CN111733239A - Method, primer, probe and kit for detecting relative expression quantity of EVI1 gene - Google Patents

Abstract

The invention is used for detecting the relative expression level of the EVI1 gene in peripheral blood of AML patients, and is convenient for developing later-stage chemotherapy scheme formulation and prognosis prediction. The kit specifically comprises reagents such as an upstream primer EVI1-F, a downstream primer EVI1-R and a Probe EVI1-Probe for detecting an EVI1 gene, and an upstream primer ABL-F, a downstream primer ABL-R and a Probe ABL-Probe for an internal reference gene ABL. The invention has high sensitivity and simple operation, can provide reference and basis for the formulation of the chemotherapy scheme of the AML patient, and is beneficial to the individualized treatment of the patient.

Description

Method, primer, probe and kit for detecting relative expression quantity of EVI1 gene

Technical Field

The invention belongs to the fields of life science and biotechnology, in particular to a primer and a probe for detecting the relative expression quantity of an EVI1 gene, which adopts the probe real-time fluorescence quantitative PCR technology to predict the AML prognosis, and the detection of the EVI1 gene expression level can be helpful to discussing the prognosis transition of the AML and the EVI.

Background

Acute Myeloid Leukemia (AML) is a group of very heterogeneous hematological malignancies, usually characterized by the inhibition of the clonal proliferation and differentiation maturation of hematopoietic stem cells. The clinical characteristics, biological behaviors and curative effects of the traditional Chinese medicine are very different. WHO2008 typing classifies AML very carefully based on its diagnostic and prognostic characteristics, combined with modern morphological, cytogenetic and molecular biological characteristics. Of these, the leukemia class with inv (3) (q21q26.2) or t (3; 3) (q 21; q26.2) has its own characteristics and is individually listed as a class. The AML often over-expresses an EVIl (Ecotropic virus integration site 1, retrovirus integration site 1) gene, morphologically has megakaryoblastic dysplasia and thrombocytosis, the treatment remission rate is less than 50%, and the long-term survival rate is less than 10%. The EVIl gene, also known as MECOM gene, was recognized in 1988 as an insertion site gene for murine leukemia provirus. The gene is located on human chromosome 3q26 and encodes a protein with transcription function containing 2 important zinc finger domains, wherein the N terminal of the protein has 7 zinc fingers, and the C terminal of the protein has 4 zinc fingers. It can specifically combine with gene promoter DNA sequence to play the role of transcription regulation. In fact, EVI1 has been found to interact directly with other transcripts involved in the regulation of transcription and epigenetics, such as RUNX1/AML1, SUV39H1, Smad3, HDACs, CtBP, CBP, P/CAF, DNMT3 and MBD3, by way of such interaction, to directly affect the expression of the gene of interest and other signaling pathways. In addition, it has been found that over-expression of EVI1 in myeloid progenitor cells can affect further differentiation, as well as proliferation and survival, and EVI1 plays an essential role in regulating hematopoietic stem cell self-renewal, proliferation, and the like. The EVIl gene can relieve the effect of TGF-beta mediated inhibition on cell growth, inhibit apoptosis caused by activation of a JNK signal pathway, and target research results at a gene level also indicate that the EVIl is indispensable to maintenance of a hematopoietic stem cell pool and differentiation of hematopoietic stem cells.

The EVI1 gene encodes a zinc finger transcription factor with a relative molecular mass of 14.5 ten thousand daltons, which is localized to the nucleus and is a site-specific DNA binding protein that plays a role in regulating RNA transcription. The EVIl gene mainly controls the development of embryos and plays an important role in the proliferation and survival of hematopoietic stem cells. Foreign studies have found that over-expression of the EVll gene is not only seen in this type of leukemia, but also frequently seen in other aberrantly karyotyped AMLs, and even in patients with the acute phase of Chronic Myelogenous Leukemia (CML), myelodysplastic syndrome (MDS). In addition to myeloid tumors, epithelial-derived tumors (including colon cancer and ovarian cancer) and the like may overexpress the EVll gene, and it has been recently found that overexpression of EVIl is also seen in some cases in Acute Lymphoblastic Leukemia (ALL). Abnormal expression of EVIl in AML of different karyotypes adversely affects prognosis.

Over-expression of EVIl accounts for 8% -12% of all AMLs. Similarly, in newly diagnosed pediatric AML, patients overexpressing EVI1 account for approximately 10%, and in both adult and pediatric AML patients, overexpression of EVI1 has a poor prognosis. Some patients showed higher expression level of EVI1 mRNA and some patients expressed lower expression of EVI1, wherein AML-M1 and AML-M6 significantly underexpressed EVI1, AML-M3 and AML-M5 over-expressed EVI 1. The research on EVIl gene expression and the relation between the EVIl gene expression and clinic and cytogenetics in China is few. The clinical and cytogenetic characteristics of the EVIl high-expression patient are deeply researched, so that the remission rate of the patient is improved, and the prognosis is improved.

In normal human peripheral blood and bone marrow, EVIl gene was expressed in amounts of 0.5% (peripheral blood) and 1.0% (bone marrow), respectively. Median EVIl expression levels were 3.6% (peripheral blood) and 23.3% (bone marrow) at the time of primary treatment in AML patients with over-expression of EVIl (EVIl +). In clinic, the incidence rate of EVIl + AML is 8.0-21.2%, high-risk chromosomal abnormalities such as inv (3) (q2lq26.2), t (3; 3) (q 21; q26.2), t (v; 11q23), -7 and the like are easy to be combined, and according to the prognosis classification of the National Comprehensive Cancer Network (NCCN) guide of related research, the EVIl + AML is mostly seen in patients in medium-risk and high-risk groups, and is rarely seen in patients in low-risk groups. It has been reported that the incidence of EVIl positive patients in naive AML is about 10%, and in AML patients with abnormalities in inv (3) (q21q26.2) or t (3; 3) (q 21; q26.2), abnormal EVIl expression is caused by a breakpoint near the EVIl locus of 3q26.2, but EVIl overexpression is also found in AML without the above chromosomal translocation. The research adopts a real-time fluorescent quantitative RT-PCR method to detect the expression level of EVI1 in leukemia cells, and aims to discuss the significance of the expression level in the generation and development of AML.

Disclosure of Invention

The invention designs primers and probe sequences for detecting an internal reference/target gene, adopts a fluorescent quantitative PCR technology and utilizes a double-standard curve method to respectively construct quantitative standard curves of an internal reference gene ABL and a target gene EVI1, and detects the expression level of the target gene EVI1 relative to the internal reference gene ABL. The amplification efficiency and the amplification rate are both optimized by adjusting the proportion of the primer probes of the target gene and the reference gene and the PCR reaction conditions, so that the detection of the expression level of the EVI1 gene can be realized, and the method is used for formulating a chemotherapy scheme and predicting prognosis.

The invention provides a primer and a probe for detecting the relative expression quantity of an EVI1 gene, wherein the primer and the probe comprise:

(1) an upstream primer EVI1-F, a downstream primer EVI1-R and a Probe EVI1-Probe for detecting the EVI1 gene, wherein,

EVI1-F：CCCATGTGCCAGAGGAACTT

EVI1-R：CAGTGACAGCATCATAGCATATGC

EVI1-Probe：FAM-CAGCCGTTACACAGAAAGTCCAAATCGC-TAMRA

(2) detecting an upstream primer ABL-F, a downstream primer ABL-R and a Probe ABL-Probe of an internal reference gene ABL; wherein the content of the first and second substances,

ABL-F：GATACGAAGGGAGGGTGTACCA

ABL-R：CTCGGCCAGGGTGTTGAA

ABL-Probe：FAM-TGCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA。

further, the molar ratio of the EVI1 upstream primer, downstream primer and probe was 1:1: 1.

Further, the molar ratio of ABL-F, ABL-R and ABL-Probe is 1:1: 1.

The primer and the probe are applied to the preparation of a kit for detecting the relative expression quantity of the EVI1 gene in a sample.

The invention also provides a method for detecting the relative expression quantity of the EVI1 gene in a sample, which comprises the following steps:

(1) extracting RNA in a sample;

(2) reverse transcribing the cDNA from the RNA of step (1);

(3) adding the cDNA obtained in the step (2) into a reaction tube, and detecting a fluorescent signal of an EVI1 gene in a sample by using an upstream primer EVI1-F, a downstream primer EVI1-R and a Probe EVI1-Probe of the EVI1 gene; the fluorescence signal of the ABL reference gene in a sample is detected by using an upstream primer ABL-F, a downstream primer ABL-R and a Probe ABL-Probe of the ABL reference gene, and the base sequence is shown as follows:

EVI1-F：CCCATGTGCCAGAGGAACTT

EVI1-R：CAGTGACAGCATCATAGCATATGC

EVI1-Probe：FAM-CAGCCGTTACACAGAAAGTCCAAATCGC-TAMRA；

ABL-F：GATACGAAGGGAGGGTGTACCA

ABL-R：CTCGGCCAGGGTGTTGAA

ABL-Probe：FAM-TGCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA。

(4) and determining the relative expression amount of the EVI1 gene in the sample according to the fluorescence signal of the EVI1 gene and the fluorescence signal of the ABL reference gene.

The invention also provides a kit for detecting the relative expression quantity of the EVI1 gene in a sample, wherein the kit comprises a detection system PCR reaction solution, and the detection system and the PCR reaction solution comprise:

(1) the base sequences of an upstream primer EVI1-F, a downstream primer EVI1-R and a Probe EVI1-Probe aiming at the EVI1 gene are shown as follows:

EVI1-F：CCCATGTGCCAGAGGAACTT

EVI1-R：CAGTGACAGCATCATAGCATATGC

EVI1-Probe：FAM-CAGCCGTTACACAGAAAGTCCAAATCGC-TAMRA；

(2) the upstream primer ABL-F, the downstream primer ABL-R and the Probe ABL-Probe aiming at the internal reference gene ABL have the following base sequences:

ABL-F：GATACGAAGGGAGGGTGTACCA

ABL-R：CTCGGCCAGGGTGTTGAA

ABL-Probe：FAM-TGCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA。

the invention has the beneficial effects that: (1) the invention combines the real-time fluorescent PCR technology with the TaqMan probe, utilizes the method of double standard curves to respectively construct the quantitative standard curves of the internal reference gene ABL and the target gene EVI1, detects the expression level of the EVI1 in a tested person relative to the internal reference gene, and reasonably matches and optimizes the primers and the probe required by a reaction system, so that the experimental condition reaches the best, thereby omitting a fussy condition searching link and greatly improving the experimental efficiency; (2) compared with the prior immunohistochemical method and the current delta-delta CT method, the method has the advantages of high precision, convenient result interpretation and the like; (3) the primers and the probes adopted by the invention have good specificity, high sensitivity and simple and convenient operation; (4) detection of the expression level of EVI1 gene can help to explore its prognostic significance in AML patients.

Drawings

FIG. 1: positive results of EVI 1.

FIG. 2: negative results of EVI 1.

FIG. 3: the EVI1 expression quantity/ABL internal reference expression quantity distribution of normal human blood.

Detailed Description

Example 1

A nucleic acid detection kit for detecting the relative expression level of EVI1 in a sample, the kit comprising:

(1) RNA extraction reagent comprising TRIzol, chloroform, isopropanol, 75% ethanol and RNase-free water.

(2) RNA reverse transcription reagent: ReverTra Ace qPCR RT Kit (TOYOBO Co.).

(3) Detection system PCR reaction solution: the THERERBIRD Probe qPCR Mix (2X) (TOYOBO company) detects the upstream primer EVI1-F, the downstream primer EVI1-R and the Probe EVI1-Probe of the EVI1 gene; an upstream primer ABL-F, a downstream primer ABL-R and a Probe ABL-Probe for detecting the internal reference gene ABL. Wherein:

EVI1-F：CCCATGTGCCAGAGGAACTT

EVI1-R：CAGTGACAGCATCATAGCATATGC

EVI1-Probe：FAM-CAGCCGTTACACAGAAAGTCCAAATCGC-TAMRA

ABL-F：GATACGAAGGGAGGGTGTACCA

ABL-R：CTCGGCCAGGGTGTTGAA

ABL-Probe：FAM-TGCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA。

positive control: EVI 1-containing genomic solution; negative control: genomic solution without EVI 1; the blank was normal saline or no substance added.

Example 2

1. The operation flow of the total RNA extraction of the peripheral blood of the sample is as follows:

(1) collecting 1ml of anticoagulated fresh blood;

(2) 1ml of erythrocyte lysate is added into a clean centrifugal tube with 1.5ml, and 0.5ml of anticoagulation blood is taken and mixed evenly. Standing at room temperature for 10 min;

(3) centrifuging at 5000rpm for 5min, discarding supernatant, and collecting cells at bottom;

(4) adding 0.5ml of erythrocyte lysate again, centrifuging at 5000rpm for 5min, discarding the supernatant, and collecting the cells at the bottom;

(5) adding 1ml of TRIzol into the cells, repeatedly blowing and beating until the precipitate is completely dissolved, and standing for 5min at room temperature;

(6) adding 0.2ml of chloroform, and shaking uniformly;

(7) centrifuging at 14000rpm at 4 ℃ for 10min, sucking the supernatant layer and transferring to another new centrifuge tube (not sucking the white middle layer);

(8) adding isopropanol with the same volume, mixing thoroughly, standing at room temperature for 10 min;

(9) centrifuging at 14000rpm and 4 ℃ for 10min, removing the supernatant, adding 1ml of 75% ethanol, and slightly reversing the upper part and the lower part to wash the tube wall;

(10) centrifuging at 14000rpm and 4 ℃ for 5min, and removing ethanol;

(11) drying at room temperature for 10-15min, and adding 20 μ L RNase-free water to obtain the extracted RNA solution in blood.

(12) RNA concentration and purity were determined on a NanoDrop instrument and stored at-80 ℃ until use.

2. Reverse transcription of RNA into cDNA

The RNA obtained in step 1 was reverse transcribed into cDNA by referring to the ReverTra Ace qPCR RT Kit instructions of TOYOBO, and stored at-20 ℃ for further use.

3. Reagent preparation: preparing X ul of PCR reaction liquid of a detection system according to the number of detected persons, and subpackaging 23ul of each person as shown in table 1:

x ═ 23ul reaction solution X (8 parts of internal reference (standard curve) +8 parts of target gene (standard curve) + n parts of specimen +1 part of positive control +1 part of negative control +1 part of blank control);

TABLE 1 EVI1 reaction System

Wherein the Forward Primer, Reverse Primer and TagMan Probe are respectively selected from EVI1-F, EVI1-R and EVI1-Probe, or ABL-F, ABL-R and ABL-Probe.

4. Sample adding: adding the PCR reaction solution of the detection system prepared in the step 3 and 2 mu l of cDNA prepared in the step 2 into a hole or a reaction tube of a 96-well plate; positive and negative controls: directly adding 2 mul of positive reference substance and negative reference substance; blank controls plus: add 2. mu.l of physiological saline or nothing. Each sample also required 2 replicates to ensure stable results.

5. And (3) detection: the detection is carried out on a real-time fluorescent PCR instrument which can use ABI 7500. Reaction conditions are as follows: pre-denaturation at 95 ℃ for 1 min; 95 ℃ for 15s, 58 ℃ for 35sec for 40 cycles, and fluorescence signals were collected at 58 ℃ for 35 sec.

6. And (5) judging a result: the threshold line is adjusted to be above the background signal and the negative amplification line, and the system automatically calculates the copy number according to the standard curve and the CT value.

1) When the internal reference is positive, the detection result is considered to be effective;

2) positive judgment standard: ct <36, positive; ct is more than or equal to 36 and less than or equal to 38, is suspected positive and needs to be verified again; ct > 38, negative.

Example 3

Testing clinical blood samples

The number of peripheral blood samples to be tested was 24, and RNA was extracted from the samples, and reagents were prepared and tested as described in example 2. Each sample was added to 2ul of the PCR reaction solution in the detection system. And simultaneously making positive, negative and blank controls, and respectively copying standard curves of the reference gene/target gene. 2 replicates per sample to ensure stability of the results. The results of the detection of the positive control and the negative control are shown in FIG. 1 and FIG. 2, respectively. Through statistical analysis of the ratio of 24 normal persons (EVI1 expression quantity/ABL internal reference expression quantity), both EVI1 and the ABL internal reference are amplified (the specific concentration value is shown in Table 2), and the expression range of the normal persons is obtained. (excluding 4 cases of invalid samples) thus obtained: the expression range of normal human is shown in FIG. 3. According to statistics, when 0< EVI1/ABL <0.01, the expression is low; when 0.01< EVI1/ABL <0.076, is medium expression; when EVI1/ABL >0.076, high expression was observed.

TABLE 2 detection of the relative expression of EVI1 in normal humans

Example 4

The method is used for detecting the peripheral blood sample of the leukemia patient.

24 samples of peripheral blood of leukemia patients were taken, RNA was extracted, reverse transcription was performed, reagents were prepared, and fluorescent quantitative PCR was performed as described in example 2.

For each sample, 2. mu.L of cDNA obtained by reverse transcription was added to the PCR reaction solution of the detection system. Simultaneously, positive, negative and blank controls are respectively made for one part, and standard curves of reference genes/target genes are respectively made for two parts. A 96-well fluorescent PCR instrument can simultaneously detect 16 samples, each sample repeated 2 times, one positive control, one negative control and one blank control.

In the case of the negative and positive control tests without errors, the test results are shown in Table 3, showing that 6 patients with leukemia fall within the low expression range and 3 patients fall within the high expression range.

TABLE 3 detection of the relative expression of EVI1 in leukemia patients

The invention can quickly detect the expression quantity of the EVI1 gene in the sample. The detection result completed by the invention is accurate and sensitive, and the detection of the EVI1 gene expression level can be helpful for discussing the prognosis return of the EVI1 gene and human Acute Myeloid Leukemia (AML).

Sequence listing

<110> Hangzhou Aidikang medical inspection center Co., Ltd

<120> method, primer and probe for detecting relative expression level of EVI1 gene, and kit

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

cccatgtgcc agaggaactt 20

<210>2

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

cagtgacagc atcatagcat atgc 24

<210>3

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

cagccgttac acagaaagtc caaatcgc 28

<210>4

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

gatacgaagg gagggtgtac ca 22

<210>5

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

ctcggccagg gtgttgaa 18

<210>6

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

tgcttctgat ggcaagctct acgtctcct 29

Claims (5)

1. Primers and probes for detecting the relative expression quantity of an EVI1 gene, wherein the primers and probes are characterized in that: the primers and probes include:

(1) an upstream primer EVI1-F, a downstream primer EVI1-R and a Probe EVI1-Probe for detecting the EVI1 gene, wherein,

EVI1-F：CCCATGTGCCAGAGGAACTT

EVI1-R：CAGTGACAGCATCATAGCATATGC

EVI1-Probe：FAM-CAGCCGTTACACAGAAAGTCCAAATCGC-TAMRA

(2) primers ABL-F and ABL-R and a Probe ABL-Probe for detecting the internal reference gene ABL; wherein the content of the first and second substances,

ABL-F：GATACGAAGGGAGGGTGTACCA

ABL-R：CTCGGCCAGGGTGTTGAA

ABL-Probe：FAM-TGCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA。

2. the primers and probes as claimed in claim 1, wherein the molar ratio of the EVI1 upstream primer, downstream primer and probe is 1:1: 1.

3. The primers and probes as claimed in claim 1, wherein the molar ratio of ABL-F to ABL-R to ABL-Probe is 1:1: 1.

4. A method for detecting the relative expression level of EVI1 gene in a sample, comprising the steps of:

(1) extracting RNA in a sample;

(2) reverse transcribing the cDNA from the RNA of step (1);

(3) adding the cDNA obtained in the step (2) into a reaction tube, and detecting the fluorescence signal of the EVI1 gene in a sample by using the upstream and downstream primers EVI1-F and EVI1-R aiming at EVI1 and the Probe EVI 1-Probe; the fluorescence signal of the ABL reference gene in a sample is detected by using upstream and downstream primers ABL-F and ABL-R aiming at the ABL reference gene and a Probe ABL-Probe, and the base sequence is shown as follows:

EVI1-F：CCCATGTGCCAGAGGAACTT

EVI1-R：CAGTGACAGCATCATAGCATATGC

EVI1-Probe：FAM-CAGCCGTTACACAGAAAGTCCAAATCGC-TAMRA；

ABL-F：GATACGAAGGGAGGGTGTACCA

ABL-R：CTCGGCCAGGGTGTTGAA

ABL-Probe：FAM-TGCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA。

(4) and determining the relative expression amount of the EVI1 gene in the sample according to the fluorescence signal of the EVI1 gene and the fluorescence signal of the ABL reference gene.

5. A kit for detecting the relative expression quantity of an EVI1 gene in a sample comprises a detection system PCR reaction solution, and is characterized in that the detection system PCR reaction solution comprises:

(1) the base sequences of an upstream primer EVI1-F, a downstream primer EVI1-R and a Probe EVI1-Probe aiming at the EVI1 gene are shown as follows:

EVI1-F：CCCATGTGCCAGAGGAACTT

EVI1-R：CAGTGACAGCATCATAGCATATGC

EVI1-Probe：FAM-CAGCCGTTACACAGAAAGTCCAAATCGC-TAMRA；

(2) the upstream primer ABL-F, the downstream primer ABL-R and the Probe ABL-Probe aiming at the internal reference gene ABL have the following base sequences:

ABL-F：GATACGAAGGGAGGGTGTACCA

ABL-R：CTCGGCCAGGGTGTTGAA

ABL-Probe：FAM-TGCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA。

Images