JP2001050951A - Screening method using cd100 - Google Patents

Abstract

PROBLEM TO BE SOLVED: To evaluate CD72 antagonist used for virus infection disease or the like and that used for the treatment or the like of abnormal antibody production by using CD100 or its salt and CD72 or its salt. SOLUTION: In screening of a compound which is useful for guiding and blocking the production of antibody, CD72 or its salt is used as an acceptor, or the manifestation system of a recombinant CD72 is constructed, CD100 using the manifestation system or the combination assay system with a salt thereof is used, and a compound for changing the connection property with CD100 or its salt and CD72 or its salt is screened. The screening includes the measurement and comparison of activity or the like for accelerating or suppressing the antibody production of, for example, antigen-specific IgG or the CD72, T-cell reactivity such as antibody production against T-cell-dependent antigen, proliferation of T cell, IL-4 production, and interferon production, dendritic cell reactivity or the like of IL-12 production or the like.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a CD100 (Procedures of the National Academy of Sciences of the USA).
Sci USA) 93, (1996) pp. 11780-11785) or a salt thereof and its receptor, CD72 (Journal of Immunol (J. Immunol) 149 (1992) 880-88).
And the like, and a method for screening a compound or a salt thereof useful as an antibody production inducer or a preventive or therapeutic agent for a disease caused by abnormal antibody production.

[0002]

2. Description of the Related Art B cells are composed of IgM, IgD, IgG, and Ig.
A, any one of the five types of antibodies, IgE, can be generated. When a B cell encounters an antigen that is first encountered in a living body as it differentiates, it first produces IgM due to its gene structure. However, the physiological function of IgM is weaker than other types of antibodies. When stimulation of the same antigen continues, the gene changes and I
Antibodies other than gM are produced and exert strong physiological functions. The action or phenomenon that this immunoglobulin changes from IgM to another type is called class switching. CD40 is a membrane glycoprotein expressed on B cells and reacts with, for example, CD40L expressed on activated T cells. CD4
It is known that in mice without 0, antibody production, class switching, and vaccine action are not observed.
Is an essential molecule for the antibody production function of B cells. C
When B cells were stimulated with D40, B cells with anti-IgM antibody
Suppression of cell death and stimulation of B cells with CD40 induces the production of various classes of antibodies, including IgM. However, it is still unknown what induces these B cell responses.

[0003]

If the death of B cells,
And if the class switch can be controlled, it will be possible to regulate the antibody production of B cells. If antibody production is required to be produced promptly, for example, if you can quickly raise the antibody titer after vaccination against epidemic diseases such as common cold and influenza,
Although an effective treatment for epidemic diseases, there is no such treatment to date. In addition, diseases caused by the production of abnormal antibodies, such as atopic asthma, atopic dermatitis, chronic indirect rheumatism, allergic rhinitis, if the abnormal antibodies can be specifically reduced, such a so-called Although it is an effective treatment for allergy and autoimmune diseases, there is no such treatment to date.

[0004]

Means for Solving the Problems Accordingly, the present inventors have proposed C
The gene induced by D40 was separated and obtained, and it was clarified that the molecule was CD100. In addition, CD1
When 00 binds to CD72 on B cells stimulated with an activator such as CD40, IL-4, or LPS to form a complex, the killing of B cells by anti-IgM antibodies can be avoided, and the induction of class switching Played a very important role. CD100 is CD40, I
Upon binding and forming a complex with CD72 on B cells stimulated with an activator such as L-4 or LPS, the B cells trigger a class switch, causing specific high affinity antibodies in vivo. It was revealed that it induced strongly. These facts indicate that a substance that induces the binding between CD72 and CD100,
A substance that replaces CD100 and binds to CD72, CD
An effective treatment method in which a substance in which 100 molecules are partially modified to enhance the binding ability to CD72 or CD100 itself rapidly raises the antibody titer after vaccination against epidemic diseases such as common cold and influenza. It is shown that it becomes. It also shows that CD100 is an immunostimulant for cancer and infectious diseases. CD72
Such a substance that inhibits the binding between CD100 and CD100 is expected to inhibit only antibody production of activated B cells and is caused by abnormal antibody production, such as atopic asthma, atopic dermatitis, Chronic indirect rheumatism,
It has been shown to be an effective treatment for allergic rhinitis.

That is, the present invention provides (1) a compound or a salt thereof which changes the binding property between CD100 or a salt thereof and CD72 or a salt thereof, characterized by using CD100 or a salt thereof and CD72 or a salt thereof. Screening method, (2) CD characterized by using CD100 or a salt thereof and CD72 or a salt thereof.
A screening kit for a compound or a salt thereof that alters the binding between 100 or a salt thereof and CD72 or a salt thereof, (3) using the screening method described in the above (1) or the screening kit described in the above (2). A compound or a salt thereof that changes the binding between CD100 or a salt thereof and CD72 or a salt thereof,
(4) The compound or salt thereof according to the above (3), which promotes or inhibits the activity of CD100 or a salt thereof, (5) a medicament containing the compound or the salt thereof according to the above (3).
(6) the medicament according to the above (5), which is an antibody production inducer or a preventive / therapeutic agent for a disease caused by abnormal antibody production;
(7) The medicament according to the above (6), wherein the disease caused by abnormal production of antibodies is allergy or an autoimmune disease, (8) C
The screening according to the above (1), wherein D100 or a salt thereof, or CD100 or a salt thereof and a test compound are added to CD72-expressing cells, and a change in the amount of antibody produced or secreted from the expressing cells is measured. Method, (9) Non-human animal in which T cell reactivity is lost, and CD100 gene is knocked out, (10) CD1
A method for screening a drug for preventing or treating a disease caused by CD100 deficiency, which comprises using a non-human animal in which the 00 gene has been knocked out, and (11) using a non-human animal in which the CD100 gene has been knocked out. (12) a screening method according to the above (11), wherein the receptor is CD72 or a salt thereof, and (13) a screening method for a compound or a salt thereof that alters the binding between CD100 or a salt thereof and its receptor. Exogenous C
DN incorporating D100 gene or its mutant gene
A transgenic non-human animal having enhanced T cell reactivity characterized by having A or a progeny thereof having the DNA, (14) a transgenic non-human having a DNA incorporating the exogenous CD100 gene or a mutant gene thereof. A method for screening a drug for preventing or treating a disease caused by CD100 enhancement, which comprises using an animal or its progeny having the DNA, (15) exogenous CD
DNA incorporating 100 genes or its mutant gene
Transgenic non-human animal having said DNA or said DNA
CD10 characterized by using its progeny having
And (16) a method for screening for a compound or a salt thereof that alters the binding between 0 or a salt thereof and its receptor, and (16) a method for screening according to the above (15), wherein the receptor is CD72 or a salt thereof. is there.

[0006] Regarding the CD100 in the present invention, specifically, a known CD100 or a salt thereof [Processing of the National Academy of Sciences of the USA (Proc Natl Acad Sci U
SA) 93, (1996) pp. 11780-11785; Journal of
Biological chemistry (Journal of Biological
Chemistry) 271: (1996) 33376-33381], and (17) an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3. A polypeptide (hereinafter abbreviated as CD100) or a salt thereof, or (18) the polypeptide, wherein at least one of the amino acids in the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3 is 30 or more In the following, preferably 1 to 30 amino acids, preferably 1 to 10 amino acids in the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3, wherein 1 to 10 amino acids are deleted. An amino acid sequence having an amino acid added (or inserted), or 1 to 30 amino acids in the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3, preferably The 10 or less amino acids than pieces is a protein comprising the amino acid sequence are substituted with other amino acids (17) according to claim CD100
Or salts thereof. In addition, as for the CD72 in the present invention, specifically, a known CD72 or a salt thereof [The Journal of Immunology (The Journal of Immunology)]
l of Immunology), 144, 4870-4877 (1990); The Journal of Immunology (The
Journal of Immunology), 149, 880-886 (1992)]. About Mouse CD72, The Journal of Immunology (The Journal
of Immunology), 149, 880-886 (199
Lyb-2 ^a.1 , Lyb-2 ^a.2 , Lyb-2 ^b , Ly described in 2)
Allotypes such as b- ^2c are also included. Further, with respect to CD72, (19) a polypeptide characterized by containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 5 or SEQ ID NO: 7 (hereinafter abbreviated as CD72) or The salt, or (2
0) The polypeptide is SEQ ID NO: 5 or SEQ ID NO: 7
1 to 10 amino acids, preferably 1 to 5 amino acids in the amino acid sequence represented by SEQ ID NO: 5, or 1 to 10 in the amino acid sequence represented by SEQ ID NO: 5 or SEQ ID NO: 7. Or less, preferably 1 to 5 amino acids added (or inserted)
Amino acid sequence, or SEQ ID NO: 5 or SEQ ID NO:
1 to 10 in the amino acid sequence represented by 7,
Preferably, CD72 or a salt thereof according to the above (19), which is a protein containing an amino acid sequence in which one or more and five or less amino acids are substituted with another amino acid, is mentioned.

[0007] As used herein, “substantially identical” refers to an activity of a polypeptide or the like, for example, a ligand (CD10).
0) and the receptor (CD72) have substantially the same binding activity, physiological properties, and the like. Amino acid substitution,
Deletions, additions or insertions often do not result in significant changes in the physiological or chemical properties of the polypeptide. , C
D72 variants, etc.) would be substantially identical to those without such substitutions, deletions, additions or insertions. Substantially identical substitutions of amino acids in the amino acid sequence can be selected, for example, from other amino acids of the class to which the amino acid belongs. Non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, methionine and the like. Polar (neutral) amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, glutamine and the like. Examples of positively charged (basic) amino acids include arginine, lysine, histidine and the like. Examples of negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

[0008]

BEST MODE FOR CARRYING OUT THE INVENTION The manufacturing method of CD100 and CD72 used in the present invention will be described in more detail below.
CD100 and CD72 used in the present invention include humans, warm-blooded animals (eg, guinea pigs, rats, mice, pigs, sheep, cows, monkeys, etc.), and all tissues such as fish (eg, pituitary, pancreas, brain, kidney,
Liver, gonad, thyroid, gall bladder, bone marrow, adrenal gland, skin, muscle, lung, gastrointestinal tract, blood vessels, heart, etc.) or polypeptides derived from cells and the like.
SEQ ID NO: 1, SEQ ID NO: 3, and CD72 are any polypeptides having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 5 or SEQ ID NO: 7. Is also good.
The amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1, 3, 5, or 7 includes SEQ ID NO:
The amino acid sequence represented by 1, 3, 5 or 7 and about 70
% Or more, preferably about 80% or more, more preferably about 9%.
Amino acid sequences having 0% or more, more preferably about 95% or more homology are exemplified. For example, CD72
As well as polypeptides containing the amino acid sequence represented by SEQ ID NO: 5 or SEQ ID NO: 7 and polypeptides containing the amino acid sequence represented by SEQ ID NO: 5 or SEQ ID NO: 7 Examples include polypeptides having the same activity. Examples of substantially the same activity include ligand binding activity, signal transduction activity, and antibody production ability. Substantially the same
This indicates that the ligand binding activity and the like are of the same nature. Therefore, such as the strength of the ligand binding activity,
Quantitative factors such as the molecular weight of the polypeptides can be different. CD100 is substantially the same as the polypeptide containing the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3 and the polypeptide containing the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3. And polypeptides having the same activity. Substantially the same activity includes, for example, receptor binding activity, antibody production activity and the like. "Substantially the same quality" means that the receptor binding activity and the like are substantially the same. Therefore, quantitative factors such as strength and weakness of the receptor binding activity and the molecular weight of the polypeptide may be different.

[0009] CD72 and CD10 herein
In the case of 0, the left end is the N-terminus (amino terminus) and the right end is the C-terminus (carboxyl terminus) according to the convention of peptide labeling. For example, a polypeptide containing the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, or the like, usually has a carboxyl group (-COOH) or carboxylate (-COO) at the C-terminus. ^-), but it is, C-terminal, may be an amide (-CONH ₂₎ or ester (-COOR). Examples of R in the ester include a C _1-6 alkyl group such as methyl, ethyl, n-propyl, isopropyl or n-butyl, and a C _1-6 such as cyclopentyl and cyclohexyl.
_3-8 cycloalkyl group, phenyl, C _6-12 aryl group such as α-naphthyl, benzyl, phenethyl, phenyl-C _1-2 alkyl such as benzhydryl, or α-naphthyl-C _1- such as α-naphthylmethyl. _In addition to C _7-14 aralkyl groups such as _2- alkyl, pivaloyloxymethyl group widely used as an oral ester and the like can be mentioned.
As salts of CD72 and CD100 used in the present invention, salts with physiologically acceptable bases (eg, alkali metals and the like) and acids (organic acids, inorganic acids) are used.
Particularly preferred are physiologically acceptable acid addition salts. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid, Salts with tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used. CD used in the present invention
72 and CD100 can be obtained by a known method [The Journal
The Journal of Immunology, 14
4, 4870-4877 (1990); The Journal of Immunolog
y), 149, 880-886 (1992); Processings of the National Academy of Sciences of the USA (ProcNatl Acad Sc)
i USA) 93, (1996) pp. 11780-11785; Journal
Journal of Biolog
271, (1996) 33376-33381), that is, it can be produced by a method of purifying a polypeptide from human or warm-blooded animal tissues or cells, or the polypeptide described below. It can also be produced according to a synthesis method. It can also be produced by culturing a transformant containing a DNA encoding the polypeptide described below. When producing from tissues or cells such as humans, warm-blooded animals, fish, etc., after homogenizing the tissues or cells, such as humans, warm-blooded animals, fish, etc., extraction is performed with an acid, an organic solvent, etc. Purification and isolation can be performed by combining chromatography such as precipitation, dialysis, gel filtration, reverse phase chromatography, ion exchange chromatography, and affinity chromatography.

As described above, the CD7 used in the present invention
2 and CD100 can be produced according to a known method for synthesizing a polypeptide, or by cleaving a polypeptide containing the polypeptide with an appropriate peptidase. As a method for synthesizing a peptide, for example, any of a solid phase synthesis method and a liquid phase synthesis method may be used. That is, the target peptide can be produced by condensing a partial peptide or amino acid capable of constituting a polypeptide with the remaining portion and, when the product has a protecting group, removing the protecting group. Known methods for condensation and elimination of protecting groups include, for example, the methods described in (1) to (4) below. M. Bodanszky and MA Ondetti, Peptide Synthesis, Interscience Publisher
s, New York (1966) Schroeder and Luebke, The Peptide,
Academic Press, New York (1965) Nobuo Izumiya et al., Fundamentals and experiments of peptide synthesis, Maruzen Co., Ltd.
(1975) Haruaki Yajima and Shunpei Sakakibara, Laboratory of Biochemistry 1, Protein Chemistry IV, 205, (1977) Supervised by Haruaki Yajima, Development of Continuing Drugs Volume 14 Peptide Synthesis Hirokawa Shoten Purification of polypeptide (CD7) by combining solvent extraction, distillation, column chromatography, liquid chromatography, recrystallization
2, CD100) can be purified and isolated. When the polypeptide obtained by the above method is a free form, it can be converted to an appropriate salt by a known method. Can be.

The amide form of CD72 and CD100 is
A commercially available resin for peptide synthesis suitable for amide formation can be used. Such resins include, for example, chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin, 4-methylbenzhydrylamine resin, PAM resin, 4-hydroxymethylmethylphenyl Acetamidomethyl resin, polyacrylamide resin, 4
-(2 ', 4'-dimethoxyphenyl-hydroxymethyl)
Phenoxy resin, 4- (2 ′, 4′-dimethoxyphenyl-
Fmoc aminoethyl) phenoxy resin. Using such a resin, an amino acid having an α-amino group and a side chain functional group appropriately protected is condensed on the resin according to the sequence of the target peptide according to various condensation methods known per se. At the end of the reaction, the peptide is cleaved from the resin and, at the same time, various protecting groups are removed, and if necessary, an intramolecular disulfide bond formation reaction is carried out in a highly diluted solution to obtain a target polypeptide. For the condensation of the protected amino acids described above, various activating reagents that can be used for peptide synthesis can be used, and carbodiimides are particularly preferable. Carbodiimides include DCC, N, N'-diisopropylcarbodiimide, N-ethyl-N '-(3-dimethylaminopropyl) carbodiimide and the like. Activation by these includes racemization inhibiting additives (eg, HO
BT) can be added directly to the resin, or can be added to the resin after activation of the previously protected amino acid as a symmetric anhydride or HOBT ester. The solvent used for activating the protected amino acid or condensing with the resin can be appropriately selected from solvents known to be usable for the peptide condensation reaction. For example, acid amides such as N, N-dimethylformamide, N, N-dimethylacetamide, N-methylpyrrolidone, halogenated hydrocarbons such as methylene chloride and chloroform, alcohols such as trifluoroethanol, and sulfoxides such as dimethylsulfoxide. , Tertiary amines such as pyridine, dioxane,
Ethers such as tetrahydrofuran, acetonitrile, nitriles such as propionitrile, methyl acetate,
Esters such as ethyl acetate or an appropriate mixture thereof are used. The reaction temperature is appropriately selected from a range known to be usable for the peptide bond formation reaction, and is usually appropriately selected from a range of about -20 ° C to 50 ° C. The activated amino acid derivative is usually 1.5 to 4
Used in fold excess. As a result of the test using the ninhydrin reaction, when the condensation is insufficient, sufficient condensation can be performed by repeating the condensation reaction without removing the protecting group. When a sufficient condensation cannot be obtained by repeating the reaction, the unreacted amino acid can be acetylated using acetic anhydride or acetylimidazole so as not to affect the subsequent reaction. Examples of the protecting group for the amino group of the starting amino acid include Z, Boc, tertiary pentyloxycarbonyl, isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl, Cl-Z, Br-Z, adamantyloxycarbonyl, trifluoro Examples include acetyl, phthaloyl, formyl, 2-nitrophenylsulfenyl, diphenylphosphinothioyl, and Fmoc. Examples of the carboxyl-protecting group include the above-mentioned C _1-6 alkyl group as R,
C _3-8 cycloalkyl group, C _7-14 aralkyl group, and 2
-Adamantyl, 4-nitrobenzyl, 4-methoxybenzyl, 4-chlorobenzyl, phenacyl group and benzyloxycarbonyl hydrazide, tert-butoxycarbonyl hydrazide, trityl hydrazide and the like. The hydroxyl groups of serine and threonine can be protected, for example, by esterification or etherification. Examples of groups suitable for the esterification include lower alkanoyl groups such as an acetyl group, aroyl groups such as a benzoyl group, and groups derived from carbon such as a benzyloxycarbonyl group and an ethoxycarbonyl group. Examples of groups suitable for etherification include a benzyl group, a tetrahydropyranyl group, and a tertiary butyl group. Examples of the protecting group for the phenolic hydroxyl group of tyrosine include Bzl, Cl ₂ -Bzl, 2-nitrobenzyl, Br-Z, tertiary butyl and the like. Examples of the imidazole protecting group of histidine include Tos, 4-methoxy-2,3,6-trimethylbenzenesulfonyl, DNP, benzyloxymethyl, Bum, Boc, Trt, Fmoc and the like. Examples of the activated carboxyl group of the raw material include the corresponding acid anhydride, azide, active ester [alcohol (eg, pentachlorophenol, 2,
4,5-trichlorophenol, 2,4-dinitrophenol,
Cyanomethyl alcohol, paranitrophenol, HON
B, N-hydroxysuccinimide, N-hydroxyphthalimide, HOBT) and the like. The activated amino group of the raw material includes, for example, a corresponding phosphoric amide.

As a method for removing (eliminating) the protecting group, for example, catalytic reduction in a hydrogen stream in the presence of a catalyst such as Pd black or Pd carbon, or hydrogen fluoride anhydride, methanesulfonic acid, trifluoromethane or the like can be used. Examples include acid treatment with dichloromethane, trifluoroacetic acid or a mixture thereof, base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine, and the like, and reduction with sodium in liquid ammonia. The elimination reaction by the above acid treatment is generally performed at a temperature of -20 ° C to 40 ° C. In the acid treatment, anisole, phenol, thioanisole, metacresol, paracresol, dimethylsulfide, 1,4-butanedithiol, , 2-
Addition of a cation scavenger such as ethanedithiol is effective. In addition, the 2,4-dinitrophenyl group used as the imidazole protecting group of histidine is removed by thiophenol treatment, and the formyl group used as the indole protecting group of tryptophan is 1,2-ethanedithiol, 1,4-butane described above. In addition to deprotection by acid treatment in the presence of dithiol or the like, it is also removed by alkali treatment with dilute sodium hydroxide, dilute ammonia or the like. The protection and protection of the functional group that should not be involved in the reaction of the raw materials, the elimination of the protective group, the activation of the functional group involved in the reaction, and the like can be appropriately selected from known groups or known means. As another method for obtaining the amide form of CD72 and CD100, first, after amidating the α-carboxyl group of the carboxyl-terminal amino acid, extending the peptide chain to the desired length on the amino group side, A peptide from which only the protecting group for the N-terminal α-amino group was removed and a peptide (or amino acid) from which only the protecting group for the C-terminal carboxyl group were removed, and both peptides were mixed in the above-mentioned mixed solvent. To condense. Details of the condensation reaction are the same as described above. After purifying the protected peptide obtained by the condensation, all the protecting groups are removed by the above-mentioned method to obtain a desired crude polypeptide. This crude polypeptide is purified using various known purification means,
The amide of the desired polypeptide can be obtained by freeze-drying the main fraction. CD72 and CD100
To obtain an ester form of
After condensing the carboxyl group with a desired alcohol to form an amino acid ester, an ester of the desired polypeptide can be obtained in the same manner as the amide of the polypeptide.

The DNA encoding CD72 used in the present invention includes a DNA encoding a receptor protein having an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 5 or SEQ ID NO: 7.
DNA containing NA, CD100 used in the present invention
Is any DNA containing a DNA encoding a ligand protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3. There may be. In addition, genomic DNA, genomic DNA library, cDNA derived from the aforementioned tissue / cell, cDNA library derived from the aforementioned tissue / cell, synthetic DN
Any of A may be used. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. In addition, using the RNA fraction prepared from the above-described tissues / cells directly
It can also be amplified by rse transcriptase polymerase chain reaction (hereinafter abbreviated as RT-PCR method). More specifically, (1) identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 5 or SEQ ID NO: 7 (or SEQ ID NO: 1 or SEQ ID NO: 3) under stringent conditions Containing DNA encoding a receptor protein having the amino acid sequence of
DNA hybridizing with the sequence of A, (2) SEQ ID NO: 5 or SEQ ID NO: 7 due to degeneracy of the genetic code
(Or the sequence of a DNA containing a DNA encoding a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3) and the sequence defined in (1). DNA that encodes a polypeptide that does not hybridize with the sequence but has the same amino acid sequence is used. Hybridization can be performed according to a method known per se or a method analogous thereto. The stringent conditions include, for example, 42 ° C., 50%
Formamide, 4 × SSPE (1 × SSPE = 150 mM NaC
_{l, 10mM NaH 2 PO 4 ·} H 2 O, 1mM EDTA pH7.4), 5 × Denhardt's solution and 0.1% SDS.

CD72 or CD1 used in the present invention
DNA encoding 00 can also be produced by the following genetic engineering techniques. CD72 or CD10
Means for cloning DNA that completely encodes 0 include synthetic DNA having a partial nucleotide sequence of a polypeptide.
The above-mentioned D was obtained by a PCR method known per se using primers.
By amplifying the target DNA from an NA library or the like, or by hybridizing the DNA incorporated in an appropriate vector with, for example, a DNA fragment having a partial or entire region of the polypeptide or labeled with a synthetic DNA. Can be sorted out. Hybridization methods include, for example, Molecular Cloning
(2nd ed .; J. Sambrook et al., Cold Spring Harbor
Lab. Press, 1989). When a commercially available library is used, the procedure is performed according to the method described in the attached instruction manual. The cloned DNA encoding CD72 or CD100 used in the present invention can be used as it is depending on the purpose, or may be used after digesting with a restriction enzyme or adding a linker, if desired. The DNA may have ATG as a translation initiation codon at the 5 'end and TAA, TGA or TAG as a translation stop codon at the 3' end. These translation initiation codon and translation termination codon can also be added using a suitable synthetic DNA adapter. CD72 or CD used in the present invention
For example, 100 expression vectors can be obtained by, for example, (a) cutting out a DNA fragment of interest from DNA encoding CD72 or CD100 used in the present invention, and (b) ligating the DNA fragment downstream of a promoter in an appropriate expression vector. Can be manufactured. As the vector, a plasmid derived from Escherichia coli (eg, pBR322, pB
R325, pUC12, pUC13) and plasmids derived from Bacillus subtilis (eg, pUB110, pTP5, pC19)
4), yeast-derived plasmids (eg, pSH19, pSH1
5), bacteriophages such as λ phage, animal viruses such as retrovirus, vaccinia virus, and baculovirus are used. The promoter to be used may be any promoter as long as it is appropriate for the host used for gene expression.

When the host used for the transformation is an animal cell, SV40-derived promoter, retrovirus promoter, metallothionein promoter, heat shock promoter, cytomegalovirus promoter, SRα promoter and the like can be used. When the host is Escherichia, Trp promoter,
T7 promoter, lac promoter, recA promoter, λPL promoter, lpp promoter, etc., when the host is Bacillus sp. , GAP promoter, ADH
One promoter, GAL promoter and the like are preferable.
When the host is an insect cell, a polyhedrin promoter, a P10 promoter and the like are preferable. In addition to the above, the expression vector may optionally include an enhancer, a splicing signal, a polyA addition signal, a selection marker,
Those containing SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori) or the like can be used. As the selection marker include dihydrofolate reductase (hereinafter sometimes abbreviated as dhfr) gene [methotrexate (MTX) resistance], ampicillin resistant gene (hereinafter sometimes abbreviated as Amp ^r),
Neomycin resistance gene (hereinafter, sometimes abbreviated as Neo, G418 resistance) and the like. In particular, CHO
When the DHFR gene is used as a selection marker using (dhfr ⁻ ) cells, selection can be made even on a thymidine-free medium. If necessary, a signal sequence suitable for the host is added to the N-terminal side of the polypeptide or its partial peptide. When the host is a bacterium belonging to the genus Escherichia, a phoA signal sequence, an OmpA signal sequence, etc., and when the host is a bacterium belonging to the genus Bacillus, an α-amylase signal sequence, a subtilisin signal sequence, etc. In some cases, such as mating factor α (MFα) signal sequence, invertase signal sequence, etc., and when the host is an animal cell, for example, insulin signal sequence, α-interferon signal sequence, antibody molecule / signal sequence, etc. Are available respectively. CD72 or CD thus constructed
A transformant can be produced using a vector containing DNA encoding 100.

As the host, for example, Escherichia, Bacillus, yeast, insects or insect cells, animal cells and the like are used. Examples of Escherichia bacteria include Escherichia coli K12.DH1.
[Processings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), 60, 160
(1968)], JM103 [Nukuilec Acids
Research, (Nucleic Acids Research), 9, 309
(1981)], JA221 [Journal of Molecular Biolog
y)], 120, 517 (1978)], HB101
[Journal of Molecular Biology, 4
1, 459 (1969)], C600 [Genetics, 39, 440 (1954)], Escherichia coli DH10B cells [Focus 12, p19 (199)
0) Low, D, etc.] are used. Examples of Bacillus bacteria include Bacillus sacillus (Bacillus s.
ubtilis) MI114 [Gene, 24, 255 (198
3)], 207-21 [Journal of Biochemistry, 95, 87]
(1984)].

Examples of yeast include Saccharomyces cerevisiae AH22,
^{AH22R -, NA87-11A, DKD-5D} , 20
B-12 or the like is used. As insects, for example, silkworm larvae are used [Maeda et al., Nature (Natu
re), 315, 592 (1985)]. As insect cells, for example, when the virus is AcNPV, Spodoptera frugiperda cell; Sf
Cells), MG1 cells from Trichoplusia ni midgut, Tri
High Five ^TM cells from choplusia ni eggs, Mamestra br
Cells derived from assicae or cells derived from Estigmena acrea are used. When the virus is BmNPV, a silkworm-derived cell line (Bombyx mori N; BmN cell) or the like is used. As the Sf cells, for example, Sf9 cells (AT
CC CRL1711), Sf21 cells [Vaughn, JL et al.
In Vitro, Volume 13, 213-217
Page (1977)]. Examples of animal cells include monkey COS-7 cells, Vero cells, Chinese hamster cells CHO, DHFR gene-deficient Chinese hamster cells CHO (dhfr ^- CHO cells), mouse L cells, mouse 3T3 cells, mouse myeloma cells, human HEK293 cells, Human FL cells, 29
3 cells, C127 cells, BALB3T3 cells, Sp-2
/ O cells, mouse B cell line WEHI231 cells, P3U
One plasma site or the like is used. In order to transform Escherichia, for example, Procagings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci.
USA), 69, 2110 (1972) and Gene
e), Vol. 17, 107 (1982). For transformation of Bacillus sp., For example, Molecular & General Genetics, 168
Vol. 111 (1979). To transform yeast, for example, Processing of the National Academy of Sciences of the USA (Proc. Natl. Acad.
Sci. USA), 75, 1929 (1978).

To transform an insect cell or insect,
For example, Bio / Technology, 6
Volume, pp. 47-55 (1988). Transformation of animal cells is described, for example, in Virology, 52, 456 (197).
This is performed according to the method described in 3). As a method for introducing an expression vector into cells, for example, a lipofection method [Felgner, PL et al.
The National Academy of Sciences
Proceedings of The Nationa
l Academy of Sciences of The United States of Amer
ica), 84, 7413 (1987)], calcium phosphate method [Graham, FL and van der Eb, AJ Virology, 52, 456-467 (1973)], electroporation method [Nuemann, E. et al.
EMBO J., Volume 1, 841-84
5 (1982)]. Thus, a transformant transformed with the expression vector containing the DNA encoding CD72 or CD100 used in the present invention is obtained. In addition, as a method for stably expressing CD72 or CD100 used in the present invention using animal cells, a method of selecting cells in which the expression vector introduced into the animal cells is integrated into a chromosome by clone selection is used. There is. Specifically, a transformant is selected using the above-mentioned selection marker as an index. Furthermore, a stable animal cell line having a high expression ability of a polypeptide or the like can be obtained by repeatedly performing clonal selection on the animal cells obtained using the selection marker. When the dhfr gene was used as a selection marker, the culture was performed by gradually increasing the MTX concentration.
By selecting a resistant strain, a DNA encoding a polypeptide or a partial peptide thereof together with the dhfr gene can be amplified in a cell to obtain an even higher-expressing animal cell strain. The above-mentioned transformant is cultured under conditions under which DNA encoding the polypeptide or the like (CD72, CD100) can be expressed, and the polypeptide or the like can be produced and accumulated to produce the polypeptide or the like. When culturing a transformant whose host is a genus Escherichia or Bacillus, a liquid medium is suitable as a medium used for the culturing, and a carbon source necessary for growth of the transformant is used therein. Nitrogen sources, inorganic substances, etc. are contained. Examples of carbon sources include glucose, dextrin, soluble starch, and sucrose. Examples of nitrogen sources include ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract, soybean meal, potato extract, and the like. Alternatively, examples of the organic substance and the inorganic substance include calcium chloride, sodium dihydrogen phosphate, and magnesium chloride. In addition, yeast extract, vitamins, growth promoting factors and the like may be added. The pH of the medium is preferably about 5 to 8.

As a medium for culturing the genus Escherichia, for example, M9 medium containing glucose and casamino acid [Miller, Journal of Experiments in Molecular Genetics (Journa)
l of Experiments in Molecular Genetics), 431-
433, Cold Spring Harbor Laboratory, New York 1
972] is preferred. If necessary, an agent such as 3β-indolylacrylic acid can be added in order to make the promoter work efficiently. When the host is a bacterium belonging to the genus Escherichia, the cultivation is usually carried out at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration and stirring may be added. When the host is a bacterium belonging to the genus Bacillus, the cultivation is usually carried out at about 30 to 40 ° C. for about 6 to 24 hours, and if necessary, aeration and stirring can be added. When culturing a transformant in which the host is yeast, as a medium, for example, Burkholder minimal medium [Bostian, KL et al.
"Processings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), 77, 450
5 (1980)] or an SD medium containing 0.5% casamino acid [Bitter, GA et al., "Processings of the National Academy of Sciences of the USA (Proc. Acad. Sci. US
A), 81, 5330 (1984)].
Preferably, the pH of the medium is adjusted to about 5-8. The cultivation is usually performed at about 20 ° C. to 35 ° C. for about 24 to 72 hours, and if necessary, aeration and stirring are added.

When culturing a transformant whose host is an insect cell, Grace's Insect Medium (Grace,
TCC, Nature, 195,788 (1962)) to which an additive such as immobilized 10% bovine serum is appropriately added is used. The pH of the medium is preferably adjusted to about 6.2 to 6.4. The cultivation is usually performed at about 27 ° C. for about 3 to 5 days, and if necessary, aeration and / or stirring are added. When culturing a transformant in which the host is an animal cell, the medium may be, for example, a MEM medium containing about 5 to 20% fetal bovine serum [Seience, Vol. 122, 501 (1952)], D
MEM medium [Virology, 8, 396
(1959)], RPMI 1640 medium [Journal
The Jounal of The American Medical Association
199, 519 (1967)], 199 medium [Proceeding of The Society for the Biological Medicine (Proceeding of the Society fo
r The Biological Medicine), 73, 1 (195
0)]. Preferably, the pH is between about 6-8. The cultivation is usually performed at about 30 ° C. to 40 ° C. for about 15 to 60 hours, and if necessary, aeration or stirring is added. Especially CHO
When (dhfr ⁻ ) cells and the dhfr gene are used as selection markers, it is preferable to use a DMEM medium containing dialyzed fetal bovine serum containing almost no thymidine.

From the above culture, CD7 used in the present invention
2 or CD100 can be separated and purified, for example, by the following method. C used in the present invention
When D72 or CD100 is extracted from cultured cells or cells, the cells or cells are collected by a known method after culturing, suspended in an appropriate buffer, and sonicated, lysozyme and / or freeze-thawed. After disrupting the cells or cells, a method of obtaining a crude extract of the polypeptide by centrifugation or filtration may be used as appropriate. The buffer may contain a protein denaturing agent such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100 (registered trademark, hereinafter sometimes abbreviated as TM). CD72 or C used in the present invention in a culture solution
When D100 is secreted, after completion of the culture, the supernatant is separated from the cells or cells by a method known per se, and the supernatant is collected. CD72 or CD used in the present invention contained in the culture supernatant or the extract thus obtained
Purification of 100 can be performed by appropriately combining known separation and purification methods. These known separation and purification methods include methods using solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SD.
A method using mainly a difference in molecular weight such as S-polyacrylamide gel electrophoresis, a method using a difference in charge such as ion exchange chromatography, a method using specific affinity such as affinity chromatography,
A method using a difference in hydrophobicity such as reversed phase high performance liquid chromatography, a method using a difference in isoelectric point such as isoelectric focusing or chromatofocusing, and the like are used.

The thus obtained CD used in the present invention
When 72 or CD100 is obtained in a free form, it can be converted to a salt by a method known per se or a method analogous thereto, and conversely, when 72 or CD100 is obtained as a salt, a method known per se or a method analogous thereto , Free form or other salts. In addition, CD72 or CD100 used in the present invention produced by a recombinant is
By applying an appropriate protein modifying enzyme before or after purification, the protein can be arbitrarily modified or the polypeptide can be partially removed. As protein modifying enzymes,
For example, trypsin, chymotrypsin, arginyl endopeptidase, protein kinase, glycosidase and the like are used. The presence of the polypeptide of the present invention thus produced can be measured by an enzyme immunoassay using a specific antibody or the like.

[Screening method for compound or salt thereof that alters the binding between CD100 and CD72 (ligand / receptor assay system)] CD100 or a salt thereof, characterized by using CD100 or a salt thereof and CD72 or a salt thereof. For screening for a compound or a salt thereof that alters the binding between CD72 and CD72 or a salt thereof, or CD100 or a salt thereof and CD7
CD100, characterized by using 2 or a salt thereof.
Alternatively, a kit for screening a compound or a salt thereof that changes the binding property between the salt thereof and CD72 or a salt thereof (hereinafter, abbreviated as the screening method of the present invention and the screening kit of the present invention) will be described in detail below. By using CD72 or a salt thereof as a receptor, or by constructing a recombinant CD72 expression system and using a binding assay system (ligand / receptor assay system) for CD100 or a salt thereof using the expression system,
Compounds that alter the binding between CD100 or a salt thereof and CD72 or a salt thereof (eg, peptides, proteins, non-peptide compounds, synthetic compounds, fermentation products, etc.) or salts thereof can be screened.
Such compounds have an immune response promoting activity via CD72 [eg, production of antibodies such as antigen-specific IgG; TD
(T cell dependency) T cell reactivity such as antibody production against an antigen, T cell proliferation, IL-4 production, interferon gamma production; activity or suppression for promoting dendritic cell reactivity such as IL-12 production, etc. (Ie, a CD72 agonist) and a compound having no immune response promoting activity (ie, a CD72 antagonist). “Changing the binding between CD100 or its salt and its receptor (eg, CD72 or its salt)” means inhibiting the binding of CD100 or its salt with its receptor (eg, CD72 or its salt) This includes both cases and cases in which binding with a ligand is promoted.

That is, the present invention relates to (i) the case where CD100 or a salt thereof is brought into contact with CD100 or a salt thereof;
Alternatively, there is provided a method for screening a compound or a salt thereof, which changes the binding property between CD100 or a salt thereof and CD72 or a salt thereof, wherein the method is carried out in comparison with the case where the test compound is brought into contact with a salt thereof and a test compound. In the screening method of the present invention, (i) the CD7
2 or a salt thereof and CD100 or a salt thereof and (ii) CD72 or a salt thereof
For example, when 100 or a salt thereof and a test compound are brought into contact with each other, the amount of a ligand bound to the CD72 or a salt thereof, the activity of promoting an immune reaction such as antibody production, and the like are measured and compared.

Specifically, the screening method of the present invention uses the labeled CD100 or a salt thereof as described above for CD7.
2 or its salt, and labeled CD10
0 or a salt thereof and CD100 or a salt thereof when the test compound is brought into contact with CD72 or a salt thereof, wherein the amount of labeled CD100 or a salt thereof binding to the CD72 or a salt thereof is measured and compared. A screening method for a compound or a salt thereof that alters the binding to CD72 or a salt thereof, a method comprising: contacting a labeled CD100 or a salt thereof with a cell containing CD72 or a salt thereof or a membrane fraction of the cell; Labeled CD100 when the contacted CD100 or a salt thereof and a test compound are contacted with a cell containing CD72 or a salt thereof or a membrane fraction of the cell.
Measuring the amount of binding of 100 or a salt thereof to the cell or the membrane fraction, and comparing the measured amount, and a method for screening a compound or a salt thereof that changes the binding property between CD100 or a salt thereof and CD72 or a salt thereof; When the labeled CD100 or a salt thereof is brought into contact with CD72 or a salt thereof expressed on a cell membrane by culturing a transformant containing DNA encoding CD72, By culturing a transformant containing DNA encoding CD72, C expressed on the cell membrane was obtained.
CD1 characterized by measuring and comparing the amount of labeled CD100 or a salt thereof to CD72 or a salt thereof when contacted with D72 or a salt thereof.
A method for screening a compound or a salt thereof that alters the binding property between 00 or a salt thereof and CD72 or a salt thereof,

When a compound that activates CD72 or a salt thereof (eg, CD100 or a salt thereof) is brought into contact with cells containing CD72 or a salt thereof,
Or a compound that activates a salt thereof and a test compound are represented by C
CD72 or its salt-mediated immune response promoting activity when contacted with cells containing D72 or a salt thereof [for example, production of antibodies such as antigen-specific IgG; TD
(T cell dependency) T cell reactivity such as antibody production against an antigen, T cell proliferation, IL-4 production, interferon gamma production; activity or suppression for promoting dendritic cell reactivity such as IL-12 production, etc. Activity, etc.)
Comparing CD100 or a salt thereof with C
A method for screening a compound or a salt thereof that alters the binding to D72 or a salt thereof, and a compound that activates CD72 or a salt thereof (for example,
CD72 or a salt thereof), when a transformant containing a DNA encoding CD72 is cultured, and a transformant containing the same is contacted with CD72 or a salt thereof expressed on a cell membrane by culturing the transformant. C. when the compound is contacted with CD72 or a salt thereof expressed on the cell membrane by culturing a transformant containing the DNA encoding CD72.
D72 or its salt-mediated immune reaction promoting activity [eg, production of antibodies such as antigen-specific IgG; production of antibodies against TD (T cell-dependent) antigens, proliferation of T cells, IL-
CD100 or a salt thereof, which measures T cell reactivity such as production of 4 or interferon gamma; activity promoting or suppressing dendritic cell reactivity such as production of IL-12, etc.] And a method of screening for a compound or a salt thereof that alters the binding property between CD72 and CD72 or a salt thereof.

The specific description of the screening method of the present invention is as follows. First, as the CD72 used in the screening method of the present invention, any CD72 may be used as long as it contains the above-mentioned CD72. It is. However, since it is extremely difficult to obtain human-derived organs in particular, CD72 or a salt thereof expressed in a large amount using a recombinant is suitable for screening. To produce CD72 or a salt thereof, the above-described methods and the like are used. In the screening method of the present invention, when cells containing CD72 or a salt thereof or the cell membrane fraction are used, the preparation method described below may be followed. When cells containing CD72 or a salt thereof are used, the cells may be immobilized with glutaraldehyde, formalin, or the like. The immobilization method can be performed according to a method known per se. The cell containing CD72 or a salt thereof refers to a host cell expressing CD72 or a salt thereof. Examples of the host cell include Escherichia coli, Bacillus subtilis, yeast, insect cells, animal cells, and the like. The membrane fraction refers to a fraction abundant in cell membrane obtained by disrupting cells and then obtained by a method known per se. As a method for crushing cells, a method of crushing cells with a Potter-Elvehjem type homogenizer, crushing with a Waring blender or a polytron (manufactured by Kinematica), crushing with ultrasonic waves, spouting cells from a thin nozzle while applying pressure with a French press, etc. Crushing and the like. For the fractionation of cell membranes, fractionation by centrifugal force such as fractionation centrifugation or density gradient centrifugation is mainly used. For example, a cell lysate is supplied at a low speed (500 rpm to 300 rpm).
0 rpm) for a short time (usually about 1 minute to 10 minutes),
The supernatant is further accelerated (15,000 rpm to 30,000 rpm).
m) for 30 minutes to 2 hours, and the resulting precipitate is used as a membrane fraction. The membrane fraction is rich in the expressed CD72 or a salt thereof and membrane components such as cell-derived phospholipids and membrane proteins.

The amount of CD72 or a salt thereof in a cell or a membrane fraction containing the CD72 or a salt thereof is preferably 10 ³ to 10 ⁸ molecules per cell, more preferably 10 ⁵ to 10 ⁷ molecules per cell. Is preferred. The higher the expression level, the higher the ligand binding activity (specific activity) per membrane fraction, which makes it possible not only to construct a highly sensitive screening system, but also to measure a large number of samples in the same lot. .
In order to carry out the above-mentioned (1) to screen for a compound that alters the binding between CD100 or a salt thereof and CD72 or a salt thereof, an appropriate CD72 fraction and a labeled ligand (CD100) are used. The CD72 fraction is preferably a natural CD72 fraction or a recombinant CD72 fraction having an activity equivalent thereto. Here, the equivalent activity indicates an equivalent ligand binding activity and the like. As the labeled ligand, a labeled ligand (CD100), a labeled ligand (CD100)
Analog compounds and the like are used. For example, [ ³ H], [
Ligands (CD100) labeled with ¹²⁵ I], [ ¹⁴ C], [ ³⁵ S] and the like can be used. In particular,
A labeled form of CD100 or a CD100 derivative prepared by a known method using a Bolton-Hunter reagent can also be used. Specifically, to screen for a compound that alters the binding between CD100 or a salt thereof and CD72 or a salt thereof, first, cells containing the CD72 or a salt thereof or a membrane fraction of the cell are suitable for screening. A receptor preparation is prepared by suspending in a buffer. Buffers include pH 4 to 10 (preferably pH
Any buffer may be used as long as it does not inhibit the binding between the ligand and the receptor, such as phosphate buffer and Tris-HCl buffer described in 6-8). For the purpose of reducing non-specific binding, a surfactant such as CHAPS, Tween-80 ^™ (Kao-Atlas), digitonin, and deoxycholate can be added to the buffer. Furthermore, to suppress the degradation of CD72 and CD100 by protease, P
Protease inhibitors such as MSF, leupeptin, E-64 (manufactured by Peptide Research Laboratories), and pepstatin can also be added. A certain amount (5,000 cpm to 500,000 cps) is added to 0.01 to 10 ml of the receptor solution.
m) labeled CD100 is added and simultaneously 10 ^-4 to 1
0 ^-1 coexist test compound [mu] M. A reaction tube to which a large excess of unlabeled CD100 or a salt thereof is added is also prepared in order to know the non-specific binding amount (NSB). The reaction is 0
C. to 50.degree. C., preferably 4 to 37.degree. C., for 20 minutes to 24 hours, preferably 30 minutes to 3 hours. After the reaction,
After filtration with a glass fiber filter or the like and washing with an appropriate amount of the same buffer, the radioactivity remaining on the glass fiber filter is measured with a liquid scintillation counter or a γ-counter.
When the count (B ₀ -NSB) obtained by subtracting the non-specific binding amount (NSB) from the count (B ₀ ) when there is no antagonistic substance is set to 100%, the specific binding amount (B-NSB) is, for example, 50%. % Of the test compound can be selected as a candidate substance capable of competitive inhibition. As a method for measuring the binding between CD72 or a salt thereof and CD100 or a salt thereof, BIAcore (manufactured by Amersham Pharmacia Biotech) can also be used. In this method, CD100 or a salt thereof or a derivative thereof is immobilized on a sensor chip by an amino coupling method according to a protocol attached to a device, and cells containing CD72 or a salt thereof or DNA containing a DNA encoding CD72 are transformed. Phosphate buffer or Tris buffer containing purified CD72 or a salt thereof or a membrane fraction containing CD72 or a salt thereof, or a purified CD72 or a salt thereof or a membrane fraction containing a CD72 or a salt thereof and a test compound, etc. Buffer solution on the sensor chip for 2 minutes
Pass through at a flow rate of -20 μl. C on sensor chip
Changes in binding between CD72 or a salt thereof and CD100 or a salt thereof by observing that a test compound that coexists changes in surface plasmon resonance caused by binding of D100 or a salt thereof to CD72 or a salt thereof changes Screening of the compound to be performed can be performed. In this method, CD72 or a salt thereof is immobilized on a sensor chip, and a buffer such as a phosphate buffer or Tris buffer containing CD100 or a salt thereof, or CD100 or a salt thereof and a test compound is passed over the sensor chip. Can also be measured in the same manner. Examples of the test compound include the same compounds as described above.

In order to carry out the above-mentioned method for screening a compound that alters the binding property between CD100 or a salt thereof and CD72 or a salt thereof, CD7
2 or its salt-mediated immune response promoting activity [for example, production of antibodies such as antigen-specific IgG; TD (T cell-dependent)
T cell reactivity such as antibody production against antigen, T cell proliferation, IL-4 production, interferon gamma production;
Activity for promoting or suppressing dendritic cell reactivity such as IL-12 production, etc.] can be measured using a known method or a commercially available measurement kit. Specifically, first, cells containing CD72 or a salt thereof are cultured in a multiwell plate or the like. Before performing screening, replace the cells with fresh medium or an appropriate buffer that is not toxic to cells, add test compounds, etc., incubate for a certain period of time, and then extract cells or collect supernatant to generate cells. The quantified product is quantified according to each method. When the production of a substance (for example, the amount of antigen-specific IgG, interferon gamma, interleukin 12 and the like) as an indicator of the immune response promoting activity is difficult to be assayed by a degrading enzyme contained in cells, an inhibitor for the degrading enzyme is used. The assay may be performed with additions. For screening by measuring an immune response promoting activity such as antibody production, cells expressing appropriate CD72 or a salt thereof are used. As cells expressing CD72 or a salt thereof, B cells and the above-mentioned recombinant CD72-expressing cell line are desirable. The CD72-expressing cell as a transformant may be a stable expression strain or a transient expression strain. Also,
The same kind of animal cell as described above is used. Test compounds include, for example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, and the like.

More specifically, the following assay system is used for the above-mentioned ligand / receptor assay system. (1) When a receptor-expressing cell is stimulated by a receptor agonist, a phenomenon occurs in which intracellular class switching and production or secretion of any of antibodies IgG, IgA, IgD and IgE other than IgM are promoted. The amount of antibody produced and secreted can be measured by ELISA using a directly or indirectly labeled anti-Ig antibody to measure the activity of the receptor agonist to promote antibody production. Using this reaction, the activity of CD100 to promote the production of antibodies against CD72-expressing cells can be measured. Specifically, it is performed by a second embodiment described later and a method according to the second embodiment. Here, CD100 or a salt thereof, or CD100 or a salt thereof and a test compound are added,
By observing that a change occurs in the activity of promoting antibody production as compared to the case where CD100 or a salt thereof is administered alone, CD
Compounds that alter the binding between 100 or a salt thereof and CD72 or a salt thereof can be screened. At this time, a compound exhibiting an activity of suppressing the antibody production promoting activity of CD100 on CD72-expressing cells by CD100 can be selected as a candidate substance having a competitive inhibition ability. On the other hand, an agonist can also be screened by administering only a test compound and observing the activity of promoting antibody production on CD72-expressing cells. One example of the screening method is described below more specifically. 1 × 10 ⁵ cells prepared by the method described in Example 2 below
/ Well splenic-derived resting B cells together with anti-CD40 monoclonal antibody, IL-4 100 units / ml, normal, CD100 fixed with paraformaldehyde
Expressing CHO cells (2 × 10 ⁴ cells / well)
Culture in a flat-bottom 96-well microtiter plate for about 7 days in the presence of 1). The production of IgM or IgG1 immunoglobulin is measured by ELISA. Specifically, the culture solution or control IgM or IgG was diluted with 0.1 M carbonate buffer (pH 9.6), and 100 μl was added to each well of a 96-well immunoplate for EIA (Maxisorp: Nunc). Inject and leave overnight at about 4 ° C. for impregnation. After washing each well with buffer A (0.02 M phosphate buffer at pH 7.0 containing 0.15 M NaCl), buffer B (p with 0.1% BSA, 0.15 M NaCl) was added.
100 μl of an enzyme-labeled anti-IgM, IgG, IgA, IgD, IgE antibody solution diluted with H2 (0.02 M phosphate buffer) is added, and the mixture is further reacted at 25 ° C. for about 2 hours. Each well was washed with buffer A, and an alkaline phosphatase substrate solution (1 mg / ml phosphatase substrate (Sigma), 100 mM Tris (pH 9.5),
100 mM NaCl, 5 mM MgCl2)
Add and react at 25 ° C for 30 minutes. The absorbance at 405 nm is measured using an automatic colorimeter for microplate. The absorbance of the experimental group to which only CD100 or its salt was added was set to 100%, and the absorbance of the experimental group to which CD100 or its salt was not added was set to 0%, and the effect of the test compound on the antibody production promoting activity by CD100 or its salt was calculated. . A test compound having an antibody production promoting activity of, for example, 50% or less can be selected as a candidate substance having competitive inhibitory ability.

A screening kit for a compound or a salt thereof that alters the binding between CD100 or a salt thereof and CD72 or a salt thereof includes CD72 or a salt thereof, CD72 or a salt thereof.
72 or a salt thereof, or a membrane fraction of cells containing CD72 or a salt thereof, and CD100
Or a salt thereof. Examples of the screening kit of the present invention include the following. 1. Screening reagents Measurement and wash buffers Hanks' Balanced Salt Solution
ion (manufactured by Gibco) plus 0.05% bovine serum albumin (manufactured by Sigma). The solution may be sterilized by filtration through a 0.45 μm filter and stored at 4 ° C., or may be prepared at use. CD72 standard CHO cells expressing CD72 or a salt thereof were
Passage to a well plate at 5 × 10 ⁵ / well, 37 ° C., 5%
Cultured for 2 days in CO ₂ , 95% air. CD100 or a salt thereof labeled with a labeled ligand [ ³ H], [ ¹²⁵ I], [ ¹⁴ C], [ ³⁵ S] or the like. The solution dissolved in an appropriate solvent or buffer is stored at 4 ° C. or −20 ° C., and diluted to 1 μM with a measuring buffer before use. Ligand standard solution CD100 or a salt thereof is dissolved to a concentration of 1 mM in PBS containing 0.1% bovine serum albumin (manufactured by Sigma) and stored at -20 ° C.

2. Assay method Cells expressing CD72 or a salt thereof cultured on a 12-well tissue culture plate were mixed with 1 ml of a measurement buffer solution.
After washing twice, 490 μl of measurement buffer is added to each well. After adding 5 μl of a test compound solution of 10 ⁻³ to 10 ⁻¹⁰ M, 5 μl of labeled CD100 or a salt thereof is added, and reacted at room temperature for 1 hour. To determine the amount of non-specific binding, 5 μl of 10 ⁻³ M ligand is added instead of the test compound. Remove the reaction solution and wash 3 times with 1 ml of washing buffer. The labeled ligand bound to the cells was 0.2N NaOH
1% SDS, 4 ml of liquid scintillator A
(Made by Wako Pure Chemical Industries). Liquid scintillation counter (Beckman)
Radioactivity was measured using Percent Maximum Binding
(PMB) is obtained by the following equation (Equation 1). [Equation 1] PMB = [(B−NSB) / (B ₀ −NSB)] × 10
0 PMB: Percent Maximum Binding B: Value when a sample is added NSB: Non-specific Binding (Non-specific binding amount) B ₀ : Maximum binding amount

The compound or a salt thereof obtained by using the screening method or the screening kit of the present invention changes the binding property between CD100 or a salt thereof and CD72 or a salt thereof (inhibits or promotes the binding).
A compound having an immune response promoting activity such as antibody production via CD72 or a salt thereof or a salt thereof (so-called CD72 agonist), or a compound not having the immune response promoting activity (so-called CD72)
Antagonist). Examples of the compound include a peptide, a protein, a non-peptidic compound, a synthetic compound, a fermentation product, and the like. These compounds may be novel compounds or known compounds. The above C
A specific method for evaluating whether a compound is a D72 agonist or an antagonist may be in accordance with the following (i) or (ii). (I) After performing a binding assay shown in the above-mentioned screening method to obtain a compound that changes the binding property (particularly, inhibits the binding) of CD100 or a salt thereof to CD72 or a salt thereof, It is determined whether or not it has the above-mentioned activity of promoting immune response such as CD72-mediated antibody production. The compound having an immune response promoting activity or a salt thereof is a CD72 agonist,
The compound having no such activity or a salt thereof is a CD72 antagonist. (Ii) (a) The test compound is brought into contact with cells containing CD72 or a salt thereof, and the activity of promoting immune response such as antibody production via the above-mentioned CD72 or a salt thereof is measured. The compound having an immune response promoting activity or a salt thereof is a CD72 agonist. (b) converting a compound that activates CD72 or a salt thereof (eg, CD100 or a CD72 agonist) to CD
72 or a cell containing the salt thereof,
When a compound that activates CD72 or a salt thereof and a test compound are contacted with cells containing CD72 or a salt thereof, the activity of promoting an immune response such as antibody production through CD72 or a salt thereof is measured and compared. CD
A compound or a salt thereof that can reduce the immune response promoting activity of a compound that activates 72 or a salt thereof is a CD72 antagonist. The CD72 agonist comprises CD
CD100 or a salt thereof has an action similar to that of CD100 or a salt thereof.
It is useful as a safe and low toxic pharmaceutical like 00 or its salt. Conversely, the CD72 antagonist is CD7
Since the physiological activity of CD100 or a salt thereof against CD2 or a salt thereof can be suppressed, the compound is useful as a safe and low-toxic drug for suppressing the receptor activity.
Further, like CD72 antagonist, CD72 or a salt thereof can suppress the physiological activity of CD100 or a salt thereof, and thus is useful as a safe and low-toxicity drug. Since CD100 or a salt thereof is involved in the action of inducing class switching and the action of promoting antibody production, it can be used as an antibody production inducer, an immunostimulant, or the like. Therefore, among the compounds obtained by using the above-described screening method or screening kit, CD72 agonist is a viral infection or disease (cold syndrome, influenza, AIDS,
Hepatitis, herpes, measles, varicella, hand-foot-and-mouth disease, shingles, erythema infectivity, rubella, sudden rash, viral conjunctivitis, viral meningitis, viral pneumonia, viral encephalitis, Lassa fever, Ebola hemorrhagic fever, Marburg disease, Congo hemorrhagic fever, yellow fever, dengue, rabies, adult T-cell leukemia (AT
L), rotavirus infection, polio, mumps, etc., bacterial or fungal infections or diseases (bacterial food poisoning, bacterial diarrhea, tuberculosis, leprosy, dysentery, typhoid, cholera, paratyphoid, plague, tetanus, hares) disease,
Brucellosis, anthrax, sepsis, bacterial pneumonia, dermatomycosis, etc., including cancer (oral, pharyngeal, lip, tongue, gingival, nasopharyngeal, esophageal, gastric, small intestine, colon cancer) Colorectal cancer,
Liver, gallbladder, pancreatic, nasal, lung, osteosarcoma, soft tissue, skin, melanoma, breast, uterine, ovarian, prostate, testicular, penile, bladder, kidney, It can be used as a prophylactic / therapeutic agent for brain tumor, thyroid cancer, lymphoma, leukemia, etc., and a CD72 antagonist (or CD72 or a salt thereof) is caused by abnormal antibody production or excessive antibody production (atopic asthma, Allergic rhinitis, atopic dermatitis, allergic bronchitis, pulmonary aspergillosis, parasitic disease, Kimura's disease, high IgE syndrome, Wiskott-Aldri
ch syndrome, thymic dysplasia, Hodkin's disease, cirrhosis, acute hepatitis, rheumatoid arthritis, insulin-dependent diabetes mellitus, systemic lupus erythematosus, scleroderma, infertility,
Endometriosis, autoimmune thyroid disease myasthenia gravis, Hashimoto's disease, Basedow's disease, pernicious anemia, Addison's disease,
Male infertility, multiple sclerosis, Goodpasture syndrome, pemphigus, pemphigoid, myasthenia gravis, lens ophthalmitis, sympathetic ophthalmitis, autoimmune hemolytic anemia, idiopathic thrombocytopenia, autoimmunity Leukopenia, Felty syndrome,
Autoimmune lymphopenia, ulcerative colitis, Sjogr
en syndrome, systemic autoimmune diseases, primary biliary cirrhosis, lupoid hepatitis, etc.).

The salts of the compounds obtained by using the above-mentioned screening method or screening kit include:
For example, pharmaceutically acceptable salts and the like are used. For example, salts with inorganic bases, salts with organic bases, salts with inorganic acids,
Salts with organic acids, salts with basic or acidic amino acids and the like can be mentioned. Preferable examples of the salt with an inorganic base include, for example, alkali metal salts such as sodium salt and potassium salt, alkaline earth metal salts such as calcium salt and magnesium salt, and aluminum salt and ammonium salt. Preferred examples of the salt with an organic base include, for example, trimethylamine, triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine, N, N'-dibenzylethylenediamine And salt. Suitable examples of salts with inorganic acids include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid,
Salts with phosphoric acid and the like can be mentioned. Suitable examples of salts with organic acids include, for example, formic acid, acetic acid, propionic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, benzoic acid And the like. Preferred examples of the salt with a basic amino acid include, for example, salts with arginine, lysine, ortin, and preferable examples of the salt with an acidic amino acid include, for example, salts with aspartic acid, glutamic acid, and the like. When a compound or a salt thereof obtained by using the screening method or the screening kit of the present invention is used as a medicament, it can be carried out according to a conventional means. For example, a sugar-coated or enteric-coated tablet as required, a capsule, a elixir, orally as a microcapsule, or a sterile solution with water or another pharmaceutically acceptable liquid, Alternatively, it can be used parenterally in the form of injections such as suspensions. For example, the compound or a salt thereof is mixed with physiologically acceptable carriers, flavors, excipients, vehicles, preservatives, stabilizers, binders and the like in a unit dosage form required for generally accepted pharmaceutical practice. Can be manufactured. The amount of the active ingredient in these preparations is such that an appropriate dose in the specified range can be obtained.

Examples of additives that can be mixed with tablets, capsules and the like include binders such as gelatin, corn starch, tragacanth gum, gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid and the like. And a lubricating agent such as magnesium stearate, a sweetening agent such as sucrose, lactose or saccharin, a flavoring agent such as peppermint, reddish oil or cherry, and the like. When the preparation unit form is a capsule, a liquid carrier such as oil and fat can be further contained in the above-mentioned type of material. Sterile compositions for injection can be formulated according to normal pharmaceutical practice such as dissolving or suspending the active substance in vehicles such as water for injection, naturally occurring vegetable oils such as sesame oil, coconut oil and the like. .

Examples of the aqueous liquid for injection include physiological saline, isotonic liquid containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.). You may use together with a solubilizing agent, for example, alcohol (for example, ethanol), polyalcohol (for example, propylene glycol, polyethylene glycol), nonionic surfactant (for example, polysorbate 80 ( ^TM ), HCO-50).
The oily liquid includes sesame oil, soybean oil and the like, and may be used in combination with solubilizers such as benzyl benzoate and benzyl alcohol.

Also, a buffer (for example, a phosphate buffer,
Sodium acetate buffer), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, human serum albumin, polyethylene glycol, etc.), preservatives (eg, benzyl alcohol, phenol, etc.), antioxidants And the like. The prepared injection is usually filled in a suitable ampoule.

The preparations thus obtained are safe and have low toxicity, and are, for example, humans and mammals (eg, mice, rats, guinea pigs, rabbits, sheep, pigs, cows, cats, dogs, monkeys, chimpanzees, etc.). Can be administered. The dose of a compound or a salt thereof obtained by using the screening method or the screening kit of the present invention varies depending on symptoms and the like. About 0.1 to 1000 mg, preferably about 1.0 to 300 mg, more preferably about 3.
0 to 50 mg. In the case of parenteral administration, the single dose varies depending on the administration subject, target organ, symptoms, administration method, and the like. About 0.01 to 30 mg per day, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg
It is convenient to administer the degree by intravenous injection. In the case of other animals, the dose can be administered in terms of 60 kg. When CD72 or a salt thereof is used as a medicine, the compound or a salt thereof obtained by using the above-described screening method or screening kit of the present invention or a salt thereof can be formulated and carried out in the same manner as in the case of using it as a medicine.

[Non-human animal in which CD100 gene is knocked out] A non-human animal in which the CD100 gene is knocked out (hereinafter, sometimes referred to as a non-human animal lacking CD100 gene expression) is a non-human animal having an inactivated CD100 gene sequence. It can be produced using human animal ES cells. Non-human animal ES having the inactivated CD100 gene sequence
A cell is a CD100 gene of a non-human animal ES cell that is artificially mutated to suppress the gene expression ability or to encode a CD encoded by the gene.
The gene refers to an ES cell of a non-human animal in which the gene is substantially incapable of expressing CD100 by substantially eliminating the activity of CD100 (hereinafter, may be referred to as a knockout gene). CD as a non-human animal
Any animal other than a human having 100 genes may be used, but a non-human mammal is preferred. As non-human mammals, for example, cows, pigs, sheep, goats,
Rabbits, dogs, cats, guinea pigs, hamsters, mice, rats and the like are used. Among non-human mammals, the ontogeny and biological cycle are relatively short from the viewpoint of creating a disease animal model system, and rodents, particularly mice, which are easy to breed (for example, C57BL as a pure strain,
/ 6 line, DBA2 line, etc.
F1 system, BDF1 system, B6D2F1 system, BALB
/ C strain, ICR strain, etc.) or rat (eg, W
istar, SD, etc.) are particularly preferred. CD10
The zero gene may be a genome-derived CD100 gene isolated and extracted from an animal, or a CD100c cloned using a genetic engineering technique.
It may be DNA. Specifically, as the gene for the mouse-derived CD100 protein having the amino acid sequence represented by SEQ ID NO: 1, for example, a gene having the base sequence represented by SEQ ID NO: 2 is used, and the gene represented by SEQ ID NO: 3 is used. -Derived CD having amino acid sequence
As a gene for 100 proteins, for example, SEQ ID NO: 4
A gene having a base sequence represented by is used. These genes can be obtained according to the method described above.

As a method for artificially mutating the CD100 gene, for example, a part or all of the gene sequence can be deleted by genetic engineering techniques, and another gene can be inserted or substituted. By these mutations, for example, a knockout gene of CD100 can be prepared by shifting the codon reading frame or disrupting the function of the promoter or exon. Specific examples of non-human animal embryonic stem cells having an inactivated CD100 gene sequence (hereinafter abbreviated as CD100 gene inactivated ES cells or knockout ES cells) include, for example, drug resistance genes (for example, neomycin resistance gene, hygroglobin). Insertion of a mycin resistance gene or the like, preferably an omycin resistance gene, or a reporter gene (eg, lacZ (β-galactosidase gene), cat (chloramphenicol acetyltransferase gene), preferably lacZ or the like) By inserting a DNA sequence that terminates gene transcription (eg, a polyA addition signal) into the introns between exons, thereby disabling the synthesis of complete messenger RNA. Resulting in DNA strand having a DNA sequence which terminates gene (hereinafter simply referred to as targeting vector) to produce. When a reporter gene is inserted to disrupt the function of an exon, the reporter gene is preferably inserted so as to be expressed under the control of the CD100 promoter. Furthermore, a DNA strand having a DNA sequence constructed so as to disrupt the gene is introduced into the chromosome of the animal by, for example, homologous recombination, and the obtained ES cell is probed with a DNA sequence on or near the CD100 gene. The DNA sequence on the targeting vector and the DNA sequence of the neighboring region other than the CD100 gene used for the preparation of the targeting vector were analyzed by PCR using primers as primers,
It can be obtained by selecting knockout ES cells.

Examples of the ES cells from which the CD100 gene is inactivated by the homologous recombination method include, for example,
You may use the one already established as mentioned above,
It may be newly established according to the method of Evans and Kaufma. For example, in the case of mouse ES cells, currently, 129 line ES cells are generally used. However, since the immunological background is not clear, a pure line instead of this is used as an immunological genetic background. For example, C57BL / 6 mice or C57BL /
BDF1 mice (F57 of C57BL / 6 and DBA / 2
Those established using 1) can also be used favorably. BD
The F1 mouse has the advantage that the number of eggs collected is large and the eggs are robust, and further, since the C57BL / 6 mouse is used as a background, the ES cells obtained by using the C57BL / 6 mouse are It can be advantageously used in that the genetic background can be replaced by C57BL / 6 mice by backcrossing with C57BL / 6 mice. Also, E
When S cells are established, blastocysts 3.5 days after fertilization are generally used. In addition, a large number of initial cells can be efficiently obtained by collecting an 8-cell stage embryo and culturing the blastocysts until use. Embryos can be obtained. Either male or female ES cells may be used, but generally male ES cells are more convenient for producing a germline chimera. It is also desirable to discriminate between males and females as soon as possible in order to reduce cumbersome culture labor. As a method for determining the sex of ES cells, for example, a method of amplifying and detecting a gene in the sex-determining region on the Y chromosome by PCR can be mentioned. By using this method, the number of ES cells of about 1 colony (about 50 cells) is sufficient, whereas the conventional method required about 106 cells for karyotype analysis. In the above, the primary selection of ES cells can be performed by discriminating between male and female, and by enabling selection of male cells at an early stage, labor in the initial stage of culture can be greatly reduced.

The secondary selection can be performed, for example, by confirming the number of chromosomes by the G-banding method. The number of chromosomes in the obtained ES cells is desirably 100% of the normal number. However, when it is difficult due to physical operations or the like at the time of establishment, after knocking out the gene of the ES cells, the cells can be knocked out of normal cells (for example, chromosome in mice). Number is 2n
= Cells). The embryonic stem cell line obtained in this way usually has very good growth properties, but must be carefully subcultured because it tends to lose its ontogenetic ability. For example, on a suitable feeder cell such as STO fibroblast, in a carbon dioxide incubator (preferably 5% carbon dioxide, 95% air or 5%) in the presence of LIF (1-10000 U / ml).
% Oxygen, 5% carbon dioxide gas, 90% air) at about 37 ° C., and at the time of subculture, for example, trypsin / EDTA solution (usually 0.001-0.5% trypsin / 0.5%). 1-5 mM EDTA, preferably about 0.1% trypsin / 1 mM EDTA) treatment to form a single cell,
A method of seeding on newly prepared feeder cells is used. Such passage is usually performed every 1-3 days. At this time, cells are observed, and if morphologically abnormal cells are found, it is desired that the cultured cells be discarded. ES cells are differentiated into various types of cells, such as parietal, visceral, and cardiac muscles, by monolayer culture up to high density or suspension culture until cell clumps are formed under appropriate conditions. (M.
J. Evans and MH Kaufman, Nature 2
92, 154, 1981; GR Martin Proceedings of National Academy of Science USA (Proc. Natl. Acad. Sci. USA)
78, 7634, 1981; TC Doetschman et al., Journal of Embryology and Experimental Morphology, 87, 27, 1985], E
Cells deficient in CD100 gene expression obtained by differentiating S cells are useful in cell biology of CD100 in vitro.

A transgenic non-human animal having an inactivated CD100 gene sequence (hereinafter sometimes referred to as a gene expression-deficient non-human animal) includes, for example, a non-human animal embryo having the inactivated CD100 gene sequence. It is created by genetic engineering using stem cell-derived cells, and is, for example, a non-human animal in which the inactivated CD100 gene sequence has been introduced into germ cells and somatic cells at an early stage of embryogenesis. As the non-human animal, the same one as described above is used. To knock out the CD100 gene,
The above-mentioned targeting vector is introduced into mouse embryonic stem cells or mouse egg cells, and the inactivated CD100 gene sequence of the targeting vector is replaced with the CD100 gene on the chromosome of mouse embryonic stem cells or mouse egg cells by gene homologous recombination. be able to. Cells in which the CD100 gene was knocked out were subjected to Southern hybridization analysis using a DNA sequence on or near the CD100 gene as a probe or a DNA sequence derived from a mouse used for the targeting vector.
It can be determined by analysis by PCR using a DNA sequence of a nearby region other than the gene as a primer. When non-human animal embryonic stem cells are used, a cell line in which the CD100 gene has been inactivated is cloned by homologous recombination, and the cells are cloned at an appropriate time in the early stage of embryogenesis, for example, at the 8-cell stage. The chimeric embryo is injected into a human animal embryo or blastocyst, and the resulting chimeric embryo is implanted into the uterus of the pseudopregnant non-human animal. The produced animal is a chimeric animal composed of both cells having a normal CD100 locus and cells having an artificially mutated CD100 locus. When a part of the germ cells of the chimeric animal has a mutated CD100 locus, all tissues were artificially mutated from a population obtained by crossing such a chimeric individual with a normal individual. It can be obtained by selecting individuals composed of cells having the CD100 locus, for example, by judging coat color or the like. The individual obtained in this manner is usually an individual having a defective expression of CD100,
100 heterozygous expression-deficient individuals can be crossed to obtain CD100 homoexpression-deficient individuals from their offspring.
When using an egg cell, for example, a transgenic non-human animal having a targeting vector introduced into a chromosome can be obtained by injecting a gene solution into the egg cell nucleus by a microinjection method, and these transgenic non-human animals can be obtained. In comparison with the above, it can be obtained by selecting those having a mutation at the CD100 locus by homologous recombination. Non-human animals deficient in CD100 gene expression can be distinguished from normal animals by measuring the mRNA levels of the animals using known methods and indirectly comparing the expression levels.

In the individual knocked out of the CD100 gene in this manner, the animal obtained by crossing can confirm that the gene has been knocked out, and can be reared in a normal rearing environment. . Furthermore, the germ line can be obtained and maintained according to a conventional method. That is, by crossing male and female animals having the inactivated gene sequence, a homozygote animal having the inactivated gene sequence on both homologous chromosomes can be obtained. The obtained homozygous animal can be efficiently obtained by rearing the mother animal in such a manner that one homozygote and one normal animal are obtained. By mating male and female heterozygous animals, homozygous and heterozygous animals having the inactivated gene sequence can be bred and passaged. The progeny of the animal having the inactivated gene sequence thus obtained is also included in the non-human animal deficient in CD100 gene expression. Such non-human animal embryonic stem cells in which the CD100 gene has been inactivated are extremely useful for producing a non-human animal deficient in CD100 gene expression. The non-human animal deficient in CD100 gene expression produced as described above has a reduced antibody-producing ability against a TD (T cell-dependent) antigen (Example 6 described later), T cell proliferation, IL-4
Non-human animal with loss of T cell reactivity such as ability to produce INF-γ (Example 7 described below) and dendritic cell reactivity such as IL-12 productivity (Example 10 described later) And diseases caused by CD100 deficiency, for example, CD
Diseases resulting from inactivation of the biological activity of CD100, based on the loss of various biological activities that can be induced by 100;
For example, viral infections or diseases (cold syndrome, influenza, AIDS, hepatitis, herpes, measles,
Chickenpox, hand-foot-and-mouth disease, shingles, erythema contagiosus, rubella, idiopathic rash, viral conjunctivitis, viral meningitis, viral pneumonia, viral encephalitis, Lassa fever, Ebola hemorrhagic fever, Marburg disease, Congo hemorrhagic fever, yellow fever , Dengue, rabies, adult T-cell leukemia (ATL), rotavirus infection, polio, mumps, etc., bacterial or fungal infections or diseases (bacterial food poisoning, bacterial diarrhea, tuberculosis, leprosy, dysentery, typhoid fever) , Cholera, paratyphoid, plague, tetanus, tularemia, brucellosis, anthrax, sepsis, bacterial pneumonia, dermatomycosis, etc., cancer (oral cancer, pharyngeal cancer, lip cancer, tongue cancer, gingival cancer, nasopharyngeal cancer, Esophageal cancer, gastric cancer,
Colorectal cancer including small intestine cancer, colon cancer, liver cancer, gallbladder cancer, pancreatic cancer, nasal cavity cancer, lung cancer, osteosarcoma, soft tissue cancer, skin cancer, melanoma, breast cancer, uterine cancer, ovarian cancer, prostate cancer, testicular cancer , Penis cancer, bladder cancer, kidney cancer, brain tumor, thyroid cancer, lymphoma, leukemia, etc.), and is useful for investigating the causes of these diseases and examining treatment methods. That is, CD
The non-animals deficient in 100 gene expression can be used for screening for a preventive / therapeutic agent for the disease.

The non-human animal deficient in CD100 gene expression used in the screening method of the present invention includes:
The same thing as the above is mentioned. As test compounds,
For example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, and the like, and these compounds may be novel compounds or known compounds It may be a compound. Specifically, a non-human animal deficient in CD100 gene expression is treated with a test compound and compared with a non-treated control animal.・ The effect of treatment can be tested. As a method of treating a test animal with a test compound, for example, oral administration, intravenous injection and the like are used, and it can be appropriately selected according to the symptoms of the test animal, the properties of the test compound, and the like. In addition, the dose of the test compound can be appropriately selected according to the administration method, properties of the test compound, and the like. For example, when screening for a prophylactic / therapeutic agent for cancer, C
After administering, for example, keyhole limpet hemocyanin to a non-human animal deficient in D100 gene expression, a test substance is sequentially administered intraperitoneally, subcutaneously, intravenously, etc., and the amount of interferon gamma or IL-12 in blood is measured. Screening can be performed. In addition, the tumor is implanted intraperitoneally, subcutaneously, or intravenously, and the test substance is administered intraperitoneally,
It can be screened by administering it subcutaneously, intravenously, or the like, and measuring the tumor volume or survival time.

The prophylactic / therapeutic agent obtained by the screening method using a non-human animal in which the CD100 gene has been knocked out of the present invention is a compound selected from the above-mentioned test compounds, and is for preventing or preventing a disease caused by CD100 deficiency. Since it has a therapeutic effect, it is useful as a medicament such as a safe and low toxic therapeutic / prophylactic drug for diseases caused by CD100 deficiency. Further, a compound derived from the compound can also be used. The compound obtained by the screening method may form a salt, and the salt of the compound is preferably a physiologically acceptable acid addition salt. As such a salt, for example, a salt with an inorganic acid (for example, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or an organic acid (for example, acetic acid,
For example, salts with formic acid, propionic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, and benzenesulfonic acid are used. The screening method of the present invention using a non-human animal in which the CD100 gene has been knocked out is carried out in combination with the above-described screening method for a compound or a salt thereof that alters the binding between CD100 and CD72 (ligand / receptor assay system). Is also good. That is, the present invention uses a non-human animal in which the CD100 gene has been knocked out, and comprises a compound that changes the binding between CD100 or a salt thereof and its receptor (particularly, enhances the binding between CD100 and CD72). Or a compound thereof that binds to CD72 by replacing CD100) or a salt thereof. Here, a ligand-receptor assay system is used as a primary screening to select a compound that changes the binding between CD100 and CD72 as a candidate compound.
The prophylactic / therapeutic effects of the candidate compound may be tested in a secondary screening system using a non-human animal in which 100 genes have been knocked out, or a primary screening method using a non-human animal in which the CD100 gene has been knocked out. After selecting a candidate compound as
A compound that changes the binding between CD100 and CD72 obtained by subjecting to a secondary screening of a receptor assay system may be selected as a candidate compound for the prophylactic / therapeutic agent of the present invention.

When a compound or a salt thereof obtained by the screening method using a non-human animal in which the CD100 gene of the present invention has been knocked out is used as the above-mentioned therapeutic or prophylactic agent, it can be carried out in a conventional manner.
For example, sugar-coated tablets, capsules,
It can be used orally as elixirs, microcapsules and the like, or parenterally in the form of injections such as sterile solutions or suspensions with water or other pharmaceutically acceptable liquids. For example, the compound or a salt thereof is mixed with physiologically acceptable carriers, flavors, excipients, vehicles, preservatives, stabilizers, binders and the like in a unit dosage form required for generally accepted pharmaceutical practice. Can be manufactured. The amount of the active ingredient in these preparations is such that an appropriate dose in the specified range can be obtained. Examples of additives that can be incorporated into tablets, capsules and the like include binders such as gelatin, corn starch, tragacanth, and gum arabic.
Excipients such as crystalline cellulose, leavening agents such as corn starch, gelatin, alginic acid, lubricants such as magnesium stearate, sweeteners such as sucrose, lactose or saccharin, peppermint, reddish oil or cherry. Such flavoring agents are used. When the preparation unit form is a capsule, a liquid carrier such as oil and fat can be further contained in the above-mentioned type of material. Sterile compositions for injection can be formulated according to normal pharmaceutical practice such as dissolving or suspending the active substance in vehicles such as water for injection, and naturally occurring vegetable oils such as sesame oil, coconut oil and the like.

Examples of the aqueous solution for injection include physiological saline, isotonic solution containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.). Auxiliaries, for example, alcohols (eg, ethanol and the like), polyalcohols (eg, propylene glycol, polyethylene glycol and the like), nonionic surfactants (eg, polysorbate 80TM, HCO-50 and the like) may be used in combination. . As the oily liquid, for example, sesame oil, soybean oil, and the like, and benzyl benzoate as a solubilizer,
You may use together with benzyl alcohol etc. In addition, buffers (eg, phosphate buffer, sodium acetate buffer, etc.), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, human serum albumin, polyethylene glycol, etc.), Preservatives (for example,
Benzyl alcohol, phenol, etc.), antioxidants and the like. The prepared injection is usually filled in a suitable ampoule. The preparations obtained in this way are safe and low toxic, for example, human or warm-blooded animals (eg, mouse, rat, rabbit, sheep, pig, cow, horse, bird, cat, dog, monkey, chimpanzee, etc.) ) Can be administered. The dose of the compound or a salt thereof varies depending on symptoms and the like, but in the case of oral administration, generally, in an adult (with a body weight of 60 kg), about 0.1 to 100 mg, preferably about 1. 0 to 50 mg, more preferably about 1.0 to 20 mg
It is. In the case of parenteral administration, the single dose varies depending on the administration subject, target organ, symptoms, administration method and the like. It is convenient to administer about 0.01 to 30 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg by intravenous injection. In the case of other animals, the dose can be administered in terms of 60 kg.

Further, the present invention provides a method for screening a compound or a salt thereof which promotes or inhibits CD100 promoter activity, which comprises administering a test compound to a non-human animal lacking CD100 gene expression and detecting the expression of a reporter gene. Provide a way. The non-human animal deficient in CD100 gene expression used in the screening method of the present invention, among the non-human animals deficient in CD100 gene expression described above, has a CD100 gene sequence inactivated by introducing a reporter gene,
A reporter gene that can be expressed under the control of the CD100 promoter is used. As test compounds,
The same thing as the above is mentioned. As the reporter gene, the same one as described above is used, and the β-galactosidase gene (lacZ) is more preferably used.
In a CD100-expressing animal in which the structural gene of CD100 was replaced with a reporter gene, the reporter gene was CD1
Since it is under the control of the 00 promoter, the activity of the CD100 promoter can be detected by tracing the expression of the substance encoded by the reporter gene.

For example, when a part of the gene region encoding CD100 is replaced by a β-galactosidase gene (lacZ) derived from Escherichia coli, β-galactosidase is expressed instead of CD100 in a tissue that originally expresses CD100. I do. Thus, for example, 5-bromo-4-
Chloro-3-indolyl-β-galactopyranoside (X
By staining with a reagent serving as a substrate for β-galactosidase such as -gal), the expression state of CD100 in an animal body can be easily observed.
Specifically, a CD100-deficient mouse or a tissue section thereof is fixed with glutaraldehyde or the like, washed with Dulbecco's phosphate buffered saline (PBS), and then stained with X-gal at room temperature or around 7 ° C. After reacting for about 30 minutes to 1 hour, the tissue specimen was diluted with 1 mM EDTA / PBS.
By washing with a solution, the β-galactosidase reaction may be stopped and the color may be observed. Further, mRNA encoding lacZ may be detected according to a conventional method.
Thus, a non-human animal deficient in CD100 gene expression is
It is extremely useful in screening for a compound or a salt thereof that promotes or inhibits and inactivates the CD100 promoter, and can greatly contribute to the investigation of the causes of various diseases caused by CD100 expression deficiency or the development of preventive / therapeutic agents.

The compound or a salt thereof obtained by using the above-mentioned screening method is a compound selected from the above-mentioned test compounds and is a compound that promotes or inhibits the CD100 promoter activity. The compound or its salt that promotes CD100 promoter activity can promote the expression of CD100 and enhance the function of CD100. Thus, for example, infection or disease caused by a virus (cold syndrome, influenza, AIDS, hepatitis, herpes, Measles, varicella, hand-foot-and-mouth disease, shingles, erythema contaminated, rubella, sudden rash, viral conjunctivitis, viral meningitis, viral pneumonia, viral encephalitis, Lassa fever, Ebola hemorrhagic fever,
Marburg disease, Congo haemorrhagic fever, yellow fever, dengue, rabies, adult T-cell leukemia (ATL), rotavirus infection, polio, mumps, etc., bacterial or fungal infections or diseases (bacterial food poisoning, bacterial diarrhea, Tuberculosis, leprosy, dysentery, typhoid fever, cholera, paratyphoid, plague, tetanus, tularemia, brucellosis, anthrax, sepsis, bacterial pneumonia, cutaneous mycosis, etc., cancer (oral cancer, pharyngeal cancer, lip cancer, tongue) Cancer, gingival, nasopharyngeal, esophageal, gastric,
Colorectal cancer including small intestine cancer, colon cancer, liver cancer, gallbladder cancer, pancreatic cancer, nasal cavity cancer, lung cancer, osteosarcoma, soft tissue cancer, skin cancer, melanoma, breast cancer, uterine cancer, ovarian cancer, prostate cancer, testicular cancer , Penile cancer, bladder cancer, kidney cancer, brain tumor, thyroid cancer, lymphoma, leukemia, etc.) and are useful as pharmaceuticals such as safe and low toxic therapeutic / prophylactic agents. On the other hand, CD10
A compound or a salt thereof that inhibits promoter activity is
It can inhibit the expression of CD100 and inhibit the function of CD100, for example, diseases caused by abnormal or excessive antibody production (eg, atopic asthma, allergic rhinitis, atopic dermatitis, allergic disease) Bronchitis, pulmonary aspergillosis, parasitic disease, Kimura's disease, high IgE syndrome, Wiskott-Aldri
ch syndrome, thymic dysplasia, Hodkin's disease, cirrhosis, acute hepatitis, rheumatoid arthritis, insulin-dependent diabetes mellitus, systemic lupus erythematosus, scleroderma, infertility,
Endometriosis, autoimmune thyroid disease myasthenia gravis, Hashimoto's disease, Basedow's disease, pernicious anemia, Addison's disease,
Male infertility, multiple sclerosis, Goodpasture syndrome, pemphigus, pemphigoid, myasthenia gravis, lens ophthalmitis, sympathetic ophthalmitis, autoimmune hemolytic anemia, idiopathic thrombocytopenia, autoimmunity Leukopenia, Felty syndrome,
Autoimmune lymphopenia, ulcerative colitis, Sjogr
It is useful as a medicament such as a safe and low toxic therapeutic / prophylactic agent for various diseases such as en syndrome, systemic autoimmune disease, primary biliary cirrhosis, and lupoid hepatitis. When a compound or a salt thereof obtained by the above-mentioned screening method is used as the above-mentioned therapeutic / prophylactic agent, it can be carried out in the same manner as described above.

[CD100 transgenic animal] Exogenous CD
DNA incorporating 100 genes or its mutant gene
Transgenic non-human animal having
00 transgenic animal) is preferably used for the non-fertilized egg, the fertilized egg, the germ cell including the sperm and its progenitor cells, etc. At the stage of single cells or fertilized egg cells and generally before the 8 cell stage), calcium phosphate method, electric pulse method, lipofection method, aggregation method, microinjection method, particle gun method, DE
Target CD100 by AE-dextran method or the like
It can be created by transferring a gene.
In addition, the CD100 gene transfer method allows for exogenous CD100 targeted on somatic cells, organs of living organisms, tissue cells, and the like.
The gene can be transferred and used for cell culture, tissue culture, and the like. Furthermore, CD10 can be obtained by fusing these cells with the above-mentioned germ cells by a cell fusion method known per se.
0 transgenic animals can also be created.

As the non-human animal, the same one as described above is used. The exogenous CD100 gene is not a CD100 gene existing in the body of a non-human animal, but a CD100 gene once isolated and extracted from an animal, or a C100 gene cloned using genetic engineering techniques.
D100 cDNA or the like is used. Specifically, a gene having the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 4 is used. Examples of the mutant gene of the CD100 gene (hereinafter, abbreviated as mutant CD100 gene) include those in which the base sequence of the original CD100 gene has a mutation (eg, mutation), specifically,
CDs with base additions, deletions, substitutions with other bases, etc.
100 genes and the like, and also includes an abnormal gene of the CD100 gene (hereinafter abbreviated as abnormal CD100 gene). The abnormal CD100 gene means a CD100 gene that expresses abnormal CD100, for example, CD1 that suppresses the function of normal CD100.
For example, a CD100 gene that expresses 00 is used.
The exogenous CD100 gene may be derived from an animal of the same or different species as the animal of interest. The DNA incorporating the exogenous CD100 gene or its mutant gene may be any DNA as long as it contains the exogenous CD100 gene or its mutant gene. In transferring the CD100 gene to a target animal, it is generally advantageous to use the CD100 gene as a DNA construct linked downstream of a promoter capable of expressing the same in animal cells. For example, when transferring the human CD100 gene, various non-human animals having the CD100 gene having a high homology to the human CD100 gene (for example,
Rabbits, dogs, cats, cats, guinea pigs, hamsters, rats, mice, etc.). For example, microinjection into a mouse fertilized egg can produce a CD100 transgenic animal that highly expresses the CD100 gene.

Examples of the CD100 expression vector include Escherichia coli-derived plasmids, Bacillus subtilis-derived plasmids, yeast-derived plasmids, bacteriophages such as λ phage, retroviruses such as Moloney leukemia virus, and animal viruses such as vaccinia virus or baculovirus. Are used. Among them, a plasmid derived from Escherichia coli, a plasmid derived from Bacillus subtilis or a plasmid derived from yeast are preferably used. Examples of the promoter for regulating the expression of the CD100 gene include, for example,
Promoters derived from viruses (eg, Simian virus, cytomegalovirus, Moloney leukemia virus, JC virus, breast cancer virus, poliovirus, etc.);
As those derived from various animals (human, rabbit, dog, cat, guinea pig, hamster, rat, mouse, etc.) and birds (chicken, etc.), albumin, insulin I
I, uroplakin II, elastase, erythropoietin, endothelin, muscle creatine kinase, glial fibrillary acidic protein, glutathione S-transferase, platelet-derived growth factor β, keratins K1, K10 and K14, collagen types I and II, cyclic AMP dependent Protein kinase βI subunit, dystrophin, tartrate-resistant alkaline phosphatase, atrial natriuretic factor, endothelial receptor tyrosine kinase (commonly abbreviated as Tie2), sodium potassium adenosine 3 kinase (Na, K-ATP)
ase), neurofilament light chain, metallothionein I and IIA, metalloproteinase 1 tissue inhibitor, MHC class I antigen (H-2L), H-ra
s, renin, dopamine β-hydroxylase, thyroid peroxidase (TPO), polypeptide chain elongation factor 1α
(EF-1α), β actin, α and β myosin heavy chains, myosin light chains 1 and 2, myelin basic protein, thyroglobulin, Thy-1, immunoglobulin, H
Chain variable region (VNP), serum amyloid P component, myoglobin, troponin C, smooth muscle α-actin,
Although promoters such as preproenkephalin A and vasopressin are used, preferably, a cytomegalovirus promoter capable of high expression throughout the body, a promoter of human polypeptide chain elongation factor 1α (EF-1α), human and chicken β-actin A promoter or the like can be used. In addition, an insulin promoter, an albumin promoter, an immunoglobulin promoter, and the like, which can be highly expressed in a specific organ or tissue, can also be used.

The vector preferably has a sequence (generally called terminator) that terminates the transcription of the messenger RNA of interest in CD100 transgenic animals. For example, the vector may be derived from a virus, derived from various mammals and birds. The sequence of each CD100 gene can be used, and preferably, the simian virus SV4
Zero terminator or the like is used. Other, target CD1
In order to further express the 00 gene, a gene splicing signal, an enhancer region such as an immunoglobulin gene, a part of an intron of a eukaryotic cell gene, etc. are placed 5 'upstream of the promoter region, between the promoter region and the translation region, or in translation. Linking 3 ′ downstream of the region is also possible depending on the purpose. The normal CD100 translation region can be derived from liver, kidney, thyroid cells, fibroblast-derived DNA from various animals (eg, rabbits, dogs, cats, guinea pigs, hamsters, rats, mice, humans, etc.), and various commercially available genomic live cells. All or part of the genomic gene from the rally, or liver, kidney, thyroid cells,
A complementary CD100 gene prepared from fibroblast-derived RNA by a known method can be obtained as a raw material. In addition, the exogenous abnormal CD100 gene can be prepared by mutating the translated region of normal CD100 obtained from the above cells or tissues by a point mutagenesis method. The translation region can be prepared as a DNA construct that can be expressed in a transgenic animal by a conventional genetic engineering technique in which it is ligated downstream of the above promoter and, if desired, upstream of the transcription termination site. Transfer of the CD100 gene at the fertilized egg cell stage is ensured to be present in all germ cells and somatic cells of the subject animal. The presence of the CD100 gene in the germ cells of the produced animal after the CD100 gene transfer means that all progeny of the produced animal will retain the CD100 gene in all of their germ cells and somatic cells. C
The progeny of this type of animal that has inherited the D100 gene have the CD100 gene in all of its germ and somatic cells.

The non-human animal to which the exogenous normal CD100 gene has been transferred can be bred in a normal breeding environment as an animal having the CD100 gene after confirming that the CD100 gene is stably maintained by mating. . Transfer of the CD100 gene at the fertilized egg cell stage is ensured to be present in excess in all germ cells and somatic cells of the subject animal. The excessive presence of the CD100 gene in the germ cells of the produced animal after the CD100 gene transfer means that the offspring of the produced animal have the CD100 gene in all of its germ cells and somatic cells in excess. Progeny of this type of animal that has inherited the CD100 gene have an excess of the CD100 gene in all of its germ and somatic cells. By obtaining a homozygous animal having the introduced CD100 gene on both homologous chromosomes and mating the male and female animals, all offspring can be bred to have the CD100 gene in excess.
The progeny thus obtained is also included in the animal of the present invention. The transgenic non-human animal having the DNA incorporating the exogenous CD100 gene or its mutant gene obtained as described above has a non-human animal in which T cell interferon gamma production ability and proliferation are increased and T cell reactivity is enhanced. It is a human animal (Example 11 described later). Normal CD
The non-human animal having 100 genes has a high expression of the normal CD100 gene and has an endogenous normal CD100 gene.
By promoting gene function, ultimately CD100
It may develop hyperfunction and can be used as a model animal for the disease. For example, normal CD100
Using transgenic animals, CD100 hyperactivity and C
D100-related diseases, for example, diseases caused by abnormal or excessive antibody production (eg, atopic asthma, allergic rhinitis, atopic dermatitis, allergic bronchitis, pulmonary aspergillosis, parasite disease, Kimura Mr. disease, high IgE syndrome, Wiscott-Aldric
h syndrome, thymic dysplasia, Hodkin's disease, cirrhosis,
Acute hepatitis, rheumatoid arthritis, insulin-dependent diabetes, systemic lupus erythematosus, scleroderma, infertility, endometriosis, autoimmune thyroid disease myasthenia gravis, Hashimoto disease,
Basedow's disease, pernicious anemia, Addison's disease, male infertility, multiple sclerosis, Goodpasture syndrome, pemphigus, pemphigoid, myasthenia gravis, phakic ophthalmitis,
Sympathetic ophthalmitis, autoimmune hemolytic anemia, idiopathic thrombocytopenia, autoimmune leukopenia, Felty syndrome, autoimmune lymphopenia, ulcerative colitis, Sjogren
Syndrome, systemic autoimmune disease, primary biliary cirrhosis,
It is possible to elucidate the pathological mechanisms of various diseases such as lupoid hepatitis and to examine treatment methods for these diseases. In addition, since the animal in which the exogenous normal CD100 gene has been transferred has an increased symptom of free CD100, it can be used for a screening test for a therapeutic agent for the above-mentioned CD100-related disease. For example, inoculating the mouse with a foreign antigen such as dinitrophenyl ovalbumin,
On the other hand, it is possible to screen for an inhibitor by measuring whether the antibody titer against the foreign antigen is lowered by appropriately administering the test substance. More specifically, it is also possible by measuring the amount of cytokines in the blood such as interferon gamma which is considered to increase due to an autoimmune disease or the like.

On the other hand, a non-human animal having an exogenous abnormal CD100 gene can be subcultured in a normal breeding environment as an animal having the CD100 gene after confirming that the CD100 gene is stably maintained by mating. Further, the target CD100 gene can be incorporated into the above-mentioned plasmid and used as a source substance. The DNA construct with the promoter can be prepared by a general CD100 genetic engineering technique. Transfer of the abnormal CD100 gene at the fertilized egg cell stage is ensured to be present in all germ cells and somatic cells of the subject animal. The presence of the abnormal CD100 gene in the germ cells of the produced animal after the CD100 gene transfer indicates that all the offspring of the produced animal have abnormal C in their germ cells and somatic cells.
It means having the D100 gene. Progeny of this type of animal that has inherited the CD100 gene have the abnormal CD100 gene in all of its germ and somatic cells.
A homozygous animal having the introduced CD100 gene on both homologous chromosomes is obtained, and by crossing these male and female animals, it is possible to breed subculture so that all offspring have the CD100 gene. A non-human animal having an abnormal CD100 gene has a high level of expression of the abnormal CD100 gene, and may eventually become a CD100 dysfunction by inhibiting the function of an endogenous normal CD100 gene. It can be used as an animal. For example, using an abnormal CD100 gene-transferred animal, it is possible to elucidate the pathological mechanism of CD100 dysfunction and to examine a method for treating this disease. Further, as a specific possibility, an animal in which an abnormal CD100 gene is highly expressed has an abnormal C100 in CD100 dysfunction.
Inhibition of normal CD100 function by D100 (dominant neg
ative action). The animal into which the foreign abnormal CD100 gene has been transferred is a normal CD100.
Infections or diseases caused by viruses (cold syndrome, influenza, AIDS, hepatitis, herpes, measles, chickenpox, hand-foot-and-mouth disease, shingles, erythema infectivity, rubella, sudden rash, viral conjunctivitis , Viral meningitis, viral pneumonia, viral encephalitis, Lassa fever, Ebola hemorrhagic fever, Marburg disease, Congo hemorrhagic fever, yellow fever, dengue fever, rabies, adult T-cell leukemia (AT
L), rotavirus infection, polio, mumps, etc., bacterial or fungal infections or diseases (bacterial food poisoning, bacterial diarrhea, tuberculosis, leprosy, dysentery, typhoid, cholera, paratyphoid, plague, tetanus, hares) disease,
Reduced resistance to brucellosis, anthrax, sepsis, bacterial pneumonia, dermatomycosis, etc., or cancer (oral, pharyngeal, lip, tongue, gingival, nasopharyngeal, nasopharyngeal, esophageal, gastric,
Colorectal cancer including small intestine cancer, colon cancer, liver cancer, gallbladder cancer, pancreatic cancer, nasal cavity cancer, lung cancer, osteosarcoma, soft tissue cancer, skin cancer, melanoma, breast cancer, uterine cancer, ovarian cancer, prostate cancer, testicular cancer , Penile cancer, bladder cancer, kidney cancer, brain tumor, thyroid cancer, lymphoma, leukemia, etc.), and can be used in screening tests for therapeutic drugs against these diseases . Foreign CD100 of the present invention
The screening method using a transgenic non-human animal having a DNA into which a gene or its mutant gene has been incorporated is combined with the above-described method for screening a compound or a salt thereof that changes the binding between CD100 and CD72 (ligand / receptor assay system). May be implemented. That is, the present invention uses a transgenic non-human animal having a DNA into which an exogenous CD100 gene or a mutant gene has been incorporated, and comprises a compound that changes the binding between CD100 or a salt thereof and its receptor (particularly, , A compound that inhibits the binding between CD100 and CD72) or a salt thereof. Here, a ligand-receptor assay system is used as a primary screening to select a compound that alters the binding between CD100 and CD72 as a candidate compound, and then a transgenic non-human animal having a DNA incorporating the exogenous CD100 gene or its mutant gene. The prophylactic / therapeutic effect of the candidate compound may be tested in a secondary screening system using a transgenic non-human animal having a DNA incorporating the exogenous CD100 gene or its mutant gene. After selecting candidate compounds for screening,
A compound that changes the binding between CD100 and CD72 obtained by subjecting the ligand-receptor assay system to secondary screening may be selected as a candidate compound for the prophylactic / therapeutic agent of the present invention.

Other possible uses of the two types of CD100 transgenic animals include, for example, use as a cell source for tissue culture, and CD100.
CD100 gene or R in tissue of transgenic animals
Analysis of the relationship with proteins specifically expressed or activated by CD100 by directly analyzing NA or analyzing tissues with high expression of CD100 gene, using cells of CD100 gene-containing tissue as standard tissue culture techniques To study the function of cells from tissues that are generally difficult to culture, to screen for drugs that enhance cell function by using the cells described above, and to isolate and purify mutant CD100 The production of the antibody can be considered. Furthermore, using the CD100 transgenic animal, clinical symptoms of a CD100-related disease, including CD100 dysfunction, can be examined, and more detailed pathological findings in each organ of the CD100-related disease model can be obtained. It can contribute to the development of new treatment methods and the research and treatment of secondary diseases caused by the diseases. Further, it is possible to take out each organ from the CD100 gene-transferred animal, cut it into small pieces, and then use a protease such as trypsin to obtain the CD100 gene-transferred cells, culture them, or systematize the cultured cells. Furthermore, it is possible to examine the specificity of CD100-producing cells, their relationship with differentiation or proliferation, or their signal transduction mechanisms, and to investigate their abnormalities.
0 and an effective research material for elucidating its action.
Furthermore, using a CD100 transgenic animal,
In order to develop a therapeutic agent for a CD100-related disease including a zero-function refractory disease, it is possible to provide an effective and rapid screening method for the therapeutic agent for the disease using the above-described test method and quantitative method. Become. In addition, it is possible to examine and develop a CD100 gene therapy method for a CD100-related disease using a CD100 gene-transferred animal or an exogenous CD100 gene expression vector. When examining a gene therapy method, for example, a virus vector such as a retrovirus vector, an adenovirus vector, an AAV vector, a herpes virus vector, or a membrane fusion liposome method is used.

In the present specification and drawings, when bases, amino acids, and the like are represented by abbreviations, IUPAC-IUB
Abbreviations based on Commision on Biochemical Nomenclature or common abbreviations in the field,
An example is given below. When an amino acid can have an optical isomer, the L-form is indicated unless otherwise specified.

DNA: deoxyribonucleic acid cDNA: complementary deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine Y: thymine or cytosine N: thymine, cytosine, adenine or guanine R: adenine or guanine M: cytosine or adenine W : Thymine or adenine S: cytosine or guanine RNA: ribonucleic acid mRNA: messenger ribonucleic acid dATP: deoxyadenosine triphosphate dTTP: deoxythymidine triphosphate dGTP: deoxyguanosine triphosphate dCTP: deoxycytidine triphosphate ATP: adenosine triphosphate Phosphate EDTA: ethylenediaminetetraacetic acid SDS: sodium dodecyl sulfate EIA: enzyme immunoassay Gly or G: glycine Ala or A: a Nin Val or V: valine Leu or L: leucine Ile or I: isoleucine Ser or S: serine

Thr or T: Threonine Cys or C: Cysteine Met or M: Methionine Glu or E: Glutamic acid Asp or D: Aspartic acid Lys or K: Lysine Arg or R: Arginine His or H: Histidine Phe or F: Phenylalanine Or Y: tyrosine Trp or W: tryptophan Pro or P: proline Asn or N: asparagine Gln or Q: glutamine pGlu: pyroglutamic acid Me: methyl group Et: ethyl group Bu: butyl group Ph: phenyl group TC: thiazolidine-4 ( R) -carboxamide group Bom: benzyloxymethyl NMP: N-methylpyrrolidone PAM: phenylacetamidomethyl

The substituents, protecting groups and reagents frequently used in the present specification are represented by the following symbols. Tos: p-toluenesulfonyl HONB: N-hydroxy-5-norbornene-2,3
- dicarboximide Bzl: benzyl Cl ₂ -Bzl: dichlorobenzyl Z: benzyloxycarbonyl Br-Z: 2-bromobenzyloxycarbonyl Cl-Z: 2-chloro benzyloxycarbonyl Boc: t-butyloxycarbonyl HOBT: 1- Hydroxybenztriazole DCC: N, N'-dicyclohexylcarbodiimide TFA: trifluoroacetic acid Fmoc: N-9-fluorenylmethoxycarbonyl DNP: dinitrophenyl Bum: tert-butoxymethyl Trt: trityl BSA: bovine serum albumin CHAPS: 3- [(3-cholamidopropyl) dimethylammonio] -1-propanesulfonate E64: (L-3-trans-carboxyoxirane-2-
Carbonyl) L-leucyl-agmatine DNP-OVA: dinitrophenyl ovalbumin DNP-BSA: dinitrophenyl bovine serum albumin ELISA: enzyme linked immunosorbent assay EIA: enzyme immunosorbent assay PBS: phosphate buffered saline LPS: Lipopolysaccharide conA: Concanavalin A

The SEQ ID Nos. In the present specification indicate the following sequences. [SEQ ID NO: 1] This shows the amino acid sequence of mouse CD100. [SEQ ID NO: 2] This shows the nucleotide sequence of mouse CD100. [SEQ ID NO: 3] This shows the amino acid sequence of human CD100. [SEQ ID NO: 4] This shows the base sequence of human CD100. [SEQ ID NO: 5] This shows the amino acid sequence of mouse CD72. [SEQ ID NO: 6] This shows the nucleotide sequence of mouse CD72. [SEQ ID NO: 7] This shows the amino acid sequence of human CD72. [SEQ ID NO: 8] This shows the base sequence of human CD72. [SEQ ID NO: 9] mCD100- described in Reference Example 1
The base sequence of the N-terminal primer used for preparing Fc is shown. [SEQ ID NO: 10] mCD100 described in Reference Example 1
The base sequence of the C-terminal primer used to prepare -Fc is shown.

[0064]

The present invention will be described in more detail with reference to the following Reference Examples and Examples, which do not limit the scope of the present invention.

Reference Example 1 Isolation of CD100 whose expression is enhanced by CD40 stimulation 1 × 10 ⁸ mouse B cell line WEHI231 cells were stimulated with an anti-CD40 antibody, HM40-3 (Pharmingen) for 8 hours. Total RNA was isolated from cells that were not stimulated by the guanidine isothiocyanate phenol method, and mRNA was purified using Oligo (dT) -coupled magnetic beads (Promega). PCR
CDNA synthesis and subtraction cloning were performed using -SELECT cDNA subtraction kit (Clontech). The cDNA fragment generated by CD40 stimulation was directly inserted into a T / A vector (Invitrogen). As a result of comparing the obtained base sequences, the Journal of Biological Chemistry (Jour
nal of Biological Chemistry 271 , 33376-33381 (199
The CD100 gene described in 6)) was isolated. MCD100-Fc described in Examples 1 and 3 described below is a protein obtained by fusing a soluble human IgG1 Fc portion to mouse CD100. Specifically, Sa in the sense direction
Primer containing lsite (gctgtcgactgtgtgcccg
ttgctgaaggcct) [SEQ ID NO: 9] and a primer containing a BamHI site in the antisense direction (gacggatcctact
WEHI2 stimulated with CD40 by PCR using an oligonucleotide consisting of the combination of tactttgctttgcttgcttgagatacaccgtcttctctga) [SEQ ID NO: 10]
Secretory mouse CD100 cDNA was prepared from mouse CD100 cDNA extracted from 31 cells. Obtained S
The alI-BamHI fragment was cloned into pEFBos human IgG1
A SalI-BamHI fragment of the Fc cassette was inserted into a DNA fragment to prepare a gene that expresses the mCD100-Fc protein. The gene was electroporated (using a Biorad Gene Pulser at 0.25 kV, 960 micro
(Performed by FD) into P3U1 plasmacytoma to prepare transformed cells. Specifically, 50 μg of H
pEFBos-mCD100-F cut with indIII
c Plasmid DNA and pMC1n cut with BamHI
The ¹⁰⁷ cells were transformed with the eo vector. 10%
Containing fetal calf serum and 0.3 mg / ml G418
After 10 days of culturing in MI medium, colonies resistant to G418 were isolated and cloned. mCD100-Fc
The protein was purified from the culture using Protein A Sepharose (Amersham Pharmacia). Biotinylated mCD100-Fc described in Example 1 below was prepared using a biotinylated kit (Beringer-Mannheim).
It is obtained by binding biotin to D100-Fc. The CHO cells expressing CD100 described in Example 2 are transformed cells in which the CD100 gene has been introduced into CHO cells, and express the CD100 protein. Specifically, the full-length CD100 cDNA was converted to pEFBOSvector.
or, and transfected into CHO cells together with the pMC1neo vector using Lipofectamine Plus (Life Technology). After 10 days in the presence of 0.3 mg / ml of G418, G418-resistant cells were selected.

Reference Example 2 Molecular CD binding to CD100
Isolation of 72 2C4 cells derived from C57BL / 6 mice were cultured using RPMI1640 culture medium containing 10% fetal bovine serum, and
2 × 10 ⁶ cells / ml 2B4 cells at 2 μg / ml
Of conA for 18 hours. Total RNA was isolated from the cells by guanidine isothiocyanate density gradient centrifugation, and mRNA was selected from the total RNA using oligo (dT) -bound magnetic beads (Promega).
Double-stranded cDNA containing oligo (dT)
It was synthesized using a ScriptII cDNA synthesis kit (Life Technology). A BstXI adapter (Invitrogen) was added to the cDNA and fractionated by 1% agarose gel electrophoresis. A cDNA of 1.0 kb or more was recovered and pME18S cut with BstXI.
Inserted into vector. Using the inserted DNA, electroporation (using a Bio-Rad Gene Pulser, 2.
Escherichia coli DH10B cells (life technology) were transformed with 5 kV, 25 μFD). 2x10 ⁷
COS7 cells were transformed with Lipofectamine Plus using a plasmid obtained from E. coli consisting of independent clones. Three days after the transformation, the cells were collected, and 5% fetal calf serum, 2.5 μg / ml Fc block
The cells were resuspended in PBS containing 5 μg / ml biotinylated mCD100-Fc to a concentration of 5 × 10 ⁶ cells / ml and left on ice for 1 hour. The cells were washed with ice-cold PBS and suspended in PBS containing M-280 streptavidin-bound Dynabeads. After 30 minutes of suspension, remove the cells
Magnetic Particle Concentr
The plate was washed 10 times with ice-cold PBS using an ator. The extrachromosomal plasmid DNA was subjected to the Hirt method (Proceeding of Nati
onal Academy sciences of USA 84, 3365-3369 (198
Extracted using 7)). The plasmid DNA was inserted into Escherichia coli DH10B cells by an electroporation method (using a Bio-Rad Gene Pulser at 2.5 kV, 25 μFD), and the second, third, and fourth transformations were performed by a protoplast fusion method. The above extraction by magnetic force was repeated four times. As a result, a clear band of 1.4 kb was observed. Analysis of the nucleotide sequence of this 1.4 kb cDNA clone revealed that the mouse CD72 cDNA was full length [SEQ ID NO: 6]. C described in Example 1
As for CHO cells expressing D72, CD72 gene is a transformed cell in which CHO cells are introduced,
Expresses 72 proteins. Specifically, the pME18S vector incorporating CD72 was introduced into CHO cells together with the pMC1neo vector using Lipofectamine Plus (Life Technology). G418 0.3
After 10 days in the presence of mg / ml, G418-resistant cells were selected.

Example 1 Binding of CD100 to CD72 mCD100-Fc was biotinylated using a biotinylation kit. For analysis by flow cytometry, 10 ⁶ control CHO cells and CHO transformed cells expressing CD72 were stained with a staining buffer containing 5 μg / ml Fc block (Pharmingen) (2% fetal bovine serum). ,
0.02% sodium azide, 2 mM calcium chloride,
Biotinylated mCD100-Fc (40 μg / ml) for 1 hour on ice in PBS containing 1 mM magnesium chloride)
And reacted. After washing with staining buffer, cells were washed with FITC-labeled streptavidin (Becton Dickinson) for 2 hours.
Stained for 0 minutes. After washing the cells with a staining buffer, the cells to which FITC-labeled streptavidin was bound were analyzed using a flow cytometer. FIG. 1 shows the results. The left panel shows the results of control CHO cells, and the right panel shows the results of CD72-expressing CHO cells. The dotted line shows the result when mCD100-Fc was not added, and the solid line shows the result when mCD100-Fc was added. In the figure, the horizontal axis shows the fluorescence intensity per cell, and the vertical axis shows the number of cells relatively. In the CHO cells in the left panel, the fluorescence intensity did not change even when biotinylated mCD100-Fc was added. This indicates that CHO cells do not bind to biotinylated mCD100-Fc. In CHO cells expressing CD72 on the right, biotinylated mCD
When 100-Fc was added (solid line), the fluorescence intensity was higher than when 100-Fc was not added (dotted line). This indicates that biotinylated mCD100-Fc binds to CD72 on the surface of CHO cells expressing CD72.

Example 2 Class switch enhancing action of mouse CD100 C57B prepared to 1 × 10 ⁵ cells / well
L / 6 mouse spleen-derived resting B cells were added to a flat-bottom 96-well microtiter plate together with anti-CD40 monoclonal antibody or IL-4 100 units / ml and CHO cells expressing CD100 fixed with paraformaldehyde (2 × 10 ⁴ cells / well). And cultured for 7 days. The production of IgM or IgG1 immunoglobulin was measured by ELISA. Specifically, a culture solution or control IgM and IgG were added to a 0.1 M carbonate buffer (p
H9.6), and 100 μl was added to each well of a 96-well immunoplate for EIA (Maxisorp: Nunc).
The mixture was injected at a temperature of about 4 ° C. overnight, and attached. Each well was buffered with buffer A (pH 7.0 containing 0.15 M NaCl).
After washing with 0.02 M phosphate buffer, buffer B (0.
Enzyme-labeled anti-I diluted with 1% BSA, 0.02 M phosphate buffer (pH 7.0 containing 0.15 M NaCl)
100 μl of a gM, IgG1 antibody solution was added and reacted at 25 ° C. for about 2 hours. Each well was washed with buffer A, and an alkaline phosphatase substrate solution (1 mg / ml)
Phosphatase substrate (Sigma), 100 mM Tri
s (pH 9.5), 100 mM NaCl, 5 mM Mg
(Cl ₂ ) was added and reacted at 25 ° C. for 30 minutes. 405 nm using an automatic colorimeter for microplate
Was measured. Separately, known amounts of IgM, I
The amount of antibody in each reaction solution was quantified by taking a quantitative curve of the absorbance and the amount of antibody with gG1 attached. The experiment is
(1) Culture solution in the absence of CHO cells that do not express CD100
When (Medium) alone was added, (2) When only a culture solution (Medium) was added in the presence of CD100-expressing CHO cells, (3) Anti-CD40 antibody (αCD40) and IL-4 were added in the absence of CD100-expressing CHO cells. When added, (4) anti-CD4 in the presence of CD100-expressing CHO cells
The amount of IgM and the amount of IgG1 were compared separately when 0 antibody (αCD40) and IL-4 were added. FIG. 2 shows the result. The horizontal axis is (1), (2), (3),
In the results of (4), the vertical axis shows the amount of antibody (unit: ng / ml) quantified from the absorbance. Compared with the control group without additive (1), C
When D100 is present (2), both IgM and IgG1 do not affect antibody production. When stimulated with an anti-CD40 antibody and IL-4 (3), both IgM and IgG1 induce antibody production as compared to the non-added control group (1).
When stimulated with anti-CD40 antibody and IL-4 in the presence of CD100 (4), IgM production was slightly decreased, whereas IgG1 production was (3) as compared with the case of stimulation with anti-CD40 antibody and IL-4. It rose even more strongly than. This indicates that a phenomenon in which the class of antibodies produced and secreted from B cells is switched from IgM to IgG1, that is, a so-called class switch was induced.

Example 3 Enhancement of In Vivo Antibody Production by CD100 Dinitrophen Prepared with 100 μg of Aluminum
ylvalbumin (DNP-OVA) to C57
BL / 6 mice were inoculated intraperitoneally and immunized. After immunization, human IgG1 myeloma protein or mCD10
0-Fc was administered at 200 μg / day for 10 days.
Serum was collected 6 days and 10 days after DNP-OVA administration. The antibody titer of DNP-specific antibody was determined by DNP-BSA
Was measured by an ELISA method. Specifically, the serum of the mouse after immunization was used in a 0.1 M carbonate buffer (pH 9.
EI diluted with 6) and coated with DNP-BSA
96-well immunoplate for A (Maxi Soap: Nunc)
100 μl each was injected into each well, and left at 4 ° C. overnight for attachment. Buffer each well with buffer A (0.15 M NaC)
buffer B (25% Block Ace (Dainippon Pharmaceutical),
100 µl of an anti-mouse IgM, IgG1, antibody solution labeled with alkaline phosphatase diluted with 0.02 M phosphate buffer (pH 7.0 containing 0.15 M NaCl)
Was added thereto, and the mixture was further reacted at 25 ° C. for 2 hours to bind to the anti-DNP antibody attached to the well. Each well was washed with buffer A, and alkaline phosphatase substrate solution was added to 10 wells.
0 μl was added and reacted at 25 ° C. for 30 minutes, and the absorbance at 405 nm was measured using an automatic colorimeter for microplate. DNP-specific antibodies were quantified. FIG. 3 shows the result. The figure on the left shows the antibody titer to DNP contained in the serum 6 days after administration of DNP-OVA, and the figure on the right shows the antibody titer after 10 days. □ on the horizontal axis indicates human IgG1 myeloma protein, ■
Indicates the antibody titer when mCD100-Fc was administered.
The vertical axis Anti-DNP indicates the antibody titer against DNP.
DN contained in the serum of the mice of the control group 12 days after administration
One thousandth of the amount of antibody to P was defined as 1 unit. When CD100 (mCD100-Fc) is administered,
The antibody titer on day 6 is at least three times higher than the antibody titer on day 6 when the control human IgG1 myeloma protein was administered, and the antibody titer on day 10 when the control human IgG1 myeloma protein was administered. Value. This indicates that CD100 plays an important role in the ability to induce antigen-specific antibody production.

Example 4 Production of CD100 Knockout Mouse Using two types of probes derived from the CD100 cDNA sequence (total length and up to 1-1200 bp),
A phage clone containing a CD100 genomic DNA fragment of about 12 kb was isolated from a SvJ mouse liver-derived genomic library (Strategene). In this DNA fragment, the 1.6 Kb portion including a part of the first exon where the initiation codon is present was replaced with a neomycin resistance gene (provided by Maternal and Child Health Center) (Cell 51).
(1987) pp.503-512). In addition, the herpes simplex virus-derived thymidine kinase gene (HSV-TK) was converted to CD100 for negative selection.
Inserted downstream of the genomic gene (Nature
e) 336 (1988) 348-352), and a targeting plasmid DNA was constructed. 50 μg of this targeting plasmid DNA was transduced into 1 × 10 ⁶ E14-1 embryonic stem cells by electroporation. For the embryonic stem cells into which the gene was introduced, G418
(0.4 mg / ml; Life Technology) and ganciclovir (2 μM; Syntex) were double selected. As a result of selecting by homologous recombination on the CD100 gene from 1000 resistant colonies by Southern blotting, homologous recombination occurred.
The cloned embryonic stem cells were identified. Embryonic stem cells derived from the CD100 mutant clone were inoculated into blastocysts of C57BL / 6 mice (Shizuoka Experimental Animal Association, 6-8 weeks old), and then transferred to ICR foster parents (Shizuoka Experimental Animal Association, 6-8 weeks old). . The chimerism of the offspring was determined based on the degree of agouti of the fur, and a knockout mouse was produced in which the male chimera was further crossed with a C57BL / 6 female mouse. About the child born, C
Whether or not the D100 gene was knocked out was analyzed by Southern blotting. Genome D from mouse tail
After isolation of NA and digestion with BamHI, agarose gel electrophoresis was performed. The electrophoresed DNA was transferred to a nylon filter (Amersham Pharmacia), and then a radiolabeled probe (CD100 promoter region, 0.2K
and b) overnight. 0.1x filter
After washing in SSC and 0.1% SDS at 65 ° C. for 1 hour, autoradiography was performed. FIG. 4 shows the result. A is a CD100 wild-type gene from the top,
1 shows a genetic map of the CD100 targeting vector, and a CD100 genetic map when expected recombination has occurred. Exons in the 5 'untranslated region are shown in gray boxes, and exons in the translated region are shown in black boxes. B indicates a position to be cleaved by BamHI restriction enzyme, and E indicates a position to be cleaved by EcoRI restriction enzyme. Neo converts the neomycin resistance gene to H
SV-TK indicates a thymidine kinase gene derived from herpes simplex virus. Arrows indicate the transcription direction of these genes. Probe indicates the position of the probe used in the Southern blot. When performing Southern blotting by BamHI digestion, the length of the gene binding to the probe is expected to be 2.6 Kb for the wild-type gene and 1.2 Kb for the recombinant. B is wild-type (+ / +), heterozygous (+ / +)
-) Shows the results of analyzing the homozygous (-/-) genotype of the mutant gene by Southern blotting. 1. In wild type
Only the 6 kb fragment, 2.6 kb and 1.
Only 1.2 Kb fragments were found in the homozygotes of the 2 Kb fragments and the mutant gene. The length of the gene binding to the probe was planned to be 2.6 Kb for the wild-type gene and 1.2 Kb for the recombinant, so
This shows a knockout mouse in which the D100 locus has been replaced with the expected length. C shows the result of confirming that the knockout mouse did not express the CD100 molecule on the cells. Spleen cells prepared from wild-type mice (+ / +) and CD100 knockout mice (-/-) were subjected to biotinylated anti-mouse CD100 antibody / F
The results of analysis by flow cytometry after double staining with ITC-labeled streptavidin and phycoerythrin-labeled anti-B220 (cell surface marker of mouse B cells) antibody are shown. In the figure, the vertical and horizontal axes are B220 and C, respectively.
The production amount of the D100 molecule on the cell surface is shown as a logarithmic expression as the fluorescence intensity per cell. C for wild-type mice
While D100-positive cells were observed, knockout mice did not show CD100-positive cells.
Therefore, it was confirmed that the CD100 molecule was not expressed on the cells in the knockout mouse.

Example 5 Analysis on CD5 Surface Antigen of Knockout Mouse and Wild-Type Mouse Lymphocytes Peritoneal cells were collected by washing the peritoneal cavity with a phosphate buffer containing 2% FCS and 10 U / ml heparin. The results of analysis after double staining of a cell suspension prepared from the abdominal cavity or spleen with a FITC-labeled anti-B220 antibody and a phycoerythrin-labeled anti-CD5 antibody (each of Pharmingen) are shown. B2
20 is a cell surface marker for mouse B cells. CD5
Is known as a marker for autoantibody production (Autoimmunity, 30 (1999) 63-6).
9). FIG. 5 shows the results. + / + Is a wild type mouse, −
/-Indicates CD100 knockout mice. In the figure, the horizontal axis and the vertical axis respectively show the production amounts of B220 and CD5 molecules on the cell surface in logarithmic representation as the fluorescence intensity per cell. The fractions of both cell marker-positive cells are shown in the frame in the figure. In the case of peritoneal cells, the ratio of both B220 and CD5 positive cells was 14.6% in wild-type mice, but decreased to 7.49% in knockout mice. In the case of spleen cells, the ratio of both B220 and CD5 positive cells was 1.5% in wild-type mice and 0.93% in knockout mice, which also decreased. These results suggest that CD100 contributes to CD5 molecule expression. Therefore, it is presumed that if the function of CD100 can be inhibited, it is possible to suppress CD5, whose expression is supposed to be enhanced in autoimmune diseases, to be useful for treating autoimmune diseases.

Example 6 Production of Antibodies Against TD (T Cell Dependent) Antigen Eight-week-old CD100 knockout mice and wild-type mice (n = 4 or 5) were treated with 100 μg of NP-CGG.
The mice were immunized intraperitoneally twice (second time 28 days later) with an aluminum salt containing (4-hydroxy-3-nitrophenylacetyl chicken gamma globulin labeled product) (n = 5). Blood collection was performed before immunization and on days 14, 21, 28, 35 and 72 after immunization. Bound to NP (nitrophenyl group) by using the NP _12-labeled bovine serum albumin plates coated with (12 4-hydroxy-3-nitrophenyl acetyl group labeled BSA) and NP ₂ labeled bovine serum albumin Total IgG and, among them, IgG that binds with high affinity were quantified by ELISA, respectively. NP _{12 in} 96-well microplate (Nunc)
The labeled bovine serum albumin or NP ₂ labeled bovine serum albumin was coated overnight at 4 ° C.. After washing, 200 μl
/ Well blocking solution (50 mM Tris-HCl
(PH 8.1), 1 mM MgCl ₂ , 0.15 M N
aCl, 1% BSA, 0.05% Tween 20) was added, and the mixture was allowed to stand at room temperature for 1 hour. A 100 μl / well sample diluted with the blocking solution was allowed to stand at room temperature for 1.5 hours. After washing three times with PBS containing 0.05% Tween 20, alkaline phosphatase-labeled goat anti-mouse Ig was used.
G1 antibody was added. One hour later, the plate was washed, a phosphatase substrate (Sigma) was added, and the mixture was detected at an absorbance of 405 nm. FIG. 6 shows the results. A represents a time course of NP ₁₂ labeled bovine serum albumin binding of IgG amounts. B is N
P ₂ shows the time course of labeled bovine serum albumin binding of IgG amounts. C is NP ₂ IgG amount of labeled bovine serum albumin binding and NP ₁₂ labeled bovine serum albumin binding of I
The ratio to the amount of gG is shown over time. The vertical axis indicates the amount of antibody in A and B. In C, the ratio is shown. The horizontal axis indicates the number of days elapsed after the immunization with the first immunization day as the 0th day. Is CD100
△ shows the results when wild-type mice were used as knockout mice. As shown in FIGS. 6A and 6B, the amount of produced antibodies was reduced in knockout mice as compared with wild type mice, and it was recognized that the ability to produce antibodies to TD (T cell-dependent) antigen was impaired in CD100 knockout mice. Was done. In particular, the production of the high affinity antibody was significantly lower than that of the low affinity antibody. As shown in FIG. 6C, the NP ₂ / NP ₁₂ ratio increased over time in wild-type mice. This shows the process of maturation into a group of B cells producing higher affinity antibodies over time, but the NP ₂ / NP ₁₂ ratio in knockout mice increases more slowly than in wild type mice, It was shown that the mechanism of maturation to high affinity antibody production was impaired. It is known that a decrease in the ability to produce antibodies to the TD (T cell-dependent) antigen, that is, a decrease in the TD reaction, weakens the resistance to infectious diseases and the like (Immuno Defensive Review, Volume 3:
(1988) pp. 101-121). Therefore, the CD
Administration of 100 or a substance that enhances the action of CD100 may be a new therapeutic agent for infectious diseases and the like.

Example 7 Loss of T Cell Reactivity in CD100 Knockout Mice KLH suspended in complete Freund's adjuvant in 8 week old wild type mice and CD100 knockout mice
(Keyhole limpet hemocyanin) was immunized intraperitoneally when T cells were collected from the spleen, and in the footpad when collected from regional lymph nodes. 9 days after immunization, CD4
Positive T cells were converted to CD4 labeled magnetic beads (Magnene).
(Tic Cell Sorting, Milteny Biotech) from the spleen or regional lymph nodes. 1
× 10 ⁵ cells were stimulated with various concentrations of KLH for 3 days in the presence of irradiated (3000 rad) wild-type mouse spleen cells (5 × 10 ⁵ ). When examining cell proliferation, 2 μCi of tritiated thymidine was added for 12 hours, and radioactivity in cells was measured. IL-4 (interleukin 4) and IFN- in cell culture supernatant for 3 days
The amount of γ (interferon gamma) was measured using an ELISA kit (R & D system). FIG. 7 shows the results. A shows the comparison between CD4 positive T cells derived from spleen and proliferating wild-type mice and CD100 knockout mice by KLH stimulation. B shows proliferating wild-type mice and CD10 of KLH stimulation of CD4 positive T cells derived from regional lymph nodes.
The comparison in 0 knockout mice is shown. ○ indicates the results of wild type mice, and △ indicates the results of CD100 knockout mice.
The vertical axis represents intracellular radioactivity as an index of proliferation. The horizontal axis indicates the amount of KLH added. C: KLH-stimulated proliferation of regional lymph node-derived CD4-positive T cells, IL-4
The comparison between the wild-type mouse and the CD100 knockout mouse in the IFN-γ-producing ability and the CD100 knockout mouse, and the effect of adding CD100 are shown. mCD100-Fc was intravenously administered at 50 μg / mouse for 6 consecutive days from the day after immunization. The result when 4 μg / ml of KLH is used is shown.
The horizontal axis + / + and − / − indicate wild type mice and knockout mice. CD100-Fc indicates the case where + was added and the case where-was not added. The vertical axis is proliferative from the left, IL
-4 and INF. As shown in FIG. 7A, the reactivity of spleen-derived T cells to KLH was reduced in knockout mice compared to wild type mice. As shown in FIG. 7B, further reduction in reactivity was observed in the lymph node-derived T cells in the knockout mice, and no reactivity was observed even when the KLH amount was increased. As shown in FIG. 7C,
In knockout mice, CD4 + T cell IL
The ability to produce -4 and INF-γ was significantly reduced as compared to wild type mice, and it was confirmed that both factors were hardly produced. Furthermore, the addition of soluble CD100 reversed the decrease in reactivity, confirming that these abnormalities in knockout mice were mediated by CD100. It has been reported that activation of antigen-presenting cells induces the activation of antitumor T cells, resulting in antitumor immunity. At that time, antiproliferative T cells show an increase in proliferation and an increase in the ability to produce IL-4 and INF-γ. According to the results of this example, the knockout mouse significantly reduced the activation of antigen-specific T cells from the indexes of proliferation, IL-4 production ability, and INF-γ production ability. This is because CD100 has antitumor T
It suggests that it is deeply involved in cell activation.
In fact, CD1 on antigen presenting cells or activated T cells
CD72, which is a receptor of OO, is expressed (Annual Solar Sick Surgery, 61: (1996))
252-258). Therefore, it is presumed that CD100 acts directly on these cells to activate T cells and exert antitumor activity.

Example 8 Examination of the amount of soluble CD100 and anti-single-chain DNA antibody contained in the serum of MRL / lpr autoimmune disease model mouse C57BL / 6, Balb / c, MRL / n, MRL /
lpr mice were purchased from SLC (Shizuoka Experimental Animal Cooperative). Blood was collected from the fundus of 16-week-old mice. A mouse fusion protein of soluble CD100 and Flag was prepared by PCR from CD100 cDNA prepared from WEHI-231 cells stimulated with anti-CD40 antibody. The primer contains a SalI site as the sequence at the 5 ′ end. 5-gctgtcgactgtgtgcccgttgctgaaggcct [SEQ ID NO: 9] is used as a sequence at the 3 ′ end as a BamHI site, Fla.
5-gacggatcctacttactttgctttgcttgctt containing g sequence
gagatacaccgtcttctctga [SEQ ID NO: 10] was used.
The SalI-BamHI fragment generated by PCR was converted to pEFBo
SalI-B of human IgG1 Fc cassette
It was incorporated into the amHI part. 10 ⁷ P3U1 plasmacytomas were digested with 50 mg of CD100-
5 m cut with Flag plasmid DNA and BamHI
g of pMC1neo vector was introduced by electroporation. The transfected cells were transformed with RPMI1640 containing 10% fetal calf serum and 0.3 mg / ml G418.
Selected by culture. CD100-Flag protein is anti-F
Purification was performed using lag antibody-labeled agarose (Sigma). Sandwich E for detecting soluble CD100
The LISA method was performed as follows. A 96-well microplate (Nunc) was coated with a rat anti-mouse CD100 antibody (clone BMA-12, 5 μg / ml) at 4 ° C. overnight. After washing, 200 μl / well of blocking solution (50
mM Tris-HCl (pH 8.1), 1 mM Mg
Cl ₂ , 0.15 M NaCl, 1% BSA, 0.0
5% Tween 20) was added, and the mixture was allowed to stand at room temperature for 1 hour. A sample and a standard sample (mouse fusion protein of soluble CD100 and Flag) at 100 μl / well diluted with a blocking solution were allowed to stand at room temperature for 1.5 hours. 0.05
After washing 3 times with PBS containing% Tween20, 2 μg
/ Ml of biotinylated rat anti-mouse CD100 antibody (clone BMA-8) was added. One hour later, alkaline phosphatase-labeled streptavidin (Sigma) was added. After washing, a phosphatase substrate (Sigma) was added, and soluble CD100 molecules were detected at an absorbance of 405 nm. Anti-single-stranded DNA was prepared as follows. Bovine thymus D
NA (Sigma) was treated with S1 nuclease (Sigma) to obtain double-stranded DNA. The double-stranded DNA was boiled for 15 minutes and then cooled on ice to obtain a single-stranded DNA. 5 μg / ml single-stranded DNA was attached to a 96-well microplate, mouse serum was added, and alkaline phosphatase-labeled anti-mouse I
The gG antibody (Southern Biotechnology) was added. The monoclonal antibodies BMA-8 and BMA-12 were prepared as follows. 100 μg of CD100-F
c was subcutaneously administered once a week for a total of four times to immunize. The adjuvant used for immunization was Freund's complete adjuvant for the first time, and Freund's incomplete adjuvant for the second and subsequent times. The same amount was administered intravenously five days before the rat was sacrificed. B cells were prepared from rat spleen and fused with myeloma cells. Clones BMA-8 and BMA-12 producing an antibody against CD100 were selected from the fused cells. The clone was transplanted into a rat intraperitoneal cavity, and the antibody was purified from ascites. Table 1 shows the results.

[Table 1] Table 1 shows the mouse strain, soluble CD100 amount, and single-stranded DNA.
The relationship with the amount is shown. MRL / lpr mice are MRL / n
This is an autoimmune disease model mouse selected from mice. The amount of soluble CD100 contained in serum was C57BL
/ 6, Balb / c and MRL / n normal mice had a detection limit (12 ng / ml) or lower, but MRL / lpr autoimmune disease mice showing autoimmune disease-like symptoms showed a marked increase (166 ng / ml). ml). Similarly, the amount of anti-single-chain DNA antibody, which is an indicator of the amount of autoantibodies associated with an autoimmune disease, is much higher in MRL / lpr mice than in MRL / n mice. It was also evident from the amount of anti-single-chain DNA antibody that the above symptoms were exhibited. From these results, MRL /
In lpr autoimmune disease mice, abnormal production of CD100 is highly likely to be involved, and animal experiments have shown that CD100 inhibitors are effective for autoimmune diseases such as rheumatoid arthritis.

Example 9 Increase in Amount of Soluble CD100 and Autoantibodies with Age in MRL / lpr Mice The amount of soluble CD100 (A) and the amount of anti-single-chain DNA antibody (B) were determined using 8-20 week old mice. It was measured. Blood was collected from the fundus. The sandwich ELISA for detecting soluble CD100 was performed as follows. Rat anti-mouse CD10 in 96-well microplate (Nunc)
Antibody 0 (BMA-12, 5 μg / ml) was coated overnight at 4 ° C. After washing, 200 μl / well of blocking solution (50 mM Tris-HCl (pH 8.1), 1 mM
MgCl ₂ , 0.15 M NaCl, 1% BSA,
0.05% Tween 20) was added, and the mixture was allowed to stand at room temperature for 1 hour. Samples and standard samples (mouse fusion protein of soluble CD100 and FLAG sequence) at 100 μl / well diluted with a blocking solution were allowed to stand at room temperature for 1.5 hours.
After washing three times with PBS containing 0.05% Tween 20,
2 μg / ml biotinylated rat anti-mouse CD100 antibody (BMA-8) was added. One hour later, alkaline phosphatase-labeled streptavidin (Sigma) was added. After washing, a phosphatase substrate (Sigma) was added, and soluble CD100 molecules were detected at an absorbance of 405 nm. Anti-single-stranded DNA was prepared as follows. Bovine thymus D
NA (Sigma) was treated with S1 nuclease (Sigma) to obtain double-stranded DNA. The double-stranded DNA was boiled for 15 minutes and then cooled on ice to obtain a single-stranded DNA. 5 μg / ml single-stranded DNA was attached to a 96-well microplate, mouse serum was added, and alkaline phosphatase-labeled anti-mouse I
The gG antibody (Southern Biotechnology) was added. FIG. 8 shows the results. A is the amount of soluble CD100 in serum,
B shows the amount of anti-single-chain DNA antibody in serum. The horizontal axis represents the age of mice. The vertical axis of B represents the amount of the antibody. The numerical value obtained from the serum of a 22-week-old mouse was defined as 1, and the magnification of each sample was indicated. The amount of soluble CD100 in serum was below the detection sensitivity in 8-week-old MRL / lpr mice, but increased with the age of the week and reached 116 ± 89 ng / ml at the age of 16 weeks. Similarly, the amount of anti-single-chain DNA antibody, which is an indicator of the progression of an autoimmune disease, also increased with age. From these results, it was found that an increase in the amount of soluble CD100 in serum correlates with the progress of the autoimmune disease in MRL / lpr mice over time. These results also indicate that abnormalities in CD100 production are highly likely to be involved in MRL / lpr autoimmune disease mice, indicating that CD100 inhibitors are effective for autoimmune diseases such as rheumatoid arthritis. Was.

Example 10 Loss of Dendritic Cell Reactivity in CD100 Knockout Mice Bone marrow cells were collected from 8-week-old wild type mice and CD100 knockout mice. BM-CSF for bone marrow cells
Dendritic cells were prepared by culturing for 6 days in the presence of. 2 × 10 ⁵ dendritic cells were seeded on a 96-well plate, and an anti-mouse CD40 antibody (HM-40-3 (Pharmingen), 2 μg / ml) or LPS (lipopolysaccharide, 10 μg / ml) was added. And cultured for 72 hours. The amount of IL-12 in the culture supernatant was measured using an ELISA kit (Amersham Pharmacia). FIG. 9 shows the results. The results for wild type mice are shown in white, and the results for knockout trout are shown as hatched. The vertical axis indicates the amount of IL-12. Anti-CD40 antibody or LP on dendritic cells derived from wild-type mice
When stimulated with S, IL-12 production increased and dendritic cells were activated. However, when dendritic cells derived from knockout mice were used, the amount of IL-12 produced decreased, and activation of dendritic cells was impaired. It has been reported that the release of IL-12, which activates antigen-presenting cells, induces the activation of antitumor T cells and produces antitumor immunity (Nature, 393: (1998).
Years) 413-414). According to the results of this example, the activation of dendritic cells was significantly reduced in knockout mice. This suggests that CD100 is deeply involved in dendritic cell activation. Therefore, CD10
It is assumed that 0 activates dendritic cells and can exert antitumor activity.

Example 11 T cell hyperreactivity in CD100 transgenic mice To express mouse CD100 in a B cell-specific manner, an immunoglobulin V region heavy chain gene promoter, an immunoglobulin heavy chain gene intron enhancer and an immunoglobulin were used. A construct was prepared in which a full-length or intracellular region-deleted membrane-type mouse CD100 cDNA was incorporated into an Eμ vector comprising a globulin κ chain enhancer. Transgenic mice were prepared by introducing this gene fragment into fertilized eggs of C57BL / 6 mice. KLH (keyhole limpet hemocyanin, 10 μl) suspended in complete Freund's adjuvant in 8-week-old wild type mice and CD100 knockout mice
g / mouse) were immunized intraperitoneally. 9 days after immunization, CD4
Positive T cells were converted to CD4 labeled magnetic beads (Magnene).
(Tic Cell Sorting, Milteny Biotech) from regional lymph nodes. The 1x10 ⁵ cells, radiation treatment (3000 rad) and wildtype mouse spleen cells (5x10 ⁵⁾ the presence of various concentrations of KL
Stimulated with H for 3 days. When examining cell proliferation, 2μ
The tritiated thymidine of Ci was added for 12 hours, and the intracellular radioactivity was measured. IFN in cell culture supernatant for 3 days
The amount of -γ (interferon gamma) was measured using an ELISA kit (R & D system). The results are shown in FIG. The left figure shows the amount of INF-γ production, and the right figure shows the proliferation. ○
Indicates the results of wild-type mice, and ● indicates the results of CD100 transgenic mice. The horizontal axis indicates the amount of KLH added. Proliferation is represented by intracellular radioactivity as an index. As shown in FIG. 10, in the transgenic mouse, the INF-γ production and proliferation of CD4-positive T cells were increased as compared with the wild type mouse. This indicates that T cells specific for KLH were activated. It has been reported that activation of antigen-presenting cells induces activation of antitumor T cells, thereby generating antitumor immunity (Nature, 3
93: (1998) 413-414). that time,
Anti-tumor T cells show increased proliferative activity and enhanced INF-γ production ability. From the results of this example, in the case of antigen-specific T cell activation, both the amount of INF-γ production and the index of proliferation were increased in the transgenic mice. This suggests that CD100 is deeply involved in the activation of antitumor T cells. In fact, CD72, a receptor for CD100, is expressed on antigen-presenting cells or activated T cells (Annual Solar Sick Surgery, 61: (1996) 252-2).
58). Therefore, it is presumed that CD100 acts directly on these cells to activate T cells and exert antitumor activity. In addition, it is considered that this transgenic model mouse is in an immune response hypersensitivity state due to enhanced CD100 production. Therefore, it is considered to be a model for a disease such as an immunodeficiency putatively caused by CD100 enhancement.

[0078]

EFFECT OF THE INVENTION CD72 of the present invention or a salt thereof and C
CD7 characterized by using D100 or a salt thereof.
2 or a salt thereof and a compound that alters the binding between CD100 or a salt thereof, or a method for screening for a salt thereof, are obtained by infecting or illness caused by a virus (cold syndrome, influenza, AIDS, hepatitis, herpes, measles, chickenpox,
Hand-foot-and-mouth disease, shingles, erythema contaminated, rubella, sudden rash,
Viral conjunctivitis, viral meningitis, viral pneumonia,
Viral encephalitis, Lassa fever, Ebola hemorrhagic fever, Marburg disease, Congo hemorrhagic fever, yellow fever, dengue fever, rabies, adult T-cell leukemia (ATL), rotavirus infection, polio, mumps, etc.), bacterial or fungal infection or disease (Bacterial food poisoning, bacterial diarrhea, tuberculosis, leprosy, dysentery, typhoid, cholera, paratyphoid, plague, tetanus, tularemia, brucellosis, anthrax, sepsis, bacterial pneumonia, dermatomycosis, etc.), cancer (oral cavity) Cancer, pharyngeal cancer, lip cancer, tongue cancer, gingival cancer, nasopharyngeal cancer, esophageal cancer, stomach cancer, small intestine cancer,
Colon cancer including colon cancer, liver cancer, gallbladder cancer, pancreatic cancer, nasal cavity cancer, lung cancer, osteosarcoma, soft tissue cancer, skin cancer, melanoma, breast cancer, uterine cancer, ovarian cancer, prostate cancer, testicular cancer, penile cancer , Bladder cancer, kidney cancer, brain tumor, thyroid cancer, lymphoma, leukemia, etc.), CD72 agonists, diseases caused by abnormal or excessive antibody production (atopic asthma, allergy) Rhinitis, atopic dermatitis, allergic bronchitis, pulmonary aspergillosis, parasitic disease, Kimura's disease, high IgE syndrome, Wiscott-Aldrich syndrome, thymic dysplasia, Hodkin's disease, liver cirrhosis, acute hepatitis, chronic Rheumatoid arthritis, insulin-dependent diabetes,
Systemic lupus erythematosus, scleroderma, infertility, endometriosis, autoimmune thyroid disease myasthenia gravis, Hashimoto's disease, Ba
sedow disease, pernicious anemia, Addison's disease, male infertility, multiple sclerosis, Goodpasture syndrome, pemphigus, pemphigoid, myasthenia gravis, lens ophthalmitis, sympathetic ophthalmitis, autoimmune hemolytic anemia, Idiopathic thrombocytopenia, autoimmune leukopenia, Felty syndrome, autoimmune lymphopenia, ulcerative colitis, Sjogren's syndrome, systemic autoimmune disease, primary biliary cirrhosis, rupioid hepatitis, etc.) It is useful as a method for screening for a CD72 antagonist that can be used as a prophylactic / therapeutic agent for the disease.

[0079]

[Sequence listing] [Sequence Listing] <110> Takeda Chemical Industries, Ltd. <120> Screening Method Using CD100 <130> B00128 <150> JP 11-157111 <151> 1999-06-03 <160> 10 <210> 1 <211> 861 <212> PRT <213> Mouse <400> 1 Met Arg Met Cys Ala Pro Val Arg Gly Leu Phe Leu Ala Leu Val Val 1 5 10 15 Val Leu Arg Thr Ala Val Ala Phe Ala Pro Val Pro Arg Leu Thr Trp 20 25 30 Glu His Gly Glu Val Gly Leu Val Gln Phe His Lys Pro Gly Ile Phe 35 40 45 Asn Tyr Ser Ala Leu Leu Met Ser Glu Asp Lys Asp Thr Leu Tyr Val 50 55 60 Gly Ala Arg Glu Ala Val Phe Ala Val Asn Ala Leu Asn Ile Ser Glu 65 70 75 80 Lys Gln His Glu Val Tyr Trp Lys Val Ser Glu Asp Lys Lys Ser Lys 85 90 95 Cys Ala Glu Lys Gly Lys Ser Lys Gln Thr Glu Cys Leu Asn Tyr Ile 100 105 110 Arg Val Leu Gln Pro Leu Ser Ser Thr Ser Leu Tyr Val Cys Gly Thr 115 120 125 Asn Ala Phe Gln Pro Thr Cys Asp His Leu Asn Leu Thr Ser Phe Lys 130 135 140 Phe Leu Gly Lys Ser Glu Asp Gly Lys Gly Arg Cys Pro Phe Asp Pro 145 150 155 160 Ala His Ser Tyr Thr Ser Val Met Val Gly Gly Glu Leu Tyr Ser Gly 165 170 175 Thr Ser Tyr Asn Phe Leu Gly Ser Glu Pro Ile Ile Ser Arg Asn Ser 180 185 190 Ser His Ser Pro Leu Arg Thr Glu Tyr Ala Ile Pro Trp Leu Asn Glu 195 200 205 Pro Ser Phe Val Phe Ala Asp Val Ile Gln Lys Ser Pro Asp Gly Pro 210 215 220 Glu Gly Glu Asp Asp Lys Val Tyr Phe Phe Phe Thr Glu Val Ser Val 225 230 235 240 Glu Tyr Glu Phe Val Phe Lys Leu Met Ile Pro Arg Val Ala Arg Val 245 250 255 Cys Lys Gly Asp Gln Gly Gly Leu Arg Thr Leu Gln Lys Lys Trp Thr 260 265 270 Ser Phe Leu Lys Ala Arg Leu Ile Cys Ser Lys Pro Asp Ser Gly Leu 275 280 285 285 Val Phe Asn Ile Leu Gln Asp Val Phe Val Leu Arg Ala Pro Gly Leu 290 295 300 Lys Glu Pro Val Phe Tyr Ala Val Phe Thr Pro Gln Leu Asn Asn Val 305 310 315 320 Gly Leu Ser Ala Val Cys Ala Tyr Thr Leu Ala Thr Val Glu Ala Val 325 330 335 Phe Ser Arg Gly Lys Tyr Met Gln Ser Ala Thr Val Glu Gln Ser His 340 345 350 Thr Lys Trp Val Arg Tyr Asn Gly Pro Val Pro Thr Pro Arg Pro Gly 355 360 365 Ala Cys Ile Asp Ser Glu Ala Arg Ala Ala Asn Tyr Thr Ser Ser Leu 370 375 380 Asn Leu Pro Asp Lys Thr Leu Gln Phe Val Lys Asp His Pro Leu Met 385 390 395 400 400 Asp Asp Ser Val Thr Pro Ile Asp Asn Arg Pro Lys Leu Ile Lys Lys 405 410 415 Asp Val Asn Tyr Thr Gln Ile Val Val Asp Arg Thr Gln Ala Leu Asp 420 425 430 Gly Thr Phe Tyr Asp Val Met Phe Ile Ser Thr Asp Arg Gly Ala Leu 435 440 445 His Lys Ala Val Ile Leu Thr Lys Glu Val His Val Ile Glu Glu Thr 450 455 460 Gln Leu Phe Arg Asp Phe Glu Pro Val Leu Thr Leu Leu Leu Ser Ser 465 470 475 480 Lys Lys Gly Arg Lys Phe Val Tyr Ala Gly Ser Asn Ser Gly Val Val 485 490 490 495 Gln Ala Pro Leu Ala Phe Cys Glu Lys His Gly Ser Cys Glu Asp Cys 500 505 510 Val Leu Ala Arg Asp Pro Tyr Cys Ala Trp Ser Pro Ala Ile Lys Ala 515 520 525 Cys Val Thr Leu His Gln Glu Glu Ala Ser Ser Arg Gly Trp Ile Gln 530 535 540 Asp Met Ser Gly Asp Thr Ser Ser Cys Leu Asp Lys Ser Lys Glu Ser 545 550 555 560 Phe Asn Gln His Phe Phe Lys His Gly Gly Thr Ala Glu Leu Lys Cys 565 570 575 Phe Gln Lys Ser Asn Leu Ala Arg Val Val Trp Lys Phe Gln Asn Gly 580 585 590 Glu Leu Lys Ala Ala Ser Pro Lys Tyr Gly Phe Val Gly Arg Lys His 595 600 605 Leu Leu Ile Phe Asn Leu Ser Asp Gly Asp Ser Gly Val Tyr Gln Cys 610 615 620 620 Leu Ser Glu Glu Arg Val Arg Asn Lys Thr Val Ser Gln Leu Leu Ala 625 630 635 640 Lys His Val Leu Glu Val Lys Met Val Pro Arg Thr Pro Pro Ser Pro 645 650 655 Thr Ser Glu Asp Val Gln Thr Glu Gly Ser Lys Ile Thr Ser Lys Met 660 665 670 Pro Val Gly Ser Thr Gln Gly Ser Ser Pro Pro Thr Pro Ala Leu Trp 675 680 685 Ala Thr Ser Pro Arg Ala Ala Thr Leu Pro Pro Lys Ser Ser Ser Gly 690 695 700 Thr Ser Cys Glu Pro Lys Met Val Ile Asn Thr Val Pro Gln Leu His 705 710 715 715 720 Ser Glu Lys Thr Val Tyr Leu Lys Ser Ser Asp Asn Arg Leu Leu Met 725 730 735 Ser Leu Leu Leu Phe Ile Phe Val Leu Phe Leu Cys Leu Phe Ser Tyr 740 745 750 Asn Cys Tyr Lys Gly Tyr Leu Pro Gly Gln Cys Leu Lys Phe Arg Ser 755 760 765 Ala Leu Leu Leu Gly Lys Lys Thr Pro Lys Ser Asp Phe Ser Asp Leu 770 775 780 Glu Gln Ser Val Lys Glu Thr Leu Val Glu Pro Gly Ser Phe Ser Gln 785 790 795 800 Gln Asn Gly Asp His Pro Lys Pro Ala Leu Asp Thr Gly Tyr Glu Thr 805 810 815 Glu Gln Asp Thr Ile Thr Ser Lys Val Pro Thr Asp Arg Glu Asp Ser 820 825 830 Gln Arg Ile Asp Glu Leu Ser Ala Arg Asp Lys Pro Phe Asp Val Lys 835 840 845 Cys Glu Leu Lys Phe Ala Asp Ser Asp Ala Asp Gly Asp 850 855 860 <210> 2 <211> 2769 <212> DNA <213> Mouse <400 > 2 gaattcggca cgaggccatc catgtgtgcc cgttgctgaa ggcctcggtg gcccctgccc 60 atgaggatgt gtgcccccgt tagggggctg ttcttggccc tggtggtagt gttgagaacc 120 gcggtggcat ttgcacctgt gcctcggctc acctgggaac atggagaggt aggtctggtg 180 cagtttcaca agccaggcat ctttaactac tcggccttgc tgatgagtga ggacaaagac 240 actctgtatg taggcgcccg ggaagcagtc tttgcagtga atgcgctgaa catctctgag 300 aagcaacatg aggtatattg gaaggtctct gaagacaaaa aatccaagtg tgcagagaag 360 gggaaatcaa agcagacgga atgcctaaac tacattcgag tactacagcc actaagcagc 420 acttccctct atgtgtgtgg gaccaatgcg ttccagccca cctgtgacca cctgaacttg 480 acatccttca agtttctggg gaaaagtgaa gatggcaaag gaagatgccc cttcgacc cc 540 gcccacagct acacatcagt catggttggg ggcgagctct actctgggac gtcctataat 600 ttcttgggca gtgaacccat catctctcga aactcttccc acagtccctt gaggacggag 660 tatgccatcc cgtggctgaa cgagcctagc ttcgtctttg ctgacgtgat ccagaaaagc 720 ccagatggtc cggagggtga agatgacaag gtctacttct tttttacgga ggtatccgtg 780 gagtacgaat tcgtcttcaa gttgatgatc ccgcgagttg ccagggtgtg caagggcgac 840 cagggcggcc tgcggacttt gcaaaaaaag tggacctcct tcctaaaggc caggctgatc 900 tgctccaagc cagacagtgg cctggtcttc aacatacttc aggatgtgtt tgtgctgagg 960 gccccgggcc tcaaggagcc tgtgttctat gcggtcttca ccccacagct gaacaatgtg 1020 ggtctgtcag cggtgtgcgc ctacacactg gccacggtgg aggcagtctt ctcccgtgga 1080 aagtacatgc agagtgccac agtggagcag tctcacacca agtgggtgcg ctacaatggc 1140 ccagtgccca ctccccgacc tggagcgtgt atcgacagtg aggcccgggc agccaactac 1200 accagctcct tgaatctccc agacaaaaca ctgcagtttg taaaagacca ccctttgatg 1260 gatgactcag tgaccccgat agacaacaga cccaagctga tcaaaaaaga tgtaaactac 1320 acccagatag tggtagacag gacccaggcc ctggatggga ctttctacga cgtcatgttc 1380 atcagc acag accggggagc tctgcataaa gcagtcatcc tcacaaaaga ggtgcatgtc 1440 atcgaggaga cccaactctt ccgggactct gaaccggtcc taactctgct gctatcgtca 1500 aagaagggga ggaagtttgt ctatgcaggc tccaactctg gagtggtcca agcgcccctg 1560 gcattctgcg aaaagcacgg tagctgtgaa gactgtgtgt tagcacggga cccctactgt 1620 gcctggagcc cagccatcaa ggcctgtgtt accctgcacc aggaagaggc ctccagcagg 1680 ggctggattc aggacatgag cggtgacaca tcctcatgcc tggataagag taaagaaagt 1740 ttcaaccagc attttttcaa gcacggcggc acagcggaac tcaaatgttt ccaaaagtcc 1800 aacctagccc gggtggtatg gaagttccag aatggcgagt tgaaggccgc aagtcccaag 1860 tacggctttg tgggcaggaa gcacctgctc atcttcaacc tgtcggacgg agacagcggc 1920 gtgtaccagt gcctgtcaga ggaaagggtg aggaataaaa cggtctccca gctgctggcc 1980 aagcacgttc tggaagtgaa gatggtacct cggacccccc cctcacctac ctcagaggat 2040 gttcagacag aaggtagtaa gatcacatcc aaaatgccgg ttggatctac ccaggggtcc 2100 tctcccccta ccccggctct gtgggcaacc tcccccagag ccgccaccct acctcccaag 2160 tcctcctccg gcacatcctg tgaaccaaag atggtcatca acacggtccc ccagctccac 2220 tcagagaaga c ggtgtatct caagtccagt gacaaccgcc tgctcatgtc tctcctcctc 2280 ttcatctttg tcctcttcct ctgcctcttt tcctacaact gctacaaggg ctacctgccc 2340 ggacagtgct taaaattccg ctcagccctg ctgcttggaa agaaaacacc caagtcagac 2400 ttctctgacc tggagcagag tgtgaaggag acactggtcg agcctgggag cttctcccag 2460 cagaacggcg accaccccaa gccagccctg gatacgggct atgaaacgga gcaggacacc 2520 atcaccagca aagtccccac ggatcgtgag gactcgcaac ggatcgatga actctctgcc 2580 cgggacaaac cgtttgatgt caagtgtgaa ctgaagtttg cagattcgga tgctgacggg 2640 gactgaggcc agcgtgtccc agcccatgcc cctctgtctt cgtggagagt gttgtgttga 2700 gcccattcag tagccgagtc ttgtcactct gtgccagcct cagtcctgtg tccccttttt 2760 ctctggttt 2769 <210> 3 <211> 862 <212> PRT <213> Human <400> Le Ala Pro Mule 1 5 10 15 Met Phe Gly Thr Ala Met Ala Phe Ala Pro Ile Pro Arg Ile Thr Trp 20 25 30 Glu His Arg Glu Val His Leu Val Gln Phe His Glu Pro Asp Ile Tyr 35 40 45 Asn Tyr Ser Ala Leu Leu Leu Ser Glu Asp Lys Asp Thr Leu Tyr Ile 50 55 60 Gly Ala Arg Glu A la Val Phe Ala Val Asn Ala Leu Asn Ile Ser Glu 65 70 75 80 Lys Gln His Glu Val Tyr Trp Lys Val Ser Glu Asp Lys Lys Ala Lys 85 90 95 Cys Ala Glu Lys Gly Lys Ser Lys Gln Thr Glu Cys Leu Asn Tyr Ile 100 105 110 Arg Val Leu Gln Pro Leu Ser Ala Thr Ser Leu Tyr Val Cys Gly Thr 115 120 125 Asn Ala Phe Gln Pro Ala Cys Asp His Leu Asn Leu Thr Ser Phe Lys 130 135 140 Phe Leu Gly Lys Asn Glu Asp Gly Lys Gly Arg Cys Pro Phe Asp Pro 145 150 155 160 Ala His Ser Tyr Thr Ser Val Met Val Asp Gly Glu Leu Tyr Ser Gly 165 170 175 Thr Ser Tyr Asn Phe Leu Gly Ser Glu Pro Ile Ile Ser Arg Asn Ser 180 185 190 Ser His Ser Pro Leu Arg Thr Glu Tyr Ala Ile Pro Trp Leu Asn Glu 195 200 205 Pro Ser Phe Val Phe Ala Asp Val Ile Arg Lys Ser Pro Asp Ser Pro 210 215 220 Asp Gly Glu Asp Asp Arg Val Tyr Phe Phe Phe Thr Glu Val Ser Val 225 230 235 240 Glu Tyr Glu Phe Val Phe Arg Val Leu Ile Pro Arg Ile Ala Arg Val 245 250 255 Cys Lys Gly Asp Gln Gly Gly Leu Arg Thr Leu Gln Lys Lys Trp Thr 260 265 270 270 Ser Phe Leu Lys Ala Arg Leu Ile Cys Ser Arg Pro Asp Ser Gly Leu 275 280 285 Val Phe Asn Val Leu Arg Asp Val Phe Val Leu Arg Ser Pro Gly Leu 290 295 300 Lys Val Pro Val Phe Tyr Ala Leu Phe Thr Pro Gln Leu Asn Asn Val 305 310 315 320 Gly Leu Ser Ala Val Cys Ala Tyr Asn Leu Ser Thr Ala Glu Glu Val 325 330 335 Phe Ser His Gly Lys Tyr Met Gln Ser Thr Thr Val Glu Gln Ser His 340 345 350 Thr Lys Trp Val Arg Tyr Asn Gly Pro Val Pro Lys Pro Arg Pro Gly 355 360 365 Ala Cys Ile Asp Ser Glu Ala Arg Ala Ala Asn Tyr Thr Ser Ser Leu 370 375 380 Asn Leu Pro Asp Lys Thr Leu Gln Phe Val Lys Asp His Pro Leu Met 385 390 395 400 400 Asp Asp Ser Val Thr Pro Ile Asp Asn Arg Pro Arg Leu Ile Lys Lys 405 410 415 Asp Val Asn Tyr Thr Gln Ile Val Val Asp Arg Thr Gln Ala Leu Asp 420 425 430 Gly Thr Val Tyr Asp Val Met Phe Val Ser Thr Asp Arg Gly Ala Leu 435 440 445 His Lys Ala Ile Ser Leu Glu His Ala Val His Ile Ile Glu Glu Thr 450 455 460 Gln Leu Phe Gln Asp Phe Glu Pro Val Gln Thr Leu Leu Leu Ser Ser 465 470 475 480 480 Lys Lys Gly Asn Arg Phe Val Tyr Ala Gly Ser Asn Ser Gly Val Val 485 490 495 Gln Ala Pro Leu Ala Phe Cys Gly Lys His Gly Thr Cys Glu Asp Cys 500 505 510 Val Leu Ala Arg Asp Pro Tyr Cys Ala Trp Ser Pro Pro Thr Ala Thr 515 520 525 Cys Val Ala Leu His Gln Thr Glu Ser Pro Ser Arg Gly Leu Ile Gln 530 535 540 Glu Met Ser Gly Asp Ala Ser Val Cys Pro Asp Lys Ser Lys Gly Ser 545 550 555 560 Tyr Arg Gln His Phe Phe Lys His Gly Gly Thr Ala Glu Leu Lys Cys 565 570 575 Ser Gln Lys Ser Asn Leu Ala Arg Val Phe Trp Lys Phe Gln Asn Gly 580 585 590 Val Leu Lys Ala Glu Ser Pro Lys Tyr Gly Leu Met Gly Arg Lys Asn 595 600 605 Leu Leu Ile Phe Asn Leu Ser Glu Gly Asp Ser Gly Val Tyr Gln Cys 610 615 620 Leu Ser Glu Glu Arg Val Lys Asn Lys Thr Val Phe Gln Val Val Ala 625 630 635 640 Lys His Val Leu Glu Val Lys Val Val Pro Lys Pro Val Val Ala Pro 645 650 655 Thr Leu Ser Val Val Gln Thr Glu Gly Ser Arg Ile Ala Thr Lys Val 660 665 670 Leu Val Ala Ser Thr Gln Gly Ser Ser Pro Pro Thr Pro Ala Val Gln 675 680 685 Ala Thr Ser Ser Gly Ala Il e Thr Leu Pro Pro Lys Pro Ala Pro Thr 690 695 700 Gly Thr Ser Cys Glu Pro Lys Ile Val Ile Asn Thr Val Pro Gln Leu 705 710 715 720 720 His Ser Glu Lys Thr Met Tyr Leu Lys Ser Ser Asp Asn Arg Leu Leu 725 730 735 Met Ser Leu Phe Leu Phe Phe Phe Val Leu Phe Leu Cys Leu Phe Phe 740 745 750 Tyr Asn Cys Tyr Lys Gly Tyr Leu Pro Arg Gln Cys Leu Lys Phe Arg 755 760 765 765 Ser Ala Leu Leu Ile Gly Lys Lys Lys Pro Lys Ser Asp Phe Cys Asp 770 775 780 Arg Glu Gln Ser Leu Lys Glu Thr Leu Val Glu Pro Gly Ser Phe Ser 785 790 795 800 Gln Gln Asn Gly Glu His Pro Lys Pro Ala Leu Asp Thr Gly Tyr Glu 805 810 815 Thr Glu Gln Asp Thr Ile Thr Ser Lys Val Pro Thr Asp Arg Glu Asp 820 825 830 Ser Gln Arg Ile Asp Asp Leu Ser Ala Arg Asp Lys Pro Phe Asp Val 835 840 845 Lys Cys Glu Leu Lys Phe Ala Asp Ser Asp Ala Asp Gly Asp 850 855 860 <210> 4 <211> 4157 <212> DNA <213> Human <400> 4 ctgagccgca tctgcaatag cacacttgcc cggccacctg ctgccgtgag cctttgctgc 60 tgaagcccct ggggtcgcct ctacctgatg aggatgtgcacccc ggcccttg cagtgatgtt tgggacagcg atggcatttg cacccatacc ccggatcacc 180 tgggagcaca gagaggtgca cctggtgcag tttcatgagc cagacatcta caactactca 240 gccttgctgc tgagcgagga caaggacacc ttgtacatag gtgcccggga ggcggtcttc 300 gctgtgaacg cactcaacat ctccgagaag cagcatgagg tgtattggaa ggtctcagaa 360 gacaaaaaag caaaatgtgc agaaaagggg aaatcaaaac agacagagtg cctcaactac 420 atccgggtgc tgcagccact cagcgccact tccctttacg tgtgtgggac caacgcattc 480 cagccggcct gtgaccacct gaacttaaca tcctttaagt ttctggggaa aaatgaagat 540 ggcaaaggaa gatgtccctt tgacccagca cacagctaca catccgtcat ggttgatgga 600 gaactttatt cggggacgtc gtataatttt ttgggaagtg aacccatcat ctcccgaaat 660 tcttcccaca gtcctctgag gacagaatat gcaatccctt ggctgaacga gcctagtttc 720 gtgtttgctg acgtgatccg aaaaagccca gacagccccg acggcgagga tgacagggtc 780 tacttcttct tcacggaggt gtctgtggag tatgagtttg tgttcagggt gctgatccca 840 cggatagcaa gagtgtgcaa gggggaccag ggcggcctga ggaccttgca gaagaaatgg 900 acctccttcc tgaaagcccg actcatctgc tcccggccag acagcggctt ggtcttcaat 960 gtgctgcggg atgtcttcgtgctcaggtcc ccgggcctga aggtgcctgt gttctatgca 1020 ctcttcaccc cacagctgaa caacgtgggg ctgtcggcag tgtgcgccta caacctgtcc 1080 acagccgagg aggtcttctc ccacgggaag tacatgcaga gcaccacagt ggagcagtcc 1140 cacaccaagt gggtgcgcta taatggcccg gtacccaagc cgcggcctgg agcgtgcatc 1200 gacagcgagg cacgggccgc caactacacc agctccttga atttgccaga caagacgctg 1260 cagttcgtta aagaccaccc tttgatggat gactcggtaa ccccaataga caacaggccc 1320 aggttaatca agaaagatgt gaactacacc cagatcgtgg tggaccggac ccaggccctg 1380 gatgggactg tctatgatgt catgtttgtc agcacagacc ggggagctct gcacaaagcc 1440 atcagcctcg agcacgctgt tcacatcatc gaggagaccc agctcttcca ggactttgag 1500 ccagtccaga ccctgctgct gtcttcaaag aagggcaaca ggtttgtcta tgctggctct 1560 aactcgggcg tggtccaggc cccgctggcc ttctgtggga agcacggcac ctgcgaggac 1620 tgtgtgctgg cgcgggaccc ctactgcgcc tggagcccgc ccacagcgac ctgcgtggct 1680 ctgcaccaga ccgagagccc cagcaggggt ttgattcagg agatgagcgg cgatgcttct 1740 gtgtgcccgg ataaaagtaa aggaagttac cggcagcatt ttttcaagca cggtggcaca 1800 gcggaactga aatgctccca aaaatc caac ctggcccggg tcttttggaa gttccagaat 1860 ggcgtgttga aggccgagag ccccaagtac ggtcttatgg gcagaaaaaa cttgctcatc 1920 ttcaacttgt cagaaggaga cagtggggtg taccagtgcc tgtcagagga gagggttaag 1980 aacaaaacgg tcttccaagt ggtcgccaag cacgtcctgg aagtgaaggt ggttccaaag 2040 cccgtagtgg cccccacctt gtcagttgtt cagacagaag gtagtaggat tgccaccaaa 2100 gtgttggtgg catccaccca agggtcttct cccccaaccc cagccgtgca ggccacctcc 2160 tccggggcca tcacccttcc tcccaagcct gcgcccaccg gcacatcctg cgaaccaaag 2220 atcgtcatca acacggtccc ccagctccac tcggagaaaa ccatgtatct taagtccagc 2280 gacaaccgcc tcctcatgtc cctcttcctc ttcttctttg ttctcttcct ctgcctcttt 2340 ttctacaact gctataaggg atacctgccc agacagtgct tgaaattccg ctcggcccta 2400 ctaattggga agaagaagcc caagtcagat ttctgtgacc gtgagcagag cctgaaggag 2460 acgttagtag agccagggag cttctcccag cagaatgggg agcaccccaa gccagccctg 2520 gacaccggct atgagaccga gcaagacacc atcaccagca aagtccccac ggatagggag 2580 gactcacaga ggatcgacga cctttctgcc agggacaagc cctttgacgt caagtgtgag 2640 ctgaagttcg ctgactcaga cgcagatgga g actgaggcc ggctgtgcat ccccgctggt 2700 gcctcggctg cgacgtgtcc aggcgtggag agttttgtgt ttctcctgtt cagtatccga 2760 gtctcgtgca gtgctgcgta ggttagcccg catcgtgcag acaacctcag tcctcttgtc 2820 tattttctct tgggttgagc ctgtgacttg gtttctcttt gtccttttgg aaaaatgaca 2880 agcattgcat cccagtcttg tgttccgaag tcagtcggag tacttgaaga aggcccacgg 2940 gcggcacgga gttcctgagc cctttctgta gtgggggaaa ggtggctgga cctctgttgg 3000 ctgagaagag catcccttca gcttcccctc cccgtagcag ccactaaaag attatttaat 3060 tccagattgg aaatgacatt ttagtttatc agattggtaa cttatcgcct gttgtccaga 3120 ttggcacgaa ccttttcttc cacttaatta tttttttagg attttgcttt gattgtgttt 3180 atgtcatggg tcattttttt ttagttacag aagcagttgt gttaatattt agaagaagat 3240 gtatatcttc cagattttgt tatatatttg gcataaaata cggcttacgt tgcttaagat 3300 tctcagggat aaacttcctt ttgctaaatg cattctttct gcttttagaa atgtagacat 3360 aaacactccc cggagcccac tcaccttttt tctttttctt tttttttttt taactttatt 3420 ccttgaggga agcattgttt ttggagagat tttctttctg tacttcgttt tacttttctt 3480 tttttttaac ttttactctc tcgaagaaga ggacctt ccc acatccacga ggtgggtttt 3540 gagcaaggga aggtagcctg gatgagctga gtggagccag gctggcccag agctgagatg 3600 ggagtgcggt acaatctgga gcccacagct gtcggtcaga acctcctgtg agacagatgg 3660 aaccttcaca agggcgcctt tggttctctg aacatctcct ttctcttctt gcttcaattg 3720 cttacccact gcctgcccag actttctatc cagcctcact gagctgccca ctactggaag 3780 ggaactgggc ctcggtggcc ggggccgcga gctgtgacca cagcaccctc aagcatacgg 3840 cgctgttcct gccactgtcc tgaagatgtg aatgggtggt acgatttcaa cactggttaa 3900 tttcacactc catctccccg ctttgtaaat acccatcggg aagagacttt ttttccatgg 3960 tgaagagcaa taaactctgg atgtttgtgc gcgtgtgtgg acagtcttat cttccagcat 4020 gataggattt gaccattttg gtgtaaacat ttgtgtttta taagatttac cttgttttta 4080 tttttctact ttgaattgta tacatttgga aagtacccaa ataaatgaga agcttctatc 4140 cttaaaaaaa aaaaaaa 4157 <210> 5 <211> 361 <212> PRT <213> Mouse <400> 5 Met Ala Asp Ala Ile Thr Tyr Ala Asp Leu Arg Phe Val Lys Val Pro 5 10 15 Leu Lys Asn Ser Ala Ser Asn His Leu Gly Gln Asp Cys Glu Ala Tyr 20 25 30 Glu Asp Gly Glu Leu Thr Tyr Glu Asn Val Gl n Val Ser Pro Val Pro 35 40 45 Gly Gly Pro Pro Gly Leu Ala Ser Pro Ala Leu Ala Asp Lys Ala Gly 50 55 60 Val Gly Ser Glu Gln Pro Thr Ala Thr Trp Ser Ser Val Asn Ser Ser 65 70 75 80 Ala Leu Arg Gln Ile Pro Arg Cys Pro Thr Val Cys Leu Gln Tyr Phe 85 90 95 Leu Leu Gly Leu Leu Val Ser Cys Leu Met Leu Gly Val Ala Val Ile 100 105 110 Cys Leu Gly Val Arg Tyr Leu Gln Val Ser Arg Gln Phe Gln Glu Gly 115 120 125 Thr Arg Ile Trp Glu Ala Thr Asn Ser Ser Leu Gln Gln Gln Leu Arg 130 135 140 Glu Lys Ile Ser Gln Leu Gly Gln Lys Glu Val Glu Leu Gln Lys Ala 145 150 155 160 Arg Lys Glu Leu Ile Ser Ser Gln Asp Thr Leu Gln Glu Lys Gln Arg 165 170 175 Thr His Glu Asp Ala Glu Gln Gln Leu Gln Ala Cys Gln Ala Glu Arg 180 185 190 Ala Lys Thr Lys Glu Asn Leu Lys Thr Glu Glu Glu Arg Arg Arg Asp 195 200 205 Leu Asp Gln Arg Leu Thr Ser Thr Arg Glu Thr Leu Arg Arg Phe Phe 210 215 220 Ser Asp Ser Ser Asp Thr Cys Cys Pro Cys Gly Trp Ile Pro Tyr Gln 225 230 235 240 Glu Arg Cys Phe Tyr Ile Ser His Thr Leu Gly Ser Leu Glu Glu Ser 245 250 255 Gln Lys Tyr Cys Thr Ser Leu Ser Ser Lys Leu Ala Ala Phe Asp Glu 260 265 270 Pro Ser Lys Tyr Tyr Tyr Glu Tyr Leu Ser Asp Ala Pro Gln Val Ser 275 280 285 Leu Pro Ser Gly Leu Glu Glu Leu Leu Asp Arg Ser Lys Ser Tyr Trp 290 295 300 Ile Gln Met Ser Lys Lys Trp Arg Gln Asp Ser Asp Ser Gln Ser Arg 305 310 315 320 His Cys Val Arg Ile Lys Thr Tyr Tyr Gln Lys Trp Glu Arg Thr Ile 325 330 335 Ser Lys Cys Ala Glu Leu His Pro Cys Ile Cys Glu Ser Glu Ala Phe 340 345 350 Arg Phe Pro Asp Gly Ile Asn Leu Asn 355 360 <210> 6 <211> 1357 <212> DNA <213> Mouse <400> 6 tggaagactg tgaagcagag gcgcccaggg ctatggctga cgctatcacg tatgcagacc 60 tgcgctttgt gaaagtgccc ctgaagaaca gcgcatctaa ccatctagga caggactgtg 120 aggcctatga agatggggaa ctcacctacg agaatgtgca agtgtctcca gtcccaggag 180 ggccaccagg cttggcttcc cctgcactag cggacaaagc aggggtcggg tcagagcaac 240 caactgcgac ctggagctct gtgaactcgt ctgctctcag gcagattccc cgctgtccta 300 cagtctgctt gcaatacttc ttgcttggcc ttctcgtgtc ctgtctgatg ttaggggtgg 360 ctgtcat ctg cctgggagtt cgctatctgc aggtgtctcg gcagttccag gaggggacca 420 ggatttggga agccaccaat agcagcctgc agcagcagct cagggagaag ataagtcagc 480 tggggcagaa ggaggtggag cttcagaagg ctcggaaaga gctgatctcg agccaggaca 540 cattacagga gaagcagagg actcacgagg acgctgagca gcaactacaa gcctgccagg 600 ctgagagagc gaagaccaag gagaacctga aaactgagga ggagcggagg agggacctgg 660 accagaggtt gacaagcacg cgggagacac tgaggcgctt cttctctgat tcatcagaca 720 cctgctgtcc atgcggatgg attccatatc aggaaaggtg cttttacatc tcacataccc 780 tcggaagtct ggaggagagc caaaaatact gcacatctct gtcctccaaa ctggcagcat 840 tcgatgaacc ttctaagtat tactatgaag tttctctgcc cagcggctta gaggagttgc 900 tagatcgttc gaagtcatat tggatacaga tgagcaagaa gtggaggcag gactctgact 960 ctcaaagccg acattgtgtc aggataaaaa catattacca gaagtgggaa agaacaattt 1020 ccaagtgtgc agagcttcac ccctgcattt gtgagtcgga ggctttcagg tttcctgatg 1080 ggatcaatct gaactgaaac ggacacttga acaagacctt gtgacctaca tccttaacct 1140 acggcctgcc aatttttaag actgctattc ctccagcact ccctcactct cgggcatgcc 1200 cagctaaggg atgacctgct g cttgcttga aagctgctcc agaaactgga cttctcttgg 1260 gaagagtaaa gaagcctcca gaaaagactt gaccttcctt aagaacttcc caaactagag 1340 atgggtcagg ggagggc 1357 <210> 7 <211> 359 <212> PRT <213> Human <400> La Ala Ala La Lag Pro 5 10 15 Leu Lys Lys Ser Ile Ser Ser Arg Leu Gly Gln Asp Pro Gly Ala Asp 20 25 30 Asp Asp Gly Glu Ile Thr Tyr Glu Asn Val Gln Val Pro Ala Val Leu 35 40 45 Gly Val Pro Ser Ser Leu Ala Ser Ser Val Leu Gly Asp Lys Ala Ala 50 55 60 Val Lys Ser Glu Gln Pro Thr Ala Ser Trp Arg Ala Val Thr Ser Pro 65 70 75 80 Ala Val Gly Arg Ile Leu Pro Cys Arg Thr Thr Cys Leu Arg Tyr Leu 85 90 95 Leu Leu Gly Leu Leu Leu Thr Cys Leu Leu Leu Gly Val Thr Ala Ile 100 105 110 Cys Leu Gly Val Arg Tyr Leu Gln Val Ser Gln Gln Leu Gln Gln Thr 115 120 125 Asn Arg Val Leu Glu Val Thr Asn Ser Ser Leu Arg Gln Gln Leu Arg 130 135 140 Leu Lys Ile Thr Gln Leu Gly Gln Ser Ala Glu Asp Leu Gln Gly Ser 145 150 155 160 Arg Arg Glu Leu Ala Gln Ser Gln Glu Ala Leu Gln Val Glu Gln A rg 165 170 175 Ala His Gln Ala Ala Glu Gly Gln Leu Gln Ala Cys Gln Ala Asp Arg 180 185 190 Gln Lys Thr Lys Glu Thr Leu Gln Ser Glu Glu Gln Gln Arg Arg Ala 195 200 205 Leu Glu Gln Lys Leu Ser Asn Met Glu Asn Arg Leu Lys Pro Phe Phe 210 215 220 Thr Cys Gly Ser Ala Asp Thr Cys Cys Pro Ser Gly Trp Ile Met His 225 230 235 240 Gln Lys Ser Cys Phe Tyr Ile Ser Leu Thr Ser Lys Asn Trp Gln Glu 245 250 255 Ser Gln Lys Gln Cys Glu Thr Leu Ser Ser Lys Leu Ala Thr Phe Ser 260 265 270 Glu Ile Tyr Pro Gln Ser His Ser Tyr Tyr Phe Leu Asn Ser Leu Leu 275 280 285 Pro Asn Gly Gly Ser Gly Asn Ser Tyr Trp Thr Gly Leu Ser Ser Asn 290 295 300 Lys Asp Trp Lys Leu Thr Asp Asp Thr Gln Arg Thr Arg Thr Tyr Ala 305 310 315 320 Gln Ser Ser Lys Cys Asn Lys Val His Lys Thr Trp Ser Trp Trp Thr 325 330 335 Leu Glu Ser Glu Ser Cys Arg Ser Ser Leu Pro Tyr Ile Cys Glu Met 340 345 350 Thr Ala Phe Arg Phe Pro Asp 355 359 <210> 8 <211> 1531 <212> DNA <213> Human <400> 8 agtcacagag ggaacacaga gcctagttgt aaacggacag agacgagagg g gcaagggag 60 gacagtggat gacagggaag acgagtgggg gcagagctgc tcaggaccat ggctgaggcc 120 atcacctatg cagatctgag gtttgtgaag gctcccctga agaagagcat ctccagccgg 180 ttaggacagg acccaggggc tgatgatgat ggggaaatca cctacgagaa tgttcaagtg 240 cccgcagtcc taggggtgcc ctcaagcttg gcttcttctg tactagggga caaagcagcg 300 gtcaagtcgg agcagccaac tgcgtcctgg agagccgtga cgtcaccagc tgtcgggcgg 360 attctcccct gccgcacaac ctgcctgcga tacctcctgc tcggcctgct cctcacctgc 420 ctgctgttag gagtgaccgc catctgcctg ggagtgcgct atctgcaggt gtctcagcag 480 ctccagcaga cgaacagggt tctggaagtc actaacagca gcctgaggca gcagctccgc 540 ctcaagataa cgcagctggg acagagtgca gaggatctgc aggggtccag gagagagctg 600 gcgcagagtc aggaagcact acaggtggaa cagagggctc atcaggcggc cgaagggcag 660 ctacaggcct gccaggcaga cagacagaag acgaaggaga ccttgcaaag tgaggagcaa 720 cagaggaggg ccttggagca gaagctgagc aacatggaga acagactgaa gcccttcttc 780 acatgcggct cagcagacac ctgctgtccg tcgggatgga taatgcatca gaaaagctgc 840 ttttacatct cacttacttc aaaaaattgg caggagagcc aaaaacaatg tgaaactctg 900 tcttcca agc tggccacatt cagtgaaatt tatccacaat cacactctta ctacttctta 960 aattcactgt tgccaaatgg tggttcaggg aattcatatt ggactggcct cagctctaac 1020 aaggattgga agttgactga tgatacacaa cgcactagga cttatgctca aagctcaaaa 1080 tgtaacaagg tacataaaac ttggtcatgg tggacactgg agtcagagtc atgtagaagt 1140 tctcttccct acatctgtga gatgacagct ttcaggtttc cagattagga cagtcctttg 1200 cactgagttg acactcatgc caacaagaac ctgtgcccct ccttcctaac ctgaggcctg 1260 gggttcctca gaccatctcc ttcattctgg gcagtgccag ccaccggctg acccacacct 1320 gacacttcca gccagtctgc tgcctgctcc ctcttcctga aactggactg ttcctgggaa 1380 aagggtgaag ccacctctag aagggacttt ggcctccccc caagaacttc ccatggtaga 1440 atggggtggg ggaggagggc gcacgggctg agcggatagg ggcggcccgg agccagccag 1500 gcagttttat tgaaatcttt ttaaataatt g 1531 <210> 9 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> <400 > 9 gctgtcgact gtgtgcccgt tgctgaaggc ct 32 <210> 10 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> <400> 10 gacggatcct acttactttg ctttgcttgc ttgagataca ccgtcttctc tga 53

[0080]

[Brief description of the drawings]

FIG. 1. CD72-expressing CHO cells and mC in Example 1.
4 shows the binding to D100-Fc.

FIG. 2 shows the activity of CD100 to promote the production of an IgG1-specific antibody in Example 2.

FIG. 3 shows the activity of CD100 for inducing antibody production in vivo in Example 3.

FIG. 4 shows the targeting vector used for the production of CD100 knockout mice in Example 4, CD100 expected in wild-type mice and knockout mice
The genetic map of the gene, the CD100 gene structure in wild-type and knockout mice, and the expression level of CD100 protein in wild-type and knockout mice are shown.

FIG. 5 shows CD5 expression levels in wild-type mice and CD100 knockout mice in Example 5.

FIG. 6 shows antibody production against a TD (T cell-dependent) antigen in Example 6.

FIG. 7 shows the loss of T cell reactivity in CD100 knockout mice in Example 7.

FIG. 8 shows the increase in soluble CD100 and autoantibody levels with age in MRL / lpr mice in Example 9.

FIG. 9 shows the loss of dendritic cell reactivity in CD100 knockout mice in Example 10.

FIG. 10 shows T cell hyperreactivity in CD100 transgenic mice in Example 11.

Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat II (reference) A61P 29/00 101 A61P 29/00 101 31/04 31/04 31/10 31/10 31/12 31/12 35 / 00 35/00 37/00 37/00 37/08 37/08 C07K 14/47 C07K 14/47 14/71 14/71 C12N 5/10 C12Q 1/02 15/09 G01N 33/50 Z C12Q 1/02 33/566 G01N 33/50 C12P 21/02 C 33/566 C12N 5/00 B // C12P 21/02 15/00 A (C12P 21/02 C12R 1:91) (C12P 21/02 C12R 1:19)

Claims (16)

[Claims] 1. A method for screening a compound or a salt thereof that alters the binding between CD100 or a salt thereof and CD72 or a salt thereof, comprising using CD100 or a salt thereof and CD72 or a salt thereof. 2. A kit for screening a compound or a salt thereof that changes the binding between CD100 or a salt thereof and CD72 or a salt thereof, comprising using CD100 or a salt thereof and CD72 or a salt thereof. [3] A compound or a salt thereof, which is obtained by using the screening method according to the above [1] or the screening kit according to the above [2], which alters the binding between CD100 or a salt thereof and CD72 or a salt thereof. 4. The compound according to claim 3, which promotes or inhibits the activity of CD100 or a salt thereof, or a salt thereof. [5] a pharmaceutical comprising the compound of [3] or a salt thereof; 6. The medicament according to claim 5, which is an agent for inducing antibody production or an agent for preventing or treating a disease caused by abnormal antibody production. 7. The medicament according to claim 6, wherein the disease caused by abnormal production of antibodies is allergy or an autoimmune disease. 8. CD100 or a salt thereof, or CD1
2. The screening method according to claim 1, wherein 00 or a salt thereof and a test compound are added to cells expressing CD72, and a change in the amount of antibody produced or secreted from the cells is measured. 9. A non-human animal in which the reactivity of T cells has been lost and the CD100 gene has been knocked out. 10. A method for screening for a drug for preventing or treating a disease caused by CD100 deficiency, which comprises using a non-human animal in which the CD100 gene has been knocked out. 11. A method for screening a compound or a salt thereof that alters the binding between CD100 or a salt thereof and a receptor thereof, which comprises using a non-human animal in which the CD100 gene has been knocked out. 12. The screening method according to claim 11, wherein the receptor is CD72 or a salt thereof. 13. A T-cell having a DNA into which an exogenous CD100 gene or a mutant gene thereof has been incorporated.
A transgenic non-human animal having enhanced cell reactivity or a progeny thereof having the DNA. 14. A prophylactic / therapeutic agent for a disease caused by enhanced CD100, characterized by using a transgenic non-human animal having a DNA into which an exogenous CD100 gene or a mutant gene thereof has been incorporated, or a progeny thereof having the DNA. Screening method. 15. Use of a transgenic non-human animal having a DNA into which an exogenous CD100 gene or its mutant gene has been incorporated, or a progeny thereof having the DNA, for binding CD100 or a salt thereof to a receptor thereof. A method for screening a compound or a salt thereof that changes the sex. 16. The screening method according to claim 15, wherein the receptor is CD72 or a salt thereof.