CN113355420B - JAK3 promoter methylation detection primer composition, application and detection method - Google Patents
JAK3 promoter methylation detection primer composition, application and detection method Download PDFInfo
- Publication number
- CN113355420B CN113355420B CN202110752106.7A CN202110752106A CN113355420B CN 113355420 B CN113355420 B CN 113355420B CN 202110752106 A CN202110752106 A CN 202110752106A CN 113355420 B CN113355420 B CN 113355420B
- Authority
- CN
- China
- Prior art keywords
- jak3
- methylation
- promoter
- detection
- primer composition
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The invention discloses a JAK3 promoter methylation detection primer composition, application and a detection method, wherein the methylation level of the JAK3 promoter cg04557677 is detected by designing a detection primer composition cg04557677-F, cg04557677-Rbio and cg04557677-S and using a pyrosequencing technology. The JAK3 promoter methylation level detection method disclosed by the invention is high in sensitivity and accuracy, and has important significance for pathological stage and early detection, prognosis and risk assessment of kidney cancer.
Description
Technical Field
The invention belongs to the technical field of molecular biological detection, and particularly relates to a JAK3 promoter methylation detection primer composition, application and a detection method.
Background
The kidney cancer is a malignant tumor originated from the parenchyma of the kidney, the high-incidence age of the kidney cancer is 50-70 years old, the kidney cancer accounts for 2-3% of adult malignant tumors, the second place of the incidence rate of the malignant tumor of the urinary system in China is just second to the bladder cancer, and the incidence rate of the cancer gradually rises in recent years. According to the research, the 5-year survival rates of patients with different risks after renal cancer surgery are different, the low-risk patients are ranked in the leaders at a rate of 90%, while the high-risk patients are only 42%, and 62% of the middle-risk patients are not optimistic. Due to the influence of various factors, the survival rate of the kidney cancer patients in China is lower than that of the data. The cause of kidney cancer is not clear at present, and may be related to factors such as obesity, smoking, hypertension treatment, heredity and the like, wherein the hereditary kidney cancer accounts for 2-4% of the total number of kidney cancer. The pathogenesis of the kidney cancer is more secret, patients at early stage often have no obvious symptoms, but when the patients have triple signs of the kidney cancer (hematuria, pain and tumor), the kidney cancer is suggested to be developed to the late stage, and the optimal treatment period is missed, so the early diagnosis and the early treatment of the kidney cancer are particularly important.
Renal cancer has no obvious symptoms in the early stage, and is difficult to find due to the hidden position. The diagnosis of renal cancer is based mainly on imaging examinations including abdominal Ultrasound (US), magnetic Resonance Imaging (MRI) and X-ray Computed Tomography (CT), in addition to clinical symptoms based on the "triple sign of renal cancer". The ultrasonic examination is currently carried out by using multi-purpose color ultrasound, can identify the kidney parenchymal tumor and the kidney cystic mass, but is difficult to distinguish from other kidney parenchymal lesions even if the ultrasound contrast is carried out; CT is the most common and important means for diagnosing kidney cancer at present, theoretically, the position, range and form of a substantial kidney tumor can be clearly displayed, the early cancerated kidney can be found, the strengthened tumor is generally strengthened, and the transparent cell cancer is similar to liver cancer and presents a strengthening mode of fast forward and fast out; MRI can clearly display the tumor morphology, invasion range and adhesion degree from various angles, mainly has a clear stage of kidney cancer, and is also helpful for diagnosing whether cancer embolus is combined or not.
The protein encoded by the JAK3 gene is a receptor tyrosine kinase, a member of the Janus kinase family, which includes JAK1, JAK2, JAK3 and TYK2.JAK3 is expressed primarily in immune cells and signals through tyrosine phosphorylation after being activated by interleukins. JAK/STAT is a very important signal pathway through which many cytokines such as IFN, IL-2, etc. and growth factors such as EGF, CSF, etc. induce proliferation, differentiation and apoptosis of cells. Therefore, the search for DNA markers in the JAK3 gene has an important role in the diagnosis and prognostic evaluation of renal cancer.
Disclosure of Invention
In order to overcome the problems in the prior art, the invention provides a JAK3 promoter methylation detection primer composition, application and a detection method, wherein the detection primer composition is designed, and the methylation level of the JAK3 promoter cg04557677 is detected by a pyrosequencing technology, so that the method has high sensitivity and accuracy, and has important significance for pathological stage and early detection, prognosis and risk assessment of kidney cancer.
In order to achieve the purpose, the invention is realized by the following technical scheme:
the invention provides a JAK3 promoter methylation detection primer composition, which comprises an upstream primer cg04557677-F, a downstream primer cg04557677-Rbio and a sequencing primer cg04557677-S, wherein the nucleotide sequence of cg04557677-F is shown as SEQ ID NO.1, the nucleotide sequence of g04557677-Rbio is shown as SEQ ID NO.2, and the nucleotide sequence of cg04557677-S is shown as SEQ ID NO. 3.
In a preferred embodiment, the JAK3 promoter methylation site is cg04557677, and cg04557677 is located 340bp upstream of the gene promoter transcription start site.
The second aspect of the invention provides an application of a JAK3 promoter methylation detection primer composition in preparation of a JAK3 promoter methylation detection tool.
In a preferred embodiment, the detection means includes, but is not limited to, as a separate detection reagent, a detection kit.
The invention also provides application of the JAK3 promoter methylation detection primer composition in preparation of a renal cancer detection tool.
In a preferred embodiment, the methylation site of the JAK3 promoter in the above application is cg04557677, and cg04557677 is located 340bp upstream of the transcription start site of the gene promoter.
In a third aspect, the invention provides a kit for detecting methylation of a JAK3 promoter, the kit comprising the primer composition described above.
The fourth aspect of the present invention provides a method for detecting the methylation of the JAK3 promoter using the above primer composition, comprising the steps of;
s1, extracting DNA of a sample to be detected;
s2, transforming and purifying the sample DNA extracted in the step S1;
s3, carrying out PCR amplification on the DNA obtained in the step S2 by using an upstream primer cg04557677-F and a downstream primer cg 04557677-Rbio;
and S4, carrying out pyrosequencing on the amplified PCR product obtained in the step S3 by using a sequencing primer cg 04557677-S.
In a preferred embodiment, the concentration of DNA in the sample in step S2 is greater than 50 ng/. Mu.L, and the total amount of the sample is greater than 500ng.
In a preferred embodiment, the reaction system for amplification in step S3 is as follows:
adding water to 25 mu L, and carrying out 40cycles of reaction procedures of 98 ℃ 10s,55 ℃ 30s,72 ℃ 30s; 72 ℃ for 1min; keeping at 4 ℃.
The JAK3 (Janus kinase 3) gene has the accession number NC _000019.10 in genebank, is positioned on chromosome 19, and has the total length of 23290bp (17824782-17848071).
The invention has the following beneficial effects:
(1) The invention discovers that the JAK3 promoter methylation site can be used as a novel kidney cancer DNA marker, and the detection primer of JAK3 promoter methylation is designed, so that the detection of the kidney cancer is carried out by utilizing the detection primer, and the invention has important values in early detection, diagnosis and prognosis of the kidney cancer.
(2) The methylation level of the JAK3 promoter can be used as a standard for grading and staging kidney cancer, is simple and convenient to operate, has strong feasibility and high accuracy, has clinical diagnosis and guidance significance, and has medium and large application in preparation of tools for detecting kidney cancer.
(3) The methylation detection method disclosed by the invention is wide in application range, DNA methylation exists in various tumors widely when the mutation sites on the JAK3 gene are detected, and the DNA methylation modification is stable, is not easy to degrade, and is convenient to store and transport.
Drawings
FIG. 1 is a plot of methylation level at the cg04557677 site as a function of expression level in renal cancer and expression of JAK3 and patient survival time;
FIG. 2 is a graph of methylation level at the cg04557677 site as a function of staging of renal cancer patients;
FIG. 3 shows the results of the methylation level at the cg04557677 site and the survival time of patients with renal cancer at the tissue specimen bank application of tumor hospital of Zhongshan university.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be obtained by a person skilled in the art without making any creative effort based on the embodiments in the present invention, belong to the protection scope of the present invention.
Furthermore, the terms "first", "second" and "first" are used for descriptive purposes only and are not to be construed as indicating or implying relative importance or to implicitly indicate the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. In the description of the present invention, "a plurality" means two or more unless specifically defined otherwise.
In the description herein, reference to the description of the terms "one embodiment," "some embodiments," "an illustrative embodiment," "an example," "a specific example," or "some examples" or the like means that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present disclosure. In this specification, the schematic representations of the terms used above do not necessarily refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.
1. Methylation sites in the JAK3 gene
First, based on the methylation chip data in the gene TCGA database, it was found that the methylation site cg04557677 on JAK3 gene is abnormally hypomethylated in kidney cancer compared with normal tissue, and at the same time, the methylation degree of this site was found to be negatively correlated with the expression of JAK3 and the higher the methylation degree of cg04557677, the longer the survival time, and the results are shown in FIG. 1, in which FIG. 1-a shows that cg04557677 is hypomethylated in kidney cancer, FIG. 1-b shows that cg04557677 is negatively correlated with the expression of JAK3, and FIG. 1-c shows that the higher the methylation degree of cg04557677 in patient, the longer the survival time.
Based on the TCGA database renal clear cell carcinoma data analysis, cg04557677 exhibits low levels of methylation in patients with high grade, in patients with high T grade, in patients with high N grade, and in patients with distant metastasis, the results of which are shown in FIG. 2, where FIG. 2-a shows cg04557677 exhibits low methylation in patients with high grade, FIG. 2-b shows cg04557677 exhibits low methylation in patients with high T grade, FIG. 2-c shows cg04557677 exhibits low methyl in patients with high grade, FIG. 2-d shows cg04557677 exhibits low methylation in patients with high N grade, and FIG. 2-e shows cg04557677 exhibits low methylation in patients with distant metastasis.
2. Method for detecting methylation of JAK3 promoter
1. Primers cg04557677-F, cg04557677-Rbio and cg04557677-S were designed, and were synthesized by the company biologies (sangon biotech), and the specific primer sequences were as follows:
cg04557677-F(SEQ ID NO:1)：AGATGGGTAAATTGAGGTAATAAGG；
cg04557677-Rbio(SEQ ID NO:2)：CTCAACCCACTCTAAACCCACTTATTAAAT；
cg04557677-S(SEQ ID NO:3)：ATTGAGGTAATAAGGGT。
2. DNA samples of tumor tissues and normal tissues (or body fluids of patients, such as blood, urine, etc.) were extracted according to a commercial genome extraction kit (Tiangen Biochemical technology (Beijing) Ltd., product No. DP 304).
3. Taking 0.5-1 μ g DNA sample, using Methylation transformation kit EZ DNA Methylation-Gold TM Kit (ZYMO, D5006) was transformed and purified.
3.1 transformation of samples
3.1.1 Using a NanoDrop ND-2000 spectrophotometer, the sample concentration was determined to be greater than 50 ng/. Mu.L and the total amount of sample was greater than 500ng.
3.1.2 reagent preparation:
reagent 1: 900 μ L H O,300 μ L M-Dilution Buffer,50 μ L M-dispensing Buffer were added to a CT Conversion Reagent tube and shaken at room temperature for 10min.
Reagent 2: 96mL of 100% ethanol was added to M-Wash Buffer.
3.1.3 reagents for bisulfite conversion reaction were prepared in a 200. Mu.L PCR tube and mixed well according to Table 1 below.
TABLE 1
| Reagent | Volume (mu L) |
| |
20 |
| |
130 |
| Total volume | 150 |
3.1.4 reaction procedure: denaturation at 98 deg.C for 8min; incubating at 64 deg.C for 2.5h; and keeping at 4 ℃.
3.2 purification of the samples
3.2.1 to Zymo-Spin TM 600. Mu. L M-Binding Buffer was added to the IC purification column.
3.2.2 mu.L of the transformed sample was added to a purification column containing M-Binding Buffer and mixed by inversion.
3.2.3 centrifuge at a speed greater than 10,000g for 30 seconds and discard the waste stream.
3.2.4 Add 100. Mu. L M-Wash Buffer to the column, centrifuge for 30s, discard.
3238 Zxft 3238 to the purification column was added 200. Mu. L M-Desulphosphorylation Buffer, and the mixture was left at room temperature for 15 to 20min, centrifuged for 30s, and discarded.
3.2.6 adding 200 μ L M-Wash Buffer into the purification column, centrifuging for 30s, repeatedly adding 200 μ L M-Wash Buffer, centrifuging for 30s, and discarding the solution.
3.2.7 Place the column in a new 1.5mL centrifuge tube, add 10. Mu. L M-Elution Buffer, and centrifuge for 30s to elute DNA.
4. PCR amplification
4.1 PCR amplification was carried out using the transformed DNA sample as a template according to the reaction system shown in Table 2 below.
TABLE 2
| Reagent | Volume of |
| 10×EpiTap PCR Buffer | 2.5μL |
| 25mM MgCl 2 | 2.5μL |
| dNTP Mixture(2.5mM each) | 3μL |
| EpiTap HS(5U/μL) | 0.125μL |
| cg04557677-F(10μM) | 1μL |
| cg04557677-Rbio(10μM) | 1μL |
| DNA template after transformation | 2μL |
| Adding water to | 25μL |
Among them, epiTap HS, mgCl2, 10 × EpiTap PCR Buffer, dNTP mix were purchased from TaKaRa, cat # R110A.
3.2 the reaction sequence is: 98 ℃ 10s,55 ℃ 30s,72 ℃ 30s,40cycles;72 ℃ for 1min; hold at 4 ℃.
4. 10. Mu.L of the PCR product was subjected to sequencing analysis using a Pyromark Q48 real-time quantitative pyrophosphate sequencer.
3. Clinical sample methylation detection
The methylation levels of 72 renal cancer tumor tissues and 12 normal tissue samples from the tumor hospital of Zhongshan university were examined using the method described in example 2, and the results are shown in Table 3 below.
TABLE 3
The methylation level referred to in the present application means that the methylation level of normal tissues is higher than that of renal cancer tumor tissues in general, and as can be seen from table 3, the methylation level of cg04557677 site of 12 cases of normal tissues is about 50% or so, and the methylation level of cg04557677 site of 84 cases of renal cancer tumor tissues is less than 50%, although the individual data is the same as the methylation level of normal tissues, from the whole data, the methylation level of JAK3 promoter in renal cancer tumor tissues is obviously reduced, indicating that the methylation level of promoter of JAK3 gene is closely related to the occurrence of renal cancer.
4. Tissue specimen detection
The methylation level of the tissue specimen of a renal cancer patient is detected by the method described in example 2, and the detection result is shown in the following figure 3, wherein the figure 3 shows that the methylation level of cg04557677 in the tissue specimen of the renal cancer patient is obviously lower than that of normal tissues, and the hypermethylated patient has longer survival time.
The foregoing is a further detailed description of the invention in connection with specific preferred embodiments and is not intended to limit the invention to the specific embodiments described. For those skilled in the art to which the invention pertains, several simple deductions or substitutions can be made without departing from the spirit of the invention, and all shall be considered as belonging to the protection scope of the invention.
SEQUENCE LISTING
<110> Hunan Lingkang medical science and technology Co., ltd
<120> JAK3 promoter methylation detection primer composition, application and detection method
<130> 1
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 25
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 1
agatgggtaa attgaggtaa taagg 25
<210> 2
<211> 30
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 2
ctcaacccac tctaaaccca cttattaaat 30
<210> 3
<211> 17
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 3
attgaggtaa taagggt 17
Claims (3)
1. The application of a primer composition for detecting the methylation of the JAK3 promoter is characterized in that the primer composition comprises an upstream primer cg04557677-F, a downstream primer cg04557677-Rbio and a sequencing primer cg04557677-S, the nucleotide sequence of cg04557677-F is shown as SEQ ID NO.1, the nucleotide sequence of cg04557677-Rbio is shown as SEQ ID NO.2, and the nucleotide sequence of cg04557677-S is shown as SEQ ID NO. 3;
the JAK3 promoter methylation detection primer composition is used for preparing a kidney cancer detection tool.
2. The application of the primer composition for detecting the methylation of the JAK3 promoter, according to claim 1, wherein the methylation site of the JAK3 promoter is cg04557677, and the cg04557677 is located 340bp upstream of the transcription start site of the gene promoter.
3. Use of a JAK3 promoter methylation detection tool, wherein said tool comprises the primer composition of claim 1; the JAK3 promoter methylation detection tool is used for preparing a kidney cancer detection tool.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110752106.7A CN113355420B (en) | 2021-06-30 | 2021-06-30 | JAK3 promoter methylation detection primer composition, application and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110752106.7A CN113355420B (en) | 2021-06-30 | 2021-06-30 | JAK3 promoter methylation detection primer composition, application and detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113355420A CN113355420A (en) | 2021-09-07 |
| CN113355420B true CN113355420B (en) | 2022-11-11 |
Family
ID=77538071
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110752106.7A Active CN113355420B (en) | 2021-06-30 | 2021-06-30 | JAK3 promoter methylation detection primer composition, application and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113355420B (en) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015116868A2 (en) * | 2014-01-29 | 2015-08-06 | Caris Mpi, Inc. | Molecular profiling of immune modulators |
| EP3472344B1 (en) * | 2016-06-08 | 2021-03-31 | University of Iowa Research Foundation | Compositions for detecting predisposition to cardiovascular disease |
| CN110785490A (en) * | 2017-04-19 | 2020-02-11 | 鹍远基因公司 | Compositions and methods for detecting genomic variations and DNA methylation status |
-
2021
- 2021-06-30 CN CN202110752106.7A patent/CN113355420B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN113355420A (en) | 2021-09-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108949990B (en) | Kit and method for detecting EGFR gene mutation | |
| CN109825586B (en) | DNA methylation qPCR kit for lung cancer detection and use method | |
| JP6606554B2 (en) | Use of the methylated site of the Y chromosome as a diagnostic marker for prostate cancer | |
| CN111172287B (en) | Application of exosome lncRNA RN7SL5P as internal reference gene in gastric cancer lncRNA detection | |
| CN109055555B (en) | Lung cancer early stage metastasis diagnosis marker and kit and application thereof | |
| CN111705130B (en) | Gene marker combination and application thereof | |
| CN112410425A (en) | Gene methylation digital PCR kit for early screening of liver cancer and application thereof | |
| CN113981083B (en) | Nucleic acid combination and kit for colorectal cancer gene methylation detection | |
| WO2021072786A1 (en) | Primer set for methylation of a specific region of a human colorectal cancer-related gene, test, test kit and application thereof | |
| CN108823314B (en) | The kit of RNF213 mutated gene and its application in a kind of detection plasma DNA | |
| EP4098755A1 (en) | Composition using cpg methylation changes in specific genes to diagnose bladder cancer, and use thereof | |
| CN112662773A (en) | TERT promoter methylation detection primer composition and application thereof | |
| CN113355420B (en) | JAK3 promoter methylation detection primer composition, application and detection method | |
| US7217515B2 (en) | HURP gene as a molecular marker for bladder cancer | |
| RU2393772C1 (en) | Method of predicting development of recurrent invasive urinary bladder cancer | |
| CN107326092B (en) | Application of colorectal cancer-related miRNA as biomarker and colorectal cancer detection kit | |
| CN110172512A (en) | A kind of application of carcinoma of endometrium biomarker in cancer diagnosis and the prediction of prognosis situation | |
| CN115961038A (en) | Composition for detecting gastric cancer, kit and application thereof | |
| CN114107498A (en) | Colorectal cancer blood detection marker and application thereof | |
| CN111154880B (en) | Bladder cancer body fluid biopsy biomarker and application thereof | |
| CN111363812B (en) | Lung cancer diagnostic agent and reagent kit based on DMRTA2 gene | |
| CN112921098A (en) | Marker for triple negative breast cancer detection and detection reagent and application thereof | |
| CN111793693A (en) | Cancer suppressor gene methylation joint detection kit and application thereof | |
| CN111733239A (en) | Method, primer, probe and kit for detecting relative expression quantity of EVI1 gene | |
| CN113308547B (en) | Primer composition for tumor methylation site detection and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |