JP2001149083A - New polypeptide and dna encoding the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a polypeptide and DNA encoding the polypeptide both of which can be used as a reagent or medicine for diagnosing, treating, or preventing optimistic infection, septicemia, poisoning, tuberculosis, cancer, liver dysfunction, immune dysfunction, endocrine disorder, or the like, and a reagent for screening a compound (or a salt thereof) promoting or inhibiting the activity of the peptide. SOLUTION: The new precursor polypeptide (or a salt thereof) contains the amino acid sequence shown by sequence 3, 1, 13, 11 or 9 or substantially the same amino acid sequence as the sequence. The DNA encodes the above polypeptide.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to a novel secretory biological defense / cell function regulating polypeptide and its DNA.

[0002]

2. Description of the Related Art Cells secrete a wide variety of proteins irrespective of their prokaryotic or eukaryotic nature by their own mechanism. In particular, multicellular organisms (organisms) exchange various kinds of information between cells for their differentiation, proliferation, maintenance of homeostasis, and defense of living organisms. Most are secreted proteins or mature forms thereof, and are classified into hormones, neurotransmitters, cytokines, growth factors, antimicrobial peptides, and the like based on their structural and functional characteristics. Recent advances in recombinant DNA technology and cell culture technology have steadily elucidated the genes encoding these secretory proteins and their protein structures. On the other hand, the discovery of these factors will dramatically advance the analysis of their receptors expressed on the cell surface, and will also lead to elucidation of the mechanism of signal transduction within each cell, and characterize their physiological functions. become. Many diseases in humans and disease states in various disease model animals are caused by the abnormal expression of some humoral factors that should maintain homeostasis, or the inhibition or enhancement of their effects. In addition, there are many cases that are often found to lead to exacerbation as a result, and there are also phenomena that can be applied in the field of diagnosis of various diseases, such as so-called tumor markers whose expression is specifically enhanced in cancer. It is also an important target for drug discovery research.

[0003] Above all, almost all known bioactive peptides and antibacterial peptides are initially biosynthesized as precursors and then converted into mature peptides through limited degradation by proteolytic enzymes. . At this time, the limited degradation by the protease is Lys-Arg, Arg-Arg, Ar
It occurs at a characteristic basic amino acid pair portion such as gXX-Arg (X represents an arbitrary amino acid), Lys-Lys, etc., and the peptide is accurately excised (Biochemistry 67, 995-1009,
1995). Another feature is that a signal sequence for efficiently secreting extracellularly is present at the N-terminus of the precursor. In many organisms, it is known that there is an innate defense mechanism against foreign pathogens, but a group of substances called antimicrobial peptides plays a role in this role. I have. In places where individuals are in contact with the outside, such as the skin, oral cavity, intestinal tract, and respiratory tract of humans and other animals, resident bacteria form flora (flora) and maintain a steady state. And antimicrobial peptides are thought to play an important role in that (see Annual Review of Immunology (Annu.
v. Immunol.) 13, 61-92, 1995). For example, as an example, the relationship between the antimicrobial peptide defensin and cystic fibrosis has been revealed. Cystic fibrosis ultimately results in the death of most patients with pulmonary complications, due to the intrinsic action of the endogenous antimicrobial peptide β-defensin-1 (β-defensin-1). As a result of inhibition due to an increase in the surrounding salt concentration, bacterial infections such as Pseudomonas aeruginosa occurred, and it became clear that the disease progressed to pneumonia, emphysema, pulmonary fibrosis, etc. 553
-560, 1997). Furthermore, many defensins are known to act not only against bacteria but also against fungi (molds and yeasts), viruses, cancer cells and the like (Annual Review of Immunology (Annu.
Rev. Immunol.) 11, 105-128, 1993). As described above, it has been found that antimicrobial peptides widely act protectively against foreign pathogens and endogenous cancer cells. A new antimicrobial peptide precursor consisting of 35 amino acid residues has been registered in the amino acid sequence database (swiss-prot) published on December 15, 1998 (swiss-prot:
Accession number P81172). However, the peptide precursor was inadequate and unnatural, such as an extremely short form, and lacking a signal sequence important for secretion. on the other hand,
At present, the structural analysis of the entire DNA of one organism, that is, the genome, has already been completed for some bacteria and is expected to be completed in a few years for humans, but the expected number of genes is It is said to be one hundred thousand. Although a large number of genes encoding secreted proteins or secreted peptides have been isolated so far, the number of such genes cannot be said to be very comprehensive in view of the whole genome. In order to understand life phenomena at the individual level, it is necessary to be able to explain the information exchange between all cells and the biological defense mechanism that occur in it, but the functionality encoded by genes that are not yet known Peptides are likely to play important physiological roles, and the discovery of such substances has been strongly desired.

[0004]

The present invention relates to a novel precursor polypeptide or a salt thereof, a DNA encoding the precursor polypeptide, a recombinant vector, a transformant, a method for producing the peptide, and a method for preparing the peptide or DNA. It is an object of the present invention to provide a contained drug, a method for screening an antibody against the peptide precursor, a receptor agonist / antagonist, a screening kit, a receptor agonist / antagonist obtainable by the screening, a drug therefor, and the like.

[0005]

Means for Solving the Problems Isolation of new physiologically active peptides and antimicrobial peptides provides new knowledge on mechanisms such as cell differentiation, proliferation, carcinogenesis, and biological defense, and furthermore, the development and homeostasis of individuals. To elucidate higher life phenomena such as the maintenance of phenotypes, and to show new inhibitory or stimulatory activities for the peptide and to prevent, diagnose and treat various diseases. Can be developed. As a result of intensive studies, the present inventors have succeeded in cloning cDNA having a novel nucleotide sequence expressed in human liver, activated macrophages and the like. The present inventors have found that a mature peptide produced from a precursor polypeptide encoded by the obtained cDNA has useful antibacterial activity and cell function regulating activity. As a result of further study based on these findings, the present invention has been completed.

That is, the present invention provides: (1) a polypeptide having an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 3 or a salt thereof; (2) a polypeptide represented by SEQ ID NO: 1 (1) containing an amino acid sequence identical or substantially identical to the amino acid sequence to be
Or a salt thereof, (3) a polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 13, or a salt thereof, (4) a polypeptide represented by SEQ ID NO: 11 (3) the polypeptide or a salt thereof comprising the same or substantially the same amino acid sequence as the amino acid sequence represented by (5) the amino acid identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 9 (3) containing the sequence
Or a salt thereof, (6) DN encoding the polypeptide of (1) above.
DNA containing A, (7) DNA described in the above (6) containing the base sequence represented by SEQ ID NO: 4, (8) recombinant vector containing the DNA described in the above (6), (9) (10) a DNA encoding a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7; Culturing a transformant transformed with a recombinant vector containing a DNA containing the same to produce the polypeptide, which is the same or substantially the same as the amino acid sequence represented by SEQ ID NO: 7. And (11) a method for producing a polypeptide comprising the amino acid sequence of SEQ ID NO: 7, or a polypeptide comprising the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7. The production method according to the above (10), wherein the peptide is a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 3, (12) the amino acid represented by SEQ ID NO: 7 The production method according to the above (10), wherein the DNA encoding the polypeptide having the same or substantially the same amino acid sequence as the sequence is a DNA having the base sequence represented by SEQ ID NO: 8, (13) DNA encoding the polypeptide of 3)
(14) a method for producing the polypeptide or the salt thereof according to the above (3), which comprises culturing a transformant transformed with a recombinant vector containing a DNA containing the above, and producing the polypeptide. DNA encoding the polypeptide of (3) above
Is the DNA having the base sequence represented by SEQ ID NO: 14, the production method according to the above (13), (15) allowing the protease according to the above (1) or (4) or a salt thereof to act on a protease. A method for producing a polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7 or SEQ ID NO: 13, or a salt thereof, (16) The method according to (3) above, Polypeptide or a salt thereof,
Or an antibody against a polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7 or a salt thereof, (17) the amino acid sequence represented by SEQ ID NO: 7 or SEQ ID NO: 13 An amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 7 or SEQ ID NO: 13, wherein a polypeptide having the same or substantially the same amino acid sequence as the above or a salt thereof is used. (18) a method for screening for a compound or a salt thereof that promotes or inhibits the activity of a polypeptide having the following or a salt thereof, SEQ ID NO: 7 or SEQ ID NO: comprising a polypeptide having (19) a screening kit for a compound or a salt thereof that promotes or inhibits the activity of a polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by 13, or a salt thereof; A polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7 or SEQ ID NO: 13, which can be obtained by the method or the screening kit described in (18) above, or a salt thereof. (20) a compound or a salt thereof that promotes or inhibits the activity of SEQ ID NO: 7 or SEQ ID NO: 13 which can be obtained using the screening method described in (17) or the screening kit described in (18). Has the same or substantially the same amino acid sequence as the represented amino acid sequence A medicament comprising a compound that promotes or inhibits the activity of a polypeptide or a salt thereof or a salt thereof; (21) an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 7 or SEQ ID NO: 13 (22) a polypeptide comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 7 or SEQ ID NO: 13, or a salt thereof A prophylactic / therapeutic agent for opportunistic infections, sepsis, drug addiction, tuberculosis, cancer, liver dysfunction, immune dysfunction, endocrine disorders, etc., comprising (23) the antibody according to (16) above. (24) From N-terminal side to C-terminal side, a signal sequence region for secretion, an intervening sequence, a basic amino acid region consisting of five consecutive residues, (25) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 27 (excluding the amino acid sequence represented by SEQ ID NO: 7), or a polypeptide thereof; (26) a pharmaceutical comprising a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 27 (excluding the amino acid sequence represented by SEQ ID NO: 7) or a salt thereof, (27) transformation The production method according to the above (10) or (13), wherein the body is an animal cell, is provided. Furthermore, the DNA and polypeptide of the present invention, their amides or their esters or their salts, etc., may be used for basic research such as molecular weight markers, tissue markers, chromosome mapping, identification of genetic diseases, primer and probe design, etc. is there.

[0007]

BEST MODE FOR CARRYING OUT THE INVENTION (1) a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 3, (2) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 11 A polypeptide containing the same or substantially the same amino acid sequence; (3) a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7; (4) a SEQ ID NO: 1
Polypeptides containing the same or substantially the same amino acid sequence as the amino acid sequence represented by No. 3 include human and warm-blooded animals (eg, guinea pig, rat, mouse, chicken, rabbit, pig, sheep, cow, monkey, etc.). ) Cells (eg, hepatocytes, splenocytes, neurons, glial cells, pancreatic β
Cells, bone marrow cells, mesangial cells, Langerhans cells, epidermal cells, epithelial cells, endothelial cells, fibroblasts, fiber cells, muscle cells, adipocytes, immune cells (eg, macrophages, T cells, B cells, natural killer cells, Mast cells, neutrophils, basophils, eosinophils, monocytes), megakaryocytes, synovial cells, chondrocytes, osteocytes, osteoblasts, osteoclasts, mammary cells, or stromal cells, or these Cell progenitor cells,
Stem cells or cancer cells, etc.) or any tissue in which these cells are present, for example, the brain, various parts of the brain (eg, olfactory bulb, amygdala, basal sphere, hippocampus, thalamus, hypothalamus, cerebral cortex, medulla, cerebellum) , Spinal cord, pituitary, stomach, pancreas, kidney,
Liver, gonad, thyroid, gall bladder, bone marrow, adrenal gland, skin, muscle, lung, digestive tract (eg, large intestine, small intestine), blood vessels, heart, thymus, spleen, salivary gland, peripheral blood, prostate, testicle, ovary, placenta, uterus Or a polypeptide derived from bone, cartilage, joint, skeletal muscle, or the like, a recombinant polypeptide, or a synthetic polypeptide. In the present specification, (1) a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 3 is referred to as a human precursor polypeptide of the present invention;
(2) a polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 11 as a mouse precursor polypeptide of the present invention;
A polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7 is the same as or substantially identical to the mature human polypeptide (4). A polypeptide having an identical amino acid sequence may be referred to as a mouse-type mature polypeptide of the present invention. Further, (1) a polypeptide having the amino acid sequence represented by SEQ ID NO: 21 or SEQ ID NO: 23 is defined as a rat precursor polypeptide of the present invention, and (2) an amino acid sequence represented by SEQ ID NO: 25 Such a polypeptide may be referred to as a rat mature polypeptide of the present invention. Also, (1) a human precursor polypeptide of the present invention, a mouse precursor polypeptide of the present invention, and a signal sequence region for secretion, an intervening sequence, and five residues from the N-terminal to the C-terminal. A continuous basic amino acid region, a polypeptide having each region in the order of the mature peptide region, the precursor polypeptide of the present invention,
(2) The human mature polypeptide of the present invention, the mouse mature polypeptide of the present invention, and the polypeptide having the amino acid sequence represented by SEQ ID NO: 27 may be collectively referred to as the mature polypeptide of the present invention. is there. Further, the precursor polypeptide of the present invention and the mature polypeptide of the present invention may be collectively referred to as the polypeptide of the present invention. When the polypeptide of the present invention has a signal peptide, the polypeptide can be efficiently secreted extracellularly.

The amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 7 is about 60% or more, preferably about 70% or more, of the amino acid sequence represented by SEQ ID NO: 7.
% Or more, more preferably about 80% or more, more preferably about 90% or more, particularly preferably about 95% or more. As the amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 7, one having one of the cysteine residues identical to the amino acid sequence represented by SEQ ID NO: 7 is preferable. SEQ ID NO:
Specifically, the polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7 is, for example, the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 3 And the like. The amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 3 is about 60% or more, preferably about 70% or more, more preferably about 80% that's all,
More preferably about 90% or more, particularly preferably about 95%
Examples include amino acid sequences having the above homology. As a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 3, specifically, for example, the same or substantially the same as the amino acid sequence represented by SEQ ID NO: 1 And the like. The amino acid sequence represented by SEQ ID NO: 1 is substantially the same as the amino acid sequence represented by SEQ ID NO: 1, preferably about 60% or more, more preferably about 70% or more, and even more preferably about 80% or more.
% Or more, more preferably about 90% or more, particularly preferably about 95% or more.

The amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 13 includes SEQ ID NO: 13
An amino acid sequence having about 60% or more, preferably about 70% or more, more preferably about 80% or more, more preferably about 90% or more, particularly preferably about 95% or more homology with the amino acid sequence represented by And specifically,
The amino acid sequences represented by SEQ ID NO: 19 and SEQ ID NO: 25 are exemplified. As the amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 13, it is preferable that the position of the cysteine residue is the same as the amino acid sequence represented by SEQ ID NO: 13. Specifically, the polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 13, specifically, for example, the same or substantially the same as the amino acid sequence represented by SEQ ID NO: 11 And the like. As the amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 11, about 60% or more, preferably about 70% or more, more preferably about 80% that's all,
More preferably about 90% or more, particularly preferably about 95%
Examples include the amino acid sequences having the above homology, and specifically, the amino acid sequences represented by SEQ ID NO: 17 and SEQ ID NO: 23. Specifically, as a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 11, for example,
A polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 9 and the like. The amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 9 is about 60% or more, preferably about 70%
Above, still more preferably about 80% or more, more preferably about 90% or more, particularly preferably about 95% or more amino acid sequence and the like. Specifically, SEQ ID NO: 15, SEQ ID NO: 21 and the like.

[0010] Examples of the property of substantially the same quality include, for example, secretion and action as a humoral factor. Substantially the same means that those properties are qualitatively the same. Therefore, properties such as secretion action and solubility are equivalent (eg, about 0.1 to 100 times, preferably about 0.5 to 1 times).
(0 times, more preferably 0.5 to 2 times), but the degree of these properties and the quantitative factors such as the molecular weight of the polypeptide may be different.

[0011] More specifically, as a polypeptide containing an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 7, for example, SEQ ID NO: 1, 1 or 2 or more (preferably about 1 to 30, preferably 1 to 10) in the amino acid sequence represented by SEQ ID NO: 3 or SEQ ID NO: 7.
Amino acid sequence in which about (preferably, 1 to 5) amino acids have been deleted, SEQ ID NO: 1, SEQ ID NO:
3 or 1 or more (preferably about 1 to 30, preferably about 1 to 10, and more preferably number (1 to 5)) amino acids in the amino acid sequence represented by SEQ ID NO: 7 1 or 2 or more (preferably about 1 to 30, preferably about 1 to 10, in addition to the amino acid sequence represented by the added amino acid sequence, SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 7; Preferably a number (1 to
5) amino acid sequence, and one or more (preferably 1 to 2) in the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 7
About 30 amino acids, preferably about 1 to 10 amino acids, more preferably about 1 to 5 amino acids, are substituted with other amino acids, or a polypeptide containing an amino acid sequence obtained by combining them. So-called muteins are also included.

More specifically, as a polypeptide having an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 9, SEQ ID NO: 11, or SEQ ID NO: 13, for example, SEQ ID NO: 9, 1 or 2 or more (preferably about 1 to 30, preferably 1 to 1) in the amino acid sequence represented by SEQ ID NO: 11 or SEQ ID NO: 13
About 0, more preferably number (1-5) amino acids are deleted, and one or two or more amino acid sequences represented by SEQ ID NO: 9, SEQ ID NO: 11 or SEQ ID NO: 13 are deleted. (Preferably about 1 to 30, preferably about 1 to 10, more preferably a number (1 to
5) amino acids added to the amino acid sequence represented by SEQ ID NO: 9, SEQ ID NO: 11 or SEQ ID NO: 13;
An amino acid sequence having about 30 amino acids inserted therein, preferably about 1 to 10 amino acids, and more preferably about 1 to 5 amino acids, represented by SEQ ID NO: 9, SEQ ID NO: 11, or SEQ ID NO: 13. An amino acid sequence in which one or more (preferably about 1 to 30, preferably about 1 to 10, and more preferably number (1 to 5)) amino acids in the amino acid sequence have been substituted with other amino acids Or so-called muteins such as polypeptides containing an amino acid sequence obtained by combining them. When the amino acid sequence is inserted, deleted or substituted as described above, the position of the insertion, deletion or substitution is not particularly limited.

[0013] Further, as a polypeptide containing an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 15, SEQ ID NO: 17 or SEQ ID NO: 19, more specifically, for example, SEQ ID NO: 15, SEQ ID NO: 1
7 or 1 in the amino acid sequence represented by SEQ ID NO: 19.
Or 2 or more (preferably about 1 to 30, preferably about 1 to 10, more preferably a number (1 to 5)
Amino acids), SEQ ID NO:
15, one or more (preferably 1 to 3) amino acid sequences represented by SEQ ID NO: 17 or SEQ ID NO: 19;
Amino acid represented by an amino acid sequence to which about 0, preferably about 1 to 10, and more preferably number (1 to 5) amino acids have been added, SEQ ID NO: 15, SEQ ID NO: 17 or SEQ ID NO: 19 An amino acid sequence in which one or more (preferably about 1 to 30, preferably about 1 to 10, and more preferably about 1 to 5) amino acids have been inserted into the sequence, SEQ ID NO: 15, One or two or more (preferably, about 1 to 30, in the amino acid sequence represented by SEQ ID NO: 17 or SEQ ID NO: 19,
Preferably about 1 to 10, more preferably a number (1 to
And so-called muteins such as polypeptides containing an amino acid sequence in which 5) amino acids are substituted with other amino acids, or an amino acid sequence obtained by combining them. When the amino acid sequence is inserted, deleted or substituted as described above, the position of the insertion, deletion or substitution is not particularly limited.

More specifically, as a polypeptide having an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 21, SEQ ID NO: 23 or SEQ ID NO: 25, for example, SEQ ID NO: 21, One or more (preferably about 1 to 30, preferably 1) in the amino acid sequence represented by SEQ ID NO: 23 or SEQ ID NO: 25
An amino acid sequence in which about 10 to about 10 amino acids are deleted, and more preferably 1 to 2 amino acids in the amino acid sequence represented by SEQ ID NO: 21, SEQ ID NO: 23 or SEQ ID NO: 25. An amino acid sequence to which the above (preferably about 1 to 30, preferably about 1 to 10, and more preferably number (1 to 5)) amino acids have been added,
SEQ ID NO: 21, SEQ ID NO: 23 or SEQ ID NO: 25
An amino acid sequence in which one or more (preferably about 1 to 30, preferably about 1 to 10, and more preferably a number (1 to 5)) amino acids have been inserted into the amino acid sequence represented by One or more (preferably about 1 to 30, preferably 1) in the amino acid sequence represented by SEQ ID NO: 21, SEQ ID NO: 23 or SEQ ID NO: 25.
So-called muteins, such as polypeptides containing an amino acid sequence in which about 10 to about 10, and more preferably the number (1 to 5) amino acids are replaced by another amino acid, or an amino acid sequence obtained by combining them are also included. When the amino acid sequence is inserted, deleted or substituted as described above, the position of the insertion, deletion or substitution is not particularly limited.

From the N-terminal side to the C-terminal side, a polypeptide having a signal sequence region for secretion, an intervening sequence, a basic amino acid region consisting of 5 consecutive residues, and a mature polypeptide region, "Signal sequence region for secretion" refers to any amino acid sequence that is required for the biosynthesized polypeptide to be transported to the secretory pathway via the endoplasmic reticulum. 10-50 containing hydrophobic amino acid clusters
, Preferably 13 to 40, more preferably 15 to 3
A signal sequence consisting of zero is preferred. “Intervening sequence” includes “signal sequence region for secretion”, “basic amino acid region consisting of 5 consecutive residues” and “mature polypeptide region”
Any amino acid sequence having an amino acid sequence other than the amino acid sequence of
~ 300, preferably about 10-200, more preferably about 20-100 are used. The “basic amino acid region consisting of 5 consecutive residues” is an arginine residue and / or
Alternatively, any region may be used as long as it has a 5-residue amino acid sequence consisting of only lysine residues, and preferably a region containing two or more arginine residues,
More preferably, a region having a sequence containing three or more arginine residues is used. The "mature polypeptide region" may be any polypeptide as long as it is a polypeptide that secretes extracellularly and exhibits a physiological effect, and includes, for example, the mature polypeptide of the present invention. In the amino acid sequence represented by SEQ ID NO: 27, Xaa represents an amino acid residue other than Cys (preferably an α-amino acid residue), and specifically, Gly, Ala, Val, Leu, Ile, Ser, Thr, Met, Glu, A
sp, Lys, Arg, His, Phe, Tyr, Trp, Pro, Asn, Gln and the like are used. The amino acid sequence represented by SEQ ID NO: 27 includes [Asp Xaa Xaa Phe ProIle Cys Xaa Phe C
ys Cys Xaa Cys Cys Xaa Xaa Xaa Xaa Cys Gly Xaa Cys
CysXaa Xaa (SEQ ID NO: 30)] is preferred, and [Asp ThrXaa Phe Pro Ile Cys Xaa
Phe Cys Cys Xaa Cys Cys Xaa Xaa Ser Xaa Cys GlyXa
a Cys Cys Xaa Thr (SEQ ID NO: 31)].

The polypeptide in the present specification is a pepti.
The left end is the N-terminal (amino terminal) and the right is
The end is the C-terminus (carboxyl terminus). SEQ ID NO: 1
A polypeptide containing an amino acid sequence represented by
In the polypeptide of the present invention, the C-terminal is usually
Boxyl group (-COOH) or carboxylate (-
COO^-), But the C-terminal is an amide (—CONH_Two)
Or an ester (—COOR). Where d
As R in stel, for example, methyl, ethyl,
C such as n-propyl, isopropyl or n-butyl
_1-6Alkyl groups such as cyclopentyl, cyclohexyl
C such as sill_3-8Cycloalkyl groups such as phenyl,
C such as α-naphthyl_6-12Aryl groups, such as benzyl
Phenyl-C such as phenyl and phenethyl _1-2Alkyl group or
Is α-naphthyl-C such as α-naphthylmethyl_1-2Archi
C such as_7-14In addition to aralkyl groups, oral esters
Pivaloyloxymethyl group is widely used as
You. When the polypeptide of the present invention has a carboxyl group
Group (or carboxylate)
Boxyl groups amidated or esterified
Are also included in the polypeptide of the present invention. Este in this case
For example, the above-mentioned C-terminal ester and the like are used
Can be Further, the polypeptide of the present invention has an N-terminal
Amino groups of amino acid residues (eg, methionine residues) are protected
Group (for example, C such as formyl group and acetyl group)_1-6Arca
C such as Noil_1-6Protected by an acyl group, etc.)
N-terminal glutamine residue generated by cleavage in vivo
Pyroglutamine oxidized, side chain of amino acid in molecule
The above substituents (for example, -OH, -SH, amino group, imida
Sol, indole, guanidino, etc.)
Protecting groups (for example, C such as formyl group, acetyl group, etc.)_1-6Al
C such as a canoyl group_1-6Acyl)
So-called sugar polypeptides or sugar chains attached
And the like.

As the polypeptide of the present invention or a salt thereof, salts with physiologically acceptable acids (eg, inorganic acids, organic acids) and bases (eg, alkali metal salts) are used. Are preferred. Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) Acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used. The polypeptide of the present invention or a salt thereof can be produced from a cell or tissue of a human or a warm-blooded animal by a known method for purifying a polypeptide (protein), or a DNA encoding the polypeptide described below can be prepared. It can also be produced by culturing the containing transformant. Further, it can also be produced according to the peptide synthesis method described later. When producing from human or mammalian tissues or cells, after homogenizing the human or mammalian tissues or cells, extraction is performed with an acid or the like, and the extract is subjected to chromatography such as reverse phase chromatography or ion exchange chromatography. Can be purified and isolated.

For the synthesis of the polypeptide of the present invention or a salt thereof, or an amide thereof, a commercially available resin for polypeptide (protein) synthesis can be used. Examples of such resins include chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin, 4-methylbenzhydrylamine resin, PAM resin,
4-hydroxymethylmethylphenylacetamidomethyl resin, polyacrylamide resin, 4- (2 ′, 4′-dimethoxyphenyl-hydroxymethyl) phenoxy resin,
-(2 ', 4'-dimethoxyphenyl-Fmocaminoethyl) phenoxy resin. Using such a resin, an amino acid having an α-amino group and a side chain functional group appropriately protected is condensed on the resin in accordance with the sequence of the target polypeptide according to various condensation methods known per se. At the end of the reaction, the polypeptide is cleaved from the resin, and at the same time, various protecting groups are removed. Further, an intramolecular disulfide bond formation reaction is carried out in a highly diluted solution to obtain a target polypeptide or an amide thereof. For the condensation of the above protected amino acids, various activating reagents that can be used for polypeptide synthesis can be used, and carbodiimides are particularly preferable. As the carbodiimides, DCC, N, N′-diisopropylcarbodiimide, N-ethyl-N ′-(3-dimethylaminoprolyl) carbodiimide and the like are used. Activation by these includes racemization inhibiting additives (eg, HO
(Bt, HOOBt) together with the protected amino acid directly to the resin or symmetrical anhydride or HOBt ester or HO
The protected amino acid can be added as an OBt ester to the resin after activation.

The solvent used for the activation of the protected amino acid and the condensation with the resin can be appropriately selected from solvents known to be usable for the polypeptide (protein) condensation reaction. For example, N, N-dimethylformamide,
Acid amides such as N, N-dimethylacetamide, N-methylpyrrolidone, halogenated hydrocarbons such as methylene chloride and chloroform, alcohols such as trifluoroethanol, sulfoxides such as dimethylsulfoxide, pyridine, dioxane, tetrahydrofuran, etc. Ethers, nitriles such as acetonitrile and propionitrile, esters such as methyl acetate and ethyl acetate, or an appropriate mixture thereof are used. The reaction temperature is appropriately selected from a range known to be usable for a polypeptide (protein) bond formation reaction, and is usually about -20 to -20.
The temperature is appropriately selected from the range of 50 ° C. The activated amino acid derivative is usually used in a 1.5 to 4-fold excess. As a result of the test using the ninhydrin reaction, when the condensation is insufficient, sufficient condensation can be performed by repeating the condensation reaction without removing the protecting group. When sufficient condensation cannot be obtained even by repeating the reaction, unreacted amino acids can be acetylated using acetic anhydride or acetylimidazole to prevent the subsequent reaction from being affected.

Examples of the amino-protecting group for the starting material include Z, Boc, t-pentyloxycarbonyl, isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl, Cl-Z, Br-Z, adamantyloxycarbonyl, Trifluoroacetyl, phthaloyl, formyl, 2
-Nitrophenylsulfenyl, diphenylphosphinothioyl, Fmoc and the like are used.

The carboxyl group may be, for example, alkyl esterified (eg, methyl, ethyl, propyl, butyl,
linear, branched or cyclic alkyl esterification of t-butyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, 2-adamantyl and the like, aralkyl esterification (for example, benzyl ester, 4-nitrobenzyl ester, 4- Methoxybenzyl ester,
4-chlorobenzyl ester, benzhydryl esterification), phenacyl esterification, benzyloxycarbonyl hydrazide, t-butoxycarbonyl hydrazide, trityl hydrazide and the like.

The hydroxyl group of serine can be protected, for example, by esterification or etherification. Examples of groups suitable for the esterification include lower (C _1-6 ) alkanoyl groups such as acetyl group, aroyl groups such as benzoyl group, and groups derived from carbonic acid such as benzyloxycarbonyl group and ethoxycarbonyl group. Used. In addition, groups suitable for etherification include, for example, a benzyl group, a tetrahydropyranyl group, a t-butyl group and the like. As the protecting group for the phenolic hydroxyl group of tyrosine, for example, Bzl, Cl ₂ -Bzl, 2-nitrobenzyl, Br-Z, t-butyl and the like are used. As the imidazole protecting group for histidine, for example, Tos, 4-methoxy-2,3,6-trimethylbenzenesulfonyl, DNP, benzyloxymethyl, Bum, Boc, Trt, Fmoc and the like are used.

Examples of the activated carboxyl groups of the raw materials include, for example, corresponding acid anhydrides, azides, active esters [alcohols (eg, pentachlorophenol, 2,4,5-trichlorophenol, 2,4- Dinitrophenol, cyanomethyl alcohol, p-nitrophenol, HONB, N-hydroxysuccinimide, N-hydroxyphthalimide, esters with HOBt) and the like. As the activated amino group of the raw material, for example, a corresponding phosphoric amide is used. Removal (elimination) of protecting group
As a method, for example, catalytic reduction in a hydrogen stream in the presence of a catalyst such as Pd-black or Pd-carbon,
Acid treatment with anhydrous hydrogen fluoride, methanesulfonic acid, trifluoromethanesulfonic acid, trifluoroacetic acid or a mixture thereof, base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine, etc., reduction with sodium in liquid ammonia, etc. Used. The elimination reaction by the acid treatment is generally about-
The acid treatment is performed at a temperature of 20 to 40 ° C., for example, such as anisole, phenol, thioanisole, metacresol, paracresol, dimethylsulfide, 1,4-butanedithiol, and 1,2-ethanedithiol. Addition of a suitable cation scavenger is effective. In addition, the 2,4-dinitrophenyl group used as the imidazole protecting group of histidine is removed by thiophenol treatment, and the formyl group used as the indole protecting group of tryptophan is 1,2-ethanedithiol, 1,4-butane described above. In addition to deprotection by acid treatment in the presence of dithiol, etc.,
It is also removed by an alkali treatment using a dilute sodium hydroxide solution, dilute ammonia or the like.

The protection of the functional group which should not be involved in the reaction of the raw material, the protecting group, the elimination of the protective group, the activation of the functional group involved in the reaction and the like can be appropriately selected from known groups or known means. . As another method for obtaining an amide form of the polypeptide, for example, first, after protecting the α-carboxyl group of the carboxy-terminal amino acid by amidation, the peptide (polypeptide) chain is extended to a desired chain length on the amino group side. After that, a polypeptide was prepared by removing only the protecting group of the N-terminal α-amino group of the peptide chain, and a polypeptide was obtained by removing only the protecting group of the carboxyl group at the C-terminus. Condensation in such a mixed solvent. Details of the condensation reaction are the same as described above. After purifying the protected polypeptide obtained by the condensation, all the protecting groups are removed by the above-mentioned method to obtain a desired crude polypeptide. The crude polypeptide is purified by various known purification means, and the main fraction is lyophilized to obtain an amide of the desired polypeptide. To obtain an ester of the polypeptide, for example,
After condensing the α-carboxyl group of the carboxy terminal amino acid with a desired alcohol to form an amino acid ester, an ester of the desired polypeptide can be obtained in the same manner as the amide of the polypeptide.

The polypeptide of the present invention or a salt thereof can be produced according to a peptide synthesis method known per se. Peptide synthesis methods include, for example, solid phase synthesis,
Any of the liquid phase synthesis methods may be used. That is, the target peptide can be produced by condensing a partial peptide or amino acid capable of constituting the partial peptide of the present invention with the remaining portion, and removing the protective group when the product has a protective group. Known methods for condensation and elimination of protecting groups include, for example, the methods described in (1) to (4) below. M. Bodanszky and MA Ondetti, Peptide Synthesis, Interscience Publisher
s, New York (1966) Schroeder and Luebke, The Peptid
e), Academic Press, NewYork (1965) Nobuo Izumiya et al., Fundamentals and experiments of peptide synthesis, Maruzen Co., Ltd.
(1975) Haruaki Yajima and Shunpei Sakakibara, Laboratory for Biochemistry 1, Protein Chemistry IV, 205, (1977) Supervised by Haruaki Yajima, Development of Continuing Drugs, Volume 14, Peptide Synthesis, Hirokawa Shoten Thereafter, the polypeptide of the present invention can be purified and isolated by a combination of ordinary purification methods such as solvent extraction, distillation, column chromatography, liquid chromatography, and recrystallization. When the polypeptide obtained by the above method is a free form, it can be converted to an appropriate salt by a known method or a method analogous thereto, and conversely, when the polypeptide is obtained as a salt, the known method or analogous method It can be converted into a free form or another salt by a method.

The DNA encoding the human polypeptide of the present invention may be any DNA containing the aforementioned base sequence encoding the human polypeptide of the present invention. In addition, any of genomic DNA, cDNA derived from the above-mentioned cells and tissues, and synthetic DNA may be used. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. In addition, the total
Directly using prepared RNA or mRNA fractions
Reverse Transcriptase Polymerase Chain Reaction
(Hereinafter, abbreviated as RT-PCR method).

As the DNA encoding the human precursor polypeptide of the present invention, for example, a DNA containing the base sequence represented by SEQ ID NO: 4, substantially the same as the base sequence represented by SEQ ID NO: 4 Contains the same nucleotide sequence and has substantially the same properties as the human precursor polypeptide of the present invention (eg,
DN encoding a polypeptide having immunogenicity)
A or D having the base sequence represented by SEQ ID NO: 4
DNA containing a DNA that hybridizes with NA under high stringency conditions and encoding a polypeptide having substantially the same properties (eg, immunogenicity, etc.) as the human precursor polypeptide of the present invention. Any one may be used.
Examples of the DNA containing the base sequence represented by SEQ ID NO: 4 include DN containing the base sequence represented by SEQ ID NO: 4.
A, DNA containing the base sequence represented by SEQ ID NO: 2
Are used. Contains DNA containing a base sequence substantially identical to the base sequence represented by SEQ ID NO: 4 or DNA hybridizing under high stringent conditions with DNA having the base sequence represented by SEQ ID NO: 4 For example, the DNA to be synthesized is, for example, about 80% or more, preferably about 90% or more, more preferably about 95% or more, and most preferably about 98% or more of the nucleotide sequence represented by SEQ ID NO: 4.
A DNA containing a base sequence having the above homology is exemplified.

As the DNA encoding the human mature polypeptide of the present invention, for example, a DNA containing the nucleotide sequence represented by SEQ ID NO: 8, substantially the same as the nucleotide sequence represented by SEQ ID NO: 8 Contains the same nucleotide sequence and has substantially the same properties as the humanized mature polypeptide of the present invention (eg,
DN encoding a polypeptide having immunogenicity)
A or D having the base sequence represented by SEQ ID NO: 8
DNA containing a DNA that hybridizes with NA under high stringency conditions and encoding a polypeptide having substantially the same properties (eg, immunogenicity, etc.) as the humanized mature polypeptide of the present invention. Any one may be used.
Examples of the DNA containing the base sequence represented by SEQ ID NO: 8 include DN containing the base sequence represented by SEQ ID NO: 8.
A or the like is used. Contains DNA containing a base sequence substantially identical to the base sequence represented by SEQ ID NO: 8 or DNA hybridizing under high stringent conditions with DNA having the base sequence represented by SEQ ID NO: 8 For example, the DNA to be synthesized is, for example, about 80% or more, preferably about 90% or more, more preferably about 95% or more, and most preferably about 98% or more of the nucleotide sequence represented by SEQ ID NO: 8.
A DNA containing a base sequence having the above homology is exemplified.

The DNA encoding the mouse polypeptide of the present invention may be any DNA containing the above-described nucleotide sequence encoding the mouse polypeptide of the present invention. In addition, any of genomic DNA, cDNA derived from the above-mentioned cells and tissues, and synthetic DNA may be used. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. In addition, from the cells and tissues described above,
Reverse Transcriptase Polymerase Chain Reaction directly using prepared lRNA or mRNA fraction
(Hereinafter, abbreviated as RT-PCR method).

As the DNA encoding the mouse precursor polypeptide of the present invention, for example, a DNA containing the nucleotide sequence represented by SEQ ID NO: 12, substantially the same as the nucleotide sequence represented by SEQ ID NO: 12 DNA encoding a polypeptide containing the same nucleotide sequence and having substantially the same properties (eg, immunogenicity) as the mouse precursor polypeptide of the present invention, or represented by SEQ ID NO: 12 Contains DNA that hybridizes under high stringent conditions with DNA having a base sequence, and has substantially the same properties as the mouse precursor polypeptide of the present invention (eg, immunogenicity, etc.)
Any of the DNAs encoding the polypeptide having As the DNA containing the base sequence represented by SEQ ID NO: 12, a DNA containing the base sequence represented by SEQ ID NO: 12, a DNA containing the base sequence represented by SEQ ID NO: 10, or the like is used. . D containing a nucleotide sequence substantially identical to the nucleotide sequence represented by SEQ ID NO: 12
Examples of the DNA containing DNA that hybridizes under high stringent conditions with DNA having the nucleotide sequence represented by NA or SEQ ID NO: 12 include, for example, about 80% of the nucleotide sequence represented by SEQ ID NO: 12 Above, preferably about 90% or more, more preferably about 95% or more, most preferably about 98% or more of a DNA containing a base sequence having homology of more than about 98%. Specifically, SEQ ID NO: 1
6, SEQ ID NO: 18, SEQ ID NO: 22 or SEQ ID NO:
DNA containing the base sequence represented by 24 is used.

The DNA encoding the mature mouse polypeptide of the present invention is, for example, a DNA containing the nucleotide sequence represented by SEQ ID NO: 14, substantially the same as the nucleotide sequence represented by SEQ ID NO: 14. A DNA encoding a polypeptide containing the same nucleotide sequence and having substantially the same properties (eg, immunogenicity, etc.) as the mouse-type mature polypeptide of the present invention, or represented by SEQ ID NO: 14 Contains DNA that hybridizes with DNA having a base sequence under high stringency conditions, and has substantially the same properties as the mature mouse polypeptide of the present invention (eg, immunogenicity, etc.)
Any of the DNAs encoding the polypeptide having As the DNA containing the nucleotide sequence represented by SEQ ID NO: 14, a DNA containing the nucleotide sequence represented by SEQ ID NO: 14 or the like is used. D containing a nucleotide sequence substantially identical to the nucleotide sequence represented by SEQ ID NO: 14
Examples of a DNA containing a DNA that hybridizes under high stringent conditions with a DNA having the base sequence represented by NA or SEQ ID NO: 14 include, for example, about 80% of the base sequence represented by SEQ ID NO: 14 Above, preferably about 90% or more, more preferably about 95% or more, most preferably about 98% or more DNA containing a base sequence having homology, specifically, SEQ ID NO: 2
0, a DN containing the base sequence represented by SEQ ID NO: 26
A or the like is used.

Hybridization is carried out by a method known per se or a method analogous thereto, for example, molecular
Cloning (Molecular Cloning) 2nd (J. Sambrook
et al., Cold Spring Harbor Lab. Press, 1989). When a commercially available library is used, it can be performed according to the method described in the attached instruction manual. More preferably,
It can be performed under high stringency conditions. High stringency conditions include, for example, a sodium concentration of about 19 to 40 mM, preferably about 19 to 20 mM.
In mM, the temperature is about 50-70 ° C, preferably about 60-6
The condition at 5 ° C. is shown. Examples of the DNA encoding the polypeptide of the present invention having the amino acid sequence represented by SEQ ID NO: 1 include DN having the base sequence represented by SEQ ID NO: 2.
Examples of the DNA encoding the polypeptide of the present invention in which A or the like has the amino acid sequence represented by SEQ ID NO: 3 include DNA having the base sequence represented by SEQ ID NO: 4 and the like. DNA encoding the polypeptide of the present invention having the amino acid sequence represented by SEQ ID NO: 6
DNA having the base sequence represented by SEQ ID NO: 7
Examples of the DNA encoding the polypeptide of the present invention having the amino acid sequence represented by SEQ ID NO: 8 include the DNA having the base sequence represented by SEQ ID NO: 8 and the present invention having the amino acid sequence represented by SEQ ID NO: 9. The DNA encoding the polypeptide of the present invention may be, for example, a DNA having the nucleotide sequence represented by SEQ ID NO: 10 or a DNA encoding the polypeptide of the present invention having the amino acid sequence represented by SEQ ID NO: 11.
As A, DNA having the base sequence represented by SEQ ID NO: 12 or the like is used. As DNA encoding the polypeptide of the present invention having the amino acid sequence represented by SEQ ID NO: 13 is represented by SEQ ID NO: 14 Having a base sequence to be obtained
A or the like includes, as DNA encoding the polypeptide of the present invention having the amino acid sequence represented by SEQ ID NO: 15,
The DNA encoding the polypeptide of the present invention having the amino acid sequence represented by SEQ ID NO: 17 is the DNA having the nucleotide sequence represented by SEQ ID NO: 16 or the like. Is a DNA encoding the polypeptide of the present invention having the amino acid sequence represented by SEQ ID NO: 19, and the like.
DNA having the base sequence represented by SEQ ID NO: 20 or the like includes, as DNA encoding the polypeptide of the present invention having the amino acid sequence represented by SEQ ID NO: 21, SEQ ID NO: 22
DNA having the base sequence represented by SEQ ID NO: 2
Examples of the DNA encoding the polypeptide of the present invention having the amino acid sequence represented by SEQ ID NO: 3 include a DNA having the base sequence represented by SEQ ID NO: 24 and a DNA having the amino acid sequence represented by SEQ ID NO: 25. As the DNA encoding the polypeptide of the present invention, a DNA having the base sequence represented by SEQ ID NO: 26 or the like is used.

As a means for cloning a DNA that completely encodes the polypeptide of the present invention, the DNA may be amplified by a PCR method using a synthetic DNA primer having a partial nucleotide sequence of the polypeptide of the present invention, or may be cloned into an appropriate vector. A DNA fragment encoding a part or all of the polypeptide of the present invention or a synthetic D
Selection can be carried out by hybridization with a substance labeled with NA. Hybridization methods include, for example, molecular cloning (Mo
lecular Cloning) 2nd (J. Sambrook et al., Cold Spr
ing Harbor Lab. Press, 1989). When a commercially available library is used, it can be performed according to the method described in the attached instruction manual. Conversion of DNA base sequence is performed by PCR
And known kits, for example, Mutan ^TM -superExpress Km
(Takara Shuzo Co., Ltd.), Mutan ^™ -K (Takara Shuzo Co., Ltd.), etc., according to a method known per se such as the ODA-LAPCR method, the Gupped duplex method and the Kunkel method, or a method analogous thereto. The DNA encoding the cloned polypeptide can be used as it is depending on the purpose, or can be used after digesting with a restriction enzyme or adding a linker, if desired. The DNA may have ATG as a translation initiation codon at the 5 'end and TAA, TGA or TAG as a translation stop codon at the 3' end. These translation initiation codon and translation termination codon can also be added using a suitable synthetic DNA adapter. An expression vector for the polypeptide of the present invention may be prepared, for example, by (a) cutting out a DNA fragment of interest from DNA encoding the polypeptide of the present invention, and (b) placing the DNA fragment downstream of a promoter in an appropriate expression vector. It can be manufactured by connecting.

As a vector, a plasmid derived from Escherichia coli (eg, pBR322, pBR325, pUC12, pUC12) is used.
UC13), a plasmid derived from Bacillus subtilis (eg, pUB11)
0, pTP5, pC194), yeast-derived plasmids (eg, pSH19, pSH15), bacteriophages such as λ phage, animal viruses such as retrovirus, vaccinia virus, baculovirus, etc., and pA1
-11, pXT1, pRc / CMV, pRc / RSV,
pcDNAI / Neo, pcDNA3.1, pRc / C
MV2, pRc / RSV (Invitrogen) or the like is used. The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression. For example, when an animal cell is used as a host, SRα promoter, SV40 promoter, HIV / LTR promoter, CMV promoter, HSV-TK promoter, β-actin and the like can be mentioned. Among these, it is preferable to use a CMV (cytomegalovirus) promoter, SRα promoter, or the like. If the host is Escherichia, tr
p promoter, lac promoter, recA promoter, λP _L promoter, lpp promoter, T
7 promoter and the like, when the host is a bacterium belonging to the genus Bacillus, SPO1 promoter, SPO2 promoter, p
When the host is yeast, such as the enP promoter, PH
O5 promoter, PGK promoter, GAP promoter, ADH promoter and the like are preferable. When the host is an insect cell, the polyhedrin promoter, P10
Promoters and the like are preferred.

[0035] In addition to the above, expression vectors which optionally contain an enhancer, a splicing signal, a poly-A addition signal, a selection marker, an SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori) and the like may be used. Can be used. As a selectable marker, for example, dihydrofolate reductase (hereinafter sometimes abbreviated as dhfr) gene [methotrexate (MT
X) resistance], an ampicillin resistance gene (hereinafter referred to as Amp ^r
Sometimes abbreviated as), neomycin resistant gene (hereinafter sometimes abbreviated as Neo ^r, include Geneticin resistance) and the like. In particular, when the dhfr gene is used as a selection marker using dhfr gene-deficient Chinese hamster cells, the recombinant cells can be selected using a thymidine-free medium. If necessary, a signal sequence suitable for the host may be replaced with the N-type of the polypeptide of the present invention.
It may be added to the terminal side. When the host is a bacterium belonging to the genus Escherichia, a PhoA signal sequence, an OmpA signal sequence, or the like, when the host is a bacterium belonging to the genus Bacillus, an α-amylase signal sequence, a subtilisin signal sequence, or the like,
When the host is yeast, MFα signal sequence, SU
When the host is an animal cell such as a C2 signal sequence, an insulin signal sequence, an α-interferon signal sequence, an antibody molecule / signal sequence, etc. can be used. Using the vector containing the DNA encoding the polypeptide of the present invention thus constructed, a transformant can be produced.

As the host, for example, Escherichia, Bacillus, yeast, insect cells, insects, animal cells and the like are used. Specific examples of the genus Escherichia include, for example, Escherichia coli K12
・ DH1 [Procedings of the National
Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), Volume 60,
160 (1968)], JM103 [Nucleic Acids Research, (Nucleic Acids Research), Vol. 9,
309 (1981)], JA 221 [Journal of
Molecular biology (Journal of Molecular B
iology)], 120, 517 (1978)], HB10
1 [Journal of Molecular Biology,
41, 459 (1969)], C600 [Genetics, 39, 440 (1954)] and the like. Examples of Bacillus bacteria include, for example, Bacillus
Bacillus subtilis MI114 [Gene, 24, 255 (1983)], 207-21 [Journal of Biochemistry
emistry), Vol. 95, 87 (1984)]. Examples of yeast include, for example, Saccharomyces cerevisiae AH22, AH22
^{R -, NA87-11A, DKD-5D} , 20B-1
2. Schizosaccharomy
ces pombe) NCYC1913, NCYC2036, Pichia pastoris KM71 and the like.

As insect cells, for example, the virus is A
In the case of cNPV, a cell line derived from night larvae of moth (Spodop
tera frugiperda cell (Sf cell), Trichoplusia ni
MG1 cells from the midgut, H from the eggs of Trichoplusia ni
igh Five ^TM cells, cells derived from Mamestra brassicae or
Estigmena acrea-derived cells and the like are used. When the virus is BmNPV, a silkworm-derived cell line (Bombyx mori)
N cells; BmN cells) and the like. Examples of the Sf cell include Sf9 cell (ATCC CRL1711), Sf21
Cells (Vaughn, JL et al., In Viv
o), 13, 213-217, (1977)) and the like. As insects, for example, silkworm larvae and the like are used [Maeda et al., Nature, 315, 592 (1985)].
As animal cells, for example, monkey cells COS-7, Ver
o, Chinese hamster cell CHO (hereinafter CHO)
Cell), dhfr gene deficient Chinese hamster cell CHO (hereinafter, CHO (dhfr ^-) cell), mouse L cells, mouse AtT-20, mouse myeloma cells, rat GH3, human FL cells or the like is used.

To transform Escherichia, for example, Procagings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), Vol. 69 , 21
10 (1972) and Gene, 17, 107 (1)
982) and the like.
In order to transform Bacillus, for example, Molecular and General Genetics (Molecula
r & General Genetics), 168, 111 (197
It can be carried out according to the method described in 9). In order to transform yeast, for example, Methods in Enzymology, 194, 1
82-187 (1991), The Prossings of
The National Academy of Sciences
Of the USA (Proc. Natl. Acad. Sci. U
SA), Vol. 75, 1929 (1978). To transform insect cells or insects, for example, bio / technology (Bio /
Technology), 6, 47-55 (1988)). To transform animal cells,
For example, Cell Engineering Separate Volume 8, New Cell Engineering Experiment Protocol. 263-267 (1995) (published by Shujunsha) and Virology, Vol. 52, 456 (1973). Thus, a transformant transformed with the expression vector containing the DNA encoding the polypeptide can be obtained. When culturing a transformant whose host is a genus Escherichia or Bacillus, a liquid medium is suitable as a medium used for the culturing, and a carbon source necessary for growth of the transformant is used therein. Nitrogen sources, inorganic substances, etc. are contained. As a carbon source, for example, glucose, dextrin, soluble starch, sucrose, etc., as a nitrogen source, for example,
Inorganic or organic substances such as ammonium salts, nitrates, corn steep liquor, peptone, casein, yeast extract, meat extract, soybean meal, potato extract, and inorganic substances such as calcium chloride, sodium dihydrogen phosphate, chloride Magnesium and the like. In addition, yeast extract, vitamins, growth promoting factors and the like may be added. The pH of the medium is preferably about 5 to 8.

As a medium for culturing the genus Escherichia, for example, an M9 medium containing glucose and casamino acid [Miller, Journal of Experiments in Molecular Genetics (Journa)
l of Experiments in Molecular Genetics), 431-
433, Cold Spring Harbor Laboratory, New York 1
972] is preferred. If necessary, an agent such as 3β-indolylacrylic acid can be added in order to make the promoter work efficiently. When the host is a bacterium belonging to the genus Escherichia, the cultivation is usually performed at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration and stirring may be added. When the host is a bacterium belonging to the genus Bacillus, the cultivation is usually carried out at about 30 to 40 ° C. for about 6 to 24 hours, and if necessary, aeration and stirring can be added. When culturing a transformant whose host is yeast, for example, a Burkholder minimum medium [Bostian, KL
Processings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), 77, 450
5 (1980)] or an SD medium containing 0.5% casamino acid [Bitter, GA et al., Processings of the.
National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. US
A), 81, 5330 (1984)].
Preferably, the pH of the medium is adjusted to about 5-8. The cultivation is usually performed at about 20 to 35 ° C. for about 24 to 72 hours, and if necessary, aeration and / or agitation are added. When culturing a transformant in which the host is an insect cell or an insect, the medium used is Grace '
s Insect Medium (Grace, TCC, Nature (Natur
e), 195,788 (1962)) to which an additive such as 10% bovine serum immobilized is appropriately added. The pH of the medium is preferably adjusted to about 6.2 to 6.4. The cultivation is usually performed at about 27 ° C. for about 3 to 5 days, and if necessary, aeration and / or stirring are added. When culturing a transformant in which the host is an animal cell, the medium may be, for example, a MEM medium containing about 5 to 20% fetal bovine serum [Science, 122
Volume, 501 (1952)], DMEM medium [Virology, 8, 396 (1959)], RPMI
1640 medium [The Journal of the American Medical Association (The Journal of the Ame
rican Medical Association) 199, 519 (196
7)], 199 medium [Proceeding of the Society for the Biological Medicin
cine), 73, 1 (1950)]. pH
Is preferably about 6-8. Culture is usually about 30-4
Perform at 0 ° C. for about 15-60 hours, adding aeration and agitation as needed. As described above, in the cells of the transformant,
The polypeptide of the present invention can be produced on the cell membrane or extracellularly.

The polypeptide of the present invention can be separated and purified from the above culture by, for example, the following method. When the polypeptide of the present invention is extracted from cultured cells or cells, after the culture, the cells or cells are collected by a known method, suspended in an appropriate buffer, and subjected to ultrasonication, lysozyme and / or freeze-thawing. After the cells or cells are destroyed by the method described above, a method of obtaining a crude extract of the polypeptide by centrifugation or filtration is used as appropriate. The buffer may contain a protein denaturant such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100 ^™ . When the polypeptide is secreted into the culture solution, after completion of the culture, the supernatant is separated from the cells or cells by a method known per se, and the supernatant is collected. Purification of the polypeptide contained in the thus obtained culture supernatant or extract can be carried out by appropriately combining known separation and purification methods. These known separation and purification methods include methods using solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SDS.
-A method mainly using a difference in molecular weight such as polyacrylamide gel electrophoresis, a method using a difference in charge such as ion exchange chromatography, a method using a specific affinity such as affinity chromatography, a reversed-phase high-performance liquid A method utilizing a difference in hydrophobicity such as chromatography, a method utilizing a difference in isoelectric points such as isoelectric focusing, and the like are used. Particularly, as a method for obtaining the precursor polypeptide and the mature polypeptide of the present invention having a complex steric structure having a large number of cysteine residues, the above-mentioned method of secreting and expressing using a recombinant and purifying it is used. Is preferred.

When the polypeptide thus obtained is obtained in a free form, it can be converted into a salt by a method known per se or a method analogous thereto, and conversely, when the polypeptide is obtained as a salt, a known method Alternatively, it can be converted to a free form or another salt by a method analogous thereto.
The polypeptide produced by the recombinant may be arbitrarily modified or partially removed by allowing a suitable protein modifying enzyme or protease to act on the polypeptide before or after purification. it can. As these enzymes, for example, trypsin, chymotrypsin, arginyl endopeptidase, protein kinase, glycosidase and the like are used. Specifically, a mature peptide can be cut out by allowing a proteolytic enzyme such as trypsin, arginyl endopeptidase, or Kex2-like endoprotease that is cleaved at a basic amino acid portion to act on the precursor polypeptide of the present invention. It is.
For example, when trypsin is used, the reaction is carried out at a pH of 3 to 10, preferably 5 to 9, more preferably around 8, and the reaction temperature is 10 to 50 ° C, preferably 20 to 45 ° C. More preferably from 30 ° C to 40
React under the condition of ° C. Also, for example, when furin, which is a Kex2-like endoprotease, is used as an enzyme, the method described in Journal of Biological Chemistry (J.B.
iol. Chem.), 267, 16094-16099.
(1992). The presence of the thus produced polypeptide of the present invention or a salt thereof can be measured by an enzyme immunoassay using a specific antibody, Western blot analysis, or the like.

The antibody against the polypeptide of the present invention or a salt thereof may be any of a polyclonal antibody and a monoclonal antibody as long as it can recognize the polypeptide of the present invention or a salt thereof. An antibody against the polypeptide of the present invention or a salt thereof can be produced using the polypeptide of the present invention as an antigen according to a method for producing an antibody or antiserum known per se. [Preparation of Monoclonal Antibody] (a) Preparation of Monoclonal Antibody-Producing Cell The polypeptide of the present invention or a salt thereof is administered to a site capable of producing an antibody by administration to a warm-blooded animal itself or together with a carrier and a diluent. Is done. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. The administration is usually performed once every 2 to 6 weeks, about 2 to 10 times in total.
Examples of warm-blooded animals used include monkeys, rabbits,
Dogs, guinea pigs, mice, rats, sheep, goats and chickens can be mentioned, but mice and rats are preferably used. When preparing monoclonal antibody-producing cells, a warm-blooded animal immunized with an antigen, for example, an individual having an antibody titer is selected from a mouse, and the spleen or lymph node is collected 2 to 5 days after the final immunization and contained in the spleen or lymph node. By fusing the antibody-producing cells thus obtained with myeloma cells of the same or different species, a monoclonal antibody-producing hybridoma can be prepared. The antibody titer in the antiserum can be measured, for example, by reacting a labeled polypeptide described below with the antiserum, and then measuring the activity of a labeling agent bound to the antibody. The fusion operation can be performed by known methods, for example, the method of Kohler and Milstein [Nature
re), 256, 495 (1975)].
Examples of the fusion promoter include polyethylene glycol (PEG) and Sendai virus, but PEG is preferably used.

Examples of myeloma cells include NS-1,
Myeloma cells of warm-blooded animals such as P3U1, SP2 / 0, and AP-1 can be mentioned, but P3U1 is preferably used.
The preferred ratio between the number of antibody-producing cells (spleen cells) and the number of myeloma cells used is about 1: 1 to 20: 1.
G (preferably PEG1000-PEG6000) is 1
Cell fusion can be carried out efficiently by adding at a concentration of about 0 to 80% and incubating at about 20 to 40 ° C, preferably about 30 to 37 ° C for about 1 to 10 minutes. Various methods can be used to screen for monoclonal antibody-producing hybridomas. For example, a hybridoma culture supernatant is added to a solid phase (eg, a microplate) in which a polypeptide antigen is directly or adsorbed together with a carrier,
Next, an anti-immunoglobulin antibody (anti-mouse immunoglobulin antibody is used if the cell used for cell fusion is a mouse) or protein A labeled with a radioactive substance or an enzyme is added, and the monoclonal antibody bound to the solid phase is detected. A method of adding a hybridoma culture supernatant to a solid phase to which an anti-immunoglobulin antibody or protein A is adsorbed, adding a polypeptide labeled with a radioactive substance, an enzyme, or the like, and detecting a monoclonal antibody bound to the solid phase. Is mentioned. The selection of the monoclonal antibody can be performed according to a method known per se or a method analogous thereto. Normal H
It can be performed in a medium for animal cells to which AT (hypoxanthine, aminopterin, thymidine) is added. As a selection and breeding medium, any medium can be used as long as hybridomas can grow. For example, RPMI 1640 medium containing about 1 to 20%, preferably about 10 to 20% fetal bovine serum, GIT medium containing about 1 to 10% fetal bovine serum (Wako Pure Chemical Industries, Ltd.) or hybridoma culture A serum-free medium (SFM-101, Nissui Pharmaceutical Co., Ltd.) or the like can be used. The culturing temperature is usually about 20 to 40 ° C, preferably about 37 ° C. The culturing time is usually 5 days to 3 weeks, preferably 1 week to 2 weeks. The culture can be usually performed under 5% carbon dioxide. The antibody titer of the hybridoma culture supernatant can be measured in the same manner as the measurement of the antibody titer in the antiserum described above.

(B) Purification of Monoclonal Antibody Separation and purification of the monoclonal antibody can be performed by a method known per se, for example, an immunoglobulin separation and purification method (eg, salting out method, alcohol precipitation method, isoelectric point precipitation method, electrophoresis). Method, adsorption and desorption with an ion exchanger (eg, DEAE), ultracentrifugation, gel filtration, antigen-bound solid phase or an active adsorbent such as protein A or protein G to collect only antibody and dissociate the bond. Specific Purification Method for Obtaining Antibody).

[Preparation of Polyclonal Antibody] The polyclonal antibody of the present invention can be produced according to a method known per se or a method analogous thereto. For example, an immunizing antigen (polypeptide antigen) itself or a complex thereof with a carrier protein is formed, and immunization is performed on a warm-blooded animal in the same manner as in the above-described method for producing a monoclonal antibody. It can be produced by collecting an antibody-containing substance corresponding to the salt and separating and purifying the antibody. For a complex of an immunizing antigen and a carrier protein used to immunize a warm-blooded animal,
The type of the carrier protein and the mixing ratio of the carrier and the hapten may be any type and any ratio, as long as the antibody can be efficiently cross-linked to the hapten that has been cross-linked to the carrier. A method is used in which bovine serum albumin, bovine thyroglobulin, hemocyanin and the like are coupled at a weight ratio of about 0.1 to 20, preferably about 1 to 5, with respect to 1 hapten. Also,
Various condensing agents can be used for coupling the hapten and the carrier. For example, glutaraldehyde, carbodiimide, a maleimide active ester, an active ester reagent containing a thiol group or a dithioviridyl group, or the like is used. The condensation product is administered to a warm-blooded animal itself or together with a carrier or diluent at a site where antibody production is possible. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. The administration is usually performed once every about 2 to 6 weeks, about 3 to 10 times in total. The polyclonal antibody can be collected from the blood, ascites, etc., preferably from the blood, of a warm-blooded animal immunized by the above method. The measurement of the polyclonal antibody titer in the antiserum can be performed in the same manner as the measurement of the antibody titer in the antiserum described above. The polyclonal antibody can be separated and purified according to the same method for separating and purifying immunoglobulins as in the above-described method for separating and purifying a monoclonal antibody.

DNA encoding the polypeptide of the present invention
Antisense DNA having a base sequence complementary to or substantially complementary to the DNA of the present invention (hereinafter, also referred to as the DNA of the present invention) may be complementary to or substantially complementary to the DNA of the present invention. Any antisense DNA may be used as long as it has a simple base sequence and an action capable of suppressing the expression of the DNA. The base sequence substantially complementary to the DNA of the present invention is, for example, a base sequence complementary to the DNA of the present invention (that is, a complementary strand of the DNA of the present invention).
About 70% or more, preferably about 80% or more, more preferably about 90% or more,
Most preferably, a nucleotide sequence having about 95% or more homology is exemplified. In particular, of the entire base sequence of the complementary strand of the DNA of the present invention, about 70% or more of the complementary sequence of the base sequence of the portion encoding the N-terminal portion of the polypeptide of the present invention (for example, the base sequence near the start codon). , Preferably about 80%
Antisense DNAs having a homology of at least about 90% or more, most preferably at least about 95% or more are suitable. These antisense DNAs are known DNAs.
It can be manufactured using a synthesizer or the like.

When the polypeptide of the present invention has a signal peptide, it is efficiently secreted extracellularly and exerts an important biological activity as a humoral factor for signal transmission, self-defense, and the like. As the signal peptide that the polypeptide of the present invention may have (hereinafter sometimes referred to as the signal peptide of the present invention), specifically, the same or the same as the amino acid sequence represented by SEQ ID NO: 5 Examples include polypeptides containing substantially the same amino acid sequence. Examples of the DNA encoding the signal peptide of the present invention include a DNA containing the base sequence represented by SEQ ID NO: 6, and a base sequence substantially identical to the base sequence represented by SEQ ID NO: 6. A DNA encoding a peptide having substantially the same properties (eg, immunogenicity, etc.) as the signal peptide of the present invention, or a DNA having the nucleotide sequence of SEQ ID NO: 6 under high stringent conditions. Containing a DNA that hybridizes with a DNA encoding a peptide having substantially the same properties (eg, immunogenicity, etc.) as the signal peptide of the present invention.
Any of A may be used. As the DNA containing the base sequence represented by SEQ ID NO: 6, a DNA containing the base sequence represented by SEQ ID NO: 6 and the like are used. Contains a DNA containing a nucleotide sequence substantially identical to the nucleotide sequence represented by SEQ ID NO: 6 or a DNA that hybridizes under high stringent conditions to a DNA having the nucleotide sequence represented by SEQ ID NO: 6 For example, the DNA having about 50% or more of the nucleotide sequence represented by SEQ ID NO: 6
Preferably, a DNA containing a base sequence having a homology of about 60% or more, more preferably about 70% or more, and most preferably about 80% or more is exemplified. Examples of the DNA encoding the signal peptide of the present invention having the amino acid sequence represented by SEQ ID NO: 5 include a DNA having the base sequence represented by SEQ ID NO: 6.

Hereinafter, the polypeptide of the present invention or a salt thereof (hereinafter sometimes abbreviated as the polypeptide of the present invention), a DNA encoding the polypeptide of the present invention (hereinafter abbreviated as the DNA of the present invention) ), An antibody against the polypeptide of the present invention or a salt thereof (hereinafter, sometimes abbreviated as the antibody of the present invention), and antisense D
The application of NA will be described.

Since the mature peptide of the present invention has as many as 8 cysteines (32%) in 25 amino acid residues, even if the primary structure (arrangement of amino acids) is the same as that of the mature peptide, the peptide can be synthesized by an organic chemical synthesis method. Even if it can be manufactured by
It is very difficult to accurately control the position of the SS bond after production and produce a mature peptide having the correct steric structure and the same antigenicity and biological activity as the natural form. Also, it is almost impossible to predict the correct SS bond position by calculation because the number of combinations of cysteine residues considered to contribute to the SS bond is enormous.
Therefore, it is very difficult to directly produce a biologically active mature peptide by an organic chemical synthesis method. In contrast, when a mature peptide is produced in a recombinant form via the precursor polypeptide of the present invention, it can be produced via the original biosynthetic pathway (secretory pathway of cells). , Keep the correct three-dimensional structure,
The mature peptide of the present invention having a physiological activity can be efficiently secreted extracellularly. In addition, the cost of industrial production can be reduced by using the production method of the present invention using a recombinant, as compared with the organic chemical synthesis method. As such a production method, specifically, for example, a DNA containing a base sequence encoding a polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 3 is contained. DN
A method of culturing a transformant transformed with the recombinant vector containing A to produce the polypeptide, and the like. The mature peptide of the present invention can also be produced by allowing a protease to act on the precursor polypeptide of the present invention. In this case, a mature peptide can be efficiently produced by allowing a protease to act so that cleavage occurs at a basic amino acid portion having five consecutive residues of the precursor polypeptide of the present invention. As the proteolytic enzyme used for such a purpose, for example, trypsin, chymotrypsin, arginyl endopeptidase, protein kinase, glycosidase and the like are used. Specifically, a mature peptide can be cut out by allowing a proteolytic enzyme such as trypsin, arginyl endopeptidase, or Kex2-like endoprotease that is cleaved at a basic amino acid portion to act on the precursor polypeptide of the present invention. It is.
For example, when trypsin is used, the reaction is carried out at a pH of 3 to 10, preferably 5 to 9, more preferably around 8, and the reaction temperature is 10 to 50 ° C, preferably 20 to 45 ° C. More preferably from 30 ° C to 40
React under the condition of ° C. Also, for example, when furin, which is a Kex2-like endoprotease, is used as an enzyme, the method described in Journal of Biological Chemistry (J.B.
iol. Chem.), 267, 16094-16099.
(1992).

(1) Since the polypeptide of the present invention is expressed in a tissue-specific manner, it can be used as a tissue marker. That is, it is useful as a marker for detecting tissue differentiation, disease state, cancer metastasis, and the like. It can also be used for fractionation of corresponding receptors, ligands, binding polypeptides and the like. Furthermore, it can be used as a panel for high-throughput screening known per se to examine biological activity. It can also be used for genetic disease research by performing chromosome mapping. (2) Agent for treating / preventing various diseases involving the polypeptide of the present invention Since the polypeptide of the present invention exists as a humoral factor in a living body, the polypeptide of the present invention or the DN of the present invention is present.
If A is abnormal, or is deficient, or if the expression level is abnormally decreased or enhanced, for example, opportunistic infection, sepsis, drug poisoning, tuberculosis, cancer, liver dysfunction, immune dysfunction, Various diseases such as endocrine disorders develop. Therefore, the polypeptide of the present invention and the DNA of the present invention may be used as therapeutic / prophylactic agents for various diseases such as, for example, opportunistic infections, sepsis, drug addiction, tuberculosis, cancer, liver dysfunction, immune dysfunction, and endocrine disorders. It can be used as a medicine. For example, when the polypeptide of the present invention is reduced or deficient in a living body, and there is a case where the information transmission in a cell is not sufficiently or normally performed, (a) the DNA of the present invention is given to the patient. Dosing,
By expressing the polypeptide of the present invention in vivo, (ii) inserting the DNA of the present invention into cells, expressing the polypeptide of the present invention, and then transplanting the cells into a patient; or ( C) By administering the polypeptide of the present invention to the patient, the role of the polypeptide of the present invention in the patient can be sufficiently or normally exerted. When the DNA of the present invention is used as the above-mentioned therapeutic / prophylactic agent, the DNA is inserted alone or into an appropriate vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, etc. It can be administered to humans or warm-blooded animals. The DNA of the present invention
The preparation can be administered as it is or together with a physiologically acceptable carrier such as an auxiliary for promoting uptake, and administered with a gene gun or a catheter such as a hydrogel catheter. When the polypeptide of the present invention is used as the above-mentioned therapeutic / prophylactic agent, at least 90%, preferably 9%
It is preferable to use one purified to 5% or more, more preferably 98% or more, and still more preferably 99% or more.

The polypeptides of the present invention include, for example, sugar-coated tablets, capsules, elixirs,
As a microcapsule orally, or aseptic solution with water or other pharmaceutically acceptable liquid,
Alternatively, it can be used parenterally in the form of injections such as suspensions. For example, the polypeptide of the present invention is mixed with physiologically acceptable carriers, flavors, excipients, vehicles, preservatives, stabilizers, binders, and the like, in a unit dosage form generally required for the practice of formulations. Can be manufactured. The amount of the active ingredient in these preparations is such that a proper dosage in the specified range can be obtained.
Examples of additives that can be mixed with tablets, capsules, and the like include binders such as gelatin, corn starch, tragacanth, and acacia, excipients such as crystalline cellulose, corn starch, gelatin, and alginic acid. Suitable leavening agents, lubricating agents such as magnesium stearate, sweetening agents such as sucrose, lactose or saccharin, and flavoring agents such as peppermint, reddish oil or cherry are used. When the preparation unit form is a capsule, a liquid carrier such as oil and fat can be further contained in the above-mentioned type of material. Sterile compositions for injection can be formulated according to normal pharmaceutical practice, such as dissolving or suspending the active substance in vehicles such as water for injection, and naturally occurring vegetable oils such as sesame oil, coconut oil and the like.
Examples of aqueous liquids for injection include physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.), and suitable solubilizing agents. For example, alcohols (eg, ethanol, etc.), polyalcohols (eg, propylene glycol, polyethylene glycol, etc.), nonionic surfactants (eg, Polysorbate 80 ^™ , HC
O-50). Examples of the oily liquid include sesame oil and soybean oil, and may be used in combination with benzyl benzoate, benzyl alcohol and the like as a solubilizing agent. In addition, buffers (eg, phosphate buffer, sodium acetate buffer, etc.), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, human serum albumin, polyethylene glycol, etc.), You may mix | blend with a preservative (for example, benzyl alcohol, phenol, etc.), an antioxidant, etc. The prepared injection is usually filled in an appropriate ampoule. The vector into which the DNA of the present invention has been inserted is also formulated in the same manner as described above, and is usually used parenterally.

The preparations thus obtained are safe and have low toxicity, and are therefore useful, for example, in humans or warm-blooded animals (eg, rats, mice, guinea pigs, rabbits, birds, sheep, pigs, cows, horses, cats, Dogs, monkeys, etc.). The dosage of the polypeptide of the present invention varies depending on the target disease, the administration target, the administration route, and the like.For example, opportunistic infections, sepsis, drug poisoning, tuberculosis, cancer, liver dysfunction, immune dysfunction, endocrine disorders When orally administering the polypeptide of the present invention for the purpose of treatment,
In general, for an adult (as 60 kg), the polypeptide of the present invention per day is about 1 mg to 1000 mg, preferably about 10 to 500 mg, more preferably about 10 to 500 mg.
Administer 200 mg. When administered parenterally, the single dose of the polypeptide of the present invention varies depending on the administration subject, the target disease, and the like.
Drug addiction, tuberculosis, cancer, liver dysfunction, immune dysfunction,
When the polypeptide of the present invention is administered to an adult (with a body weight of 60 kg) in the form of an injection for the treatment of endocrine disorders, etc.
About 1 to 1000 mg of the polypeptide per day,
Preferably about 1 to 200 mg, more preferably about 1 mg
It is convenient to administer by injecting about 0 to 100 mg into the affected area. In the case of other animals, the dose can be administered in terms of 60 kg.

(3) Screening of drug candidate compounds for diseases Since the polypeptide of the present invention exists as a humoral factor in the living body (particularly liver, blood, urine, etc.), a compound that promotes the activity of the polypeptide of the present invention Or a salt thereof, for example,
It can be used as a medicament such as an agent for treating or preventing opportunistic infections, sepsis, drug poisoning, tuberculosis, cancer, liver dysfunction, immune dysfunction, endocrine disorders and the like. On the other hand, the compound or its salt that inhibits the activity of the polypeptide of the present invention can be used as a medicament such as an agent for treating or preventing a disease caused by excessive production of the polypeptide of the present invention. Therefore, the polypeptide of the present invention is useful as a reagent for screening a compound or a salt thereof that promotes or inhibits the activity of the polypeptide of the present invention. That is, the present invention provides a compound or a salt thereof which promotes the activity of the polypeptide of the present invention or a salt thereof, which comprises using the polypeptide of the present invention or a salt thereof (hereinafter sometimes abbreviated as a promoter). Or a compound that inhibits the activity of the polypeptide of the present invention or a salt thereof (hereinafter may be abbreviated as an inhibitor). The screening kit of the present invention contains the polypeptide of the present invention or a salt thereof.

Compounds or salts thereof that can be obtained using the screening method or screening kit of the present invention include, for example, peptides, proteins, non-peptide compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, A compound selected from animal tissue extracts, plasma, and the like, which promotes or inhibits the activity of the polypeptide of the present invention. As the salt of the compound, those similar to the aforementioned salts of the polypeptide of the present invention are used.

When a compound obtainable by using the screening method or the screening kit of the present invention is used as the above-mentioned therapeutic / prophylactic agent, it can be carried out according to conventional means. For example, in the same manner as the drug containing the polypeptide of the present invention described above, tablets, capsules,
An elixir, microcapsule, sterile solution, suspension or the like can be used. The preparations thus obtained are safe and have low toxicity, and thus are useful, for example, in humans or warm-blooded animals (eg, mice, rats, rabbits, sheep, pigs, cows, horses, birds, cats, dogs, monkeys, etc.). Can be administered. The dosage of the compound or a salt thereof varies depending on its action, target disease, administration subject, administration route, etc., but, for example, opportunistic infection, sepsis, drug poisoning, tuberculosis, cancer, liver dysfunction, immune dysfunction When a compound that promotes the activity of the polypeptide of the present invention is orally administered for the purpose of treating endocrine disorders or the like, generally, in an adult (with a body weight of 60 kg), about 0.1 to 100 mg of the compound per day is used. , Preferably about 1.0 to 50 m
g, more preferably about 1.0-20 mg. When administered parenterally, the single dose of the compound varies depending on the administration subject, the target disease, and the like, and includes, for example, opportunistic infection, sepsis, drug poisoning, tuberculosis, cancer, liver dysfunction,
When a compound which promotes the activity of the polypeptide of the present invention for the purpose of treating immune dysfunction, endocrine disorder or the like is usually administered to an adult (as 60 kg) in the form of an injection, the compound is administered in an amount of about 0.01 to 10 mg / day. About 30 mg, preferably about 0.1
Conveniently, about 20 mg, more preferably about 0.1 to 10 mg is administered by intravenous injection. In the case of other animals, the dose can be administered in terms of 60 kg. On the other hand, when a compound that inhibits the activity of the polypeptide of the present invention is orally administered, the compound is generally administered to an adult (body weight 6).
0 kg), from about 0.1 to 100 mg, preferably from about 1.0 to 50 mg of the compound per day,
More preferably, about 1.0 to 20 mg is administered. When administered parenterally, a single dose of the compound should be administered to the subject,
Although it varies depending on the target disease and the like, a compound that inhibits the activity of the polypeptide of the present invention is usually administered in the form of an injection to an adult (60%).
kg)), the compound is administered in an amount of about 0.01 to 30 mg, preferably about 0.1 to 20 mg per day.
Conveniently, about g, more preferably about 0.1 to 10 mg, will be administered by intravenous injection. In the case of other animals, the dose can be administered in terms of 60 kg.

(4) Quantification of the polypeptide of the present invention or a salt thereof An antibody against the polypeptide of the present invention (hereinafter sometimes abbreviated as the antibody of the present invention) specifically recognizes the polypeptide of the present invention. Therefore, it can be used for quantification of the polypeptide of the present invention in a test solution, particularly for quantification by sandwich immunoassay. That is, the present invention provides (i) a reaction of the antibody of the present invention with a test solution and a labeled polypeptide of the present invention in a competitive manner, and the binding of the labeled polypeptide of the present invention to the antibody. And (ii) separating the test solution from the antibody of the present invention insolubilized on a carrier and the labeled present invention. A method for quantifying the polypeptide of the present invention in a test solution, comprising reacting the antibody of the present invention with the antibody simultaneously or successively, and then measuring the activity of the labeling agent on the insolubilized carrier.

In addition to quantification of the polypeptide of the present invention using a monoclonal antibody against the polypeptide of the present invention (hereinafter sometimes referred to as the monoclonal antibody of the present invention), detection by tissue staining or the like is also possible. You can also. For these purposes, the antibody molecule itself may be used, or F (ab ′) ₂ , Fab ′, or Fab fraction of the antibody molecule may be used. The method for quantifying the polypeptide of the present invention using the antibody of the present invention is not particularly limited, and may be an antibody, an antigen or an antibody corresponding to the amount of the antigen in the liquid to be measured (eg, the amount of the polypeptide of the present invention). Any method may be used, as long as the amount of the antigen complex is detected by chemical or physical means, and this is calculated from a standard curve prepared using a standard solution containing a known amount of the antigen. Is also good. For example, nephrometry, competitive methods,
Although an immunometric method and a sandwich method are suitably used, it is particularly preferable to use a sandwich method described later in terms of sensitivity and specificity. As a labeling agent used in a measurement method using a labeling substance, for example, a radioisotope, an enzyme, a fluorescent substance, a luminescent substance and the like are used. Examples of radioisotopes include [ ¹²⁵ I], [ ¹³¹ I], [
³ H], [ ¹⁴ C] and the like. As the above enzymes,
Those which are stable and have a large specific activity are preferred. For example, β-galactosidase, β-glucosidase, alkaline phosphatase, peroxidase, malate dehydrogenase and the like are used. As the fluorescent substance, for example, fluorescamine, fluorescein isothiocyanate and the like are used. As the luminescent substance, for example, luminol, luminol derivatives, luciferin, lucigenin and the like are used. Further, a biotin-avidin system can be used for binding the antibody or antigen to the labeling agent.

For insolubilization of antigen or antibody,
Physical adsorption may be used, or a method using a chemical bond usually used for insolubilizing and immobilizing a polypeptide or an enzyme may be used. Examples of the carrier include insoluble polysaccharides such as agarose, dextran, and cellulose; synthetic resins such as polystyrene, polyacrylamide, and silicon; and glass. In the sandwich method, the test solution is reacted with the insolubilized monoclonal antibody of the present invention (primary reaction), and further reacted with another labeled monoclonal antibody of the present invention (secondary reaction). By measuring the activity of the labeling agent, the amount of the polypeptide of the present invention in the test solution can be determined. The primary reaction and the secondary reaction may be performed in the reverse order, may be performed simultaneously, or may be performed at staggered times. The labeling agent and the method of insolubilization can be in accordance with those described above. In the immunoassay by the sandwich method, the antibody used for the solid phase antibody or the labeling antibody is not necessarily one kind, and a mixture of two or more kinds of antibodies is used for the purpose of improving measurement sensitivity and the like. You may. In the method for measuring the polypeptide of the present invention by the sandwich method of the present invention, the monoclonal antibody of the present invention used in the primary reaction and the secondary reaction is preferably an antibody having a different binding site to the polypeptide of the present invention. Can be That is, the antibody used in the primary reaction and the secondary reaction is preferably used, for example, when the antibody used in the secondary reaction recognizes the C-terminal of the polypeptide of the present invention. Is an antibody that recognizes other than the C-terminal, for example, the N-terminal.

The monoclonal antibody of the present invention can be used in a measurement system other than the sandwich method, for example, a competition method, an immunometric method, a nephelometry and the like. In the competition method, an antigen in a test solution and a labeled antigen are allowed to react competitively with an antibody, and then the unreacted labeled antigen is reacted.
(F) and the labeled antigen (B) bound to the antibody are separated (B / F separation), the amount of labeling of either B or F is measured, and the amount of antigen in the test solution is quantified. In this reaction method, a soluble antibody is used as the antibody, B / F separation is performed using polyethylene glycol, a liquid phase method using a second antibody against the antibody, or a solid phase antibody is used as the first antibody, or
A solid-phase method using a soluble antibody as the first antibody and using a solid-phased antibody as the second antibody is used. In the immunometric method, an antigen in a test solution and a solid-phased antigen are subjected to a competitive reaction with a fixed amount of a labeled antibody, and then the solid phase and the liquid phase are separated. Is reacted with an excess amount of the labeled antibody, and then the immobilized antigen is added to bind the unreacted labeled antibody to the solid phase, and then the solid phase and the liquid phase are separated. Next, the amount of label in any phase is measured to determine the amount of antigen in the test solution. In nephelometry, the amount of insoluble precipitates generated as a result of an antigen-antibody reaction in a gel or in a solution is measured. Even when the amount of antigen in the test solution is small and only a small amount of sediment is obtained, laser nephrometry utilizing laser scattering is preferably used.

In applying these individual immunological measurement methods to the quantification method of the present invention, no special conditions, operations, and the like need to be set. What is necessary is just to construct the measuring system of the polypeptide of this invention, adding the usual technical consideration of those skilled in the art to the usual conditions and operation methods in each method. For details of these general technical means, reference can be made to reviews and books. For example, Hiroe Irie, "Radio Immunoassay" (Kodansha, published in 1974), Hiroshi Irie, "Radio Immunoassay" (Kodansha, published in 1974), Eiji Ishikawa et al., "Enzyme Immunoassay" (Medical Shoin, Showa Ed. Ishikawa et al., “Enzyme Immunoassay” (Second Edition) (Issue Shoin, 1982) Published in 1962, "Methods in ENZYMOLOGY" Vol. 70 (Immunochem
ical Techniques (Part A)), ibid.Vol. 73 (Immunochem
ical Techniques (Part B)), ibid.Vol. 74 (Immunochem
ical Techniques (Part C)), ibid.Vol. 84 (Immunochem
ical Techniques (Part D: Selected Immunoassays)),
Ibid.Vol. 92 (Immunochemical Techniques (Part E: Mono
clonal Antibodies and General Immunoassay Method
s)), ibid.Vol. 121 (Immunochemical Techniques (Part
I: Hybridoma Technology and Monoclonal Antibodie
s)) (above, issued by Academic Press) and the like. As described above, the polypeptide of the present invention can be quantified with high sensitivity by using the antibody of the present invention. Furthermore, when a decrease in the concentration of the polypeptide of the present invention is detected by quantifying the concentration of the polypeptide of the present invention using the antibody of the present invention, for example, opportunistic infection, sepsis, drug poisoning, tuberculosis, , Cancer, liver dysfunction, immune dysfunction, endocrine disorders, etc., or a high possibility of illness in the future.
Further, the antibody of the present invention can be used for detecting the polypeptide of the present invention present in a subject such as a body fluid or a tissue. In addition, preparation of an antibody column used for purifying the polypeptide of the present invention, detection of the polypeptide of the present invention in each fraction at the time of purification, analysis of the behavior of the polypeptide of the present invention in test cells, etc. Can be used for

(5) Gene Diagnostic Agent The DNA of the present invention can be used, for example, as a probe to produce a human or warm-blooded animal (eg, rat, mouse, guinea pig, rabbit, bird, sheep, pig, bovine,
DNA or mRNA abnormalities (genetic abnormalities) encoding the polypeptide of the present invention in horses, cats, dogs, monkeys, etc.) can be detected.
Or mRNA damage, mutation or decreased expression,
It is useful as a diagnostic agent for a gene such as increase or excessive expression of the DNA or mRNA. The above-mentioned genetic diagnosis using the DNA of the present invention can be performed, for example, by the known Northern hybridization or PCR-SSCP method (Genomics, Vol. 5, p. 874-879 (1989)).
Years), Proceedings of the National Academy of Sciences of the National Academy of Sciences of USA
the United States of America), Vol. 86, 276
6 to 2770 (1989)). For example, when a decrease in expression is detected by Northern hybridization or a mutation in DNA is detected by PCR-SSCP method, for example, opportunistic infection, sepsis, drug poisoning, tuberculosis, cancer, liver dysfunction, It can be diagnosed that there is a high possibility that the disease is a dysfunction or endocrine disorder.

(6) Pharmaceuticals Containing Antisense DNA The antisense DNA capable of binding to the DNA of the present invention complementarily and suppressing the expression of the DNA is a polypeptide of the present invention in vivo or the present invention. Can be used as, for example, an agent for treating or preventing a disease caused by excessive expression of the polypeptide of the present invention. The above-mentioned antisense DNA can be used as the above-mentioned therapeutic / prophylactic agent in the same manner as the aforementioned therapeutic / prophylactic agent for various diseases containing the DNA of the present invention. For example, the antisense DNA can be administered alone or after being inserted into an appropriate vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, or the like, and then used in a conventional manner. The antisense DNA can be administered as it is or in the form of a formulation together with a physiologically acceptable carrier such as an adjuvant for promoting uptake, and then administered using a gene gun or a catheter such as a hydrogel catheter. Furthermore, the antisense DNA can also be used as a diagnostic oligonucleotide probe for examining the presence or expression of the DNA of the present invention in tissues or cells.

(7) Pharmaceuticals Containing Antibody of the Present Invention Antibodies of the present invention having an activity of neutralizing the activity of the polypeptide of the present invention include, for example, diseases caused by excessive expression of the polypeptide of the present invention (eg, , Liver dysfunction, liver cancer, etc.). The therapeutic / prophylactic agent for the above-mentioned diseases containing the antibody of the present invention can be used directly as a liquid or as a pharmaceutical composition in an appropriate dosage form as a human or mammal (eg, rat, rabbit, sheep, pig, cow, cat, Dogs, monkeys, etc.) orally or parenterally. The dose varies depending on the administration subject, target disease, symptoms, administration route and the like.
About 01-20 mg / kg body weight, preferably 0.1-1
0 mg / kg body weight, more preferably 0.1 to 5 m
g / kg body weight about 1 to 5 times a day, preferably 1
It is convenient to administer by intravenous injection about 1 to 3 times a day. In the case of other parenteral administration and oral administration, an equivalent amount can be administered. If the symptoms are particularly severe, the dose may be increased according to the symptoms. The antibodies of the present invention can be administered as such or as a suitable pharmaceutical composition. The pharmaceutical composition used for the administration contains the above or a salt thereof and a pharmacologically acceptable carrier, diluent or excipient. Such compositions are provided in dosage forms suitable for oral or parenteral administration. That is, for example, compositions for oral administration include solid or liquid dosage forms, specifically tablets (including sugar-coated tablets and film-coated tablets), pills, granules, powders, capsules (soft capsules and the like). Syrup, emulsion, suspension and the like. Such a composition is produced by a method known per se and contains a carrier, diluent or excipient commonly used in the field of formulation.
For example, lactose, starch, sucrose, magnesium stearate and the like are used as carriers and excipients for tablets.

As a composition for parenteral administration, for example, injections, suppositories and the like can be used.
It includes dosage forms such as subcutaneous injections, intradermal injections, intramuscular injections, and infusions. Such injections are prepared according to a method known per se, for example, by dissolving, suspending or emulsifying the antibody or a salt thereof in a sterile aqueous or oily liquid commonly used for injections. Examples of the aqueous liquid for injection include, for example, physiological saline, isotonic solution containing glucose and other auxiliary agents, and a suitable solubilizing agent, for example,
Alcohol (eg, ethanol), polyalcohol (eg,
Propylene glycol, polyethylene glycol), nonionic surfactant [eg, polysorbate 80, HCO-
50 (polyoxyethylene (50mol) adduct of hydrogen
ated castor oil)]. As the oily liquid, for example, sesame oil, soybean oil, and the like are used, and benzyl benzoate, benzyl alcohol, and the like may be used in combination as a solubilizing agent. The prepared injection is usually filled in an appropriate ampoule. Suppositories to be used for rectal administration are prepared by mixing the above antibody or a salt thereof with a conventional suppository base. The above-mentioned oral or parenteral pharmaceutical composition is conveniently prepared in a unit dosage form so as to be compatible with the dosage of the active ingredient. Examples of such dosage unit dosage forms include tablets, pills, capsules, injections (ampoules), suppositories and the like.
~ 100mg, 10 ~ 250mg for other dosage forms
It is preferable that the above-mentioned antibody is contained in a degree. Each of the above-mentioned compositions may contain another active ingredient as long as the composition does not cause an undesirable interaction with the above-mentioned antibody.

(8) DNA-Transferred Animal The present invention relates to a DNA encoding an exogenous polypeptide of the present invention (hereinafter abbreviated as the exogenous DNA of the present invention) or a mutant DNA thereof (the exogenous mutant DNA of the present invention) Which may be abbreviated as such). That is, the present invention provides (1) a non-human mammal having the exogenous DNA of the present invention or a mutant DNA thereof, (2) the animal according to (1), wherein the non-human mammal is a rodent, (3)
(2) The animal according to (2), wherein the rodent is a mouse or a rat; and (4) a recombinant vector containing the exogenous DNA of the present invention or a mutant DNA thereof and capable of being expressed in a mammal. . Exogenous DNA of the present invention
Or a non-human mammal having the mutant DNA thereof (hereinafter, referred to as
The DNA-transferred animal of the present invention is preferably used for embryos in non-human mammals, such as embryos including unfertilized eggs, fertilized eggs, spermatozoa and their progenitor cells, and more preferably at the stage of embryo development (more preferably At the stage of single cells or fertilized egg cells and generally before the 8-cell stage), calcium phosphate method, electric pulse method, lipofection method, aggregation method, microinjection method, particle gun method, DEA
It can be produced by transferring the target DNA by the E-dextran method or the like. The DNA
By the transfer method, the exogenous DNA of the present invention can be transferred to somatic cells, organs of living organisms, tissue cells, and the like, and used for cell culture, tissue culture, and the like. The DNA-transferred animal of the present invention can also be produced by fusing with a cell fusion method known per se.

Non-human mammals include, for example, bovine,
Pigs, sheep, goats, rabbits, dogs, cats, guinea pigs, hamsters, mice, rats and the like are used. Above all, rodents, which are relatively short in ontogeny and biological cycle in terms of preparation of disease animal model systems, and are easy to breed, especially mice (for example, C57B as a pure strain,
As a hybrid line such as L / 6 line and DBA2 line, B6C3
F ₁ system, BDF ₁ system, B6D2F ₁ system, BALB /
c strain, ICR strain, etc.) or rat (eg, Wis
tar, SD, etc.). As a `` mammal '' in a recombinant vector that can be expressed in mammals,
In addition to the above non-human mammals, humans and the like can be mentioned. The exogenous DNA of the present invention refers to the DNA of the present invention once isolated and extracted from a mammal, not the DNA of the present invention originally possessed by a non-human mammal. Mutant DN of the present invention
A is a DNA having a mutation (for example, mutation) in the base sequence of the original DNA of the present invention, specifically, a DNA having a base added, deleted, substituted with another base, or the like. And also includes abnormal DNA. The abnormal DNA includes DN which expresses an abnormal polypeptide of the present invention.
A means, for example, a DNA or the like that expresses a polypeptide that suppresses the function of the normal polypeptide of the present invention. The exogenous DNA of the present invention may be derived from a mammal which is the same or different from the animal of interest. In transferring the DNA of the present invention to a target animal, it is generally advantageous to use the DNA as a DNA construct linked downstream of a promoter capable of being expressed in animal cells. For example, when the human DNA of the present invention is transferred, DN derived from various mammals (eg, rabbits, dogs, cats, guinea pigs, hamsters, rats, mice, etc.) having the DNA of the present invention having high homology thereto is used.
The DNA of the present invention is obtained by microinjecting a DNA construct (eg, a vector, etc.) in which the human DNA of the present invention is bound downstream of various promoters capable of expressing A into a fertilized egg of a target mammal, for example, a mouse fertilized egg. A DNA-transferred mammal that highly expresses can be produced.

Examples of the expression vector of the polypeptide of the present invention include a plasmid derived from Escherichia coli, a plasmid derived from Bacillus subtilis, a plasmid derived from yeast, a bacteriophage such as λ phage, a retrovirus such as Moloney leukemia virus, a vaccinia virus or a baculovirus. And the like. Among them, a plasmid derived from Escherichia coli, a plasmid derived from Bacillus subtilis or a plasmid derived from yeast are preferably used. Examples of the promoter for controlling the DNA expression include, for example, promoters of DNAs derived from viruses (eg, simian virus, cytomegalovirus, Moloney leukemia virus, JC virus, breast cancer virus, poliovirus, etc.);
Promoters derived from various mammals (human, rabbit, dog, cat, guinea pig, hamster, rat, mouse, etc.), for example, albumin, insulin II, uroplakin II, elastase, erythropoietin, endothelin, muscle creatine kinase, glial fibrillary acidic protein Glutathione S-transferase, platelet-derived growth factor β, keratins K1, K10 and K14, collagen types I and II, cyclic AMP-dependent protein kinase β I subunit, dystrophin, tartrate-resistant alkaline phosphatase, atrial natriuretic factor, Endothelial receptor tyrosine kinase (generally abbreviated as Tie2), sodium potassium adenosine 3 kinase (Na, K-ATPase), neurofilament light chain, Tarothionine I and IIA,
Metalloproteinase 1 tissue inhibitor, MHC class I antigen (H-2L), H-ras, renin, dopamine β-hydroxylase, thyroid peroxidase (TP
O), polypeptide elongation factor 1α (EF-1α), β
Actin, α and β myosin heavy chains, myosin light chains 1 and 2, myelin basic protein, thyroglobulin, T
hy-1, immunoglobulin, heavy chain variable region (VNP), serum amyloid P component, myoglobin, troponin C, smooth muscle α-actin, promoter such as preproenkephalin A, vasopressin and the like are used. Among them, a cytomegalovirus promoter capable of high expression throughout the body, human polypeptide chain elongation factor 1α
(EF-1α) promoter, human and chicken β
Actin promoters and the like are preferred.

The vector preferably has a sequence (generally called terminator) that terminates transcription of the messenger RNA of interest in the DNA-transferred mammal. And preferably a Simian virus SV40 terminator or the like. In addition, a splicing signal of each DNA for the purpose of further expressing the desired foreign DNA,
It is also possible to link an enhancer region, a part of an intron of eukaryotic DNA, etc. 5 'upstream of the promoter region, between the promoter region and the translation region, or 3' downstream of the translation region. The translation region can be prepared as a DNA construct that can be expressed in a transgenic animal by a conventional DNA engineering technique in which the translation region is ligated downstream of the promoter and, if desired, upstream of the transcription termination site. Exogenous DNA of the invention at the fertilized egg cell stage
Is ensured to be present in all germ cells and somatic cells of the target mammal. The presence of the exogenous DNA of the present invention in the germinal cells of the produced animal after the DNA transfer means that all the progeny of the produced animal retain the exogenous DNA of the present invention in all of the germ cells and somatic cells. means. The progeny of such animals that have inherited the exogenous DNA of the present invention have the exogenous DNA of the present invention in all of their germinal and somatic cells.

The non-human mammal to which the exogenous normal DNA of the present invention has been transferred is confirmed to stably retain the exogenous DNA by mating, and is subcultured as an animal having the DNA in an ordinary breeding environment. I can do it. Transfer of the exogenous DNA of the present invention at the fertilized egg cell stage is ensured to be present in excess in all germ cells and somatic cells of the target mammal. Excessive presence of the exogenous DNA of the present invention in germ cells of a produced animal after DNA transfer means that all offspring of the produced animal have an excessive amount of the exogenous DNA of the present invention in all of their germ cells and somatic cells. Means The offspring of such an animal inheriting the exogenous DNA of the present invention will have the exogenous DNA of the present invention in all of its germinal and somatic cells.
In excess. By obtaining a homozygous animal having the introduced DNA on both homologous chromosomes and breeding the male and female animals, it is possible to breed and pass all the offspring so as to have the DNA in excess. The non-human mammal having the normal DNA of the present invention has a high level of expression of the normal DNA of the present invention, and eventually promotes the function of the endogenous normal DNA, so that the hyperactivity of the polypeptide of the present invention is finally increased. May develop and can be used as a disease model animal. For example, using the normal DNA transgenic animal of the present invention, elucidation of the hyperfunction of the polypeptide of the present invention and the pathological mechanism of a disease associated with the polypeptide of the present invention, and examination of a method for treating these diseases. It is possible. Further, since the mammal into which the exogenous normal DNA of the present invention has been transferred has an increased symptom of the released polypeptide of the present invention, it is also used for a screening test for a therapeutic drug for a disease associated with the polypeptide of the present invention. It is possible.

On the other hand, a non-human mammal having the foreign abnormal DNA of the present invention should be subcultured in a normal breeding environment as an animal having the DNA after confirming that the foreign DNA is stably maintained by mating. Can be done. Furthermore, the desired foreign DNA can be incorporated into the above-described plasmid and used as a source material. The DNA construct with the promoter can be prepared by a usual DNA engineering technique. Abnormal D of the present invention at the fertilized egg cell stage
NA transfer is ensured to be present in all germinal and somatic cells of the target mammal. The presence of the abnormal DNA of the present invention in the germinal cells of the produced animal after DNA transfer means that all the offspring of the produced animal have the abnormal DNA of the present invention in all of its germ cells and somatic cells. The offspring of such animals that have inherited the exogenous DNA of the present invention have the abnormal DNA of the present invention in all of their germinal and somatic cells. A homozygous animal having the introduced DNA on both homologous chromosomes is obtained, and by crossing these male and female animals, it is possible to breed so that all offspring have the DNA. In the non-human mammal having the abnormal DNA of the present invention, the abnormal DNA of the present invention is highly expressed, and the function of the polypeptide of the present invention is ultimately inactivated by inhibiting the function of endogenous normal DNA. It can be a type refractory disease and can be used as a disease model animal. For example, using the abnormal DNA-transferred animal of the present invention, it is possible to elucidate the pathological mechanism of the function-inactive refractory of the polypeptide of the present invention and to examine a method for treating this disease. Also, as a specific possibility, the abnormal DNA highly expressing animal of the present invention can inhibit the function of the normal polypeptide by the abnormal polypeptide of the present invention (domi
nant negative action). Also,
Since the mammal to which the foreign abnormal DNA of the present invention has been transferred has an increased symptom of the released polypeptide of the present invention, it can also be used for a therapeutic drug screening test for functional inactive refractory of the polypeptide of the present invention. It is.

Other possible uses of the above two DNA-transferred animals of the present invention include, for example, use as a cell source for tissue culture, and DNA or R in the tissues of the DNA-transferred animal of the present invention.
Analysis of the relationship with polypeptides specifically expressed or activated by the polypeptide of the present invention by directly analyzing NA or analyzing polypeptide tissue expressed by DNA; Tissue having DNA The cells are cultured by standard tissue culture techniques and used to study the function of cells from tissues that are generally difficult to culture, screening for agents that enhance cell function by using the cells described above, and Isolation and purification of the mutant polypeptide of the present invention and production of its antibody can be considered. Furthermore, using the DNA-transferred animal of the present invention, it is possible to examine the clinical symptoms of diseases related to the polypeptide of the present invention, including the inactive refractory type of the polypeptide of the present invention, and the like. More detailed pathological findings in each organ of a disease model related to the polypeptide of the present invention can be obtained, which can contribute to the development of a new treatment method, and further to the study and treatment of a secondary disease caused by the disease. Further, each organ is taken out from the DNA-transferred animal of the present invention, and after shredding,
By using a polypeptide (protein) -degrading enzyme such as trypsin, it is possible to obtain free DNA-transferred cells, culture them, or systematize the cultured cells. Furthermore, it is possible to examine the specificity of the polypeptide-producing cell of the present invention, its relationship with apoptosis, differentiation or proliferation, or the signal transduction mechanism thereof, and to investigate the abnormalities thereof. It is an effective research material for elucidation. Further, the DN of the present invention
In order to develop a therapeutic agent for a disease associated with the polypeptide of the present invention, including a functionally inactive refractory type of the polypeptide of the present invention, using the A-transposed animal, The method can be used to provide an effective and rapid screening method for a therapeutic agent for the disease. In addition, using the transgenic animal of the present invention or the exogenous DNA expression vector of the present invention, it is possible to examine and develop a DNA treatment method for a disease associated with the polypeptide of the present invention.

(9) Knockout Animal The present invention provides a non-human mammalian embryonic stem cell in which the DNA of the present invention is inactivated and a non-human mammal deficient in expression of the DNA of the present invention. That is, the present invention provides (1) a non-human mammalian embryonic stem cell in which the DNA of the present invention has been inactivated,
(2) the embryonic stem cell according to (1), wherein the DNA is inactivated by introducing a reporter gene (eg, a β-galactosidase gene derived from Escherichia coli); (4) The embryonic stem cell according to (1), wherein the non-human mammal is a rodent, (5) the embryonic stem cell according to (4), wherein the rodent is a mouse, 6) a non-human mammal deficient in expression of the DNA in which the DNA of the present invention is inactivated; (7) the DNA is inactivated by introducing a reporter gene (eg, a β-galactosidase gene derived from Escherichia coli); The non-human mammal according to (6), wherein the reporter gene can be expressed under the control of a promoter for the DNA of the present invention,
(8) The non-human mammal according to (6), wherein the non-human mammal is a rodent, (9) the non-human mammal according to (8), wherein the rodent is a mouse, and (10) D) administering the test compound to the animal described in (7) and detecting the expression of the reporter gene;
A method for screening a compound or a salt thereof that promotes or inhibits a promoter activity for NA is provided.

A non-human mammalian embryonic stem cell in which the DNA of the present invention has been inactivated is defined as a DNA obtained by artificially mutating the DNA of the present invention in the non-human mammal to suppress the expression ability of the DNA. Alternatively, by substantially losing the activity of the polypeptide of the present invention encoded by the DNA, the DNA does not substantially have the ability to express the polypeptide of the present invention (hereinafter referred to as the knockout DNA of the present invention). Non-human mammalian embryonic stem cells (may be referred to as)
(Abbreviated as ES cell). As the non-human mammal, the same one as described above is used. Examples of a method for artificially mutating the DNA of the present invention include, for example, deletion of part or all of the DNA sequence by genetic engineering,
It can be carried out by inserting or substituting another DNA. By these mutations, for example, the knockout DN of the present invention is shifted by shifting the codon reading frame or disrupting the function of the promoter or exon.
A may be prepared. Specific examples of the non-human mammalian embryonic stem cells in which the DNA of the present invention has been inactivated (hereinafter abbreviated as the DNA-inactivated ES cells of the present invention or the knockout ES cells of the present invention) include, for example, The DNA of the present invention possessed by a non-human mammal is isolated, and a drug resistance gene represented by a neomycin resistance gene, a hygromycin resistance gene or lacZ
Inserting a reporter gene such as (β-galactosidase gene) or cat (chloramphenicol acetyltransferase gene), etc., destroys the function of exons, or terminates the transcription of genes in the introns between exons. A DNA sequence (hereinafter abbreviated as a targeting vector) having a DNA sequence constructed so as to insert a DNA sequence (for example, a polyA addition signal or the like) so that complete messenger RNA cannot be synthesized, resulting in gene disruption. Is introduced into the chromosome of the animal by, for example, a homologous recombination method, and the obtained ES cells are subjected to Southern hybridization analysis using a DNA sequence at or near the DNA of the present invention as a probe or a DNA sequence on a targeting vector. And ta The DNA sequence of the neighboring region other than the DNA of the present invention used in Getting vector production was analyzed by PCR method using a primer, can be to select the knockout ES cell of the present invention.

Further, the DN of the present invention may be
As the ES cells from which A is inactivated, for example, those already established as described above may be used.
It may be newly established according to the method of Evans and Kaufma. For example, in the case of mouse ES cells, currently, 129 line ES cells are generally used. However, since the immunological background is not clear, a pure line instead of this is used as an immunological genetic background. For example, C57BL / 6 mice or C57BL / 6 mice for the purpose of obtaining ES cells in which
BDF ₁ mice a lack of egg collection number was improved by crossing with DBA / 2 of (F ₁ of C57BL / 6 and DBA / 2)
Those established by using the method can also be used favorably. Since the BDF ₁ mouse has the advantage that the number of eggs collected is large and the eggs are robust, it has C57BL / 6 mice as a background,
The ES cells obtained by using this can be used for backcrossing (backcross) with C57BL / 6 mice when a pathological model mouse is created, whereby the genetic background can be changed to C57BL / 6 mice. It can be used advantageously. In addition, when ES cells are established, blastocysts 3.5 days after fertilization are generally used. In addition, a large number of blastocysts can be obtained efficiently by collecting 8-cell stage embryos and culturing them up to blastocysts. Early embryos can be obtained. In addition, E
Although S cells may be used, male ES cells are generally more convenient for producing germline chimeras. It is also desirable to discriminate between males and females as soon as possible in order to reduce cumbersome culture labor. As a method for determining the sex of ES cells, for example, a method of amplifying and detecting a gene in the sex-determining region on the Y chromosome by PCR can be mentioned. By using this method, the number of ES cells of about 1 colony (about 50 cells) is sufficient, whereas the conventional method required about 10 ⁶ cells for karyotype analysis. The primary selection of ES cells in the early stage can be performed by discriminating between male and female, and by enabling selection of male cells at an early stage, labor in the initial stage of culture can be greatly reduced.

The secondary selection can be performed, for example, by confirming the number of chromosomes by the G-banding method. The number of chromosomes in the obtained ES cells is desirably 100% of the normal number. However, when it is difficult due to physical operations or the like at the time of establishment, after knocking out the gene of the ES cells, the cells can be knocked out of normal cells (for example, chromosome in mice). Number is 2n
= Cells). The embryonic stem cell line obtained in this way usually has very good growth properties, but must be carefully subcultured because it tends to lose its ontogenetic ability. For example, on suitable feeder cells such as STO fibroblasts, in the presence of LIF (1-10000 U / ml) in a carbon dioxide incubator (preferably about 5% carbon dioxide, about 95% air or about 5% oxygen). About 5% carbon dioxide, about 90% air)
The cells are cultured by a method such as culturing at 7 ° C., and at the time of subculture, for example, a trypsin / EDTA solution (usually about 0.001 to
A single cell is obtained by treatment with 5% trypsin / about 0.1-5 mM EDTA (preferably, about 0.1% trypsin / about 1 mM EDTA), and the cells are seeded on freshly prepared feeder cells. Such passages are usually 1-3
It is carried out every day. At this time, it is desirable to observe the cells and, if any morphologically abnormal cells are found, discard the cultured cells. ES cells are differentiated into various types of cells such as parietal muscle, visceral muscle, myocardium, etc. by appropriate conditions under monolayer culture up to high density or by suspension culture until cell clumps are formed. [MJ Evans and MH Kaufman, Nature (Na
292), 154, 1981; GR Martin Proceedings of National Academy of
Science USA (Proc. Natl. Acad. Sci.
USA) 78, 7634, 1981; TC Doetschman
Et al., Journal of Embryology and Experimental Morphology, Vol. 87, p. 27, 19
85 years], the cells deficient in expressing the DNA of the present invention obtained by differentiating the ES cells of the present invention are useful in in vitro cell biological studies of the polypeptide of the present invention.
The non-human mammal deficient in DNA expression of the present invention comprises
By measuring the amount of RNA using a known method and indirectly comparing the expression level, it is possible to distinguish the normal animal from normal animals. As the non-human mammal, those similar to the aforementioned can be used.

The non-human mammal deficient in expression of the DNA of the present invention can be prepared, for example, by introducing the targeting vector prepared as described above into mouse embryonic stem cells or mouse egg cells,
By knocking out the DNA of the present invention, the DNA sequence in which NA has been inactivated is replaced with the DNA of the present invention on the chromosome of mouse embryonic stem cells or mouse egg cells by gene homologous recombination. it can. A cell in which the DNA of the present invention has been knocked out is a DNA sequence of the present invention derived from the mouse used in the targeting vector, the DNA sequence of the DNA of the present invention or a DNA sequence of the targeting vector, or a DNA sequence on or near the DNA of the present invention. The determination can be made by analysis by a PCR method using the DNA sequence of a nearby region other than DNA as a primer. When a non-human mammalian embryonic stem cell is used, a cell line in which the DNA of the present invention has been inactivated by gene homologous recombination is cloned, and the cell is cultured at an appropriate time, for example, at the 8-cell stage of a non-human mammalian stem cell. The chimeric embryo is injected into an animal embryo or blastocyst, and the produced chimeric embryo is transplanted into the uterus of the pseudopregnant non-human mammal. The produced animal is a chimeric animal comprising both cells having the normal DNA locus of the present invention and cells having the artificially mutated DNA locus of the present invention. When a part of the germ cells of the chimeric animal has a mutated DNA locus of the present invention, all tissues are artificially mutated from a population obtained by crossing such a chimeric individual with a normal individual. D of the present invention added
It can be obtained by selecting individuals composed of cells having NA loci, for example, by judging coat color. The individual thus obtained is usually an individual heterozygously deficient in expression of the polypeptide of the present invention, and mated with an individual heterozygously deficient in expression of the polypeptide of the present invention. Can be obtained. When using an egg cell, for example, a transgenic non-human mammal having a targeting vector introduced into a chromosome can be obtained by injecting a DNA solution into a nucleus of an egg cell by a microinjection method, and these transgenic non-human mammals can be obtained. Compared to mammals, they can be obtained by selecting those having a mutation in the DNA locus of the present invention by homologous recombination.

In the case of an individual knocked out of the DNA of the present invention in this manner, the animal individual obtained by mating should be confirmed to have knocked out the DNA, and bred in an ordinary breeding environment. Can be. further,
The germline can be obtained and maintained in accordance with a conventional method. That is, by crossing male and female animals having the inactivated DNA, homozygous animals having the inactivated DNA on both homologous chromosomes can be obtained. The obtained homozygous animals were compared to normal animals 1
It can be obtained efficiently by breeding in a state where a plurality of homozygotes are formed. By mating male and female heterozygous animals, homozygous and heterozygous animals having the inactivated DNA are bred and passaged. The non-human mammalian embryonic stem cells in which the DNA of the present invention has been inactivated are extremely useful for producing a non-human mammal deficient in expressing the DNA of the present invention. In addition, the DN of the present invention
Since a non-human mammal deficient in A expression lacks various biological activities that can be induced by the polypeptide of the present invention, it can serve as a model for a disease caused by inactivation of the biological activity of the polypeptide of the present invention. It is useful for investigating the causes of these diseases and examining treatment methods.

(9a) A method for screening a compound having a therapeutic / preventive effect against diseases caused by DNA deficiency or damage of the present invention The non-human mammal deficient in expression of the DNA of the present invention comprises
Used for screening compounds that have therapeutic and / or preventive effects on diseases caused by NA deficiency or damage (opportunistic infections, sepsis, drug addiction, tuberculosis, cancer, liver dysfunction, immune dysfunction, endocrine disorders, etc.) be able to. That is, the present invention is characterized by administering a test compound to a non-human mammal deficient in expressing the DNA of the present invention, and observing and measuring a change in the animal. Provided is a method for screening a compound or a salt thereof having a therapeutic / prophylactic effect against a disease. The non-human mammal deficient in expressing DNA of the present invention used in the screening method includes the same ones as described above. Test compounds include, for example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, plasma and the like, and these compounds are novel compounds. May be
Known compounds may be used. Specifically, the D of the present invention
Treating a non-human mammal deficient in NA expression with a test compound;
Compared to an untreated control animal, the therapeutic / preventive effect of the test compound can be tested using changes in the organs, tissues, disease symptoms and the like of the animal as indices. As a method of treating a test animal with a test compound, for example, oral administration, intravenous injection and the like are used, and it can be appropriately selected according to the symptoms of the test animal, the properties of the test compound, and the like. The dose of the test compound can be appropriately selected according to the administration method, properties of the test compound, and the like. For example, when screening for a compound having a therapeutic / preventive effect on liver dysfunction, a toxic load treatment is performed on a non-human mammal deficient in expressing DNA of the present invention, and a test compound is administered before or after the toxic load treatment, The detoxifying action and weight change of the animal are measured over time.

Compounds that can be obtained by using the screening method of the present invention are compounds selected from the above-mentioned test compounds, and are diseases (such as opportunistic infections, sepsis, It has a therapeutic / prophylactic effect against drug poisoning, tuberculosis, cancer, liver dysfunction, immune dysfunction, endocrine disorders, etc., and can be used as a safe and low toxic therapeutic / prophylactic agent for such diseases. it can. Further, compounds derived from the compounds obtained by the above screening can be used in the same manner. The compound obtained by the screening method may form a salt, and the salt of the compound may include a physiologically acceptable acid (eg, inorganic acid, organic acid) and a base (eg, alkali metal). Are used, and especially preferred are physiologically acceptable acid addition salts. Such salts include:
For example, inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid,
Sulfuric acid) or organic acids (eg, acetic acid, formic acid,
Salts with propionic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid, etc. are used.
A medicament containing the compound or a salt thereof obtained by the screening method can be produced in the same manner as the aforementioned medicament containing the polypeptide of the present invention. The preparations obtained in this way are safe and have low toxicity, and are therefore useful, for example, in humans or mammals (eg, rats, mice, guinea pigs, rabbits, sheep, pigs, cows, horses, cats,
Dogs, monkeys, etc.). The dose of the compound or a salt thereof varies depending on the target disease, the administration subject, the administration route, and the like. For example, when the compound is orally administered for the purpose of treating an inflammatory disease, it is generally used for an adult (with a body weight of 60 kg). )), The compound is used in an amount of about 0.1 to 100 mg, preferably about 1.0 to 50 mg per day.
mg, more preferably about 1.0-20 mg. When administered parenterally, the single dose of the compound varies depending on the administration subject, the target disease, and the like, and includes, for example, opportunistic infection, sepsis, drug poisoning, tuberculosis, cancer, liver dysfunction, immune dysfunction. When the compound is usually administered to an adult (as 60 kg) in the form of an injection for the treatment of endocrine disorders and the like, the compound is about 0.01 to 30 mg, preferably about 0.1 to 20 mg per day. And more preferably about 0.1 to 10 mg by intravenous injection. In the case of other animals, the dose can be administered in terms of 60 kg.

(9b) Method for Screening Compound Promoting or Inhibiting the Activity of Promoter for DNA of the Present Invention The present invention relates to a non-human mammal deficient in expression of the DNA of the present invention.
The present invention provides a method for screening a compound or a salt thereof that promotes or inhibits the activity of a promoter for DNA of the present invention, which comprises administering a test compound and detecting the expression of a reporter gene. In the above-mentioned screening method, the non-human mammal deficient in expression of DNA of the present invention may be a non-human mammal deficient in expressing DNA of the present invention in which the DNA of the present invention is inactivated by introducing a reporter gene, A reporter gene that can be expressed under the control of a promoter for the DNA of the present invention is used. Examples of the test compound include the same compounds as described above. As the reporter gene, the same one as described above is used, and a β-galactosidase gene (lacZ), a soluble alkaline phosphatase gene, a luciferase gene and the like are preferable. DNA of the present invention in which the DNA of the present invention is replaced with a reporter gene
In a non-human mammal deficient in expression, since the reporter gene is under the control of the promoter for the DNA of the present invention, the activity of the promoter can be detected by tracing the expression of the substance encoded by the reporter gene.

For example, when a part of the DNA region encoding the polypeptide of the present invention is replaced with a β-galactosidase gene (lacZ) derived from Escherichia coli, the tissue which expresses the polypeptide of the present invention should Β-galactosidase is expressed instead of the polypeptide of the invention. Therefore, for example, by staining with a reagent serving as a substrate for β-galactosidase, such as 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal), it is easy to perform the staining. The expression state of the polypeptide of the present invention in an animal body can be observed. Specifically, the polypeptide-deficient mouse of the present invention or a tissue section thereof is fixed with glutaraldehyde or the like, washed with phosphate buffered saline (PBS), and then stained with X-gal,
After reacting at room temperature or around 37 ° C. for about 30 minutes to 1 hour, the β-galactosidase reaction may be stopped by washing the tissue sample with a 1 mM EDTA / PBS solution, and coloration may be observed. In addition, according to a conventional method, la
The mRNA encoding cZ may be detected.

The compound or a salt thereof which can be obtained by the above-mentioned screening method is a compound selected from the above-mentioned test compounds, and is a compound which promotes or inhibits the promoter activity for the DNA of the present invention. The compound obtained by the screening method may form a salt, and the salt of the compound may be a salt with a physiologically acceptable acid (eg, an inorganic acid) or a base (eg, an organic acid). Are used, and physiologically acceptable acid addition salts are particularly preferable. Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) Acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used. The compound or a salt thereof that promotes the promoter activity of the DNA of the present invention can promote the expression of the polypeptide of the present invention and promote the function of the polypeptide. For example, opportunistic infection, sepsis, drug poisoning It is useful as a medicament such as a safe and low toxic therapeutic / prophylactic agent for diseases such as tuberculosis, cancer, liver dysfunction, immune dysfunction, and endocrine disorders. Further, compounds derived from the compounds obtained by the above screening can be used in the same manner.

A drug containing the compound or a salt thereof obtained by the screening method can be produced in the same manner as the above-mentioned drug containing the polypeptide of the present invention or a salt thereof. The preparations obtained in this way are safe and have low toxicity, for example, humans or mammals (eg, rats, mice, guinea pigs, rabbits, sheep,
Pig, cow, horse, cat, dog, monkey, etc.). The dose of the compound or a salt thereof,
Although there are differences depending on the target disease, administration target, administration route, etc., for example, opportunistic infection, sepsis, drug poisoning, tuberculosis,
When orally administering the compound of the present invention which promotes the promoter activity to DNA for the purpose of treating cancer, liver dysfunction, immune dysfunction, endocrine disorder, etc., generally in adults (with a body weight of 60 kg) per day, About 0.1 to 100 mg, preferably about 1.0 to 50 mg of the compound,
More preferably, about 1.0 to 20 mg is administered. When administered parenterally, a single dose of the compound should be administered to the subject,
For example, the DNA of the present invention may be used for the treatment of opportunistic infections, sepsis, drug addiction, tuberculosis, cancer, liver dysfunction, immune dysfunction, endocrine disorders, etc.
When a compound that promotes the promoter activity of the compound is administered to an adult (as 60 kg) in the form of an injection, the compound is administered in an amount of about 0.01 to 30 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 20 mg per day. Is about 0.1 ~
It is convenient to administer about 10 mg by intravenous injection. In the case of other animals, the dose can be administered in terms of 60 kg. On the other hand, for example, the DNA of the present invention
When orally administering a compound that inhibits the promoter activity of the compound, it is generally about 0.1 to 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 50 mg of the compound per day in an adult (with a body weight of 60 kg). About 1.0
Administer ~ 20 mg. When administered parenterally, the single dose of the compound varies depending on the administration subject, target disease and the like, but the compound of the present invention which inhibits the promoter activity for DNA is usually administered in the form of an injection to an adult (60 kg). )), The compound is administered in an amount of about 0.01 per day.
About 30 mg, preferably about 0.1 to 20 mg,
More preferably, about 0.1 to 10 mg is administered by intravenous injection. For other animals, 60
An amount converted per kg can be administered.

As described above, the non-human mammal deficient in expression of the DNA of the present invention is extremely useful for screening for a compound or a salt thereof that promotes or inhibits the activity of the promoter for the DNA of the present invention. It can greatly contribute to investigating the cause of various diseases caused by expression deficiency or developing preventive and therapeutic drugs. Furthermore, since the gene encoding the polypeptide of the present invention is expressed in a very large amount in mice and humans, particularly in the liver, the promoter sequence of the gene should not target the target protein (such as any useful gene product). It is convenient as a promoter for expressing a large amount in the liver of a human warm-blooded animal. Examples of the non-human warm-blooded animal include those similar to those exemplified above as the warm-blooded animal. That is, the present invention provides a target protein (any useful gene) downstream (3 'end) of a promoter region of a gene encoding a polypeptide characterized by containing the amino acid sequence represented by SEQ ID NO: 1. The present invention provides a method for expressing a target protein (such as any useful gene product) in a liver predominantly in a non-human warm-blooded animal by ligating the non-human animal and the product into a non-human animal. Examples of the target protein (eg, any useful gene product) include cytokines (eg, interleukins, interferons, chemokines, hematopoietic factors), growth factors (eg, EGF (epidermal growth factor)).
Or a substance having substantially the same activity as that (eg, EGF, hallegulin (HER2 ligand), etc.), insulin or a substance having substantially the same activity as that (eg, insulin, IGF (insulin-like growth facto)).
r) -1, IGF-2 etc.), FGF (fibroblast growth facto)
r) or those having substantially the same activity as it (for example, aFGF, bFGF, KGF (Keratindcyte Growth Facto
r), HGF (Hepatocyte Growth Factor), FGF-10, etc.) and other cell growth factors (for example, CSF (colony stimulatin)
g factor), EPO (erythropoietin), IL-2 (interleukin
-2), NGF (nerve growth factor), PDGF (platelet-der
ived growth factor), TGFβ (transforming growth f
actorβ)) etc.), hormones (eg, luteinizing hormone releasing hormone (LH-RH), growth hormone, growth hormone releasing hormone (GH-RH), prolactin, melanocyte stimulating hormone, thyroid hormone releasing hormone, thyroid stimulating hormone, lutein Forming hormone, progestin,
Follicle stimulating hormone, gastrin, motilin, somatostatin, secretin, glucagon, PACAP, VIP
Digestive enzymes (eg, amylase, pepsinogen, lipase, etc.), antibodies against pathogens (eg, antibodies against pathogenic bacteria such as pathogenic Salmonella, antibodies against pathogenic viruses such as influenza, antibodies against parasites such as echinococcus) And useful gene products such as antibacterial polypeptides (eg, cecropin, histatin, indolicidin, protegrin, defensin, lysozyme, etc.). Of the above-mentioned target proteins, by specifically expressing cytokines in the liver, for example, enhancement and regulation of immune activity in non-human warm-blooded animals can be achieved. By expressing antimicrobial peptides in the liver, for example, Increased resistance of human warm-blooded animals to various infectious diseases can be achieved.

The target protein (arbitrarily useful gene) is located downstream (3'-terminal) of the promoter region of the gene encoding the polypeptide characterized by containing the amino acid sequence represented by SEQ ID NO: 1. Product or the like) and ligated with DNA or RNA, and introduced into a non-human animal to introduce the target protein (any useful gene product or the like)
Is more specifically described as to a method for specifically expressing E. coli in the liver of a non-human warm-blooded animal. First, a promoter of a gene encoding a polypeptide characterized by containing the amino acid sequence represented by SEQ ID NO: 1 can be obtained by a method known per se such as colony hybridization, plaque hybridization, or PCR (for example, molecular・
Cloning (Molecular Cloning) 2nd (J. Sambrook
et al., Cold Spring Harbor Lab. Press, 1989). The region having promoter activity can be identified by a method known per se such as a reporter assay (for example, Analytical Biochemistry, 188).
Vol., P. 245 (1990)). Next, in order to ligate the target protein (any useful gene product or the like) downstream (3 ′ end) of the promoter obtained by the above method, a method known per se for constructing a plasmid using T4 DNA ligase is used. Methods (eg, molecular cloning (Molecula
r Cloning) 2nd (J. Sambrook et al., Cold Spring H
The purpose can be achieved by the method described in arbor Lab. Press, 1989). In order to introduce a DNA encoding the target protein (any useful gene product or the like) downstream (3 ′ end) of the promoter into a non-human warm-blooded animal, a method using electroporation, A method using a gun, a method using a retroviral vector (for example, Blood Cell
s), vol. 17, p. 407 (1991)),
There is a method using an adenovirus vector (for example, the method described in Pathology, vol. 30, p. 335 (1998)) and the like.

In the present specification and drawings, when bases, amino acids and the like are represented by abbreviations, IUPAC-IUB Co.
This is based on the abbreviation by mmision on Biochemical Nomenclature or the abbreviation commonly used in the art, examples of which are described below. When an amino acid can have an optical isomer, the L-form is indicated unless otherwise specified. DNA: deoxyribonucleic acid cDNA: complementary deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine RNA: ribonucleic acid mRNA: messenger ribonucleic acid dATP: deoxyadenosine triphosphate dTTP: deoxythymidine triphosphate dGTP: deoxyguanosine triphosphate Phosphate dCTP: Deoxycytidine triphosphate ATP: Adenosine triphosphate EDTA: Ethylenediaminetetraacetic acid SDS: Sodium dodecyl sulfate

Gly or G: glycine Ala or A: alanine Val or V: valine Leu or L: leucine Ile or I: isoleucine Ser or S: serine Thr or T: threonine Cys or C: cysteine Met or M: thione E: glutamic acid Asp or D: aspartic acid Lys or K: lysine Arg or R: arginine His or H: histidine Phe or F: phenylalanine Tyr or Y: tyrosine Trp or W: tryptophan Pro or P: pron Asn or proline Asn Or Q: glutamine pGlu: pyroglutamic acid Xaa: any amino acid other than cysteine

The substituents, protecting groups and reagents frequently used in the present specification are represented by the following symbols. Me: methyl group Et: ethyl group Bu: butyl group Ph: phenyl group TC: thiazolidine -4 (R) - carboxamide group Tos: p-toluenesulfonyl CHO: formyl Bzl: benzyl Cl ₂ -Bzl: 2,6-dichlorobenzyl Bom: benzyloxymethyl Z: benzyloxycarbonyl Cl-Z: 2-chlorobenzyloxycarbonyl Br-Z: 2-bromobenzyloxycarbonyl Boc: t-butoxycarbonyl DNP: dinitrophenyl Trt: trityl Bum: t-butoxymethyl Fmoc : N-9-fluorenylmethoxycarbonyl HOBt: 1-hydroxybenztriazole HOOBT: 3,4-dihydro-3-hydroxy-4-oxo-1,2,3-benzotriazine HONB: 1-hydroxy-5 -Norbornene-2,3-dicarboximide DCC: N, N'-dicyclohexylcarbodiimide

The sequence numbers in the sequence listing in the present specification indicate the following sequences. [SEQ ID NO: 1] This shows the amino acid sequence of the human precursor polypeptide of the present invention. [SEQ ID NO: 2] DNA encoding human precursor polypeptide having amino acid sequence represented by SEQ ID NO: 1
Shows the nucleotide sequence of [SEQ ID NO: 3] This shows the amino acid sequence of the human precursor polypeptide of the present invention. [SEQ ID NO: 4] DNA encoding human precursor polypeptide having amino acid sequence represented by SEQ ID NO: 3
Shows the nucleotide sequence of [SEQ ID NO: 5] This shows the amino acid sequence of the signal sequence contained in the human precursor polypeptide having the amino acid sequence represented by SEQ ID NO: 1. [SEQ ID NO: 6] This shows the base sequence of DNA encoding the signal sequence having the amino acid sequence represented by SEQ ID NO: 5. [SEQ ID NO: 7] This shows the amino acid sequence of the humanized mature polypeptide of the present invention. [SEQ ID NO: 8] DNA encoding human mature polypeptide having amino acid sequence represented by SEQ ID NO: 7
Shows the nucleotide sequence of [SEQ ID NO: 9] This shows the amino acid sequence of the mouse precursor polypeptide of the present invention. [SEQ ID NO: 10] D encoding a mouse precursor polypeptide having the amino acid sequence represented by SEQ ID NO: 9
Shows the base sequence of NA. [SEQ ID NO: 11] This shows the amino acid sequence of the mouse precursor polypeptide of the present invention. [SEQ ID NO: 12] This shows the base sequence of DNA encoding the mouse precursor polypeptide having the amino acid sequence represented by SEQ ID NO: 11. [SEQ ID NO: 13] This shows the amino acid sequence of the mature mouse polypeptide of the present invention. [SEQ ID NO: 14] This shows the base sequence of DNA encoding the mature mouse polypeptide having the amino acid sequence represented by SEQ ID NO: 13. [SEQ ID NO: 15] This shows the amino acid sequence of the mouse precursor polypeptide of the present invention. [SEQ ID NO: 16] This shows the base sequence of DNA encoding the mouse precursor polypeptide having the amino acid sequence represented by SEQ ID NO: 15. [SEQ ID NO: 17] This shows the amino acid sequence of the mouse precursor polypeptide of the present invention. [SEQ ID NO: 18] This shows the base sequence of DNA encoding the mouse precursor polypeptide having the amino acid sequence represented by SEQ ID NO: 17. [SEQ ID NO: 19] This shows the amino acid sequence of the mature mouse polypeptide of the present invention. [SEQ ID NO: 20] This shows the base sequence of DNA encoding the mature mouse polypeptide having the amino acid sequence represented by SEQ ID NO: 19. [SEQ ID NO: 21] This shows the amino acid sequence of the rat precursor polypeptide of the present invention. [SEQ ID NO: 22] This shows the base sequence of DNA encoding the rat precursor polypeptide having the amino acid sequence represented by SEQ ID NO: 21. [SEQ ID NO: 23] This shows the amino acid sequence of the rat precursor polypeptide of the present invention. [SEQ ID NO: 24] This shows the base sequence of DNA encoding the rat precursor polypeptide having the amino acid sequence represented by SEQ ID NO: 23. [SEQ ID NO: 25] This shows the amino acid sequence of the rat mature polypeptide of the present invention. [SEQ ID NO: 26] This shows the base sequence of DNA encoding the mature mouse polypeptide having the amino acid sequence represented by SEQ ID NO: 25. [SEQ ID NO: 27] This shows the amino acid sequence of the mature polypeptide of the present invention. [SEQ ID NO: 28] This shows the base sequence of the primer used in EXAMPLE 2. [SEQ ID NO: 29] This shows the base sequence of the primer used in EXAMPLE 2. [SEQ ID NO: 30] This shows the amino acid sequence of the mature polypeptide of the present invention. [SEQ ID NO: 31] This shows the amino acid sequence of the mature polypeptide of the present invention. [SEQ ID NO: 32] This shows the base sequence of the primer used in EXAMPLE 5. [SEQ ID NO: 33] This shows the base sequence of the primer used in EXAMPLE 5. [SEQ ID NO: 34] This shows the base sequence of the primer used in EXAMPLE 5.

The transformant Escherichia coli XL10-Gold / pDRL8 obtained in Example 2 described later.
4vH has been deposited with the National Institute of Advanced Industrial Science and Technology (NIBH) on August 2, 1999 under the deposit number FER.
MBP-6810, deposited on July 21, 1999 with the Institute of Fermentation (IFO) under the deposit number IFO16
No. 298.

EXAMPLES The present invention will be described below in detail with reference to examples, but the present invention is not limited thereto.
Gene manipulation using Escherichia coli is performed by molecular
The method described in Molecular cloning was followed.

Example 1 Discovery of Human Precursor Polypeptide from Genetic Information Database From the publicly available genetic information database, a signal sequence for secretion and an identical open reading frame (ORF) Basic amino acid pair (Arg-
As a result of searching for a sequence containing both Arg and Lys-Arg), a sequence derived from chromosome 19 was found in the human gene sequence. In order to confirm whether the mRNA containing the present gene sequence is actually transcribed and whether the expected ORF is correct, the same EST database supplied from SmithKline Beecham (SB) was used. A clone having the sequence was searched. As a result, it was found that HGS: 416104, HGS: 699764, and the like were present, and it was confirmed that the present gene product was actually transcribed. In addition, the nucleotide sequence of the EST sequence was clarified, which revealed that it was a novel precursor polypeptide.

Example 2 Cloning of cDNA Encoding Human Precursor Polypeptide cDNA encoding human precursor polypeptide was obtained by RT-PCR using poly (A) ⁺ RNA derived from human liver.
Was cloned. Human liver-derived poly (A) ⁺ RNA (C
lontech) 1 μg with poly (T) following restriction enzyme site
chored primer-SuperscriptII MMLV reverse transcriptase (Gib
After synthesizing 1st strand cDNA using co-BRL, OR of human precursor polypeptide estimated from human genome sequence
Primer before and after F, 5 'CAGTGGGACAGCCAGACAGACGG
3 '(SEQ ID NO: 28), and 5' CAGGGCAGGTAGGTTCTA
RT-PCR was performed using CGTCTT 3 '(SEQ ID NO: 29) to obtain a 297 bp DNA containing the ORF of the human precursor polypeptide.
A cDNA fragment was obtained (FIG. 1). This cDNA fragment encoded a human precursor polypeptide consisting of 84 amino acids including a typical signal sequence of 22 or 24 amino acid residues. This DNA fragment was introduced into pCR2.1-TOPO and pDRL84
vH was obtained. Plasmid pDRL84vH was transformed into E. coli (Escherich
ia coli) XL10-Gold strain to obtain a transformant Escherichia coli XL10-Gold / pDRL84vH.

Example 3 Analysis of Expression Site 20 ng of the inserted DNA fragment (EcoRI-EcoRI 0.3 kb fragment) described in Example 2 and 5 μm of [α- ³² P] dCTP (Amersham: 6000 Ci / mmol)
l using Multiprime DNA labeling system (Amersham:
RPN.1601Y) to prepare a DNA probe. Using this probe, human multi-tissue northern blot (CLONTECH: # 7759-1, # 7760-1) and human RN
Hybridization was performed on an A master blot (CLONTECH: # 7770-1). Hybridization and washing conditions were in accordance with the attached manual.
This was performed using 2000 (Fuji Film). As a result, it was found that the mRNA of this clone was specifically expressed in a large amount in the liver (adult and fetus), and it was revealed that the mRNA was specifically expressed in the organ. The size of the mRNA was about 0.6 kb.

Example 4 Mouse and Rat Polypeptides The amino acid sequence (SEQ ID NO: 1) and the base sequence (SEQ ID NO: 2) of the human peptide precursor were determined using a query sequence.
ce), and homology search was performed using blast on the public database. As a result, the sequences of the mouse and rat mature polypeptides corresponding to the human mature polypeptide were revealed as follows. . Mouse type mature polypeptide 1 (SEQ ID NO: 13): Asp Thr Asn Phe Pro Ile Cys Ile Phe Cys Cys Lys Cy
Cys Asn Asn Ser GlnCys Gly Ile Cys Lys Thr Mouse-type mature polypeptide 2 (SEQ ID NO: 19): Asp Ile Asn Phe Pro Ile Cys Arg Phe Cys Cys Gln Cy
Cys Asn Lys Pro SerCys Gly Ile Cys Cys Glu Glu Rat-type mature polypeptide (SEQ ID NO: 25): Asp Thr Asn Phe Pro Ile Cys Leu Phe Cys Cys Lys Cy
s Cys Lys Asn Ser SerCys Gly Leu Cys Cys Ile Thr In addition, regardless of the animal species, the above mature polypeptide is obtained after the excision sequence in which five basic amino acids (Arg and Lys) in the precursor are aligned. , And the mature peptide was excised. Furthermore, the position of the eight cysteine residues in the mature peptide is
It was revealed that the amino acid sequence was conserved and existed at the position in the amino acid sequence represented by SEQ ID NO: 27. Xaa Xaa Xaa Xaa Xaa Xaa Cys Xaa Xaa Cys Cys Xaa Cy
s Cys Xaa Xaa Xaa XaaCys Xaa Xaa Cys Cys Xaa Xaa
(SEQ ID NO: 27)

Example 5 Construction of Expression Vector for Human Polypeptide An expression vector for expressing a human polypeptide in animal cells encodes a human precursor polypeptide.
The DNA fragment containing ORF is transferred to an animal cell expression vector pCA.
Constructed by insertion into N618. First, a synthetic DNA [5'-TCGGAATTCA] was designed using the inserted DNA fragment (EcoRI-EcoRI 0.3 kb fragment) described in Example 2 as a template and a restriction enzyme EcoRI recognition site immediately before the translation initiation codon.
CGATGGCACTGAGCTCCCAGATCTGG-3 ′: (SEQ ID NO: 3
2)] and the restriction enzyme Xh at the C-terminus of the humanized polypeptide.
Synthetic DNA [5'-ACGCT designed to have oI recognition site
CGAGCTACGTCTTGCAGCACATCCCACA-3 ': (SEQ ID NO: 3
3)] was used to perform PCR. Premix T for PCR reaction
Using aq (Ex Taq Version) (Takara), extension reaction was performed at 96 ° C for 30 seconds, 94 ° C for 30 seconds, 68 ° C for 2 minutes 25 times, and then at 72 ° C for 7 minutes to perform human-type precursor polypeptide. A DNA fragment of about 0.29 kb containing the ORF was obtained. In addition, a FLAG sequence (Asp-Tyr-Lys-Asp-Asp-Asp-) was added to the C-terminus of the human precursor polypeptide.
Asp-Asp-Lys) was added to obtain the ORF with the synthetic DNA [5'-TCGGAATTCACGATGGCACTGAGCTCCCAGATCTGG-
3 ′: (SEQ ID NO: 32)] and C of human polypeptide
Synthetic DNA [5'-ACGCTCGAGTTACTTGTCATCGTCGTCCT designed to have a FLAG sequence and XhoI recognition site at the end
TGTAGTCCGTCTTGCAGCACATCCCACACTT-3 ': (SEQ ID NO:
34)] was used to perform PCR. Premix for PCR reaction
Using Taq (Ex Taq Version) (Takara), extension reaction was performed at 96 ° C for 30 seconds, 94 ° C for 30 seconds, 68 ° C for 2 minutes 25 times, and then at 72 ° C for 7 minutes, and a DNA fragment of about 0.3kb was obtained. I got These DNA fragments are digested with restriction enzymes EcoRI and XhoI, and pCAN
PCAN84vH and pCAN84vH-FL Expression vectors for human polypeptides in animal cells inserted into 618 EcoRI / SalI sites
AG (with FLAG) was obtained.

Example 6 Expression of human polypeptide in COS7 cells COS7 cells 1.2 × 10 ⁵ cells were cultured in 10-well plates using a 6-well plate.
The cells were cultured in Dulbecco's modified minimal medium (DMEM) containing 5% fetal bovine serum (FBS) for 24 hours, and 1 μg of the above expression plasmid (pCAN84vH-FLAG) was added to Effectene (QIAGE
N). After 24 hours from the introduction, the medium was replaced with a fresh medium. After another 6 hours, DMEM without FBS (GibcoB
After culturing for 48 hours instead of RL), culture supernatant and cells were obtained by centrifugation. To obtain a cell extract, wash cells twice with phosphate buffered saline (PBS) containing
Dissolution extraction was performed by adding a DS sample buffer. In order to concentrate the culture supernatant, acetic acid was added to the culture supernatant of COS7 cells to a final concentration of 1 M, and Sep-Pak was equilibrated with 1 M acetic acid.
After passing through a C18 column (Waters), the column was washed with 1 M acetic acid and eluted with 80% acetonitrile and 0.05% TFA. The eluate was dried under reduced pressure and redissolved in SDS sample buffer. This sample and the above cell extract were fractionated by 16% SDS-polyacrylamide gel electrophoresis (Peptide-PAGE; TEFCO) and transferred to a PVDF membrane (Amersham) by a semi-dried lot method. Next, apply PVDF membrane with Block Ace (Snow Brand Milk Products)
Treat for 1 hour at room temperature, then add PBS containing 0.05% Tween 20 (P
BS-T) in anti-FLAG monoclonal antibody (10μg / m
l; Kodak) for 1 hour. After washing twice with PBS-T, the plate was further reacted with a horseradish peroxidase-labeled anti-mouse IgG goat antibody (Amersham; 5000-fold dilution) for 1 hour in PBS-T. After washing 5 times with PBS-T, the expression product was detected using ECLplus color development kit (Amersham) and ECL film (Amersham). As a result, it was confirmed that the gene product was secreted into the culture supernatant. From the comparison with the molecular weight marker, the mature peptide (about 3.8 k
Da) was found to be secreted into the culture supernatant.

Example 7 Expression of Human Polypeptide in CHO Cells Chinese Hamster Ovary Cells
ary Cell, CHO-K1) was cultured in Dulbecco's modified minimal medium (DMEM) containing 10% fetal bovine serum (FBS), and 1 μg of the above expression plasmid (pCAN84vH) was added to Effectene (QIAGEN).
Introduce using. Then, 200 μg / ml of G was added to the same culture solution.
After culturing in a medium containing 418, surviving cells (transformed cells into which the expression plasmid has been introduced) are selected. The obtained G418-resistant CHO cells are cultured in the above culture medium or Dulbecco's modified minimal medium (DMEM) transiently free of fetal bovine serum (FBS) to produce a gene product (human polypeptide). Obtain the culture supernatant.

[0098]

The polypeptide of the present invention and the DNA encoding the same are useful for the diagnosis, treatment and prevention of, for example, opportunistic infections, sepsis, drug addiction, tuberculosis, cancer, liver dysfunction, immune dysfunction, endocrine dysfunction and the like. Can be used for
Further, the polypeptide of the present invention is useful as a reagent for screening a compound or a salt thereof that promotes or inhibits the activity of the polypeptide of the present invention. further,
Since an antibody against the polypeptide of the present invention can specifically recognize the polypeptide of the present invention, it can be used for detection, quantification, neutralization, and the like of the polypeptide of the present invention in a test solution. Further, by using the promoter of the present invention, proteins (any useful gene products, etc.)
Can be expressed predominantly (preferably specifically) in large amounts in the liver of non-human warm-blooded animals, and can contribute to the field of gene therapy.

[0099]

[Sequence List] <110> Takeda Chemical Industries, Ltd. <120> Novel Protein and its DNA <150> JP 11-262228 <151> 1999-09-16 <160> 34 <210> 1 <211> 84 <212 > PRT <213> Human <400> 1 Met Ala Leu Ser Ser Gln Ile Trp Ala Ala Cys Leu Leu Leu Leu Leu 1 5 10 15 Leu Leu Ala Ser Leu Thr Ser Gly Ser Val Phe Pro Gln Gln Thr Gly 20 25 30 Gln Leu Ala Glu Leu Gln Pro Gln Asp Arg Ala Gly Ala Arg Ala Ser 35 40 45 Trp Met Pro Met Phe Gln Arg Arg Arg Arg Arg Asp Thr His Phe Pro 50 55 60 Ile Cys Ile Phe Cys Cys Gly Cys Cys His Arg Ser Lys Cys Gly Met 65 70 75 80 Cys Cys Lys Thr 84 <210> 2 <211> 297 <212> DNA <213> Human <400> 2 CAGTGGGACA GCCAGACAGA CGGCACGATG GCACTGAGCT CCCAGATCTG GGCCGCTTGC 60 CTCCTGCTCC TCCTCCCCAGCTCACGTCGATCCTCGTCGATCCTCGTCGATCCTCGTCGATCCTCGTCGATCCTCGTCCATCGATCGCCGCTCACGCGCTCATCGACGCTCACGCGCTCATCGCCGCTCATCGCTCGATCCATCGGCTCACGTCGACGCTCATCGCTCCGCTCACGCGCTCACGTCCATCGCTCGATCCACGGGCTCACGTCCTCGTCCACGCGCTCACGTCGACGTCCACGTCCACGTCCACGTCGACGTCCACGTCGACGTCCACGTCCACGTCGACGTCCACGTCGACGTCCACGTCGACGTCCACGTCCACGTCGACGTCCACGTCGACGTCCACGTCCATC Att at CCAGGGCCAG CTGGATGCCC 180 ATGTTCCAGA GGCGAAGGAG GCGAGACACC CACTTCCCCA TCTGCATTTT CTGCTGCGGC 240 TGCTGTCATC GATCAAAGTG TGGGATGTGC TGCAAGACGT AGAACCTACC TGCCCTG 297 <210> 3 <211> 60 <212> PRT <213> Human <400> 3 Ser Val Phe Pro Gln Gln Thr Gly Gln Leu Ala Glu Leu Gln Pro Gln 1 5 10 15 Asp Arg Ala Gly Ala Arg Ala Ser Trp Met Pro Met Phe Gln Arg Arg 20 25 30 Arg Arg Arg Asp Thr His Phe Pro Ile Cys Ile Phe Cys Cys Gly Cys 35 40 45 Cys His Arg Ser Lys Cys Gly Met Cys Cys Lys Thr 50 55 60 <210> 4 <211> 180 <212> DNA <213> Human <400> 4 TCTGTTTTCC CACAACAGAC GGGACAACTT GCAGAGCTGC AACCCCAGGA CAGAGCTGGA 60 GCCAGGGCCA GCTGGATGCC CATGTTCCAG AGGCGAAGGA GGCGAGACAC CCACTTCCCC 120 ATCTGCATTT TCTGCTGCGG CTGCTGTCAT CGATCAAAGT GTGGGATGTG CTGCAAGACG 180 <210> 5 <211> 24 <212> PRT <la> Ser <A> G Leu Leu Leu Leu 1 5 10 15 Leu Leu Ala Ser Leu Thr Ser Gly 20 24 <210> 6 <211> 72 <212> DNA <213> Human <400> 6 ATGGCACTGA GCTCCCAGAT CTGGGCCGCT TGCCTCCTGC TCCTCCTCCT CCTCGCCAGC 60 CTGACCAGTG GC 72 <210 > 7 <211> 25 <212> PRT <213> Human <400> 7 Asp Thr His Phe Pro Ile Cys Ile Phe Cys Cys Gly Cys Cys His Arg 5 10 15 Ser Lys Cys Gly Met Cys Cys Lys Thr 20 25 <210 > 8 <211> 75 <212> DNA <213> Human <400> 8 GACACCCACT TCCCCATCTG CATTTTCTGC TGCGGCTGCT GTCATCGATC AAAGTGTGGG 60 ATGTGCTGCA AGACG 75 <210> 9 <211> 84 <212> PRT <213> Mouse <400> 9 Met Met Ala Leu Ser Thr Arg Thr Gln Ala Ala Cys Leu Leu Leu Leu 1 5 10 15 Leu Leu Ala Ser Leu Ser Ser Thr Thr Tyr Leu His Gln Gln Met Arg 20 25 30 Gln Thr Thr Glu Leu Gln Pro Leu His Gly Glu Glu Ser Arg Ala Asp 35 40 45 Ile Ala Ile Pro Met Gln Lys Arg Arg Lys Arg Asp Thr Asn Phe Pro 50 55 60 Ile Cys Ile Phe Cys Cys Lys Cys Cys Asn Asn Ser Gln Cys Gly Ile 65 70 75 80 Cys Cys Lys Thr 84 < 210> 10 <211> 252 <212> DNA <213> Mouse <400> 10 ATGATGGCAC TCAGCACTCG GACCCAGGCT GCCTGTCTCC TGCTTCTCCT CCTTGCCAGC 60 CTGAGCAGCA CCACCTATCT CCATCAACAG ATGAGACAGA CTACAGAGCT GCAGCCTTTG 120 CACGGGGAAG AAAGCAGGGC AGACATTGCG ATACCAATGC AGAAGAGAAG GAAGAGAGAC 180 ACCAACTTCC CCATCTGCAT CTTCTGCTGT AAATGCTGTA ACAATTCCCA GTGTGGTATC 240 TGTTGCAAAA CA 252 <210> 11 <211> 60 <212> PRT <213> Mouse <400> 11 Thr Tyr Leu His Gln Gln Met Arg Gln Th r Thr Glu Leu Gln Pro Leu 1 5 10 15 His Gly Glu Glu Ser Arg Ala Asp Ile Ala Ile Pro Met Gln Lys Arg 20 25 30 Arg Lys Arg Asp Thr Asn Phe Pro Ile Cys Ile Phe Cys Cys Lys Cys 35 40 45 Cys Asn Asn Ser Gln Cys Gly Ile Cys Cys Lys Thr 50 55 60 <210> 12 <211> 180 <212> DNA <213> Mouse <400> 12 ACCTATCTCC ATCAACAGAT GAGACAGACT ACAGAGCTGC AGCCTTTGCA CGGGGAAGAA 60 AGCAGGGCAG ACATTGCGAT ACCAATTCAGAGAGAGTCAG ATGCTGTAAC AATTCCCAGT GTGGTATCTG TTGCAAAACA 180 <210> 13 <211> 25 <212> PRT <213> Mouse <400> 13 Asp Thr Asn Phe Pro Ile Cys Ile Phe Cys Cys Lys Cys Cys Asn Asn 5 10 15 Ser Gln Cys Gly Ile Cys Cys Lys Thr 20 25 <210> 14 <211> 75 <212> DNA <213> Mouse <400> 14 GACACCAACT TCCCCATCTG CATCTTCTGC TGTAAATGCT GTAACAATTC CCAGTGTGGT 60 ATCTGTTGCA AAACA 75 <210> 15 <211> 84 <212> PRT <213> Mouse <400> 15 Met Met Ala Leu Ser Thr Arg Thr Gln Ala Ala Cys Leu Leu Leu Leu 1 5 10 15 Leu Leu Ala Ser Leu Ser Ser Thr Thr Tyr Leu Gln Gln Gln Met Arg 20 25 30 Gln T hr Thr Glu Leu Gln Pro Leu His Gly Glu Glu Ser Arg Ala Asp 35 40 45 Ile Ala Ile Pro Met Gln Lys Arg Arg Lys Arg Asp Ile Asn Phe Pro 50 55 60 Ile Cys Arg Phe Cys Cys Gln Cys Cys Asn Lys Pro Ser Cys Gly Ile 65 70 75 80 Cys Cys Glu Glu 84 <210> 16 <211> 252 <212> DNA <213> Mouse <400> 16 ATGATGGCAC TCAGCACTCG GACCCAGGCT GCCTGTCTCC TGCTTCTCCT CCTTGCCAGC 60 CTGAGCAGGCCCACCTATCT CCAGCAACAG ATGAGACAGATCGATCGATCGATCGATCAGCAGCAGCATCAGCAGCAGCATCAGCAGCAGGATCCAGCAGGATCCAGCAGGATCCAGCAGGATCCAGCAGGATCCAGCAGGATCCAGCAGGATCCAGCAGGATCCAGCAGGATCGACGACGATCGATCAGCAGCAGGATCCAGCAGCATCGATCCAGCAGGATCCAGCAGGATCCAGCAGGATCCAGCAGCATCGATCCAGCAGCATCGCAGCATCAGCTCAGCAGCATCGCAGCATCAGCTCACGCATCAGCTCACGCATCAGCATCAGCAGCAGCATCGCAGCACGATCATCAG AGAAGAGAAG GAAGAGAGAC 180 ATCAACTTCC CCATCTGCAG ATTCTGCTGT CAGTGCTGTA ACAAACCCTC CTGTGGTATC 240 TGTTGTGAAG AA 252 <210> 17 <211> 60 <212> PRT <213> Mouse <400> 17 Thr Tyr Leu Gln Gln Gln Met Arg Gln Thr Thr Glu Leu 5 10 15 His Gly Glu Glu Ser Arg Ala Asp Ile Ala Ile Pro Met Gln Lys Arg 20 25 30 Arg Lys Arg Asp Ile Asn Phe Pro Ile Cys Arg Phe Cys Cys Gln Cys 35 40 45 Cys Asn Lys Pro Ser Cys Gly Ile Cys Cys Glu Glu 50 55 60 <210> 18 <211> 180 <212> DNA <213> Mouse <400> 18 ACCTATCTCC AGCAACAGAT GAGACAGACT ACAGAGCT GC AGCCTTTGCA CGGGGAAGAA 60 AGCAGGGCAG ACATTGCGAT CCCAATGCAG AAGAGAAGGA AGAGAGACAT CAACTTCCCC 120 ATCTGCAGAT TCTGCTGTCA GTGCTGTAAC AAACCCTCCT GTGGTATCTG TTGTGAAGAA 180 <210> 19 <211> 25 <212> PRT <213he Is Ple <As> Pe <E> Asn Cys Cys Asn Lys 5 10 15 Pro Ser Cys Gly Ile Cys Cys Glu Glu 20 25 <210> 20 <211> 75 <212> DNA <213> Mouse <400> 20 GACATCAACT TCCCCATCTG CAGATTCTGC TGTCAGTGCT GTAACAAACC CTCCTGTGGT 60 ATCTGTTGTG AAGAA 75 <210 > 21 <211> 84 <212> PRT <213> Rat <400> 21 Met Ala Leu Ser Thr Arg Ile Gln Ala Ala Cys Leu Leu Leu Leu Leu 1 5 10 15 Leu Ala Ser Leu Ser Ser Gly Ala Tyr Leu Arg Gln Gln Thr Arg Gln 20 25 30 Thr Thr Ala Leu Gln Pro Trp His Gly Ala Glu Ser Lys Thr Asp Asp 35 40 45 Ser Ala Leu Leu Met Leu Lys Arg Arg Lys Arg Asp Thr Asn Phe Pro 50 55 60 Ile Cys Leu Phe Cys Cys Lys Cys Cys Lys Asn Ser Ser Cys Gly Leu 65 70 75 80 Cys Cys Ile Thr 84 <210> 22 <211> 252 <212> DNA <213> Rat <400> 22 ATGGCACTAA GCACTCGGAT CCAGGCTGCC TGTCTCCTGC TTCT CCTCCT GGCCAGCCTG 60 AGCAGCGGTG CCTATCTCCG GCAACAGACG AGACAGACTA CGGCTCTGCA GCCTTGGCAT 120 GGGGCAGAAA GCAAGACTGA TGACAGTGCG CTGCTGATGC TGAAGCGAAG GAAGCGAGAC 180 ACCAACTTCC CCATATGCCT CTTCTGTCTGATGAATGTCTGTATGAATGCCTGTCATG Gln Gln Thr Arg Gln Thr Thr Ala Leu Gln Pro Trp His 1 5 10 15 Gly Ala Glu Ser Lys Thr Asp Asp Ser Ala Leu Leu Met Leu Lys Arg 20 25 30 Arg Lys Arg Asp Thr Asn Phe Pro Ile Cys Leu Phe Cys Cys Lys Cys 35 40 45 Cys Lys Asn Ser Ser Cys Gly Leu Cys Cys Ile Thr 50 55 60 <210> 24 <211> 180 <212> DNA <213> Rat <400> 24 TATCTCCGGC AACAGACGAG ACAGACTACG GCTCTGCAGC CTTGGCATGG GGCAGAAAGC 60 AAGACTTGTG ACAGTGCGCT AAGCGAAGGA AGCGAGACAC CAACTTCCCC 120 ATATGCCTCT TCTGCTGTAA ATGCTGTAAG AATTCCTCCT GTGGTCTCTG TTGCATAACA 180 <210> 25 <211> 25 <212> PRT <213> Rat <400> 25 Asp Thr Asn Phe Pro Ile Cys Leu Phe Cys Cys 5 Cys Lys Cys 10 Ser Ser Cys Gly Leu Cys Cys Ile Thr 20 25 <210> 26 <211> 75 <212> DNA <213> Rat <400> 26 GACACCAACT TCCCCATATG CCTCTTCTGC TGTAAATGCT GTAAGAATTC CTCCTGTGGT 60 CTCTGTTGCA TAACA 75 <210> 27 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> < 400> 27 Xaa Xaa Xaa Xaa Xaa Xaa Cys Xaa Xaa Cys Cys Xaa Cys Cys Xaa Xaa 1 5 10 15 Xaa Xaa Cys Xaa Xaa Cys Cys Xaa Xaa 20 25 <210> 28 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> <400> 28 CAGTGGGACA GCCAGACAGA CGG 23 <210> 29 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> <400> 29 CAGGGCAGGT AGGTTCTACG TCTT 24 <210> 30 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> <400> 30 Asp Xaa Xaa Phe Pro Ile Cys Xaa Phe Cys Cys Xaa Cys Cys Xaa Xaa 1 5 10 15 Xaa Xaa Cys Gly Xaa Cys Cys Xaa Xaa 20 25 <210> 31 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> <400> 31 Asp Thr Xaa Phe Pro Ile Cys Xaa Phe Cys Cys Xaa Cys Cys Xaa Xaa 1 5 10 15 Ser Xaa Cys Gly Xaa Cys Cys Xaa Thr 20 25 <210> 32 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> <400> 32 TCGGAATTCA CGATG GCACT GAGCTCCCAG ATCTGG 36 <210> 33 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> <400> 33 ACGCTCGAGC TACGTCTTGC AGCACATCCC ACA 33 <210> 34 <211> 60 <212> DNA <213 > Artificial Sequence <220> <223> <400> 34 ACGCTCGAGT TACTTGTCAT CGTCGTCCTT GTAGTCCGTC TTGCAGCACA TCCCACACTT 60

[Brief description of the drawings]

FIG. 1 shows the nucleotide sequence and amino acid sequence of the human precursor polypeptide of the present invention.

FIG. 2 shows the amino acid sequences of a mature human polypeptide, a mature mouse polypeptide (two types), and a mature rat polypeptide.

FIG. 3 shows a restriction map of plasmid pCAN618 used in Example 5.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61P 31/00 A61P 35/00 31/06 37/02 35/00 39/02 37/02 C07K 14/47 39/02 16/18 C07K 14/47 C12N 1/15 16/18 1/19 C12N 1/15 1/21 1/19 C12P 21/02 C 1/21 21/08 5/10 G01N 33/15 Z C12P 21/02 33/50 Z 21/08 T G01N 33/15 33/53 D 33/50 C12N 15/00 ZNAA A61K 37/02 33/53 C12N 5/00 A (72) Inventor Hideyuki Tanaka Tsukuba, Ibaraki 1-7-9 Kasuga 9 Takeda Kasuga Heights 1302

Claims (27)

[Claims] 1. A polypeptide comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 3, or a salt thereof. 2. The polypeptide according to claim 1, which comprises an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, or a salt thereof. 3. A polypeptide comprising the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 13, or a salt thereof. 4. The polypeptide according to claim 3, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 11, or a salt thereof. 5. The polypeptide according to claim 3, which comprises an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 9, or a salt thereof. 6. A DNA containing a DNA encoding the polypeptide according to claim 1. 7. The DNA according to claim 6, which comprises the nucleotide sequence represented by SEQ ID NO: 4. 8. A recombinant vector containing the DNA according to claim 6. 9. A transformant transformed with the recombinant vector according to claim 8. 10. A trait transformed by a recombinant vector containing a DNA containing a DNA encoding a polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7. A method for producing a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7, or a salt thereof, wherein the transformant is cultured to produce the polypeptide. 11. A polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7, wherein the polypeptide has the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 3. The method according to claim 10, which is a polypeptide containing a sequence. 12. A DNA encoding a polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7 is a DNA having the base sequence represented by SEQ ID NO: 8. The method according to claim 10. [13] a D encoding the polypeptide of [3];
The method for producing a polypeptide or a salt thereof according to claim 3, wherein a transformant transformed with a recombinant vector containing a DNA containing NA is cultured to produce the polypeptide. [14] a D encoding the polypeptide of [3];
DN whose NA has the base sequence represented by SEQ ID NO: 14
The method according to claim 13, wherein A is used. 15. An amino acid sequence identical to or substantially identical to the amino acid sequence represented by SEQ ID NO: 7 or SEQ ID NO: 13, wherein a protease is allowed to act on the polypeptide or the salt thereof according to claim 1 or 4. For producing a polypeptide having the same amino acid sequence or a salt thereof. 16. An antibody against the polypeptide according to claim 3, or a salt thereof, or a polypeptide containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 7, or an salt thereof. 17. Use of a polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7 or SEQ ID NO: 13 or a salt thereof, SEQ ID NO: 1
A method for screening a compound or a salt thereof that promotes or inhibits the activity of a polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by No. 3, or a salt thereof. 18. SEQ ID NO: 7 or SEQ ID NO: comprising a polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7 or SEQ ID NO: 13, or a salt thereof. : A kit for screening a compound or a salt thereof that promotes or inhibits the activity of a polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by 13, or a salt thereof. 19. The amino acid sequence represented by SEQ ID NO: 7 or 13 which can be obtained by using the screening method according to claim 17 or the screening kit according to claim 18. Or a salt thereof, which promotes or inhibits the activity of the polypeptide having the amino acid sequence of or a salt thereof. 20. The same or substantially the same as the amino acid sequence represented by SEQ ID NO: 7 or SEQ ID NO: 13, which can be obtained by using the screening method according to claim 17 or the screening kit according to claim 18. A pharmaceutical comprising a compound which promotes or inhibits the activity of a polypeptide having the amino acid sequence of or a salt thereof, or a salt thereof. 21. A medicament comprising a polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7 or 13 or a salt thereof. 22. An opportunistic infection, sepsis, drug poisoning comprising a polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7 or 13 or a salt thereof. , Tuberculosis, cancer, liver dysfunction, immune dysfunction, endocrine disorders, etc. (23) a diagnostic agent comprising the antibody according to (16); 24. A polypeptide having, from the N-terminal side to the C-terminal side, a signal sequence region for secretion, an intervening sequence, a basic amino acid region consisting of 5 consecutive residues, and a mature polypeptide region in this order. Or its salt. 25. A polypeptide comprising the amino acid sequence represented by SEQ ID NO: 27 (excluding the amino acid sequence represented by SEQ ID NO: 7) or a salt thereof. 26. A medicament comprising a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 27 (excluding the amino acid sequence represented by SEQ ID NO: 7) or a salt thereof. (27) the transformant is an animal cell;
Or the production method according to 13.