNA only) with and without effector cells.
By this calculation, maximal specific lysis of 55.5% +/- 5.6% is reached with 12 μg / ml 1BiMAB IVT-mRNA in this experiment. The susceptibility of NugC4 target cells to electroporation stress, and in addition, the specific target cell lysis plotted for dead target cells in the inevitable background to be deducted, is in this experimental setting. , May be lower than the actual dissolution rate.

Example 20: 1 T cell proliferation in response to transfection of BiMAB with IVT-mRNA T cell proliferation is an indicator of T cell activation. A flow cytometry assay was used to show specific T cell proliferation in response to the bi-scFv code IVT-mRNA 1 BiMAB in the presence of CLDN 18.2 positive target cells. ^{Briefly, 1 × 10 7} human T cells isolated as described in Example 16 are lysed into 1 μM carboxyfluorescein diacetate succinimidyl ester (CellTrace CFSE, Invitrogen / It was stained with RT for 5 minutes in the dark with Life Technologies GmbH (Germany). Cells were washed twice with DPBS / 5% FCS and resuspended in assay medium at 2 x 106 cells / ml. As target cells, NugC4 cells into which human CLDN18.2 was transduced by lentivirus, and CLDN18.2-negative breast cancer cell line MDA-MB-231 were selected for specificity testing. 20 μg / ml IVT-mRNA 1 BiMAB or non-targeted control was used for electroporation. Electroporation of NugC4 was performed as described in Example 16. Electroporation of MDA-MB-231 was performed using the following conditions: 400 V, 3 ms pulse length, one pulse, 400 ms interval length, 0.4 cm Gene Pulser / MicroPulsar cuvette ( Bio-Rad, Dreieich, Germany). A cytotoxic assay as described in Example 16 was set up with transfected target cells and CFSE-labeled human T cells as effector cells. T cells alone and untransfected target cells or control-transfected target cells + T cells were used as negative controls. A single T cell stimulated by 5 μg / ml OKT3 (Bio X Cell, West Lebanon, NH, USA) and 2 μg / ml anti-CD28 (BioLegend, Fell, Germany) served as a positive control. 1 BiMAB protein at a concentration of 5 ng / ml was applied to untransfected target cells + T cells to confirm the validity of the assay. Samples combined with the non-targeted bi-scFv protein 6PHU3 were included as specificity controls. All samples were set in triplets with a total volume of 0.2 ml assay medium in 96 wells. After 72 hours of co-incubation, T cells are collected, harvested in 5 ml round bottom tubes, washed, with 2 μl anti-CD45-APC to distinguish human T cells from tumor cells, and in 200 μl DPBS. Dead cells were stained with 0.25 μl eFluor506 (BD Biosciences, Heidelberg, Germany) at 4 ° C. for 30 minutes for counterstaining. After washing with DPBS, cells were resuspended in FACS buffer and analyzed using FACSCanto II (BD Biosciences, Heidelberg, Germany).
T cell proliferation was detected by a reduced CFSE signal only in the presence of CLDN 18.2 positive target cells and bi-scFv 1 BiMAB (see also FIG. 25). In addition to positive controls, 42% -48% T cell proliferation could be observed in the presence of CDRN18.2 positive target cells in combination with the 1BiMAB protein. Target-positive cells transfected with 1 BiMAB IVT-mRNA yielded 22% +/- 3%. Proliferation in response to IVT-mRNA, which is lower than for proteins, is probably due to the low transfection efficiency achievable by NugC4 target cells. T cells incubated with CLDN18.2 negative target cells MDA-MB-231 show significant proliferation in T cells without target cells, as well as in any type, except for positive controls. Absent.

Example 21: Effector to Target Ratio Dose Setting to Determine Effective Ratio To determine a suitable E: T ratio in the context of an in vitro cytotoxicity assay based on FACS analysis, 0.3 in 3x increments. E: T ratios ranging from 1: 1 to 10: 1 were chosen.
NugC4 target cells were prepared and transfected with an IVT-mRNA concentration of 40 μg / ml as described in Example 16. One preparation of cells transfected with 1 BiMAB IVT-mRNA was used for all test samples. Transfection of 40 μg / ml luciferase IVT-mRNA was selected as the negative control.
Human cytotoxic T cells were isolated from freshly isolated PBMCs and treated as effector cells as described in Example 16. 1 × 10 ⁵ transfected target cells were co-incubated with cytotoxic T cells in double on 6-well plates at the following effector to target ratios: 0.3: 1-1: 1-3. 1 to 10: 1. In addition, human cytotoxic T cells were cultured in the absence of target cells to seek background T cell activation. Target cells transfected with control IVT-mRNA or 1BiMAB IVT-mRNA were also cultured in the absence of effector cells to identify dead cells in the background due to electroporation stress. Luciferase negative controls were only sown with a maximum E: T ratio of 10: 1. After 48 hours of co-incubation, cells were collected, labeled and analyzed as described in Example 16.
FIG. 26A shows the specific activation of cytotoxic T cells in response to 1BiMAB secretion by NugC4 target cells. Total activation of 50% to 60% was detected regardless of the number of T cells in the sample. Moreover, the distribution of CD25 and CD69 expression in the samples is very similar. This indicates that there is a certain percentage of T cells that can be activated in the cytotoxic T cell population.
In FIG. 26B, it becomes clear that efficient target cell lysis depends on the number of cytotoxic T cells. Even if the target cells are lysed with an E: T ratio of only 0.3: 1, strong lysis begins with a 3: 1 ratio.

Example 22: Analysis of T cell activation and target cell lysis in a FACS-type assay using effector cells transfected with 1 BiMAB IVT-mRNA The purpose of this experiment was to transfect human effector cells as well. After that, it was to test whether 1 BiMAB could be produced and secreted. The rationale behind this was the hypothetical patient situation in which the patient's own T cells could be transfected with bi-scFv and then re-transferred into the patient.
Human cytotoxic T cells (isolated as described in Example 16) were washed twice with X-Vivo15 medium (LONZA, Basel, Switzerland) and reconstituted to a density of 2 x 107 cells / ml. Suspended. 250 μl of cell suspension was transferred to a pre-cooled 0.4 cm Gene Pulser / MicroPulser cuvette (Bio-Rad, Dreieich, Germany) and 80 μg / ml or 240 μg / ml IVT-mRNA was added. The IVT-mRNA used was 1BiMAB and eGFP as a control. After careful mixing, cells were electroporated using a BTX ECM 830 (Harvard Apparatus, Holliston, MA, USA) electroporator using the following conditions: 500 V, 1 pulse, 3 ms pulse. Length, interval length of 400 ms. Immediately after electroporation, the cuvette was placed on ice for a short period of time, after which the cell suspension was placed in assay medium containing 10 U / ml IL-2 (5% heat-inactivated human AB serum, 0.5%). Transferred to RPMI 1640 medium supplemented with penicillin-streptomycin, 1 × NEAA and 1 mM sodium pyruvate) (Gibco / Life Technologies GmbH, Darmstadt, Germany). Transfected effector cells were cultured overnight at 37 ° C. and 5% CO _2. The next day, transfection efficiencies were analyzed by FACS, which revealed transfection efficiencies in excess of 70% for both concentrations of VT-mRNA in eGFP. Each effector cell sample was counted ^{and adjusted to 5 × 10 5} cells / ml. NugC4 target cells were collected by trypsin treatment, washed with assay medium, counted ^{and adjusted to 1 × 10 5} cells / ml. Effector cells and target cells were mixed and seeded in duplicate in 6 wells with a final E: T ratio of 5: 1 and a final volume of 2 ml. Untreated T cells were seeded without target cells for background activation signals. Assay analysis was performed as described in Example 16 after 48 hours of co-incubation at 37 ° C. and 5% CO _2.
Significant activation of cytotoxic T cells transfected with 1 BiMAB IVT-mRNA and co-incubated with target cells was achieved as shown in FIG. 27A. Target cell lysis by T cells transfected with 1 BiMAB IVT-mRNA was greater than 60% as plotted in FIG. 27B. The effect of 80 μg / ml 1BiMAB IVT-mRNA could not be increased by the larger amount of RNA.
In conclusion from this experiment, effector cells could theoretically be used as recipient cells to produce and secrete bi-scFv.

Example 23: Investigation of target specificity of 1BiMAB IVT-mRNA in a luciferase-type cytotoxicity assay using CLDN18.2 negative target cells Strict target specificity is important for avoiding unwanted adverse effects in patients It is a matter to be considered. In this preliminary study, the CLDN 18.2 negative cell line, the malformed cancer cell line PA-1 (ATCC CRL-1572), was selected to examine the non-specific cytolytic potential of 1BiMAB introduced as IVT-mRNA. It has been.
The PA-1 cell line used was stably transduced with a luciferase vector of lentivirus and could therefore be applied in a luciferase-based cytotoxicity assay. PA-1 / luc target cells were prepared for electroporation as described in Example 16. A total of 40 μg / ml IVT-mRNA was transfected per sample. The IVT-mRNA used is 1BiMAB, no. It was 25 and 6 RHU3. no. 25 targets the unexpressed TAA PLAC-1, and 6RHU3 targets the highly expressed target CLDN6 in PA-1 / luc cells. See Tables 7 and 8 for more information on the bi-scFv variants. no. Twenty-five was used as fill-up IVT-mRNA in electroporation samples with 4 μg / ml IVT-mRNA to ensure the same stress level caused by RNA transfection for all target cell samples. After careful mixing, cells were transfected with a BTX ECM 830 electropolator (Harvard Apparatus, Holliston, MA, USA) using the following conditions for a 0.4 cm cuvette: 200 V, 2 One pulse, 12 ms pulse length, 400 ms interval length. Immediately after electroporation, the cuvette was placed on ice for a short period of time, after which the cell suspension was placed in RT warm PA-1 assay medium in a 15 ml tube (10% heat-inactivated FCS, 0.5% penicillin-streptomycin). , 1 × NEAA, MEM medium supplemented with 1.5 g / l sodium bicarbonate and 1 mM sodium pyruvate) (Gibco / Life Technologies GmbH, Damstat, Germany). Transfected target cells were counted ^{and adjusted to 1 × 10 5} cells / ml.
Human effector cells were isolated as described in Example 16. Human cytotoxic T cells were isolated from PBMC by magnetically activated cell isolation (MACS) by Pan T Cell Isolation Kit II (human) (Miltenyi Biotec, Teterow, Germany) according to the manufacturer's guidelines. ^{T cells were adjusted to 5 × 10 5} cells / ml in PA-1 assay medium.
1 × 10 ⁴ target cells were seeded per well in a 96-well plate and human cytotoxic T cells were added to a 5: 1 E: T ratio. The final volume of the well was 100 μl. Control samples containing effector cells and target cells were used as negative controls, no. It contained 25 secreting target cells, 6RHU3 or 6PHU3 protein as a positive control, and 1BiMAB protein. The protein concentration was set to a final concentration of 100 ng / ml and no. Together with the target cells transfected with 25, the same conditions were guaranteed for the target cells used. The minimal lysis control (L _min ) contained each electorated target cell sample alone. The spontaneous lysis control (L _max ) is an untreated target cell and effector cell (L _max1 ) for subtraction from the L test sample, or a single untreated target cell for subtraction from _{L min. It consisted} of (L max2). Each sample was sown in triplets. Assay analysis was undertaken after 72 hours of incubation at 37 ° C. and 5% CO _2. Spontaneous dissolution controls (L _max ) were treated with Triton X-100 at a final concentration of 2%.
For analysis, 50 μl of an aqueous solution containing 1 mg / ml luciferin (BD Monolite, BD Biosciences, Heidelberg, Germany) and 50 mM HEPES was added per well, followed by incubation of the plate at 37 ° C. for 30 minutes in the dark. did. Luminescence resulting from the oxidation of luciferin by live cells expressing luciferase was measured with a microplate reader (Infinite M200, Tecan, Mannedorf, Switzerland). The percentage of specific target cell lysis was calculated by the following formula:% specific lysis = [1- (luminescence test sample-L _max1 ) / (L _min- L _max2 )] x 100.
FIG. 28 shows the rate of specific target cell lysis. Negative control no. CLDN18.2-negative PA-1 / luc cells transfected with 25 or 1 BiMAB show no significant lysis even after 72 hours of incubation. Similarly, 100 ng / ml 1BiMAB protein did not result in significant lysis, whereas lysis by bi-scFv secretion of 6RHU3 targeting TAA or lysis by 100 ng / ml 6PHU3 protein was 85. It was between% and 93%. The 24 hour and 48 hour time points were analyzed in the same manner. These time points show comparable results (data not shown).

Example 24: Qualitative Analysis of 1BiMAB Protein Production After IVT-RNA Transfection of Mammalian Cells To investigate RNA translation into proteins in detail in Mammalian cells, an expression system of cell line BHK21 (ATCC CRL-13001) was used. I chose as. 2 × 10 ⁷ cells / ml BHK21 cells were electroporated as described in Example 16 with the difference that all steps were performed at RT. 250 μl of cell suspension was transferred to a 0.4 cm Gene Pulser / MicroPulser cuvette (Bio-Rad, Dreieich, Germany) and 40 μg / ml of 1BiMAB IVT-mRNA or IVT-replicon RNA was added. The electroporation conditions were as follows: 300 V, 16 ms pulse length, one pulse, 400 ms interval length.
Electroporated cells were resuspended in culture medium at RT (RPMI 1640, 10% FCS) and transferred to a 15 cm culture dish. Five hours after sowing, the medium containing FCS was replaced with medium containing no FCS. In the case of Example 24a and Example 24b, cell culture supernatants and cells were collected separately 18 hours after electroporation. Cell pellets were lysed in 1 × LDS sample buffer (Cat. No. NP0008; Life technologies, Darmstadt, Germany) and heated at 72 ° C. for 15 minutes. Unconcentrated supernatants and approximately 50-fold concentrated supernatants were used for ELISA analysis. Concentration was performed using an Amicon Ultra-15 centrifugal filtration unit (Merck Millipore, Billerica, MA, USA) according to the manufacturer's protocol. In the case of Example 24c (IVT-mRNA only), the supernatant was collected 48 hours after transfection and subjected to 40-fold concentration as described above.

a. ELISA using supernatant
For ELISA analysis, a nickel-coated plate (Thermo Fisher Scientific, Bonn, Germany) was used to capture the analyte by its His tag. First, the plates were washed 3 times with 200 μl wash buffer per well (0.01% Tween-20 in 1 x PBS). As a standard, the purified 1BiMAB protein was diluted with 1.75% Na casein (= diluted solution) in 1 × PBS. The dilution series ranged from 2.34 ng / ml to 37.50 ng / ml in double increments. 100 μl per standard dilution was transferred to the wells in triplets of each concentration. Therefore, 100 μl of the sample was transferred in triplets. The plate was sealed with an adhesive film and incubated at 37 ° C. for 30 minutes. The plate was then washed 3 times with 200 μl wash buffer per well. For the detection of 1BiMAB, an anti-idiotype monoclonal IgG 8B1F3 that specifically binds to VH-VL of mCLDN18.2ab and therefore also specifically to 1BiMAB was used. 8B1F3 was mixed with the diluent to a final concentration of 1 μg / ml. 100 μl of anti-idiotype antibody solution was transferred to each well, followed by a 30 minute incubation time at 37 ° C. The plate was subsequently washed 3 times with 200 μl wash buffer per well and diluted 1: 500 with 100 μl AP-conjugated anti-mouse detection antibody (Jackson Immuno Research Laboratories, West Grove, PA, USA). Was added to each well, followed by a 30 minute incubation at 37 ° C. After the final wash step (200 μl wash buffer, 3 times), 1.5 mg in a suitable substrate buffer (1 M diethanolamine, 0.5 mM MgCl2, 0.01% Na azide, pH 9.8). / Ml substrate pNPP was added to each well, followed by incubation in the dark at RT for 30 minutes. 100 μl of 3M KOH was used for each well to stop the enzymatic reaction. Absorbance was measured using a microplate reader (Infinite M200, Tecan, Mannedorf, Switzerland). For dual wavelength analysis, 405 nm was set as the measurement wavelength and 492 nm was set as the reference wavelength. The absorbance value was calculated by subtracting the reference wavelength from the measurement wavelength.
In FIG. 29A, the average absorbance value at 405 nm including the standard deviation is plotted. Concentrated supernatants obtained from cells transfected with 1BiMAB IVT-mRNA and IVT-replicon evoked significant signals demonstrating translation of IVT-RNA encoding bi-scFv. The concentrated supernatant obtained from the mock-transfected cells produced no signal. The actual protein concentration cannot be proposed due to the different toxicity of the IVT-mRNA construct and the IVT-replicon construct and the slightly different x-fold concentrate. Approximate protein concentration estimates in the unconcentrated supernatant ranged from 1.5 ng / ml for IVT-replicon samples and 2.4 ng / ml for IVT-mRNA samples.

b. Western blot analysis of supernatants and cell lysates (IVT-mRNA samples and IVT-replicon samples) For analysis by Western blot, the concentrated supernatants and cell lysates were subjected to NuPAGE Novex 4-12% Bis-Tris gel (Invitrogen). / Life Technologies GmbH, Darmstadt, Germany). 1 BiMAB IVT-mRNA, supernatants and cell lysates of BHK21 or untreated cells transfected with IVT-replicon RNA, and positive controls (0.1 μg of purified 1 BiMAB protein) were loaded. Western blot analysis was performed by standard procedures (Curent Protocols in Protein Science, 2012). Briefly, the protein is blotted onto PVDF membrane, the blocking treatment is performed with PBST / 3% milk powder, and then the membrane is diluted 1: 500 in blocking buffer with the primary antibody Anti-HIS Epitope-Tag (Dianova). Incubated with GmbH, Hamburg, Germany) at 4 ° C. for 1 hour. After repeated washes with blocking buffer, membranes were mixed with Fc-specific secondary peroxidase-conjugated goat anti-mouse IgG antibody (Sigma Aldrich, Germany) diluted 1: 10000 in blocking buffer at 4 ° C. Incubated for 1 hour. After repeated washing with blocking buffer, the signal was visualized by the SuperSignal West Femto Chemiluminescent Substrate (Pierce / Thermo Fisher Scientific, Rockford, IL, USA) and the ImageQueiluminescence Recorded by. A signal of 1 BiMAB was detected between 50 kD and 60 kD when compared to the internal molecular weight standard.
As shown in FIG. 29B, weak signals were detected in cells transfected with IVT-mRNA (lane 2) and cells transfected with IVT-replicon RNA (lane 3). Lane 4, whose supernatant is derived from untreated cells, is not signaled. A strong signal could be generated by cell lysates of cells transfected with IVT-mRNA (lane 5) and cells transfected with IVT-replicon RNA (lane 6). Cell lysates from untreated cells (lane 7), again, did not provide any signal. All signals appeared as large as the purified 1BiMAB protein control (lane 8). The weak signal in the supernatant, along with weak 1BiMAB secretion, is probably due to the relatively short incubation time after transfection. Longer incubation times could not be investigated due to the toxic effects of Replicon RNA.
Both analyzes are qualitative and do not help determine protein concentration.

c. Western Blot Analysis of Supernatants (IVT-mRNA Samples) The supernatant collected 48 hours after transfection was separated by SDS-PAGE, after which Western blot analysis was performed as described in Example 24b. As shown in FIG. 29C, no. Translated from IVT-mRNA and secreted into the supernatant. Twenty-five and one BiMAB were detected by their His tags. In addition, the production and secretion of 1BiMAB, as well as no., Which is also used as a bi-scFv specificity control. The production and secretion of 25 could be demonstrated.

Example 25: Detection of Functional 1BiMAB Protein Translated In vivo After Intramuscular RNA Injection Female and male NSG mice at 8 to 16 weeks of age were selected and 4 groups of 5 mice. Divided into. 40 μl of RNA solution was injected per mouse and thigh muscle. A 40 μl RNA solution consisted of 1 × PBS, 5 μg of D2-capped 1BiMAB IVT-mRNA or IVT-replicon, 2 μg of D1-capped luciferase IVT-mRNA, and 0 μg or 15 μg of D1-capped EBK IVT-mRNA. .. EBK IVT-mRNA encoding vaccinia viral proteins (E3L, B18R and K3L) (EBK) was co-injected to inhibit the IFN response and counteract PKR activation for RNA translation enhancement (patent application PCT). / EP2012 / 04673). Luciferase signals were monitored 24 hours after injection with Xenogen IVIS 2000 and mice without the signal were removed from the sample population.
Blood was collected 2 days, 4 days and 7 days after injection. Serum was collected and subsequently frozen at -80 ° C. Mouse muscles with strong luminescent signals were dissected 4 days after RNA infusion, tissue fixed for IHC, or snap frozen for Western blot analysis.

Cytotoxicity Assay NSG mouse sera were analyzed by in vitro cytotoxicity assay. NugC4 target cells stably transduced with firefly luciferase and human CLDN 18.2 for better target expression into human T cells at a 30: 1 E: T ratio for maximal sensitivity (Example 16). Seen with (isolated as described in). The assay medium consisted of RPMI 1640 medium (Gibco / Life Technologies GmbH, Darmstadt, Germany) supplemented with 10% heat-inactivated FCS, 0.5% penicillin-streptomycin, 1 × NEAA and 1 mM sodium pyruvate. .. 20 μl of thawed test serum was added per test sample well. Standard 1 BiMAB protein control wells, L _min wells and L _max wells were completed with 20 μl serum from untreated NSG mice. The final volume of the well was 100 μl. L _min was sown in 2 stations, L _max was sown in 6 stations, and the test sample was sown in 3 stations. After 48 hours of incubation at 37 ° C. and 5% CO _{2 , L max} wells were mixed with 10 μl of 2% Triton X-100 solution and incubated for 10 minutes. 10 μl of assay medium was added to all other wells. 50 μl of luciferin solution (see Example 23) was added and the plates were measured on an Infinite M200 microplate reader (TECAN, Männedorf, Switzerland) after a 30 minute incubation step at 37 ° C. in the dark. Calculations of specific target cell lysis were performed as described in Example 23.
In FIG. 30, percent specific dissolutions are plotted. Significant cytotoxic effects were detected in each group. The effect of cell lysis was increased 1.7-fold in wells containing mouse serum collected 2 days after injection of EBK and 1BiMAB IVT-mRNA. Significantly lower effects were achieved with samples collected 4 or 7 days after injection. In the case of 1BiMAB replicon samples, sera collected at a later time also produced a strong cytolytic effect.
These data demonstrate in vivo translation of 1BiMAB from IVT-mRNA or IVT-replicon after intramuscular injection as well as secretion into the bloodstream.

Example 26: Preparation and Testing of Bispecific Binders Targeting CLDN6 and CD3 a. Sequence origin, design and template cloning of bi-scFv constructs Bispecific tandem form containing binding domains specific for human T cell receptor component CD3 and human tumor-related antigen (TAA) A single chain antibody construct (bi-scFv) was prepared. The corresponding variable heavy chain region (VH) and the corresponding variable light chain region (VL) for each construct were specifically placed from the 5'end to the 3'end in the following contiguous order:

Table 9 summarizes all bi-scFv constructs made in the process of the present invention that are specific for TAA CLDN6. The CLDN18.2-specific bi-scFv construct 1BiMAB was used as a control antibody. These bi-scFv constructs were made by gene synthesis with GeneArt AG (GeneArt / Life Technologies GmbH, Regensburg, Germany) using the VH and VL sequences of the corresponding antibodies. Codon optimizations, such as human (Homo sapiens) (HS) or mouse (Mus musculus) (MM), were performed by GeneArt's GeneOptimizer® software. These are shown in Table 9. Information on specificity, sequence origin from monoclonal antibodies (mABs), codon frequency, additional sequence features, and references for all applied domains is summarized in Table 10. The variable domain sequence origin of each CD3 antibody is shown in Table 10. Due to the large homology of human TAA and mouse TAA, the same anti-TAA VH and VL sequences are combined with the VH and VL sequences of mouse-specific anti-CD3 antibody clone 145-2C11, except in combination. It could be used for the production of bi-scFv constructs for mouse assays.
DNA cloning and expression vector construction were performed according to standard procedures widely known by those skilled in the art (Green / Sambrook, Molecular Cloning, 2012). Briefly, the first bi-scFv DNA sequence was given a BsmBI restriction site on the 5'side and an XhoI restriction site on the 3'side for cloning into the pST1 plasmid. A secretory signal sequence was introduced upstream of the bi-scFv sequence at the 5'end for the secretion of bi-scFv. A VH domain for assembling a sequence encoding a flexible glycine-serine peptide linker of 15 to 18 amino acids, a single chain variable antibody fragment (scFv) in which one binds to CD3 and the other binds to TAA. And inserted to stitch the VL domains together. To form a bispecific single chain antibody, these two scFv domain sequences were linked by a sequence encoding a short peptide linker (GGGGS). Along with this linker sequence, a BamHI restriction site was introduced for the scFv domain exchange for upcoming cloning of the bi-scFV construct. Briefly, the 5'side scFv domain could be exchanged by BsmBI and BamHI restrictions, and the 3'side scFv domain could be exchanged by BamHI and XhoI restrictions. The C-terminal 6xHis tag served for the detection and analysis of the translated protein. For the preparation of the 6RHU3 replicon vector, the complete 6RHU3 sequence containing the secretory signal and the 6 × His tag was prepared by K.K. Subcloned to the 3'side of the subgenome promoter of the Semliki Forest Virus Replicon Vector (pSFV) assigned by Lundstrom (Lundstrom, K. et al. (2001), Histochem. Cell Biol., 115 (1), pp. 83- P. 91; Ehrengruber, MU et al. (1999), Proc. Natl. Acad. Sci. USA, 96 (12), pp. 7041-7046).
All constructs were confirmed by sequencing by MWG's single-read sequence service (Eurofins MWG Operon, Ebersberg, Germany) and only constructs with the correct sequence and more than 100 poly (A) tails of adenine were in vitro RNA transcription. Used for
See also Figure 31A for an overview of the structure.

b. IVT-RNA Synthesis To generate an IVT template for anti-CLDN6-specific bi-scFv, plasmids were linearized downstream of the poly (A) tail using class IIs endonucleases. The linearized template DNA was purified by phenol / chloroform extraction and sodium acetate precipitation as described elsewhere (Holtkamp, S. et al. (2006), Blood, 108 (13), pp. 4009- 4017).
The linearized DNA template was subjected to in vitro transcription using MEGAscript Kits (Ambion / Life Technologies, Darmstadt, Germany) according to the manufacturer's guidelines: the pST1 template was transcribed using the MEGAscript T7 Kit and the pSFV template. Was transcribed using MEGAscript SP6 Kit. Reduce GTP concentration to 1.5 mM for reaction with cap analoga, 6 mM RNA, beta-S-ARCA (D1) or beta-S-ARCA (D2) (these are described elsewhere. (Synthesized to be) (Grudzien, E. et al. (2004), RNA, 10 (9), pp. 1479 to 1487; Kowalska, J. et al. Page 1131; Stepinski, J. et al. (2001), RNA, 7 (10), pp. 1486 to 1495) were added to the reaction solution. Purification of IVT-RNA was performed according to the manual using MEGAclear Kit (Ambion / Life Technologies, Darmstadt, Germany). The concentration and quality of IVT-RNA were evaluated by spectrophotometry and analysis by 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA).

Example 27: Microscopic analysis of T cells targeted to target cells that secrete 1 BiMAB of CLDN6-specific bi-scFv Assay settings are, in principle, Example 2. It went as described in a.
As the target cell line, a subclone of the ovarian malformation cancer cell line PA-1 (ATCC CRL-1572), which endogenously expresses high levels of human CLDN6, was used. Human cytotoxic T cells were isolated from freshly isolated PBMCs by MACS according to the manufacturer's guidelines by Pan T Cell Isolation Kit II (Human) (Miltenyi Biotec, Teterow, Germany).
PA-1 target cells, which are routinely tested for TAA expression by FACS analysis prior to any assay, were washed twice with ice-cold X-Vivo15 medium (LONZA, Basel, Switzerland). Resuspended to a density of 2, x 107 cells / ml. 250 μl of cell suspension was transferred to a pre-cooled 0.4 cm Gene Pulser / MicroPulser cuvette (Bio-Rad, Dreieich, Germany) and 20 μg / ml IVT-mRNA was added. The conditions for using the BTX ECM 830 Electropolator (Harvard Apparatus, Holliston, MA, USA) were 200 V, 12 ms pulse length, 2 pulses, 400 ms interval length. The IVT-mRNA used is 6RHU5, 6RHU3, no. It was 25 (see Tables 9 and 10 for details). Transfected target cells were counted ^{and adjusted to 1 × 10 5} cells / ml. 1 × 10 ⁵ target cells were seeded per well in a 6-well plate and human cytotoxic T cells were added according to a 5: 1 E: T ratio. The final volume of the well was 2 ml. Control samples include target cells after transfection alone to demonstrate post-electroporation health and target cells transfected with control bi-scFv with effector cells. That's right. As a positive control, the corresponding CLDN6-specific bi-scFv proteins 6PHU5 and 6PHU3 were run at a concentration of 50 μg / ml. Therefore, untreated PA-1 cells with human T cells were used. Tissue culture plates were subsequently incubated at 37 ° C. and 5% CO _2. Significant effects on T cell clustering, immunological synaptogenesis and killing of target cells were observed after 24 hours in samples containing target cells transfected with 6RHU5 or 6RHU3, these effects. Was recorded using a Nikon Electropse TS100 inverted microscope (Nikon, Japan). As shown in FIG. 32, T cell clustering or target cell lysis is no. Nothing was found in control samples with target cells transfected with 25, implying a strict dependence on TAA expression to induce T cell activation. Similarly, simulated controls without bi-scFv show no T cell clustering. Instead, protein control resulted in strong T cell clustering and target cell lysis.

Example 28: T cell activation induced by 6RHU5 and 6RHU3 of bi-scFv candidates targeting CLDN6 To detect T cell activation and of these two CLDN6-specific bi-scFv variants A FACS-based T cell activation assay was performed to clarify the difference in efficiency. Early activation marker CD69 and late activation marker CD25 were selected for staining with fluorescent conjugated antibodies. CD3 expressed by all T cells was stained for detection of human T cells in a mixture of target cells and T cells.
Target cells and effector cells were prepared as described above (Example 27). Briefly, PA-1 target cells that endogenously express CLDN6 were transfected by electroporation with 20 μg / ml of the following IVT-mRNA: 6RHU5, 6RHU3 and no. 25. no. Twenty-five (which targets unexpressed TAA) served as a specificity control, and untreated target cells served as a simulated control. As a positive control, 50 ng / ml 6PHU5 protein was used. In addition, T cells were seeded without target cells, with 6PHU5 protein, or as a reference for background activation, without 6PHU5 protein. Each sample was seeded in duplicate on a 6-well plate and incubated at _{37 ° C. and 5% CO 2.} After 24 and 48 hours, T cells were collected by scraping and transferred to 5 ml round bottom tubes (BD Falcon, Heidelberg, Germany). Cells were centrifuged and washed with DPBS. Mouse anti-human CD3-FITC, mouse anti-human CD69-APC and mouse anti-human CD25-PE (all antibodies were BD Biosciences, Heidelberg, Germany) were used for cell staining. Cell pellets were resuspended in 50 μl FACS buffer (DPBS supplemented with 5% FBS) containing fluorescent conjugated antibody and 2 μl 7-AAD (BD Biosciences, Heidelberg, Germany). After incubation in the dark at 4 ° C. for 20 minutes, the samples were washed with 4 ml DPBS and the cell pellet was resuspended in 200 μl FACS buffer. Samples were kept on ice and in the dark throughout the period of measurement using a FACSCanto II flow cytometer (both BD Biosciences, Heidelberg, Germany). The analysis was evaluated by FlowJo software (Tree Star, San Carlos, CA, USA).
As shown in FIGS. 33A and 33B, both variants result in T cell activation, whereas none of the negative controls show significant expression of the T cell activation marker CD69 or CD25. It was.
Total T cell activation in response to 6RHU3 was 1.53 times greater after 24 hours (A) and 1.35 times greater after 48 hours (B) than in response to 6RHU5. Based on these findings, all further studies were carried out using only variant 6RHU3.

Example 29: Concentration-dependent T-cell activation by co-incubation with target cells transfected with 6RHU3 Determine the minimum 6RHU3 IVT-mRNA concentration required to induce target-dependent T-cell activation. To this end, PA-1 target cells were transfected with a dilution range of IVT-mRNA from 0.2 μg / ml to 20 μg / ml. All samples were transfected with a total concentration of 20 μg / ml IVT-mRNA to expose them to the same stress levels from RNA electroporation. no. Twenty-five (which targets unexpressed TAA) was used as IVT-mRNA for fill-up. Therefore, 0 μg / ml 6RHU3 is 20 μg / ml no. Corresponds to 25. Electroporation was performed as described in Example 27. Human T cells were used as effector cells. Isolation from PBMCs was performed according to the manufacturer's manual (Pan T Cell Isolation Kit II, Miltenyi, Teterow, Germany). Effector cells and target cells were mixed in a 5: 1 ratio. Untreated target cells with T cells served as simulated controls. In addition, T cells were seeded without target cells, with 6PHU5 protein, or as a reference for background activation, without 6PHU5 protein. As a positive control, untreated target cells were mixed with T cells and 50 ng / ml 6PHU5 protein. All samples were prepared in duplicate on a 6-well plate.
Target cells and effector cells were co-incubated at 37 ° C. at 5% CO _{2 for 48 hours.} Samples were prepared for flow cytometric analysis as described in Example 28.
In FIG. 34, the percentage of CD3-positive T cells expressing the activation marker is plotted. No T cell activation was observed in the control. Detection of significant T cell activation began at a concentration of 6RHU3 IVT-mRNA at 0.7 μg / ml. The effect on the response to 2.0 μg / ml 6RHU3 IVT-mRNA was comparable to the effect mediated by the 50 ng / ml 6PHU5 protein control. Therefore, protein translation and secretion from transfected IVT-mRNA appears to be an efficient process.

Example 30: Determination of EC ₅₀ for 6RHU3 To determine the 50% maximum effective dose of IVT-mRNA 6RHU3 encoding bi-scFv, a titration sequence of 6RHU3 was tested in an in vitro luciferase cytotoxic assay. PA-1 cells stably expressing luciferase were transiently transfected by electroporation as described in Example 27. The 6RHU3 IVT-mRNA concentration used ranged from 0.004 μg / ml to 13.3 μg / ml in 6 dilution steps. The total IVT-mRNA concentration was always set to 13.3 μg / ml and no. Twenty-five was used as IVT-mRNA for fill-up. As a minimal lysis control (L _min ), all transfected target cell samples were seeded without effector cells. This procedure deducts dead cells in the background of each individual electroporation sample, resulting in only T cell-mediated lytic effects.
Transfected target cells were seeded in triplets in a 96-well format with human T cells at a 5: 1 effector to target ratio and incubated at _{37 ° C. and 5% CO 2. Maximum lysis (L max} ) for normalization to natural luminescence counts is achieved by adding Triton X-100 to control wells containing effector cells and untreated target cells immediately prior to luciferin addition. did. After adding a luciferin solution (1 mg / ml luciferin per well (BD Monolite, BD Biosciences, Heidelberg, Germany) and 50 μl of an aqueous solution containing 50 mM HEPES), luminescence was emitted using an Infinite M200 Tecan microplate reader. Measured after 24 hours and 48 hours. Specific target cell lysis was calculated by the following formula:% specific lysis = [1- (luminescence test sample-L _max ) / (L _{min_test} sample-L _max )] x 100.
FIG. 35 shows a concentration-dependent curve for specific target cell lysis in response to 6RHU3. GraphPad formula Prism "log (agonist) vs.response- Variable slope" a by the use for the calculation of _{The EC 50 values, EC 50 (24h) = 548.0ng} / ml, _and, EC 50 (48h) = 194.5 ng / ml was revealed. The results of this assay are also reported by others (see, eg, Luterbuese, R et al. (2010), Proc. Natl. Acad. Sci. USA, 107 (28), pp. 12605-12610). It strongly depends on the potency of human T cells, which changes according to the immune status of the donor. Therefore, the results may vary from donor to donor.

Example 31: T cell proliferation in response to 6RHU3 IVT-mRNA transfection T cell proliferation is an indicator of T cell activation. Flow cytometric analysis was used to show specific T cell proliferation in response to IVT-mRNA 1 BiMAB encoding bi-scFv in the presence of CLDN6-positive target cells. ^{Briefly, 1 × 10 7} human T cells isolated as described in Example 16 are lysed into 1 μM carboxyfluorescein diacetate succinimidyl ester (CellTrace CFSE, Invitrogen / It was stained with RT for 5 minutes in the dark with Life Technologies GmbH (Germany). Cells were washed twice with DPBS / 5% FCS and resuspended in assay medium at 2 x 106 cells / ml. PA-1, which endogenously expresses CLDN6, and the CLDN6-negative breast cancer cell line MDA-MB-231 were selected as target cells for specific testing. 20 μg / ml IVT-mRNA 6RHU3 or non-targeted control was used for electroporation. Electroporation of PA-1 was performed as described in Example 27. Electroporation of MDA-MB-231 was performed using the following conditions: 400 V, 3 ms pulse length, one pulse, 400 ms interval length, 0.4 cm Gene Pulser / MicroPulsar cuvette ( Bio-Rad, Dreieich, Germany). A cytotoxic assay as described in Example 27 was set up with transfected target cells and CFSE-labeled human T cells as effector cells. T cells alone and untransfected target cells or control-transfected target cells + T cells were used as negative controls. A single T cell stimulated by 5 μg / ml OKT3 (Bio X Cell, West Lebanon, NH, USA) and 2 μg / ml anti-CD28 (BioLegend, Fell, Germany) served as a positive control. 6PHU3 protein at a concentration of 5 ng / ml was applied to untransfected target cells + T cells to confirm the validity of the assay. Samples combined with the non-targeted bi-scFv protein 1 BiMAB were included as specificity controls. All samples were set in triplets with a total volume of 0.2 ml assay medium in 96 wells. After 72 hours of co-incubation, T cells are collected, harvested in 5 ml round bottom tubes, washed, with 2 μl anti-CD45-APC to distinguish human T cells from tumor cells, and in 200 μl DPBS. Dead cells were stained with 0.25 μl eFluor506 (BD Biosciences, Heidelberg, Germany) at 4 ° C. for 30 minutes for counterstaining. After washing with DPBS, cells were resuspended in FACS buffer and analyzed using FACSCanto II (BD Biosciences, Heidelberg, Germany).
T cell proliferation was detected by a reduced CFSE signal only in the presence of CLDN6-positive target cells and anti-CLDN6-specific bi-scFv (see also FIG. 36). In addition to positive controls, 49% -61% T cell proliferation could be observed in combination with 6PHU3 protein in the presence of CDLN6-positive target cells. Target-positive cells transfected with 6RHU3 IVT-mRNA yielded 62% +/- 2%. T cells incubated with CLDN6-negative target cells MDA-MB-231 show no significant proliferation in any type of T cells, as well as in T cells without target cells, except for positive controls.

Example 32: Qualitative Analysis of Protein Production After Transfection of Mammalian Cells with IVT-RNA of 6RHU3 To examine RNA translation into proteins in detail in Mammalian cells, cell line BHK21 (ATCC CRL-13001) was used. Selected as the expression system. 2 × 10 ⁷ cells / ml BHK21 cells were electroporated as described in Example 16 with the difference that all steps were performed at RT. 250 μl of cell suspension was transferred to a 0.4 cm Gene Pulser / MicroPulser cuvette (Bio-Rad, Dreieich, Germany) and 40 μg / ml no. 25 IVT-mRNA, 6RHU3 IVT-mRNA or 6RHU3 IVT-replicon RNA was added. The electroporation conditions were as follows: 300 V, 16 ms pulse length, one pulse, 400 ms interval length.
Electroporated cells were resuspended in culture medium at RT (RPMI 1640, 10% FCS) and transferred to a 15 cm culture dish. Five hours after sowing, the medium containing FCS was replaced with medium containing no FCS. In the case of Example 32a and Example 32b, cell culture supernatants and cells were collected separately 18 hours after electroporation. Cell pellets were lysed in 1 × LDS sample buffer (Cat. No. NP0008; Life technologies, Darmstadt, Germany) and heated at 72 ° C. for 15 minutes. Unconcentrated supernatants and approximately 50-fold concentrated supernatants were used for ELISA analysis. Concentration was performed using an Amicon Ultra-15 centrifugal filtration unit (Merck Millipore, Billerica, MA, USA) according to the manufacturer's protocol. In the case of Example 32c (IVT-mRNA only), the supernatant was collected 48 hours after transfection and subjected to 40-fold concentration as described above.

a. ELISA using supernatant
For ELISA analysis, a nickel-coated plate (Thermo Fisher Scientific, Bonn, Germany) was used to capture the analyte by its His tag. First, the plates were washed 3 times with 200 μl wash buffer per well (0.01% Tween-20 in 1 x PBS). As a standard, the purified 6PHU3 protein was diluted with 1.75% Na casein (= diluent) in 1 x PBS. The dilution series ranged from 2.34 ng / ml to 150 ng / ml in double increments. 100 μl per standard dilution was transferred to the wells in triplets of each concentration. Therefore, 100 μl of the sample was transferred in triplets. The plate was sealed with an adhesive film and incubated at 37 ° C. for 30 minutes. The plate was then washed 3 times with 200 μl wash buffer per well. For the detection of 6PHU3 / 6RHU3, an anti-idiotype monoclonal IgG 4F9 that specifically binds to VH-VL of mCLDN6ab and therefore also specifically to 6PHU3 / 6RHU3 was used. 4F9 was mixed with the diluent to a final concentration of 2.5 μg / ml. 100 μl of anti-idiotype antibody solution was transferred to each well, followed by a 30 minute incubation time at 37 ° C. Subsequently, the plate is washed 3 times with 200 μl of wash buffer per well and diluted 1: 500 with the diluent, 100 μl of AP-conjugated anti-mouse detection antibody (Jackson Immuno Research Laboratories, West Grove, PA, USA). Was added to each well and then incubated at 37 ° C. for 30 minutes. After the final wash step (200 μl wash buffer, 3 times), 1.5 mg in a suitable substrate buffer (1 M diethanolamine, 0.5 mM MgCl2, 0.01% Na azide, pH 9.8). / Ml substrate pNPP was added to each well, followed by incubation in the dark at RT for 30 minutes. 100 μl of 3M KOH was used for each well to stop the enzymatic reaction. Absorbance was measured using a microplate reader (Infinite M200, Tecan, Mannedorf, Switzerland). For dual wavelength analysis, 405 nm was chosen as the measurement wavelength and 492 nm was chosen as the reference wavelength. The absorbance value was calculated by subtracting the reference wavelength from the measurement wavelength.
In FIG. 37A, the average absorbance value including the standard deviation is plotted. Concentrated supernatants obtained from cells transfected with 6RHU3 IVT-mRNA and IVT-replicon provided significant signals demonstrating translation of IVT-RNA encoding bi-scFv. Simulated transfection cells and no. The concentrated supernatant obtained from 25 control (-CTRL) transfected cells produced no signal, as expected. The actual protein concentration cannot be proposed due to the different toxicity of the IVT-mRNA construct and the IVT-replicon construct and the slightly different x-fold concentrate. Estimates of approximate protein concentration in the unconcentrated supernatant ranged from 1.4 ng / ml for IVT-replicon and 5.9 ng / ml for IVT-mRNA samples.

b. Western blot analysis of supernatants and cell lysates (IVT-mRNA samples and IVT-replicon samples) For analysis by Western blot, the concentrated supernatants and cell lysates were subjected to NuPAGE Novex 4-12% Bis-Tris gel (Invitrogen). / Life Technologies GmbH, Darmstadt, Germany). 6RHU3 IVT-mRNA, IVT-replicon RNA, no. Supernatants and cell lysates of BHK21 or untreated cells transfected with 25 IVT-mRNAs, as well as positive controls (0.1 μg of purified 6PHU3 protein) were loaded. Western blot analysis was performed by standard procedures (Curent Protocols in Protein Science, 2012). Briefly, the protein is blotted onto PVDF membrane, the blocking treatment is performed with PBST / 3% milk powder, and then the membrane is diluted 1: 500 in blocking buffer with the primary antibody Anti-HIS Epitope-Tag (Dianova). Incubated with GmbH, Hamburg, Germany) at 4 ° C. for 1 hour. After repeated washes with blocking buffer, membranes were mixed with Fc-specific secondary peroxidase-conjugated goat anti-mouse IgG antibody (Sigma Aldrich, Germany) diluted 1: 10000 in blocking buffer at 4 ° C. Incubated for 1 hour. Again, after repeated washings with blocking buffer, the signal was visualized by the SuperSignal West Femto Chemiluminescent Substrate (Pierce / Thermo Fisher Scientific, Rockford, IL, USA) and the ImageSearchETechiluminescence. Recorded by Germany). A signal of 6PHU3 was detected between 50 kD and 60 kD when compared to the internal molecular weight standard.
As shown in FIG. 37B, the signal is no. Cells transfected with 25 IVT-mRNA (lane 1), cells transfected with 6RHU3 IVT-mRNA (lane 4), and cells transfected with 6RHU3 IVT-replicon RNA (lane 5). In contrast, lane 6 from which the supernatant was derived from untreated cells was not signaled. A strong signal could be generated by cell lysates of cells transfected with 6RHU3 IVT-mRNA (lane 8) and cells transfected with 6RHU3 IVT-replicon RNA (lane 9). no. Cell lysates derived from cells transfected with 25 gave a very weak signal (lane 2) and untreated cells (lane 10) showed no signal. The purified 6PHU3 protein control (lane 11) could be detected. The relatively weak signal in the supernatant, along with the weak 6RHU3 secretion, is probably due to the relatively short incubation time after transfection. Longer incubation times could not be investigated due to the toxic effects of Replicon RNA.
Both analyzes (ELISA and Western blot) are qualitative and do not help determine protein concentration.

c. Western Blot Analysis of Supernatants (IVT-mRNA Samples) The supernatant collected 48 hours after transfection was separated by SDS-PAGE, after which Western blot analysis was performed as described in Example 32b. As shown in FIG. 37C, no. Translated from IVT-mRNA and secreted into the supernatant. 25 and 6RHU3 were detected by their His tags. In addition, the production and secretion of 6RHU3, as well as no., Which is also used as a bi-scFv specificity control. The production and secretion of 25 could be demonstrated.

Example 33: Detection of Functional CLDN6-Specific Bi-scFv Protein Translated In vivo After Intramuscular RNA Injection Female and male NSG mice at 8 to 16 weeks of age were selected and 5 mice were selected. It was divided into four groups consisting of. 40 μl of RNA solution was injected per mouse and thigh muscle. A 40 μl RNA solution consisted of 1 × PBS, 5 μg of D2-capped 6RHU3 IVT-mRNA or IVT-replicon, 2 μg of D1-capped luciferase IVT-mRNA, and 0 μg or 15 μg of D1-capped EBK IVT-mRNA. .. EBK IVT-mRNA encoding vaccinia viral proteins (E3L, B18R and K3L) (EBK) was co-injected to inhibit the IFN response and counteract PKR activation for RNA translation enhancement (patent application PCT). / EP2012 / 04673). Luciferase signals were monitored 24 hours after injection with Xenogen IVIS 2000 and mice without the signal were removed from the sample population.
Blood was collected 7 days after injection. Serum was collected and subsequently frozen at -80 ° C.

Cytotoxicity Assay NSG mouse sera were analyzed by in vitro cytotoxicity assay. PA-1 target cells in which firefly luciferase is stably transduced and which endogenously expresses CLDN6 are expressed as human T cells at a 30: 1 E: T ratio for maximum sensitivity (described in Example 16). It was sown with (isolated to be). The assay medium consisted of RPMI 1640 medium (Gibco / Life Technologies GmbH, Darmstadt, Germany) supplemented with 10% heat-inactivated FCS, 0.5% penicillin-streptomycin, 1 × NEAA and 1 mM sodium pyruvate. .. 20 μl of thawed test serum was added per test sample well. Standards of 6PHU3 protein Control wells, L _min wells and L _max wells were completed with 20 μl serum from untreated NSG mice. The final volume of the well was 100 μl. L _min was sown in 2 stations, L _max was sown in 6 stations, and the test sample was sown in 3 stations. After 48 hours of incubation at 37 ° C. and 5% CO _{2 , L max} wells were mixed with 10 μl of 2% Triton X-100 solution and incubated for 10 minutes. 10 μl of assay medium was added to all other wells. 50 μl of luciferin solution (see Example 23) was added and the plates were measured on an Infinite M200 microplate reader (TECAN, Männedorf, Switzerland) after a 30 minute incubation step at 37 ° C. in the dark. Calculations of specific target cell lysis were performed as described in Example 23.
In FIG. 38, the percentage of specific dissolution is plotted. Significant cytotoxic effects were detected in each group. The concentration of CLDN6-specific bi-scFv protein was significantly increased by EBK co-injection in the case of 6RHU3 IVT-mRNA.
These data demonstrate in vivo translation of 6RHU3 from IVT-mRNA or IVT-replicon after intramuscular injection as well as secretion into the bloodstream.

Example 34: Preparation and Testing of Bispecific Binders Targeting CLDN18.2 or CLDN6 and CD3 Original for the further development of anti-CLDN18.2-specific and anti-CLDN6-specific bi-scFv antibody fragments. Various aspects for optimizing the protein of the above were investigated. These aspects were primarily related to obtaining preparations with greater homogeneity with respect to the various folding species, disulfide isomers and oligomers that may form during recombinant protein production. These modifications should not be detrimental to the functional activity of the bi-scFv protein.

Replacement of Extra (Non-paired) Cysteine Residues in the Anti-CD3 Binding Domain of the bi-scFv Protein The unpaired cysteine residues present in the primary sequence of the Ig domain are appropriate for the resulting antibody fragment. Several synthetic constructs were made to investigate in detail whether they could interfere with the correct formation of intra-chain and / or inter-chain disulfide bonds that are essential for good folding and stability. Such non-paired cysteines may impair the potency, homogeneity, productivity and stability of the final protein product and should therefore be avoided. In addition to the "standard" set of cysteines involved in disulfide pairing, free cysteine residues may be present in the variable domain.
For example, in the VH domain derived from the OKT3 antibody, a conserved cysteine at the H92 position is present 3 residues before the beginning of CDR-H3, forming a structural disulfide bond with the H22 position. However, in this molecule, at position H100A (CDR-H3), another cysteine (Cys) was involved in H100A forming a disulfide bond with H22 on behalf of H92, thereby misfolding. It may be possible to allow false folds that result in insoluble non-functional products. To overcome this possible false pairing of these cysteine residues, site-specific substitutions of free cysteines were performed (Kipryanov, Protein Engineering, 10: 445-453, 1997). By this single substitution, a significant increase in the productivity and stability of scFv derived from OKT3 was achieved while maintaining overall binding activity.
The VH domain of the anti-CD3 antibody TR66 used in this study (SEQ ID NO: 36) contains such a free cysteine at position H103 of the primary sequence as set forth in SEQ ID NO: 36. A sequence comparison of the VH domain of anti-CD3 antibody TR66 (SEQ ID NO: 36) with the VH domain of anti-CD3 antibody OKT3 shows 96.6% sequence homology.
According to these results, substituting this free cysteine with a serine residue in the CDR-H3 of the VH domain of the anti-CD3 antibody TR66 for the bi-scFv protein targeting CD3 (SEQ ID NO: 94). And for either CLDN18.2 or CLDN6. The introduction of such substitutions results in the design of the bi-scFv proteins 1-BiMAB-S (SEQ ID NO: 103) and 6-PHU3-S (SEQ ID NO: 101) (see Tables 11 and 12, respectively). ).

Substitution of Extra (Non-paired) Cysteine Residues in Anti-CLDN6 Bi-scFv Protein Original Anti-CLDN6 Antibody mCLDN6ab (its variable domain is 6PHU3 (SEQ ID NO: 45) and 6PHU5 (SEQ ID NO: 45) and 6PHU5 (SEQ ID NO: 45) of the corresponding bi-scFv protein. (No. 43) used for assembly) contains an unpaired cysteine residue in the flanking region of CDR-L2 of the VL domain at position 46 of the corresponding primary sequence. This corresponds to position 45 in SEQ ID NO: 23, from which the first amino acid of VL has been removed. Various substitutions were made to replace this free cysteine with the following residues:
A serine residue, in this case a substitution similar to that of the anti-CD3 antibody TR66 in the VH domain (SEQ ID NO: 100).
-Leucine residue, in this case a substitution by comparison with the amino acid sequence of another anti-CLDN6 antibody (SEQ ID NO: 97 and SEQ ID NO: 98).
-Tryptophan residue, in this case a substitution by amino acid sequence comparison with a germline database (SEQ ID NO: 99).

Evaluation of linker length, V-domain order and artificially interconnected disulfide bonds in anti-CLDN18.2bi-scFv proteins As another example, Arndt et al. (Biochemistry, 37:12918-12926, 1998) have non-scFv fragments. As a possible explanation for the appearance of covalently linked oligomers, so-called domain swapping is described. Under this model, the protein state provides a possible thermodynamic equilibrium between the monomeric form and the dimer / oligomeric form due to the constant intramolecular and intermolecular exchange of VL / VH interconnect contacts. Will be done. These oligomers may already be present in the cell culture supernatant and must be removed during the purification process. However, these molecular species may also be formed during the storage period of the purified monomer species.
The preferred energy state of a protein is strongly influenced by its overall design (primary sequence, linker length, VL / VH orientation, etc.).
Worn and Pluckthun (JMB, 305: 989-1010, 1999) stated that forms with higher content of monomeric species could be obtained by using a linker of 20 residues or more. Desplancq et al. (Protein Eng., 7: 1027-1033, 1994) have shown that variable domain orientation may also have an effect on the formation of dimer and polymeric morphology. In the same publication, Desplancq showed that a linker of 25 or 30 amino acids (aa) gives the best monomer / dimer ratio for those particular antibodies. The distance between the C-terminal of VL and the N-terminal of VH is approximately 39 Å to 43 Å, and the distance between the C-terminal of VH and the N-terminal of VL is 32 Å to 34 Å (Pluckthun et al., From PCR to fermentation (J. McCafferty). , HR Hoogenboom & DJ Christell), Title: (IRL Press, pp. 203-252, 1996)). To obtain similar molecular properties, the linker for orienting the VL-VH must be longer than the VH-VL linker. Pluckthun et al. (From PCR to fermentation (J. McCafferty, HR Hoogenboom & DJ Chriswell ed.), Title: (IRL Press, pp. 203-252, 1996)) has 15 amino acids in VH / VL orientation. Alternatively, it was recommended to use a linker with a length of 20 amino acids and in the VL / VH orientation a linker with a length of 20 or 25 amino acids.
Another possibility for forcing monomer formation and stabilizing VH / VL domain interactions is to manipulate interconnect disulfide bonds within the contact surface between these two domains. Introducing disulfide bridges at the H44-L100 position (Kabat number notation) is the most frequently used in scFv with satisfactory results (Brinkmann et al., PNAS, 90: 7538-7542). , 1993; Worn and Pluckthun, Biochemistry, 38: 8739-8750, 1999; Weatherill et al., PEDS, 25: 321-329, 2012). This strategy has been successfully used to stabilize IgG-like bispecific antibodies that combine scFv fused to full-length IgG (Michaelson et al., mAbs, 1: 128-141, 2009; Schander et al., Etc. Antibob. Agents. Chemother., 55: 2369-2378, 2011).
Weatherill et al. (PEDS, 25: 321-239, 2012) have disulfided human scFv (VH- (G4S) 4-VL and VL- (G4S) 4-VH) between VH44 and VL-100 positions. Stabilized by binding. Moreover, this publication addresses the problem of possible domain exchange with scFv, which contains no interconnected disulfide bonds, by performing different SE-HPLC experiments at different load volumes and concentrations. These assays give different results depending on the sample loading conditions for unstabilized scFv, but regardless of the conditions used, the disulfide-stabilized molecules elute like monomers. did. Zhao et al. (Int. J. Mol. Sci., 12: 1-11, 2011) introduced the same mutation in scFv to provide greater stability of the stabilized molecule for 20 hours of storage at 37 ° C. I admitted later.
For a bispecific form using scFv fused to full-length IgG, Schanser et al. (Antimiclob. Agents Chemother., 55: 2369-2378, 2011) compared the effects of linker length and interconnect disulfide bonds. .. Schanser et al. Fused the original scFv or scdFv (VH- (G4S) 3-VL) at either the C-terminal or N-terminal portion of the heavy or light chain. For different linker lengths (20, 25 and 30 amino acids), Schander et al. Fused the original scFv to the C-terminal portion of either the heavy or light chain. The results obtained for different linker lengths identified the 30aa peptide as the more preferred linker for producing stable monomers. Aggregate levels after 7 days of storage at 40 ° C. are 50% for _{scFv 15} , 18% for _{scFv 20} , 8% for _{scFv 25} , and 6% for _{scFv 30.} Met. However, the disulfide scFv ₁₅ stabilized by interconnected disulfide bonds was slightly superior to scFv _30. The same effort was used by Michaelson et al. (mAbs, 1: 128-141, 2009), who contained scFv with a linker of 15aa in a VH / VL orientation with their original IgG-like bispecific antibody (Mabs, 1: 128-141, 2009). This resulted in 40% agglutination) was improved by increasing the linker length to 20aa of scFv and introducing interconnect disulfide bonds between VH44 and VL-100 positions. The resulting molecule yielded more than 98% of the monomers that were stable after 3 months at 4 ° C. The authors decided to work on improving the scFv molecule before proceeding to the bispecific form.
In the case of anti-CLDN18.2 specific bi-scFv proteins, it is not known whether the formation of dimer and macromolecular forms can occur and what is involved with respect to anti-claudin and / or anti-CD3 scFv molecules. .. The following modifications have been evaluated to evaluate the optimal global molecule for the anti-CLDN18.2 specific bi-scFv protein for each distinct scFv:
-Domain orientation-Linker length-Introduction of interconnected disulfide bonds-Combination of these three modifications

For the anti-claudin 18.2 binding domain, in addition to the variable domain derived from mCLDN18.2ab (VH: SEQ ID NO: 8; VL: SEQ ID NO: 15), the sequence derived from mCLDN18.2ab1 (VH: SEQ ID NO: 6; VL: SEQ ID NO: 11) has been used for the construction of anti-CLDN18.2 specific bi-scFv protein.
Section A. Table 11 in a "Sequence origin, design and cloning of 32 anti-CLDN 18.2 specific bi-scFv constructs into an expression vector" describes these different constructs.

A. Preparation and testing of bispecific binders targeting CLDN 18.2 and CD3 a. Cloning of 32 anti-CLDN 18.2 specific bi-scFv constructs into sequence origin, design and expression vectors The bispecific tandem single chain antibody construct bi-scFv shown herein is the first. Two differences in which the binding domain is specific for the human tumor-related antigen (TAA), whereas the second binding domain is specific for the ε chain of the human T cell receptor (CD3). Contains a binding domain. Each of these two binding domains of this bispecific molecule contains two antibody variable domains that are arranged as scFv components in either VH-VL or VL-VH orientation. These antibody variable domains are linked via a flexible glycine-serine peptide linker consisting of 4 or 5 repeats of the G4S subunit, depending on orientation. Therefore, the scFv components arranged in a VH-VL orientation are linked by a 20 amino acid linker (which is named "LL4") and the VL-VH is linked by a 25 amino acid linker (which is named "LL5"). To. On the other hand, these two scFv components are linked via a 6 amino acid long SG4S linker (which is named "SL"). Information on sequence origin from monoclonal antibodies (mABs) and domain organization are summarized in Table 11.
Variants 5504, 5505, 5506, 5507, 5512, 5513, 5514, 5515, 5520, 5521, 5522, 5523, 5528, 5592, 5530, 5531, 5536, 5537, 5538, 5339, 5544, 5545, 5546, 5547 , 5552, 5535, 5554, 5555, 5560, 5561, 5562 and 5563 include VH anti-CD3 according to SEQ ID NO: 95 and VL anti-CD3 according to SEQ ID NO: 96.
In the specific case of 1-BiMAB-S, only the substitution of free cysteine with serine in VH anti-CD3 (SEQ ID NO: 94) is performed in comparison to the amino acid sequence of 1-BiMAB sequence (SEQ ID NO: 39). It should be noted that SEQ ID NO: 39 still contains the amino acid sequence of the N-terminal signal sequence that mediates the secretion of the 1-BiMAB bi-scFv protein into the cell culture supernatant during expression in mammals. It doesn't become. This signal sequence is not part of the secreted recombinant protein as it is cleaved by the signal peptidase in the lumen of the reticular endoplasmic reticulum.
GeneArt® gene synthesis (Life Technologies GmbH) using GeneOptimizer® software to optimize codon usage for expression in CHO cells for the genes encoding these bi-scFv constructs. , Darmstadt, Germany). In addition to general secretory signals, all DNA constructs contain the same Kozak sequence and HindIII restriction at the 5'end. At the 3'end, BsiWI and XhoI restriction sites were added to allow flexible subcloning into different expression vectors. Subcloning into an excellent pCEP4 expression vector (Life Technologies GmbH, Darmstadt, Germany) was performed by Life Technologies using the HindIII and XhoI restriction sites.

SEQ ID NOs: 66 to 93 still contain the amino acid sequence of the N-terminal signal sequence that mediates the secretion of the 1-BiMAB bi-scFv protein into the cell culture supernatant during expression in mammals. You have to be careful. This signal sequence is cleaved by the signal peptidase in the endoplasmic reticulum lumen and is not part of the secreted recombinant protein.

b. Were subcultured in serum-free medium in transient transfection with 32 anti CLDN18.2 specific for bi-scFv protein production and purification suspending-adapted CHO cells humidified CO ₂ shaker. The day before transfection, cells were seeded in serum-free medium in a shaking flask. On the day of transfection, cells were centrifuged (200 xg for 5 minutes) and resuspended in fresh DMEM medium (Invitrogen, 41965-039) in a shaking flask. DNA and transfection reagents were added to the cells and gently mixed by shaking. After static incubation in a CO ₂ incubator, cells were diluted with serum-free growth medium and further cultured for expression in an incubation shaker. Cells were fed CHO CD EffectFeed ™ C (Invitrogen, A13275) according to nutritional requirements. The bi-scFv protein was collected after the cell's viability began to decline. The antibody construct was purified by Capto L Sepharose. The protein concentration was determined by the absorbance at 280 nm.

c. Luciferase cytotoxic assay with 32 anti-CLDN18.2-specific bi-scFv proteins For functional screening of 32 anti-CLDN18.2-specific bi-scFv proteins, 4 titer points ( Examples 2. Examples: 5000 ng / ml, 1000 ng / ml, 200 ng / ml and 40 ng / ml). Tested in an in vitro luciferase cytotoxic assay as described in c.
Example 2. The stable luciferase-expressing NugC4 cells described in c were incubated with human T cells and bi-scFv protein, or without the bi-scFv protein to determine _{the L min value.} Live cell luminescence was measured 24 and 48 hours after assay setup using an Infinite M200 Tecan plate reader. Specific target cell lysis, Example 2. Calculated by the formula exemplified in c.

Qualitative analysis of cytotoxicity results (FIGS. 39a, 39b, 39c and 39d) based on the anti-CD3 TR66 binding domain of scFv was able to elicit the following findings:
The best-performing anti-CLDN18.2-specific bi-scFv protein in the luciferase cytotoxic assay is a VH / VL domain orientation in which the anti-CD3 component is linked by an "LL4" linker with or without interconnected disulfide bridges. It contains (5504, 5505, 5506, 5507, 5536, 5537, 5538, 5538, 5512, 5513, 5514, 5515, 5544, 5545, 5546, 5547; FIGS. 39a and 39b). Lower cytotoxic activity is obtained by variants containing the anti-CD3 component in a VL / VH domain orientation with the peptide linker "LL5" and containing interconnected disulfide bridges (5528, 5729, 5530, 5531, 5560, 5651, 5562, 5563; FIG. 39d). The lowest cytotoxic activity is obtained by variants containing the anti-CD3 component in a VL / VH domain orientation with the peptide linker "LL5" without interconnect disulfide bridges (5520, 5521, 5522, 5523, 5552, 5553, 5554, 5555; FIG. 39c).

B. Preparation and testing of bispecific binders targeting CLDN6 and CD3 a. Sequence Origin, Design and Expression Vector Clone of bi-scFv Construct The bispecific tandem single chain antibody construct bi-scFv shown herein, on the one hand, against a human tumor-related antigen (TAA). It contains two different binding domains that are specific, whereas the other is specific for the ε chain of the human T cell receptor (CD3). Each of these two binding domains of this bispecific molecule contains two antibody variable domains that are arranged as scFv components in either VH-VL or VL-VH orientation. These antibody variable domains are linked via a flexible glycine-serine peptide linker. The scFv component that targets TAA is arranged in a VH-VL orientation and is linked by a 15 amino acid linker (which is named "LL3") consisting of three identical repetitions of the G4S subunit. ScFv component targeting CD3 are arranged in the same manner as VH-VL orientation, however, the sequence _{G 4 S (G 2 S)} 18 amino acids of the linker with the 3 _{G 3} S (which is named is a LLv1) connected by To. On the other hand, these two scFv components are linked via a 6 amino acid long SG4S linker (which is named "SL"). Information on sequence origin from monoclonal antibodies (mABs) and domain organization are summarized in Table 12. Variants 5454, 5456, 5458, 5460, 5462 and 5464 include VH anti-CD3 according to SEQ ID NO: 95 and VL anti-CD3 according to SEQ ID NO: 96 for the anti-CD3 binding domain. Variants 5454 and 5458 contain VL anti-CLDN6 according to SEQ ID NO: 98, variants 5456 and 5460 contain VL anti-CLDN6 according to SEQ ID NO: 99, and variants 5462 and 5464 contain VL anti-CLDN6 according to SEQ ID NO: 100. ..
In the specific case of 6PHU3-S (SEQ ID NO: 101), only the substitution of free cysteine by the serine residue in VH anti-CD3 (SEQ ID NO: 94) is the only comparison of the 6PHU3 sequence to the amino acid sequence (SEQ ID NO: 45). Will be done. It should be noted that SEQ ID NO: 45 still contains the amino acid sequence of the N-terminal signal sequence that mediates the secretion of the 6PHU-3 bi-scFv protein into the cell culture supernatant upon expression in mammals. It doesn't become. This signal sequence is cleaved by the signal peptidase in the endoplasmic reticulum lumen and is not part of the secreted recombinant protein. Moreover, for 6PHU3-SL (SEQ ID NO: 102), the substitution of free cysteine with a leucine residue in VL anti-CLDN6 (SEQ ID NO: 97) at position 46 of the corresponding primary sequence in comparison to the amino acid sequence of 6PHU3-S. Will be done. This corresponds to position 45 in SEQ ID NO: 23, from which the first amino acid of VL has been removed.

GeneArt® gene synthesis (Life Technologies GmbH) using GeneOptimizer® software to optimize codon usage for expression in CHO cells for the genes encoding these bi-scFv constructs. , Darmstadt, Germany). In addition to general secretory signals, all DNA constructs contain the same Kozak sequence and HindIII restriction at the 5'end. At the 3'end, BsiWI and XhoI restriction sites were added to allow flexible subcloning into different expression vectors. Subcloning into an excellent pEE12.4 expression vector (Lonza Group Ltd, Basel, Switzerland) was performed using standard techniques using HindIII and BsiWI restriction sites.

b. Were subcultured in serum-free medium in transient transfection with six anti-CLDN6 specific for bi-scFv protein production and purification suspending-adapted CHO cells humidified CO ₂ shaker. The day before transfection, cells were seeded in serum-free medium in a shaking flask. On the day of transfection, cells were centrifuged (200 xg for 5 minutes) and resuspended in fresh DMEM medium (Invitrogen, 41965-039) in a shaking flask. DNA and transfection reagents were added to the cells and gently mixed by shaking. After static incubation in a CO ₂ incubator, cells were diluted with serum-free growth medium and further cultured for expression in an incubation shaker. Cells were fed CHO CD EffectFeed ™ C (Invitrogen, A13275) according to nutritional requirements. The bi-scFv protein was collected after the cell's viability began to decline. The antibody construct was purified by FPLC using Capto L Sepharose. The protein concentration was determined by the absorbance at 280 nm.

c. To determine the six anti-CLDN6 50% maximum effective dose of determining the anti-CLDN6-specific bi-scFv protein _{EC 50} for specific bi-scFv protein, wherein the titration sequence of bi-scFv protein in Example 13 In vitro luciferase cytotoxic assay was tested as such.
A bi-scFv protein in the range of 2.5 pg / ml to 5 μg / ml (in 10-fold increments) of PA-1 cells and human T cells that stably express luciferase at a 5: 1 E: T ratio. Incubated with concentration or without the anti-CLDN6-specific bi-scFv protein to determine _{the L min value.}
Three independent assays were performed on different human donors to prepare human T cells. The results are illustrated in FIG.
Quantitative comparison of cytotoxicity results is based on cysteine residue substitution in the flanking region of CDR-L2 with either serine, leucine or tryptophan, and at anti-CLDN6 binding domain positions and anti-CD3 binding domain positions. By doing so, we were able to draw out the following findings.
The best-performing anti-CLDN6-specific bi-scFv protein in the luciferase cytotoxic assay contains a cysteine-to-tryptophan substitution with an anti-CLDN6 binding domain in the N-terminal portion of the bi-scFv protein (variant 5456). A variant with slightly lower cytotoxic activity, containing anti-CLDN6 in the C-terminal portion, with a tryptophan substitution of cysteine (variant 5460) or a variant with serine substitution of cysteine (alteration). Obtained for either body 5464). Lower cytotoxic activity for variants containing leucine substitutions of cysteine with anti-CLDN6 at the N-terminal portion (variant 5454) or C-terminal portion (variant 5458) of the bi-scFv protein. Is measured in comparison with the variant. Surprisingly, among the variants containing the substitution of cysteine with serine, the variant having anti-CLDN6 at the N-terminal portion of the bi-scFv protein (variant 5462) has the lowest cytotoxic activity.

15. Other Therapies There are numerous other cancer therapies that can be combined with the formulations and methods of the invention to produce synergistic effects. Examples include, but are not limited to, treatments that target apoptosis, hyperthermia, hormone therapy, telomerase therapy, insulin augmentation therapy, gene therapy and photodynamic therapy.
Hereinafter, an example of the reference form will be added.
1. 1. A binding agent comprising at least two binding domains, the first binding domain binding to claudin (CLDN) and the second binding domain binding to CD3.
2. It is a bispecific molecule. Binders described in.
3. 3. 2. The bispecific molecule is a bispecific antibody. Binders described in.
4. 2. The bispecific antibody is a bispecific single chain antibody. Binders described in.
5. The claudin is expressed in cancer cells. ~ 4. The binder according to any one of the above.
6. The claudin is expressed on the surface of cancer cells. ~ 5. The binder according to any one of the above.
7. The claudin is selected from the group consisting of claudin 18.2 and claudin 6. ~ 6. The binder according to any one of the above.
8. 1. The first binding domain binds to the extracellular domain of the claudin. ~ 7. The binder according to any one of the above.
9. 1. The second binding domain binds to the epsilon chain of CD3. ~ 8. The binder according to any one of the above.
10. 1. The CD3 is expressed on the surface of T cells. ~ 9. The binder according to any one of the above.
11. Binding of the binding agent to CD3 on T cells causes proliferation and / or activation of the T cells, provided that the activated T cells cause cytotoxic factors (eg, perforin and granzyme). ) Is preferably released, and cytolysis and apoptosis of cancer cells are initiated. -10. The binder according to any one of the above.
12. 1. The binding to claudin and / or the binding to CD3 is a specific binding. ~ 11. The binder according to any one of the above.
13. It is in the form of a full-length antibody or antibody fragment. ~ 12. The binder according to any one of the above.
14. It comprises a set of antibody variable domains (preferably four antibody variable domains) with at least two binding domains, provided that at least one binding domain binds to claudin and at least one binding domain binds to CD3. 1. ~ 13. The binder according to any one of the above.
15. The variable domain (VH) of the heavy chain of immunoglobulin, which has specificity for claudin antigen (VH (CLDN)), and the variable domain of light chain of immunoglobulin (VL), which has specificity for claudin antigen. Variable domain (VL (CLDN)), variable domain of immunoglobulin heavy chain (VH), variable domain having specificity for CD3 (VH (CD3)), and variable domain of light chain of immunoglobulin (VL) ) Contains a variable domain (VL (CD3)) having specificity for CD3. ~ 14. The binder according to any one of the above.
16. 1. It is a form of diabodies containing heavy chain variable domains linked to light chain variable domains in the same polypeptide chain, so that these two domains are not paired. ~ 15. The binder according to any one of the above.
17. The diabodies contain two polypeptide chains, where one polypeptide contains VH (CLDN) and VL (CD3) and the other polypeptide chain contains VH (CD3) and VL (CLDN). .. Binders described in.
18. 1. It is a form of a bispecific single chain antibody consisting of two scFv molecules linked via a linker peptide. ~ 15. The binder according to any one of the above.
19. The heavy chain variable region (VH) and its corresponding light chain variable region (VL) are arranged from the N-terminal to the C-terminal in the order of VH (CLDN) -VL (CLDN) -VH (CD3) -VL (CD3). It is arranged in the order of VH (CD3) -VL (CD3) -VH (CLDN) -VL (CLDN) or VH (CD3) -VL (CD3) -VL (CLDN) -VH (CLDN). 18. Binders described in.
20. The heavy chain variable region (VH) and its corresponding light chain variable region (VL) are via a long peptide linker, preferably via a peptide linker containing the amino acid sequence of (GGGGS) 3 or VE (GGGGS) 2GGVD. Connected, 19. Binders described in.
21. The two VH-VL-type scFv units or VL-VH-type scFv units are linked via a short peptide linker, preferably via a peptide linker containing the amino acid sequence of SGGGGS or GGGGS. Or 20. Binders described in.
22. The CLDN is CLDN 18.2, the VH (CLDN) comprises the amino acid sequence represented by SEQ ID NO: 8 or a fragment thereof, or a variant thereof, and the VL (CLDN) is a sequence. 15. The amino acid sequence represented by number 15 or a fragment thereof or a variant of the amino acid sequence or fragment. ~ 21. The binder according to any one of the above.
23. The CLDN is CLDN6, the VH (CLDN) comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, or a variant thereof, and the VL (CLDN) is SEQ ID NO: 23. Containing an amino acid sequence represented by or a fragment thereof or a variant of the amino acid sequence or fragment. ~ 21. The binder according to any one of the above.
24. The VH (CD3) comprises the amino acid sequence or fragment thereof represented by SEQ ID NO: 36 or a variant of the amino acid sequence or fragment, and the VL (CD3) contains the amino acid sequence or fragment represented by SEQ ID NO: 37. 15. It comprises the fragment or a variant of the amino acid sequence or fragment. ~ 23. The binder according to any one of the above.
25. The CLDN is CLDN 18.2, and the binder comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40 and SEQ ID NO: 41, or a fragment or variant thereof. .. The binder according to any one of 22 and 24.
26. 1. The CLDN is CLDN6 and the binder comprises an amino acid sequence or fragment or variant thereof selected from the group consisting of SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 and SEQ ID NO: 45. 21. The binder according to any one of 23 and 24.
27. The cancer cells expressing CLDN18.2 are gastric cancer, esophageal cancer, pancreatic cancer, lung cancer (eg, non-small cell lung cancer (NSCLC), etc.), breast cancer, ovarian cancer, colon cancer, liver cancer, head and neck cancer. 4. Cancer cancer cells selected from the group consisting of cancers of the bile sac and their metastases, Krkenberg tumors, peritoneal metastases and / or lymph node metastases. The binder according to any one of 22, 24 and 25.
28. The cancer cells expressing CLDN6 include bladder cancer, ovarian cancer (particularly ovarian adenocarcinoma and ovarian malformation cancer), lung cancer (small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), but particularly , Flat epithelial lung cancer and flat epithelial lung adenocarcinoma), gastric cancer, breast cancer, liver cancer, pancreatic cancer, skin cancer (particularly basal cell cancer and flat epithelial cancer), malignant melanoma, head and neck cancer (particularly malignant polymorphism) Gonoma), sarcoma (particularly synovial sarcoma and synovial cancer sarcoma), bile duct cancer, bladder cancer (particularly transitional epithelial cancer and transitional epithelial papillary cancer), kidney cancer (particularly clear cell carcinoma and papillary carcinoma) Renal cell cancer including renal cell cancer), colon cancer, small intestinal cancer (including ileal cancer, especially small intestinal gland cancer and ileal gland cancer), testicular fetal cancer, placental chorionic villus cancer, cervical cancer, testicular cancer (Especially testicular seminoma, testicular malformations and embryonic testicular cancers), uterine cancers, embryonic cell tumors (eg, malformed cancers or embryonic cancers, especially testicular embryonic cell tumors), and their metastatic forms. It is a cancer cell of cancer selected from the group consisting of 5. The binder according to any one of 21, 23, 24 and 26.
29. 1. It has an N-terminal secretory signal and / or a C-terminal histidine epitope tag (preferably a histidine 6 epitope tag). ~ 28. The binder according to any one of the above.
30. 1. 1. ~ 29. A recombinant nucleic acid encoding a binder described in any one of the above.
31. 30. In the form of vector or RNA. Recombinant nucleic acid according to.
32. 30. Or 31. A host cell containing the recombinant nucleic acid described in.
33. 1. To be used in treatment, especially in treating or preventing cancer. ~ 29. The binder according to any one of 30. Or 31. The recombinant nucleic acid according to the above, or 32. The host cell according to.
34. 1. 1. ~ 29. The binder according to any one of 30. Or 31. Recombinant nucleic acid described in, or 32. A pharmaceutical composition comprising a host cell according to.
35. 34. A method for treating or preventing a cancer disease, which comprises administering to a patient the pharmaceutical composition described in.
36. 33. The cancer cells express a claudin to which the binder can bind. Binder, recombinant nucleic acid or host cell, or 35. The method described in.
37. The claudin is CLDN18.2, and the cancers are gastric cancer, esophageal cancer, pancreatic cancer, lung cancer (eg, non-small cell lung cancer (NSCLC), etc.), breast cancer, ovarian cancer, colon cancer, liver. Selected from the group consisting of cancer, head and neck cancer, cancer of the bile sac, and their metastases, Krkenberg tumors, peritoneal metastases and / or lymph node metastases, 36. Binder, recombinant nucleic acid, host cell or method according to.
38. The claudin is CLDN6, and the cancers are bladder cancer, ovarian cancer (particularly ovarian adenocarcinoma and ovarian malformation cancer), lung cancer (small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC)). In particular, squamous cell lung cancer and squamous epithelial lung adenocarcinoma), gastric cancer, breast cancer, liver cancer, pancreatic cancer, skin cancer (particularly basal cell cancer and squamous cell carcinoma), malignant melanoma, head and neck cancer ( In particular, malignant polymorphic adenoma), sarcoma (particularly synovial sarcoma and synovial cancer sarcoma), bile duct cancer, bladder cancer (particularly transitional epithelial cancer and transitional epithelial papillary carcinoma), kidney cancer (particularly renal clear) Renal cell cancer including cell cancer and papillary renal cell cancer), colon cancer, small intestinal cancer (including ileal cancer, especially small intestinal adenocarcinoma and ileal gland cancer), testicular fetal cancer, placental chorionic villus cancer, offspring Palace cancer, testicular cancer (particularly testicular seminoma, testicular malformation and embryonic testicular cancer), uterine cancer, embryonic cell tumor (eg, malformed cancer or embryonic cancer, especially testicular embryonic cell tumor), and Selected from the group consisting of those transitional forms, 36. Binder, recombinant nucleic acid, host cell or method according to.

Claims (38)

A binding agent comprising at least two binding domains, the first binding domain binding to claudin (CLDN) and the second binding domain binding to CD3. The binder according to claim 1, which is a bispecific molecule. The binder according to claim 2, wherein the bispecific molecule is a bispecific antibody. The binder according to claim 3, wherein the bispecific antibody is a bispecific single chain antibody. The binder according to any one of claims 1 to 4, wherein the claudin is expressed in cancer cells. The binder according to any one of claims 1 to 5, wherein the claudin is expressed on the surface of cancer cells. The binder according to any one of claims 1 to 6, wherein the claudin is selected from the group consisting of claudin 18.2 and claudin 6. The binder according to any one of claims 1 to 7, wherein the first binding domain binds to the extracellular domain of the claudin. The binder according to any one of claims 1 to 8, wherein the second binding domain binds to the epsilon chain of CD3. The binder according to any one of claims 1 to 9, wherein the CD3 is expressed on the surface of T cells. Binding of the binding agent to CD3 on T cells causes proliferation and / or activation of the T cells, provided that the activated T cells cause cytotoxic factors (eg, perforin and granzyme). ) Is preferably released, and cell lysis and apoptosis of cancer cells are initiated, according to any one of claims 1 to 10. The binder according to any one of claims 1 to 11, wherein the binding to claudin and / or the binding to CD3 is a specific binding. The binder according to any one of claims 1 to 12, which is in the form of a full-length antibody or antibody fragment. It comprises a set of antibody variable domains (preferably four antibody variable domains) with at least two binding domains, provided that at least one binding domain binds to claudin and at least one binding domain binds to CD3. The binder according to any one of claims 1 to 13. The variable domain (VH) of the heavy chain of immunoglobulin, which has specificity for claudin antigen (VH (CLDN)), and the variable domain of light chain of immunoglobulin (VL), which has specificity for claudin antigen. Variable domain (VL (CLDN)), variable domain of immunoglobulin heavy chain (VH), variable domain having specificity for CD3 (VH (CD3)), and variable domain of light chain of immunoglobulin (VL) ), The binding agent according to any one of claims 1 to 14, comprising a variable domain (VL (CD3)) having specificity for CD3. Any one of claims 1-15, which is a form of diabodies comprising a heavy chain variable domain linked to a light chain variable domain in the same polypeptide chain, so that these two domains are not paired. The binder according to the section. Claimed that the diabodies contain two polypeptide chains, where one polypeptide contains VH (CLDN) and VL (CD3) and the other polypeptide chain contains VH (CD3) and VL (CLDN). Item 16. The binder according to item 16. The binder according to any one of claims 1 to 15, which is a form of a bispecific single chain antibody consisting of two scFv molecules linked via a linker peptide. The heavy chain variable region (VH) and its corresponding light chain variable region (VL) are arranged from the N-terminal to the C-terminal in the order of VH (CLDN) -VL (CLDN) -VH (CD3) -VL (CD3). It is arranged in the order of VH (CD3) -VL (CD3) -VH (CLDN) -VL (CLDN) or VH (CD3) -VL (CD3) -VL (CLDN) -VH (CLDN). The binder according to claim 18. The heavy chain variable region (VH) and its corresponding light chain variable region (VL) are via a long peptide linker, preferably via a peptide linker comprising the amino acid sequence of (GGGGS) 3 or VE (GGGGS) 2GGVD. The binder according to claim 19, which is linked. 19 or 20, wherein the two VH-VL-type scFv units or VL-VH-type scFv units are linked via a short peptide linker, preferably via a peptide linker containing the amino acid sequence of SGGGGS or GGGGS. The binder described. The CLDN is CLDN 18.2, the VH (CLDN) comprises the amino acid sequence represented by SEQ ID NO: 8 or a fragment thereof, or a variant thereof, and the VL (CLDN) is a sequence. The binder according to any one of claims 15 to 21, which comprises the amino acid sequence represented by No. 15 or a fragment thereof or a variant of the amino acid sequence or fragment. The CLDN is CLDN6, the VH (CLDN) comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, or a variant thereof, and the VL (CLDN) is SEQ ID NO: 23. The binder according to any one of claims 15 to 21, which comprises the amino acid sequence represented by the above or a fragment thereof or a variant of the amino acid sequence or fragment. The VH (CD3) comprises the amino acid sequence or fragment thereof represented by SEQ ID NO: 36 or a variant of the amino acid sequence or fragment, and the VL (CD3) contains the amino acid sequence or fragment represented by SEQ ID NO: 37. The binder according to any one of claims 15 to 23, which comprises the fragment or a variant of the amino acid sequence or fragment. Claimed that the CLDN is CLDN 18.2 and the binder comprises an amino acid sequence or fragment or variant thereof selected from the group consisting of SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40 and SEQ ID NO: 41. Item 2. The binder according to any one of Items 1 to 22 and 24. 1. Claim 1 in which the CLDN is CLDN6 and the binder comprises an amino acid sequence or fragment or variant thereof selected from the group consisting of SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 and SEQ ID NO: 45. 21. The binder according to any one of 23 and 24. The cancer cells expressing CLDN18.2 are gastric cancer, esophageal cancer, pancreatic cancer, lung cancer (eg, non-small cell lung cancer (NSCLC), etc.), breast cancer, ovarian cancer, colon cancer, liver cancer, head and neck cancer. , And cancer cells of the cancer selected from the group consisting of their metastases, Krkenberg tumors, peritoneal metastases and / or lymph node metastases, any of claims 5-22, 24 and 25. The binder according to item 1. The cancer cells expressing CLDN6 include bladder cancer, ovarian cancer (particularly ovarian adenocarcinoma and ovarian malformation cancer), lung cancer (small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), but particularly , Flat epithelial lung cancer and flat epithelial lung adenocarcinoma), gastric cancer, breast cancer, liver cancer, pancreatic cancer, skin cancer (particularly basal cell cancer and flat epithelial cancer), malignant melanoma, head and neck cancer (particularly malignant polymorphism) Gonoma), sarcoma (particularly synovial sarcoma and synovial cancer sarcoma), bile duct cancer, bladder cancer (particularly transitional epithelial cancer and transitional epithelial papillary cancer), kidney cancer (particularly clear cell carcinoma and papillary carcinoma) Renal cell cancer including renal cell cancer), colon cancer, small intestinal cancer (including ileal cancer, especially small intestinal gland cancer and ileal gland cancer), testicular fetal cancer, placental chorionic villus cancer, cervical cancer, testicular cancer (Especially testicular seminoma, testicular malformations and embryonic testicular cancers), uterine cancers, embryonic cell tumors (eg, malformed cancers or embryonic cancers, especially testicular embryonic cell tumors), and their metastatic forms. The binder according to any one of claims 5 to 21, 23, 24 and 26, which is a cancer cell of cancer selected from the group consisting of. The binder according to any one of claims 1 to 28, which has an N-terminal secretory signal and / or a C-terminal histidine epitope tag (preferably a histidine 6 epitope tag). A recombinant nucleic acid encoding the binder according to any one of claims 1 to 29. 30. The recombinant nucleic acid of claim 30, which is in the form of a vector or RNA. A host cell comprising the recombinant nucleic acid according to claim 30 or 31. The binder according to any one of claims 1-29, according to claim 30 or 31, for use in treatment, in particular for use in treating or preventing cancer. The recombinant nucleic acid or the host cell according to claim 32. A pharmaceutical composition comprising the binder according to any one of claims 1 to 29, the recombinant nucleic acid according to claim 30 or 31, or the host cell according to claim 32. A method for treating or preventing a cancer disease, which comprises administering the pharmaceutical composition according to claim 34 to a patient. The binder, recombinant nucleic acid or host cell of claim 33, or the method of claim 35, wherein the cancer cell expresses a claudin to which the binder can bind. The claudin is CLDN18.2, and the cancers are gastric cancer, esophageal cancer, pancreatic cancer, lung cancer (eg, non-small cell lung cancer (NSCLC), etc.), breast cancer, ovarian cancer, colon cancer, liver. The binding agent, recombinant nucleic acid of claim 36, selected from the group consisting of cancer, head and neck cancer, cancer of the bile sac, and their metastases, Krkenberg tumors, peritoneal metastases and / or lymph node metastases. , Host cell or method. The claudin is CLDN6, and the cancers are bladder cancer, ovarian cancer (particularly ovarian adenocarcinoma and ovarian malformation cancer), lung cancer (small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC)). In particular, squamous cell lung cancer and squamous epithelial lung adenocarcinoma), gastric cancer, breast cancer, liver cancer, pancreatic cancer, skin cancer (particularly basal cell cancer and squamous cell carcinoma), malignant melanoma, head and neck cancer ( In particular, malignant polymorphic adenoma), sarcoma (particularly synovial sarcoma and synovial cancer sarcoma), bile duct cancer, bladder cancer (particularly transitional epithelial cancer and transitional epithelial papillary carcinoma), kidney cancer (particularly renal clear) Renal cell cancer including cell cancer and papillary renal cell cancer), colon cancer, small intestinal cancer (including ileal cancer, especially small intestinal adenocarcinoma and ileal gland cancer), testicular fetal cancer, placental chorionic villus cancer, offspring Palace cancer, testicular cancer (particularly testicular seminoma, testicular malformation and embryonic testicular cancer), uterine cancer, embryonic cell tumor (eg, malformed cancer or embryonic cancer, especially testicular embryonic cell tumor), and The binding agent, recombinant nucleic acid, host cell or method of claim 36, selected from the group consisting of these translocated forms.