JP2001048803A - Pharmaceutical - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a pharmaceutical which induces an antibody with peculiar high affinity strongly in vivo, enables us to evade the extinction of B-cell due to anti-IgM antibody and is useful in the prophylaxis or treatment for virus infectious disease, cancer, immunodeficiency or the like by including CD 100 or its salt. SOLUTION: This pharmaceutical is obtained by including CD 100 or its salt which is prepared by homogenizing the tissue or cell of e.g. human beings, warm-blooded animals, fishes or the like followed by extracting with acids, organic solvents or the like and purifying the resultant extract by combined methods of salting out, dialysis, gel filtration or chromatography, e.g. reversed phase chromatography, ion-exchange chromatography or the like, and contains the amino acid sequence or the like represented by the formula. Further, it is favorable that the class switch inducer for immunoglobulin contains a DNA encoding CD 100 and the dosage of CD 100 (salt) is in the range of 3.0-50 mg a day per an adult (as the body weight of 60 kg) when orally administrated.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to CD100 ([Procedures of the National Academy of
Sciences of the USA (Proc Natl Ac
ad Sci USA) 93, (1996) 11780-11785])
Also, the present invention relates to a drug useful as an immunoglobulin class switch-inducing agent, dendritic cell activator, or the like containing a salt thereof.

[0002]

2. Description of the Related Art B cells are composed of IgM, IgD, IgG, and Ig.
A, any one of the five types of antibodies, IgE, can be generated. When a B cell encounters an antigen that is first encountered in a living body as it differentiates, it first produces IgM due to its gene structure. However, the physiological function of IgM is weaker than other types of antibodies. When stimulation of the same antigen continues, the gene changes and I
Antibodies other than gM are produced and exert strong physiological functions. The action or phenomenon that this immunoglobulin changes from IgM to another type is called class switching. CD40 is a membrane glycoprotein expressed on B cells and reacts with, for example, CD40L expressed on activated T cells. CD4
It is known that in mice without 0, antibody production, class switching, and vaccine action are not observed.
Is an essential molecule for the antibody production function of B cells. C
When B cells were stimulated with D40, B cells with anti-IgM antibody
Suppression of cell death and stimulation of B cells with CD40 induces the production of various classes of antibodies, including IgM. However, it is still unknown what induces these B cell responses.

[0003]

If the death of B cells,
And if the class switch can be controlled, it will be possible to regulate the antibody production of B cells. If antibody production is required to be produced promptly, for example, cold syndrome, viruses such as influenza, bacterial diseases, etc., alone or if the antibody titer can be rapidly raised after vaccination, such diseases There is no effective treatment to date, although so far. In addition, as an immunostimulant, it is an effective treatment for cancer, infectious disease, and immunodeficiency accompanied by decreased antibody production, but there is no such treatment to date.

[0004]

Means for Solving the Problems Accordingly, the present inventors have proposed C
The gene induced by D40 was separated and obtained, and it was clarified that the molecule was CD100. In addition, CD1
00 plays a very important role in preventing B cell killing by anti-IgM antibodies and inducing class switching on B cells stimulated with activators such as CD40, IL-4 or LPS. I understood that. When CD100 binds to and forms a complex with B cells stimulated with an activator such as CD40, IL-4, or LPS, the B cells trigger a class switch and are specific high-affinity antibodies in vivo. Was found to be strongly induced. These facts indicate that CD100 itself is an effective treatment for rapidly increasing the antibody titer after vaccination against epidemic diseases such as cold syndrome and influenza. It also shows that CD100 is an immunostimulant for cancer, infectious diseases, and immunodeficiency accompanied by decreased antibody production.

That is, the present invention provides (1) an agent for inducing class switching of immunoglobulins, which contains CD100 or a salt thereof, and (2) an immunity, which contains DNA encoding CD100. A globulin class switch inducing agent, (3) a dendritic cell activator characterized by containing CD100 or a salt thereof, and (4) a dendritic cell characterized by containing a DNA encoding CD100. An activator is provided.

[0006] With respect to the CD100 in the present invention, specifically, a known CD100 or a salt thereof (Processing of the National Academy of Sciences of the USA (Proc Natl Acad Sci U U)
SA) 93, (1996) pp. 11780-11785; Journal of
Biological chemistry (Journal of Biological
Chemistry, vol.271, (1996) pp. 33376-33381], and (i) an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3. A polypeptide (hereinafter abbreviated as CD100) or a salt thereof, or (ii) one or more of the polypeptides in the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3
An amino acid sequence in which 0 or less, preferably 1 to 10 amino acids have been deleted, SEQ ID NO: 1 or SEQ ID NO:
An amino acid sequence obtained by adding (or inserting) 1 to 30 amino acids, preferably 1 to 10 amino acids to the amino acid sequence represented by 3, or SEQ ID NO: 1
Or the above-mentioned protein (i), which is a protein containing an amino acid sequence in which 1 to 30 amino acids, preferably 1 to 10 amino acids in the amino acid sequence represented by SEQ ID NO: 3 are substituted with other amino acids. Described CD100 or a salt thereof.

[0007] As used herein, “substantially identical” refers to an activity of a polypeptide or the like, for example, a ligand (CD10).
0 or a salt thereof) has substantially the same binding activity to a receptor (eg, CD72), physiological properties, and the like. Amino acid substitutions, deletions, additions or insertions often do not result in a significant change in the physiological or chemical properties of the polypeptide. Such as the so-called CD100 variant) would be substantially identical to those without such substitutions, deletions, additions or insertions. Substantially identical substitutions of amino acids in the amino acid sequence can be selected, for example, from other amino acids of the class to which the amino acid belongs. Non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline,
Examples include phenylalanine, tryptophan, methionine and the like. Glycine as a polar (neutral) amino acid
Serine, threonine, cysteine, tyrosine, asparagine, glutamine and the like. Examples of positively charged (basic) amino acids include arginine, lysine, histidine and the like. Examples of negatively charged (acidic) amino acids include aspartic acid and glutamic acid. CD72, a receptor, is available, for example, from The Journal of Immunology,
44, 4870-4877 (1990); The Journal of Immunolog
y), 149, 880-886 (1992).

[0008]

BEST MODE FOR CARRYING OUT THE INVENTION The method for producing CD100 or a salt thereof used in the present invention will be described in more detail below. The CD100 used in the present invention includes humans, warm-blooded animals (eg, guinea pigs, rats, mice, pigs, sheep, cows, monkeys, etc.) and any tissues such as fish (eg, pituitary, pancreas, brain, kidney, Liver, gonads,
Thyroid, gallbladder, bone marrow, adrenal gland, skin, muscle, lung, gastrointestinal tract, blood vessel, heart, etc.) or cells derived from cells, etc., and are the same as the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3. Alternatively, any polypeptide may be used as long as it has a substantially identical amino acid sequence. SEQ ID NO: 1 or SEQ ID NO: 3
The amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1 is about 70% or more, preferably about 80%
Above, more preferably about 90% or more, more preferably about 95% or more amino acid sequences having homology. Further, the CD100 of the present invention contains the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3, in addition to the polypeptide containing the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3. Examples include polypeptides having substantially the same activity as the polypeptide. Substantially the same activity includes, for example, receptor binding activity, antibody production activity and the like.
"Substantially the same quality" means that the receptor binding activity, the antibody production activity, and the like are substantially the same. Therefore, the quantitative factors such as the strength of the receptor binding activity and the strength of the antibody producing activity and the molecular weight of the polypeptide may be different.

In the present specification, CD100 has an N-terminus (amino terminus) at the left end and a C-terminus (carboxyl terminus) at the right end according to the convention of peptide description. For example, a polypeptide containing the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3 or the like generally has a carboxyl group (-C
OOH) or carboxylate (—COO ⁻ ), but the C-terminus may be amide (—CONH ₂ ) or ester (—COOR). Examples of R in the ester include methyl, ethyl, n
-C such as propyl, isopropyl or n-butyl
_1-6 alkyl group, C _3-8 cycloalkyl group such as cyclopentyl, cyclohexyl, phenyl, C _6-12 aryl group such as α-naphthyl, benzyl, phenethyl, phenyl-C _1-2 alkyl such as benzhydryl, or α
In addition to a C _7-14 aralkyl group such as α-naphthyl-C _1-2 alkyl such as -naphthylmethyl, a pivaloyloxymethyl group widely used as an oral ester and the like. As a salt of CD100 used in the present invention, a salt with a physiologically acceptable base (for example, an alkali metal or the like) or an acid (organic acid or inorganic acid) is used. Salts are preferred. Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg, acetic acid,
For example, salts with formic acid, propionic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, and benzenesulfonic acid are used. CD100 used in the present invention can be produced by a known method or a method analogous thereto, that is, a method of purifying a polypeptide from human or warm-blooded animal tissues or cells, or a method for synthesizing a polypeptide described below. It can also be manufactured according to it. It can also be produced by culturing a transformant containing a DNA encoding the polypeptide described below (for example, Procesings of the National Academy of Sciences of the Sciences). USA (Proc Na
tl Acad Sci USA) 93, (1996) 11780-11785
Method). When producing from tissues or cells such as humans, warm-blooded animals, fish, etc., after homogenizing the tissues or cells, such as humans, warm-blooded animals, fish, etc., extraction is performed with an acid, an organic solvent, etc. Analysis, dialysis, gel filtration,
Purification and isolation can be performed by combining chromatography such as reverse phase chromatography, ion exchange chromatography, and affinity chromatography.

As described above, the CD1 used in the present invention
00 can be produced according to a polypeptide synthesis method known per se, or by cleaving a polypeptide containing CD100 with an appropriate peptidase. As a method for synthesizing a peptide, for example, any of a solid phase synthesis method and a liquid phase synthesis method may be used. That is, the target peptide can be produced by condensing a partial peptide or amino acid capable of constituting a polypeptide with the remaining portion and, when the product has a protecting group, removing the protecting group. Known methods for condensation and elimination of protecting groups include, for example, the methods described in (1) to (4) below. M. Bodanszky and MA Ondetti, Peptide Synthesis, Interscience Publisher
s, New York (1966) Schroeder and Luebke, The Peptide,
Academic Press, New York (1965) Nobuo Izumiya et al., Fundamentals and experiments of peptide synthesis, Maruzen Co., Ltd.
(1975) Haruaki Yajima and Shunpei Sakakibara, Biochemistry Laboratory Course 1, Protein Chemistry IV, 205, (1977) Supervised by Haruaki Yajima, Development of Continuing Drugs Volume 14 Peptide Synthesis Hirokawa Shoten The polypeptide can be purified and isolated by a combination of purification methods such as solvent extraction, distillation, column chromatography, liquid chromatography, and recrystallization. When the polypeptide (CD100) obtained by the above method is a free form, it can be converted to an appropriate salt by a known method, and conversely, when the polypeptide (CD100) is obtained by a salt, the free form is obtained by a known method. Can be converted.

As the amide of CD100, a commercially available resin for peptide synthesis suitable for amide formation can be used.
Examples of such a resin include chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin, 4-methylbenzhydrylamine resin, PAM resin, and 4-hydroxymethylmethylphenyl. Acetamidomethyl resin, polyacrylamide resin, 4- (2 ', 4'-
Examples thereof include dimethoxyphenyl-hydroxymethyl) phenoxy resin and 4- (2 ′, 4′-dimethoxyphenyl-Fmocaminoethyl) phenoxy resin. Using such a resin, an amino acid having an α-amino group and a side chain functional group appropriately protected is condensed on the resin according to the sequence of the target peptide according to various condensation methods known per se. At the end of the reaction, the peptide is cleaved from the resin and, at the same time, various protecting groups are removed, and if necessary, an intramolecular disulfide bond formation reaction is carried out in a highly diluted solution to obtain a target polypeptide. For the condensation of the protected amino acids described above, various activating reagents that can be used for peptide synthesis can be used, and carbodiimides are particularly preferable. Carbodiimides include DCC, N, N'-diisopropylcarbodiimide, N-ethyl-N '-(3-dimethylaminopropyl) carbodiimide and the like. Racemization inhibitors (eg HOBT, etc.)
The protected amino acid can be added directly to the resin, or can be added to the resin after activation of the previously protected amino acid as a symmetric anhydride or HOBT ester. The solvent used for activating the protected amino acid or condensing with the resin can be appropriately selected from solvents known to be usable for the peptide condensation reaction. For example, N, N-dimethylformamide, N,
N-dimethylacetamide, acid amides such as N-methylpyrrolidone, methylene chloride, halogenated hydrocarbons such as chloroform, alcohols such as trifluoroethanol, sulfoxides such as dimethylsulfoxide, tertiary amines such as pyridine, Ethers such as dioxane and tetrahydrofuran, nitriles such as acetonitrile and propionitrile, esters such as methyl acetate and ethyl acetate, or an appropriate mixture thereof are used. The reaction temperature is appropriately selected from a range known to be usable for the peptide bond formation reaction, and is usually appropriately selected from a range of about -20 ° C to 50 ° C. The activated amino acid derivative is usually used in a 1.5 to 4-fold excess. As a result of the test using the ninhydrin reaction,
When the condensation is insufficient, sufficient condensation can be performed by repeating the condensation reaction without removing the protecting group. When a sufficient condensation cannot be obtained by repeating the reaction, the unreacted amino acid can be acetylated using acetic anhydride or acetylimidazole so as not to affect the subsequent reaction. Examples of the protecting group for the amino group of the starting amino acid include Z, Boc, tertiarypentyloxycarbonyl, isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl, Cl-
Z, Br-Z, adamantyloxycarbonyl, trifluoroacetyl, phthaloyl, formyl, 2-nitrophenylsulfenyl, diphenylphosphinothioyl, Fmoc
And the like. As a carboxyl protecting group,
For example, as R, the above-mentioned C _1-6 alkyl group, C _3-8 cycloalkyl group, C _7-14 aralkyl group, 2-adamantyl, 4-nitrobenzyl, 4-methoxybenzyl,
-Chlorobenzyl, phenacyl group and benzyloxycarbonyl hydrazide, tert-butoxycarbonyl hydrazide, trityl hydrazide and the like.
The hydroxyl groups of serine and threonine can be protected, for example, by esterification or etherification. Examples of groups suitable for the esterification include lower alkanoyl groups such as an acetyl group, aroyl groups such as a benzoyl group, and groups derived from carbon such as a benzyloxycarbonyl group and an ethoxycarbonyl group. Examples of groups suitable for etherification include a benzyl group, a tetrahydropyranyl group, and a tertiary butyl group. Examples of the protecting group for the phenolic hydroxyl group of tyrosine include Bzl, Cl ₂ -Bzl, 2-nitrobenzyl, Br
-Z, tertiary butyl and the like. The protecting groups for imidazole of histidine include Tos, 4-methoxy-
2,3,6-trimethylbenzenesulfonyl, DNP, benzyloxymethyl, Bum, Boc, Trt, Fmoc and the like. Examples of the activated carboxyl group of the raw material include the corresponding acid anhydride, azide, active ester [alcohol (eg, pentachlorophenol, 2,
4,5-trichlorophenol, 2,4-dinitrophenol,
Cyanomethyl alcohol, paranitrophenol, HON
B, N-hydroxysuccinimide, N-hydroxyphthalimide, HOBT) and the like. The activated amino group of the raw material includes, for example, a corresponding phosphoric amide.

As a method for removing (eliminating) the protecting group, for example, catalytic reduction in a hydrogen stream in the presence of a catalyst such as Pd black or Pd carbon, or hydrogen fluoride anhydride, methanesulfonic acid, trifluoromethane or the like can be used. Examples include acid treatment with dichloromethane, trifluoroacetic acid or a mixture thereof, base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine, and the like, and reduction with sodium in liquid ammonia. The elimination reaction by the above acid treatment is generally performed at a temperature of -20 ° C to 40 ° C. In the acid treatment, anisole, phenol, thioanisole, metacresol, paracresol, dimethylsulfide, 1,4-butanedithiol, , 2-
Addition of a cation scavenger such as ethanedithiol is effective. In addition, the 2,4-dinitrophenyl group used as the imidazole protecting group of histidine is removed by thiophenol treatment, and the formyl group used as the indole protecting group of tryptophan is 1,2-ethanedithiol, 1,4-butane described above. In addition to deprotection by acid treatment in the presence of dithiol or the like, it is also removed by alkali treatment with dilute sodium hydroxide, dilute ammonia or the like. The protection and protection of the functional group that should not be involved in the reaction of the raw materials, the elimination of the protective group, the activation of the functional group involved in the reaction, and the like can be appropriately selected from known groups or known means. As another method for obtaining the amide form of CD100, first, after amidating the α-carboxyl group of the carboxyl-terminal amino acid, extending the peptide chain to a desired chain length on the amino group side, and then N-terminal of the peptide chain And a peptide (or amino acid) from which only the protecting group for the carboxyl group at the C-terminus is removed, and both peptides are condensed in a mixed solvent as described above. . Details of the condensation reaction are the same as described above. After purifying the protected peptide obtained by condensation,
By removing all protecting groups by the above method, a desired crude polypeptide can be obtained. The crude polypeptide is purified by various known purification means, and the main fraction is lyophilized to obtain an amide of the desired polypeptide. In order to obtain an ester of CD100, the α-carboxyl group of the carboxy terminal amino acid is condensed with a desired alcohol to form an amino acid ester, and then an ester of the desired polypeptide is obtained in the same manner as the amide of the polypeptide. it can.

The DNA encoding CD100 used in the present invention includes SEQ ID NO: 1 or SEQ ID NO:
DNA encoding a protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by 3
Any DNA may be used as long as it contains DNA. Genomic DNA, genomic DNA library,
Any of the above-described cDNA derived from a tissue or cell, a cDNA library derived from the tissue or a cell described above, or a synthetic DNA may be used. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. In addition, R
Using the prepared NA fraction directly for Reverse Transcri
ptase Polymerase Chain Reaction (hereinafter, RT-PCR
Method). More specifically, (1) contains a DNA encoding a protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3 under stringent conditions. (2) a protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3 due to the degeneracy of the genetic code; DNA containing DNA encoding
DNA that does not hybridize with the sequence of (1) and the sequence defined in (1) but encodes a polypeptide having the same amino acid sequence is used. Hybridization can be performed according to a method known per se or a method analogous thereto. The stringent conditions include, for example, 42 ° C., 50% formamide,
4 × SSPE (1 × SSPE = 150 mM NaCl, 10 mM NaH ₂ PO
₄・ H ₂ O, 1mM EDTA pH7.4), 5 × Denhardt's solution, 0.1
% SDS. As the DNA encoding CD100, for example, a DNA containing the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 4, about 70% or more, preferably about 70% or more of the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 4 DNA containing a base sequence having a homology of 80% or more, more preferably about 90% or more, still more preferably about 95% or more is used.

The DNA encoding CD100 used in the present invention can also be produced by the following genetic engineering techniques. As a means for cloning a DNA completely encoding CD100, a target DNA is amplified from the DNA library or the like by a PCR method known per se using a synthetic DNA primer having a partial nucleotide sequence of a polypeptide, or The DNA incorporated in an appropriate vector can be selected by, for example, hybridization with a DNA fragment having a partial or entire region of the polypeptide or labeled with a synthetic DNA. Hybridization methods are described, for example, in Molecular Cloning (2nd ed .; J. Sambrook et a.
l, Cold Spring Harbor Lab. Press, 1989). When a commercially available library is used, the procedure is performed according to the method described in the attached instruction manual. CD10 used in the present invention cloned
DNA encoding 0 can be used as it is depending on the purpose, or can be used after digesting with a restriction enzyme or adding a linker, if desired. The DNA has ATG as a translation initiation codon at its 5 'end and TAA, TGA or TGA as a translation stop codon at its 3' end.
It may have AG. These translation initiation codon and translation termination codon can also be added using a suitable synthetic DNA adapter. CD100 used in the present invention
The expression vector is prepared by, for example, (a) cutting out a DNA fragment of interest from the DNA encoding CD100 used in the present invention, and (b) ligating the DNA fragment downstream of a promoter in an appropriate expression vector. Can be manufactured. As a vector, a plasmid derived from Escherichia coli (eg, pBR322, pBR325, pUC1
2, pUC13), a plasmid derived from Bacillus subtilis (eg, pU
B110, pTP5, pC194), yeast-derived plasmids (eg, pSH19, pSH15), bacteriophages such as λ phage, and animal viruses such as retrovirus, vaccinia virus, and baculovirus. The promoter to be used may be any promoter as long as it is appropriate for the host used for gene expression.

When the host used for the transformation is an animal cell, SV40-derived promoter, retrovirus promoter, metallothionein promoter, heat shock promoter, cytomegalovirus promoter, SRα promoter and the like can be used. When the host is Escherichia, Trp promoter,
T7 promoter, lac promoter, recA promoter, λPL promoter, lpp promoter, etc., when the host is Bacillus sp. , GAP promoter, ADH
One promoter, GAL promoter and the like are preferable.
When the host is an insect cell, a polyhedrin promoter, a P10 promoter and the like are preferable. In addition to the above, the expression vector may optionally include an enhancer, a splicing signal, a polyA addition signal, a selection marker,
Those containing SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori) or the like can be used. As the selection marker include dihydrofolate reductase (hereinafter sometimes abbreviated as dhfr) gene [methotrexate (MTX) resistance], ampicillin resistant gene (hereinafter sometimes abbreviated as Amp ^r),
Neomycin resistance gene (hereinafter, sometimes abbreviated as Neo, G418 resistance) and the like. In particular, CHO
When the DHFR gene is used as a selection marker using (dhfr ⁻ ) cells, selection can be made even on a thymidine-free medium. If necessary, a signal sequence suitable for the host is added to the N-terminal side of the polypeptide or its partial peptide. When the host is a bacterium belonging to the genus Escherichia, a phoA signal sequence, an OmpA signal sequence, etc., and when the host is a bacterium belonging to the genus Bacillus, an α-amylase signal sequence, a subtilisin signal sequence, etc. In some cases, such as mating factor α (MFα) signal sequence, invertase signal sequence, etc., and when the host is an animal cell, for example, insulin signal sequence, α-interferon signal sequence, antibody molecule / signal sequence, etc. Are available respectively. Using the vector containing the DNA encoding CD100 thus constructed, a transformant can be produced.

As the host, for example, Escherichia, Bacillus, yeast, insects or insect cells, animal cells and the like are used. Examples of Escherichia bacteria include Escherichia coli K12.DH1.
[Processings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), 60, 160
(1968)], JM103 [Nukuilec Acids
Research, (Nucleic Acids Research), 9, 309
(1981)], JA221 [Journal of Molecular Biolog
y)], 120, 517 (1978)], HB101
[Journal of Molecular Biology, 4
1, 459 (1969)], C600 [Genetics, 39, 440 (1954)], Escherichia coli DH10B cells [Focus 12, p19 (199)
0) Low, D, etc.] are used. Examples of Bacillus bacteria include Bacillus sacillus (Bacillus s.
ubtilis) MI114 [Gene, 24, 255 (198
3)], 207-21 [Journal of Biochemistry, 95, 87]
(1984)].

Examples of yeast include Saccharomyces cerevisiae AH22,
^{AH22R -, NA87-11A, DKD-5D} , 20
B-12 or the like is used. As insects, for example, silkworm larvae are used [Maeda et al., Nature (Natu
re), 315, 592 (1985)]. As insect cells, for example, when the virus is AcNPV, Spodoptera frugiperda cell; Sf
Cells), MG1 cells from Trichoplusia ni midgut, Tri
High Five ^TM cells from choplusia ni eggs, Mamestra br
Cells derived from assicae or cells derived from Estigmena acrea are used. When the virus is BmNPV, a silkworm-derived cell line (Bombyx mori N; BmN cell) or the like is used. As the Sf cells, for example, Sf9 cells (AT
CC CRL1711), Sf21 cells [Vaughn, JL et al.
In Vitro, Volume 13, 213-217
Page (1977)]. Examples of animal cells include monkey COS-7 cells, Vero cells, Chinese hamster cells CHO, DHFR gene-deficient Chinese hamster cells CHO (dhfr ^- CHO cells), mouse L cells, mouse 3T3 cells, mouse myeloma cells, human HEK293 cells, Human FL cells, 29
3 cells, C127 cells, BALB3T3 cells, Sp-2
/ O cells, mouse B cell line WEHI231 cells, P3U
One plasma site or the like is used. In order to transform Escherichia, for example, Procagings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci.
USA), 69, 2110 (1972) and Gene
e), Vol. 17, 107 (1982). For transformation of Bacillus sp., For example, Molecular & General Genetics, 168
Vol. 111 (1979). To transform yeast, for example, Processing of the National Academy of Sciences of the USA (Proc. Natl. Acad.
Sci. USA), 75, 1929 (1978).

To transform an insect cell or insect,
For example, Bio / Technology,
6, p. 47-55 (1988). Transformation of animal cells is described, for example, in Virology, 52, 456 (19).
73). As a method for introducing an expression vector into cells, for example, a lipofection method [Felgner, PL et al. Proceedings of the National Academy of Sciences of the USA]
nal Academy of Sciences of The United States of Am
erica), 84, 7413 (1987)], calcium phosphate method [Graham, FL and van der Eb, AJ.
Virology, 52, 456-467 (1973)], electroporation [Nuemann, E. et al.
EMBO J., Volume 1, 841-84
5 (1982)]. Thus, the DNA encoding CD100 used in the present invention
Thus, a transformant transformed with the expression vector containing is obtained. In addition, as a method for stably expressing CD100 used in the present invention using animal cells, there is a method of selecting cells in which the expression vector introduced into the animal cells has been integrated into the chromosome by clone selection.
Specifically, a transformant is selected using the above-mentioned selection marker as an index. Furthermore, a stable animal cell line having high CD100 expression ability can be obtained by repeatedly performing clonal selection on the animal cells obtained using the selectable marker. When the dhfr gene was used as a selection marker, cultivation was carried out while gradually increasing the MTX concentration, and the dhfr gene was selected by selecting a resistant strain.
Along with the gene, DNA encoding CD100 can be amplified in cells to obtain a more highly expressed animal cell line. CD100 can be produced by culturing the above transformant under conditions under which DNA encoding CD100 can be expressed, and producing and accumulating CD100. When culturing a transformant whose host is a genus Escherichia or Bacillus, a liquid medium is suitable as a medium used for the culturing, and a carbon source necessary for growth of the transformant is used therein. Nitrogen sources, inorganic substances, etc. are contained. As a carbon source, for example, glucose,
Examples of nitrogen sources such as dextrin, soluble starch, and sucrose include, for example, inorganic or organic substances such as ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract, soybean meal, potato extract, and inorganic substances such as Examples thereof include calcium chloride, sodium dihydrogen phosphate, and magnesium chloride. In addition, yeast extract, vitamins, growth promoting factors and the like may be added. The pH of the medium is preferably about 5 to 8.

As a medium for culturing the genus Escherichia, for example, M9 medium containing glucose and casamino acid [Miller, Journal of Experiments in Molecular Genetics (Journa)
l of Experiments in Molecular Genetics), 431-
433, Cold Spring Harbor Laboratory, New York 1
972] is preferred. If necessary, an agent such as 3β-indolylacrylic acid can be added in order to make the promoter work efficiently. When the host is a bacterium belonging to the genus Escherichia, the cultivation is usually carried out at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration and stirring may be added. When the host is a bacterium belonging to the genus Bacillus, the cultivation is usually carried out at about 30 to 40 ° C. for about 6 to 24 hours, and if necessary, aeration and stirring can be added. When culturing a transformant in which the host is yeast, for example, Burkholder's minimal medium [Bostian, KL et al., Processings of the National Academy.
Of Sciences of the USA (Pro
Natl. Acad. Sci. USA), 77, 4505 (1
980)] or an SD medium containing 0.5% casamino acid [Bi
tter, GA et al., The Proceedings of the National Academy of Sciences of the
USA (Proc. Natl. Acad. Sci. USA), 8
1, 5330 (1984)]. Medium p
H is preferably adjusted to about 5 to 8. Culture is usually about 2
The reaction is carried out at 0 ° C. to 35 ° C. for about 24 to 72 hours, and aeration and stirring are added as necessary.

When culturing a transformant whose host is an insect cell, Grace's Insect Medium (Grace,
TCC, Nature, 195,788 (1962)) to which an additive such as immobilized 10% bovine serum is appropriately added is used. The pH of the medium is preferably adjusted to about 6.2 to 6.4. The cultivation is usually performed at about 27 ° C. for about 3 to 5 days, and if necessary, aeration and / or stirring are added. When culturing a transformant in which the host is an animal cell, the medium may be, for example, a MEM medium containing about 5 to 20% fetal bovine serum [Seience, Vol. 122, 501 (1952)], D
MEM medium [Virology, 8, 396
(1959)], RPMI 1640 medium [Journal
The Jounal of The American Medical Association
199, 519 (1967)], 199 medium [Proceeding of The Society for the Biological Medicine (Proceeding of the Society fo
r The Biological Medicine), 73, 1 (195
0)]. Preferably, the pH is between about 6-8. The cultivation is usually performed at about 30 ° C. to 40 ° C. for about 15 to 60 hours, and if necessary, aeration or stirring is added. Especially CHO
When (dhfr ⁻ ) cells and the dhfr gene are used as selection markers, it is preferable to use a DMEM medium containing dialyzed fetal bovine serum containing almost no thymidine.

From the above culture, CD1 used in the present invention
In order to separate and purify 00, for example, the following method can be used. When CD100 used in the present invention is extracted from cultured cells or cells, the cells or cells are collected by a known method after culture, suspended in an appropriate buffer, and subjected to ultrasonication, lysozyme and / or freezing. After the cells or cells are destroyed by thawing or the like, a method of obtaining a crude extract of CD100 by centrifugation or filtration may be used as appropriate. The buffer may contain a protein denaturing agent such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100 (registered trademark, hereinafter sometimes abbreviated as TM). When CD100 used in the present invention is secreted into the culture solution, after the culture, the supernatant is separated from the cells or cells by a method known per se, and the supernatant is collected. The purification of CD100 used in the present invention contained in the culture supernatant or the extract obtained in this manner can be performed by appropriately combining separation and purification methods known per se. As these known separation and purification methods, methods utilizing solubility such as salting out and solvent precipitation,
Methods that mainly use differences in molecular weight, such as dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis, methods that use differences in charge, such as ion exchange chromatography, and affinity chromatography. Methods that utilize the specific affinity of DNA, methods that use differences in hydrophobicity such as reversed-phase high-performance liquid chromatography, and methods that use differences in isoelectric points such as isoelectric focusing or chromatofocusing. Can be

The thus obtained CD used in the present invention
When 100 is obtained in a free form, it can be converted to a salt by a method known per se or a method analogous thereto, and conversely, when 100 is obtained as a salt, it can be converted into a salt by a method known per se or a method analogous thereto Can be converted to body or other salts. In addition, CD100 used in the present invention produced by the recombinant can be arbitrarily modified or the polypeptide can be partially removed by applying an appropriate protein modifying enzyme before or after purification. .
As the protein modifying enzyme, for example, trypsin, chymotrypsin, arginyl endopeptidase, protein kinase, glycosidase and the like are used. The presence of CD100 thus generated can be measured by an enzyme immunoassay using a specific antibody or the like.

CD100 or a salt thereof, and CD10
Since the DNA encoding 0 is involved in the action of inducing a class switch, an immunoglobulin class switch-inducing agent, a dendritic cell activator, an antibody production inducer,
It can be used as an immunostimulant or the like. Therefore, CD100 or a salt thereof, and DNA encoding CD100 can be used for viral infections or diseases (cold syndrome, influenza, AIDS, hepatitis, herpes, measles, varicella, hand, foot and mouth disease, shingles, erythema infectious, rubella, sudden onset) Rash, viral conjunctivitis, viral meningitis, viral pneumonia, viral encephalitis, Lassa fever, Ebola hemorrhagic fever,
Marburg disease, Congo haemorrhagic fever, yellow fever, dengue fever, rabies, adult T-cell leukemia, rotavirus infection, polio, mumps, etc., bacterial or fungal infections or diseases (bacterial food poisoning, bacterial diarrhea, tuberculosis, Hansen) Mr. disease, dysentery, typhoid fever, cholera, paratyphoid, plague, tetanus, tularemia, brucellosis, anthrax, sepsis, bacterial pneumonia, dermatomycosis, etc., cancer (oral cancer, pharyngeal cancer, lip cancer, tongue cancer, gingival cancer) Cancer, nasopharyngeal cancer, esophageal cancer, stomach cancer, small intestine cancer,
Colon cancer including colon cancer, liver cancer, gallbladder cancer, pancreatic cancer, nasal cavity cancer, lung cancer, osteosarcoma, soft tissue cancer, skin cancer, melanoma, breast cancer, uterine cancer, ovarian cancer, prostate cancer, testicular cancer, penile cancer , Bladder cancer, kidney cancer, brain tumor, thyroid cancer, lymphoma, leukemia, etc.), immunodeficiency accompanied by reduced antibody production, and the like. For example, when there is a patient in whom CD100 is reduced or deficient in a living body, (a) administering DNA encoding CD100 to the patient and expressing CD100 in the living body, Is inserted into the patient after expression of CD100, and the cells are transplanted into the patient, or (c) administering CD100 to the patient, such as by administering CD100 to the patient.
Role can be fully or normally exerted. When the DNA encoding CD100 is used as the above-mentioned therapeutic or prophylactic agent, the DNA may be used alone or after insertion into an appropriate vector such as a retrovirus vector, adenovirus vector, adenovirus associated virus vector, and the like, followed by conventional means. , Human or warm-blooded animals. The DNA encoding CD100 can be administered as it is or in the form of a formulation together with a physiologically acceptable carrier such as an auxiliary for promoting uptake, and can be administered using a gene gun or a catheter such as a hydrogel catheter.

When CD100 or a salt thereof is used as a medicament, it can be carried out in a conventional manner. For example, a sugar-coated or enteric-coated tablet as required, a capsule, a elixir, orally as a microcapsule, or a sterile solution with water or another pharmaceutically acceptable liquid, Alternatively, it can be used parenterally in the form of injections such as suspensions. For example, the CD100
Or a pharmaceutical composition by admixing a salt thereof with a physiologically acceptable carrier, flavoring agent, excipient, vehicle, preservative, stabilizer, binder and the like in a unit dosage form generally required for pharmaceutical practice. Things can be manufactured. The amount of the active ingredient in these preparations is such that an appropriate dose in the specified range can be obtained.

Examples of additives that can be incorporated into tablets, capsules and the like include binders such as gelatin, corn starch, tragacanth gum, gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid and the like. And a lubricating agent such as magnesium stearate, a sweetening agent such as sucrose, lactose or saccharin, a flavoring agent such as peppermint, reddish oil or cherry, and the like. When the preparation unit form is a capsule, a liquid carrier such as oil and fat can be further contained in the above-mentioned type of material. Sterile compositions for injection can be formulated according to normal pharmaceutical practice such as dissolving or suspending the active substance in vehicles such as water for injection, naturally occurring vegetable oils such as sesame oil, coconut oil and the like. .

Examples of the aqueous liquid for injection include physiological saline, isotonic liquid containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.). You may use together with a solubilizing agent, for example, alcohol (for example, ethanol), polyalcohol (for example, propylene glycol, polyethylene glycol), nonionic surfactant (for example, polysorbate 80 ( ^TM ), HCO-50).
The oily liquid includes sesame oil, soybean oil and the like, and may be used in combination with solubilizers such as benzyl benzoate and benzyl alcohol.

Also, a buffer (for example, a phosphate buffer,
Sodium acetate buffer), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, human serum albumin, polyethylene glycol, etc.), preservatives (eg, benzyl alcohol, phenol, etc.), antioxidants And the like. The prepared injection is usually filled in a suitable ampoule.

Since the preparation thus obtained is safe and has low toxicity, for example, humans and mammals (eg, mouse, rat, guinea pig, rabbit, sheep, pig, cow, cat, dog, monkey, chimpanzee, etc.) Can be administered. The dose of CD100 or a salt thereof varies depending on the symptoms and the like, but in the case of oral administration, generally, for an adult (with a body weight of 60 kg), about 0.1 to 1000 mg, preferably about 1.0 to 1000 mg per day is used. To 300 mg, more preferably about 3.0 to 50 mg. In the case of parenteral administration, the single dose varies depending on the administration subject, target organ, symptoms, administration method, and the like. For example, in the case of administration to an adult (with a body weight of 60 kg) in the form of an injection, one dose may be used. About 0.01 to 3 per day
It is convenient to administer about 0 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg by intravenous injection. For other animals, 60
An amount converted per kg can be administered.

[Non-human animal in which CD100 gene is knocked out] A non-human animal in which the CD100 gene is knocked out (hereinafter sometimes referred to as a CD100 gene-deficient non-human animal) is a non-human animal having an inactivated CD100 gene sequence. It can be produced using human animal ES cells. Non-human animal ES having the inactivated CD100 gene sequence
A cell is a CD100 gene of a non-human animal ES cell that is artificially mutated to suppress the gene expression ability or to encode a CD encoded by the gene.
The gene refers to an ES cell of a non-human animal in which the gene is substantially incapable of expressing CD100 by substantially eliminating the activity of CD100 (hereinafter, may be referred to as a knockout gene). CD as a non-human animal
Any animal other than a human having 100 genes may be used, but a non-human mammal is preferred. As non-human mammals, for example, cows, pigs, sheep, goats,
Rabbits, dogs, cats, guinea pigs, hamsters, mice, rats and the like are used. Among non-human mammals, the ontogeny and biological cycle are relatively short from the viewpoint of creating a disease animal model system, and rodents, particularly mice, which are easy to breed (for example, C57BL as a pure strain,
/ 6 line, DBA2 line, etc.
F1 system, BDF1 system, B6D2F1 system, BALB
/ C strain, ICR strain, etc.) or rat (eg, W
istar, SD, etc.) are particularly preferred. CD10
The zero gene may be a genome-derived CD100 gene isolated and extracted from an animal, or a CD100c cloned using a genetic engineering technique.
It may be DNA. Specifically, as the gene for the mouse-derived CD100 protein having the amino acid sequence represented by SEQ ID NO: 1, for example, a gene having the base sequence represented by SEQ ID NO: 2 is used, and the gene represented by SEQ ID NO: 3 is used. -Derived CD having amino acid sequence
As a gene for 100 proteins, for example, SEQ ID NO: 4
A gene having a base sequence represented by is used. These genes can be obtained according to the method described above.

As a method for artificially mutating the CD100 gene, for example, it can be carried out by deleting a part or all of the gene sequence and inserting or substituting another gene by genetic engineering techniques. By these mutations, for example, a knockout gene of CD100 can be prepared by shifting the codon reading frame or disrupting the function of the promoter or exon. Specific examples of non-human animal embryonic stem cells having an inactivated CD100 gene sequence (hereinafter abbreviated as CD100 gene inactivated ES cells or knockout ES cells) include, for example, drug resistance genes (eg, neomycin resistance gene, hygromycin) And a reporter gene (for example, lacZ (β-galactosidase gene), cat (chloramphenicol acetyltransferase gene)), preferably lacZ.
Or the insertion of a DNA sequence that terminates gene transcription (eg, a polyA addition signal) into the introns between exons to synthesize complete messenger RNA. By eliminating the DNA strand, a DNA strand having a DNA sequence constructed so as to eventually destroy the gene (hereinafter, referred to as a DNA strand)
Abbreviated as targeting vector). When a reporter gene is inserted to disrupt the function of an exon, the reporter gene is preferably inserted so as to be expressed under the control of the CD100 promoter. Furthermore, a DNA strand having a DNA sequence constructed so as to disrupt the gene is introduced into the chromosome of the animal by, for example, homologous recombination, and the obtained ES cell is probed with a DNA sequence on or near the CD100 gene. The DNA sequence on the targeting vector and the DNA sequence of the neighboring region other than the CD100 gene used for the preparation of the targeting vector were analyzed by PCR using primers as primers,
It can be obtained by selecting knockout ES cells.

The ES cells from which the CD100 gene is inactivated by the homologous recombination method or the like include, for example,
You may use the one already established as mentioned above,
It may be newly established according to the method of Evans and Kaufma. For example, in the case of mouse ES cells, currently, 129 line ES cells are generally used. However, since the immunological background is not clear, a pure line instead of this is used as an immunological genetic background. For example, C57BL / 6 mice or C57BL /
BDF1 mice (F57 of C57BL / 6 and DBA / 2
Those established using 1) can also be used favorably. BD
The F1 mouse has the advantage that the number of eggs collected is large and the eggs are robust, and further, since the C57BL / 6 mouse is used as a background, the ES cells obtained by using the C57BL / 6 mouse are It can be advantageously used in that the genetic background can be replaced by C57BL / 6 mice by backcrossing with C57BL / 6 mice. Also, E
When S cells are established, blastocysts 3.5 days after fertilization are generally used. In addition, a large number of initial cells can be efficiently obtained by collecting an 8-cell stage embryo and culturing the blastocysts until use. Embryos can be obtained. Either male or female ES cells may be used, but generally male ES cells are more convenient for producing a germline chimera. It is also desirable to discriminate between males and females as soon as possible in order to reduce cumbersome culture labor. As a method for determining the sex of ES cells, for example, a method of amplifying and detecting a gene in the sex-determining region on the Y chromosome by PCR can be mentioned. By using this method, the number of ES cells of about 1 colony (about 50 cells) is sufficient, whereas the conventional method required about 10 ⁶ cells for karyotype analysis. The primary selection of ES cells in the early stage can be performed by discriminating between male and female, and by enabling selection of male cells at an early stage, labor in the initial stage of culture can be greatly reduced.

The secondary selection can be performed, for example, by confirming the number of chromosomes by the G-banding method. The number of chromosomes in the obtained ES cells is desirably 100% of the normal number. However, when it is difficult due to physical operations or the like at the time of establishment, after knocking out the gene of the ES cells, the cells can be knocked out of normal cells (for example, chromosome in mice). Number is 2n
= Cells). The embryonic stem cell line obtained in this way usually has very good growth properties, but must be carefully subcultured because it tends to lose its ontogenetic ability. For example, on a suitable feeder cell such as STO fibroblast, in a carbon dioxide incubator (preferably 5% carbon dioxide, 95% air or 5%) in the presence of LIF (1-10000 U / ml).
% Oxygen, 5% carbon dioxide gas, 90% air) at about 37 ° C., and at the time of subculture, for example, trypsin / EDTA solution (usually 0.001-0.5% trypsin / 0.5%). 1-5 mM EDTA, preferably about 0.1% trypsin / 1 mM EDTA) treatment to form a single cell,
A method of seeding on newly prepared feeder cells is used. Such passage is usually performed every 1-3 days. At this time, cells are observed, and if morphologically abnormal cells are found, it is desired that the cultured cells be discarded. ES cells are differentiated into various types of cells, such as parietal, visceral, and cardiac muscles, by monolayer culture up to high density or suspension culture until cell clumps are formed under appropriate conditions. (M.
J. Evans and MH Kaufman, Nature 2
92, 154, 1981; GR Martin Proceedings of National Academy of Science USA (Proc. Natl. Acad. Sci. USA)
78, 7634, 1981; TC Doetschman et al., Journal of Embryology and Experimental Morphology, 87, 27, 1985], E
Cells deficient in CD100 gene expression obtained by differentiating S cells are useful in cell biology of CD100 in vitro.

A transgenic non-human animal having an inactivated CD100 gene sequence (hereinafter sometimes referred to as a gene expression-deficient non-human animal) includes, for example, a non-human animal embryo having the above-described inactivated CD100 gene sequence. It is created by genetic engineering using stem cell-derived cells, and is, for example, a non-human animal in which the inactivated CD100 gene sequence has been introduced into germ cells and somatic cells at an early stage of embryogenesis. As the non-human animal, the same one as described above is used. To knock out the CD100 gene,
The above-mentioned targeting vector is introduced into mouse embryonic stem cells or mouse egg cells, and the inactivated CD100 gene sequence of the targeting vector is replaced with the CD100 gene on the chromosome of mouse embryonic stem cells or mouse egg cells by gene homologous recombination. be able to. Cells in which the CD100 gene was knocked out were subjected to Southern hybridization analysis using a DNA sequence on or near the CD100 gene as a probe or a DNA sequence derived from a mouse used for the targeting vector.
It can be determined by analysis by PCR using a DNA sequence of a nearby region other than the gene as a primer. When non-human animal embryonic stem cells are used, a cell line in which the CD100 gene has been inactivated is cloned by homologous recombination, and the cells are cloned at an appropriate time in the early stage of embryogenesis, for example, at the 8-cell stage. The chimeric embryo is injected into a human animal embryo or blastocyst, and the resulting chimeric embryo is implanted into the uterus of the pseudopregnant non-human animal. The produced animal is a chimeric animal composed of both cells having a normal CD100 locus and cells having an artificially mutated CD100 locus. When a part of the germ cells of the chimeric animal has a mutated CD100 locus, all tissues were artificially mutated from a population obtained by crossing such a chimeric individual with a normal individual. It can be obtained by selecting individuals composed of cells having the CD100 locus, for example, by judging coat color or the like. The individual obtained in this manner is usually an individual having a defective expression of CD100,
100 heterozygous expression-deficient individuals can be crossed to obtain CD100 homoexpression-deficient individuals from their offspring.
When using an egg cell, for example, a transgenic non-human animal having a targeting vector introduced into a chromosome can be obtained by injecting a gene solution into the egg cell nucleus by a microinjection method, and these transgenic non-human animals can be obtained. In comparison with the above, it can be obtained by selecting those having a mutation at the CD100 locus by homologous recombination. Non-human animals deficient in CD100 gene expression can be distinguished from normal animals by measuring the mRNA levels of the animals using known methods and indirectly comparing the expression levels.

[0034] In the individual in which the CD100 gene has been knocked out in this manner, animal individuals obtained by mating can confirm that the gene has been knocked out and can be subcultured in a normal breeding environment. . Furthermore, the germ line can be obtained and maintained according to a conventional method. That is, by crossing male and female animals having the inactivated gene sequence, a homozygote animal having the inactivated gene sequence on both homologous chromosomes can be obtained. The obtained homozygous animal can be efficiently obtained by rearing the mother animal in such a manner that one homozygote and one normal animal are obtained. By mating male and female heterozygous animals, homozygous and heterozygous animals having the inactivated gene sequence can be bred and passaged. The progeny of the animal having the inactivated gene sequence thus obtained is also included in the non-human animal deficient in CD100 gene expression. Such non-human animal embryonic stem cells in which the CD100 gene has been inactivated are extremely useful for producing a non-human animal deficient in CD100 gene expression. The non-human animal deficient in CD100 gene expression produced as described above has a reduced ability to produce antibodies to the TD (T cell-dependent) antigen (Example 5 described later), T cell proliferation, IL-4
Non-human animal with loss of T cell reactivity such as ability to produce INF-γ (Example 6 described below) and dendritic cell such as IL-12 productivity (Example 9 described below) And diseases caused by CD100 deficiency, for example, CD1
Diseases resulting from inactivation of the biological activity of CD100, based on the loss of various biological activities that can be induced by 00.
For example, viral infections or diseases (cold syndrome, influenza, AIDS, hepatitis, herpes, measles,
Chickenpox, hand-foot-and-mouth disease, shingles, erythema contagiosus, rubella, idiopathic rash, viral conjunctivitis, viral meningitis, viral pneumonia, viral encephalitis, Lassa fever, Ebola hemorrhagic fever, Marburg disease, Congo hemorrhagic fever, yellow fever , Dengue, rabies, adult T-cell leukemia (ATL), rotavirus infection, polio, mumps, etc., bacterial or fungal infections or diseases (bacterial food poisoning, bacterial diarrhea, tuberculosis, leprosy, dysentery, typhoid fever) , Cholera, paratyphoid, plague, tetanus, tularemia, brucellosis, anthrax, sepsis, bacterial pneumonia, dermatomycosis, etc., cancer (oral cancer, pharyngeal cancer, lip cancer, tongue cancer, gingival cancer, nasopharyngeal cancer, Esophageal cancer, gastric cancer,
Colorectal cancer including small intestine cancer, colon cancer, liver cancer, gallbladder cancer, pancreatic cancer, nasal cavity cancer, lung cancer, osteosarcoma, soft tissue cancer, skin cancer, melanoma, breast cancer, uterine cancer, ovarian cancer, prostate cancer, testicular cancer , Penis cancer, bladder cancer, kidney cancer, brain tumor, thyroid cancer, lymphoma, leukemia, etc.) and immunodeficiency with decreased antibody production, and is useful for investigating the causes of these diseases and studying treatment methods. . That is, the non-animals deficient in CD100 gene expression can be used for screening for a preventive / therapeutic agent for the disease.

Examples of the non-human animal deficient in CD100 gene expression used in screening for a prophylactic / therapeutic agent for the above-mentioned diseases include those described above. Test compounds include, for example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, and the like. Or a known compound. Specifically, a non-human animal deficient in CD100 gene expression is treated with a test compound and compared with a non-treated control animal.・ The effect of treatment can be tested. As a method of treating a test animal with a test compound, for example, oral administration, intravenous injection and the like are used, and it can be appropriately selected according to the symptoms of the test animal, the properties of the test compound, and the like. In addition, the dose of the test compound can be appropriately selected according to the administration method, properties of the test compound, and the like. For example, when screening for a prophylactic / therapeutic agent for cancer, after administering, for example, keyhole limpet hemocyanin to a non-human animal lacking CD100 gene expression,
A test substance can be screened by administering the test substance to the peritoneal cavity, subcutaneously, intravenously or the like over time, and measuring the amount of interferon gamma or IL-12 in the blood. In addition, screening can be performed by implanting a tumor into the abdominal cavity, subcutaneously, or intravenously, administering a test substance to the peritoneal cavity, subcutaneously, intravenously, or the like over time, and measuring the tumor volume or survival period.

The prophylactic / therapeutic agent obtained by the screening method using a non-human animal in which the CD100 gene has been knocked out is a compound selected from the above-mentioned test compounds, and has a prophylactic / therapeutic effect on a disease caused by CD100 deficiency. It is useful as a safe and low-toxicity therapeutic or prophylactic drug for diseases caused by CD100 deficiency. Further, a compound derived from the compound can also be used. The compound obtained by the screening method may form a salt, and the salt of the compound is preferably a physiologically acceptable acid addition salt. Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) Acids, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used.

When a compound or a salt thereof obtained by a screening method using a non-human animal in which the CD100 gene has been knocked out is used as the above-mentioned therapeutic or prophylactic agent, it can be carried out according to a conventional method.
Sugar-coated tablets, capsules, elixirs, microcapsules, and the like, as necessary, orally, or sterile solutions with water or other pharmaceutically acceptable liquids, or suspensions, etc. It can be used parenterally in the form of injections. For example, the compound or a salt thereof is mixed with physiologically acceptable carriers, flavors, excipients, vehicles, preservatives, stabilizers, binders and the like in a unit dosage form required for generally accepted pharmaceutical practice. Can be manufactured. The amount of the active ingredient in these preparations is such that an appropriate dose in the specified range can be obtained. Examples of additives that can be mixed with tablets, capsules, and the like include binders such as gelatin, corn starch, tragacanth, and acacia, excipients such as crystalline cellulose, corn starch, gelatin, and alginic acid. Useful bulking agents, lubricants such as magnesium stearate, sweeteners such as sucrose, lactose or saccharin, flavoring agents such as peppermint, reddish oil or cherry and the like are used. When the preparation unit form is a capsule, a liquid carrier such as oil and fat can be further contained in the above-mentioned type of material. Sterile compositions for injection can be formulated according to normal pharmaceutical practice such as dissolving or suspending the active substance in vehicles such as water for injection, and naturally occurring vegetable oils such as sesame oil, coconut oil and the like.

Examples of aqueous solutions for injection include physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.). Auxiliaries, for example, alcohols (eg, ethanol and the like), polyalcohols (eg, propylene glycol, polyethylene glycol and the like), nonionic surfactants (eg, polysorbate 80TM, HCO-50 and the like) may be used in combination. . As the oily liquid, for example, sesame oil, soybean oil, and the like, and benzyl benzoate as a solubilizer,
You may use together with benzyl alcohol etc. In addition, buffers (eg, phosphate buffer, sodium acetate buffer, etc.), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, human serum albumin, polyethylene glycol, etc.), Preservatives (for example,
Benzyl alcohol, phenol, etc.), antioxidants and the like. The prepared injection is usually filled in a suitable ampoule. The preparations obtained in this way are safe and low toxic, for example, human or warm-blooded animals (eg, mouse, rat, rabbit, sheep, pig, cow, horse, bird, cat, dog, monkey, chimpanzee, etc.) ) Can be administered. The dose of the compound or a salt thereof varies depending on symptoms and the like, but in the case of oral administration, generally, in an adult (with a body weight of 60 kg), about 0.1 to 100 mg, preferably about 1. 0 to 50 mg, more preferably about 1.0 to 20 mg
It is. In the case of parenteral administration, the single dose varies depending on the administration subject, target organ, symptoms, administration method and the like. It is convenient to administer about 0.01 to 30 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg by intravenous injection. In the case of other animals, the dose can be administered in terms of 60 kg.

Furthermore, the present invention provides a method for screening a compound or a salt thereof which promotes or inhibits CD100 promoter activity, comprising administering a test compound to a CD100 gene-deficient non-human animal and detecting the expression of a reporter gene. About the method. The non-human animal deficient in CD100 gene expression used in the screening method includes, among the non-human animals deficient in CD100 gene expression described above, a CD100 gene sequence inactivated by introducing a reporter gene, Can be expressed under the control of the CD100 promoter. Examples of the test compound include the same compounds as described above. As the reporter gene, the same one as described above is used, and the β-galactosidase gene (lacZ) is more preferably used. CD10
CD1 in which 0 structural gene is replaced by a reporter gene
In the 00-expressing animal, since the reporter gene is under the control of the CD100 promoter, by tracing the expression of the substance encoded by the reporter gene,
The activity of 100 promoters can be detected.

For example, when a part of the gene region encoding CD100 is replaced with a β-galactosidase gene (lacZ) derived from Escherichia coli, β-galactosidase is expressed instead of CD100 in a tissue that originally expresses CD100. I do. Thus, for example, 5-bromo-4-
Chloro-3-indolyl-β-galactopyranoside (X
By staining with a reagent serving as a substrate for β-galactosidase such as -gal), the expression state of CD100 in an animal body can be easily observed.
Specifically, a CD100-deficient mouse or a tissue section thereof is fixed with glutaraldehyde or the like, washed with Dulbecco's phosphate buffered saline (PBS), and then stained with X-gal at room temperature or around 7 ° C. After reacting for about 30 minutes to 1 hour, the tissue specimen was diluted with 1 mM EDTA / PBS.
By washing with a solution, the β-galactosidase reaction may be stopped and the color may be observed. Further, mRNA encoding lacZ may be detected according to a conventional method.
Thus, a non-human animal deficient in CD100 gene expression is
It is extremely useful in screening for a compound or a salt thereof that promotes or inhibits and inactivates the CD100 promoter, and can greatly contribute to the investigation of the causes of various diseases caused by CD100 expression deficiency or the development of preventive / therapeutic agents.

The compound or a salt thereof obtained by using the above-mentioned screening method is a compound selected from the above-mentioned test compounds and a compound that promotes or inhibits the CD100 promoter activity. The compound or its salt that promotes CD100 promoter activity can promote the expression of CD100 and enhance the function of CD100. Thus, for example, infection or disease caused by a virus (cold syndrome, influenza, AIDS, hepatitis, herpes, Measles, varicella, hand-foot-and-mouth disease, shingles, erythema contaminated, rubella, sudden rash, viral conjunctivitis, viral meningitis, viral pneumonia, viral encephalitis, Lassa fever, Ebola hemorrhagic fever,
Marburg disease, Congo haemorrhagic fever, yellow fever, dengue, rabies, adult T-cell leukemia (ATL), rotavirus infection, polio, mumps, etc., bacterial or fungal infections or diseases (bacterial food poisoning, bacterial diarrhea, Tuberculosis, leprosy, dysentery, typhoid fever, cholera, paratyphoid, plague, tetanus, tularemia, brucellosis, anthrax, sepsis, bacterial pneumonia, cutaneous mycosis, etc., cancer (oral cancer, pharyngeal cancer, lip cancer, tongue) Cancer, gingival, nasopharyngeal, esophageal, gastric,
Colorectal cancer including small intestine cancer, colon cancer, liver cancer, gallbladder cancer, pancreatic cancer, nasal cavity cancer, lung cancer, osteosarcoma, soft tissue cancer, skin cancer, melanoma, breast cancer, uterine cancer, ovarian cancer, prostate cancer, testicular cancer , Penile cancer, bladder cancer, kidney cancer, brain tumor, thyroid cancer, lymphoma, leukemia, etc.), and immunosuppressive diseases associated with reduced antibody production. . On the other hand, compounds or salts thereof that inhibit the CD100 promoter activity can inhibit the expression of CD100 and inhibit the function of CD100.
For example, diseases caused by abnormal or excessive antibody production (eg, atopic asthma, allergic rhinitis, atopic dermatitis, allergic bronchitis, pulmonary aspergillosis, parasitic disease, Kimura's disease, high IgE syndrome, Wiscott-Aldrich syndrome, thymic dysplasia, Hodkin's disease, cirrhosis, acute hepatitis, rheumatoid arthritis, insulin-dependent diabetes, systemic lupus erythematosus, scleroderma, infertility, endometriosis, autoimmune thyroid Diseases Myasthenia gravis, Hashimoto's disease, Basedow's disease,
Pernicious anemia, Addison's disease, male infertility, multiple sclerosis, Goodpasture syndrome, pemphigus, pemphigoid, myasthenia gravis, lens ophthalmitis, sympathetic ophthalmitis, autoimmune hemolytic anemia, idiopathic platelets Safety against various diseases such as hypoxia, autoimmune leukopenia, Felty syndrome, autoimmune lymphopenia, ulcerative colitis, Sjogren's syndrome, systemic autoimmune disease, primary biliary cirrhosis, and lupoid hepatitis It is useful as a low-toxic therapeutic or prophylactic agent. When a compound or a salt thereof obtained by the above-mentioned screening method is used as the above-mentioned therapeutic / prophylactic agent, it can be carried out in the same manner as described above.

[CD100 transgenic animal] Exogenous CD
DNA incorporating 100 genes or its mutant gene
Transgenic non-human animal having
00 transgenic animal) is preferably used for the non-fertilized egg, the fertilized egg, the germ cell including the sperm and its progenitor cells, etc. At the stage of single cells or fertilized egg cells and generally before the 8 cell stage), calcium phosphate method, electric pulse method, lipofection method, aggregation method, microinjection method, particle gun method, DE
Target CD100 by AE-dextran method or the like
It can be created by transferring a gene.
In addition, the CD100 gene transfer method allows for exogenous CD100 targeted on somatic cells, organs of living organisms, tissue cells, and the like.
The gene can be transferred and used for cell culture, tissue culture, and the like. Furthermore, CD10 can be obtained by fusing these cells with the above-mentioned germ cells by a cell fusion method known per se.
0 transgenic animals can also be created.

As the non-human animal, the same one as described above is used. The exogenous CD100 gene is not a CD100 gene existing in the body of a non-human animal, but a CD100 gene once isolated and extracted from an animal, or a C100 gene cloned using genetic engineering techniques.
D100 cDNA or the like is used. Specifically, a gene having the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 4 is used. Examples of the mutant gene of the CD100 gene (hereinafter, abbreviated as mutant CD100 gene) include those in which the base sequence of the original CD100 gene has a mutation (eg, mutation), specifically,
CDs with base additions, deletions, substitutions with other bases, etc.
100 genes and the like, and also includes an abnormal gene of the CD100 gene (hereinafter abbreviated as abnormal CD100 gene). The abnormal CD100 gene means a CD100 gene that expresses abnormal CD100, for example, CD1 that suppresses the function of normal CD100.
For example, a CD100 gene that expresses 00 is used.
The exogenous CD100 gene may be derived from an animal of the same or different species as the animal of interest. The DNA incorporating the exogenous CD100 gene or its mutant gene may be any DNA as long as it contains the exogenous CD100 gene or its mutant gene. In transferring the CD100 gene to a target animal, it is generally advantageous to use the CD100 gene as a DNA construct linked downstream of a promoter capable of expressing the same in animal cells. For example, when transferring the human CD100 gene, various non-human animals having the CD100 gene having a high homology to the human CD100 gene (for example,
Rabbits, dogs, cats, cats, guinea pigs, hamsters, rats, mice, etc.). For example, microinjection into a mouse fertilized egg can produce a CD100 transgenic animal that highly expresses the CD100 gene.

Examples of the CD100 expression vector include a plasmid derived from Escherichia coli, a plasmid derived from Bacillus subtilis, a plasmid derived from yeast, a bacteriophage such as λ phage, a retrovirus such as Moloney leukemia virus, an animal virus such as vaccinia virus or baculovirus. Are used. Among them, a plasmid derived from Escherichia coli, a plasmid derived from Bacillus subtilis or a plasmid derived from yeast are preferably used. Examples of the promoter for regulating the expression of the CD100 gene include, for example,
Promoters derived from viruses (eg, Simian virus, cytomegalovirus, Moloney leukemia virus, JC virus, breast cancer virus, poliovirus, etc.);
As those derived from various animals (human, rabbit, dog, cat, guinea pig, hamster, rat, mouse, etc.) and birds (chicken, etc.), albumin, insulin I
I, uroplakin II, elastase, erythropoietin, endothelin, muscle creatine kinase, glial fibrillary acidic protein, glutathione S-transferase, platelet-derived growth factor β, keratins K1, K10 and K14, collagen types I and II, cyclic AMP dependent Protein kinase βI subunit, dystrophin, tartrate-resistant alkaline phosphatase, atrial natriuretic factor, endothelial receptor tyrosine kinase (commonly abbreviated as Tie2), sodium potassium adenosine 3 kinase (Na, K-ATP)
ase), neurofilament light chain, metallothionein I and IIA, metalloproteinase 1 tissue inhibitor, MHC class I antigen (H-2L), H-ra
s, renin, dopamine β-hydroxylase, thyroid peroxidase (TPO), polypeptide chain elongation factor 1α
(EF-1α), β actin, α and β myosin heavy chains, myosin light chains 1 and 2, myelin basic protein, thyroglobulin, Thy-1, immunoglobulin, H
Chain variable region (VNP), serum amyloid P component, myoglobin, troponin C, smooth muscle α-actin,
Although promoters such as preproenkephalin A and vasopressin are used, preferably, a cytomegalovirus promoter capable of high expression throughout the body, a promoter of human polypeptide chain elongation factor 1α (EF-1α), human and chicken β-actin A promoter or the like can be used. In addition, an insulin promoter, an albumin promoter, an immunoglobulin promoter, and the like, which can be highly expressed in a specific organ or tissue, can also be used.

The above vector preferably has a sequence that terminates transcription of the messenger RNA of interest in the transgenic animal of CD100 (generally called terminator). For example, it is derived from viruses, various mammals and birds. The sequence of each CD100 gene can be used, and preferably, the simian virus SV4
Zero terminator or the like is used. Other, target CD1
In order to further express the 00 gene, a gene splicing signal, an enhancer region such as an immunoglobulin gene, a part of an intron of a eukaryotic cell gene, etc. are placed 5 'upstream of the promoter region, between the promoter region and the translation region, or in translation. Linking 3 ′ downstream of the region is also possible depending on the purpose. The normal CD100 translation region can be derived from liver, kidney, thyroid cells, fibroblast-derived DNA from various animals (eg, rabbits, dogs, cats, guinea pigs, hamsters, rats, mice, humans, etc.), and various commercially available genomic live cells. All or part of the genomic gene from the rally, or liver, kidney, thyroid cells,
A complementary CD100 gene prepared from fibroblast-derived RNA by a known method can be obtained as a raw material. In addition, the exogenous abnormal CD100 gene can be prepared by mutating the translated region of normal CD100 obtained from the above cells or tissues by a point mutagenesis method. The translation region can be prepared as a DNA construct that can be expressed in a transgenic animal by a conventional genetic engineering technique in which it is ligated downstream of the above promoter and, if desired, upstream of the transcription termination site. Transfer of the CD100 gene at the fertilized egg cell stage is ensured to be present in all germ cells and somatic cells of the subject animal. The presence of the CD100 gene in the germ cells of the produced animal after the CD100 gene transfer means that all progeny of the produced animal will retain the CD100 gene in all of their germ cells and somatic cells. C
The progeny of this type of animal that has inherited the D100 gene have the CD100 gene in all of its germ and somatic cells.

The non-human animal to which the exogenous normal CD100 gene has been transferred can be subcultured in a normal breeding environment as a CD100 gene-carrying animal after confirming that the CD100 gene is stably maintained by mating. . Transfer of the CD100 gene at the fertilized egg cell stage is ensured to be present in excess in all germ cells and somatic cells of the subject animal. The excessive presence of the CD100 gene in the germ cells of the produced animal after the CD100 gene transfer means that the offspring of the produced animal have the CD100 gene in all of its germ cells and somatic cells in excess. Progeny of this type of animal that has inherited the CD100 gene have an excess of the CD100 gene in all of its germ and somatic cells. By obtaining a homozygous animal having the introduced CD100 gene on both homologous chromosomes and mating the male and female animals, all offspring can be bred to have the CD100 gene in excess.
A transgenic non-human animal having a DNA incorporating the exogenous CD100 gene or its mutant gene obtained as described above has a non-human animal in which T cell interferon gamma production ability and proliferation are increased and T cell reactivity is enhanced. It is a human animal (Example 10 described later). Normal CD10
The non-human animal having the 0 gene has a high expression of the normal CD100 gene, and may eventually develop CD100 hyperactivity by promoting the function of the endogenous normal CD100 gene. Can be used as an animal. For example, using normal CD100 transgenic animals, CD100 hyperfunction, CD1
00-related diseases, such as diseases caused by abnormal or excessive antibody production (eg, atopic asthma,
Allergic rhinitis, atopic dermatitis, allergic bronchitis, pulmonary aspergillosis, parasitic disease, Kimura's disease, high IgE syndrome, Wiskott-Aldrich
Syndrome, thymic dysplasia, Hodkin's disease, cirrhosis, acute hepatitis, rheumatoid arthritis, insulin-dependent diabetes, systemic lupus erythematosus, scleroderma, infertility, endometriosis, autoimmune thyroid disease, myasthenia gravis, Hashimoto's disease, B
asedow disease, pernicious anemia, Addison disease, male infertility, multiple sclerosis, Goodpasture syndrome,
Pemphigus, pemphigoid, myasthenia gravis, lens ophthalmitis, sympathetic ophthalmitis, autoimmune hemolytic anemia, idiopathic thrombocytopenia,
Pathological mechanisms of various diseases such as autoimmune leukopenia, Felty syndrome, autoimmune lymphopenia, ulcerative colitis, Sjogren's syndrome, systemic autoimmune disease, primary biliary cirrhosis, and rupioid hepatitis It is possible to elucidate and examine treatment methods for these diseases. In addition, the animal in which the exogenous normal CD100 gene has been transferred,
Because of having an increase in free CD100, the CD
It can also be used for screening tests for therapeutic drugs for 100-related diseases. For example, it is possible to perform screening for an inhibitor by inoculating the mouse with a foreign antigen such as dinitrophenyl ovalbumin and measuring whether the antibody titer against the foreign antigen decreases by appropriately administering the test substance. It is possible. More specifically, it is also possible by measuring the amount of cytokines in the blood such as interferon gamma which is considered to increase due to an autoimmune disease or the like.

On the other hand, a non-human animal having an exogenous abnormal CD100 gene can be subcultured in a normal breeding environment as an animal having the CD100 gene after confirming that the CD100 gene is stably maintained by mating. Further, the target CD100 gene can be incorporated into the above-mentioned plasmid and used as a source substance. The DNA construct with the promoter can be prepared by a general CD100 genetic engineering technique. Transfer of the abnormal CD100 gene at the fertilized egg cell stage is ensured to be present in all germ cells and somatic cells of the subject animal. The presence of the abnormal CD100 gene in the germ cells of the produced animal after the CD100 gene transfer indicates that all the offspring of the produced animal have abnormal C in their germ cells and somatic cells.
It means having the D100 gene. Progeny of this type of animal that has inherited the CD100 gene have the abnormal CD100 gene in all of its germ and somatic cells.
A homozygous animal having the introduced CD100 gene on both homologous chromosomes is obtained, and by crossing these male and female animals, it is possible to breed subculture so that all offspring have the CD100 gene. A non-human animal having an abnormal CD100 gene has a high level of expression of the abnormal CD100 gene, and may eventually become a CD100 dysfunction by inhibiting the function of an endogenous normal CD100 gene. It can be used as an animal. For example, using an abnormal CD100 gene-transferred animal, it is possible to elucidate the pathological mechanism of CD100 dysfunction and to examine a method for treating this disease. Further, as a specific possibility, an animal in which an abnormal CD100 gene is highly expressed has an abnormal C100 in CD100 dysfunction.
Inhibition of normal CD100 function by D100 (dominant neg
ative action). The animal into which the foreign abnormal CD100 gene has been transferred is a normal CD100.
Infections or diseases caused by viruses (cold syndrome, influenza, AIDS, hepatitis, herpes, measles, chickenpox, hand-foot-and-mouth disease, shingles, erythema infectivity, rubella, sudden rash, viral conjunctivitis , Viral meningitis, viral pneumonia, viral encephalitis, Lassa fever, Ebola hemorrhagic fever, Marburg disease, Congo hemorrhagic fever, yellow fever, dengue fever, rabies, adult T-cell leukemia (AT
L), rotavirus infection, polio, mumps, etc., bacterial or fungal infections or diseases (bacterial food poisoning, bacterial diarrhea, tuberculosis, leprosy, dysentery, typhoid, cholera, paratyphoid, plague, tetanus, hares) disease,
Reduced resistance to brucellosis, anthrax, sepsis, bacterial pneumonia, dermatomycosis, etc., or cancer (oral, pharyngeal, lip, tongue, gingival, nasopharyngeal, nasopharyngeal, esophageal, gastric,
Colorectal cancer including small intestine cancer, colon cancer, liver cancer, gallbladder cancer, pancreatic cancer, nasal cavity cancer, lung cancer, osteosarcoma, soft tissue cancer, skin cancer, melanoma, breast cancer, uterine cancer, ovarian cancer, prostate cancer, testicular cancer , Penile cancer, bladder cancer, kidney cancer, brain tumor, thyroid cancer, lymphoma, leukemia, etc.) and animals with immunodeficiency with decreased antibody production. It can also be used for screening tests of therapeutic agents for.

Other possible uses of the above two kinds of CD100 transgenic animals include, for example, use as a cell source for tissue culture, and direct analysis of CD100 gene or RNA in the tissue of the CD100 transgenic animal. Or CD100
Analysis of the association with proteins specifically expressed or activated by CD100 by analyzing gene-high expression tissues. Cultivating cells of a tissue having the CD100 gene by standard tissue culture techniques, and using these Research on the function of cells from tissues that are generally difficult to culture, screening of drugs that enhance cell function by using the cells described above, and isolation and purification of mutant CD100 and production of antibodies thereof can be considered. Furthermore, using a CD100 transgenic animal,
The clinical symptoms of CD100-related disease including zero function refractory disease can be examined, more detailed pathological findings in each organ of the CD100-related disease model can be obtained, and a new therapeutic method can be developed. It can contribute to the research and treatment of secondary diseases caused by diseases. Also CD
Take out each organ from 100 transgenic animals, shred and
CD10 by proteolytic enzymes such as trypsin
It is possible to obtain the 0 gene transfer cells, culture them, or systematize the cultured cells. In addition, CD10
It can be used to investigate the specificity of 0-producing cells, their relationship with differentiation or proliferation, or their signal transduction mechanisms, and their abnormalities, and the like, which is an effective research material for elucidating CD100 and its effects. In addition, CD1
In order to develop a therapeutic agent for a CD100-related disease, including CD100 dysfunction, using a transgenic animal, an effective and rapid screening for the therapeutic agent for the disease is carried out using the above-described test method and quantitative method. Law can be provided. In addition, using a CD100 transgenic animal or an exogenous CD100 gene expression vector,
It is possible to study and develop a CD100 gene therapy for 0-related disease. When examining a gene therapy method, for example, a virus vector such as a retrovirus vector, an adenovirus vector, an AAV vector, a herpes virus vector, or a membrane fusion liposome method is used.

In the present specification and drawings, when bases, amino acids and the like are represented by abbreviations, IUPAC-IUB
Abbreviations based on Commision on Biochemical Nomenclature or common abbreviations in the field,
An example is given below. When an amino acid can have an optical isomer, the L-form is indicated unless otherwise specified.

DNA: deoxyribonucleic acid cDNA: complementary deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine Y: thymine or cytosine N: thymine, cytosine, adenine or guanine R: adenine or guanine M: cytosine or adenine W : Thymine or adenine S: cytosine or guanine RNA: ribonucleic acid mRNA: messenger ribonucleic acid dATP: deoxyadenosine triphosphate dTTP: deoxythymidine triphosphate dGTP: deoxyguanosine triphosphate dCTP: deoxycytidine triphosphate ATP: adenosine triphosphate Phosphate EDTA: ethylenediaminetetraacetic acid SDS: sodium dodecyl sulfate EIA: enzyme immunoassay Gly or G: glycine Ala or A: a Nin Val or V: valine Leu or L: leucine Ile or I: isoleucine Ser or S: serine

Thr or T: Threonine Cys or C: Cysteine Met or M: Methionine Glu or E: Glutamic acid Asp or D: Aspartic acid Lys or K: Lysine Arg or R: Arginine His or H: Histidine Phe or F: Phenylalanine Or Y: tyrosine Trp or W: tryptophan Pro or P: proline Asn or N: asparagine Gln or Q: glutamine pGlu: pyroglutamic acid Me: methyl group Et: ethyl group Bu: butyl group Ph: phenyl group TC: thiazolidine-4 ( R) -carboxamide group Bom: benzyloxymethyl NMP: N-methylpyrrolidone PAM: phenylacetamidomethyl

The substituents, protecting groups and reagents frequently used in the present specification are represented by the following symbols. Tos: p-toluenesulfonyl HONB: N-hydroxy-5-norbornene over 2,3-dicarboximide Bzl: benzyl Cl ₂ -Bzl: dichlorobenzyl Z: benzyloxycarbonyl Br-Z: 2-bromobenzyloxycarbonyl Cl-Z : 2-chlorobenzyloxycarbonyl Boc: t-butyloxycarbonyl HOBT: 1-hydroxybenztriazole DCC: N, N'-dicyclohexylcarbodiimide Fmoc: N-9-fluorenylmethoxycarbonyl DNP: dinitrophenyl Bum: tertiary butoxy Methyl Trt: Trityl BSA: Bovine serum albumin DNP-OVA: Dinitrophenyl ovalbumin DNP-BSA: Dinitrophenyl bovine serum albumin ELISA: Enzymeulin De immunoaffinity saw a vent assay EIA: enzyme immunoblotting saw a vent assay LPS: lipopolysaccharide

SEQ ID NOs in the present specification indicate the following sequences. [SEQ ID NO: 1] This shows the amino acid sequence of mouse CD100. [SEQ ID NO: 2] This shows the nucleotide sequence of mouse CD100. [SEQ ID NO: 3] This shows the amino acid sequence of human CD100. [SEQ ID NO: 4] This shows the base sequence of human CD100. [SEQ ID NO: 5] mCD100- described in Reference Example 1
The base sequence of the N-terminal primer used for preparing Fc is shown. [SEQ ID NO: 6] mCD100- described in Reference Example 1
The base sequence of the C-terminal primer used for preparing Fc is shown.

[0054]

The present invention will be described in more detail with reference to the following Reference Examples and Examples, which do not limit the scope of the present invention.

Reference Example 1 Isolation of CD100, whose expression is enhanced by CD40 stimulation 1 × 10 ⁸ mouse B cell line WEHI231 cells were stimulated with an anti-CD40 antibody, HM40-3 (Pharmingen) for 8 hours. Total RNA was isolated from cells that were not stimulated by the guanidine isothiocyanate phenol method, and mRNA was purified using Oligo (dT) -coupled magnetic beads (Promega). PCR
CDNA synthesis and subtraction cloning were performed using -SELECT cDNA subtraction kit (Clontech). The cDNA fragment generated by CD40 stimulation was directly inserted into a T / A vector (Invitrogen). As a result of comparing the obtained base sequences, the Journal of Biological Chemistry (Jour
nal of Biological Chemistry 271 , 33376-33381 (199
The CD100 gene described in 6)) was isolated. MCD100-Fc described in Example 2 described below is a protein obtained by fusing a soluble human IgG1 Fc portion to mouse CD100. Specifically, SalI in the sense direction
primer containing site (gctgtcgactgtgtgcccgttgc
tgaaggcct) [SEQ ID NO: 5] and Ba in the antisense direction
Primers containing the mHI site (gacggatcctacttact
ttgctttgcttgcttgagatacaccgtcttctctga) [SEQ ID NO:
WEHI231 stimulated with CD40 by PCR using an oligonucleotide consisting of the combination of [6]
Secretory mouse CD100 cDNA was prepared from mouse CD100 cDNA extracted from the cells. Sal obtained
The I-BamHI fragment was converted to pEFBos human IgG1 Fc
A gene expressing the mCD100-Fc protein was prepared by inserting the SalI-BamHI fragment into the DNA fragment of the cassette. The gene was electroporated (using Biorad Gene Pulser at 0.25 kV, 960 microFD).
) Was introduced into P3U1 plasmacytoma to prepare transformed cells. Specifically, 50 μg of Hin
pEFBos-mCD100-Fc plasmid DNA cut with dIII and pMC1neo cut with BamHI
10 ⁷ cells were transformed with the vector. RPMI containing 10% fetal calf serum and 0.3 mg / ml G418
After culturing in a culture solution for 10 days, colonies resistant to G418 were isolated and cloned. The mCD100-Fc protein was purified from the culture using Protein A Sepharose (Amersham Pharmacia). For CHO cells expressing CD100 as described in Example 1, CD1
A transformed cell in which the 00 gene has been introduced into CHO cells, and expresses the CD100 protein. Specifically, CD1
The full-length 00 cDNA was incorporated into pEFBOSvector and introduced into CHO cells together with the pMC1neo vector using Lipofectamine Plus (Life Technology). G418 in the presence of 0.3 mg / ml
One day later, G418 resistant cells were selected.

Example 1 Class switch enhancing action of mouse CD100 C57B prepared at 1 × 10 ⁵ cells / well
L / 6 mouse spleen-derived resting B cells were added to a flat-bottom 96-well microtiter plate together with anti-CD40 monoclonal antibody or IL-4 100 units / ml and CHO cells expressing CD100 fixed with paraformaldehyde (2 × 10 ⁴ cells / well). And cultured for 7 days. The production of IgM or IgG1 immunoglobulin was measured by ELISA. Specifically, a culture solution or control IgM and IgG were added to a 0.1 M carbonate buffer (p
H9.6), and 100 μl was added to each well of a 96-well immunoplate for EIA (Maxisorp: Nunc).
The mixture was injected at a temperature of about 4 ° C. overnight, and attached. Each well was buffered with buffer A (pH 7.0 containing 0.15 M NaCl).
After washing with 0.02 M phosphate buffer, buffer B (0.
Enzyme-labeled anti-I diluted with 1% BSA, 0.02 M phosphate buffer (pH 7.0 containing 0.15 M NaCl)
100 μl of a gM, IgG1 antibody solution was added and reacted at 25 ° C. for about 2 hours. Each well was washed with buffer A, and an alkaline phosphatase substrate solution (1 mg / ml)
Phosphatase substrate (Sigma), 100 mM Tri
s (pH 9.5), 100 mM NaCl, 5 mM Mg
(Cl ₂ ) was added and reacted at 25 ° C. for 30 minutes. 405 nm using an automatic colorimeter for microplate
Was measured. Separately, known amounts of IgM, I
The amount of antibody in each reaction solution was quantified by taking a quantitative curve of the absorbance and the amount of antibody with gG1 attached. The experiment is
(1) Culture medium (M) in the presence of CHO cells not expressing CD100
(2) in the presence of CD100-expressing CHO cells, and (3) anti-CD in the presence of CD100-expressing CHO cells.
When 40 antibody (αCD40) and IL-4 were added,
(4) When the anti-CD40 antibody (αCD40) and IL-4 were added in the presence of CHO cells expressing CD100,
The amount of gM and the amount of IgG1 were compared. FIG. 1 shows the results. The horizontal axis is (1), (2), (3),
In the results of (4), the vertical axis shows the amount of antibody (unit: ng / ml) quantified from the absorbance. Compared with the control group without additive (1), C
When D100 is present (2), both IgM and IgG1 do not affect antibody production. When stimulated with an anti-CD40 antibody and IL-4 (3), both IgM and IgG1 induce antibody production as compared to the non-added control group (1).
When stimulated with anti-CD40 antibody and IL-4 in the presence of CD100 (4), IgM production was slightly decreased, whereas IgG1 production was (3) as compared with the case of stimulation with anti-CD40 antibody and IL-4. It rose even more strongly than. This indicates that a phenomenon in which the class of antibodies produced and secreted from B cells is switched from IgM to IgG1, that is, a so-called class switch was induced.

Example 2 Enhancement of In Vivo Antibody Production by CD100 Dinitrophen Prepared with 100 μg of Aluminum
ylvalbumin (DNP-OVA) to C57
BL / 6 mice were inoculated intraperitoneally and immunized. After immunization, human IgG1 myeloma protein or mCD10
0-Fc was administered at 200 μg / day for 10 days.
Serum was collected 6 days and 10 days after DNP-OVA administration. The antibody titer of DNP-specific antibody was determined by DNP-BSA
Was measured by an ELISA method. Specifically, the serum of the mouse after immunization was used in a 0.1 M carbonate buffer (pH 9.
EI diluted with 6) and coated with DNP-BSA
96-well immunoplate for A (Maxi Soap: Nunc)
100 μl each was injected into each well, and left at 4 ° C. overnight for attachment. Buffer each well with buffer A (0.15 M NaC)
buffer B (25% Block Ace (Dainippon Pharmaceutical),
100 µl of an anti-mouse IgM, IgG1, antibody solution labeled with alkaline phosphatase diluted with 0.02 M phosphate buffer (pH 7.0 containing 0.15 M NaCl)
Was added thereto, and the mixture was further reacted at 25 ° C. for 2 hours to bind to the anti-DNP antibody attached to the well. Each well was washed with buffer A, and alkaline phosphatase substrate solution was added to 10 wells.
0 μl was added and reacted at 25 ° C. for 30 minutes, and the absorbance at 405 nm was measured using an automatic colorimeter for microplate. DNP-specific antibodies were quantified. FIG. 2 shows the result. The figure on the left shows the antibody titer to DNP contained in the serum 6 days after administration of DNP-OVA, and the figure on the right shows the antibody titer after 10 days. □ on the horizontal axis indicates human IgG1 myeloma protein, ■
Indicates the antibody titer when mCD100-Fc was administered.
The vertical axis Anti-DNP indicates the antibody titer against DNP.
DN contained in the serum of the mice of the control group 12 days after administration
One thousandth of the amount of antibody to P was defined as 1 unit. When CD100 (mCD100-Fc) is administered,
The antibody titer on day 6 is at least three times higher than the antibody titer on day 6 when the control human IgG1 myeloma protein was administered, and the antibody titer on day 10 when the control human IgG1 myeloma protein was administered. Value. This indicates that CD100 plays an important role in the ability to induce antigen-specific antibody production.

Example 3 Generation of CD100 Knockout Mouse Using two types of probes derived from the CD100 cDNA sequence (total length and up to 1-1200 bp),
A phage clone containing a CD100 genomic DNA fragment of about 12 kb was isolated from a SvJ mouse liver-derived genomic library (Strategene). In this DNA fragment, the 1.6 Kb portion including a part of the first exon where the initiation codon is present was replaced with a neomycin resistance gene (provided by Maternal and Child Health Center) (Cell 51).
(1987) pp.503-512). In addition, the herpes simplex virus-derived thymidine kinase gene (HSV-TK) was converted to CD100 for negative selection.
Inserted downstream of the genomic gene (Nature
e) 336 (1988) 348-352), and a targeting plasmid DNA was constructed. 50 μg of this targeting plasmid DNA was transduced into 1 × 10 ⁶ E14-1 embryonic stem cells by electroporation. For the embryonic stem cells into which the gene was introduced, G418
(0.4 mg / ml; Life Technology) and ganciclovir (2 μM; Syntex) were double selected. As a result of selecting by homologous recombination on the CD100 gene from 1000 resistant colonies by Southern blotting, homologous recombination occurred.
The cloned embryonic stem cells were identified. Embryonic stem cells derived from the CD100 mutant clone were inoculated into blastocysts of C57BL / 6 mice (Shizuoka Experimental Animal Association, 6-8 weeks old), and then transferred to ICR foster parents (Shizuoka Experimental Animal Association, 6-8 weeks old). . The chimerism of the offspring was determined based on the degree of agouti of the fur, and a knockout mouse was produced in which the male chimera was further crossed with a C57BL / 6 female mouse. About the child born, C
Whether or not the D100 gene was knocked out was analyzed by Southern blotting. Genome D from mouse tail
After isolation of NA and digestion with BamHI, agarose gel electrophoresis was performed. The electrophoresed DNA was transferred to a nylon filter (Amersham Pharmacia), and then a radiolabeled probe (CD100 promoter region, 0.2K
and b) overnight. 0.1x filter
After washing in SSC and 0.1% SDS at 65 ° C. for 1 hour, autoradiography was performed. FIG. 3 shows the result. A is a CD100 wild-type gene from the top,
1 shows a genetic map of the CD100 targeting vector, and a CD100 genetic map when expected recombination has occurred. Exons in the 5 'untranslated region are shown in gray boxes, and exons in the translated region are shown in black boxes. B indicates a position to be cleaved by BamHI restriction enzyme, and E indicates a position to be cleaved by EcoRI restriction enzyme. Neo converts the neomycin resistance gene to H
SV-TK indicates a thymidine kinase gene derived from herpes simplex virus. Arrows indicate the transcription direction of these genes. Probe indicates the position of the probe used in the Southern blot. When performing Southern blotting by BamHI digestion, the length of the gene binding to the probe is expected to be 2.6 Kb for the wild-type gene and 1.2 Kb for the recombinant. B is wild-type (+ / +), heterozygous (+ / +)
-) Shows the results of analyzing the homozygous (-/-) genotype of the mutant gene by Southern blotting. 1. In wild type
Only the 6 kb fragment, 2.6 kb and 1.
Only 1.2 Kb fragments were found in the homozygotes of the 2 Kb fragments and the mutant gene. The length of the gene binding to the probe was planned to be 2.6 Kb for the wild-type gene and 1.2 Kb for the recombinant, so
This shows a knockout mouse in which the D100 locus has been replaced with the expected length. C shows the result of confirming that the knockout mouse did not express the CD100 molecule on the cells. Spleen cells prepared from wild-type mice (+ / +) and CD100 knockout mice (-/-) were subjected to biotinylated anti-mouse CD100 antibody / F
The results of analysis by flow cytometry after double staining with ITC-labeled streptavidin and phycoerythrin-labeled anti-B220 (cell surface marker of mouse B cells) antibody are shown. In the figure, the vertical and horizontal axes are B220 and C, respectively.
The production amount of the D100 molecule on the cell surface is shown as a logarithmic expression as the fluorescence intensity per cell. C for wild-type mice
While D100-positive cells were observed, knockout mice did not show CD100-positive cells.
Therefore, it was confirmed that the CD100 molecule was not expressed on the cells in the knockout mouse.

Example 4 Analysis of CD5 Surface Antigen of Knockout Mouse and Wild Type Mouse Lymphocytes Peritoneal cells were collected by washing the peritoneal cavity with a phosphate buffer containing 2% FCS and 10 U / ml heparin. The results of analysis after double staining of a cell suspension prepared from the abdominal cavity or spleen with a FITC-labeled anti-B220 antibody and a phycoerythrin-labeled anti-CD5 antibody (each of Pharmingen) are shown. B2
20 is a cell surface marker for mouse B cells. CD5
Is known as a marker for autoantibody production (Autoimmunity, 30 (1999) 63-6).
9). FIG. 4 shows the results. + / + Is a wild type mouse, −
/-Indicates CD100 knockout mice. In the figure, the horizontal axis and the vertical axis respectively show the production amounts of B220 and CD5 molecules on the cell surface in logarithmic representation as the fluorescence intensity per cell. The fractions of both cell marker-positive cells are shown in the frame in the figure. In the case of peritoneal cells, the ratio of both B220 and CD5 positive cells was 14.6% in wild-type mice, but decreased to 7.49% in knockout mice. In the case of spleen cells, the ratio of both B220 and CD5 positive cells was 1.5% in wild-type mice and 0.93% in knockout mice, which also decreased. These results suggest that CD100 contributes to CD5 molecule expression. Therefore, if the function of CD100 can be inhibited, it is possible to suppress CD5, which is considered to be enhanced in the expression of an autoimmune disease, and to treat the autoimmune disease.

Example 5 Production of Antibodies Against TD (T Cell Dependent) Antigen Eight weeks old CD100 knockout mice and wild type mice (n = 4 or 5) were treated with 100 μg of NP-CGG.
The mice were immunized intraperitoneally twice (second time 28 days later) with an aluminum salt containing (4-hydroxy-3-nitrophenylacetyl chicken gamma globulin labeled product) (n = 5). Blood collection was performed before immunization and on days 14, 21, 28, 35 and 72 after immunization. Bound to NP (nitrophenyl group) by using the NP _12-labeled bovine serum albumin plates coated with (12 4-hydroxy-3-nitrophenyl acetyl group labeled BSA) and NP ₂ labeled bovine serum albumin Total IgG and, among them, IgG that binds with high affinity were quantified by ELISA, respectively. NP _{12 in} 96-well microplate (Nunc)
The labeled bovine serum albumin or NP ₂ labeled bovine serum albumin was coated overnight at 4 ° C.. After washing, 200 μl
/ Well blocking solution (50 mM Tris-HCl
(PH 8.1), 1 mM MgCl ₂ , 0.15 M N
aCl, 1% BSA, 0.05% Tween 20) was added, and the mixture was allowed to stand at room temperature for 1 hour. After washing, 100 μl / well of a sample diluted with a blocking solution was added, and the mixture was allowed to stand at room temperature for 1.5 hours. After washing three times with PBS containing 0.05% Tween 20, alkaline phosphatase-labeled goat anti-mouse IgG1 antibody was added. After 1 hour, wash, add phosphatase substrate (Sigma) and add 405n
m. FIG. 5 shows the results. A is NP ₁₂
The time course of the amount of labeled bovine serum albumin-binding IgG is shown. B shows the time course of NP ₂ labeled bovine serum albumin binding of IgG amounts. C over time shows the ratio of NP ₂ IgG amount of labeled bovine serum albumin binding and NP ₁₂ labeled bovine serum albumin binding of IgG amounts. The vertical axis indicates the amount of antibody in A and B. In C, the ratio is shown. The horizontal axis indicates the number of days elapsed after the immunization with the first immunization day as the 0th day. Shows the results when CD100 knockout mice were used, and △ shows the results when wild type mice were used. As shown in FIGS. 5A and 6B, the amount of produced antibodies was reduced in knockout mice as compared with wild type mice, and it was recognized that the ability to produce antibodies to TD (T cell-dependent) antigen was impaired in CD100 knockout mice. Was done. In particular, the production of the high affinity antibody was significantly lower than that of the low affinity antibody. As shown in FIG. 5C, in the wild type mouse,
₂ / NP ₁₂ ratio was increased. This shows the process of maturation into a group of B cells producing higher affinity antibodies over time, but the NP ₂ / NP ₁₂ ratio in knockout mice increases more slowly than in wild type mice, It was shown that the mechanism of maturation to high affinity antibody production was impaired. It is known that a decrease in the ability to produce an antibody against a TD (T cell-dependent) antigen, that is, a decrease in the TD reaction, results in weaker resistance to infectious diseases and the like (Immunodeficiency Review, Volume 3: (1988) 101-). 121). Therefore, a substance that enhances the administration of CD100 or the action of CD100 is a new therapeutic agent for infectious diseases and the like.

Example 6 Loss of T Cell Reactivity in CD100 Knockout Mice KLH suspended in complete Freund's adjuvant in 8-week old wild type mice and CD100 knockout mice
(Keyhole limpet hemocyanin) was immunized intraperitoneally when T cells were collected from the spleen, and in the footpad when T cells were collected from regional lymph nodes. 9 days after immunization, CD
4 positive T cells were converted to CD4 labeled magnetic beads (Magn).
(Etic Cell Sorting, Milteny Biotech) from the spleen or regional lymph nodes.
1 × 10 ⁵ cells were irradiated (3000 rad)
The cells were stimulated with various concentrations of KLH for 3 days in the presence of spleen cells (5 × 10 ⁵ ) of wild-type mice. When examining cell proliferation, 2 μCi of tritiated thymidine was added for 12 hours, and radioactivity in cells was measured. IL-4 (interleukin 4) and IFN- in cell culture supernatant for 3 days
The amount of γ (interferon gamma) was measured using an ELISA kit (R & D system). FIG. 6 shows the results. A shows the comparison between CD4 positive T cells derived from spleen and proliferating wild-type mice and CD100 knockout mice by KLH stimulation. B shows proliferating wild-type mice and CD10 of KLH stimulation of CD4 positive T cells derived from regional lymph nodes.
The comparison in 0 knockout mice is shown. ○ indicates the results of wild type mice, and △ indicates the results of CD100 knockout mice.
The vertical axis represents intracellular radioactivity as an index of proliferation. The horizontal axis indicates the amount of KLH added. C: KLH-stimulated proliferation of regional lymph node-derived CD4-positive T cells, IL-4
The comparison between the wild-type mouse and the CD100 knockout mouse in the IFN-γ-producing ability and the CD100 knockout mouse, and the effect of adding CD100 are shown. mCD100-Fc was intravenously administered at 50 μg / mouse for 6 consecutive days from the day after immunization. The result when 4 μg / ml of KLH is used is shown.
The horizontal axis + / + and − / − indicate wild type mice and knockout mice. CD100-Fc indicates the case where + was added and the case where-was not added. The vertical axis is proliferative from the left, IL
-4 and INF. As shown in FIG. 6A, the reactivity of spleen-derived T cells to KLH was reduced in knockout mice compared to wild type mice. As shown in FIG. 6B, further reduction in reactivity was observed in T cells derived from lymph nodes in knockout mice, and no reactivity was observed even when the amount of KLH was increased. As shown in FIG. 6C,
In knockout mice, CD4 + T cell IL
The ability to produce -4 and INF-γ was significantly reduced as compared to wild type mice, and it was confirmed that both factors were hardly produced. Furthermore, the addition of soluble CD100 reversed the decrease in reactivity, confirming that these abnormalities in knockout mice were mediated by CD100. It has been reported that activation of antigen-presenting cells induces the activation of antitumor T cells, resulting in antitumor immunity. At that time, antiproliferative T cells show an increase in proliferation and an increase in the ability to produce IL-4 and INF-γ. According to the results of this example, the knockout mouse significantly reduced the activation of antigen-specific T cells from the indexes of proliferation, IL-4 production ability, and INF-γ production ability. This is because CD100 has antitumor T
It suggests that it is deeply involved in cell activation.
In fact, CD1 on antigen presenting cells or activated T cells
CD72, which is a receptor of OO, is expressed (Annual Solar Sick Surgery, 61: (1996))
252-258). Thus, CD100 can act directly on these cells to activate T cells and exert antitumor activity.

Example 7 Examination of the amount of soluble CD100 and anti-single-chain DNA antibody contained in serum of MRL / lpr autoimmune disease model mouse C57BL / 6, Balb / c, MRL / n, MRL /
lpr mice were purchased from SLC (Shizuoka Experimental Animal Cooperative). Blood was collected from the fundus of 16-week-old mice. A mouse fusion protein of soluble CD100 and Flag was prepared by PCR from CD100 cDNA prepared from WEHI-231 cells stimulated with anti-CD40 antibody. The primer contains a SalI site as a sequence at the 5 ′ end.
5-gacggatcctacttactttgctttgcttgctt containing g sequence
gagatacaccgtcttctctga [SEQ ID NO: 6] was used. P
The SalI-BamHI fragment generated in CR was converted to pEFBos.
SalI-Ba of human IgG1 Fc cassette
It was incorporated into the mHI part. 10 ⁷ P3U1 plasmacytomas 50 mg CD100-F cut with HindIII
5 mg digested with lag plasmid DNA and BamHI
PMC1neo vector was introduced by electroporation. The transfected cells were transformed with RPMI1640 containing 10% fetal calf serum and 0.3 mg / ml G418.
Selected by culture. CD100-Flag protein is anti-F
Purification was performed using lag antibody-labeled agarose (Sigma). Sandwich E for detecting soluble CD100
The LISA method was performed as follows. A 96-well microplate (Nunc) was coated with a rat anti-mouse CD100 antibody (clone BMA-12, 5 μg / ml) at 4 ° C. overnight. After washing, 200 μl / well of blocking solution (50
mM Tris-HCl (pH 8.1), 1 mM Mg
Cl ₂ , 0.15 M NaCl, 1% BSA, 0.0
5% Tween 20) was added, and the mixture was allowed to stand at room temperature for 1 hour. A sample and a standard sample (mouse fusion protein of soluble CD100 and Flag) at 100 μl / well diluted with a blocking solution were allowed to stand at room temperature for 1.5 hours. 0.05
After washing 3 times with PBS containing% Tween20, 2 μg
/ Ml of biotinylated rat anti-mouse CD100 antibody (clone BMA-8) was added. One hour later, alkaline phosphatase-labeled streptavidin (Sigma) was added. After washing, a phosphatase substrate (Sigma) was added, and soluble CD100 molecules were detected at an absorbance of 405 nm. Anti-single-stranded DNA was prepared as follows. Bovine thymus D
NA (Sigma) was treated with S1 nuclease (Sigma) to obtain double-stranded DNA. The double-stranded DNA was boiled for 15 minutes and then cooled on ice to obtain a single-stranded DNA. 5 μg / ml single-stranded DNA was attached to a 96-well microplate, mouse serum was added, and alkaline phosphatase-labeled anti-mouse I
The gG antibody (Southern Biotechnology) was added. The monoclonal antibodies BMA-8 and BMA-12 were prepared as follows. 100 μg of CD100-F
c was subcutaneously administered once a week for a total of four times to immunize. The adjuvant used for immunization was Freund's complete adjuvant for the first time, and Freund's incomplete adjuvant for the second and subsequent times. The same amount was administered intravenously five days before the rat was sacrificed. B cells were prepared from rat spleen and fused with myeloma cells. Clones BMA-8 and BMA-12 producing an antibody against CD100 were selected from the fused cells. The clone was transplanted into a rat intraperitoneal cavity, and the antibody was purified from ascites. Table 1 shows the results.

[Table 1] Table 1 shows the mouse strain, soluble CD100 amount, and single-stranded DNA.
The relationship with the amount is shown. MRL / lpr mice are MRL / n
This is an autoimmune disease model mouse selected from mice. The amount of soluble CD100 contained in serum was C57BL
/ 6, Balb / c and MRL / n normal mice had a detection limit (12 ng / ml) or lower, but MRL / lpr autoimmune disease mice showing autoimmune disease-like symptoms showed a marked increase (166 ng / ml). ml). Similarly, the amount of anti-single-chain DNA antibody, which is an indicator of the amount of autoantibodies associated with an autoimmune disease, is much higher in MRL / lpr mice than in MRL / n mice. It was also evident from the amount of anti-single-chain DNA antibody that the above symptoms were exhibited. From these results, MRL /
In lpr autoimmune disease mice, abnormal production of CD100 is highly likely to be involved, and animal experiments have shown that CD100 inhibitors are effective for autoimmune diseases such as rheumatoid arthritis.

Example 8 Increase in Amount of Soluble CD100 and Autoantibodies with Age in MRL / lpr Mice The amount of soluble CD100 (A) and the amount of anti-single-chain DNA antibody (B) were determined using 8-20 week old mice. It was measured. Blood was collected from the fundus. The sandwich ELISA for detecting soluble CD100 was performed as follows. Rat anti-mouse CD10 in 96-well microplate (Nunc)
Antibody 0 (BMA-12, 5 μg / ml) was coated overnight at 4 ° C. After washing, 200 μl / well of blocking solution (50 mM Tris-HCl (pH 8.1), 1 mM
MgCl ₂ , 0.15 M NaCl, 1% BSA,
0.05% Tween 20) was added, and the mixture was allowed to stand at room temperature for 1 hour. Samples and standard samples (mouse fusion protein of soluble CD100 and FLAG sequence) at 100 μl / well diluted with a blocking solution were allowed to stand at room temperature for 1.5 hours.
After washing three times with PBS containing 0.05% Tween 20,
2 μg / ml biotinylated rat anti-mouse CD100 antibody (BMA-8) was added. One hour later, alkaline phosphatase-labeled streptavidin (Sigma) was added. After washing, a phosphatase substrate (Sigma) was added, and soluble CD100 molecules were detected at an absorbance of 405 nm. Anti-single-stranded DNA was prepared as follows. Bovine thymus D
NA (Sigma) was treated with S1 nuclease (Sigma) to obtain double-stranded DNA. The double-stranded DNA was boiled for 15 minutes and then cooled on ice to obtain a single-stranded DNA. 5 μg / ml single-stranded DNA was attached to a 96-well microplate, mouse serum was added, and alkaline phosphatase-labeled anti-mouse I
The gG antibody (Southern Biotechnology) was added. FIG. 7 shows the results. A is the amount of soluble CD100 in serum,
B shows the amount of anti-single-chain DNA antibody in serum. The horizontal axis represents the age of mice. The vertical axis of B represents the amount of the antibody. The numerical value obtained from the serum of a 22-week-old mouse was defined as 1, and the magnification of each sample was indicated. The amount of soluble CD100 in serum was below the detection sensitivity in 8-week-old MRL / lpr mice, but increased with the age of the week and reached 116 ± 89 ng / ml at the age of 16 weeks. Similarly, the amount of anti-single-chain DNA antibody, which is an indicator of the progression of an autoimmune disease, also increased with age. From these results, it was found that an increase in the amount of soluble CD100 in serum correlates with the progress of the autoimmune disease in MRL / lpr mice over time. These results also indicate that abnormalities in CD100 production are highly likely to be involved in MRL / lpr autoimmune disease mice, indicating that CD100 inhibitors are effective for autoimmune diseases such as rheumatoid arthritis. Was.

Example 9 Loss of Dendritic Cell Reactivity in CD100 Knockout Mice Bone marrow cells were collected from 8-week-old wild type mice and CD100 knockout mice. BM-CSF for bone marrow cells
Dendritic cells were prepared by culturing for 6 days in the presence of. 2 × 10 ⁵ dendritic cells were seeded on a 96-well plate, and an anti-mouse CD40 antibody (HM-40-3 (Pharmingen), 2 μg / ml) or LPS (lipopolysaccharide, 10 μg / ml) was added. And cultured for 72 hours. The amount of IL-12 in the culture supernatant was measured using an ELISA kit (Amersham Pharmacia). FIG. 8 shows the results. The results for wild-type mice are shown in white, and the results for knockout mice are shown as hatched. The vertical axis indicates the amount of IL-12.
Dendritic cells derived from wild-type mice have anti-CD40 antibody or L
When stimulated with PS, IL-12 production increases,
Dendritic cells were activated. However, when dendritic cells derived from knockout mice were used, the amount of IL-12 produced decreased, and activation of dendritic cells was impaired. When an antitumor effect occurs due to immunostimulation, antitumor cytotoxic T cells attack cancer cells directly. Activation of antitumor cytotoxic T cells is performed by dendritic cells, and a key regulator is IL-12 [Procedures of the National Academy Off Sciences of the. USA (Proc Natl Acad Sci USA) 87 volumes, (1990)
6808-6812]. Thus, if dendritic cells are activated and IL-12 is released, the antitumor cytotoxic T
It is thought that cells are activated and tumor cells are attacked (Nature, 393: (1998) 413-41).
4). In fact, it has been shown that administration of IL-12 activates antitumor T cells and produces an antitumor effect (Journal of Immunology, 153, 169).
7-1706, 1994). From the results of this example,
Since the amount of IL-12 produced from dendritic cells was significantly reduced in the knockout mice, it is considered that the activation of dendritic cells stimulated with the anti-CD40 antibody or LPS was suppressed. This suggests that CD100 is deeply involved in dendritic cell activation. Therefore, C
When D100 is administered, the dendritic cells are activated, and the antitumor cytotoxic T cells are activated, thereby exhibiting the antitumor activity.

Example 10 T cell hyperreactivity in CD100 transgenic mice To express mouse CD100 in a B cell-specific manner, an immunoglobulin V region heavy chain gene promoter, an immunoglobulin heavy chain gene intron enhancer and an immunoglobulin were used. A construct was prepared in which a full-length or intracellular region-deleted membrane-type mouse CD100 cDNA was incorporated into an Eμ vector comprising a globulin κ chain enhancer. Transgenic mice were prepared by introducing this gene fragment into fertilized eggs of C57BL / 6 mice. KLH (keyhole limpet hemocyanin, suspended in complete Freund's adjuvant) in 8-week-old wild type mice and CD100 transgenic mice
10 μg / mouse) was immunized intraperitoneally. 9 days after immunization,
CD4 positive T cells were converted to CD4 labeled magnetic beads (Ma
genetic cell Sorting, Milteny Biotech) from regional lymph nodes. 1x1
0 ⁵ cells, radiation treatment (3000 rad) and wildtype mouse spleen cells (5x10 ⁵⁾ presence were stimulated 3 days with various concentrations of KLH. When examining cell proliferation, 2 μCi of tritiated thymidine was added for 12 hours,
Intracellular radioactivity was measured. The amount of IFN-γ (interferon gamma) in the cell culture supernatant for 3 days was determined by ELISA.
The measurement was performed using an A kit (R & D system). FIG. 9 shows the results. The left figure shows the amount of INF-γ production, and the right figure shows the proliferation. ○ indicates the results of wild-type mice, and ● indicates the results of CD100 transgenic mice. The horizontal axis indicates the amount of KLH added. Proliferation is represented by intracellular radioactivity as an index. As shown in FIG. 9, in the transgenic mouse, CD
The amount of INF-γ production and proliferation of 4 positive T cells were increased as compared with wild type mice. This indicates that T cells specific for KLH were activated. Activation of the antigen-presenting cells induces activation of antitumor T cells,
It has been reported that antitumor immunity occurs (Nature, 393: (1998) 413-414). At that time, in the antitumor T cells, increased proliferation and INF-
Enhanced production of γ is observed. From the results of this example,
Regarding antigen-specific T cell activation, transgenic mice also increased both INF-γ production and proliferative indicators. This suggests that CD100 is deeply involved in the activation of antitumor T cells. In fact, CD10 on antigen presenting cells or activated T cells
0 receptor, CD72 is expressed (Annual Solar Sick Surgery, 61: (1996) 2
52-258). Thus, CD100 can act directly on these cells to activate T cells and exert antitumor activity. In addition, it is considered that this transgenic model mouse is in an immune response hypersensitivity state due to enhanced CD100 production. Therefore, it serves as a model for diseases such as immunodeficiency presumed to be caused by CD100 enhancement.

[0066]

EFFECT OF THE INVENTION Since CD100 or a salt thereof is involved in the action of inducing class switching, it can be used as an agent for inducing class switching of immunoglobulins. Further, since it has an action of activating dendritic cells, it can be used as an activator of dendritic cells. Accordingly, the medicament of the present invention may be used for infections or diseases caused by viruses (cold syndrome, influenza, AIDS,
Hepatitis, herpes, measles, varicella, hand-foot-and-mouth disease, shingles, erythema contaminated, rubella, sudden rash, viral conjunctivitis, viral meningitis, viral pneumonia, viral encephalitis, Lassa fever, Ebola hemorrhagic fever, Marburg disease, Congo haemorrhagic fever, yellow fever, dengue, rabies, adult T-cell leukemia, rotavirus infection, polio, mumps, etc., bacterial or fungal infections or diseases (bacterial food poisoning, bacterial diarrhea, tuberculosis, leprosy, Dysentery, typhoid, cholera, paratyphoid, plague, tetanus, tularemia, brucellosis, anthrax, sepsis, bacterial pneumonia, dermatomycosis, etc., cancer (oral cancer, pharyngeal cancer, lip cancer, tongue cancer, gingival cancer, nose) Pharyngeal cancer, esophageal cancer, gastric cancer, small bowel cancer, colon cancer including colon cancer, liver cancer, gallbladder cancer, pancreatic cancer, nasal cavity cancer, lung cancer, osteosarcoma, soft tissue cancer, skin cancer, melanoma, breast cancer, Miyazaki cancer, ovarian cancer, prostate cancer, testicular cancer, penile cancer, bladder cancer, kidney cancer, brain tumor, thyroid cancer, lymphoma, leukemia, etc.), useful as a prophylactic / therapeutic agent for immunodeficiency with decreased antibody production is there.

[0067]

[Sequence listing] [Sequence Listing] <110> Takeda Chemical Industries, Ltd. <120> Pharmaceutical <130> B00127 <150> JP 11-157110 <151> 1999-06-03 <160> 6 <210> 1 <211 > 861 <212> PRT <213> Mouse <400> 1 Met Arg Met Cys Ala Pro Val Arg Gly Leu Phe Leu Ala Leu Val Val 1 5 10 15 Val Leu Arg Thr Ala Val Ala Phe Ala Pro Val Pro Arg Leu Thr Trp 20 25 30 Glu His Gly Glu Val Gly Leu Val Gln Phe His Lys Pro Gly Ile Phe 35 40 45 Asn Tyr Ser Ala Leu Leu Met Ser Glu Asp Lys Asp Thr Leu Tyr Val 50 55 60 Gly Ala Arg Glu Ala Val Phe Ala Val Asn Ala Leu Asn Ile Ser Glu 65 70 75 80 Lys Gln His Glu Val Tyr Trp Lys Val Ser Glu Asp Lys Lys Ser Lys 85 90 95 Cys Ala Glu Lys Gly Lys Ser Lys Gln Thr Glu Cys Leu Asn Tyr Ile 100 105 110 Arg Val Leu Gln Pro Leu Ser Ser Thr Ser Leu Tyr Val Cys Gly Thr 115 120 125 Asn Ala Phe Gln Pro Thr Cys Asp His Leu Asn Leu Thr Ser Phe Lys 130 135 140 Phe Leu Gly Lys Ser Glu Asp Gly Lys Gly Arg Cys Pro Phe Asp Pro 145 150 155 160 Ala His Ser Tyr Thr Ser Val Met Val Gly Gly Glu Le u Tyr Ser Gly 165 170 175 Thr Ser Tyr Asn Phe Leu Gly Ser Glu Pro Ile Ile Ser Arg Asn Ser 180 185 190 Ser His Ser Pro Leu Arg Thr Glu Tyr Ala Ile Pro Trp Leu Asn Glu 195 200 205 Pro Ser Phe Val Phe Ala Asp Val Ile Gln Lys Ser Pro Asp Gly Pro 210 215 220 Glu Gly Glu Asp Asp Lys Val Tyr Phe Phe Phe Thr Glu Val Ser Val 225 230 235 240 Glu Tyr Glu Phe Val Phe Lys Leu Met Ile Pro Arg Val Ala Arg Val 245 250 255 Cys Lys Gly Asp Gln Gly Gly Leu Arg Thr Leu Gln Lys Lys Trp Thr 260 265 270 Ser Phe Leu Lys Ala Arg Leu Ile Cys Ser Lys Pro Asp Ser Gly Leu 275 280 285 285 Val Phe Asn Ile Leu Gln Asp Val Phe Val Leu Arg Ala Pro Gly Leu 290 295 300 Lys Glu Pro Val Phe Tyr Ala Val Phe Thr Pro Gln Leu Asn Asn Val 305 310 315 320 Gly Leu Ser Ala Val Cys Ala Tyr Thr Leu Ala Thr Val Glu Ala Val 325 330 335 Phe Ser Arg Gly Lys Tyr Met Gln Ser Ala Thr Val Glu Gln Ser His 340 345 350 Thr Lys Trp Val Arg Tyr Asn Gly Pro Val Pro Thr Pro Arg Pro Gly 355 360 365 Ala Cys Ile Asp Ser Glu Ala Arg Ala Ala Asn Tyr Thr Se r Ser Leu 370 375 380 Asn Leu Pro Asp Lys Thr Leu Gln Phe Val Lys Asp His Pro Leu Met 385 390 395 400 Asp Asp Ser Val Thr Pro Ile Asp Asn Arg Pro Lys Leu Ile Lys Lys 405 410 415 Asp Val Asn Tyr Thr Gln Ile Val Val Asp Arg Thr Gln Ala Leu Asp 420 425 430 Gly Thr Phe Tyr Asp Val Met Phe Ile Ser Thr Asp Arg Gly Ala Leu 435 440 445 His Lys Ala Val Ile Leu Thr Lys Glu Val His Val Ile Glu Glu Thr 450 455 460 Gln Leu Phe Arg Asp Phe Glu Pro Val Leu Thr Leu Leu Leu Ser Ser 465 470 475 480 Lys Lys Gly Arg Lys Phe Val Tyr Ala Gly Ser Asn Ser Gly Val Val 485 490 495 Gln Ala Pro Leu Ala Phe Cys Glu Lys His Gly Ser Cys Glu Asp Cys 500 505 510 Val Leu Ala Arg Asp Pro Tyr Cys Ala Trp Ser Pro Ala Ile Lys Ala 515 520 525 Cys Val Thr Leu His Gln Glu Glu Ala Ser Ser Arg Gly Trp Ile Gln 530 535 540 Asp Met Ser Gly Asp Thr Ser Ser Cys Leu Asp Lys Ser Lys Glu Ser 545 550 555 560 Phe Asn Gln His Phe Phe Lys His Gly Gly Thr Ala Glu Leu Lys Cys 565 570 575 Phe Gln Lys Ser Asn Leu Ala Arg Val Val Trp Lys Phe Gl n Asn Gly 580 585 590 Glu Leu Lys Ala Ala Ser Pro Lys Tyr Gly Phe Val Gly Arg Lys His 595 600 605 Leu Leu Ile Phe Asn Leu Ser Asp Gly Asp Ser Gly Val Tyr Gln Cys 610 615 620 620 Leu Ser Glu Glu Arg Val Arg Asn Lys Thr Val Ser Gln Leu Leu Ala 625 630 635 640 Lys His Val Leu Glu Val Lys Met Val Pro Arg Thr Pro Pro Ser Pro 645 650 655 Thr Thr Glu Asp Val Gln Thr Glu Gly Ser Lys Ile Thr Ser Lys Met 660 665 670 Pro Val Gly Ser Thr Gln Gly Ser Ser Pro Pro Thr Pro Ala Leu Trp 675 680 685 Ala Thr Ser Pro Arg Ala Ala Thr Leu Pro Pro Lys Ser Ser Ser Gly 690 695 700 Thr Ser Cys Glu Pro Lys Met Val Ile Asn Thr Val Pro Gln Leu His 705 710 715 715 720 Ser Glu Lys Thr Val Tyr Leu Lys Ser Ser Asp Asn Arg Leu Leu Met 725 730 735 Ser Leu Leu Leu Phe Ile Phe Val Leu Phe Leu Cys Leu Phe Ser Tyr 740 745 750 Asn Cys Tyr Lys Gly Tyr Leu Pro Gly Gln Cys Leu Lys Phe Arg Ser 755 760 765 Ala Leu Leu Leu Gly Lys Lys Thr Pro Lys Ser Asp Phe Ser Asp Leu 770 775 780 Glu Glu Gln Ser Val Lys Glu Thr Leu Val Glu Pro Gly Ser Phe Se r Gln 785 790 795 800 Gln Asn Gly Asp His Pro Lys Pro Ala Leu Asp Thr Gly Tyr Glu Thr 805 810 815 Glu Gln Asp Thr Ile Thr Ser Lys Val Pro Thr Asp Arg Glu Asp Ser 820 825 830 Gln Arg Ile Asp Glu Leu Ser Ala Arg Asp Lys Pro Phe Asp Val Lys 835 840 845 Cys Glu Leu Lys Phe Ala Asp Ser Asp Ala Asp Gly Asp 850 855 860 <210> 2 <211> 2769 <212> DNA <213> Mouse <400> 2 gaattcggca cgaggccatc catgtgtgcc cgttgctgaa ggcctcggtg gcccctgccc 60 atgaggatgt gtgcccccgt tagggggctg ttcttggccc tggtggtagt gttgagaacc 120 gcggtggcat ttgcacctgt gcctcggctc acctgggaac atggagaggt aggtctggtg 180 cagtttcaca agccaggcat ctttaactac tcggccttgc tgatgagtga ggacaaagac 240 actctgtatg taggcgcccg ggaagcagtc tttgcagtga atgcgctgaa catctctgag 300 aagcaacatg aggtatattg gaaggtctct gaagacaaaa aatccaagtg tgcagagaag 360 gggaaatcaa agcagacgga atgcctaaac tacattcgag tactacagcc actaagcagc 420 acttccctct atgtgtgtgg gaccaatgcg ttccagccca cctgtgacca cctgaacttg 480 acatccttca agtttctggg gaaaagtgaa gatggcaaag gaagatgccc cttcgacccc 540 gcccacag ct acacatcagt catggttggg ggcgagctct actctgggac gtcctataat 600 ttcttgggca gtgaacccat catctctcga aactcttccc acagtccctt gaggacggag 660 tatgccatcc cgtggctgaa cgagcctagc ttcgtctttg ctgacgtgat ccagaaaagc 720 ccagatggtc cggagggtga agatgacaag gtctacttct tttttacgga ggtatccgtg 780 gagtacgaat tcgtcttcaa gttgatgatc ccgcgagttg ccagggtgtg caagggcgac 840 cagggcggcc tgcggacttt gcaaaaaaag tggacctcct tcctaaaggc caggctgatc 900 tgctccaagc cagacagtgg cctggtcttc aacatacttc aggatgtgtt tgtgctgagg 960 gccccgggcc tcaaggagcc tgtgttctat gcggtcttca ccccacagct gaacaatgtg 1020 ggtctgtcag cggtgtgcgc ctacacactg gccacggtgg aggcagtctt ctcccgtgga 1080 aagtacatgc agagtgccac agtggagcag tctcacacca agtgggtgcg ctacaatggc 1140 ccagtgccca ctccccgacc tggagcgtgt atcgacagtg aggcccgggc agccaactac 1200 accagctcct tgaatctccc agacaaaaca ctgcagtttg taaaagacca ccctttgatg 1260 gatgactcag tgaccccgat agacaacaga cccaagctga tcaaaaaaga tgtaaactac 1320 acccagatag tggtagacag gacccaggcc ctggatggga ctttctacga cgtcatgttc 1380 atcagcacag accggggagc tctgcataaa gcagtcatcc tcacaaaaga ggtgcatgtc 1440 atcgaggaga cccaactctt ccgggactct gaaccggtcc taactctgct gctatcgtca 1500 aagaagggga ggaagtttgt ctatgcaggc tccaactctg gagtggtcca agcgcccctg 1560 gcattctgcg aaaagcacgg tagctgtgaa gactgtgtgt tagcacggga cccctactgt 1620 gcctggagcc cagccatcaa ggcctgtgtt accctgcacc aggaagaggc ctccagcagg 1680 ggctggattc aggacatgag cggtgacaca tcctcatgcc tggataagag taaagaaagt 1740 ttcaaccagc attttttcaa gcacggcggc acagcggaac tcaaatgttt ccaaaagtcc 1800 aacctagccc gggtggtatg gaagttccag aatggcgagt tgaaggccgc aagtcccaag 1860 tacggctttg tgggcaggaa gcacctgctc atcttcaacc tgtcggacgg agacagcggc 1920 gtgtaccagt gcctgtcaga ggaaagggtg aggaataaaa cggtctccca gctgctggcc 1980 aagcacgttc tggaagtgaa gatggtacct cggacccccc cctcacctac ctcagaggat 2040 gttcagacag aaggtagtaa gatcacatcc aaaatgccgg ttggatctac ccaggggtcc 2100 tctcccccta ccccggctct gtgggcaacc tcccccagag ccgccaccct acctcccaag 2160 tcctcctccg gcacatcctg tgaaccaaag atggtcatca acacggtccc ccagctccac 2220 tcagagaaga cggtgtatct caagt ccagt gacaaccgcc tgctcatgtc tctcctcctc 2280 ttcatctttg tcctcttcct ctgcctcttt tcctacaact gctacaaggg ctacctgccc 2340 ggacagtgct taaaattccg ctcagccctg ctgcttggaa agaaaacacc caagtcagac 2400 ttctctgacc tggagcagag tgtgaaggag acactggtcg agcctgggag cttctcccag 2460 cagaacggcg accaccccaa gccagccctg gatacgggct atgaaacgga gcaggacacc 2520 atcaccagca aagtccccac ggatcgtgag gactcgcaac ggatcgatga actctctgcc 2580 cgggacaaac cgtttgatgt caagtgtgaa ctgaagtttg cagattcgga tgctgacggg 2640 gactgaggcc agcgtgtccc agcccatgcc cctctgtctt cgtggagagt gttgtgttga 2700 gcccattcag tagccgagtc ttgtcactct gtgccagcct cagtcctgtg tccccttttt 2760 ctctggttt 2769 <210> 3 <211> 862 <212> PRT <213> Human <400> 3 Met Arg LeAu Lae Gly Athlete Pro Gly 5 10 15 Met Phe Gly Thr Ala Met Ala Phe Ala Pro Ile Pro Arg Ile Thr Trp 20 25 30 Glu His Arg Glu Val His Leu Val Gln Phe His Glu Pro Asp Ile Tyr 35 40 45 Asn Tyr Ser Ala Leu Leu Leu Ser Glu Asp Lys Asp Thr Leu Tyr Ile 50 55 60 Gly Ala Arg Glu Ala Val Phe Ala Val Asn Ala Leu Asn Ile Ser Glu 65 70 75 80 Lys Gln His Glu Val Tyr Trp Lys Val Ser Glu Asp Lys Lys Ala Lys 85 90 95 Cys Ala Glu Lys Gly Lys Ser Lys Gln Thr Glu Cys Leu Asn Tyr Ile 100 105 110 Arg Val Leu Gln Pro Leu Ser Ala Thr Ser Leu Tyr Val Cys Gly Thr 115 120 125 Asn Ala Phe Gln Pro Ala Cys Asp His Leu Asn Leu Thr Ser Phe Lys 130 135 140 Phe Leu Gly Lys Asn Glu Asp Gly Lys Gly Arg Cys Pro Phe Asp Pro 145 150 155 160 Ala His Ser Tyr Thr Ser Val Met Val Asp Gly Glu Leu Tyr Ser Gly 165 170 175 Thr Ser Tyr Asn Phe Leu Gly Ser Glu Pro Ile Ile Ser Arg Asn Ser 180 185 190 Ser His Ser Pro Leu Arg Thr Glu Tyr Ala Ile Pro Trp Leu Asn Glu 195 200 205 Pro Ser Phe Val Phe Ala Asp Val Ile Arg Lys Ser Pro Asp Ser Pro 210 215 220 Asp Gly Glu Asp Asp Arg Val Tyr Phe Phe Phe Thr Glu Val Ser Val 225 230 235 240 Glu Tyr Glu Phe Val Phe Arg Val Leu Ile Pro Arg Ile Ala Arg Val 245 250 255 Cys Lys Gly Asp Gln Gly Gly Leu Arg Thr Leu Gln Lys Lys Trp Thr 260 265 270 Ser Phe Leu Lys Ala Arg Leu Ile Cys Se r Arg Pro Asp Ser Gly Leu 275 280 285 Val Phe Asn Val Leu Arg Asp Val Phe Val Leu Arg Ser Pro Gly Leu 290 295 300 300 Lys Val Pro Val Phe Tyr Ala Leu Phe Thr Pro Gln Leu Asn Asn Val 305 310 315 320 Gly Leu Ser Ala Val Cys Ala Tyr Asn Leu Ser Thr Ala Glu Glu Val 325 330 335 Phe Ser His Gly Lys Tyr Met Gln Ser Thr Thr Val Glu Gln Ser His 340 345 350 Thr Lys Trp Val Arg Tyr Asn Gly Pro Val Pro Lys Pro Arg Pro Gly 355 360 365 Ala Cys Ile Asp Ser Glu Ala Arg Ala Ala Asn Tyr Thr Ser Ser Leu 370 375 380 Asn Leu Pro Asp Lys Thr Leu Gln Phe Val Lys Asp His Pro Leu Met 385 390 395 400 Asp Asp Ser Val Thr Pro Ile Asp Asn Arg Pro Arg Leu Ile Lys Lys 405 410 415 Asp Val Asn Tyr Thr Gln Ile Val Val Asp Arg Thr Gln Ala Leu Asp 420 425 430 Gly Thr Val Tyr Asp Val Met Phe Val Ser Thr Asp Arg Gly Ala Leu 435 440 445 His Lys Ala Ile Ser Leu Glu His Ala Val His Ile Ile Glu Glu Thr 450 455 460 Gln Leu Phe Gln Asp Phe Glu Pro Val Gln Thr Leu Leu Leu Ser Ser 465 470 475 480 480 Lys Lys Gly Asn Arg Phe Val Tyr Ala Gl y Ser Asn Ser Gly Val Val 485 490 495 Gln Ala Pro Leu Ala Phe Cys Gly Lys His Gly Thr Cys Glu Asp Cys 500 505 510 Val Leu Ala Arg Asp Pro Tyr Cys Ala Trp Ser Pro Pro Thr Ala Thr 515 520 525 525 Cys Val Ala Leu His Gln Thr Glu Ser Pro Ser Arg Gly Leu Ile Gln 530 535 540 Glu Met Ser Gly Asp Ala Ser Val Cys Pro Asp Lys Ser Lys Gly Ser 545 550 555 560 Tyr Arg Gln His Phe Phe Lys His Gly Gly Thr Ala Glu Leu Lys Cys 565 570 575 Ser Gln Lys Ser Asn Leu Ala Arg Val Phe Trp Lys Phe Gln Asn Gly 580 585 590 Val Leu Lys Ala Glu Ser Pro Lys Tyr Gly Leu Met Gly Arg Lys Asn 595 600 605 Leu Leu Ile Phe Asn Leu Ser Glu Gly Asp Ser Gly Val Tyr Gln Cys 610 615 620 Leu Ser Glu Glu Arg Val Lys Asn Lys Thr Val Phe Gln Val Val Ala 625 630 635 640 Lys His Val Leu Glu Val Lys Val Val Pro Lys Pro Val Val Ala Pro 645 650 655 Thr Leu Ser Val Val Gln Thr Glu Gly Ser Arg Ile Ala Thr Lys Val 660 665 670 Leu Val Ala Ser Thr Gln Gly Ser Ser Pro Pro Thr Pro Ala Val Gln 675 680 685 Ala Thr Ser Ser Gly Ala Ile Thr Leu Pro P ro Lys Pro Ala Pro Thr 690 695 700 Gly Thr Ser Cys Glu Pro Lys Ile Val Ile Asn Thr Val Pro Gln Leu 705 710 715 720 His Ser Glu Lys Thr Met Tyr Leu Lys Ser Ser Asp Asn Arg Leu Leu 725 730 735 Met Ser Leu Phe Leu Phe Phe Phe Val Leu Phe Leu Cys Leu Phe Phe 740 745 750 Tyr Asn Cys Tyr Lys Gly Tyr Leu Pro Arg Gln Cys Leu Lys Phe Arg 755 760 760 765 Ser Ala Leu Leu Ile Gly Lys Lys Lys Pro Lys Ser Asp Phe Cys Asp 770 775 780 Arg Glu Gln Ser Leu Lys Glu Thr Leu Val Glu Pro Gly Ser Phe Ser 785 790 795 800 Gln Gln Asn Gly Glu His Pro Lys Pro Ala Leu Asp Thr Gly Tyr Glu 805 810 815 815 Thr Glu Gln Asp Thr Ile Thr Ser Lys Val Pro Thr Asp Arg Glu Asp 820 825 830 Ser Gln Arg Ile Asp Asp Leu Ser Ala Arg Asp Lys Pro Phe Asp Val 835 840 845 Lys Cys Glu Leu Lys Phe Ala Asp Ser Asp Ala Asp Gly Asp 850 855 860 < 210> 4 <211> 4157 <212> DNA <213> Human <400> 4 ctgagccgca tctgcaatag cacacttgcc cggccacctg ctgccgtgag cctttgctgc 60 tgaagcccct ggggtcgcct ctacctgatg aggatgtgca cccccatc gggctg tgtt tgggacagcg atggcatttg cacccatacc ccggatcacc 180 tgggagcaca gagaggtgca cctggtgcag tttcatgagc cagacatcta caactactca 240 gccttgctgc tgagcgagga caaggacacc ttgtacatag gtgcccggga ggcggtcttc 300 gctgtgaacg cactcaacat ctccgagaag cagcatgagg tgtattggaa ggtctcagaa 360 gacaaaaaag caaaatgtgc agaaaagggg aaatcaaaac agacagagtg cctcaactac 420 atccgggtgc tgcagccact cagcgccact tccctttacg tgtgtgggac caacgcattc 480 cagccggcct gtgaccacct gaacttaaca tcctttaagt ttctggggaa aaatgaagat 540 ggcaaaggaa gatgtccctt tgacccagca cacagctaca catccgtcat ggttgatgga 600 gaactttatt cggggacgtc gtataatttt ttgggaagtg aacccatcat ctcccgaaat 660 tcttcccaca gtcctctgag gacagaatat gcaatccctt ggctgaacga gcctagtttc 720 gtgtttgctg acgtgatccg aaaaagccca gacagccccg acggcgagga tgacagggtc 780 tacttcttct tcacggaggt gtctgtggag tatgagtttg tgttcagggt gctgatccca 840 cggatagcaa gagtgtgcaa gggggaccag ggcggcctga ggaccttgca gaagaaatgg 900 acctccttcc tgaaagcccg actcatctgc tcccggccag acagcggctt ggtcttcaat 960 gtgctgcggg atgtcttcgt gctcaggtcc ccgg gcctga aggtgcctgt gttctatgca 1020 ctcttcaccc cacagctgaa caacgtgggg ctgtcggcag tgtgcgccta caacctgtcc 1080 acagccgagg aggtcttctc ccacgggaag tacatgcaga gcaccacagt ggagcagtcc 1140 cacaccaagt gggtgcgcta taatggcccg gtacccaagc cgcggcctgg agcgtgcatc 1200 gacagcgagg cacgggccgc caactacacc agctccttga atttgccaga caagacgctg 1260 cagttcgtta aagaccaccc tttgatggat gactcggtaa ccccaataga caacaggccc 1320 aggttaatca agaaagatgt gaactacacc cagatcgtgg tggaccggac ccaggccctg 1380 gatgggactg tctatgatgt catgtttgtc agcacagacc ggggagctct gcacaaagcc 1440 atcagcctcg agcacgctgt tcacatcatc gaggagaccc agctcttcca ggactttgag 1500 ccagtccaga ccctgctgct gtcttcaaag aagggcaaca ggtttgtcta tgctggctct 1560 aactcgggcg tggtccaggc cccgctggcc ttctgtggga agcacggcac ctgcgaggac 1620 tgtgtgctgg cgcgggaccc ctactgcgcc tggagcccgc ccacagcgac ctgcgtggct 1680 ctgcaccaga ccgagagccc cagcaggggt ttgattcagg agatgagcgg cgatgcttct 1740 gtgtgcccgg ataaaagtaa aggaagttac cggcagcatt ttttcaagca cggtggcaca 1800 gcggaactga aatgctccca aaaatccaac ctggcccggg tcttttggaa gttccagaat 1860 ggcgtgttga aggccgagag ccccaagtac ggtcttatgg gcagaaaaaa cttgctcatc 1920 ttcaacttgt cagaaggaga cagtggggtg taccagtgcc tgtcagagga gagggttaag 1980 aacaaaacgg tcttccaagt ggtcgccaag cacgtcctgg aagtgaaggt ggttccaaag 2040 cccgtagtgg cccccacctt gtcagttgtt cagacagaag gtagtaggat tgccaccaaa 2100 gtgttggtgg catccaccca agggtcttct cccccaaccc cagccgtgca ggccacctcc 2160 tccggggcca tcacccttcc tcccaagcct gcgcccaccg gcacatcctg cgaaccaaag 2220 atcgtcatca acacggtccc ccagctccac tcggagaaaa ccatgtatct taagtccagc 2280 gacaaccgcc tcctcatgtc cctcttcctc ttcttctttg ttctcttcct ctgcctcttt 2340 ttctacaact gctataaggg atacctgccc agacagtgct tgaaattccg ctcggcccta 2400 ctaattggga agaagaagcc caagtcagat ttctgtgacc gtgagcagag cctgaaggag 2460 acgttagtag agccagggag cttctcccag cagaatgggg agcaccccaa gccagccctg 2520 gacaccggct atgagaccga gcaagacacc atcaccagca aagtccccac ggatagggag 2580 gactcacaga ggatcgacga cctttctgcc agggacaagc cctttgacgt caagtgtgag 2640 ctgaagttcg ctgactcaga cgcagatgga gactgaggcc ggctg tgcat ccccgctggt 2700 gcctcggctg cgacgtgtcc aggcgtggag agttttgtgt ttctcctgtt cagtatccga 2760 gtctcgtgca gtgctgcgta ggttagcccg catcgtgcag acaacctcag tcctcttgtc 2820 tattttctct tgggttgagc ctgtgacttg gtttctcttt gtccttttgg aaaaatgaca 2880 agcattgcat cccagtcttg tgttccgaag tcagtcggag tacttgaaga aggcccacgg 2940 gcggcacgga gttcctgagc cctttctgta gtgggggaaa ggtggctgga cctctgttgg 3000 ctgagaagag catcccttca gcttcccctc cccgtagcag ccactaaaag attatttaat 3060 tccagattgg aaatgacatt ttagtttatc agattggtaa cttatcgcct gttgtccaga 3120 ttggcacgaa ccttttcttc cacttaatta tttttttagg attttgcttt gattgtgttt 3180 atgtcatggg tcattttttt ttagttacag aagcagttgt gttaatattt agaagaagat 3240 gtatatcttc cagattttgt tatatatttg gcataaaata cggcttacgt tgcttaagat 3300 tctcagggat aaacttcctt ttgctaaatg cattctttct gcttttagaa atgtagacat 3360 aaacactccc cggagcccac tcaccttttt tctttttctt tttttttttt taactttatt 3420 ccttgaggga agcattgttt ttggagagat tttctttctg tacttcgttt tacttttctt 3480 tttttttaac ttttactctc tcgaagaaga ggaccttccc acatccacga ggtgggtttt 3540 gagcaaggga aggtagcctg gatgagctga gtggagccag gctggcccag agctgagatg 3600 ggagtgcggt acaatctgga gcccacagct gtcggtcaga acctcctgtg agacagatgg 3660 aaccttcaca agggcgcctt tggttctctg aacatctcct ttctcttctt gcttcaattg 3720 cttacccact gcctgcccag actttctatc cagcctcact gagctgccca ctactggaag 3780 ggaactgggc ctcggtggcc ggggccgcga gctgtgacca cagcaccctc aagcatacgg 3840 cgctgttcct gccactgtcc tgaagatgtg aatgggtggt acgatttcaa cactggttaa 3900 tttcacactc catctccccg ctttgtaaat acccatcggg aagagacttt ttttccatgg 3960 tgaagagcaa taaactctgg atgtttgtgc gcgtgtgtgg acagtcttat cttccagcat 4020 gataggattt gaccattttg gtgtaaacat ttgtgttttta taagatttac cttgttttta 4080 tttttctact <tt> gattgta tacatttgga aagtaccaa4c1 ag <1> > 5 gctgtcgact gtgtgcccgt tgctgaaggc ct 32 <210> 6 <211> 53 <212> DNA <213> Artifical Sequence <220> <223> <400> 6 gacggatcct acttactttg ctttgcttgc ttgagataca ccgtcttctc tga 53

[0068]

[Brief description of the drawings]

FIG. 1 shows the activity of CD100 to promote the production of IgG1-specific antibodies in Example 1.

2 shows the activity of CD100 for inducing antibody production in vivo in Example 2. FIG.

FIG. 3 shows the targeting vector used for the production of CD100 knockout mice in Example 3, CD100 expected in wild-type mice and knockout mice.
The genetic map of the gene, the CD100 gene structure in wild-type and knockout mice, and the expression level of CD100 protein in wild-type and knockout mice are shown.

FIG. 4 shows CD5 expression levels in wild-type mice and CD100 knockout mice in Example 4.

FIG. 5 shows antibody production against a TD (T cell-dependent) antigen in Example 5.

FIG. 6 shows the loss of T cell reactivity in CD100 knockout mice in Example 6.

FIG. 7 shows the increase in soluble CD100 and autoantibody levels with age in MRL / lpr mice in Example 8.

FIG. 8 shows the loss of dendritic cell reactivity in CD100 knockout mice in Example 9.

9 shows T cell hyperreactivity in CD100 transgenic mice in Example 10. FIG.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61P 37/02 A61P 37/02 C07K 14/52 C07K 14/52 C12N 5/10 C12P 21/02 C 15 / 09 ZNA C12N 5/00 B C12P 21/02 15/00 ZNAA

Claims (4)

[Claims] (1) An agent for inducing class switching of immunoglobulin, which comprises CD100 or a salt thereof. 2. An agent for inducing an immunoglobulin class switch, comprising a DNA encoding CD100. 3. A dendritic cell activator comprising CD100 or a salt thereof. 4. A dendritic cell activator comprising a DNA encoding CD100.