CN113308547B

CN113308547B - Primer composition for tumor methylation site detection and application thereof

Info

Publication number: CN113308547B
Application number: CN202110808269.2A
Authority: CN
Inventors: 邓务国; 龙谦; 肖比苍
Original assignee: Hunan Lingkang Medical Technology Co ltd
Current assignee: Hunan Lingkang Medical Technology Co ltd
Priority date: 2021-07-16
Filing date: 2021-07-16
Publication date: 2022-08-12
Anticipated expiration: 2041-07-16
Also published as: CN113308547A

Abstract

The invention provides a primer composition for detecting the methylation level of a TERT promoter and application thereof in tumor detection. The primer composition can be used for detecting the methylation level of sites cg26006951, cg17166338 and cg07380026 of TERT promoters by a pyrosequencing technology, and further performing pathological stage classification on kidney cancer. The TERT promoter methylation level detection method is high in sensitivity and accuracy, and has important guiding significance for early detection, prognosis and risk assessment of kidney cancer.

Description

Primer composition for tumor methylation site detection and application thereof

Technical Field

The invention relates to the technical field of molecular biological detection, in particular to a primer composition and a kit for detecting tumor methylation sites and application of the primer composition and the kit in tumor methylation site detection.

Background

Tumor (Tumor) is formed by the mutation and proliferation of cells in a certain part of tissues of living organisms, and under the action of various carcinogenic factors, the growth of the cells is out of normal control, thus forming the Tumor. The tumors are classified into benign and malignant tumors, the benign tumors are less harmful to human bodies, and the malignant tumors can cause serious harm and threaten the health and the life of human bodies. Malignant tumor, cancer, is a multiple lethal disease, and has a complex process.

With the continuous progress of gene technology, molecular biology technology and cell biology technology, it is now clear that tumors are caused by the fact that some genes are mutated under the influence of various factors and generate a large number of cells with infinite amplification capacity after multi-level evolution, and the tumors are clinically often manifested by the formation of local masses and can be transferred and spread to other tissues in vivo. At the cellular level, the termination of division and differentiation of tumor cells is circumvented, and cells continue to proliferate and are extremely aggressive. From a more microscopic point of view, the above mutation process of tumor cells involves the regulation and control of the level of DNA or protein, and thus, it is known that tumor is a molecular disease.

The early stage of the tumor has no obvious symptoms and is difficult to find. The diagnosis is mainly made clinically by the following imaging results: (1) a Computed Tomography (CT) examination; (2) a Magnetic Resonance Imaging (MRI) examination; (3) radionuclide imaging examination; (4) and (6) ultrasonic examination. However, imaging examinations usually require specialized equipment and personnel, are expensive to detect, and do not allow for tumor prediction, early screening, or prognostic guidance. In addition, the pathology can be developed from the cellular tissue level to the ultrastructural and molecular level by the pathological diagnosis technique of the tumor, and the commonly used diagnosis techniques include cytochemistry and histochemistry, immunohistochemistry and the like. Among them, biopsy is the only means for confirming the diagnosis of malignant tumor, but it is necessary to take a part of the biopsy by a method such as surgery.

Telomerase is a ribonucleoprotein complex consisting of a catalytic subunit, telomerase reverse transcriptase (TERT), and RNA component (TERC), which functions by maintaining telomere homeostasis and chromosomal integrity. The TERT gene encodes the rate-limiting catalytic subunit of telomerase, which maintains the integrity of the genome. The human telomerase reverse transcriptase (hTERT) gene is not expressed in normal human cells except germ stem cells and hematopoietic stem cells, but is highly expressed in tumor tissues. Research shows that the hTERT gene is involved in the development of various tumors, the hTERT gene which is up-regulated can be detected in 80-90% of malignant tumors, and the mutation of a promoter region of the hTERT gene is closely related to the proliferation and invasion of the tumors.

Patent CN111560436A discloses a TERT mutation detection kit (C228T or C250T) and its application in noninvasive diagnosis of bladder cancer and renal pelvis cancer. Patent CN103571954A discloses a single nucleotide polymorphism sequence of TERT promoter and application thereof in detecting transitional cell carcinoma of bladder or upper urothelial cell carcinoma. However, in many tumors, such as renal carcinoma, osteosarcoma and cervical squamous cell carcinoma, the mutation of the TERT promoter region is relatively rare, and the mutation frequency of the TERT promoter is low, so that the detection method based on the mutation of the TERT promoter has certain limitations. Research on the role of TERT gene promoter region methylation in gastric cancer development (Chua Zhongrui, Shenjiakang, Chencangken, Wang Tianxiang, Chinese medical engineering 23, No. 6, 2015 6) discusses the difference between the methylation level of the TERT gene promoter region in gastric cancer tissues and tissues beside the cancer, and analyzes the relationship between the TERT gene promoter region methylation and clinical pathological parameters such as pathological differentiation of gastric cancer tissues, nerve metastasis, infiltration depth, TNM stage and the like.

Therefore, the search for new DNA markers on TERT has important roles in the diagnosis and prognosis evaluation of tumors.

Disclosure of Invention

Aiming at the defects, the invention provides a TERT promoter methylated tumor marker and a primer composition thereof, adopts a pyrosequencing technology to detect the level of the TERT promoter methylated tumor marker, has high sensitivity and accuracy, and has important significance for pathological staging and early detection, prognosis and risk assessment of kidney cancer.

In order to achieve the above object, the technical solution of the present invention is as follows:

in one aspect, the invention provides a tumor marker for TERT promoter methylation, wherein the tumor marker comprises cg26006951, cg17166338 and cg 07380026.

Specifically, the TERT gene has an accession number NC-000005.10 in genbank, has a genome sequence with a total length of 41881bp (chromosome 5: 1253167.1295047), and consists of 15 introns and 16 exons. The total length of the transcribed mRNA is 4018bp, and 1132 amino acids are coded. The TERT gene promoter region has high GC content, no TATA box and CAAT box, and the full length of the promoter region sequence is 2043bp (chromosome 5: 1294667.1296709).

More specifically, the transcription start site of the TERT gene is chr5:1295183, the cg26006951 is positioned at 806bp upstream of the TERT gene promoter, the cg17166338 is positioned at 787bp upstream of the TERT gene promoter, and the cg07380026 is positioned at 825bp upstream of the TERT gene promoter.

In another aspect, the present invention provides a primer composition for detecting the tumor marker, wherein the primer composition comprises:

(1) primer for detecting cg 17166338:

F1：GATGTTGGTTTTATTTGTTAGATAGAGT SEQ ID NO:1；

R1：ACAAACCACCCCAAATCTAT SEQ ID NO:2；

S1：GGTTAAGGTAGTTGTGGTTG SEQ ID NO:3；

(2) primers for detection of cg26006951 and cg 07380026:

F2：AGGTTGTTTTTTATTTTGTG SEQ ID NO:4；

R2：AATAAAAAATAAAACCAAAC SEQ ID NO:5；

S2：GGTTTTATTTGTTAGATAGAGT SEQ ID NO:6。

specifically, F1/R1 and F2/R2 are amplification primers, and S1 and S2 are sequencing primers.

On the other hand, the invention provides the application of the tumor marker or the primer composition in the preparation of a TERT promoter methylation detection tool.

Specifically, the means includes, but is not limited to, a single reagent, a kit.

In another aspect, the invention provides an application of the tumor marker or the primer composition in preparing a tumor detection tool.

Specifically, the tumors include adrenocortical carcinoma ACC, urothelial carcinoma BLCA, mammary infiltrative carcinoma BRCA, squamous cell carcinoma of the cervix and adenocarcinoma CESC, cholangiocarcinoma CHOL, colon carcinoma COAD, colorectal carcinoma COADRED, diffuse large B-cell lymphoma DLBC, esophageal carcinoma ESCA, glioblastoma multiforme GBMGliotoma multiformer, Glioma GBMGlioma, head and neck squamous cell carcinoma HNSC, renal chromocytoma KICH, mixed renal carcinoma KIPAN, renal clear cell carcinoma KIRC, renal papillary carcinoma KIRP, acute myeloid leukemia LAML, Brain low-Grade Glioma LGG in Lower Grade Glioma, hepatocellular carcinoma LIHC, lung squamous cell carcinoma LUSC, lung adenocarcinoma LUAD, mesothelioma MESO, ovarian serous adenocarcinoma OV, pancreatic carcinoma PAAD, pheochromocytoma and paraganglioma PCPG, prostate carcinoma, PRAD, rectal adenocarcinoma, skin carcinoma SKRC, gastric carcinoma SKCT, thyroid carcinoma and thyroid carcinoma TGCT, thyroid carcinoma, squamous cell carcinoma, squamous cell carcinoma, carcinoma of the same of the, Thymus cancer THYM, endometrial cancer UCEC, uterine sarcoma UCS, uveal melanoma UVM.

In another aspect, the present invention provides a tumor detection tool, which comprises the primer composition.

Specifically, the tool comprises the reaction system shown in table 1 below.

TABLE 1 reaction System

Reagent	Final concentration
		10×EpiTaqPCR Buffer	1×
MgCl ₂	2.5mM
		Calcium beta-hydroxy-beta-methylbutyrate	0.5μg/μL
Reduced glutathione	1μg/μL
		Triton X-100	0.03％
dNTP Mixture	0.3mM
		EpiTaqHS	0.5U
F1	0.4μM
		R1	0.2μM
S1	0.4μM
		F2	0.4μM
R2	0.2μM
		S2	0.4μM

In yet another aspect, the invention provides a method for detecting methylation of the TERT promoter, which is a non-disease diagnostic or therapeutic method, comprising detecting a sample using pyrophosphate sequencing using the primer composition or means described above.

Specifically, the method comprises the following steps:

(1) extracting sample DNA;

(2) transforming and purifying the DNA extracted in the step (1);

(3) amplifying the DNA purified in the step (2);

(4) and (4) pyrosequencing.

Specifically, in the step (2), the concentration of the extracted DNA is more than 50 ng/. mu.L, and the total amount of the sample is more than 500 ng.

Specifically, in step (3), the reaction system for amplification is shown in table 1 above.

The reaction procedure of the amplification is as follows: 10s at 98 ℃, 30s at 55 ℃, 30s at 72 ℃ and 40 cycles; 72 ℃ for 1 min; hold at 4 ℃.

Compared with the prior art, the invention has the advantages that:

(1) the invention discovers for the first time that TERT promoter methylation sites cg26006951, cg17166338 and cg07380026 can be used as a new tumor marker, and have important value in early detection, diagnosis and prognosis of tumors.

(2) The methylation level of the TERT promoter region can be used as the standard of the grading and staging of the kidney cancer, the operation is simple and convenient, the feasibility is strong, the accuracy is high, and the invention has clinical diagnosis and guidance significance.

(3) The invention can detect the methylation degree of the TERT promoter locus through blood, urine and the like, thereby achieving the purpose of non-invasiveness.

(4) The methylation detection method disclosed by the invention is wide in application range, DNA methylation exists in various tumors widely compared with detection of mutation sites on the TERT gene, and the DNA methylation modification is stable, is not easy to degrade, and is convenient to store and transport.

Drawings

FIG. 1 is a graph comparing the locations of cg26006951 in tumor and normal tissues in TCGA database.

FIG. 2 is a graph comparing the sites cg07380026 of tumor tissue and normal tissue in the TCGA database.

FIG. 3 is a graph comparing the cg17166338 sites of tumor tissues and normal tissues in TCGA database.

FIG. 4 is a graph of methylation levels at cg26006951, cg07380026 and cg17166338 sites as a function of survival and prognosis of neoplastic patients.

FIG. 5 is a graph of methylation levels at cg26006951, cg07380026 and cg17166338 sites as a function of stage and grade of tumor patients.

Detailed Description

The present invention will be further illustrated in detail with reference to the following specific examples, which are not intended to limit the present invention but are merely illustrative thereof. The experimental methods used in the following examples are not specifically described, and the materials, reagents and the like used in the following examples are generally commercially available under the usual conditions without specific descriptions.

Example 1TERT Gene methylation site screening

According to the invention, based on an Illumina450K chip of a TCGA database tumor patient, methylation degree difference analysis is carried out according to methylation sites on TERT genes of tumor tissues and normal tissues, and cg26006951, cg17166338 and cg07380026 are identified to be sites with obvious methylation difference degrees. Wherein, FIG. 1 is a comparison graph of cg26006951 sites of tumor tissues and normal tissues in TCGA database, FIG. 2 is a comparison graph of cg07380026 sites of tumor tissues and normal tissues in TCGA database, FIG. 3 is a comparison graph of cg17166338 sites of tumor tissues and normal tissues in TCGA database, FIG. 4 is a graph of methylation levels of cg26006951, cg07380026 and cg17166338 sites as a function of survival and prognosis of tumor patients, and FIG. 5 is a graph of methylation levels of cg26006951, cg 07026 and cg17166338 sites as a function of stage and grade of tumor patients.

The invention is based on TCGA tumor patient data, and finds that the methylation levels of TERT cg26006951, cg17166338 and cg07380026 loci are closely related to the stage, grading, survival and prognosis of tumors for the first time.

EXAMPLE 2 kit

1. Primer composition

The primers were synthesized by the company sangon biotech, and the specific primer sequences were as follows:

(1) primer for detecting cg 17166338:

F1：GATGTTGGTTTTATTTGTTAGATAGAGT SEQ ID NO:1；

R1：ACAAACCACCCCAAATCTAT SEQ ID NO:2；

S1：GGTTAAGGTAGTTGTGGTTG SEQ ID NO:3；

(2) primers for detection of cg26006951 and cg 07380026:

F2：AGGTTGTTTTTTATTTTGTG SEQ ID NO:4；

R2：AATAAAAAATAAAACCAAAC SEQ ID NO:5；

S2：GGTTTTATTTGTTAGATAGAGT SEQ ID NO:6。

wherein, the F1/R1 and the F2/R2 are amplification primers, the S1 and the S2 are sequencing primers, and the primers are methylation primers, namely, the primers are designed according to sequences after methylation.

2. The reaction system is shown in table 2 below.

TABLE 2 reaction System

EpiTaqHS、MgCl ₂ 10 × EpiTaqPCR Buffer, dNTP mix from TaKaRa, cat # R110A.

Reaction procedure: 10s at 98 ℃, 30s at 55 ℃, 30s at 72 ℃ and 40 cycles; 72 ℃ for 1 min; hold at 4 ℃.

3. Positive and negative controls

The TERT gene promoter region has high GC content, no TATA box and CAAT box, and the full length of the promoter region sequence is 2043bp (chr5: 1294667.1296709). The transcription start site of the TERT gene is chr5:1295183, the cg26006951 is positioned at 806bp upstream of a TERT gene promoter, the cg17166338 is positioned at 787bp upstream of the TERT gene promoter, and the cg07380026 is positioned at 825bp upstream of the TERT gene promoter. The sequences selected to include the cg26006951, cg17166338 and cg07380026 sites are shown in SEQ ID NO:7 (chr5:1295873 and 1296075).

7 (cg 17166338, cg26006951 and cg07380026 sites within boxes, respectively):

a nucleotide sequence shown as SEQ ID NO. 7 is synthesized by a chemical synthesis method by using base A, T, C, G, wherein a positive control adopts methylated base G, a negative control adopts unmethylated base G, the synthesized sequence is constructed on pET-32a plasmid (manufacturer: Solarbio, cat # P3100) through enzyme digestion, connection and transformation respectively, and the success of plasmid connection is proved through sequencing.

Example 3TERT Gene methylation detection

1. DNA samples of tumor tissues and normal tissues (or body fluids such as blood, urine, etc.) were extracted according to a commercial genome extraction kit (Tiangen Biochemical technology (Beijing) Ltd., product No. DP 304).

2. Taking 0.5-1 μ g DNA sample, positive control sample or negative control sample, and using methylation conversion kit EZ DNAlhylation-Gold ^TM Kit (manufacturer: ZYMO, cat # D5006) was transformed and purified.

2.1 sample homogenization: the sample concentration was determined to be greater than 50 ng/. mu.L and the total amount of sample was greater than 500ng using a NanoDrop ND-2000 spectrophotometer.

2.2 reagent preparation:

reagent 1: adding 900 mu L H ₂ O, 300. mu. L M-Dilution Buffer, 50. mu. L M-dispensing Buffer into a CT Conversion Reagent tube, shaking at room temperature for 10 min.

Reagent 2: to M-Wash Buffer was added 96mL of 100% ethanol.

2.3 according to the following Table 3, a bisulfite conversion reaction reagent was prepared in a 200. mu.L PCR tube and mixed well.

TABLE 3 bisulfite conversion reaction reagent

Reagent	Volume (μ L)
		DNA sample	20
Reagent 1	130
		Total volume	150

2.4 reaction sequence: denaturation at 98 deg.C for 8 min; incubating at 64 deg.C for 2.5 h; hold at 4 ℃.

2.5 purification

2.5.1 to Zymo-Spin ^TM 600. mu. L M-Binding Buffer was added to the IC purification column.

2.5.2 mu.L of the transformed sample was added to a purification column containing M-Binding Buffer and mixed by inversion.

2.5.3 centrifuge at greater than 10,000g for 30 seconds and discard the waste stream.

2.5.4 Add 100. mu. L M-Wash Buffer to the column, centrifuge for 30s, discard the solution.

2.5.5 mu. L M-depletion Buffer was added to the column, and the column was left at room temperature for 15-20min, centrifuged for 30s, and discarded.

2.5.6 adding 200 mu L M-Wash Buffer into the purification column, centrifuging for 30s, repeatedly adding 200 mu L M-Wash Buffer, centrifuging for 30s, and discarding the solution.

2.5.7 the column was placed in a new 1.5mL centrifuge tube, 10. mu. L M-Elution Buffer was added, and the DNA was eluted by centrifugation for 30 s.

3. And (3) PCR amplification: PCR amplification was performed using the transformed DNA sample as a template with the primers and kit of example 2.

4. 10. mu.L of the PCR product was subjected to sequencing analysis using a Pyromark Q48 real-time quantitative pyrophosphate sequencer.

Methylation level meth%

(1.2×cg26006951meth％+0.9×cg17166338meth％+0.9×cg07380026meth％)/3

Comparative example 1

The only difference from example 3 is that in step 3 of example 3, the PCR amplification reaction system is shown in table 4 below.

TABLE 4 reaction System

Reagent	Final concentration
		10×EpiTaqPCR Buffer	1×
MgCl ₂	2.5mM
		Triton X-100	0.03％
dNTP Mixture	0.3mM
		EpiTaqHS	0.5U
F1	0.2μM
		R1	0.2μM
S1	0.2μM
		F2	0.4μM
R2	0.4μM
		S2	0.4μM

Experimental example 1 accuracy test

The methylation levels of the positive and negative controls were tested using the procedures described in example 3 and comparative example 1, respectively, and the results are shown in table 5 below.

TABLE 5 accuracy test results

Methylation level meth%	Positive control	Negative control
			Example 3	100	0
Comparative example 1	91.25	1.93

As can be seen from Table 5, the primer composition and the kit described in the present application have good detection accuracy.

Experimental example 2 repeatability test

The methylation levels of the positive control and the negative control were measured three times using the kit described in example 2 and the procedure described in example 3, and the results are shown in table 6 below.

TABLE 6 results of repeated measurements

Methylation level meth%	Positive control	Negative control
			For the first time	100	0
For the second time	100	0
			The third time	100	0

As can be seen from Table 6, the primer composition and the kit disclosed by the application have good detection repeatability.

Experimental example 3 detection of accuracy

Three batches of the kit prepared in example 2 of the present invention and the procedure described in example 3 were used to determine the methylation levels of the positive and negative controls, with the results shown in Table 7 below.

TABLE 7 results of accuracy test

Methylation level meth%	Positive control	Negative control
			First batch	100	0
Second batch	100	0
			Third batch	100	0

As can be seen from Table 7, the primer compositions and kits described herein have good detection accuracy.

Experimental example 4

The methylation levels of 5 lung cancer tumor tissues, 5 colorectal cancer tumor tissues, 5 breast cancer tumor tissues, 5 liver cancer tumor tissues, 5 pancreatic cancer tumor tissues, 5 thyroid cancer tumor tissues and 30 corresponding normal tissue samples (samples from the tumor hospital of Zhongshan university) were measured according to the method described in example 3, and the results are shown in Table 8 below.

TABLE 8 methylation assay results

As can be seen from Table 8, the methylation levels of the promoter regions cg26006951, cg17166338 and cg07380026 of the TERT gene were significantly increased in tumor tissues, which was consistent with the results of clinical examination.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that various changes and modifications can be made by those skilled in the art without departing from the spirit of the invention, and these changes and modifications are all within the scope of the invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Hunan Lingkang medical science and technology Co., Ltd

<120> primer composition for tumor methylation site detection and application thereof

<130> 20210624

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 28

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 1

gatgttggtt ttatttgtta gatagagt 28

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 2

acaaaccacc ccaaatctat 20

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 3

ggttaaggta gttgtggttg 20

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 4

aggttgtttt ttattttgtg 20

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 5

aataaaaaat aaaaccaaac 20

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 6

ggttttattt gttagataga gt 22

<210> 7

<211> 203

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 7

gcaaaccacc ccaaatctgt taatcaccca ccggggcggt cccgtcgaga aagggtggga 60

aatggagcca ggcgctcctg ctggccgcgc accgggcgcc tcacaccagc cacaacggcc 120

ttgaccctgg gccccggcac tctgtctggc agatgaggcc aacatctggt cacatcccgc 180

ccgcacaggg tggagggcaa cct 203

Claims

1. The application of a primer composition for detecting a TERT promoter methylated tumor marker in preparing a tumor detection tool is characterized in that:

the tumor markers comprise cg26006951, cg17166338 and cg 07380026; the cg26006951 is positioned at 806bp upstream of a TERT gene promoter, the cg17166338 is positioned at 787bp upstream of the TERT gene promoter, and the cg07380026 is positioned at 825bp upstream of the TERT gene promoter;

the primer composition comprises:

(1) primer for detecting cg 17166338:

F1：GATGTTGGTTTTATTTGTTAGATAGAGT SEQ ID NO:1；

R1：ACAAACCACCCCAAATCTAT SEQ ID NO:2；

S1：GGTTAAGGTAGTTGTGGTTG SEQ ID NO:3；

(2) primers for detection of cg26006951 and cg 07380026:

F2：AGGTTGTTTTTTATTTTGTG SEQ ID NO:4；

R2：AATAAAAAATAAAACCAAAC SEQ ID NO:5；

S2：GGTTTTATTTGTTAGATAGAGT SEQ ID NO:6；

wherein: F1/R1 and F2/R2 are amplification primers, and S1 and S2 are sequencing primers;

the method for detecting the methylation of the TERT gene comprises the following steps:

(1) extracting sample DNA;

(2) transforming and purifying the DNA sample extracted in the step (1); the concentration of the extracted DNA is more than 50 ng/muL, and the total amount of the sample is more than 500 ng;

(3) and (3) PCR amplification: taking the converted and purified DNA sample as a template, and carrying out PCR amplification according to the primer composition, wherein the PCR amplification reaction system is as follows:

the reaction procedure is as follows: 10s at 98 ℃, 30s at 55 ℃, 30s at 72 ℃ and 40 cycles; 72 ℃ for 1 min; hold at 4 ℃;

(4) sequencing the PCR product by adopting pyrosequencing to analyze the sample so as to obtain the methylation level of the sample;

(5) and judging the grading stage of the tumor according to the methylation level of the sample.

2. Use according to claim 1, characterized in that: the tumor detection means comprises a single reagent or a kit.

3. Use according to claim 1, characterized in that: the tumor includes adrenal cortex cancer ACC, bladder urothelial cancer BLCA, mammary gland infiltration cancer BRCA, cervical squamous cell carcinoma and adenocarcinoma CESC, bile duct cancer CHOL, colon cancer COAD, colorectal cancer COADRED, diffuse large B-cell lymphoma DLBC, esophageal cancer ESCA, Glioblastoma multiforme GBM Globlattoma multiforme, Glioma GBM Glioma, head and neck squamous cell carcinoma HNSC, renal chromophobe cancer KICH, mixed renal cancer KIPAN, renal clear cell carcinoma KIRC, renal papillary cell carcinoma KIRP, acute myeloid leukemia LAML, Brain low-Grade Glioma LGG Brain Lowerg Graioma, hepatocellular carcinoma LIHC, lung squamous cell carcinoma LUSC, lung adenocarcinoma LUAD, mesothelioma MESO, ovarian serosa adenocarcinoma OVCA, pancreatic cancer PAAD, pheochromocytoma and paraneuroma PCPG, prostate cancer, rectal adenocarcinoma, SARC, skin sarcoma, SKCM, stomach cancer, thyroid cancer, and other tumors, human cancers, Thymus cancer THYM, endometrial cancer UCEC, uterine sarcoma UCS, uveal melanoma UVM.