JP2001029090A - Novel polypeptide - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a novel polypeptide that comprises a secretory polypeptide having a specific amino acid sequence and is useful for treatment and prevention of cancers, immunological diseases, pulmonary function impairment, liver function failure, infections, gastrointestinal injury and the like, and for searching its activity accelerator or inhibitory substance. SOLUTION: This is a novel secretory polypeptide including the same amino acid sequence or substantially same amino acid sequence as that selected from formula I, formula II, or the like (or a salt thereof), is useful as a therapeutic agent or a preventive for a variety of diseases, for example, cancers, immunological diseases, pulmonary function impairment, liver function failure, infections, gastrointestinal injury, and the like, and as a reagent for screening the compounds that promotes or inhibits its activity. This polypeptide is prepared by collecting a gene from cDNA library originating from tissues, for example, brain, testis, heart, or the like or through the RT-PCR technique by using an mRNA originating from these tissues as a template, incorporating the gene into a vector, transforming a host cell with the recombinant vector and culturing the transformed cell.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a novel secretory polypeptide, a novel use of the secretory polypeptide, and the like.

[0002]

2. Description of the Related Art Living organisms communicate with each other between cells or tissues to generate, differentiate, grow, repair,
We make integrated adjustments such as maintaining homeostasis,
In many cases, extracellularly secreted protein factors play an important role as signal transmitters. For example, a series of secretory factors (humoral factors) called cytokines
Is a polypeptide having a molecular weight of about 20,000 to 50,000 and frequently modified with a sugar chain, and is a hormone-like molecule mainly acting on the immune system and the hematopoietic system. Until now, various types of monokine found as macrophage activating factor and migration inhibitory factor released from monocyte cells, interferon α, β, γ, and T cells that activate various cells to exert antiviral action A variety of polypeptides called lymphokines, which have been produced from Escherichia coli and have been considered as lymphocyte proliferation / differentiation factors, have subsequently been reported in a variety of biological activities one after another, and are often collectively included in the category of cytokines. A feature of the action of cytokines is that the activity as autocrine or paracrine is superior. On the other hand, humoral factors such as peptide hormones and growth factors produced from endocrine tissues show endocrine-like activity, and many of these humoral factors have potential for research and drug discovery to explore their relevance to disease. The pursuit of development research is being actively pursued. By the way, many of these important protein factors for living organisms have been discovered so far using intrinsic biological activity as an index or based on structural similarity with existing bioactive polypeptides. Things. However, considering the subtle maintenance of the homeostasis of living organisms found in higher organisms such as mammals, there are many unknown factors other than these known bioactive polypeptides and peptides, and play an important role. It is expected that it is enough. In recent years, a huge number of novel gene candidates have been identified through large-scale nucleotide sequencing and genome structure analysis projects of cDNA libraries of various organisms including humans. Attempts are being made to predict the function of the drug and apply it to biology, medicine, veterinary medicine, agriculture, etc. [Trends in Biotechnology, Vol. 14, 294 (1996)
Year)]. However, in general, such sequence information is often fragmentary and inaccurate, and at present, it is not easy to directly select a completely new and useful new gene from these. For example, there are many partial reading errors in the sequence information obtained by large-scale nucleotide sequencing. To know the correct open reading frame (ORF) and amino acid sequence accurately, it is necessary to use a base sequence without errors. Whether it can be expected as a source and secretory factor (humoral factor),
It was necessary to judge the suitability. The present invention has found a novel humoral factor from such a viewpoint from a large-scale cDNA sequence analysis and subsequent detailed information analysis.

[0003]

DISCLOSURE OF THE INVENTION The present invention is to find a novel humoral factor, and to provide a novel polypeptide, a partial peptide thereof, or a salt or group thereof, which can be used in biology, medicine, pharmacy, veterinary medicine and the like. It is an object of the present invention to provide a recombinant vector, a transformant, a method for producing the polypeptide, a drug containing the polypeptide, a partial peptide, and an antibody against the polypeptide.

[0004]

Means for Solving the Problems The present inventors have conducted a sincere study to solve the above-mentioned problems, and as a result, have obtained a large-scale CDD.
From the NA nucleotide sequence database, a cDNA encoding the novel secretory polypeptide was searched, and a plurality of structures of the novel secretory polypeptide meeting the purpose were identified. The present inventors have further studied based on these findings, and as a result, have completed the present invention. That is, the present invention is characterized in that (1) contains an amino acid sequence identical or substantially identical to at least one (preferably one) amino acid sequence selected from SEQ ID NO: 1 to SEQ ID NO: 15. Or a salt thereof, (2)
(C) culturing a transformant transformed with a recombinant vector containing a DNA encoding the polypeptide according to (1), and producing the polypeptide; How to make that salt,
(3) an antibody against the polypeptide or a salt thereof according to the above (1); (4) a polypeptide or a salt thereof according to the above (1), wherein the polypeptide or a salt thereof according to the above (1) is used. A method for screening a compound or a salt thereof that promotes or inhibits the activity, (5) promoting or inhibiting the activity of the polypeptide or the salt thereof according to the above (1) comprising the polypeptide or the salt thereof according to the above (1) (6) The activity of the polypeptide or salt thereof according to (1), obtained using the screening method according to (4) or the screening kit according to (5). Compounds or salts thereof that promote or inhibit
(7) Contains a compound or salt thereof that promotes or inhibits the activity of the polypeptide or salt thereof according to (1) obtained by using the screening method according to (4) or the screening kit according to (5). And (8) a medicament containing the polypeptide of the above (1) or a salt thereof. Furthermore, the present invention relates to (9) an amino acid sequence substantially identical to one amino acid sequence selected from the amino acid sequences represented by SEQ ID NO: 1 to SEQ ID NO: 15; And about 50% or more (preferably about 60%) of one amino acid sequence selected from the amino acid sequences represented by
% Or more, more preferably about 70% or more, more preferably about 80% or more, particularly preferably about 90% or more, and most preferably about 95% or more). (10) An amino acid sequence substantially identical to one amino acid sequence selected from the amino acid sequences represented by SEQ ID NO: 1 to SEQ ID NO: 15 is selected from SEQ ID NO: 1 to SEQ ID NO: 15 An amino acid sequence in which one or more (preferably about 1 to 30) amino acids have been deleted in one amino acid sequence, and one or two amino acids in one amino acid sequence selected from SEQ ID NO: 1 to SEQ ID NO: 15 An amino acid sequence to which at least (preferably about 1 to 30) amino acids have been added, one amino acid sequence selected from SEQ ID NO: 1 to SEQ ID NO: 15 1 or 2 or more (preferably,
(1 to 30 amino acids), wherein the amino acid sequence is an amino acid sequence in which amino acids are substituted with other amino acids, or an amino acid sequence obtained by combining them. (11) The polypeptide according to (1), which encodes the polypeptide according to (1). And (12) a recombinant vector containing a DNA encoding the polypeptide described in (1) above. Further polypeptides of the present invention, molecular weight markers, tissue markers, chromosome mapping, genetic disease identification, primers,
It can also be used for basic research such as probe design.

[0005]

BEST MODE FOR CARRYING OUT THE INVENTION The polypeptide of the present invention containing at least one amino acid sequence selected from SEQ ID NO: 1 to SEQ ID NO: 15 (hereinafter sometimes referred to as the polypeptide of the present invention) is Warm-blooded animals (eg, guinea pigs, rats, mice, chickens, rabbits, pigs,
Cells of sheep, cattle, monkeys, etc. (for example, hepatocytes, spleen cells, nerve cells, glial cells, pancreatic β cells, bone marrow cells,
Mesangial cells, Langerhans cells, epidermal cells, epithelial cells, endothelial cells, fibroblasts, fibrocytes, muscle cells, adipocytes, immune cells (eg, macrophages, T cells, B cells, natural killer cells, mast cells, neutrophils Spheres, basophils, eosinophils, monocytes), megakaryocytes, synovial cells, chondrocytes, osteocytes, osteoblasts, osteoclasts, mammary cells, or stromal cells, or precursor cells of these cells, Stem cells or cancer cells) or any tissue in which these cells are present, such as the brain, various parts of the brain (eg, olfactory bulb, amygdala, basal sphere, hippocampus, thalamus, hypothalamus, cerebral cortex, medulla, cerebellum) , Spinal cord, pituitary, stomach, pancreas, kidney, liver, gonads,
Thyroid, gallbladder, bone marrow, adrenal gland, skin, muscle, lung, digestive tract (eg, large intestine, small intestine), blood vessels, heart, thymus, spleen, salivary gland, peripheral blood, prostate, testicle, ovary, placenta, uterus, bone, cartilage , Joints, skeletal muscle, etc., a recombinant polypeptide, or a synthetic polypeptide. Further, since the polypeptide of the present invention has a signal peptide, the polypeptide can be efficiently secreted out of cells.

As an amino acid sequence substantially identical to one amino acid sequence selected from SEQ ID NO: 1 to SEQ ID NO: 15, about 50% of one amino acid sequence selected from SEQ ID NO: 1 to SEQ ID NO: 15 Or more, preferably about 60% or more, more preferably about 70% or more, more preferably about 80% or more, particularly preferably about 90% or more,
Most preferably, an amino acid sequence having about 95% or more homology is exemplified. As the polypeptide of the present invention having an amino acid sequence substantially identical to one amino acid sequence selected from SEQ ID NO: 1 to SEQ ID NO: 15,
For example, it has an amino acid sequence substantially identical to one amino acid sequence selected from SEQ ID NO: 1 to SEQ ID NO: 15, and has one amino acid sequence selected from SEQ ID NO: 1 to SEQ ID NO: 15 Polypeptides having substantially the same properties as polypeptides are preferred.
Substantially the same property includes, for example, being secreted and acting as a humoral factor. Substantially the same means that those properties are qualitatively the same.
Therefore, properties such as secretion and solubility are equivalent (eg,
About 0.1 to 100 times, preferably about 0.5 to 10 times, more preferably 0.5 to 2 times),
Quantitative factors such as the degree of these properties and the molecular weight of the polypeptide may vary. Specifically, SEQ ID NO: 1
A polypeptide having an amino acid sequence consisting of the 22nd amino acid to the 125th amino acid of SEQ ID NO: 2,
A polypeptide having an amino acid sequence consisting of the 24th amino acid to the 121st amino acid of SEQ ID NO: 3,
A polypeptide having an amino acid sequence consisting of the 20th amino acid to the 223th amino acid of SEQ ID NO: 4,
A polypeptide having an amino acid sequence consisting of the 22nd amino acid to the 248th amino acid of SEQ ID NO: 5,
A polypeptide having an amino acid sequence consisting of the 20th amino acid to the 173rd amino acid of SEQ ID NO: 6,
A polypeptide having an amino acid sequence consisting of the 21st amino acid to the 261st amino acid of SEQ ID NO: 7,
A polypeptide having an amino acid sequence consisting of the 31st amino acid to the 243rd amino acid of SEQ ID NO: 8,
A polypeptide having an amino acid sequence consisting of the 19th amino acid to the 149th amino acid of SEQ ID NO: 9,
A polypeptide having an amino acid sequence consisting of the 21st amino acid to the 136th amino acid of SEQ ID NO: 1,
A polypeptide having an amino acid sequence consisting of the 23rd amino acid to the 123rd amino acid of SEQ ID NO: 0, SEQ ID NO:
A polypeptide having an amino acid sequence consisting of amino acids 21 to 163 of SEQ ID NO: 11, a polypeptide having an amino acid sequence consisting of amino acids 19 to 301 of SEQ ID NO: 12, and a polypeptide of SEQ ID NO: 13 A polypeptide having an amino acid sequence consisting of the 27th amino acid to the 69th amino acid; a polypeptide having an amino acid sequence consisting of the 24th amino acid to the 69th amino acid of SEQ ID NO: 14; And a polypeptide having an amino acid sequence consisting of the amino acid at position 197 to the amino acid at position 197.

[0007] More specifically, the polypeptides of the present invention include, for example, SEQ ID NO: 1 to SEQ ID NO: 15
Amino acids in which one or more (preferably about 1 to 30, preferably about 1 to 10, more preferably number (1 to 5)) amino acids in one amino acid sequence selected from Sequence, SEQ ID NO: 1 to SEQ ID NO:
One or two or more (preferably about 1 to 30, preferably 1 to 10)
Amino acid sequence to which about 1 amino acid sequence is added, more preferably 1 to 5 amino acids, and 1 or 2 is added to one amino acid sequence selected from SEQ ID NO: 1 to SEQ ID NO: 15.
Or more (preferably about 1 to 30, preferably 1 to 30)
Approximately 10, more preferably number (1 to 5) amino acids, and one or more (preferably, one or more) amino acid sequences selected from an amino acid sequence selected from SEQ ID NO: 1 to SEQ ID NO: 15 , About 1 to 30, preferably about 1 to 10, more preferably number (1 to 5))
An amino acid sequence in which the amino acid of the above is replaced with another amino acid,
Alternatively, so-called muteins such as polypeptides containing an amino acid sequence obtained by combining them are also included. When the amino acid sequence is inserted, deleted or substituted as described above, the position of the insertion, deletion or substitution is not particularly limited.

[0008] In the present specification, the left end is the N-terminus (amino terminus) and the right end is the C-terminus (carboxyl terminus) according to the convention of peptide labeling. SEQ ID NO: 1
The polypeptide of the present invention, including the polypeptide containing the amino acid sequence represented by the following formula, usually has a carboxyl group (—COOH) or a carboxylate at the C-terminus.
(—COO ⁻ ), but the C-terminal is an amide (—CON
H ₂ ) or an ester (—COOR).
Here, as R in the ester, for example, methyl,
A C _1-6 alkyl group such as ethyl, n-propyl, isopropyl or n-butyl, for example cyclopentyl,
C _3-8 cycloalkyl groups such as cyclohexyl, for example, C _6-12 aryl groups such as phenyl, α-naphthyl,
For example, phenyl-C _1-2 such as benzyl and phenethyl
In addition to an alkyl group or a C _7-14 aralkyl group such as an α-naphthyl-C _1-2 alkyl group such as α-naphthylmethyl, a pivaloyloxymethyl group commonly used as an oral ester and the like are used. The polypeptide of the present invention may comprise C
Carboxyl group (or carboxylate) other than at the end
When the carboxyl group is amidated or esterified, it is also included in the polypeptide of the present invention. Examples of the ester in this case include the above-mentioned C
A terminal ester or the like is used. Further, the polypeptides of the present invention, amino acid residues (eg, methionine residue) of the N-terminal amino group protecting group (e.g., formyl group, such as C _1-6 alkanoyl such as acetyl group C _1-6 Acyl-group-protected), N-terminal glutamine residue generated by cleavage in vivo, pyroglutamine-oxidized, substituent on the side chain of amino acid in the molecule (for example, -O
H, -SH, amino group, imidazole group, indole group, guanidino group, etc. are suitable protecting groups (for example, C _1-6 acyl groups such as C _1-6 alkanoyl groups such as formyl group and acetyl group). Protected ones and complex proteins such as so-called glycoproteins to which sugar chains are bound are also included.

As the polypeptide of the present invention or a salt thereof, salts with physiologically acceptable acids (eg, inorganic acids, organic acids) and bases (eg, alkali metal salts) are used. Are preferred. Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) Acids, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used. The polypeptide of the present invention or a salt thereof can be produced from the above-mentioned human or warm-blooded animal cells or tissues by a known method for purifying a polypeptide, or a DNA encoding the polypeptide described below.
Can also be produced by culturing a transformant containing Further, it can also be produced according to the peptide synthesis method described later. When producing from human or mammalian tissues or cells, the homogenized human or mammalian tissues or cells are extracted with an acid or the like, and the extract is subjected to chromatography such as reverse phase chromatography or ion exchange chromatography. Can be purified and isolated.

For the synthesis of the polypeptide of the present invention or a salt thereof, or an amide thereof or a salt thereof, a commercially available resin for peptide synthesis can be usually used. Examples of such a resin include chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin,
-Methylbenzhydrylamine resin, PAM resin, 4-hydroxymethylmethylphenylacetamidomethyl resin, polyacrylamide resin, 4- (2 ', 4'-dimethoxyphenyl-hydroxymethyl) phenoxy resin, 4-
(2 ′, 4′-dimethoxyphenyl-Fmocaminoethyl) phenoxy resin. Using such a resin, an amino acid having an α-amino group and a side chain functional group appropriately protected is condensed on the resin in accordance with the sequence of the target polypeptide according to various condensation methods known per se. At the end of the reaction, the polypeptide is cleaved from the resin, and at the same time, various protecting groups are removed. Further, an intramolecular disulfide bond formation reaction is carried out in a highly diluted solution to obtain a target polypeptide or an amide thereof. Regarding the condensation of the protected amino acids described above, various activating reagents that can be used for peptide synthesis can be used, and carbodiimides are particularly preferable. As the carbodiimides, DCC, N, N′-diisopropylcarbodiimide, N-ethyl-N ′-(3-dimethylaminoprolyl) carbodiimide and the like are used. Activation by these includes racemization inhibiting additives (eg, HOB
t, HOOBt) with the protected amino acid directly to the resin or symmetrical anhydride or HOBt ester or HO
The protected amino acid can be added as an OBt ester to the resin after activation.

The solvent used for activating the protected amino acid or condensing with the resin can be appropriately selected from solvents known to be usable for the peptide condensation reaction. For example, acid amides such as N, N-dimethylformamide, N, N-dimethylacetamide, N-methylpyrrolidone, halogenated hydrocarbons such as methylene chloride and chloroform, alcohols such as trifluoroethanol,
Sulfoxides such as dimethylsulfoxide, ethers such as pyridine, dioxane, and tetrahydrofuran; nitriles such as acetonitrile and propionitrile; esters such as methyl acetate and ethyl acetate; or an appropriate mixture thereof are used. The reaction temperature is appropriately selected from a range known to be usable for the peptide bond formation reaction, and is usually appropriately selected from a range of about -20 ° C to 50 ° C. The activated amino acid derivative is usually used in a 1.5 to 4-fold excess. As a result of the test using the ninhydrin reaction, when the condensation is insufficient, sufficient condensation can be performed by repeating the condensation reaction without removing the protecting group. When sufficient condensation cannot be obtained even by repeating the reaction, unreacted amino acids can be acetylated using acetic anhydride or acetylimidazole to prevent the subsequent reaction from being affected.

Examples of the protecting group for the amino group of the starting material include Z, Boc, t-pentyloxycarbonyl, isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl, Cl-Z, Br-Z, adamantyloxycarbonyl, Trifluoroacetyl, phthaloyl, formyl, 2
-Nitrophenylsulfenyl, diphenylphosphinothioyl, Fmoc and the like are used. The carboxyl group is
For example, alkyl esterification (eg, methyl, ethyl, propyl, butyl, t-butyl, cyclopentyl,
Cyclohexyl, cycloheptyl, cyclooctyl, 2
Linear, branched or cyclic alkyl esterification such as adamantyl), aralkyl esterification (eg, benzyl ester, 4-nitrobenzyl ester, 4-methoxybenzyl ester, 4-chlorobenzyl ester, benzhydryl esterification) , Phenacyl esterification, benzyloxycarbonyl hydrazide, t-butoxycarbonyl hydrazide, trityl hydrazide and the like. The hydroxyl group of serine is
For example, it can be protected by esterification or etherification. Suitable groups for this esterification include, for example, lower (C _1-6 ) alkanoyl groups such as acetyl groups, aroyl groups such as benzoyl groups, and groups derived from carbonic acid such as benzyloxycarbonyl groups and ethoxycarbonyl groups. Used. Examples of a group suitable for etherification include a benzyl group, a tetrahydropyranyl group, and a t-butyl group. Examples of the protecting group for the phenolic hydroxyl group of tyrosine include, for example, Bzl, Cl ₂ -Bzl,
Nitrobenzyl, Br-Z, t-butyl and the like are used.
As a protecting group for imidazole of histidine, for example,
Tos, 4-methoxy-2,3,6-trimethylbenzenesulfonyl, DNP, benzyloxymethyl, Bum, Boc, Trt, Fmoc
Are used.

[0013] The activated carboxyl groups of the raw materials include, for example, corresponding acid anhydrides, azides, active esters [alcohols (eg, pentachlorophenol, 2,4,5-trichlorophenol, 2,4- Dinitrophenol, cyanomethyl alcohol, para-nitrophenol, HONB, N-hydroxysuccinimide, N-hydroxyphthalimide, and esters with HOBt). As the activated amino group of the raw material, for example, a corresponding phosphoric amide is used. As a method for removing (eliminating) the protecting group, for example, catalytic reduction in a hydrogen stream in the presence of a catalyst such as Pd-black or Pd-carbon,
Also, acid treatment with anhydrous hydrogen fluoride, methanesulfonic acid, trifluoromethanesulfonic acid, trifluoroacetic acid or a mixture thereof, base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine, etc., and reduction with sodium in liquid ammonia Also used. The elimination reaction by the above acid treatment is generally performed at a temperature of about -20 ° C to 40 ° C,
In the acid treatment, for example, anisole, phenol,
It is effective to add a cation scavenger such as thioanisole, metacresol, paracresol, dimethylsulfide, 1,4-butanedithiol, 1,2-ethanedithiol and the like. In addition, the 2,4-dinitrophenyl group used as the imidazole protecting group of histidine is removed by thiophenol treatment, and the formyl group used as the indole protecting group of tryptophan is 1,2-ethanedithiol, 1,4-butane described above. In addition to deprotection by acid treatment in the presence of dithiol or the like, it is also removed by alkali treatment with dilute sodium hydroxide solution, dilute ammonia or the like.

The protection of the functional group which should not be involved in the reaction of the raw material, the protecting group, the elimination of the protective group, the activation of the functional group involved in the reaction, and the like can be appropriately selected from known groups or known means. . As another method for obtaining an amide form of the polypeptide, for example, first, after protecting the α-carboxyl group of the carboxy-terminal amino acid by amidation, the peptide (polypeptide) chain is extended to a desired chain length on the amino group side. After that, a polypeptide in which only the protecting group of the N-terminal α-amino group of the peptide chain is removed and a polypeptide in which only the protecting group of the C-terminal carboxyl group is removed,
The two polypeptides are condensed in a mixed solvent as described above. Details of the condensation reaction are the same as described above.
After purifying the protected polypeptide obtained by the condensation, all the protecting groups are removed by the above-mentioned method to obtain a desired crude polypeptide. The crude polypeptide is purified by various known purification means, and the main fraction is lyophilized to obtain an amide of the desired polypeptide. To obtain an ester of the polypeptide, for example, after condensing the α-carboxyl group of the carboxy terminal amino acid with a desired alcohol to form an amino acid ester,
An ester of the desired polypeptide can be obtained in the same manner as the amide of the polypeptide.

The polypeptide of the present invention or a salt thereof can be produced according to a peptide synthesis method known per se. Peptide synthesis methods include, for example, solid phase synthesis,
Any of the liquid phase synthesis methods may be used. That is, the target peptide can be produced by condensing a partial peptide or amino acid capable of constituting the partial peptide of the present invention with the remaining portion, and removing the protective group when the product has a protective group. Examples of the known condensation method and elimination of the protecting group include the methods described in 1 to 5 below. 1. M. Bodanszky and MA Ondetti, Peptide Synthesis, Interscience Publish
ers, New York (1966) 2. Schroeder and Luebke, The Peptid
e), Academic Press, New York (1965) Nobuo Izumiya et al., Fundamentals and experiments of peptide synthesis, Maruzen Co., Ltd.
(1975) 4. Haruaki Yajima and Shunpei Sakakibara, Laboratory for Biochemical Experiments 1, Protein Chemistry IV, 205, (1977) Supervised by Haruaki Yajima, Development of Continuing Pharmaceuticals, Vol. 14, Peptide Synthesis, Hirokawa Shoten In addition, after the reaction, combine normal purification methods such as solvent extraction, distillation, column chromatography, liquid chromatography, recrystallization, etc. The polypeptide of the present invention can be purified and isolated. When the polypeptide obtained by the above method is a free form, it can be converted to an appropriate salt by a known method or a method analogous thereto, and conversely, when the polypeptide is obtained as a salt, the known method or analogous method It can be converted into a free form or another salt by a method.

DNA encoding the polypeptide of the present invention
May be any as long as it contains a base sequence encoding the polypeptide of the present invention described above. In addition, any of genomic DNA, cDNA derived from the above-mentioned cells and tissues, and synthetic DNA may be used. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. In addition, Reverse Transcription was directly performed using a total RNA or mRNA fraction prepared from the cells and tissues described above.
scriptase Polymerase Chain Reaction (RT-P
It can also be amplified by the CR method). As the DNA encoding the polypeptide of the present invention, for example, a DNA containing at least one base sequence selected from SEQ ID NO: 16 to SEQ ID NO: 30, or at least selected from SEQ ID NO: 16 to SEQ ID NO: 30 It has a base sequence that hybridizes under stringent conditions with one base sequence and has substantially the same properties as the polypeptide of the present invention (eg, DNA encoding a polypeptide having immunogenicity and the like). And any DNA encoding a polypeptide having substantially the same properties as the polypeptide of the present invention, and more specifically, selected from SEQ ID NO: 16 to SEQ ID NO: 30. DN containing at least one base sequence
A, or a nucleotide sequence that hybridizes under stringent conditions with at least one nucleotide sequence selected from SEQ ID NO: 16 to SEQ ID NO: 30, and has substantially the same property as the polypeptide of the present invention ( Eg, a DNA encoding a polypeptide having immunogenicity and the like, and a DNA encoding a polypeptide having substantially the same properties as the polypeptide of the present invention.
More specifically, SEQ ID NO: 16 to SEQ ID NO: 3
D containing at least one base sequence selected from 0
NA or a nucleotide sequence that hybridizes under stringent conditions with at least one nucleotide sequence selected from SEQ ID NO: 16 to SEQ ID NO: 30, and has substantially the same property as the polypeptide of the present invention ( Examples thereof include a DNA encoding a polypeptide having a secretory action, etc.), and a DNA encoding a polypeptide having substantially the same properties as the polypeptide of the present invention.

The DNA that can hybridize with at least one base sequence selected from SEQ ID NO: 16 to SEQ ID NO: 30 under high stringency conditions includes
For example, DNA containing a base sequence having about 60% or more, preferably about 70% or more, more preferably about 80% or more homology with at least one base sequence selected from SEQ ID NO: 16 to SEQ ID NO: 30 Are used. More specifically, the DNA encoding the polypeptide containing the amino acid sequence represented by SEQ ID NO: 1 includes a DNA containing the base sequence represented by SEQ ID NO: 16
The DNA encoding the polypeptide having the amino acid sequence represented by SEQ ID NO: 2 as the NA includes the DNA comprising the base sequence represented by SEQ ID NO: 17 as the amino acid represented by SEQ ID NO: 3. As the DNA encoding the polypeptide containing the sequence, the DNA containing the nucleotide sequence represented by SEQ ID NO: 18 is the DNA encoding the polypeptide containing the amino acid sequence represented by SEQ ID NO: 4. The DNA containing the nucleotide sequence represented by SEQ ID NO: 19 is a DNA encoding the polypeptide containing the amino acid sequence represented by SEQ ID NO: 5, DN contained
A is a DNA encoding a polypeptide containing the amino acid sequence represented by SEQ ID NO: 6;
The DNA containing the nucleotide sequence represented by SEQ ID NO: 22 is a DNA encoding the polypeptide containing the amino acid sequence represented by SEQ ID NO: 7. Encoding a polypeptide containing the amino acid sequence represented by SEQ ID NO: 8
As the NA, a DNA containing the base sequence represented by SEQ ID NO: 23 is a DNA encoding a polypeptide containing the amino acid sequence represented by SEQ ID NO: 9;
DNA containing the base sequence represented by SEQ ID NO: 24
However, the DNA encoding the polypeptide containing the amino acid sequence represented by SEQ ID NO: 10 includes SEQ ID NO:
The DNA containing the nucleotide sequence represented by SEQ ID NO: 26 is a DNA encoding the polypeptide containing the amino acid sequence represented by SEQ ID NO: 11 as the DNA containing the nucleotide sequence represented by SEQ ID NO: 11. As the DNA encoding the polypeptide containing the amino acid sequence represented by SEQ ID NO: 12, the DNA containing the base sequence represented by SEQ ID NO: 27 is the amino acid sequence represented by SEQ ID NO: 13. The DNA encoding the containing polypeptide includes a DNA containing the base sequence represented by SEQ ID NO: 28.
As the DNA encoding the polypeptide having the amino acid sequence represented by SEQ ID NO: 14 as the NA, the DNA containing the base sequence represented by SEQ ID NO: 29 is the amino acid represented by SEQ ID NO: 15 Examples of the DNA encoding the polypeptide containing the sequence include a DNA containing the nucleotide sequence represented by SEQ ID NO: 30. Hybridization can be performed by a method known per se or a method analogous thereto, for example, molecular cloning (Mole
cular Cloning) 2nd (J. Sambrook et al., Cold Sprin)
g Harbor Lab. Press, 1989). When a commercially available library is used, it can be performed according to the method described in the attached instruction manual. More preferably, it can be performed under high stringent conditions. High stringency conditions include, for example, a sodium concentration of about 19
４０40 mM, preferably about 19-20 mM, and a temperature of about 50-70 ° C., preferably about 60-65 ° C.

Means for cloning DNA that completely encodes the polypeptide of the present invention include synthetic DNA primers having a partial nucleotide sequence of the polypeptide of the present invention and templates derived from tissues or cells in which the polypeptide is expressed. Amplified by PCR using PCR, or a DNA integrated into an appropriate vector, labeled with a DNA fragment encoding a partial or entire region of the polypeptide of the present invention or a synthetic DNA, and expressed with the polypeptide Selection can be carried out by hybridization to a library derived from a tissue or cell in which the cell is used. Hybridization methods include, for example, molecular
Cloning (Molecular Cloning) 2nd (J. Sambrook
et al., Cold Spring Harbor Lab. Press, 1989). When a commercially available library is used, it can be performed according to the method described in the attached instruction manual. Conversion of the base sequence of DNA can be performed by PCR or a known kit, for example, Mutan ^™ -
G (Takara Shuzo Co., Ltd.), Mutan ^™ -K (Takara Shuzo Co., Ltd.) or the like can be used according to a method known per se such as the Gupped duplex method or the Kunkel method, or a method analogous thereto. D encoding the cloned polypeptide
NA can be used as it is depending on the purpose, or can be used after digestion with a restriction enzyme or addition of a linker, if desired. The DNA may have ATG as a translation initiation codon at the 5 'end and TAA, TGA or TAG as a translation stop codon at the 3' end. These translation start codon and translation stop codon
It can also be added using an appropriate synthetic DNA adapter. An expression vector for the polypeptide of the present invention may be prepared, for example, by (a) cutting out a DNA fragment of interest from DNA encoding the polypeptide of the present invention, and (b) placing the DNA fragment downstream of a promoter in an appropriate expression vector. It can be manufactured by connecting.

As a vector, a plasmid derived from Escherichia coli (eg, pBR322, pBR325, pUC12, pUC12) is used.
UC13), a plasmid derived from Bacillus subtilis (eg, pUB11)
0, pTP5, pC194), yeast-derived plasmids (eg, pSH19, pSH15), bacteriophages such as phage λ, animal viruses such as retrovirus, vaccinia virus, baculovirus, etc.
A1-11, pXT1, pRc / CMV, pRc / RS
V, pcDNAI / Neo, etc. are used. The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression. For example, when animal cells are used as hosts, SRα promoter, SV40 promoter, L
TR promoter, CMV promoter, HSV-TK
Promoters and the like. Of these, CMV
(Cytomegalovirus) promoter, SRα promoter and the like are preferably used. When the host is Escherichia, trp promoter, lac promoter, recA promoter, .lambda.P _L promoter,
When the host is a bacterium of the genus Bacillus, the SPO1 promoter, the S7 promoter,
When the host is yeast, such as a PO2 promoter and a penP promoter, a PHO5 promoter, a PGK promoter, a GAP promoter, an ADH promoter and the like are preferable. When the host is an insect cell, a polyhedrin promoter, a P10 promoter and the like are preferable.

[0020] In addition to the above, an expression vector optionally containing an enhancer, a splicing signal, a poly-A addition signal, a selection marker, an SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori) and the like may be used. Can be used. As a selection marker, for example, dihydrofolate reductase (hereinafter, dhfr)
Gene (sometimes abbreviated as “methotrexate (M
TX) resistance], an ampicillin resistance gene (hereinafter referred to as Amp
^r ), a neomycin resistance gene (hereinafter sometimes abbreviated as Neo ^r , G418 resistance), and the like. In particular, when the dhfr gene is used as a selection marker using dhfr gene-deficient Chinese hamster cells, the target gene can be selected using a thymidine-free medium. Further, if necessary, a signal sequence suitable for the host is added to the N-terminal side of the polypeptide of the present invention. When the host is a genus Escherichia, a PhoA signal sequence, an OmpA signal sequence, and the like. In some cases, the MFα signal sequence,
When the host is an animal cell, such as an SUC2 signal sequence, an insulin signal sequence, an α-interferon signal sequence, an antibody molecule / signal sequence, etc. can be used. Using the vector containing the DNA encoding the polypeptide of the present invention thus constructed, a transformant can be produced.

As the host, for example, Escherichia, Bacillus, yeast, insect cells, insects, animal cells and the like are used. Specific examples of Escherichia bacteria include
For example, Escherichia coli K1
2. DH1 [Procedures of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), 60]
Vol. 160 (1968)], JM103 [Nukuirek
Acids Research, (Nucleic Acids Research), 9
309 (1981)], JA 221 [Journal of Molecule Biology (Journal of Molecul)
ar Biology)], 120, 517 (1978)], HB
101 [Journal of Molecular Biology, Vol. 41, 459 (1969)], C600 [Genetics, Vol. 39, 440 (1954)] and the like are used. Examples of Bacillus spp. Include, for example, Bacillus subtilis MI114
[Gene, 24, 255 (1983)], 207-21
[Journal of Biochemistry
Biochemistry), 95, 87 (1984)]. As yeast, for example, Saccharomyces
Saccharomyces cerevisiae AH22, A
H22R-, NA87-11A, DKD-5D, 20B
-12, Schizosacchamyces pombe
romyces pombe) NCYC1913, NCYC203
6. Pichia pastoris KM71
Are used.

As insect cells, for example, virus is A
In the case of cNPV, a cell line derived from night larvae of moth (Spodop
tera frugiperda cell (Sf cell), Trichoplusia ni
MG1 cells from the midgut, H from the eggs of Trichoplusia ni
igh FiveTM cells, cells derived from Mamestra brassicae, cells derived from Estigmena acrea, and the like are used. When the virus is BmNPV, a silkworm-derived cell line (Bombyx m
ori N cells; BmN cells). Examples of the Sf cells include Sf9 cells (ATCC CRL1711),
f21 cells (Vaughn, JL et al., In Vivo)
Vivo), 13, 213-217, (1977)). As insects, for example, silkworm larvae are used [Maeda et al., Nature, 315, 592 (19).
85)]. As animal cells, for example, monkey cells COS
7, Vero, Chinese hamster cell CHO (hereinafter referred to as
CHO cells), dhfr gene-deficient Chinese hamster cells CHO (hereinafter abbreviated as CHO (dhfr ⁻ ) cells), mouse L cells, mouse AtT-20, mouse myeloma cells, rat GH3, human FL cells, and the like. For transformation of Escherichia sp., For example, Processing of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), 69, 21
10 (1972) and Gene, 17, 107 (1)
982).

For transforming Bacillus sp., For example, Molecular & General Genetics, Vol. 168,
111 (1979). To transform yeast, for example, Methods in Enzymolog
y), 194, 182-187 (1991), Processings of the National Academy of Sciences of the USA (Proc. Na)
Acad. Sci. USA), 75, 1929 (197).
8) and the like. In order to transform insect cells or insects, for example, Bio / Technology, 6, 47-55 (1988))
And the like. To transform animal cells, for example, see Cell Engineering Separate Volume 8, New Cell Engineering Experiment Protocol. 263-267 (1995)
(Published by Shujunsha), Virology, Volume 52,
456 (1973). Thus, the DN encoding the polypeptide
A transformant transformed with the expression vector containing A can be obtained. When culturing a transformant whose host is a genus Escherichia or Bacillus, a liquid medium is suitable as a medium used for the culturing, and a carbon source necessary for growth of the transformant is used therein. Nitrogen sources, inorganic substances, etc. are contained. As the carbon source, for example, glucose, dextrin, soluble starch, sucrose, etc., as the nitrogen source, for example, ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract,
Inorganic or organic substances such as soybean meal, potato extract,
Examples of the inorganic substance include calcium chloride, sodium dihydrogen phosphate, and magnesium chloride. In addition, yeast extract, vitamins, growth promoting factors and the like may be added. The pH of the medium is preferably about 5 to 8.

As a medium for culturing the genus Escherichia, for example, M9 medium containing glucose and casamino acid [Miller, Journal of Experiments in Molecular Genetics (Journa)
l of Experiments in Molecular Genetics), 431-
433, Cold Spring Harbor Laboratory, New York 1
972] is preferred. If necessary, an agent such as 3β-indolylacrylic acid can be added in order to make the promoter work efficiently. When the host is a bacterium belonging to the genus Escherichia, the cultivation is usually performed at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration and stirring may be added. When the host is a bacterium belonging to the genus Bacillus, the cultivation is usually carried out at about 30 to 40 ° C. for about 6 to 24 hours, and if necessary, aeration and stirring can be added. When culturing a transformant whose host is yeast, for example, a Burkholder minimum medium [Bostian, KL
Processings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), 77, 450
5 (1980)] or an SD medium containing 0.5% casamino acid [Bitter, GA et al., Processings of the.
National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. US
A), 81, 5330 (1984)].
Preferably, the pH of the medium is adjusted to about 5-8. The cultivation is usually performed at about 20 ° C. to 35 ° C. for about 24 to 72 hours, and if necessary, aeration and stirring are added. When culturing a transformant whose host is an insect cell or an insect, the medium used is Grac.
e's Insect Medium (Grace, TCC, Nature (Natu
re), 195, 788 (1962)) to which an additive such as immobilized 10% bovine serum is appropriately added. Medium pH
Is preferably adjusted to about 6.2 to 6.4. The cultivation is usually performed at about 27 ° C. for about 3 to 5 days, and if necessary, aeration and / or stirring are added. When culturing a transformant in which the host is an animal cell, the medium may be, for example, a MEM medium containing about 5 to 20% fetal bovine serum [Seience, 12
2, 501 (1952)], DMEM medium [Virology, 8, 396 (1959)], RPMI
1640 medium [Journal of the American
Medical Association (The Jounal of the Am
erican Medical Association) 199, 519 (19
67)], a 199 medium [Proceeding of the Society for the Biological Med (Proceeding of the Society for the Biological Medicine)]
icine), Vol. 73, 1 (1950)].
Preferably, the pH is between about 6-8. Culture is usually about 30
The reaction is carried out at a temperature of from 40 ° C. to 40 ° C. for about 15 to 60 hours, and aeration and stirring are added as necessary. As described above, the polypeptide of the present invention can be produced in the cell, in the cell membrane, or outside the cell of the transformant.

The polypeptide of the present invention can be separated and purified from the above culture by, for example, the following method. When the polypeptide of the present invention is extracted from cultured cells or cells, after the culture, the cells or cells are collected by a known method, suspended in an appropriate buffer, and subjected to ultrasonication, lysozyme and / or freeze-thawing. After the cells or cells are destroyed by, for example, a method of obtaining a crude extract of the polypeptide by centrifugation or filtration is used as appropriate. The buffer may contain a protein denaturant such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100 ^™ . When the polypeptide is secreted into the culture solution, after completion of the culture, the supernatant is separated from the cells or cells by a method known per se, and the supernatant is collected. Purification of the polypeptide contained in the culture supernatant or the extract obtained in this manner can be performed by appropriately combining known separation and purification methods. These known separation and purification methods include methods utilizing solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis, and the like. Method using difference in charge, method using charge difference such as ion exchange chromatography, method using specific affinity such as affinity chromatography, and use of difference in hydrophobicity such as reverse phase high performance liquid chromatography A method utilizing a difference between isoelectric points, such as an isoelectric focusing method, is used.

When the polypeptide thus obtained is obtained in a free form, it can be converted into a salt by a method known per se or a method analogous thereto, and conversely, when the polypeptide is obtained as a salt, a known method Alternatively, it can be converted into a free form or another salt by a method analogous thereto.
The polypeptide produced by the recombinant can be arbitrarily modified or the polypeptide can be partially removed by applying an appropriate protein-modifying enzyme before or after purification. As a protein modifying enzyme, for example,
Trypsin, chymotrypsin, arginyl endopeptidase, protein kinase, glycosidase and the like are used. The presence of the thus produced polypeptide of the present invention or a salt thereof can be measured by an enzyme immunoassay using a specific antibody, Western blotting, or the like.

An antibody against the polypeptide of the present invention or a salt thereof may be any of a polyclonal antibody and a monoclonal antibody as long as it can recognize the polypeptide of the present invention or a salt thereof. An antibody against the polypeptide of the present invention or a salt thereof can be produced using the polypeptide of the present invention as an antigen according to a method for producing an antibody or antiserum known per se. [Preparation of Monoclonal Antibody] (a) Preparation of Monoclonal Antibody-Producing Cell The polypeptide of the present invention is administered to a warm-blooded animal at a site capable of producing an antibody by administration, itself or together with a carrier and a diluent. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. The administration is usually performed once every 2 to 6 weeks, about 2 to 10 times in total. Examples of the warm-blooded animal used include monkeys, rabbits, dogs, guinea pigs, mice, rats, sheep, goats, and chickens, and mice and rats are preferably used.
When producing monoclonal antibody-producing cells, a warm-blooded animal immunized with an antigen, for example, an individual having an antibody titer is selected from a mouse, and the spleen or lymph node is collected 2 to 5 days after the final immunization and contained therein. By fusing the antibody-producing cells to the same or different species of myeloma cells.
A hybridoma producing a monoclonal antibody can be prepared. The antibody titer in the antiserum can be measured, for example, by reacting a labeled polypeptide described below with the antiserum, and then measuring the activity of a labeling agent bound to the antibody. The fusion operation is performed by a known method, for example, the method of Kohler and Milstein [Nature, 256, 49
5 (1975)]. Examples of the fusion promoter include polyethylene glycol (PEG) and Sendai virus.
G is used.

Examples of myeloma cells include NS-1,
Myeloma cells of warm-blooded animals such as P3U1, SP2 / 0 and AP-1 can be mentioned, but P3U1 is preferably used. The preferred ratio between the number of antibody-producing cells (spleen cells) and the number of myeloma cells used is about 1: 1 to 20: 1,
PEG (preferably PEG1000-PEG6000)
Is added at a concentration of about 10 to 80%,
Preferably, cell fusion can be carried out efficiently by incubating at 30 to 37 ° C for 1 to 10 minutes. Various methods can be used to screen for monoclonal antibody-producing hybridomas. For example, a hybridoma culture supernatant is added to a solid phase (eg, a microplate) on which a polypeptide antigen is directly or adsorbed together with a carrier, and then a radioactive substance is added. A method for detecting monoclonal antibodies bound to a solid phase by adding an anti-immunoglobulin antibody (anti-mouse immunoglobulin antibody is used when the cells used for cell fusion are mice) or protein A, A method in which a hybridoma culture supernatant is added to a solid phase on which an immunoglobulin antibody or protein A is adsorbed, a polypeptide labeled with a radioactive substance, an enzyme, or the like is added, and a monoclonal antibody bound to the solid phase is detected. The selection of the monoclonal antibody can be performed according to a method known per se or a method analogous thereto. Usually, it can be carried out in a medium for animal cells supplemented with HAT (hypoxanthine, aminopterin, thymidine).
As a selection and breeding medium, any medium can be used as long as hybridomas can grow. For example, RPMI 1640 medium containing 1-20%, preferably 10-20% fetal bovine serum, GIT medium containing 1-10% fetal bovine serum (Wako Pure Chemical Industries, Ltd.) or serum-free for hybridoma culture A medium (SFM-101, Nissui Pharmaceutical Co., Ltd.) or the like can be used. The culture temperature is
Usually, it is 20 to 40 ° C, preferably about 37 ° C. The culturing time is usually 5 days to 3 weeks, preferably 1 week to 2 weeks. The culture can be usually performed under 5% carbon dioxide. The antibody titer of the hybridoma culture supernatant can be measured in the same manner as the measurement of the antibody titer in the antiserum described above.

(B) Purification of Monoclonal Antibody Separation and purification of the monoclonal antibody can be performed by a method known per se, for example, a separation and purification method of immunoglobulin [eg, salting out method, alcohol precipitation method, isoelectric point precipitation method, electrophoresis Method, adsorption and desorption with an ion exchanger (eg, DEAE), ultracentrifugation, gel filtration, antigen-bound solid phase or an active adsorbent such as protein A or protein G to collect only antibodies and dissociate the bond. Specific Purification Method for Obtaining Antibody).

[Preparation of Polyclonal Antibody] The polyclonal antibody of the present invention can be produced by a method known per se or a method analogous thereto. For example, an immunizing antigen (polypeptide antigen) itself or a complex thereof with a carrier protein is formed, and a warm-blooded animal is immunized in the same manner as in the above-described method for producing a monoclonal antibody. The antibody can be produced by collecting an antibody-containing substance corresponding to those salts and separating and purifying the antibody. With respect to the complex of the immunizing antigen and the carrier protein used to immunize a warm-blooded animal, the type of the carrier protein and the mixing ratio of the carrier and the hapten are such that the antibody is efficiently cross-linked to the hapten immunized by crosslinking the carrier If possible, any material may be cross-linked at any ratio. For example, bovine serum albumin, bovine thyroglobulin, hemocyanin and the like may be used in a weight ratio of about 0.1 to 20, preferably about 1 to 20, relative to hapten 1. A method of coupling at a rate of ５5 is used. In addition, various coupling agents can be used for coupling the hapten and the carrier, but glutaraldehyde, carbodiimide, maleimide active ester, thiol group,
An active ester reagent containing a dithioviridyl group is used. The condensation product is administered to a warm-blooded animal itself or together with a carrier or diluent at a site where antibody production is possible. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. The administration is usually performed once every about 2 to 6 weeks, about 3 to 10 times in total. The polyclonal antibody can be collected from the blood, ascites, etc., preferably from the blood of a warm-blooded animal immunized by the above method. The measurement of the polyclonal antibody titer in the antiserum can be performed in the same manner as the measurement of the antibody titer in the antiserum described above. The polyclonal antibody can be separated and purified according to the same method for separating and purifying immunoglobulins as in the above-described method for separating and purifying a monoclonal antibody. Further, using the polypeptide of the present invention, Nat Biotechnol, 14, 845-851. (1996), Nat Genet
15, 146-156. (1997), PNAS, 97 (2), 722-727. (2000)
And the like, it is also possible to prepare a humanized antibody according to the method described in, for example.

DNA encoding the polypeptide of the present invention
(Hereinafter, in the description of antisense DNA, these DNAs are abbreviated as the DNA of the present invention.) Antisense D having a base sequence complementary to or substantially complementary to
The NA is any antisense DNA as long as it has a base sequence complementary to or substantially complementary to the DNA of the present invention and has an action capable of suppressing the expression of the DNA. Is also good. The nucleotide sequence substantially complementary to the DNA of the present invention is, for example, about 70% of the total nucleotide sequence or a partial nucleotide sequence of the nucleotide sequence complementary to the DNA of the present invention (that is, the complementary strand of the DNA of the present invention). % Or more, preferably about 80% or more, more preferably about 90% or more, most preferably about 95% or more. In particular, of the total nucleotide sequence of the complementary strand of the DNA of the present invention, about 70% or more of the complementary strand of the nucleotide sequence encoding the N-terminal site of the polypeptide of the present invention (for example, the nucleotide sequence near the start codon). , Preferably about 80% or more, more preferably about 90% or more, and most preferably about 9% or more.
Antisense DNA having a homology of 5% or more is preferred. These antisense DNAs can be produced using a known DNA synthesizer or the like.

Since the polypeptide of the present invention has a signal peptide, it is efficiently secreted extracellularly and has an important biological activity as a humoral factor for signal transmission, self-defense, and the like. Hereinafter, the polypeptide of the present invention or a salt thereof (hereinafter, sometimes abbreviated as the polypeptide of the present invention), DNA encoding the polypeptide of the present invention
(Hereinafter sometimes abbreviated as the DNA of the present invention), antibodies against the polypeptide of the present invention or a salt thereof (hereinafter sometimes abbreviated as the antibody of the present invention), and uses of antisense DNA are described. .

(1) Since the polypeptide of the present invention is expressed in a tissue-specific manner, it can be used as a tissue marker. That is, it is useful as a marker for detecting tissue differentiation, disease state, metastasis of cancer and the like. It can also be used for fractionation of corresponding receptors, ligands, binding proteins and the like. Furthermore, it can be used as a panel for high-throughput screening known per se to examine biological activity. It can also be used for genetic disease research by performing chromosome mapping. (2) Therapeutic / prophylactic agent for various diseases related to the polypeptide of the present invention Since the polypeptide of the present invention exists as a humoral factor in a living body, it can be used as the polypeptide of the present invention or the DNA of the present invention. If there is an abnormality, is missing or abnormally decreased or enhanced expression, for example, cancer, immune disease, respiratory disease, gastrointestinal disease, cardiovascular disease, endocrine disease, infectious disease or Various diseases such as nervous system diseases and mental illness develop. Therefore, the polypeptide of the present invention and the DNA of the present invention can be used for various diseases such as cancer, immune disease, respiratory disease, gastrointestinal tract disease, cardiovascular disease, endocrine disease, infectious disease, nervous system disease and mental illness. It can be used as a medicament such as a therapeutic / prophylactic agent. For example, when there is a patient in which the information transmission in cells is not sufficiently or normally exerted because the polypeptide or the like of the present invention is reduced or deleted in a living body, (a) the DNA of the present invention is used in the patient. (B) inserting the DNA of the present invention into cells to express the polypeptide of the present invention, and then transplanting the cells into a patient. By carrying out or (c) administering the polypeptide of the present invention to the patient, the role of the polypeptide of the present invention in the patient can be sufficiently or normally exerted. When the DNA of the present invention is used as the above-mentioned therapeutic / prophylactic agent, the DNA is inserted alone or into a suitable vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, and the like. It can be administered to humans or warm-blooded animals. The DNA of the present invention can be administered as it is or in the form of a formulation together with a physiologically acceptable carrier such as an auxiliary agent for promoting uptake, using a gene gun or a catheter such as a hydrogel catheter. When the polypeptide or the like of the present invention is used as the above-mentioned therapeutic / prophylactic agent, at least 9
It is preferable to use one purified to 0%, preferably 95% or more, more preferably 98% or more, and still more preferably 99% or more.

The polypeptide of the present invention is orally acceptable, for example, as a sugar-coated tablet, capsule, elixir, microcapsule or the like, or water or other pharmaceutically acceptable one. It can be used parenterally in the form of a sterile solution with liquid or injection, such as a suspension. For example, the polypeptide of the present invention is mixed with physiologically acceptable carriers, flavors, excipients, vehicles, preservatives, stabilizers, binders, and the like in a unit dosage form generally required for the practice of the pharmaceutical preparation. It can be manufactured by doing. The amount of the active ingredient in these preparations is such that an appropriate dose in the specified range can be obtained. Examples of additives that can be mixed with tablets, capsules, and the like include binders such as gelatin, corn starch, tragacanth, and acacia, excipients such as crystalline cellulose, corn starch, gelatin, and alginic acid. Useful bulking agents, lubricants such as magnesium stearate, sweeteners such as sucrose, lactose or saccharin, flavoring agents such as peppermint, reddish oil or cherry and the like are used. When the preparation unit form is a capsule, a liquid carrier such as oil and fat can be further contained in the above-mentioned type of material. Sterile compositions for injection can be formulated according to normal pharmaceutical practice such as dissolving or suspending the active substance in vehicles such as water for injection, and naturally occurring vegetable oils such as sesame oil, coconut oil and the like. Aqueous liquids for injection include, for example, physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.), and suitable solubilizing agents. , For example, alcohols (eg, ethanol, etc.),
It may be used in combination with a polyalcohol (eg, propylene glycol, polyethylene glycol, etc.), a nonionic surfactant (eg, Polysorbate 80 ^™ , HCO-50, etc.). As the oily liquid, for example, sesame oil,
Soybean oil and the like may be used, and may be used in combination with benzyl benzoate, benzyl alcohol and the like as a solubilizing agent. In addition, buffers (eg, phosphate buffer, sodium acetate buffer, etc.), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, human serum albumin, polyethylene glycol, etc.), You may mix | blend with a preservative (for example, benzyl alcohol, phenol, etc.), an antioxidant, etc. The prepared injection is
Usually, it is filled into a suitable ampoule. The vector into which the DNA of the present invention has been inserted is also formulated in the same manner as described above.
Used parenterally.

The preparation thus obtained is safe and has low toxicity, and is therefore useful, for example, in humans or warm-blooded animals (eg, rats, mice, guinea pigs, rabbits, birds, sheep, pigs, cows, horses, cats, Dogs, monkeys, etc.). The dose of the polypeptide or the like of the present invention may vary depending on the target disease, the subject of administration, the administration route, and the like. (60
kg), the polypeptide or the like is used in an amount of about 1 mg to 1000 mg, preferably about 10 to 500 mg per day.
mg, more preferably about 10 to 200 mg. When administered parenterally, the single dose of the polypeptide or the like varies depending on the administration subject, target disease, and the like. When administered to an adult (with a body weight of 60 kg), about 1 to 1000 mg of the polypeptide etc. per day
It is convenient to administer the drug by injecting into the affected part about, preferably about 1 to 200 mg, more preferably about 10 to 100 mg. 60k for other animals
The amount converted per g can be administered.

(2) Screening of Candidate Drug Compounds for Diseases Since the polypeptide of the present invention exists as a humoral factor in vivo, compounds or salts thereof that promote the function of the polypeptide of the present invention include, for example, It can be used as a medicament such as a therapeutic / prophylactic agent for cancer, immune disease, respiratory disease, gastrointestinal disease, cardiovascular disease, endocrine disease, infectious disease, nervous system disease and mental illness. On the other hand, the compound that inhibits the function of the polypeptide or the like of the present invention or a salt thereof can be used as a medicament such as an agent for treating or preventing a disease caused by overproduction of the polypeptide or the like of the present invention. Therefore, the polypeptide etc. of the present invention is useful as a reagent for screening a compound or its salt that promotes or inhibits the function of the polypeptide etc. of the present invention. That is, the present invention relates to (1) a compound or a salt thereof which promotes the function of the polypeptide of the present invention or a salt thereof characterized by using the polypeptide of the present invention or a salt thereof (hereinafter referred to as a promoter) Or a compound that inhibits the function of the polypeptide of the present invention or a salt thereof (hereinafter may be abbreviated as an inhibitor). The screening kit of the present invention contains the polypeptide of the present invention or a salt thereof.

Compounds or salts thereof obtained by using the screening method or screening kit of the present invention include, for example, peptides, proteins, non-peptide compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, and animals. A compound selected from a tissue extract, plasma, and the like, which promotes or inhibits the function of the polypeptide or the like of the present invention. As the salt of the compound, those similar to the aforementioned salts of the polypeptide of the present invention are used.

When a compound obtained by using the screening method or the screening kit of the present invention is used as the above-mentioned therapeutic / prophylactic agent, it can be carried out according to conventional means. For example, in the same manner as the drug containing the polypeptide of the present invention and the like, tablets, capsules,
An elixir, microcapsule, sterile solution, suspension or the like can be used. The preparations obtained in this way are safe and low toxic, for example, for humans or warm-blooded animals (eg, mice, rats, rabbits, sheep, pigs, cows, horses, birds, cats, dogs, monkeys, etc.) Can be administered. The dose of the compound or a salt thereof varies depending on its action, target disease, subject to be administered, administration route, and the like.For example, a compound that promotes the function of the polypeptide or the like of the present invention for the purpose of treating an inflammatory disease may be used. When administered orally, in general, in adults (with a body weight of 60 kg), the compound is administered in an amount of about 0.1 to 100 m / day.
g, preferably about 1.0-50 mg, more preferably about 1.0-20 mg. When administered parenterally, a single dose of the compound varies depending on the administration subject, target disease, and the like. For example, it promotes the function of the polypeptide of the present invention for the purpose of treating inflammatory disease or immune disease. When the compound to be administered is usually administered to an adult (60 kg) in the form of an injection, the compound is administered in an amount of about 0.01 to 30 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 20 mg per day. It is convenient to administer about 10 to 10 mg by intravenous injection. In the case of other animals, the dose can be administered in terms of 60 kg. On the other hand, when a compound that inhibits the function of the polypeptide or the like of the present invention is orally administered, generally in an adult (with a body weight of 60 kg),
About 0.1 to 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg of the compound per day
mg. When administered parenterally, the dose of the compound varies depending on the administration subject, target disease and the like, but the compound which inhibits the function of the polypeptide or the like of the present invention is usually administered in the form of an injection to an adult (60 kg). ), About 0.01 to 30 mg of the compound per day,
It is convenient to administer preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg by intravenous injection. In the case of other animals, the dose can be administered in terms of 60 kg.

(3) Quantification of the polypeptide of the present invention or a salt thereof An antibody against the polypeptide of the present invention (hereinafter sometimes abbreviated as the antibody of the present invention) specifically binds to the polypeptide of the present invention. Since it can be recognized, it can be used for quantification of the polypeptide or the like of the present invention in a test solution, particularly for quantification by a sandwich immunoassay. That is, the present invention provides (i) a method of competitively reacting an antibody of the present invention with a test solution, a labeled polypeptide of the present invention, and the like, and binding a labeled polypeptide of the present invention to the antibody. A method for quantifying the polypeptide or the like of the present invention in a test solution, which comprises measuring the proportion of a peptide or the like; and (ii) the test solution and the antibody of the present invention insolubilized on a carrier and a labeled book The present invention provides a method for quantifying the polypeptide of the present invention in a test solution, which comprises reacting the antibody of the present invention with another antibody simultaneously or continuously, and then measuring the activity of a labeling agent on an insolubilized carrier. .

In addition to quantification of the polypeptide of the present invention using a monoclonal antibody against the polypeptide of the present invention (hereinafter sometimes referred to as the monoclonal antibody of the present invention), detection by tissue staining or the like can be performed. You can do it. For these purposes, the antibody molecule itself may be used, and F (ab ') 2, Fa
b ′ or Fab fraction may be used. The method for quantifying the polypeptide or the like of the present invention using the antibody of the present invention is not particularly limited, and may be an antibody, an antigen or an antibody-antigen corresponding to the amount of an antigen (for example, the amount of a polypeptide) in a test solution. Any measurement method may be used as long as the amount of the complex is detected by chemical or physical means, and this is calculated from a standard curve prepared using a standard solution containing a known amount of antigen. . For example, nephelometry, a competitive method, an immunometric method, and a sandwich method are preferably used, and in terms of sensitivity and specificity, it is particularly preferable to use a sandwich method described later. As a labeling agent used in a measurement method using a labeling substance, for example, a radioisotope, an enzyme, a fluorescent substance, a luminescent substance and the like are used. Examples of radioisotopes include [ ¹²⁵ I],
[ ¹³¹ I], [ ³ H], [ ¹⁴ C] and the like are used. As the enzyme, a stable enzyme having a large specific activity is preferable,
For example, β-galactosidase, β-glucosidase,
Alkaline phosphatase, peroxidase, malate dehydrogenase and the like are used. As the fluorescent substance, for example, fluorescamine, fluorescein isothiocyanate and the like are used. As the luminescent substance, for example,
Luminol, luminol derivatives, luciferin, lucigenin and the like are used. Further, a biotin-avidin system can be used for binding the antibody or antigen to the labeling agent.

For the insolubilization of the antigen or antibody, physical adsorption may be used, or a method using a chemical bond usually used for insolubilizing or immobilizing a polypeptide or an enzyme may be used. Examples of the carrier include insoluble polysaccharides such as agarose, dextran, and cellulose; synthetic resins such as polystyrene, polyacrylamide, and silicon; and glass. In the sandwich method, the test solution is reacted with the insolubilized monoclonal antibody of the present invention (primary reaction), and further reacted with another labeled monoclonal antibody of the present invention (secondary reaction). By measuring the activity of the labeling agent, the amount of the polypeptide of the present invention in the test solution can be determined. The primary reaction and the secondary reaction may be performed in the reverse order, may be performed simultaneously, or may be performed at staggered times. The labeling agent and the method of insolubilization can be in accordance with those described above. In the immunoassay by the sandwich method, the antibody used for the solid phase antibody or the labeling antibody is not necessarily one kind, and a mixture of two or more kinds of antibodies is used for the purpose of improving measurement sensitivity and the like. You may. Antibodies having different binding sites for the polypeptide or the like of the present invention by the sandwich method of the present invention are preferably used. That is, the antibody used in the primary reaction and the secondary reaction is, for example, when the antibody used in the secondary reaction recognizes the C-terminal of the polypeptide or the like of the present invention, the antibody used in the primary reaction is Preferably, an antibody that recognizes other than the C-terminal, for example, the N-terminal, is used.

The monoclonal antibody of the present invention can be used in a measurement system other than the sandwich method, for example, a competition method, an immunometric method, a nephelometry and the like. In the competition method, an antigen in a test solution and a labeled antigen are allowed to react competitively with an antibody, and then the unreacted labeled antigen is reacted.
(F) and the labeled antigen (B) bound to the antibody are separated (B / F separation), the amount of labeling of either B or F is measured, and the amount of antigen in the test solution is quantified. In this reaction method, a soluble antibody is used as the antibody, B / F separation is performed using polyethylene glycol, a liquid phase method using a second antibody against the antibody, or a solid phase antibody is used as the first antibody, or A solid-phase method using a soluble antibody as the first antibody and using a solid-phased antibody as the second antibody is used. In the immunometric method, an antigen in a test solution and a solid-phased antigen are subjected to a competitive reaction with a fixed amount of a labeled antibody, and then the solid phase and the liquid phase are separated. Is reacted with an excess amount of the labeled antibody, and then the immobilized antigen is added to bind the unreacted labeled antibody to the solid phase, and then the solid phase and the liquid phase are separated.
Next, the amount of label in any phase is measured to determine the amount of antigen in the test solution. In nephelometry, the amount of insoluble precipitates generated as a result of an antigen-antibody reaction in a gel or in a solution is measured. Even when the amount of antigen in the test solution is small and only a small amount of sediment is obtained, laser nephelometry utilizing laser scattering is preferably used.

When these individual immunoassays are applied to the quantification method of the present invention, no special conditions, operations and the like need to be set. A measurement system for the polypeptide of the present invention may be constructed by adding ordinary technical considerations of those skilled in the art to ordinary conditions and operation methods in each method. For details of these general technical means, reference can be made to reviews, books, and the like. For example, Hiro Irie edited by "Radio Immunoassay" (Kodansha, published in 1974), Irie
Kan-edo “Radio immunoassay” (Kodansha, published in 1979), Eiji Ishikawa et al. “Enzyme immunoassay” (Medical Shoin,
Published in 1983), edited by Eiji Ishikawa et al. “Enzyme immunoassay”
(Second Edition) (Medical Shoin, published in 1982), “Enzyme Immunoassay” edited by Eiji Ishikawa et al. (Third Edition) (Medical Shoin, Showa 62)
Years), “Methods in ENZYMOLOGY” Vol. 70 (Immunoch
emical Techniques (Part A)), ibid.Vol. 73 (Immunoch
emical Techniques (Part B)), ibid.Vol. 74 (Immunoch
emical Techniques (Part C)), ibid.Vol. 84 (Immunoch
emical Techniques (Part D: Selected Immunoassays)),
Ibid. Vol. 92 (Immunochemical Techniques (Part E: Mon
oclonal Antibodies and General Immunoassay Method
s)), ibid.Vol. 121 (Immunochemical Techniques (Part
I: Hybridoma Technology and Monoclonal Antibodie
s)) (above, published by Academic Press). As described above, the polypeptide and the like of the present invention can be quantified with high sensitivity by using the antibody of the present invention. Furthermore, by quantifying the concentration of the polypeptide or the like of the present invention using the antibody of the present invention, (1) when a decrease in the concentration of the polypeptide or the like of the present invention is detected, for example, cancer, an immune disease, The patient can be diagnosed as having a respiratory disease, a gastrointestinal disease, a cardiovascular disease, an endocrine disease, an infectious disease or a disease such as a nervous system disease or a mental illness, or having a high possibility of suffering from the disease in the future. Further, the antibody of the present invention can be used for detecting the polypeptide of the present invention or the like present in a subject such as a body fluid or a tissue.
Further, preparation of an antibody column used to purify the polypeptide of the present invention, detection of the polypeptide of the present invention in each fraction during purification, behavior of the polypeptide of the present invention in the test cells Can be used for analysis and the like.

(4) Genetic Diagnostic Agent The DNA of the present invention can be used, for example, as a probe to produce a human or warm-blooded animal (eg, rat, mouse, guinea pig, rabbit, bird, sheep, pig, cow,
(DNA, mRNA, etc.) encoding the polypeptide of the present invention in horses, cats, dogs, monkeys, etc.).
It is useful as a gene diagnostic agent for A or mRNA damage, mutation, or decreased expression, and increase or excessive expression of the DNA or mRNA. The above-described genetic diagnosis using the DNA of the present invention can be performed, for example, by the known Northern hybridization or PCR-SSCP method (Genomics, Vol. 5, pp. 874-879 (1)
989), Proceedings of the National Academy of Science
s of the United States of America), Vol. 86, 2
766 to 2770 (1989)). For example, when a decrease in expression is detected by Northern hybridization or PCR-SSC
When a DNA mutation is detected by the P method, it may be, for example, a cancer, an immune disease, a respiratory disease, a gastrointestinal disease, a circulatory disease, an endocrine disease, an infectious disease, or a disease such as a nervous system disease or a mental illness. Can be diagnosed as high.

(5) Pharmaceuticals Containing Antisense DNA Antisense DNA that can complementarily bind to the DNA of the present invention and suppress the expression of the DNA is a polypeptide or the like of the present invention in a living body or the like. Since the function of the DNA of the present invention can be suppressed, it can be used, for example, as an agent for treating or preventing a disease caused by overexpression of the polypeptide of the present invention. The above antisense DNA
Is used as the above-mentioned therapeutic / prophylactic agent, it can be carried out in the same manner as the aforementioned therapeutic / prophylactic agent for various diseases containing the DNA of the present invention. For example, when the antisense DNA is used, the method can be carried out according to a conventional method after inserting the antisense DNA alone or into an appropriate vector such as a retrovirus vector, an adenovirus vector, and an adenovirus associated virus vector. The antisense DNA can be administered as it is or in the form of a formulation together with a physiologically acceptable carrier such as an auxiliary agent for promoting uptake, and then administered using a gene gun or a catheter such as a hydrogel catheter. Furthermore, the antisense DNA can also be used as a diagnostic oligonucleotide probe for examining the presence or expression of the DNA of the present invention in tissues or cells.

(6) Pharmaceuticals Containing Antibody of the Present Invention Antibodies of the present invention which have an activity of neutralizing the activity of the polypeptide of the present invention are, for example, diseases caused by overexpression of the polypeptide of the present invention. It can be used as a medicament such as a therapeutic / prophylactic agent. The therapeutic / prophylactic agent for the above-mentioned diseases containing the antibody of the present invention can be used directly as a liquid or as a pharmaceutical composition in an appropriate dosage form as a human or mammal (eg, rat, rabbit, sheep, pig, cow, cat, Dogs, monkeys, etc.) can be administered orally or parenterally. The dose varies depending on the administration subject, target disease, symptoms, administration route, and the like. For example, the dose of the antibody of the present invention is usually 0.01 to 20 mg / k per dose.
g body weight, preferably about 0.1 to 10 mg / kg body weight, more preferably about 0.1 to 5 mg / kg body weight, about 1 to 5 times a day, preferably about 1 to 3 times a day,
It is conveniently administered by intravenous injection. In the case of other parenteral administration and oral administration, an equivalent amount can be administered. If the symptoms are particularly severe, the dose may be increased according to the symptoms. The antibodies of the present invention can be administered as such or as a suitable pharmaceutical composition. The pharmaceutical composition used for the administration contains the above or a salt thereof and a pharmacologically acceptable carrier, diluent or excipient. Such compositions are provided in dosage forms suitable for oral or parenteral administration. That is, for example, compositions for oral administration include solid or liquid dosage forms, specifically tablets (including sugar-coated tablets and film-coated tablets), pills, granules, powders, capsules (soft capsules and the like). Syrup, emulsion, suspension and the like. Such a composition is produced by a method known per se and contains a carrier, diluent or excipient commonly used in the field of formulation. For example, lactose, starch, sucrose, magnesium stearate and the like are used as carriers and excipients for tablets.

As the composition for parenteral administration, for example, injections, suppositories, etc. are used. Injections are intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, drip injections, etc. In the dosage form. Such injections are prepared according to a method known per se, for example, by dissolving, suspending or emulsifying the antibody or a salt thereof in a sterile aqueous or oily liquid commonly used for injections. As an aqueous liquid for injection, for example, physiological saline, isotonic solution containing glucose and other auxiliary agents and the like are used, and a suitable solubilizing agent,
For example, alcohol (eg, ethanol), polyalcohol (eg, propylene glycol, polyethylene glycol), nonionic surfactant [eg, polysorbate 8]
0 ^TM , HCO-50 (polyoxyethylene (50 mol) addu
ct of hydrogenated castor oil)]. As the oily liquid, for example, sesame oil, soybean oil, and the like are used, and benzyl benzoate, benzyl alcohol, and the like may be used in combination as a solubilizing agent. The prepared injection is usually filled in an appropriate ampoule. Suppositories to be used for rectal administration are prepared by mixing the above antibody or a salt thereof with a conventional suppository base. The above-mentioned oral or parenteral pharmaceutical compositions are conveniently prepared in dosage unit form so as to be compatible with the dosage of the active ingredient. Examples of such dosage unit forms include tablets, pills, capsules, injections (ampoules), and suppositories.
Usually 5 to 500 mg per dosage unit dosage form, especially 5 to 100 mg for injection, 1 for other dosage forms
Preferably, it contains 0-250 mg of the above antibody. Each of the above-mentioned compositions may contain another active ingredient as long as the composition does not cause an undesirable interaction with the above-mentioned antibody.

(7) DNA-Transferred Animal The present invention relates to a DNA encoding an exogenous polypeptide of the present invention (hereinafter abbreviated as the exogenous DNA of the present invention) or a mutant DNA thereof (the exogenous mutation of the present invention). (Which may be abbreviated as DNA).
That is, the present invention provides (1) a non-human mammal having the exogenous DNA of the present invention or a mutant DNA thereof, (2) the animal according to (1), wherein the non-human mammal is a rodent,
(3) the rodent is a mouse or a rat (2)
And (4) a recombinant vector containing the exogenous DNA of the present invention or its mutant DNA and capable of being expressed in mammals. Non-human mammals having the exogenous DNA of the present invention or the mutant DNA thereof (hereinafter abbreviated as the DNA-transferred animal of the present invention) can be used for non-fertilized eggs, fertilized eggs, germ cells including sperm and their progenitor cells, and the like. And preferably at the stage of embryonic development in non-human mammal development (more preferably at the stage of single cells or fertilized eggs and generally before the 8-cell stage), the calcium phosphate method, the electric pulse method, the lipofection method, the agglutination method, The target D by microinjection method, particle gun method, DEAE-dextran method, etc.
It can be created by transferring NA. Further, by the DNA transfer method, the exogenous DNA of the present invention can be transferred to somatic cells, organs of living organisms, tissue cells, and the like, and used for cell culture, tissue culture, and the like. The DNA-transferred animal of the present invention can also be produced by fusing the above-mentioned germ cells with a cell fusion method known per se.

Non-human mammals include, for example, bovine,
Pigs, sheep, goats, rabbits, dogs, cats, guinea pigs, hamsters, mice, rats and the like are used. Among them, rodents, which are relatively short in ontogeny and biological cycle in terms of preparation of disease animal model systems, and are easy to breed, especially mice (for example, C57 as a pure strain)
As a hybrid line such as BL / 6 line and DBA2 line, B6 line
C3F ₁ system, BDF ₁ system, B6D2F ₁ system, BAL
B / c strain, ICR strain, etc.) or rat (for example,
Wistar, SD, etc.) are preferred. "Mammals" in recombinant vectors that can be expressed in mammals
Examples thereof include humans in addition to the above-mentioned non-human mammals. The exogenous DNA of the present invention refers to the DNA of the present invention once isolated and extracted from a mammal, not the DNA of the present invention originally possessed by a non-human mammal. As the mutant DNA of the present invention, those having a mutation (eg, mutation) in the base sequence of the original DNA of the present invention, specifically, base addition, deletion, substitution with another base, etc. The resulting DNA or the like is used, and also includes abnormal DNA. The abnormal DNA refers to a DNA that expresses an abnormal polypeptide of the present invention, and for example, a DNA that expresses a polypeptide that suppresses the function of the normal polypeptide of the present invention is used. Exogenous DNA of the present invention
May be derived from mammals of the same species or different species from the target animal. In transferring the DNA of the present invention to a target animal, it is generally advantageous to use the DNA as a DNA construct linked downstream of a promoter capable of being expressed in animal cells. For example, when transferring the human DNA of the present invention, DNAs derived from various mammals (eg, rabbits, dogs, cats, guinea pigs, hamsters, rats, mice, etc.) having the DNA of the present invention having high homology thereto are expressed. Downstream of various promoters that can be made to bind to the human DNA of the present invention.
A DNA-transferred mammal that highly expresses the DNA of the present invention can be produced by microinjecting an NA construct (eg, a vector, etc.) into a fertilized egg of a target mammal, for example, a mouse fertilized egg.

Examples of the expression vector for the polypeptide of the present invention include a plasmid derived from Escherichia coli, a plasmid derived from Bacillus subtilis, a plasmid derived from yeast, a bacteriophage such as λ phage, a retrovirus such as Moloney leukemia virus, a vaccinia virus or a baculovirus. For example, animal viruses and the like are used. Among them, a plasmid derived from Escherichia coli, a plasmid derived from Bacillus subtilis or a plasmid derived from yeast are preferably used. The above DN
Examples of promoters that regulate A expression include, for example,
Promoters of DNAs derived from viruses (eg, Simian virus, cytomegalovirus, Moloney leukemia virus, JC virus, breast cancer virus, poliovirus, etc.), various mammals (human, rabbit, dog, cat,
Guinea pig, hamster, rat, mouse, etc.), for example, albumin, insulin II,
Uroplakin II, elastase, erythropoietin,
Endothelin, muscle creatine kinase, glial fibrillary acidic protein, glutathione S-transferase,
Platelet-derived growth factor β, keratins K1, K10 and K
14. Collagen type I and type II, cyclic AM
P-dependent protein kinase βI subunit, dystrophin, tartrate-resistant alkaline phosphatase, atrial natriuretic factor, endothelial receptor tyrosine kinase (commonly abbreviated as Tie2), sodium potassium adenosine 3 kinase (Na, K-ATPas)
e), neurofilament light chain, metallothionein I
And IIA, metalloproteinase 1 tissue inhibitor, MHC class I antigen (H-2L), H-ras, renin, dopamine β-hydroxylase, thyroid peroxidase (TPO), polypeptide chain elongation factor 1α (EF-
1α), β actin, α and β myosin heavy chains, myosin light chains 1 and 2, myelin basic protein, thyroglobulin, Thy-1, immunoglobulin, heavy chain variable region (V
NP), serum amyloid P component, myoglobin, troponin C, smooth muscle α-actin, preproenkephalin A, vasopressin and other promoters. Among them, a cytomegalovirus promoter capable of high expression throughout the body, a promoter of human polypeptide chain elongation factor 1α (EF-1α), and human and chicken β-actin promoters are preferable.

The above-described vector preferably has a sequence that terminates transcription of a messenger RNA of interest in a DNA-transferred mammal (generally called a terminator). And preferably a Simian virus SV40 terminator or the like. In addition, a splicing signal of each DNA for the purpose of further expressing the desired foreign DNA,
It is also possible to link an enhancer region, a part of an intron of eukaryotic DNA, etc. 5 ′ upstream of the promoter region, between the promoter region and the translation region, or 3 ′ downstream of the translation region. The translation region can be prepared as a DNA construct that can be expressed in a transgenic animal by a conventional DNA engineering technique in which the translation region is ligated downstream of the promoter and, if desired, upstream of the transcription termination site. Exogenous DN of the invention at the fertilized egg cell stage
Metastasis of A is ensured to be present in all germinal and somatic cells of the target mammal. The presence of the exogenous DNA of the present invention in the germinal cells of the produced animal after the DNA transfer means that all the progeny of the produced animal retain the exogenous DNA of the present invention in all of the germ cells and somatic cells. means. The progeny of such animals that have inherited the exogenous DNA of the present invention have the exogenous DNA of the present invention in all of their germinal and somatic cells.

The non-human mammal to which the exogenous normal DNA of the present invention has been transferred is confirmed to stably maintain the exogenous DNA by mating, and is subcultured as an animal having the DNA in a normal breeding environment. I can do it. Transfer of the exogenous DNA of the present invention at the fertilized egg cell stage is ensured to be present in excess in all germ cells and somatic cells of the target mammal. Excessive presence of the exogenous DNA of the present invention in germ cells of a produced animal after DNA transfer means that all offspring of the produced animal have an excessive amount of the exogenous DNA of the present invention in all of their germ cells and somatic cells. Means The offspring of such an animal inheriting the exogenous DNA of the present invention will have the exogenous DNA of the present invention in all of its germinal and somatic cells.
In excess. By obtaining a homozygous animal having the introduced DNA on both homologous chromosomes and breeding the male and female animals, it is possible to breed and pass all the offspring so as to have the DNA in excess. The non-human mammal having the normal DNA of the present invention has a high level of expression of the normal DNA of the present invention, and eventually promotes the function of the endogenous normal DNA, so that the hyperactivity of the polypeptide of the present invention is finally increased. May develop and can be used as a disease model animal. For example, using the normal DNA transgenic animal of the present invention, elucidation of the hyperfunction of the polypeptide of the present invention and the pathological mechanism of a disease associated with the polypeptide of the present invention, and examination of a method for treating these diseases. It is possible. Further, since the mammal into which the exogenous normal DNA of the present invention has been transferred has an increased symptom of the released polypeptide of the present invention, it is also used for a screening test for a therapeutic drug for a disease associated with the polypeptide of the present invention. It is possible.

On the other hand, the non-human mammal having the extraneous abnormal DNA of the present invention should be subcultured in a normal breeding environment as an animal having the DNA after confirming that the exogenous DNA is stably retained by mating. Can be done. Furthermore, the desired foreign DNA can be incorporated into the above-described plasmid and used as a source material. The DNA construct with the promoter can be prepared by a usual DNA engineering technique. Abnormal D of the present invention at the fertilized egg cell stage
NA transfer is ensured to be present in all germinal and somatic cells of the target mammal. The presence of the abnormal DNA of the present invention in the germinal cells of the produced animal after DNA transfer means that all the offspring of the produced animal have the abnormal DNA of the present invention in all of its germ cells and somatic cells. The offspring of such animals that have inherited the exogenous DNA of the present invention have the abnormal DNA of the present invention in all of their germinal and somatic cells. A homozygous animal having the introduced DNA on both homologous chromosomes is obtained, and by crossing these male and female animals, it is possible to breed so that all offspring have the DNA. In the non-human mammal having the abnormal DNA of the present invention, the abnormal DNA of the present invention is highly expressed, and the function of the polypeptide of the present invention is ultimately inactivated by inhibiting the function of endogenous normal DNA. It can be a type refractory disease and can be used as a disease model animal. For example, using the abnormal DNA-transferred animal of the present invention, it is possible to elucidate the pathological mechanism of the function-inactive refractory of the polypeptide of the present invention and to examine a method for treating this disease. Also, as a specific possibility, the abnormal DNA highly expressing animal of the present invention can inhibit the function of the normal polypeptide by the abnormal polypeptide of the present invention (domi
nant negative action). Also,
Since the mammal to which the foreign abnormal DNA of the present invention has been transferred has an increased symptom of the released polypeptide of the present invention, it can also be used for a therapeutic drug screening test for functional inactive refractory of the polypeptide of the present invention. It is.

Other possible uses of the above two types of DNA-transferred animals of the present invention include, for example, use as a cell source for tissue culture, and DNA or R in the tissues of the DNA-transferred animals of the present invention.
Analysis of the relationship with polypeptides specifically expressed or activated by the polypeptide of the present invention by directly analyzing NA or analyzing polypeptide tissue expressed by DNA; Tissue having DNA The cells are cultured by standard tissue culture techniques and used to study the function of cells from tissues that are generally difficult to culture, screening for agents that enhance cell function by using the cells described above, and Isolation and purification of the mutant polypeptide of the present invention and production of its antibody can be considered. Furthermore, using the DNA-transferred animal of the present invention, it is possible to examine clinical symptoms of a disease associated with the polypeptide of the present invention, including a functionally inactive refractory disease of the polypeptide of the present invention. More detailed pathological findings in each organ of the disease model related to the polypeptide of the present invention can be obtained, which can contribute to the development of a new treatment method, and further to the research and treatment of a secondary disease caused by the disease. Further, it is possible to take out each organ from the DNA-transferred animal of the present invention, cut it into small pieces, and then use a polypeptide-degrading enzyme such as trypsin to obtain the released DNA-transferred cells, culture them, or systematize the cultured cells. is there. Furthermore, it is possible to examine the specificity of the polypeptide-producing cell of the present invention, its relationship with apoptosis, differentiation or proliferation, or the mechanism of signal transduction in them, and to investigate their abnormalities. It is an effective research material for elucidation. Furthermore, in order to develop a therapeutic agent for a disease associated with the polypeptide of the present invention, including the inactive refractory type of the polypeptide of the present invention, using the DNA-transferred animal of the present invention, It is possible to provide an effective and rapid screening method for a therapeutic agent for the disease by using the method and the quantitative method. In addition, using the transgenic animal of the present invention or the exogenous DNA expression vector of the present invention, it is possible to examine and develop a DNA treatment method for a disease associated with the polypeptide of the present invention.

(8) Knockout Animal The present invention provides a non-human mammalian embryonic stem cell in which the DNA of the present invention is inactivated and a non-human mammal deficient in expression of the DNA of the present invention. That is, the present invention provides (1) a non-human mammalian embryonic stem cell in which the DNA of the present invention has been inactivated,
(2) the embryonic stem cell according to (1), wherein the DNA is inactivated by introducing a reporter gene (eg, a β-galactosidase gene derived from Escherichia coli); (4) The embryonic stem cell according to (1), wherein the non-human mammal is a rodent, (5) the embryonic stem cell according to (4), wherein the rodent is a mouse, 6) a non-human mammal deficient in expression of the DNA in which the DNA of the present invention is inactivated; (7) the DNA is inactivated by introducing a reporter gene (eg, a β-galactosidase gene derived from Escherichia coli); The non-human mammal according to (6), wherein the reporter gene can be expressed under the control of a promoter for the DNA of the present invention,
(8) The non-human mammal according to (6), wherein the non-human mammal is a rodent, (9) the non-human mammal according to (8), wherein the rodent is a mouse, and (10) D) administering the test compound to the animal described in (7) and detecting the expression of the reporter gene;
A method for screening a compound or a salt thereof that promotes or inhibits a promoter activity for NA is provided.

A non-human mammalian embryonic stem cell in which the DNA of the present invention has been inactivated is defined as a DNA obtained by artificially mutating the DNA of the present invention possessed by the non-human mammal to suppress the expression ability of the DNA. Alternatively, the DNA substantially does not have the ability to express the polypeptide of the present invention by substantially losing the activity of the polypeptide of the present invention encoded by the DNA (hereinafter referred to as the knockout DNA of the present invention). Non-human mammalian embryonic stem cells (may be referred to as
(Abbreviated as ES cell). As the non-human mammal, the same one as described above is used. The method of artificially mutating the DNA of the present invention can be performed, for example, by deleting a part or all of the DNA sequence and inserting or substituting another DNA by a genetic engineering technique. Due to these mutations, for example, the knockout DNA of the present invention is shifted by shifting the codon reading frame or disrupting the function of the promoter or exon.
May be prepared. Specific examples of the non-human mammalian embryonic stem cells in which the DNA of the present invention has been inactivated (hereinafter abbreviated as the DNA-inactivated ES cells of the present invention or the knockout ES cells of the present invention) include, for example, The DNA of the present invention possessed by a non-human mammal is isolated, and a drug resistance gene represented by a neomycin resistance gene, a hygromycin resistance gene or lacZ
Inserting a reporter gene such as (β-galactosidase gene) or cat (chloramphenicol acetyltransferase gene), etc., destroys the function of exons, or terminates the transcription of genes in the introns between exons. A DNA chain (hereinafter abbreviated as a targeting vector) having a DNA sequence constructed to insert a DNA sequence (for example, a polyA addition signal or the like) so that complete messenger RNA cannot be synthesized, resulting in gene disruption. Is introduced into the chromosome of the animal by, for example, a homologous recombination method, and the obtained ES cells are subjected to Southern hybridization analysis using a DNA sequence at or near the DNA of the present invention as a probe or a DNA sequence on a targeting vector. When Over the DNA sequence of the neighboring region other than the DNA of the present invention used in Getting vector production was analyzed by PCR method using a primer, it can be to select the knockout ES cell of the present invention.

The DN of the present invention can be prepared by the homologous recombination method or the like.
As the ES cells from which A is inactivated, for example, those already established as described above may be used.
It may be newly established according to the method of Evans and Kaufma. For example, in the case of mouse ES cells, currently, 129 line ES cells are generally used. However, since the immunological background is not clear, a pure line instead of this is used as an immunological genetic background. For example, C57BL / 6 mice or C57BL /
Well as the number of oocytes retrieved the lack of 6 DBA / 2 and BDF ₁ mice improved by crossing (C57BL / 6 and F ₁ and DBA / 2) which were established by using the usable good. B
DF ₁ mice are often egg number and egg can be changed to that of a tough, since with C57BL / 6 mice in the background, when the ES cells obtained therefrom, which were generated pathological model mice , C57BL / 6 mice can be advantageously used in that their genetic background can be replaced with C57BL / 6 mice by backcrossing. Also,
When ES cells are established, blastocysts 3.5 days after fertilization are generally used. In addition to this, a large number of initial cells can be efficiently prepared by collecting 8-cell embryos and culturing them up to blastocysts. Embryos can be obtained. Either male or female ES cells may be used, but generally male ES cells are more convenient for producing a germline chimera. It is also desirable to discriminate between males and females as soon as possible in order to reduce cumbersome culture labor. As a method for determining the sex of ES cells, for example, a method of amplifying and detecting a gene in the sex-determining region on the Y chromosome by PCR can be mentioned. By using this method, the number of ES cells of about 1 colony (about 50 cells) is sufficient, whereas the conventional method required about 10 ⁶ cells for karyotype analysis. The primary selection of ES cells in the early stage can be performed by discriminating between male and female, and by enabling selection of male cells at an early stage, labor in the initial stage of culture can be greatly reduced.

The secondary selection can be performed by, for example, confirming the number of chromosomes by the G-banding method. The number of chromosomes in the obtained ES cells is desirably 100% of the normal number. However, when it is difficult due to physical operations or the like at the time of establishment, after knocking out the gene of the ES cells, the cells can be knocked out of normal cells (for example, chromosome in mice). Number is 2n
= Cells). The embryonic stem cell line obtained in this way usually has very good growth properties, but must be carefully subcultured because it tends to lose its ontogenetic ability. For example, on a suitable feeder cell such as STO fibroblast, in a carbon dioxide incubator (preferably 5% carbon dioxide, 95% air or 5%) in the presence of LIF (1-10000 U / ml).
% Oxygen, 5% carbon dioxide gas, 90% air) at about 37 ° C., and at the time of subculture, for example, trypsin / EDTA solution (usually 0.001-0.5% trypsin / 0.5%). 1-5 mM EDTA, preferably about 0.1% trypsin / 1 mM EDTA) treatment to form a single cell,
A method of seeding on newly prepared feeder cells is used. Such passage is usually performed every 1 to 3 days. At this time, it is desirable to observe the cells and, if morphologically abnormal cells are found, discard the cultured cells. ES cells are differentiated into various types of cells, such as parietal, visceral, and cardiac muscles, by monolayer culture up to high density or suspension culture until cell clumps are formed under appropriate conditions. [MJ
Evans and MH Kaufman, Nature 292
Vol. 154, 1981; GR Martin Proceedings of National Academy of Sciences USA (Proc. Natl. Acad. Sci. USA) No. 7
8, 7634, 1981; TC Doetschman et al., Journal of Embryology and Experimental Morphology, 87, 27, 1985], obtained by differentiating the ES cells of the present invention. The cells deficient in expressing the DNA of the present invention are useful in in vitro cell biology of the polypeptide of the present invention. The DN of the present invention
A non-human mammal deficient in A expression can be distinguished from a normal animal by measuring the mRNA level of the animal using a known method and indirectly comparing the expression level. As the non-human mammal, those similar to the aforementioned can be used.

The non-human mammal deficient in DNA expression of the present invention can be prepared, for example, by introducing the targeting vector prepared as described above into a mouse embryonic stem cell or mouse egg cell, and introducing the targeting vector of the present invention.
By knocking out the DNA of the present invention, the DNA sequence in which NA has been inactivated is replaced with the DNA of the present invention on the chromosome of mouse embryonic stem cells or mouse egg cells by gene homologous recombination. it can. A cell in which the DNA of the present invention has been knocked out is a DNA sequence of the present invention derived from the mouse used in the targeting vector, the DNA sequence of the DNA of the present invention or a DNA sequence of the targeting vector, or a DNA sequence on or near the DNA of the present invention. The determination can be made by analysis by a PCR method using the DNA sequence of a nearby region other than DNA as a primer. When a non-human mammalian embryonic stem cell is used, a cell line in which the DNA of the present invention has been inactivated by gene homologous recombination is cloned, and the cell is cultured at an appropriate time, for example, at the 8-cell stage of a non-human mammalian stem cell. The chimeric embryo is injected into an animal embryo or blastocyst, and the produced chimeric embryo is transplanted into the uterus of the pseudopregnant non-human mammal. The produced animal is a chimeric animal comprising both cells having the normal DNA locus of the present invention and cells having the artificially mutated DNA locus of the present invention. When a part of the germ cells of the chimeric animal has a mutated DNA locus of the present invention, all tissues are artificially mutated from a population obtained by crossing such a chimeric individual with a normal individual. D of the present invention added
It can be obtained by selecting individuals composed of cells having NA loci, for example, by judging coat color. The individual thus obtained is usually an individual heterozygously deficient in expression of the polypeptide of the present invention, and mated with an individual heterozygously deficient in expression of the polypeptide of the present invention. Can be obtained. When an egg cell is used, for example, a transgenic non-human mammal having a targeting vector introduced into a chromosome can be obtained by injecting a DNA solution into a nucleus of an egg cell by a microinjection method, and these transgenic non-human mammals can be obtained. Compared to mammals, they can be obtained by selecting those having a mutation in the DNA locus of the present invention by homologous recombination.

In the individual knocked out of the DNA of the present invention as described above, the animal individual obtained by mating should be confirmed to have knocked out the DNA, and then reared in a normal rearing environment. Can be. further,
The germline can be obtained and maintained in accordance with a conventional method. That is, by crossing male and female animals having the inactivated DNA, homozygous animals having the inactivated DNA on both homologous chromosomes can be obtained. The obtained homozygous animals were compared to normal animals 1
It can be obtained efficiently by breeding in a state where a plurality of homozygotes are formed. By mating male and female heterozygous animals, homozygous and heterozygous animals having the inactivated DNA are bred and passaged. The non-human mammalian embryonic stem cells in which the DNA of the present invention has been inactivated are extremely useful for producing a non-human mammal deficient in expressing the DNA of the present invention. In addition, the DN of the present invention
Since a non-human mammal deficient in A expression lacks various biological activities that can be induced by the polypeptide of the present invention, it can serve as a model for a disease caused by inactivation of the biological activity of the polypeptide of the present invention. It is useful for investigating the causes of these diseases and examining treatment methods.

(8a) A method for screening a compound having a therapeutic / preventive effect against diseases caused by DNA deficiency or damage according to the present invention.
Treatment / prevention of diseases caused by NA deficiency or damage (eg, cancer, immunological diseases, respiratory diseases, gastrointestinal diseases, cardiovascular diseases, endocrine diseases, infectious diseases or diseases such as nervous system diseases and mental illnesses) The present invention can be used for screening a compound having an effect, that is, the present invention relates to the DN of the present invention.
A test compound is administered to a non-human mammal deficient in A expression, and a change in the animal is observed and measured.
A method for screening a compound having a prophylactic effect or a salt thereof is provided. The non-human mammal deficient in expression of the DNA of the present invention used in the screening method includes:
The same thing as the above is mentioned. As test compounds,
For example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, plasma and the like, and these compounds may be novel compounds, Known compounds may be used. Specifically, a non-human mammal deficient in expression of the DNA of the present invention is treated with a test compound, compared with a non-treated control animal, and tested using changes in each organ, tissue, disease symptoms, etc. of the animal as an index. The therapeutic / preventive effects of the compounds can be tested. As a method of treating a test animal with a test compound, for example, oral administration, intravenous injection and the like are used, and it can be appropriately selected according to the symptoms of the test animal, the properties of the test compound, and the like. In addition, the dose of the test compound can be appropriately selected according to the administration method, properties of the test compound, and the like. For example, when screening for a compound having a therapeutic / preventive effect on pancreatic dysfunction, a non-human mammal deficient in expressing DNA of the present invention is subjected to glucose tolerance treatment, and a test compound is administered before or after glucose tolerance treatment,
The blood glucose level and weight change of the animal are measured over time.

The compound obtained by using the screening method of the present invention is a compound selected from the above-mentioned test compounds, and is a disease (eg, cancer, immune disease, etc.) caused by deficiency or damage of the polypeptide or the like of the present invention. , Respiratory disease, gastrointestinal tract disease, cardiovascular disease, endocrine disease, infectious disease or nervous system disease or mental illness, etc.). Can be used as a medicine. Further, compounds derived from the compounds obtained by the above screening can be used in the same manner. The compound obtained by the screening method may form a salt, and the salt of the compound may be a physiologically acceptable acid (eg, an inorganic acid,
Salts with organic acids) and bases (eg, alkali metals) are used, and particularly preferred are physiologically acceptable acid addition salts. Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) Acids, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used. A medicament containing the compound or a salt thereof obtained by the screening method can be produced in the same manner as the aforementioned medicament containing the polypeptide of the present invention. The preparation thus obtained is
Since it is safe and has low toxicity, it can be administered to, for example, humans or mammals (eg, rats, mice, guinea pigs, rabbits, sheep, pigs, cows, horses, cats, dogs, monkeys, etc.). The dose of the compound or a salt thereof varies depending on the target disease, the administration subject, the administration route, and the like. For example, when the compound is orally administered for the purpose of treating an inflammatory disease, it is generally used for an adult (with a body weight of 60 kg). )), The compound is used in an amount of about 0.1 to 10 per day.
0 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg. When administered parenterally, the single dose of the compound varies depending on the administration subject, target disease, and the like. For example, for the purpose of treating an inflammatory disease, the compound is usually administered in the form of an injection to an adult (60 kg as an injection). )), The compound is administered in an amount of from about 0.01 to 30 per day.
It is convenient to administer about mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg by intravenous injection. In the case of other animals, the dose can be administered in terms of 60 kg.

(8b) Method for Screening Compound Promoting or Inhibiting the Activity of Promoter for DNA of the Present Invention The present invention relates to a non-human mammal deficient in expression of the DNA of the present invention.
The present invention provides a method for screening a compound or a salt thereof that promotes or inhibits the activity of a promoter for DNA of the present invention, which comprises administering a test compound and detecting the expression of a reporter gene. In the above-mentioned screening method, the non-human mammal deficient in expression of DNA of the present invention may be a non-human mammal deficient in expressing DNA of the present invention in which the DNA of the present invention is inactivated by introducing a reporter gene, A reporter gene that can be expressed under the control of a promoter for the DNA of the present invention is used. Examples of the test compound include the same compounds as described above. As the reporter gene, the same one as described above is used, and a β-galactosidase gene (lacZ), a soluble alkaline phosphatase gene, a luciferase gene and the like are preferable. The DN of the present invention in which the DNA of the present invention is replaced with a reporter gene
In a non-human mammal deficient in A expression, since the reporter gene is under the control of the promoter for the DNA of the present invention, the activity of the promoter can be detected by tracing the expression of a substance encoded by the reporter gene.

For example, when a part of the DNA region encoding the polypeptide of the present invention is replaced with a β-galactosidase gene (lacZ) derived from Escherichia coli, the tissue which expresses the polypeptide of the present invention should Β-galactosidase is expressed instead of the polypeptide of the invention. Thus, for example, β-bromo-4-chloro-3-indolyl-β-galactopyranoside (X-gal)
By staining with a reagent serving as a substrate for galactosidase, the expression state of the polypeptide of the present invention in an animal body can be easily observed. In particular,
The polypeptide-deficient mouse of the present invention or a tissue section thereof is fixed with glutaraldehyde or the like, washed with a phosphate buffered saline (PBS), and then stained with X-gal-containing staining solution at room temperature or around 37 ° C. for about 30 minutes. After reacting for 1 minute to 1 hour, the β-galactosidase reaction may be stopped by washing the tissue specimen with a 1 mM EDTA / PBS solution, and coloration may be observed. Also, according to the usual method, lac
The mRNA encoding Z may be detected.

The compound or a salt thereof obtained by using the above-mentioned screening method is a compound selected from the above-mentioned test compounds, and is a compound that promotes or inhibits the promoter activity for the DNA of the present invention. The compound obtained by the screening method may form a salt,
Salts of the compound include physiologically acceptable acids (eg,
Salts with inorganic acids) and bases (eg, organic acids),
Particularly preferred are physiologically acceptable acid addition salts. Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) Acids, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used. The compound or its salt that promotes the promoter activity for the DNA of the present invention can promote the expression of the polypeptide of the present invention and promote the function of the polypeptide, and thus can be used, for example, for cancer, immune disease, and respiratory disease. It is useful as a medicament such as a safe and low-toxic therapeutic / prophylactic agent for diseases such as gastrointestinal diseases, cardiovascular diseases, endocrine diseases, infectious diseases, nervous system diseases and mental illness. Further, compounds derived from the compounds obtained by the above screening can be used in the same manner.

A medicament containing the compound or a salt thereof obtained by the screening method can be produced in the same manner as the above-mentioned medicament containing the polypeptide of the present invention or a salt thereof. The preparations obtained in this way are safe and have low toxicity, for example, humans or mammals (eg, rats, mice, guinea pigs, rabbits, sheep,
Pig, cow, horse, cat, dog, monkey, etc.). The dose of the compound or a salt thereof varies depending on the target disease, the target of administration, the administration route, and the like. When a compound that promotes the promoter activity of the DNA of the present invention is orally administered for the purpose of treating a nervous system disease or a psychiatric disorder, generally, in an adult (with a body weight of 60 kg), about 0.1 to 100 mg of the compound per day is used. , Preferably about 1.
0 to 50 mg, more preferably about 1.0 to 20 mg is administered. When administered parenterally, a single dose of the compound may vary depending on the administration subject, target disease, and the like. When administered to a normal adult (as 60 kg) in the form of a preparation, the compound is administered in an amount of about 0.01 to 30 mg, preferably about 0.1 to 30 mg per day.
Conveniently, about 20 mg, more preferably about 0.1 to 10 mg is administered by intravenous injection. In the case of other animals, the dose can be administered in terms of 60 kg. On the other hand, for example, when orally administering a compound that inhibits the promoter activity of the DNA of the present invention,
Generally, in an adult (assuming a body weight of 60 kg), the compound is used in an amount of about 0.1 to 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg per day.
Administer. When administered parenterally, the single dose of the compound varies depending on the administration subject, target disease, and the like.
When the compound of the present invention that inhibits promoter activity on DNA is administered to an adult (60 kg) in the form of an injection, the compound is administered in an amount of about 0.01 to 30 mg per day.
It is convenient to administer a dose of about 0.1 to 20 mg, more preferably about 0.1 to 10 mg, by intravenous injection. In the case of other animals, the dose can be administered in terms of 60 kg. As described above, the non-human mammal deficient in expression of the DNA of the present invention comprises the DN of the present invention.
It is extremely useful in screening for compounds or salts thereof that promote or inhibit the activity of the promoter for A, and greatly contribute to the investigation of the causes of various diseases caused by DNA expression deficiency of the present invention or the development of preventive / therapeutic agents. Can be.

In the present specification and drawings, when bases, amino acids and the like are represented by abbreviations, IUPAC-IUB
It is based on the abbreviation by the Commission on Biochemical Nomenclature or the abbreviation commonly used in the relevant field. When an amino acid can have an optical isomer, the L-form is indicated unless otherwise specified. DNA: deoxyribonucleic acid cDNA: complementary deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine RNA: ribonucleic acid mRNA: messenger ribonucleic acid dATP: deoxyadenosine triphosphate dTTP: deoxythymidine triphosphate dGTP: deoxyguanosine triphosphate Phosphate dCTP: Deoxycytidine triphosphate ATP: Adenosine triphosphate EDTA: Ethylenediaminetetraacetic acid SDS: Sodium dodecyl sulfate

Gly: glycine Ala: alanine Val: valine Leu: leucine Ile: isoleucine Ser: serine Thr: threonine Cys: cysteine Met: methionine Glu: glutamic acid Asp: aspartic acid Lysine arginine arginine : Tyrosine Trp: Tryptophan Pro: Proline Asn: Asparagine Gln: Glutamine pGlu: Pyroglutamic acid

The substituents, protecting groups and reagents frequently used in the present specification are represented by the following symbols. Me: methyl group Et: ethyl group Bu: butyl group Ph: phenyl group TC: thiazolidine -4 (R) - carboxamide group Tos: p-toluenesulfonyl CHO: formyl Bzl: benzyl Cl ₂ Bzl: 2,6-dichlorobenzyl Bom : Benzyloxymethyl Z: benzyloxycarbonyl Cl-Z: 2-chlorobenzyloxycarbonyl Br-Z: 2-bromobenzyloxycarbonyl Boc: t-butoxycarbonyl DNP: dinitrophenyl Trt: trityl Bum: t-butoxymethyl Fmoc: N-9-fluorenylmethoxycarbonyl HOBt: 1-hydroxybenztriazole HOOBT: 3,4-dihydro-3-hydroxy-4-oxo-1,2,3-benzotriazine HONB: 1-hydroxy 5-norbornene-2,3-dicarboximide DCC: N, N'-dicyclohexylcarbodiimide

The sequence numbers in the sequence listing in the present specification indicate the following sequences. [SEQ ID NO: 1] Human-derived polypeptide TGC-48 of the present invention
1 shows the amino acid sequence of 0. [SEQ ID NO: 2] Human-derived polypeptide TGC-54 of the present invention
6 shows the amino acid sequence of 6. [SEQ ID NO: 3] Human-derived polypeptide TGC-59 of the present invention
5 shows the amino acid sequence of 5. [SEQ ID NO: 4] Human-derived polypeptide TGC-62 of the present invention
3 shows the amino acid sequence of 3. [SEQ ID NO: 5] Human-derived polypeptide TGC-62 of the present invention
4 shows the amino acid sequence of 4. [SEQ ID NO: 6] Human-derived polypeptide TGC-62 of the present invention
5 shows the amino acid sequence of 5. [SEQ ID NO: 7] Human-derived polypeptide TGC-62 of the present invention
8 shows the amino acid sequence of 8. [SEQ ID NO: 8] Human-derived polypeptide TGC-70 of the present invention
8 shows the amino acid sequence of 8. [SEQ ID NO: 9] Human-derived polypeptide TGC-71 of the present invention
1 shows the amino acid sequence of 1. [SEQ ID NO: 10] Human-derived polypeptide TGC- of the present invention
1 shows the amino acid sequence of 714. [SEQ ID NO: 11] Human-derived polypeptide TGC- of the present invention
1 shows the amino acid sequence of 715. [SEQ ID NO: 12] Human-derived polypeptide TGC- of the present invention
1 shows the amino acid sequence of 749. [SEQ ID NO: 13] Human-derived polypeptide TGC- of the present invention
1 shows the amino acid sequence of 768. [SEQ ID NO: 14] Human-derived polypeptide TGC- of the present invention
772 shows the amino acid sequence of 772. [SEQ ID NO: 15] Human-derived polypeptide TGC- of the present invention
790 shows the amino acid sequence of 790. [SEQ ID NO: 16] This shows the base sequence of DNA encoding human-derived polypeptide TGC-480 of the present invention having the amino acid sequence represented by SEQ ID NO: 1. [SEQ ID NO: 17] This shows the base sequence of DNA encoding human-derived polypeptide TGC-546 of the present invention having the amino acid sequence represented by SEQ ID NO: 2. [SEQ ID NO: 18] This shows the base sequence of DNA encoding human-derived polypeptide TGC-595 of the present invention having the amino acid sequence represented by SEQ ID NO: 3. [SEQ ID NO: 19] This shows the base sequence of DNA encoding the human-derived polypeptide TGC-623 of the present invention having the amino acid sequence represented by SEQ ID NO: 4. [SEQ ID NO: 20] This shows the base sequence of DNA encoding the human-derived polypeptide TGC-624 of the present invention having the amino acid sequence represented by SEQ ID NO: 5. [SEQ ID NO: 21] This shows the base sequence of DNA encoding the human-derived polypeptide TGC-625 of the present invention having the amino acid sequence represented by SEQ ID NO: 6. [SEQ ID NO: 22] This shows the base sequence of DNA encoding human-derived polypeptide TGC-628 of the present invention having the amino acid sequence represented by SEQ ID NO: 7. [SEQ ID NO: 23] This shows the base sequence of DNA encoding human-derived polypeptide TGC-708 of the present invention having the amino acid sequence represented by SEQ ID NO: 8. [SEQ ID NO: 24] This shows the base sequence of DNA encoding human-derived polypeptide TGC-711 of the present invention having the amino acid sequence represented by SEQ ID NO: 9. [SEQ ID NO: 25] This shows the base sequence of DNA encoding the human-derived polypeptide TGC-714 of the present invention having the amino acid sequence represented by SEQ ID NO: 10. [SEQ ID NO: 26] This shows the base sequence of DNA encoding human-derived polypeptide TGC-715 of the present invention having the amino acid sequence represented by SEQ ID NO: 11. [SEQ ID NO: 27] This shows the base sequence of DNA encoding human-derived polypeptide TGC-749 of the present invention having the amino acid sequence represented by SEQ ID NO: 12. [SEQ ID NO: 28] This shows the base sequence of DNA encoding the human-derived polypeptide TGC-768 of the present invention having the amino acid sequence represented by SEQ ID NO: 13. [SEQ ID NO: 29] This shows the base sequence of DNA encoding human-derived polypeptide TGC-772 of the present invention having the amino acid sequence represented by SEQ ID NO: 14. [SEQ ID NO: 30] This shows the base sequence of DNA encoding human-derived polypeptide TGC-790 of the present invention having the amino acid sequence represented by SEQ ID NO: 15.

[SEQ ID NO: 31] 5 ′ described in Example 1
Shows the nucleotide sequence of the terminal primer. [SEQ ID NO: 32] This shows the base sequence of the primer for 3 ′ end described in Example 1. [SEQ ID NO: 33] This shows the base sequence of the primer for 5 ′ end described in Example 2. [SEQ ID NO: 34] This shows the base sequence of the primer for 3 ′ end described in Example 2. [SEQ ID NO: 35] This shows the base sequence of the primer for 5 ′ end described in Example 3. [SEQ ID NO: 36] This shows the base sequence of the primer for 3 ′ end described in Example 3. [SEQ ID NO: 37] This shows the base sequence of the primer for 5 ′ end described in Example 4. [SEQ ID NO: 38] This shows the base sequence of the primer for 3 ′ end described in Example 4. [SEQ ID NO: 39] This shows the base sequence of the primer for 5 ′ end described in Example 5. [SEQ ID NO: 40] This shows the base sequence of the primer for 3 ′ end described in Example 5. [SEQ ID NO: 41] This shows the base sequence of the primer for 5 ′ end described in Example 6. [SEQ ID NO: 42] This shows the base sequence of the primer for 3 ′ end described in Example 6. [SEQ ID NO: 43] This shows the base sequence of the primer for 5 ′ end described in Example 7. [SEQ ID NO: 44] This shows the base sequence of the primer for 3 ′ end described in Example 7. [SEQ ID NO: 45] This shows the base sequence of the primer for 5 ′ end described in Example 8. [SEQ ID NO: 46] This shows the base sequence of the 3′-end primer described in Example 8. [SEQ ID NO: 47] This shows the base sequence of the primer for 5 ′ end described in Example 9. [SEQ ID NO: 48] This shows the base sequence of the primer for 3 ′ end described in Example 9. [SEQ ID NO: 49] This shows the base sequence of the primer for 5 ′ end described in Example 10. [SEQ ID NO: 50] This shows the base sequence of the primer for 3 ′ end described in Example 10. [SEQ ID NO: 51] This shows the base sequence of the primer for 5 ′ end described in Example 11. [SEQ ID NO: 52] This shows the base sequence of the 3′-end primer described in Example 11. [SEQ ID NO: 53] This shows the base sequence of the primer for 5 ′ end described in Example 12. [SEQ ID NO: 54] This shows the base sequence of the primer for 3 ′ end described in Example 12. [SEQ ID NO: 55] This shows the base sequence of the primer for 5 ′ end described in Example 13. [SEQ ID NO: 56] This shows the base sequence of the primer for 3 ′ end described in Example 13. [SEQ ID NO: 57] This shows the base sequence of the primer for 5 ′ end described in Example 14. [SEQ ID NO: 58] This shows the base sequence of the primer for 3 ′ end described in Example 14. [SEQ ID NO: 59] This shows the base sequence of the primer for 5 ′ end described in Example 15. [SEQ ID NO: 60] This shows the base sequence of the primer for 3 ′ end described in Example 15. [SEQ ID NO: 61] This shows the base sequence of the primer described in Example 16. [SEQ ID NO: 62] This shows the base sequence of the primer described in Example 16. [SEQ ID NO: 63] This shows the base sequence of the primer described in Example 17. [SEQ ID NO: 64] This shows the base sequence of the primer described in Example 17. [SEQ ID NO: 65] This shows the base sequence of the primer described in Example 18. [SEQ ID NO: 66] This shows the base sequence of the primer described in Example 18. [SEQ ID NO: 67] This shows the base sequence of the primer described in Example 19. [SEQ ID NO: 68] This shows the base sequence of the primer described in Example 19. [SEQ ID NO: 69] This shows the base sequence of the primer described in Example 20. [SEQ ID NO: 70] This shows the base sequence of the primer described in Example 20.

[0072]

EXAMPLES The present invention will be described below in detail with reference to examples, but the present invention is not limited thereto.
Gene manipulation using Escherichia coli is performed by molecular
The method described in Molecular cloning was followed. Example 1 TGC-480 from database
Selection and nucleotide sequence analysis Smith Klein Bee Cham (S
B) A clone which seems to encode a signal sequence for secretion and a processing site was selected from the EST database supplied by the company. Specifically, each E
The DNA sequence of ST is translated into an amino acid sequence, and a sequence having a cluster of hydrophobic amino acids (Leu, Ile, Val, Ala, etc.) after Met and conserved at the processing site in the same frame (Arg-Arg , Lys-Arg, Lys-Lys). As a result, HGS: 558273 was found as an EST clone satisfying these conditions. However, in the EST sequence, there is usually a possibility of deletion, insertion, misreading, etc. of the base sequence, and at the same time, since this is a partial sequence of cDNA, this clone is ordered from SB as TGC-480 and inserted into the plasmid. A DNA sequencer (ABI PRISMTM 377, Perkin
Elmer). As a result, the inserted sequence (cDNA) of this clone encodes a polypeptide of 125 amino acid residues represented by SEQ ID NO: 1, SEQ ID NO: 1
It was found to have an open reading frame of 378 bases represented by No. 6. The N-terminal 21 amino acid residues of the amino acid sequence represented by SEQ ID NO: 1 are expected to be a signal sequence for secretion. The clone was also found to be expressed in the brain, testis, heart and the like. The cDNA fragment can be obtained by a usual method based on the above information. That is, the 5 'end and 3'
PCR primers corresponding to the ends (for example, ATGGCC
AAGTACCTGGCCCAGATCA and TCACGTATGGGGCATCTGCCCTTTT)
And a cDNA library (eg, brain, testis, heart, etc.) of the above-described tissue or mRNA derived from the above-mentioned tissue
Can be obtained by RT-PCR using as a template. In particular,
5 pmol of each primer, 5 μl of 100 mM Tris / HCl buffer (pH 9.0), 5 μl of 500 mM potassium chloride solution, 3 μm of 25 mM magnesium chloride solution
1, 2.5 mM deoxyribonucleotide solution 4μ
1, 1 μl of cDNA solution, and TaKaRa Taq
Prepare 50 μl of a mixed solution containing 0.5 μl of ^TM
After first placing at 95 ° C. for 1 minute using Ra PCR Thermal Cycler MP (Takara Shuzo Co., Ltd.),
Each reaction was repeated 35 cycles, each cycle consisting of 30 seconds at 65 ° C, 1 minute at 65 ° C, and 2 minutes at 72 ° C.
By performing a PCR reaction using a program for reacting at 10 ° C. for 10 minutes, a target PCR fragment can be obtained.

Example 2 Selection of TGC-546 from Database and Analysis of Nucleotide Sequence After selecting HGS: 447917 by the same method as described in Example 1, this clone was ordered as TGC-546 and the nucleotide sequence was confirmed. Was done. As a result, the inserted sequence (cD
NA) was found to have an open reading frame of 366 bases represented by SEQ ID NO: 17, which encodes a polypeptide of 121 amino acid residues represented by SEQ ID NO: 2. The N-terminal 23 amino acid residues of the amino acid sequence represented by SEQ ID NO: 2 are predicted to be a signal sequence for secretion. This clone was found to be expressed in the epididymis. The cDNA fragment can be obtained by a usual method based on the above information. That is, primers for PCR corresponding to the 5 ′ end and the 3 ′ end from the base sequence described in SEQ ID NO: 17 (for example, ATGCACAGATCAGAGCCATTTCTGA and
TTACAGTAGTGGCAGTAACACTTGG) can be prepared and obtained by RT-PCR using a cDNA library (for example, epididymis, etc.) of the above tissue or mRNA derived from the above tissue as a template. As the PCR reaction conditions, the method described in Example 1 is used.

Example 3 Selection of TGC-595 from Database and Analysis of Nucleotide Sequence After selecting HGS: 1006634 by the same method as described in Example 1, this clone was ordered as TGC-595 and the nucleotide sequence was confirmed. Was done. As a result, the inserted sequence (c
DNA) was found to have an open reading frame of 672 bases represented by SEQ ID NO: 18, which encodes a polypeptide of 223 amino acid residues represented by SEQ ID NO: 3. The N-terminal 19 amino acid residues of the amino acid sequence represented by SEQ ID NO: 3 are predicted to be a signal sequence for secretion. In addition, this clone was obtained from spinal cord, T
It was found to be expressed in cells and retina. In addition,
When the cDNA fragment is obtained, it can be performed by a usual method based on the above information. That is, primers for PCR corresponding to the 5 ′ end and 3 ′ end from the base sequence described in SEQ ID NO: 18 (for example, ATGAAGTTCGTC
CCCTGCCTCCTGC and TCACCCTCGGAAGAAGCTGATGAGA) are prepared, and can be obtained by RT-PCR using a cDNA library (for example, spinal cord, T cell, retina, etc.) of the above tissue or mRNA derived from the above tissue as a template. As the PCR reaction conditions, the method described in Example 1 is used.

Example 4 Selection of TGC-623 from Database and Analysis of Nucleotide Sequence After selecting HGS: 92551 by the same method as described in Example 1, this clone was ordered as TGC-623, and the nucleotide sequence was confirmed. Was done. As a result, the inserted sequence (cD
NA) was found to have an open reading frame of 747 bases represented by SEQ ID NO: 19, encoding a polypeptide of 248 amino acid residues represented by SEQ ID NO: 4. The N-terminal 21 amino acid residues of the amino acid sequence represented by SEQ ID NO: 4 are predicted to be a signal sequence for secretion. In addition, this clone was found to be expressed in the cerebellum, adrenal gland, and the like. The cDNA
When obtaining a fragment, it can be carried out by a usual method based on the above information. That is, SEQ ID NO: 19
PC corresponding to the 5 'end and 3' end from the base sequence described in
R primers (eg, ATGGGACCTGTGCGGTTGGGAAT
AT and TCAAAGATCTTCTCGGTCAAGTTTG) to prepare a cDNA library (for example, cerebellum, adrenal gland, etc.) of the above-mentioned tissue or an RT-P using mRNA derived from the above-mentioned tissue as a template.
It can be obtained by CR. As the PCR reaction conditions, the method described in Example 1 is used.

Example 5 Selection of TGC-624 from Database and Analysis of Nucleotide Sequence After selecting HGS: 1731120 by the same method as described in Example 1, this clone was ordered as TGC-624 and the nucleotide sequence was confirmed. Was done. As a result, the inserted sequence (c
DNA) was found to have an open reading frame of 522 bases represented by SEQ ID NO: 20, which encodes a polypeptide having 173 amino acid residues represented by SEQ ID NO: 5. The N-terminal 19 amino acid residues of the amino acid sequence represented by SEQ ID NO: 5 are predicted to be a signal sequence for secretion. In addition, this clone was found to be expressed in dendritic cells, T cells, and the like. In addition,
When the cDNA fragment is obtained, it can be performed by a usual method based on the above information. That is, primers for PCR corresponding to the 5 ′ end and the 3 ′ end from the base sequence described in SEQ ID NO: 20 (for example, ATGTTTTGCCC
ACTGAAACTCATCC and TCATG AAAATATCCATTCTACCTTG) were prepared, and a cDNA library (for example,
Dendritic cells, T cells, etc.) and the above-mentioned tissue-derived mRNA as a template. As the PCR reaction conditions, the method described in Example 1 is used.

Example 6 Selection of TGC-625 from Database and Analysis of Nucleotide Sequence After selecting HGS: 1014817 by the same method as described in Example 1, this clone was ordered as TGC-625, and the nucleotide sequence was confirmed. Was done. As a result, the inserted sequence (c
DNA) was found to have an open reading frame of 786 bases represented by SEQ ID NO: 21, encoding a polypeptide of 261 amino acid residues represented by SEQ ID NO: 6. The N-terminal 20 amino acid residues of the amino acid sequence represented by SEQ ID NO: 6 are predicted to be a signal sequence for secretion. It was also found that this clone was expressed in vascular endothelial cells, bone marrow and the like. In addition,
When the cDNA fragment is obtained, it can be performed by a usual method based on the above information. That is, primers for PCR corresponding to the 5 ′ end and the 3 ′ end from the base sequence described in SEQ ID NO: 21 (for example, ATGGAACTGCT
TCAAGTGACCATTC and TCAGTTCTTGGTTTTTCCTTGTGCA) are prepared, and can be obtained by RT-PCR using a cDNA library (for example, vascular endothelial cell, bone marrow, or the like) of the above tissue or mRNA derived from the above tissue as a template. As the PCR reaction conditions, the method described in Example 1 is used.

Example 7 Selection of TGC-628 from Database and Analysis of Nucleotide Sequence After selecting HGS: 1878022 by the same method as described in Example 1, this clone was ordered as TGC-628 and the nucleotide sequence was confirmed. Was done. As a result, the inserted sequence (c
DNA) was found to have an open reading frame of 732 bases represented by SEQ ID NO: 22, encoding a polypeptide of 243 amino acid residues represented by SEQ ID NO: 7. The N-terminal 30 amino acid residues of the amino acid sequence represented by SEQ ID NO: 7 are predicted to be a signal sequence for secretion. This clone was found to be expressed in the thymus, placenta and the like. The cDN
When obtaining the fragment A, it can be carried out by a usual method based on the above information. That is, SEQ ID NO: 2
P corresponding to the 5 'end and 3' end from the nucleotide sequence described in 2
Primer for CR (for example, ATGCGACCCCAGGGCCCCGCCG
CCT and TTATTTTGGTAGTTCTTCAATAATG), and a cDNA library (for example, thymus, placenta, etc.) of the above tissue or an RT-P using mRNA derived from the above tissue as a template
It can be obtained by CR. As the PCR reaction conditions, the method described in Example 1 is used.

Example 8 Selection of TGC-708 from Database and Analysis of Nucleotide Sequence After selecting HGS: 2346555 by the same method as described in Example 1, this clone was ordered as TGC-708 and the nucleotide sequence was determined. Confirmation was made. As a result, the inserted sequence (c
DNA) was found to have an open reading frame of 450 bases represented by SEQ ID NO: 23, encoding a polypeptide of 149 amino acid residues represented by SEQ ID NO: 8. The N-terminal 18 amino acid residues of the amino acid sequence represented by SEQ ID NO: 8 are expected to be a signal sequence for secretion. This clone was found to be expressed on monocytes. The cDNA fragment can be obtained by a usual method based on the above information. That is, primers for PCR corresponding to the 5 ′ end and the 3 ′ end from the base sequence described in SEQ ID NO: 23 (for example, ATGAAGTTACAGTGTGTTTCCCTTT and TC
AGGAGGCCGATGGGGGCCAGCAC) was prepared and c
It can be obtained by RT-PCR using a DNA library (for example, monocytes) or mRNA derived from the above-mentioned tissue as a template. As the PCR reaction conditions, the method described in Example 1 is used.

Example 9 Selection of TGC-711 from Database and Analysis of Nucleotide Sequence After selecting HGS: 809616 by the same method as described in Example 1, this clone was ordered as TGC-711 and the nucleotide sequence was confirmed. Was done. As a result, the inserted sequence (cD
NA) was found to have an open reading frame of 411 bases represented by SEQ ID NO: 24, encoding a polypeptide of 136 amino acid residues represented by SEQ ID NO: 9. The N-terminal 20 amino acid residues of the amino acid sequence represented by SEQ ID NO: 9 are predicted to be a signal sequence for secretion. In addition, this clone was found to be expressed in the cerebellum, lung and the like. The cDNA fragment can be obtained by a usual method based on the above information. That is, the PCR corresponding to the 5 'end and the 3' end from the base sequence described in SEQ ID NO: 24
Primers (eg, ATGGCCAGCCTGGGGCTGCTGCTCC
And TCATGAGGCTCCTGCAGAGGTCTGA), and can be obtained by RT-PCR using a cDNA library (for example, cerebellum, lung, etc.) of the above tissue or mRNA derived from the above tissue as a template. As the PCR reaction conditions, the method described in Example 1 is used.

Example 10 TGC-714 from Database
Selection of HGS and Analysis of Nucleotide Sequence After selecting HGS: 1260352 by the same method as described in Example 1, this clone was ordered as TGC-714 and its nucleotide sequence was confirmed. As a result, the inserted sequence (c
DNA) was found to have an open reading frame of 372 bases represented by SEQ ID NO: 25, which encodes a polypeptide having 123 amino acid residues represented by SEQ ID NO: 10. The N-terminal 22 amino acid residues of the amino acid sequence represented by SEQ ID NO: 10 are predicted to be a signal sequence for secretion. This clone was found to be expressed in the epididymis. The cDNA
When obtaining a fragment, it can be carried out by a usual method based on the above information. That is, SEQ ID NO: 25
PC corresponding to the 5 'end and 3' end from the base sequence described in
R primers (eg, ATGAAACTCCTGCTGCTGGCTCT
TC and TCATGAGCTATGGTGAACATTTGGA) are prepared, and a cDNA library of the above tissue (eg, epididymis, etc.)
-RT-PCR using mRNA derived from the above-mentioned tissue or a template
You can get it. As the PCR reaction conditions, the method described in Example 1 is used.

Example 11 TGC-715 from Database
Selection of HGS and Analysis of Nucleotide Sequence After selecting HGS: 81772 by the same method as described in Example 1, this clone was ordered as TGC-715 and the nucleotide sequence was confirmed. As a result, the inserted sequence (cD
NA) was found to have an open reading frame of 492 bases represented by SEQ ID NO: 26, encoding a polypeptide of 163 amino acid residues represented by SEQ ID NO: 11. The N-terminal 20 amino acid residues of the amino acid sequence represented by SEQ ID NO: 11 are predicted to be a signal sequence for secretion. This clone was found to be expressed in the epididymis. The cDNA fragment can be obtained by a usual method based on the above information. That is, PCR corresponding to the 5 ′ end and 3 ′ end from the base sequence described in SEQ ID NO: 26
Primers (eg, ATGGGCGGCCTGCTGCTGGCTGCTT
And CTACTGTGACAGGAAGCCCAGGCTC), and can be obtained by RT-PCR using a cDNA library (for example, epididymis or the like) of the above tissue or mRNA derived from the above tissue as a template. As the PCR reaction conditions, the method described in Example 1 is used.

Example 12 TGC-749 from Database
Selection of HGS and Analysis of Nucleotide Sequence After selecting HGS: 1379897 by the same method as described in Example 1, this clone was obtained as TGC-749 and its nucleotide sequence was confirmed. As a result, the inserted sequence (c
DNA) was found to have an open reading frame of 906 bases represented by SEQ ID NO: 27, encoding a polypeptide having 301 amino acid residues represented by SEQ ID NO: 12. The N-terminal 18 amino acid residues of the amino acid sequence represented by SEQ ID NO: 12 are predicted to be a signal sequence for secretion. In addition, this clone was found to be expressed in T cells, placenta, liver, large intestine and the like. The cDNA fragment can be obtained by a usual method based on the above information. That is, the 5 'end from the nucleotide sequence of SEQ ID NO: 27
PCR primers corresponding to the 3 'end (for example, AT
GGCCCGGCATGGGTTACCGCTGC and TTACAGCTCCCCTGGCGGCCGGC
CT), and can be obtained by RT-PCR using a cDNA library (for example, T cells, placenta, liver, large intestine, etc.) of the above tissue or mRNA derived from the above tissue as a template. As the PCR reaction conditions, the method described in Example 1 is used.

Example 13 TGC-768 from Database
Selection of HGS and Analysis of Nucleotide Sequence After selecting HGS: 398232 by the same method as described in Example 1, this clone was ordered as TGC-768 and the nucleotide sequence was confirmed. As a result, the inserted sequence (cD
NA) was found to have an open reading frame of 210 bases represented by SEQ ID NO: 28, encoding a polypeptide of 69 amino acid residues represented by SEQ ID NO: 13. The N-terminal 26 amino acid residues of the amino acid sequence represented by SEQ ID NO: 13 are predicted to be a signal sequence for secretion. This clone was found to be expressed in testis. The cDNA fragment can be obtained by a usual method based on the above information. That is, primers for PCR corresponding to the 5 ′ end and the 3 ′ end from the base sequence described in SEQ ID NO: 28 (for example, ATGTGCTGGCTGCGGGCATGGGGCC and TT
ATCTATTCATCATATATTTCTTA), and can be obtained by RT-PCR using a cDNA library (for example, testis or the like) of the above-mentioned tissue or mRNA derived from the above-mentioned tissue as a template. As the PCR reaction conditions, the method described in Example 1 is used.

Example 14 TGC-772 from Database
Selection of HGS and Analysis of Nucleotide Sequence After selecting HGS: 2079036 by the same method as described in Example 1, this clone was obtained as TGC-772 and the nucleotide sequence was confirmed. As a result, the inserted sequence (c
DNA) was found to have an open reading frame of 210 bases represented by SEQ ID NO: 29 which encodes a polypeptide having 69 amino acid residues represented by SEQ ID NO: 14. The 23 amino acid residues at the N-terminal of the amino acid sequence represented by SEQ ID NO: 14 are predicted to be a signal sequence for secretion. In addition, this clone, pancreas,
It was found to be expressed in placenta and the like. The cD
When obtaining the NA fragment, it can be carried out by a usual method based on the above information. That is, SEQ ID NO:
PCR primers corresponding to the 5 'end and the 3' end from the nucleotide sequence described in 29 (for example, ATGGGGTTCCCGGCCGCG
GCGCTGC and CTACGCCGAGACCGTGGGCCTGCGG)
RT using a cDNA library of the above tissue (eg, pancreas, placenta, etc.) or mRNA derived from the above tissue as a template
-Can be obtained by PCR. The reaction conditions of the PCR were as described in Example 1.
Is used.

Example 15 TGC-790 from Database
Selection of HGS and Analysis of Nucleotide Sequence After selecting HGS: 2450362 by the same method as described in Example 1, this clone was ordered as TGC-790 and the nucleotide sequence was confirmed. As a result, the inserted sequence (c
DNA) was found to have an open reading frame of 594 bases represented by SEQ ID NO: 30, encoding a polypeptide of 197 amino acid residues represented by SEQ ID NO: 15. The N-terminal 26 amino acid residues of the amino acid sequence represented by SEQ ID NO: 15 are predicted to be a signal sequence for secretion. This clone was found to be expressed in the placenta. The cDNA fragment can be obtained by a usual method based on the above information. That is, primers for PCR (eg, ATGCGAGGTGGCAAATGCAACATGC and TCATAAACTTGTGTTGGGCTTTAGG) corresponding to the 5 ′ end and the 3 ′ end are prepared from the base sequence described in SEQ ID NO: 30, and a cDNA library of the above-described tissue (eg, placenta, etc.) Alternatively, it can be obtained by RT-PCR using mRNA derived from the above tissue as a template. As the PCR reaction conditions, the method described in Example 1 is used.

Example 16 Expression of secretion of TGC-480 product in COS7 cells An expression vector for expressing the TGC-480 product in animal cells was a DNA containing ORF encoding the TGC-480 product.
The fragment was obtained by inserting it into the expression vector for animal cells pCAN618. First, the TGC-480 obtained in Example 1
Using the cDNA fragment encoding the protein as a template,
Synthetic DNA [5'-TCGGAATTCGCCATGGCC designed so that the recognition site for the EcoRI restriction enzyme comes immediately before the translation initiation codon
AAGTACCTGGCCCAGATC-3 ': (SEQ ID NO: 61)]
Consists of 8 amino acids at the C-terminus of TGC-480 protein
Synthetic DNA [5'-ACGCTCGAGTTACT] designed to have a FLAG sequence (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) followed by a stop codon and a restriction enzyme XhoI recognition site
TGTCATCGTCGTCCTTGTAGTCCGTATGGGGCATCTGCCCTTTTTC-
3 ′: (SEQ ID NO: 62)]. P
Pyrobest DNA Polymerase (Takara Shuzo) was used for the CR reaction, and after 94 minutes at 94 ° C, 10 seconds at 98 ° C, 30 seconds at 60 ° C,
After 25 minutes at 72 ° C for 1 minute, an extension reaction was performed at 72 ° C for 10 minutes to obtain a DNA fragment containing the ORF of TGC-480. This D
The NA fragment is digested with restriction enzymes EcoRI and XhoI, and pCA
Human TGC-480 inserted into EcoRI / XhoI site of N618
Expression vector of protein in animal cells pCAN618 / TGC-48
0FLAG was obtained. 4 × 10 ⁵ COS7 cells were cultured in DMEM (medium; Gibco BRL) containing 10% FBS (fetal bovine serum) in 6-w
The cells were cultured in an el plate for 24 hours. The expression vector pCAN618 / TGC480FLAG DNA was added to these cells using LipofectAMINE (G
ibcoBRL) and further cultured for 18 hours.
Next, Opti-MEM (medium; Gib) containing 0.05% CHAPS
(coBRL) and further cultured for 24 hours, and the culture supernatant was collected. After removing the floating cells by centrifugation, the supernatant was concentrated 10 times by ultrafiltration (Centricon-10; Amicon), and the same amount of SDS-S containing 2-mercaptoethanol was added.
10-25% SDS-PAGE (TEFCO) with ample Buffer
Was electrophoresed. This was transferred to a PVDF membrane (Amersham) and subjected to Western Blot analysis. As primary antibody,
FLAG mouse IgG (10 µg / ml; Sigma) was used, and HRP (Horseradish peroxidase) -labeled anti-mouse IgG antibody (2000-fold diluted; Amersham) was used as the secondary antibody.
The color is developed using the ECLplus Western Blot Detection System (Amers
ham). As a result, it was found that TGC-480 protein was secreted into the culture supernatant (FIG. 1).

Example 17 Secretion Expression of TGC-623 Product in COS7 Cells An expression vector for expressing the TGC-623 product in animal cells was prepared by transfecting a DNA fragment containing ORF encoding the TGC-623 product into animal cells. Obtained by inserting it into the expression vector pCAN618FLAG. pCAN618FLA G is derived from the plasmid vector pCAN618 and is located immediately after the SalI site.
FLAG sequence of amino acids (Asp-Tyr-Lys-Asp-Asp-Asp-Asp
The target protein can be expressed as a FLAG fusion protein by matching the reading frame to the nucleotide sequence encoding -Lys) and the stop codon. First, Example 4
CDNA encoding the TGC-623 protein obtained in
Using the fragment as a template, restriction enzyme E immediately before the translation initiation codon
Synthetic DNA [5'-
TAGACGAATTCCCACCATGGGACCTGTGCGGTTGGGAATATTGC-
3 ': (SEQ ID NO: 67)] and C of TGC-623 protein
Synthetic DNA [5'- AGGCAAGTCGACAAGATCT-TCTCGGTCAAGTTT designed with a restriction enzyme Sal I recognition site at the end
GGGGTGGCTTCCTGTCTTGGTCAT-3 ': (SEQ ID NO: 68
)]. Pyrobe for PCR reactions
Using st DNA Polymerase (Takara), perform TGC-623 after 1 minute at 94 ° C, 25 times at 98 ° C for 10 seconds, 57 ° C for 30 seconds, and 72 ° C for 1 minute, followed by extension at 72 ° C for 10 minutes. OR
A DNA fragment containing F was obtained. This DNA fragment is
Cut with Eco RI and Sal I, Eco R of pCAN618FLAG
The expression vector pCAN618 / TGC-623FLAG for human TGC-623 protein in animal cells was obtained by insertion into the I / SalI site.
This expression vector was transformed with COS7 in the same manner as in Example 16.
The cells were introduced into the cells, the culture supernatant was prepared, and Western Blot analysis was performed. As a result, it was found that TGC-623 protein was secreted into the culture supernatant (FIG. 1).

Example 18 Secretion Expression of TGC-711 Product in COS7 Cells An expression vector for expressing the TGC-711 product in animal cells was prepared in the same manner as in the case of the TGC-480 product shown in Example 16. I got it. First, the TGC-711 obtained in Example 9
Synthetic DNA [5'-TCGGAATTCGCCATGGCCAG] designed using a cDNA fragment encoding a protein as a template and a restriction enzyme Eco RI recognition site immediately before the translation initiation codon
CCTGGGGCTGCTGCTC-3 ': (SEQ ID NO: 63)] and T
FLAG consisting of 8 amino acids at the C-terminus of GC-711 protein
A synthetic DNA [5'-ACGCTCGAGTTACTTGTCAT] designed to have a sequence (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) followed by a stop codon and a restriction enzyme XhoI recognition site.
C GTCGTCCTTGTAGTCTGAGGCTCCTGCAGAGGTCTGAGA-3 ':
(SEQ ID NO: 64)]. PCR and subsequent treatments were performed under the same conditions as in Example 16, and the expression vector pCAN for animal cells of human TGC-711 protein was used.
618 / TGC-711FLAG was obtained. This expression vector was introduced into COS7 cells in the same manner as in Example 16, a culture supernatant was prepared, and Western Blot analysis was performed. As a result, TG
C-711 protein was found to be secreted into the culture supernatant (FIG. 1).

Example 19 Secretion Expression of TGC-714 Product in COS7 Cells An expression vector for expressing the TGC-714 product in animal cells was prepared in the same manner as in the case of the TGC-480 product shown in Example 16. I got it. First, the TGC-714 obtained in Example 10
Using the cDNA fragment encoding the protein as a template,
Synthetic DNA [5'-TCGGAATTCACCATGAAA designed so that the recognition site for the EcoRI restriction enzyme comes immediately before the translation initiation codon
CTCCTGCTGCTGGCTC TT-3 ': (SEQ ID NO: 65)]
Consists of 8 amino acids at the C-terminus of TGC-714 protein
Synthetic DNA designed to have a FLAG sequence (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) followed by a stop codon and a restriction enzyme XhoI recognition site [5'-ACGCTCGAGTTACT
TGTCATCGTCGTCCTTGTAGTCTGAGCTATGGTGAACATTTGGAAG-
3 ′: (SEQ ID NO: 66)].
Pyr obest DNA Polymerase (Takara Shuzo) was used for the PCR reaction. After 1 minute at 94 ° C, 98 ° C for 10 seconds, 55 ° C for 30 seconds,
After 25 times at 72 ° C. for 30 seconds, an extension reaction was performed at 72 ° C. for 10 minutes to obtain a DNA fragment containing the ORF of TGC-714. This D
The NA fragment is digested with restriction enzymes EcoRI and XhoI, and pCA
Human TGC-714 inserted into EcoRI / XhoI site of N618
Expression vector of protein in animal cells pCAN618 / TGC-71
4FLAG was obtained. This expression vector was introduced into COS7 cells in the same manner as in Example 16, and a culture supernatant was prepared.
A tern Blot analysis was performed. As a result, it was found that TGC-714 protein was secreted into the culture supernatant (FIG. 1).

Example 20 Secretion Expression of TGC-715 Product in COS7 Cells An expression vector for expressing the TGC-715 product in animal cells was prepared in the same manner as in the case of the TGC-623 product shown in Example 17. I got it. First, the TGC-715 obtained in Example 11
Using the cDNA fragment encoding the protein as a template,
Synthetic DNA [5'- GTGTAGAATTCCCACCAT designed so that the recognition site for EcoRI is immediately before the translation initiation codon
GGGCGGCCTGCTGCTGGCTGCTTTTCTGGCTTT-3 ': (SEQ ID NO: 69)] and a synthetic DNA designed to have a restriction enzyme Sal I recognition site at the C-terminus of TGC-715 protein [
5'-CTGGGCGTCGACCTGTGACAGGAAGCCCAGGCTCCTGCTCCACT
-3 ': (SEQ ID NO: 70)]. PCR was performed under the same conditions as in Example 16 to obtain
The DNA fragment was purified from pCAN618FLAG in the same manner as in Example 17.
An expression vector pCAN618 / TGC-715FLAG for human TGC-715 protein in animal cells was obtained by insertion into Eco RI / Sal I sites. This expression vector was prepared in the same manner as in Example 16.
Transfer to COS7 cells, prepare culture supernatant, and
t Analysis was performed. As a result, it was found that the TGC-715 protein was secreted into the culture supernatant (FIG. 1).

[0092]

The polypeptide of the present invention may be a tissue marker, a cancer marker, a molecular weight marker, a pathological marker, a binding protein to the polypeptide of the present invention for basic research purposes such as biology, physiology, pharmacology and medicine. It can be used for detection and the like. Further, the polypeptide of the present invention is expected to have one or more biological activities, for example, anticancer action, anti-inflammatory action, hematopoietic action,
Diagnosis and treatment of diseases caused by these actions, as they may have anticoagulant action, cell migration action, cell growth stimulating action, cell differentiation inducing action, immunomodulatory action, ligand action, etc. Can be used for prevention. Furthermore, the polypeptide of the present invention is useful as a reagent for screening a compound or a salt thereof that promotes or inhibits the activity of the polypeptide of the present invention. Furthermore, since an antibody against the polypeptide of the present invention can specifically recognize the polypeptide of the present invention, it can be used for detection, quantification, neutralization, and the like of the polypeptide of the present invention in a test solution. it can.

[0093]

[Sequence Listing] [Sequence Listing] <110> Takeda Chemical Industries, Ltd. <120> Novel Polypeptide <130> B00083 <150> JP 11-140229 <151> 1999-05-20 <160> 70 <210> 1 < 211> 125 <212> PRT <213> Human <400> 1 Met Ala Lys Tyr Leu Ala Gln Ile Ile Val Met Gly Val Gln Val Val 5 10 15 Gly Arg Ala Phe Ala Arg Ala Leu Arg Gln Glu Phe Ala Ala Ser Arg 20 25 30 Ala Ala Ala Asp Ala Arg Gly Arg Ala Gly His Arg Ser Ala Ala Ala 35 40 45 Ser Asn Leu Ser Gly Leu Ser Leu Gln Glu Ala Gln Gln Ile Leu Asn 50 55 60 Val Ser Lys Leu Ser Pro Glu Glu Val Gln Lys Asn Tyr Glu His Leu 65 70 75 80 Phe Lys Val Asn Asp Lys Ser Val Gly Gly Ser Phe Tyr Leu Gln Ser 85 90 95 Lys Val Val Arg Ala Lys Glu Arg Leu Asp Glu Glu Leu Lys Ile Gln 100 105 110 Ala Gln Glu Asp Arg Glu Lys Gly Gln Met Pro His Thr 115 120 125 <210> 2 <211> 121 <212> PRT <213> Human <400> 2 Met His Arg Ser Glu Pro Phe Leu Lys Met Ser Leu Leu Ile Leu Leu 5 10 15 Phe Leu Gly Leu Ala Glu Ala Cys Thr Pro Arg Glu Val Asn Leu Leu 20 25 30 Lys Gly Ile Ile Gly Leu Met Ser Arg Leu Ser Pro Asp Glu Ile Leu 35 40 45 Gly Leu Leu Ser Leu Gln Val Leu His Glu Glu Thr Ser Gly Cys Lys 50 55 60 Glu Glu Val Lys Pro Phe Ser Gly Thr Thr Pro Ser Arg Lys Pro Leu 65 70 75 80 Pro Lys Arg Lys Asn Thr Trp Asn Phe Leu Lys Cys Ala Tyr Met Val 85 90 95 Met Thr Tyr Leu Phe Val Ser Tyr Asn Lys Gly Asp Trp Phe Thr Phe 100 105 110 Ser Ser Gln Val Leu Leu Pro Leu Leu 115 120 <210> 3 <211> 223 <212> PRT <213> Human <400> 3 Met Lys Phe Val Pro Cys Leu Leu Leu Val Thr Leu Ser Cys Leu Gly 5 10 15 Thr Leu Gly Gln Ala Pro Arg Gln Lys Gln Gly Ser Thr Gly Glu Glu 20 25 30 Phe His Phe Gln Thr Gly Gly Arg Asp Ser Cys Thr Met Arg Pro Ser 35 40 45 Ser Leu Gly Gln Gly Ala Gly Glu Val Trp Leu Arg Val Asp Cys Arg 50 55 60 Asn Thr Asp Gln Thr Tyr Trp Cys Glu Tyr Arg Gly Gln Pro Ser Met 65 70 75 80 Cys Gln Ala Phe Ala Ala Asp Pro Lys Ser Tyr Trp Asn Gln Ala Leu 85 90 95 Gln Glu Leu Arg Arg Leu His His Ala Cys Gln Gly Ala Pro Val Leu 100 105 110 Arg Pro Ser Val Cys Arg Glu Ala Gly Pro Gln Ala His Met Gln Gln 115 120 125 Val Thr Ser Ser Leu Lys Gly Ser Pro Glu Pro Asn Gln Gln Pro Glu 130 135 140 Ala Gly Thr Pro Ser Leu Ser Pro Lys Ala Thr Val Lys Leu Thr Gly 145 150 155 160 Ala Thr Gln Leu Gly Lys Asp Ser Met Glu Glu Leu Gly Lys Ala Lys 165 170 175 Pro Thr Thr Gly Pro Thr Ala Lys Pro Thr Gln Pro Gly Pro Arg Pro 180 185 190 Gly Gly Asn Glu Glu Ala Lys Lys Lys Ala Trp Glu His Cys Trp Lys 195 200 205 Pro Phe Gln Ala Leu Cys Ala Phe Leu Ile Ser Phe Phe Arg Gly 210 215 220 <210> 4 <211> 248 <212> PRT <213> Human <400> 4 Met Gly Pro Val Arg Leu Gly Ile Leu Leu Phe Leu Phe Leu Ala Val 5 10 15 His Glu Ala Trp Ala Gly Met Leu Lys Glu Glu Asp Asp Asp Thr Glu 20 25 30 Arg Leu Pro Ser Lys Cys Glu Val Cys Lys Leu Leu Ser Thr Glu Leu 35 40 45 Gln Ala Glu Leu Ser Arg Thr Gly Arg Ser Arg Glu Val Leu Glu Leu 50 55 60 Gly Gln Val Leu Asp Thr Gly Lys Arg Lys Arg His Val Pro Tyr Ser 65 70 75 80 Val Ser Glu Thr Arg Leu Glu Glu Alu Le Glu Asn Leu Cys Glu Arg 85 90 95 Ile Leu Asp Tyr Ser Val His Ala Glu Arg Lys Gly Ser Leu Arg Tyr 100 105 110 Ala Lys Gly Gln Ser Gln Thr Met Ala Thr Leu Lys Gly Leu Val Gln 115 120 125 Lys Gly Val Lys Val Asp Leu Gly Ile Pro Leu Glu Leu Trp Asp Glu 130 135 140 Pro Ser Val Glu Val Thr Tyr Leu Lys Lys Gln Cys Glu Thr Met Leu 145 150 155 160 Glu Glu Phe Glu Asp Ile Val Gly Asp Trp Tyr Phe His His Gln Glu 165 170 175 Gln Pro Leu Gln Asn Phe Leu Cys Glu Gly His Val Leu Pro Ala Ala 180 185 190 Glu Thr Ala Cys Leu Gln Glu Thr Trp Thr Gly Lys Glu Ile Thr Asp 195 200 205 Gly Glu Glu Lys Thr Glu Gly Glu Glu Glu Gln Glu Glu Glu Glu Glu Glu 210 215 220 Glu Glu Glu Glu Glu Gly Gly Asp Lys Met Thr Lys Thr Gly Ser His 225 230 235 240 Pro Lys Leu Asp Arg Glu Asp Leu 245 <210> 5 <211> 173 <212> PRT <213> Human <400> 5 Met Phe Cys Pro Leu Lys Leu Ile Leu Leu Pro Val Leu Leu Asp Tyr 5 10 15 Ser Leu Gly Leu Asn Asp Leu Asn Val Ser Pro Pro Glu Leu Thr Val 20 25 30 His Val Gly Asp Ser Ala Leu Met Gly Cys Val Phe Gln Ser Thr Glu 35 40 45 Asp Lys Cys Ile Phe Lys Ile As p Trp Thr Leu Ser Pro Gly Glu His 50 55 60 Ala Lys Asp Glu Tyr Val Leu Tyr Tyr Tyr Ser Asn Leu Ser Val Pro 65 70 75 80 Ile Gly Arg Phe Gln Asn Arg Val His Leu Met Gly Asp Ile Leu Cys 85 90 95 Asn Asp Gly Ser Leu Leu Leu Gln Asp Val Gln Glu Ala Asp Gln Gly 100 105 110 Thr Tyr Ile Cys Glu Ile Arg Leu Lys Gly Glu Ser Gln Val Phe Lys 115 120 125 Lys Ala Val Val Leu His Val Leu Pro Glu Glu Pro Lys Glu Leu Met 130 135 140 Val His Val Gly Gly Leu Ile Gln Met Gly Cys Val Phe Gln Ser Thr 145 150 155 160 Glu Val Lys His Val Thr Lys Val Glu Trp Ile Phe Ser 165 170 <210> 6 <211> 261 <212> PRT <213> Human <400> 6 Met Glu Leu Leu Gln Val Thr Ile Leu Phe Leu Leu Pro Ser Ile Cys 5 10 15 Ser Ser Asn Ser Thr Gly Val Leu Glu Ala Ala Asn Asn Ser Leu Val 20 25 30 Val Thr Thr Thr Lys Pro Ser Ile Thr Thr Pro Asn Thr Glu Ser Leu 35 40 45 Gln Lys Asn Val Val Thr Pro Thr Thr Gly Thr Thr Pro Lys Gly Thr 50 55 60 Ile Thr Asn Glu Leu Leu Lys Met Ser Leu Met Ser Thr Ala Thr Phe 65 70 75 80 Leu Thr Ser Lys Asp Glu G ly Leu Lys Ala Thr Thr Thr Asp Val Arg 85 90 95 Lys Asn Asp Ser Ile Ile Ser Asn Val Thr Val Thr Ser Val Thr Leu 100 105 110 Pro Asn Ala Val Ser Thr Leu Gln Ser Ser Lys Pro Lys Thr Glu Thr 115 120 125 Gln Ser Ser Ile Lys Thr Thr Glu Ile Pro Gly Ser Val Leu Gln Pro 130 135 140 Asp Ala Ser Pro Ser Lys Thr Gly Thr Leu Thr Ser Ile Pro Val Thr 145 150 155 160 Ile Pro Glu Asn Thr Ser Gln Ser Gln Val Ile Gly Thr Glu Gly Gly 165 170 175 Lys Asn Ala Ser Thr Ser Ala Thr Ser Arg Ser Tyr Ser Ser Ile Ile 180 185 190 Leu Pro Val Val Ile Ala Leu Ile Val Ile Thr Leu Ser Val Phe Val 195 200 205 Leu Val Gly Leu Tyr Arg Met Cys Trp Lys Ala Asp Pro Gly Thr Pro 210 215 220 Glu Asn Gly Asn Asp Gln Pro Gln Ser Asp Lys Glu Ser Val Lys Leu 225 230 235 240 Leu Thr Val Lys Thr Ile Ser His Glu Ser Gly Glu His Ser Ala Gln 245 250 255 Gly Lys Thr Lys Asn 260 <210> 7 <211> 243 <212> PRT <213> Human <400> 7 Met Arg Pro Gln Gly Pro Ala Ala Ser Pro Gln Arg Leu Arg Gly Leu 5 10 15 Leu Leu Leu Leu Leu Leu Gln Leu Pro Ala Pro Ser Ser Ala Ser Glu 20 25 30 Ile Pro Lys Gly Lys Gln Lys Ala Gln Leu Arg Gln Arg Glu Val Val 35 40 45 Asp Leu Tyr Asn Gly Met Cys Leu Gln Gly Pro Ala Gly Val Pro Gly 50 55 60 Arg Asp Gly Ser Pro Gly Ala Asn Gly Ile Pro Gly Thr Pro Gly Ile 65 70 75 80 Pro Gly Arg Asp Gly Phe Lys Gly Glu Lys Gly Glu Cys Leu Arg Glu 85 90 95 Ser Phe Glu Glu Ser Trp Thr Pro Asn Tyr Lys Gln Cys Ser Trp Ser 100 105 110 Ser Leu Asn Tyr Gly Ile Asp Leu Gly Lys Ile Ala Glu Cys Thr Phe 115 120 125 Thr Lys Met Arg Ser Asn Ser Ala Leu Arg Val Leu Phe Ser Gly Ser 130 135 140 Leu Arg Leu Lys Cys Arg Asn Ala Cys Cys Gln Arg Trp Tyr Phe Thr 145 150 155 160 Phe Asn Gly Ala Glu Cys Ser Gly Pro Leu Pro Ile Glu Ala Ile Ile 165 170 175 Tyr Leu Asp Gln Gly Ser Pro Glu Met Asn Ser Thr Ile Asn Ile His 180 185 190 Arg Thr Ser Ser Val Glu Gly Leu Cys Glu Gly Ile Gly Ala Gly Leu 195 200 205 Val Asp Val Ala Ile Trp Val Gly Thr Cys Ser Asp Tyr Pro Lys Gly 210 215 220 Asp Ala Ser Thr Gly Trp Asn Ser Val Ser Arg Ile Ile Ile Glu Glu 225 230 235 240 Leu Pro Lys <210> 8 <211> 149 <212> PRT <213> Human <400> 8 Met Lys Leu Gln Cys Val Ser Leu Trp Leu Leu Gly Thr Ile Leu Ile 5 10 15 Leu Cys Ser Val Asp Asn His Gly Leu Arg Arg Cys Leu Ile Ser Thr 20 25 30 Asp Met His His Ile Glu Glu Ser Phe Gln Glu Ile Lys Arg Ala Ile 35 40 45 Gln Ala Lys Asp Thr Phe Pro Asn Val Thr Ile Leu Ser Thr Leu Glu 50 55 60 Thr Leu Gln Ile Ile Lys Pro Leu Asp Val Cys Cys Val Thr Lys Asn 65 70 75 80 Leu Leu Ala Phe Tyr Val Asp Arg Val Phe Lys Asp His Gln Glu Pro 85 90 95 Asn Pro Lys Ile Leu Arg Lys Ile Ile Ser Ile Cys Gln Leu Phe Pro 100 105 110 Leu His Ala Glu Asn Ser Ala Ala Met Cys Glu Ser Leu Gly Gln Asn 115 120 125 Ser Ser Ile Cys Ser Leu Ser Ala Gln Gly Glu Ala Arg Lys Cys Trp 130 135 140 Pro Pro Ser Ala Ser 145 <210> 9 <211> 136 <212> PRT <213> Human <400> 9 Met Ala Ser Leu Gly Leu Leu Leu Leu Leu Leu Leu Thr Ala Leu Pro 5 10 15 Pro Leu Trp Ser Ser Ser Leu Pro Gly Leu Asp Thr Ala Glu Ser Lys 20 25 30 Ala Thr Ile Ala Asp Leu Ile Leu Se r Ala Leu Glu Arg Ala Thr Val 35 40 45 Phe Leu Glu Gln Arg Leu Pro Glu Ile Asn Leu Asp Gly Met Val Gly 50 55 60 Val Arg Val Leu Glu Glu Gln Leu Lys Ser Val Arg Glu Lys Trp Ala 65 70 75 80 Gln Glu Pro Leu Leu Gln Pro Leu Ser Leu Arg Val Gly Met Leu Gly 85 90 95 Glu Lys Leu Glu Ala Ala Ile Gln Arg Ser Leu His Tyr Leu Lys Leu 100 105 110 Ser Asp Pro Lys Tyr Leu Arg Gly Arg Thr Ala Ala Ser Pro Ala Ala 115 120 125 Ser Gln Thr Ser Ala Gly Ala Ser 130 135 <210> 10 <211> 123 <212> PRT <213> Human <400> 10 Met Lys Leu Leu Leu Leu Ala Leu Pro Met Leu Val Leu Leu Pro Gln 5 10 15 Val Ile Pro Ala Tyr Ser Gly Glu Lys Lys Cys Trp Asn Arg Ser Gly 20 25 30 His Cys Arg Lys Gln Cys Lys Asp Gly Glu Ala Val Lys Asp Thr Cys 35 40 45 Lys Asn Leu Arg Ala Cys Cys Ile Pro Ser Asn Glu Asp His Arg Arg 50 55 60 Val Pro Ala Thr Ser Pro Thr Pro Leu Ser Asp Ser Thr Pro Gly Ile 65 70 75 80 Ile Asp Asp Ile Leu Thr Val Arg Phe Thr Thr Asp Tyr Phe Glu Val 85 90 95 Ser Ser Lys Lys Asp Met Val Glu Glu Ser Glu Ala Gly Arg G ly Thr 100 105 110 Glu Thr Ser Leu Pro Asn Val His His Ser Ser 115 120 <210> 11 <211> 163 <212> PRT <213> Human <400> 11 Met Gly Gly Leu Leu Leu Ala Ala Phe Leu Ala Leu Val Ser Val Pro 5 10 15 Arg Ala Gln Ala Val Trp Leu Gly Arg Leu Asp Pro Glu Gln Leu Leu 20 25 30 Gly Pro Trp Tyr Val Leu Ala Val Ala Ser Arg Glu Lys Gly Phe Ala 35 40 45 Met Glu Lys Asp Met Lys Asn Val Val Gly Val Val Val Thr Leu Thr 50 55 60 Pro Glu Asn Asn Leu Arg Thr Leu Ser Ser Gln His Gly Leu Gly Gly 65 70 75 80 Cys Asp Gln Ser Val Met Asp Leu Ile Lys Arg Asn Ser Gly Trp Val 85 90 95 Phe Glu Asn Pro Ser Ile Gly Val Leu Glu Leu Trp Val Leu Ala Thr 100 105 110 Asn Phe Arg Asp Tyr Ala Ile Ile Phe Thr Gln Leu Glu Phe Gly Asp 115 120 125 Glu Pro Phe Asn Thr Val Glu Leu Tyr Ser Leu Thr Glu Thr Ala Ser 130 135 140 Gln Glu Ala Met Gly Leu Phe Thr Lys Trp Ser Arg Ser Leu Gly Phe 145 150 155 160 Leu Ser Gln <210> 12 <211> 301 <212> PRT <213> Human < 400> 12 Met Ala Arg His Gly Leu Pro Leu Leu Pro Leu Leu Ser Leu Leu Val 5 10 15 Gly Ala Trp Leu Lys Leu Gly Asn Gly Gln Ala Thr Ser Met Val Gln 20 25 30 Leu Gln Gly Gly Arg Phe Leu Met Gly Thr Asn Ser Pro Asp Ser Arg 35 40 45 Asp Gly Glu Gly Pro Val Arg Glu Ala Thr Val Lys Pro Phe Ala Ile 50 55 60 Asp Ile Phe Pro Val Thr Asn Lys Asp Phe Arg Asp Phe Val Arg Glu 65 70 75 80 Lys Lys Tyr Arg Thr Glu Ala Glu Met Phe Gly Trp Ser Phe Val Phe 85 90 95 Glu Asp Phe Val Ser Asp Glu Leu Arg Asn Lys Ala Thr Gln Pro Met 100 105 110 Lys Ser Val Leu Trp Trp Leu Pro Val Glu Lys Ala Phe Trp Arg Gln 115 120 125 Pro Ala Gly Pro Gly Ser Gly Ile Arg Glu Arg Leu Glu His Pro Val 130 135 140 Leu His Val Ser Trp Asn Asp Ala Arg Ala Tyr Cys Ala Trp Arg Gly 145 150 155 160 Lys Arg Leu Pro Thr Glu Glu Glu Trp Glu Phe Ala Ala Ala Arg Gly Gly 165 170 175 Leu Lys Gly Gln Val Tyr Pro Trp Gly Asn Trp Phe Gln Pro Asn Arg 180 185 190 Thr Asn Leu Trp Gln Gly Lys Phe Pro Lys Gly Asp Lys Ala Glu Asp 195 200 205 Gly Phe His Gly Val Ser Pro Val Asn Ala Phe Pro Ala Gln Asn Asn 210 215 220 Tyr Gly Leu Tyr A sp Leu Leu Gly Asn Val Trp Glu Trp Thr Ala Ser 225 230 235 240 Pro Tyr Gln Ala Ala Glu Gln Asp Met Arg Val Leu Arg Gly Ala Ser 245 250 255 Trp Ile Asp Thr Ala Asp Gly Ser Ala Asn His Arg Ala Arg Val Thr 260 265 270 Thr Arg Met Gly Asn Thr Pro Asp Ser Ala Ser Asp Asn Leu Gly Phe 275 280 285 Arg Cys Ala Ala Asp Ala Gly Arg Pro Pro Gly Glu Leu 290 295 300 <210> 13 <211> 69 <212> PRT <213> Human <400> 13 Met Cys Trp Leu Arg Ala Trp Gly Gln Ile Leu Leu Pro Val Phe Leu 5 10 15 Ser Leu Phe Leu Ile Gln Leu Leu Ile Ser Phe Ser Glu Asn Gly Phe 20 25 30 Ile His Ser Pro Arg Asn Asn Gln Lys Pro Arg Asp Gly Asn Glu Glu 35 40 45 Glu Cys Ala Val Lys Lys Ser Cys Gln Leu Cys Thr Glu Asp Lys Lys 50 55 60 Tyr Met Met Asn Arg 65 <210> 14 <211> 69 < 212> PRT <213> Human <400> 14 Met Gly Phe Pro Ala Ala Ala Leu Leu Cys Ala Leu Cys Cys Gly Leu 5 10 15 Leu Ala Pro Ala Ala Ala Arg Ala Gly Tyr Ser Glu Glu Arg Cys Ser Trp 20 25 30 Arg Gly Arg Pro Arg Arg Thr Arg Thr Ser Ala Ala Ala Trp Pro Pro 35 40 45 Ser Ala Leu Ser Cys Ala Arg Thr Gly Ala Pro Ser Cys Pro Arg Arg 50 55 60 Pro Thr Val Ser Ala 65 <210> 15 <211> 197 <212> PRT <213> Human <400> 15 Met Arg Gly Gly Lys Cys Asn Met Leu Ser Ser Leu Gly Cys Leu Leu 5 10 15 Leu Cys Gly Ser Ile Thr Leu Ala Leu Gly Asn Ala Gln Lys Leu Pro 20 25 30 Lys Gly Lys Arg Pro Asn Leu Lys Val His Ile Asn Thr Thr Ser Asp 35 40 45 Ser Ile Leu Leu Lys Phe Leu Arg Pro Ser Pro Asn Val Lys Leu Glu 50 55 60 Gly Leu Leu Leu Gly Tyr Gly Ser Asn Val Ser Pro Asn Gln Tyr Phe 65 70 75 80 Pro Leu Pro Ala Glu Gly Lys Phe Thr Glu Ala Ile Val Asp Ala Glu 85 90 95 Pro Lys Tyr Leu Ile Val Val Arg Pro Ala Pro Pro Pro Ser Gln Lys 100 105 110 Lys Ser Cys Ser Gly Lys Thr Arg Ser Arg Lys Pro Leu Gln Leu Val 115 120 125 Val Gly Thr Leu Thr Pro Ser Ser Val Phe Leu Ser Trp Gly Phe Leu 130 135 140 Ile Asn Pro His His Asp Trp Thr Leu Pro Ser His Cys Pro Asn Asp 145 150 155 160 Arg Phe Tyr Thr Ile Arg Tyr Arg Glu Lys Asp Lys Glu Lys Lys Trp 165 170 175 Ile Phe Gln Ile Cys Pro Ala Thr Glu Thr Ile V al Glu Asn Leu Lys 180 185 190 Pro Asn Thr Ser Leu 195 <210> 16 <211> 378 <212> DNA <213> Human <400> 16 ATGGCCAAGT ACCTGGCCCA GATCATTGTG ATGGGCGTGC AGGTGGTGGG CAGGGCCTTT 60 GCACGGGCCT TGCGGCAGGA GTTTGCGCGCCAGCGCGCGCCAGG CGCTTCCAAC CTCTCCGGCC TCAGCCTCCA GGAGGCACAG 180 CAGATTCTCA ACGTGTCCAA GCTGAGCCCT GAGGAGGTCC AGAAGAACTA TGAACACTTA 240 TTTAAGGTGA ATGATAAATC CGTGGGTGGC TCCTTCTACC TGCAGTCAAA GGTGGTCCGC 300 GCAAAGGAGC GCCTGGATGA GGAACTCAAA ATCCAGGCCC AGGAGGACAG AGAAAAAGGG 360 CAGATGCCCC ATACGTGA 378 <210> 17 <211> 366 <212> DNA <213> Human <400> 17 ATGCACAGAT CAGAGCCATT TCTGAAAATG TCGCTGCTGA TTCTGCTTTT CCTGGGATTG 60 GCAGAAGCCT GTACTCCTCG TGAAGTCAAC TTGCTGAAAG GGATCATAGG TCTCATGAGC 120 AGACTGTCAC CGGATGAGAT CCTAGGCTTG CTGAGCCTCC AAGTACTGCA TGAAGAAACA 180 AGTGGCTGCA AGGAGGAAGT TAAACCCTTC TCAGGCACCA CCCCATCCAG GAAACCACTC 240 CCCAAGAGGA AGAACACGTG GAACTTCCTG AAATGCGCCT ACATGGTGAT GACCTACCTC 300 TTCGTATCCT ACAACAAAGG GGACTGGTTC ACTTTTTCCT CCCAAGTGT T ACTGCCACTA 360 CTGTAA 366 <210> 18 <211> 672 <212> DNA <213> Human <400> 18 ATGAAGTTCG TCCCCTGCCT CCTGCTGGTG ACCTTGTCCT GCCTGGGGAC TTTGGGTCAG 60 GCCCCGAGGC AAAAGCAAGG AAGCACTGGG GAGGAATTCC ATTTCCAGAC TGGAGGGAGA 120 GATTCCTGCA CTATGCGTCC CAGCAGCTTG GGGCAAGGTG CTGGAGAAGT CTGGCTTCGC 180 GTCGACTGCC GCAACACAGA CCAGACCTAC TGGTGTGAGT ACAGGGGGCA GCCCAGCATG 240 TGCCAGGCTT TCGCTGCTGA CCCCAAATCT TACTGGAATC AAGCCCTGCA GGAGCTGAGG 300 CGCCTTCACC ATGCGTGCCA GGGGGCCCCG GTGCTTAGGC CATCCGTGTG CAGGGAGGCT 360 GGACCCCAGG CCCATATGCA GCAGGTGACT TCCAGCCTCA AGGGCAGCCC AGAGCCCAAC 420 CAGCAGCCTG AGGCTGGGAC GCCATCTCTG AGCCCCAAGG CCACAGTGAA ACTCACAGGA 480 GCAACACAGC TGGGAAAGGA CTCGATGGAA GAGCTGGGAA AAGCCAAACC CACCACCGGA 540 CCCACAGCCA AACCTACCCA GCCTGGACCC AGGCCCGGAG GGAATGAGGA AGCAAAGAAG 600 AAGGCCTGGG AACATTGTTG GAAACCCTTC CAGGCCCTGT GCGCCTTTCT CATCAGCTTC 660 TTCCGAGGGT GA 672 <210> 19 <211> 747 <212> DNA <213> Human <400> 19 ATGGGACCTG TGCGGTTGGG AATATTGCTT TTCCTTTTTT TGGCCGTGCA CGAGGCTTGG 60 GCTGGGATGT TGAAG GAGGA GGACGATGAC ACAGAACGCT TGCCCAGCAA ATGCGAAGTG 120 TGTAAGCTGC TGAGCACAGA GCTACAGGCG GAACTGAGTC GCACCGGTCG ATCTCGAGAG 180 GTGCTGGAGC TGGGGCAGGT GCTGGATACA GGCAAGAGGA AGAGACACGT GCCTTACAGC 240 GTTTCAGAGA CAAGGCTGGA AGAGGCCTTA GAGAATTTAT GTGAGCGGAT CCTGGACTAT 300 AGTGTTCACG CTGAGCGCAA GGGCTCACTG AGATATGCCA AGGGTCAGAG TCAGACCATG 360 GCAACACTGA AAGGCCTAGT GCAGAAGGGG GTGAAGGTGG ATCTGGGGAT CCCTCTGGAG 420 CTTTGGGATG AGCCCAGCGT GGAGGTCACA TACCTCAAGA AGCAGTGTGA GACCATGTTG 480 GAGGAGTTTG AAGACATTGT GGGAGACTGG TACTTCCACC ATCAGGAGCA GCCCCTACAA 540 AATTTTCTCT GTGAAGGTCA TGTGCTCCCA GCTGCTGAAA CTGCATGTCT ACAGGAAACT 600 TGGACTGGAA AGGAGATCAC AGATGGGGAA GAGAAAACAG AAGGGGAGGA AGAGCAGGAG 660 GAGGAGGAGG AAGAGGAGGA AGAGGAAGGG GGAGACAAGA TGACCAAGAC AGGAAGCCAC 720 CCCAAACTTG ACCGAGAAGA TCTTTGA 747 <210> 20 <211> 522 <212> DNA <213> Human <400> 20 ATGTTTTGCC CACTGAAACT CATCCTGCTG CCAGTGTTAC TGGATTATTC CTTGGGCCTG 60 AATGACTTGA ATGTTTCCCC GCCTGAGCTA ACAGTCCATG TGGGTGATTC AGCTCTGATG 120 GGATGTGTTT TCCAGAGCAC A GAAGACAAA TGTATATTCA AGATAGACTG GACTCTGTCA 180 CCAGGAGAGC ACGCCAAGGA CGAATATGTG CTATACTATT ACTCCAATCT CAGTGTGCCT 240 ATTGGGCGCT TCCAGAACCG CGTACACTTG ATGGGGGACA TCTTATGCAA TGATGGCTCT 300 CTCCTGCTCC AAGATGTGCA AGAGGCTGAC CAGGGAACCT ATATCTGTGA AATCCGCCTC 360 AAAGGGGAGA GCCAGGTGTT CAAGAAGGCG GTGGTACTGC ATGTGCTTCC AGAGGAGCCC 420 AAAGAGCTCA TGGTCCATGT GGGTGGATTG ATTCAGATGG GATGTGTTTT CCAGAGCACA 480 GAAGTGAAAC ACGTGACCAA GGTAGAATGG ATATTTTCAT GA 522 <210> 21 <211> 786 <212> DNA <213> Human <400> 21 ATGGAACTGC TTCAAGTGAC CATTCTTTTT CTTCTGCCCA GTATTTGCAG CAGTAACAGC 60 ACAGGTGTTT TAGAGGCAGC TAATAATTCA CTTGTTGTTA CTACAACAAA ACCATCTATA 120 ACAACACCAA ACACAGAATC ATTACAGAAA AATGTTGTCA CACCAACAAC TGGAACAACT 180 CCTAAAGGAA CAATCACCAA TGAATTACTT AAAATGTCTC TGATGTCAAC AGCTACTTTT 240 TTAACAAGTA AAGATGAAGG ATTGAAAGCC ACAACCACTG ATGTCAGGAA GAATGACTCC 300 ATCATTTCAA ACGTAACAGT AACAAGTGTT ACACTTCCAA ATGCTGTTTC AACATTACAA 360 AGTTCCAAAC CCAAGACTGA AACTCAGAGT TCAATTAAAA CAACAGAAAT ACCAGGTAGT 420 GTTCTACAAC CA GATGCATC ACCTTCTAAA ACTGGTACAT TAACCTCAAT ACCAGTTACA 480 ATTCCAGAAA ACACCTCACA GTCTCAAGTA ATAGGCACTG AGGGTGGAAA AAATGCAAGC 540 ACTTCAGCAA CCAGCCGGTC TTATTCCAGT ATTATTTTGC CGGTGGTTAT TGCTTTGATT 600 GTAATAACAC TTTCAGTATT TGTTCTGGTG GGTTTGTACC GAATGTGCTG GAAGGCAGAT 660 CCGGGCACAC CAGAAAATGG AAATGATCAA CCTCAGTCTG ATAAAGAGAG CGTGAAGCTT 720 CTTACCGTTA AGACAATTTC TCATGAGTCT GGTGAGCACT CTGCACAAGG AAAAACCAAG 780 AACTGA 786 <210> 22 <211> 732 <212> DNA <213> Human <400> 22 ATGCGACCCC AGGGCCCCGC CGCCTCCCCG CAGCGGCTCC GCGGCCTCCT GCTGCTCCTG 60 CTGCTGCAGC TGCCCGCGCC GTCGAGCGCC TCTGAGATCC CCAAGGGGAA GCAAAAGGCG 120 CAGCTCCGGC AGAGGGAGGT GGTGGACCTG TATAATGGAA TGTGCTTACA AGGGCCAGCA 180 GGAGTGCCTG GTCGAGACGG GAGCCCTGGG GCCAATGGCA TTCCGGGTAC ACCTGGGATC 240 CCAGGTCGGG ATGGATTCAA AGGAGAAAAG GGGGAATGTC TGAGGGAAAG CTTTGAGGAG 300 TCCTGGACAC CCAACTACAA GCAGTGTTCA TGGAGTTCAT TGAATTATGG CATAGATCTT 360 GGGAAAATTG CGGAGTGTAC ATTTACAAAG ATGCGTTCAA ATAGTGCTCT AAGAGTTTTG 420 TTCAGTGGCT CACTTCGGCT AAAATGCAGA AATGCATGCT GTCAGCGTTG GTATTTCACA 480 TTCAATGGAG CTGAATGTTC AGGACCTCTT CCCATTGAAG CTATAATTTA TTTGGACCAA 540 GGAAGCCCTG AAATGAATTC AACAATTAAT ATTCATCGCA CTTCTTCTGT GGAAGGACTT 600 TGTGAAGGAA TTGGTGCTGG ATTAGTGGAT GTTGCTATCT GGGTTGGCAC TTGTTCAGAT 660 TACCCAAAAG GAGATGCTTC TACTGGATGG AATTCAGTTT CTCGCATCAT TATTGAAGAA 720 CTACCAAAAT AA 732 <210> 23 <211> 450 <212> DNA <213> Human <400> 23 ATGAAGTTAC AGTGTGTTTC CCTTTGGCTC CTGGGTACAA TACTGATATT GTGCTCAGTA 60 GACAACCACG GTCTCAGGAG ATGTCTGATT TCCACAGACA TGCACCATAT AGAAGAGAGT 120 TTCCAAGAAA TCAAAAGAGC CATCCAAGCT AAGGACACCT TCCCAAATGT CACTATCCTG 180 TCCACATTGG AGACTCTGCA GATCATTAAG CCCTTAGATG TGTGCTGCGT GACCAAGAAC 240 CTCCTGGCGT TCTACGTGGA CAGGGTGTTC AAGGATCATC AGGAGCCAAA CCCCAAAATC 300 TTGAGAAAAA TCATCAGCAT TTGCCAACTC TTTCCTCTAC ATGCAGAAAA CTCTGCGGCA 360 ATGTGTGAGT CACTGGGTCA GAATTCCAGC ATCTGCTCCC TGTCTGCCCA AGGAGAGGCC 420 AGGAAGTGCT GGCCCCCATC GGCCTCCTGA 450 <210> 24 <211> 411 <212> DNA <213> Human <400> 24 ATGGCCAGCC TGGGGCTGCT GCTCCTGCTC TTACTGACAG CACTG CCACC GCTGTGGTCC 60 TCCTCACTGC CTGGGCTGGA CACTGCTGAA AGTAAAGCCA CCATTGCAGA CCTGATCCTG 120 TCTGCGCTGG AGAGAGCCAC CGTCTTCCTA GAACAGAGGC TGCCTGAAAT CAACCTGGAT 180 GGCATGGTGG GGGTCCGAGT GCTGGAAGAG CAGCTAAAAA GTGTCCGGGA GAAGTGGGCC 240 CAGGAGCCCC TGCTGCAGCC GCTGAGCCTG CGCGTGGGGA TGCTGGGGGA GAAGCTGGAG 300 GCTGCCATCC AGAGATCCCT CCACTACCTC AAGCTGAGTG ATCCCAAGTA CCTAAGAGGA 360 CGGACAGCAG CGAGCCCTGC GGCCTCTCAG ACCTCTGCAG GAGCCTCATG A 411 <210> 25 < 211> 372 <212> DNA <213> H uman <400> 25 ATGAAACTCC TGCTGCTGGC TCTTCCTATG CTTGTGCTCC TACCCCAAGT GATCCCAGCC 60 TATAGTGGTG AAAAAAAATG CTGGAACAGA TCAGGGCACT GCAGGAAACA ATGCAAAGAT 120 GGAGAAGCAG TGAAAGATAC ATGCAAAAAT CTTCGAGCTT GCTGCATTCC ATCCAATGAA 180 GACCACAGGC GAGTTCCTGC GACATCTCCC ACACCCTTGA GTGACTCAAC ACCAGGAATT 240 ATTGATGATA TTTTAACAGT AAGGTTCACG ACAGACTACT TTGAAGTAAG CAGCAAGAAA 300 GATATGGTTG AAGAGTCTGA GGCGGGAAGG GGAACTGAGA CCTCTCTTCC AAATGTTCAC 360 CATAGCTCAT GA 372 <210> 26 <211> 492 <212> DNA <213> Human <400> 26 ATGGGCGGCC TGCTGCTGGC TGCTTTTCT G GCTTTGGTCT CGGTGCCCAG GGCCCAGGCC 60 GTGTGGTTGG GAAGACTGGA CCCTGAGCAG CTTCTTGGGC CCTGGTACGT GCTTGCGGTG 120 GCCTCCCGGG AAAAGGGCTT TGCCATGGAG AAGGACATGA AGAACGTCGT GGGGGTGGTG 180 GTGACCCTCA CTCCAGAAAA CAACCTGCGG ACGCTGTCCT CTCAGCACGG GCTGGGAGGG 240 TGTGACCAGA GTGTCATGGA CCTGATAAAG CGAAACTCCG GATGGGTGTT TGAGAATCCC 300 TCAATAGGCG TGCTGGAGCT CTGGGTGCTG GCCACCAACT TCAGAGACTA TGCCATCATC 360 TTCACTCAGC TGGAGTTCGG GGACGAGCCC TTCAACACCG TGGAGCTGTA CAGTCTGACG 420 GAGACAGCCA GCCAGGAGGC CATGGGGCTC TTCACCAAGT GGAGCAGGAG CCTGGGCTTC 480 CTGTCACAGT AG 492 <210> 27 <211> 906 <212> DNA <213> Human <400> 27 ATGGCCCGGC ATGGGTTACC GCTGCTGCCC CTGCTGTCGC TCCTGGTCGG CGCGTGGCTC 60 AAGCTAGGAA ATGGACAGGC TACTAGCATG GTCCAACTGC AGGGTGGGAG ATTCCTGATG 120 GGAACAAATT CTCCAGACAG CAGAGATGGT GAAGGGCCTG TGCGGGAGGC GACAGTGAAA 180 CCCTTTGCCA TCGACATATT TCCTGTCACC AACAAAGATT TCAGGGATTT TGTCAGGGAG 240 AAAAAGTATC GGACAGAAGC TGAGATGTTT GGATGGAGCT TTGTCTTTGA GGACTTTGTC 300 TCTGATGAGC TGAGAAACAA AGCCACCCAG CCAATGAAGT CTGTACTCTG GTGGCTTCCA 360 GTGGAAAAGG CATTTTGGAG GCAGCCTGCA GGTCCTGGCT CTGGCATCCG AGAGAGACTG 420 GAGCACCCAG TGTTACACGT GAGCTGGAAT GACGCCCGTG CCTACTGTGC TTGGCGGGGA 480 AAACGACTGC CCACGGAGGA AGAGTGGGAG TTTGCCGCCC GAGGGGGCTT GAAGGGTCAA 540 GTTTACCCAT GGGGGAACTG GTTCCAGCCA AACCGCACCA ACCTGTGGCA GGGAAAGTTC 600 CCCAAGGGAG ACAAAGCTGA GGATGGCTTC CATGGAGTCT CCCCAGTGAA TGCTTTCCCC 660 GCCCAGAACA ACTACGGGCT CTATGACCTC CTGGGGAACG TGTGGGAGTG GACAGCATCA 720 CCGTACCAGG CTGCTGAGCA GGACATGCGC GTCCTCCGGG GGGCATCCTG GATCGACACA 780 GCTGATGGCT CTGCCAATCA CCGGGCCCGG GTCACCACCA GGATGGGCAA CACTCCAGAT 840 TCAGCCTCAG ACAACCTCGG TTTCCGCTGT GCTGCAGACG CAGGCCGGCC GCCAGGGGAG 900 CTGTAA 906 <210> 28 <211> 210 <212> DNA <213> Human <400> 28 ATGTGCTGGC TGCGGGCATG GGGCCAGATC CTCCTGCCAG TTTTCCTCTC CCTCTTTCTC 60 ATCCAATTGC TTATCAGCTT CTCAGAGAAT GGTTTTATCC ACAGCCCCAG GAACAATCAG 120 AAACCAAGAG ATGGGAATGA AGAGGAATGT GCTGTAAAGA AGAGTTGTCA ATTGTGCACA 180 GAAGATAAGA AATATATGAT GAATAGATAA 210 <210> 29 <211> 210 <212> DNA <213> Human <400> 2 9 ATGGGGTTCC CGGCCGCGGC GCTGCTCTGC GCGCTGTGCT GCGGCCTCCT GGCCCCGGCT 60 GCCCGCGCCG GCTACTCCGA GGAGCGCTGC AGCTGGAGGG GCAGGCCACG CCGCACCAGG 120 ACATCAGCCG CCGCGTGGCC GCCTTCCGCT TTGAGCTGCG CGAGGACGGG CGCCCCGAGC 180 TGCCCCCGCA GGCCCACGGT CTCGGCGTAG 210 <210> 30 <211> 594 <212> DNA <213> Human <400> 30 ATGCGAGGTG GCAAATGCAA CATGCTCTCC AGTTTGGGGT GTCTACTTCT CTGTGGAAGT 60 ATTACACTAG CCCTGGGAAA TGCACAGAAA TTGCCAAAAG GTAAAAGGCC AAACCTCAAA 120 GTCCACATCA ATACCACAAG TGACTCCATC CTCTTGAAGT TCTTGCGTCC AAGTCCAAAT 180 GTAAAGCTTG AAGGTCTTCT CCTGGGATAT GGCAGCAATG TATCACCAAA CCAGTACTTC 240 CCTCTTCCCG CTGAAGGGAA ATTCACAGAA GCTATAGTTG ATGCAGAGCC GAAATATCTG 300 ATAGTTGTGC GACCTGCTCC ACCTCCAAGT CAAAAGAAGT CATGTTCAGG TAAAACTCGT 360 TCTCGCAAAC CTCTGCAGCT GGTGGTTGGC ACTCTGACAC CGAGCTCGGT CTTCCTGTCC 420 TGGGGTTTCC TCATCAACCC ACACCATGAC TGGACATTGC CAAGTCACTG TCCCAATGAC 480 AGATTTTATA CAATTCGCTA TCGAGAAAAG GATAAAGAAA AGAAGTGGAT TTTTCAAATC 540 TGTCCAGCCA CTGAAACAAT TGTGGAAAAC CTAAAGCCCA ACACAAGTTT ATGA 594 <210> 31 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> <400> 31 ATGGCCAAGT ACCTGGCCCA GATCA 25 <210> 32 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> <400> 32 TCACGTATGG GGCATCTGCC CTTTT 25 <210> 33 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> <400> 33 ATGCACAGAT CAGAGCCATT TCTGA 25 <210> 34 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> <400> 34 TTACAGTAGT GGCAGTAACA CTTGG 25 <210> 35 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> <400> 35 ATGAAGTTCG TCCCCTGCCT CCTGC 25 <210> 36 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> <400> 36 TCACCCTCGG AAGAAGCTGA TGAGA 25 <210> 37 <211> 25 <212> DNA <213> Artificial Sequence < 220> <223> <400> 37 ATGGGACCTG TGCGGTTGGG AATAT 25 <210> 38 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> <400> 38 TCAAAGATCT TCTCGGTCAA GTTTG 25 <210> 39 <211 > 25 <212> DNA <213> Artificial Sequence <220> <223> <400> 39 ATGTTTTGCC CACTGAAACT CATCC 25 <210> 40 <211> 25 <212> DNA <213> Artificial Sequence < 220> <223> <400> 40 TCATGAAAAT ATCCATTCTA CCTTG 25 <210> 41 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> <400> 41 ATGGAACTGC TTCAAGTGAC CATTC 25 <210> 42 <211 > 25 <212> DNA <213> Artificial Sequence <220> <223> <400> 42 TCAGTTCTTG GTTTTTCCTT GTGCA 25 <210> 43 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> <400 > 43 ATGCGACCCC AGGGCCCCGC CGCCT 25 <210> 44 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> <400> 44 TTATTTTGGT AGTTCTTCAA TAATG 25 <210> 45 <211> 25 <212> DNA < 213> Artificial Sequence <220> <223> <400> 45 ATGAAGTTAC AGTGTGTTTC CCTTT 25 <210> 46 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> <400> 46 TCAGGAGGCC GATGGGGGCC AGCAC 25 < 210> 47 <211> 25 <212> DNA <220> <223> <213> Artificial Sequence <400> 47 ATGGCCAGCC TGGGGCTGCT GCTCC 25 <210> 48 <211> 25 <212> DNA <220> <223> <213 > Artificial Sequence <400> 48 TCATGAGGCT CCTGCAGAGG TCTGA 25 <210> 49 <211> 25 <212> DNA <220> <223> <213> Artificial Sequence <400> 49 ATGAAACTCC TGCTGCTGGC TCTT C 25 <210> 50 <211> 25 <212> DNA <220> <223> <213> Artificial Sequence <400> 50 TCATGAGCTA TGGTGAACAT TTGGA 25 <210> 51 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> <400> 51 ATGGGCGGCC TGCTGCTGGC TGCTT 25 <210> 52 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> <400> 52 CTACTGTGAC AGGAAGCCCA GGCTC 25 <210> 53 < 211> 25 <212> DNA <213> Artificial Sequence <220> <223> <400> 53 ATGGCCCGGC ATGGGTTACC GCTGC 25 <210> 54 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> < 400> 54 TTACAGCTCC CCTGGCGGCC GGCCT 25 <210> 55 <211> 25 <212> DNA <220> <223> <213> Artificial Sequence <400> 55 ATGTGCTGGC TGCGGGCATG GGGCC 25 <210> 56 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> <400> 56 TTATCTATTC ATCATATATT TCTTA 25 <210> 57 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> <400> 57 ATGGGGTTCC CGGCCGCGGC GCTGC 25 <210> 58 <211> 25 <212> DNA <213> Artificial sequence <220> <223> <400> 58 CTACGCCGAG ACCGTGGGCC TGCGG 25 <210> 59 <211> 25 <212> DNA <213> Artifi cial Sequence <220> <223> <400> 59 ATGCGAGGTG GCAAATGCAA CATGC 25 <210> 60 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> <400> 60 TCATAAACTT GTGTTGGGCT TTAGG 25 <210> 61 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> <400> 61 TCGGAATTCG CCATGGCCAA GTACCTGGCC CAGATC 36 <210> 62 <211> 60 <212> DNA <213> Artificial Sequence <220> < 223> <400> 62 ACGCTCGAGT TACTTGTCAT CGTCGTCCTT GTAGTCCGTA TGGGGCATCT GCCCTTTTTC 60 <210> 63 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> <400> 63 TCGGAATTCG CCATGGCCAG CCTGGGGCTG CTGCTC 36 <210> 64 < 211> 60 <212> DNA <213> Artificial Sequence <220> <223> <400> 64 ACGCTCGAGT TACTTGTCAT CGTCGTCCTT GTAGTCTGAG GCTCCTGCAG AGGTCTGAGA 60 <210> 65 <211> 36 <212> DNA <213> Artificial Sequence <220> < 223> <400> 65 TCGGAATTCA CCATGAAACT CCTGCTGCTG GCTCTT 36 <210> 66 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> <400> 66 ACGCTCGAGT TACTTGTCAT CGTCGTCCTT GTAGTCTGAG CTATGGTGAA CATTTGGAAG 60 <210> 67 < 211> 44 <212> DNA <213> Artifici al Sequence <220> <223> <400> 67 TAGACGAATT CCCACCATGG GACCTGTGCG GTTGGGAATA TTGC 44 <210> 68 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> <400> 68 AGGCAAGTCG ACAAGATCTT CTCGGTCAAG TTTGGGGTGG CTTCCTGTCT TGGTCAT 57 <210> 69 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> <400> 69 GTGTAGAATT CCCACCATGG GCGGCCTGCT GCTGGCTGCT TTTCTGGCTT T 51 <210> 70 <211> 44 <212> DNA <213 > Artificial Sequence <220> <223> <400> 70 CTGGGCGTCG ACCTGTGACA GGAAGCCCAG GCTCCTGCTC CACT 44

[Brief description of the drawings]

FIG. 1 is a Western blot analysis diagram showing the results of secretion confirmation in animal cells of each clone performed in Examples 16-20. Culture supernatant collected from 6-well plate
Expand 1/16 well equivalent by 10-25% SDS-PAGE, and
Western Blot analysis was performed using the AG antibody. In the figure,
Lane 1 is TGC-480, Lane 2 is TGC-711, Lane 3 is TGC-714, Lane 4 is TGC-715 and Lane 5 is the culture supernatant of COS7 cells expressing TGC-623. Indicates that electrophoresis was performed.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61K 48/00 A61P 1/00 A61P 1/00 5/00 5/00 9/00 9/00 11/00 11/00 25/00 25/00 25/18 25/18 31/00 31/00 35/00 35/00 37/00 37/00 C07K 14/47 C07K 14/47 16/18 16/18 C12P 21 / 02 C C12P 21/02 G01N 33/15 Z G01N 33/15 33/50 Z 33/50 33/566 33/566 C12N 1/15 // C12N 1/15 1/19 1/19 1/21 1/21 C12P 21/08 5/10 A61K 37/02 C12P 21/08 C12N 5/00 A (C12P 21/02 C12R 1:91) (C12N 5/10 C12R 1:91) (C12P 21/08 C12R 1:91) (72) Inventor Shoichi Okubo 1-4-4, Chuo, Ushiku City, Ibaraki Prefecture (72) Inventor Kazuhiro Ogi 2-16-1, Umezono, Tsukuba City, Ibaraki Prefecture Run B No. 206

Claims (8)

[Claims] 1. A polypeptide or a salt thereof comprising an amino acid sequence identical or substantially identical to at least one amino acid sequence selected from SEQ ID NO: 1 to SEQ ID NO: 15. 2. The method according to claim 1, wherein a transformant transformed with the recombinant vector containing the DNA encoding the polypeptide according to claim 1 is cultured to produce the polypeptide. A method for producing a polypeptide or a salt thereof. 3. An antibody against the polypeptide according to claim 1 or a salt thereof. 4. A method for screening a compound or a salt thereof that promotes or inhibits the activity of the polypeptide or a salt thereof according to claim 1, wherein the polypeptide or a salt thereof according to claim 1 is used. (5) A kit for screening a compound or a salt thereof which promotes or inhibits the activity of the polypeptide or a salt thereof according to the above (1), comprising the polypeptide or the salt thereof according to the above (1). 6. A compound or a salt thereof that promotes or inhibits the activity of the polypeptide or a salt thereof according to claim 1, which is obtained by using the screening method according to claim 4 or the screening kit according to claim 5. 7. A compound or a salt thereof which promotes or inhibits the activity of the polypeptide of claim 1 or a salt thereof obtained by using the screening method of claim 4 or the screening kit of claim 5. Medicine. [8] a pharmaceutical comprising the polypeptide according to [1] or a salt thereof;