CN109385447B

CN109385447B - Use of insecticidal proteins

Info

Publication number: CN109385447B
Application number: CN201811234937.XA
Authority: CN
Inventors: 张爱红; 杨淑靖; 任振涛; 吴竹筠
Original assignee: Beijing Dabeinong Biotechnology Co Ltd
Current assignee: Beijing Dabeinong Biotechnology Co Ltd
Priority date: 2018-10-23
Filing date: 2018-10-23
Publication date: 2022-04-15
Anticipated expiration: 2038-10-23
Also published as: CN109385447A

Abstract

The invention relates to an application of insecticidal protein, which comprises the following steps: the meadow borer is contacted with at least Cry2Ab protein. According to the invention, Cry2Ab protein capable of killing the meadow moth is generated in the plant body to control the meadow moth pests; compared with the agricultural control method, the chemical control method, the physical control method and the biological control method used in the prior art, the invention protects the whole plant in the whole growth period to control the invasion of the meadow moth pests, and has the advantages of no pollution, no residue, stable and thorough effect, simplicity, convenience and economy.

Description

Use of insecticidal proteins

Technical Field

The invention relates to application of an insecticidal protein, in particular to application of Cry2Ab protein in controlling meadow moth-damaged plants through expression in plants.

Background

The meadow moth Loxostege sticticalis belongs to the genus Chilo of the Lepidoptera Bombycidae family, and is mainly distributed in northeast, northwest and North China areas, namely Jilin, inner Mongolia, Heilongjiang, Ningxia, Gansu, Qinghai, Hebei, Shanxi, Shaanxi, Jiangsu and other provinces. The meadow moth is a big omnivorous pest, can eat over 200 plants of 35 families, and mainly comprises various crops such as beet, soybean, sunflower, potato, hemp, vegetables, medicinal materials and the like; in the case of large occurrence, cereal crops, trees and the like are all harmed by the plant growth promoter. The meadow moth outbreak generally occurs once in about 10 years, and is characterized in that: most of the larvae gather on the branch tips to form a net and hide, and the larvae eat mesophyll, leave epidermis and veins, and leave the veins or are eaten in serious cases, thus seriously affecting the yield.

Cultivated soybean (Glycine max (L.) Merri), an important commercial crop grown worldwide as a major source of vegetable oil and vegetable protein, is an important food crop in china. Soybean is one of the most favorite plants of the meadow moth, and the meadow moth can cause grain loss in different degrees every year, with the yield being reduced by 1-2 for light people and 3-4 for serious people. For controlling meadow moth, agricultural control, chemical control, physical control, and biological control are generally used as main methods.

The agricultural control is to comprehensively coordinate and manage multiple factors of the whole farmland ecosystem, regulate and control crop, pest and environmental factors and create a farmland ecological environment which is beneficial to crop growth and is not beneficial to emergence of the meadow moth. If the crop rotation is carried out on the seriously damaged field, the meadow moth loses the host; can be irrigated in autumn and winter for multiple times or in flowering period to kill larvae; in the place where the meadow moth overwinter is centralized, the method of turning over in autumn and ploughing in spring is adopted, and the overwinter larva is damaged by mechanical killing and soil block pressing, so that the death rate of the overwinter larva is increased; in a field with heavy grass waste, before larvae migrate as pests, an insect-preventing ditch can be dug, powder pesticide is sprayed in the ditch or a mulching film is erected in the middle of the ditch to prevent the larvae from migrating into the field and diffusing as pests; when the eggs are laid and most of the eggs are not hatched, weeding and killing the eggs by intertillage, and taking the removed weeds out of the field for composting or digging pits for burying; meanwhile, weeds on ridges beside the farmland are removed completely to prevent larvae from migrating into the farmland and damaging the farmland; in the field where the larvae are hatched, the pesticide is applied first and then the weeds are removed, so that the larvae are prevented from being transferred to crops quickly and the damage is increased.

The chemical control, namely the pesticide control, is to utilize chemical insecticide to kill pests, is an important component of the comprehensive control of the meadow moth, has the characteristics of rapidness, convenience, simplicity and high economic benefit, and is an essential emergency measure especially under the condition of large occurrence of the meadow moth. The existing chemical prevention and control method mainly adopts liquid medicine spraying, has better prevention and control effect during 1-3 instars of the larvae of the meadow moth, and can hardly achieve the purpose of prevention and control as the larger the larvae are, the stronger the drug resistance is and the poorer the prevention and control effect of the pesticide is. In fields with large concentrated damage of larvae in the instar period, when the pesticide control effect is poor, ditches can be dug around the fields or a pesticide spraying belt can be blocked to control diffusion damage. Meanwhile, chemical control also has limitations, such as pesticide damage to crops, drug resistance of pests, natural enemy killing and environmental pollution caused by improper use, damage to farmland ecosystems, threat to safety of pesticide residues to people and livestock and other adverse effects.

Physical control mainly utilizes various physical factors such as light, electricity, color, temperature and humidity and mechanical equipment for trapping, radiation sterilization and the like to control pests according to the reaction of the pests on various physical factors in environmental conditions. When the adult insects are sent out, the adult insects are trapped and killed by a net puff or light. The habit of migratory flight and phototaxis of the meadow moth is utilized, and a high-pressure mercury lamp, a frequency vibration type insecticidal lamp and the like are arranged to trap and kill the imagoes; however, the frequency vibration type insecticidal lamp needs to clean dirt on a high-voltage power grid every day in time, otherwise the insecticidal effect is influenced; the lamp can not be turned on in thunderstorm days, and the danger of hurting people by electric shock exists in operation; furthermore, the lamp is installed in a relatively large investment.

Biological control is to control the population quantity of pests by using some beneficial organisms or biological metabolites to achieve the purpose of reducing or eliminating the pests, such as trichogramma or beauveria bassiana to control the meadow moth. It is characterized by safety to human and livestock, little pollution to environment and long-term control of certain pests; but the effect is often unstable and the same investment is required to be made no matter the weight of the meadow moth is light.

In order to solve the limitation of agricultural control, chemical control, physical control and biological control in practical application, scientists find that some insect-resistant transgenic plants can be obtained to prevent and control plant pests by transferring insect-resistant genes for coding insecticidal proteins into plants through research.

Cry2Ab insecticidal protein is one of many insecticidal proteins, and is an insoluble parasporal crystalline protein produced by Bacillus thuringiensis. The Cry2Ab protein is ingested by the insect into the midgut and the toxoprotein protoxin is solubilized in the alkaline pH environment of the insect midgut. The N-and C-termini of the protein are digested by alkaline protease to convert the protoxin to an active fragment; the active fragment is combined with a receptor on the upper surface of the insect midgut epithelial cell membrane and is inserted into the intestinal membrane, so that the cell membrane has perforation symptoms, osmotic pressure change, pH balance and the like inside and outside the cell membrane are damaged, the digestion process of the insect is disturbed, and the insect finally dies.

The transgenic Cry2Ab plant is proved to be capable of resisting the invasion of Lepidoptera (Lepidoptera) pests such as corn borer, pink plumule borer and the like, however, no report on controlling the damage of the meadow moth to plants by generating transgenic plants expressing Cry2Ab protein exists so far.

Disclosure of Invention

The invention aims to provide the application of insecticidal protein, provides a method for controlling the damage of meadow moth to plants by generating transgenic plants expressing Cry2Ab protein for the first time, and effectively overcomes the technical defects of agricultural control, chemical control, physical control, biological control and the like in the prior art.

To achieve the above object, the present invention provides a method for controlling a meadow moth pest, comprising contacting the meadow moth pest with at least Cry2Ab protein.

Further, said Cry2Ab protein is present in a host cell that produces at least said Cry2Ab protein, and said meadow moth pest is contacted with at least said Cry2Ab protein by ingesting said host cell.

Still further, said Cry2Ab protein is present in a bacterium or transgenic plant that produces at least said Cry2Ab protein, said meadow moth pest is contacted with at least said Cry2Ab protein by ingestion of tissue of said bacterium or transgenic plant, upon contact said meadow moth pest growth is inhibited and/or caused to die, to achieve control of meadow moth pest damage to plants.

The tissue of the transgenic plant is root, leaf, stem, fruit, tassel, female ear, anther or filament.

The plant is soybean, herba Chenopodii Serotini, beet, sunflower, rhizoma Solani Tuber osi, hemp, and semen Maydis.

The transgenic plant may be at any stage of growth.

The control of the meadow moth hazard plants is not altered by changes in planting location and/or planting time.

The step preceding the contacting step is planting a plant comprising a polynucleotide encoding the Cry2Ab protein.

Preferably, the Cry2Ab protein has an amino acid sequence shown as SEQ ID NO. 1.

More preferably, the Cry2Ab protein has a nucleotide sequence shown as SEQ ID NO. 2.

On the basis of the above technical solution, said plant may also comprise at least one second nucleotide different from the nucleotide encoding said Cry2Ab protein.

Further, the second nucleotide encodes a Cry class insecticidal protein, a Vip class insecticidal protein, a protease inhibitor, a lectin, an alpha-amylase, or a peroxidase.

In the present invention, expression of a Cry2Ab protein in a transgenic plant can be accompanied by expression of one or more Cry-class insecticidal proteins and/or Vip-class insecticidal proteins. Co-expression of more than one insecticidal toxin in the same transgenic plant can be achieved by genetic engineering the plant to contain and express the desired genes. Alternatively, one plant (the 1 st parent) may be genetically engineered to express a Cry2Ab protein and a second plant (the 2 nd parent) may be genetically engineered to express a Cry-like insecticidal protein and/or a Vip-like insecticidal protein. Progeny plants expressing all the genes introduced into the 1 st and 2 nd parents are obtained by crossing the 1 st and 2 nd parents.

Preferably, the second nucleotide encodes a Vip3A protein, a Cry1A protein, or a Cry1F protein.

More preferably, the second nucleotide encodes a polypeptide having the amino acid sequence shown in SEQ ID NO. 3 or SEQ ID NO. 5. The second nucleotide has a nucleotide sequence shown in SEQ ID NO. 4 or SEQ ID NO. 6.

Alternatively, the second nucleotide is a dsRNA that inhibits an important gene in the target insect pest.

In order to achieve the purpose, the invention also provides application of the Cry2Ab protein in controlling meadow moth pests.

The invention also provides a method of producing a plant that controls a meadow moth pest comprising introducing into the genome of the plant a polynucleotide sequence encoding a Cry2Ab protein.

The invention also provides a method of producing a plant propagule for control of a meadow moth pest, comprising crossing a first plant obtained by the method with a second plant, and/or removing reproductive tissue from the plant obtained by the method for culture, thereby producing a plant propagule comprising a polynucleotide sequence encoding a Cry2Ab protein.

The present invention also provides a method of cultivating a plant for controlling a meadow moth pest, comprising:

planting at least one plant propagule comprising in its genome a polynucleotide sequence encoding a Cry2Ab protein;

growing the plant propagule into a plant;

growing said plants under conditions in which artificial inoculation by meadow moth pests and/or meadow moth pests naturally occur harm, harvesting plants having reduced plant damage and/or having increased plant yield as compared to other plants not having a polynucleotide sequence encoding a Cry2Ab protein.

"plant propagules" as used herein include, but are not limited to, vegetative propagules and vegetative propagules. The plant sexual propagules include, but are not limited to, plant seeds; the vegetative propagation body of the plant refers to a vegetative organ or a special tissue of the plant body, and can generate a new plant under the condition of in vitro; the vegetative organ or a specific tissue includes, but is not limited to, roots, stems and leaves, such as: plants with roots as vegetative propagules include strawberry, sweet potato, and the like; plants with stems as vegetative propagules include sugarcane and potato (tubers); the plant with leaves as asexual propagules includes aloe, begonia, etc.

The term "contact" as used herein means touching, staying and/or feeding, in particular, an insect and/or pest touching, staying and/or feeding, to a plant, plant organ, plant tissue or plant cell, which may be either a plant, plant organ, plant tissue or plant cell expressing an insecticidal protein in vivo, or a plant, plant organ, plant tissue or plant cell having an insecticidal protein on the surface and/or a microorganism producing an insecticidal protein.

The 'control' and/or 'control' of the invention means that the grassland borer is at least contacted with Cry2Ab protein, and the growth of the grassland borer is inhibited and/or the grassland borer dies after the contact. Further, the meadow moth pests are at least contacted with the Cry2Ab protein by feeding plant tissue, and after contact, all or part of the meadow moth pests are inhibited from growing and/or caused to die. Inhibition refers to sublethal, i.e., not yet lethal, but capable of causing some effect in growth, development, behavior, physiology, biochemistry and tissue, such as slow and/or stopped growth. At the same time, the plant should be morphologically normal and can be cultured under conventional methods for consumption and/or production of the product. Furthermore, plants and/or plant propagules for controlling meadow moth pests which contain a polynucleotide sequence encoding a Cry2Ab protein have reduced plant damage including, but not limited to, improved leaf resistance, and/or increased kernel weight, and/or yield increase, as compared to non-transgenic wild-type plants, under conditions in which artificial inoculation with meadow moth pests and/or meadow moth pests naturally occurs. The "controlling" and/or "controlling" effect of the Cry2Ab protein on meadow moth is that it can exist independently, in particular that any tissue of the transgenic plant (containing the polynucleotide sequence encoding the Cry2Ab protein) is present and/or produced simultaneously and/or asynchronously, the Cry2Ab protein and/or another substance that can control meadow moth pests, then the presence of said another substance neither affects the "controlling" and/or "controlling" effect of Cry2Ab on meadow moth, nor does it result in said "controlling" and/or "controlling" effect being achieved wholly and/or in part by said another substance, irrespective of the Cry2Ab protein. Generally, in the field, the process of feeding plant tissues by the meadow borers is short and difficult to observe by naked eyes, so that under the condition that the meadow borers and/or the meadow borers are naturally harmed, such as the meadow borers dead in any tissues of transgenic plants (containing a polynucleotide sequence for coding Cry2Ab protein), and/or the meadow borers with growth inhibition staying thereon, and/or the plant damage reduced compared with non-transgenic wild-type plants, is realized, namely, the method and/or the application of the invention are realized, namely, the method and/or the application of controlling the meadow borers by contacting the meadow borers with at least Cry2Ab protein are realized.

RNA interference (RNAi) refers to a highly conserved, double-stranded RNA (dsRNA) -induced, highly efficient and specific degradation of homologous mrnas during evolution. RNAi techniques can thus be used in the present invention to specifically knock out or turn off the expression of particular genes in target insect pests, particularly genes associated with the growth and development of the target insect pests.

The meadow moth imago is light brown, the body length is 8-10mm, the front wing is grey brown, the outer edge is provided with a light yellow stripe, the central near front edge of the wing is provided with a deep yellow spot, the front edge of the inner side of the vertex angle is provided with an unobvious triangular light yellow small spot, the back wing is light grey yellow, and the meadow moth is provided with two wavy stripes parallel to the outer edge. The ovum is elliptical, has a length of 0.8-1.2mm, and is 3, 5 or 7, 8 pieces of cluster-shaped ovum block adhered into complex tile shape. The larvae are 5 years old, the aged larvae are 16-25mm, the 1 st larvae are light green, and the body back has a plurality of dark brown lines; the 3 rd age is gray green, the body side has a light longitudinal band, and the whole body has burrs; the 5 th instar is mostly gray black, and bright yellow lines are arranged on two sides. Pupa length 14-20mm, back each node has 14 tawny small points, arranged on both sides, 8 thorns.

The meadow moth is distributed in northern areas of China, 2-4 generations occur in one year, adults are weak in flying ability and like to eat nectar, eggs are scattered on two sides of a leaf back main vein and are usually 3-4 grains together, and the number of the eggs is 2-8cm away from the ground. The newly hatched larvae mostly concentrate on the branch tips to form a net and hide, the larvae eat mesophyll, the food intake is increased sharply after 3 years, and the larvae are 5 years old. The meadow moth uses the aged larva to spin silk in soil to make it cocoon and overwinter. In the next spring, the overwintering larva begins pupating along with the increase of sunshine and the rise of air temperature, and generally enters the eclosion full period from the lower month of 5 to the upper month of 6. After eclosion, the adult insects migrate from the overwintering place to the emergence place, propagate for 1-2 generations in the emergence place, migrate to the overwintering place again, spawn and propagate until the mature larvae enter the soil and overwinter.

In the classification system, lepidoptera is generally classified into suborder, superfamily, and family according to morphological characteristics such as the pulse order, linkage pattern, and the type of an antennary. The borer moth family is one of the most varied families in lepidoptera, more than 1 ten thousand families are found in the world, and thousands of families are recorded in China. Most of the borer moth insects are pests of crops, most of which are in the form of stem borers, such as chilo suppressalis and corn borers. Although the corn borers and the meadow moth belong to the lepidoptera borer family, the corn borers and the meadow borers have great difference on other morphological structures except the similarity on classification standards; as compared with the strawberry and the apple in the plant (belonging to Rosaceae of Rosales), the strawberry and apple all have the characteristics of flower amphipathy, radiation symmetry, 5 petals and the like, but the fruit and plant forms are very different. However, people are considered to be largely different in insect morphology because people are less exposed to insects, especially agricultural pests, and have less concern about differences in insect morphology. In fact, meadow moth has its unique characteristics, both in terms of larval and adult morphology.

The insects belonging to the same family of the borer moth have great difference in morphological characteristics and also have difference in feeding habits. For example, the corn borer, which is the family of the borer moth, is mainly harmful to the corn of the family of the Gramineae, and rarely harmful to other broad-leaf crops. While the meadow moth prefers to eat vegetables such as grey vegetables, sugar beet and soybeans, and is harmful to cereal crops, forest trees and the like in the case of large emergence. Differences in feeding habits also suggest that the enzymes and receptor proteins produced by the digestive system in vivo are different. Enzymes produced in the digestive tract are the key points for the Bt genes to act, and only enzymes or receptor proteins which can be combined with specific Bt genes can make certain Bt genes have insect-resistant effects on the pests. More and more studies have shown that insects from different families of the same order, and even from different species of the same family, exhibit different sensitivities to the same species of Bt proteins. For example, the Vip3Aa gene shows insect-resistant activity against Chilo suppresalis, a Chilo suppressalis, and Ostrinia furnacalis, both of the family Cyclinae, but the Vip3Aa gene has no insect-resistant effect against Plodia interpunctella, a Plumba internella, and Ostrinia nubilalis, both of the family Ostrinia. The pests belong to the lepidoptera family of snout moth, but the same Bt protein shows different resistance effects on the pests of the lepidoptera family of snout moth. In particular, European corn borer and Asian corn borer belong to Ostrinia (congeneric genus) of the family Bombycidae in classification even, but the responses to the same Bt protein are quite different, and more fully indicate that the interaction mode of the Bt protein with insect in-vivo enzymes and receptors is complex and unpredictable.

The genome of a plant, plant tissue or plant cell as defined in the present invention refers to any genetic material within a plant, plant tissue or plant cell and includes the nuclear and plastid and mitochondrial genomes.

The polynucleotides and/or nucleotides described in the present invention form a complete "gene" encoding a protein or polypeptide in a desired host cell. One of skill in the art will readily recognize that the polynucleotides and/or nucleotides of the present invention may be placed under the control of regulatory sequences in the host of interest.

As is well known to those skilled in the art, DNA typically exists in a double stranded form. In this arrangement, one strand is complementary to the other strand, and vice versa. Other complementary strands of DNA are produced as the DNA replicates in plants. Thus, the present invention includes the use of the polynucleotides and their complementary strands exemplified in the sequence listing. The "coding strand" as commonly used in the art refers to the strand to which the antisense strand is joined. To express a protein in vivo, one strand of DNA is typically transcribed into the complementary strand of an mRNA, which serves as a template for translation of the protein. mRNA is actually transcribed from the "antisense" strand of DNA. The "sense" or "coding" strand has a series of codons (a codon is three nucleotides, three of which at a time can yield a particular amino acid) that can be read as an Open Reading Frame (ORF) to form a protein or peptide of interest. The present invention also includes RNAs that are functional equivalent to the exemplified DNA.

The nucleic acid molecule or fragment thereof of the invention hybridizes with the Cry2Ab gene of the invention under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of the Cry2Ab gene of the invention. Nucleic acid molecules or fragments thereof are capable of specifically hybridizing to other nucleic acid molecules under certain circumstances. In the present invention, two nucleic acid molecules can be said to be capable of specifically hybridizing to each other if they can form an antiparallel double-stranded nucleic acid structure. Two nucleic acid molecules are said to be "complements" of one another if they exhibit complete complementarity. In the present invention, two nucleic acid molecules are said to exhibit "perfect complementarity" when each nucleotide of the two nucleic acid molecules is complementary to the corresponding nucleotide of the other nucleic acid molecule. Two nucleic acid molecules are said to be "minimally complementary" if they are capable of hybridizing to each other with sufficient stability to allow them to anneal and bind to each other under at least conventional "low stringency" conditions. Similarly, two nucleic acid molecules are said to have "complementarity" if they are capable of hybridizing to each other with sufficient stability to allow them to anneal and bind to each other under conventional "highly stringent" conditions. Deviations from perfect complementarity may be tolerated as long as such deviations do not completely prevent the formation of a double-stranded structure by the two molecules. In order to allow a nucleic acid molecule to act as a primer or probe, it is only necessary to ensure sufficient complementarity in sequence to allow the formation of a stable double-stranded structure in the particular solvent and salt concentrations employed.

In the present invention, a substantially homologous sequence is a nucleic acid molecule that specifically hybridizes under highly stringent conditions to the complementary strand of a compatible nucleic acid molecule. Suitable stringency conditions for promoting DNA hybridization include, for example, treatment with 6.0 XSSC/sodium citrate (SSC) at about 45 ℃ followed by a wash with 2.0 XSSC at 50 ℃, as is well known to those skilled in the art. For example, the salt concentration in the washing step can be selected from the group consisting of about 2.0 XSSC for low stringency conditions, 50 ℃ to about 0.2 XSSC for high stringency conditions, 50 ℃. In addition, the temperature conditions in the washing step can be raised from about 22 ℃ at room temperature for low stringency conditions to about 65 ℃ for high stringency conditions. Both the temperature conditions and the salt concentration may be varied, or one may be held constant while the other is varied. Preferably, the stringent conditions of the present invention may be specifically hybridized with SEQ ID NO:2, SEQ ID NO:4 and SEQ ID NO:6 in a 6 XSSC, 0.5% SDS solution at 65 ℃ and then washed 1 time each with 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS.

Thus, sequences having anti-insect activity and hybridizing under stringent conditions to SEQ ID NO 2, SEQ ID NO 4 and SEQ ID NO 6 of the present invention are included in the present invention. These sequences are at least about 40% -50% homologous, about 60%, 65%, or 70% homologous, and even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence homology to the sequences of the present invention.

The genes and proteins described in the present invention include not only the specific exemplified sequences, but also portions and/or fragments (including internal and/or terminal deletions compared to the full-length protein), variants, mutants, substitutions (proteins with substituted amino acids), chimeras and fusion proteins that preserve the pesticidal activity characteristics of the specific exemplified proteins. The "variant" or "variation" refers to a nucleotide sequence that encodes the same protein or encodes an equivalent protein with pesticidal activity. The "equivalent protein" refers to a protein having the same or substantially the same biological activity against a meadow moth pest as the protein of claim.

"fragment" or "truncation" of a DNA molecule or protein sequence as described herein refers to a portion of the original DNA or protein sequence (nucleotide or amino acid) or an artificially modified form thereof (e.g., a sequence suitable for plant expression) that may vary in length but is long enough to ensure that the (encoded) protein is an insect toxin.

Modification of genes and easy construction of gene variants can be achieved using standard techniques. For example, techniques for making point mutations are well known in the art. Another example is U.S. patent No. 5605793, which describes methods for generating other molecular diversity using DNA reassembly after random fragmentation. Fragments of the full-length gene can be made using commercial endonucleases, and exonucleases can be used following standard procedures. For example, nucleotides can be systematically excised from the ends of these genes using enzymes such as Bal31 or site-directed mutagenesis. A variety of restriction enzymes can also be used to obtain a gene encoding an active fragment. Active fragments of these toxins can be obtained directly using proteases.

The invention can derive equivalent proteins and/or genes encoding the equivalent proteins from Bt isolates and/or DNA libraries. There are various methods for obtaining the pesticidal proteins of the present invention. For example, antibodies to the pesticidal proteins disclosed and claimed herein can be used to identify and isolate other proteins from a mixture of proteins. In particular, antibodies may be caused by the most constant and different protein portions of the protein than other Bt proteins. These antibodies can then be used to specifically identify the equivalent proteins with characteristic activities by immunoprecipitation, enzyme-linked immunosorbent assay (ELISA) or western blot methods. Antibodies to the proteins disclosed in the present invention or equivalent proteins or fragments of such proteins can be readily prepared using standard procedures in the art. The genes encoding these proteins can then be obtained from the microorganism.

Due to the redundancy of the genetic code, a plurality of different DNA sequences may encode the same amino acid sequence. It is well within the skill of the art to generate such alternative DNA sequences encoding the same or substantially the same protein. These different DNA sequences are included in the scope of the present invention. The "substantially identical" sequence refers to a sequence having amino acid substitutions, deletions, additions or insertions which do not substantially affect pesticidal activity, and also includes fragments which retain pesticidal activity.

The substitution, deletion or addition of the amino acid sequence in the present invention is a conventional technique in the art, and it is preferable that such amino acid change is: small changes in properties, i.e., conservative amino acid substitutions that do not significantly affect the folding and/or activity of the protein; small deletions, typically of about 1-30 amino acids; a small amino-or carboxy-terminal extension, e.g., one methionine residue to the amino terminus; small linker peptides, for example, about 20-25 residues in length.

Examples of conservative substitutions are those that occur within the following amino acid groups: basic amino acids (e.g., arginine, lysine, and histidine), acidic amino acids (e.g., glutamic acid and aspartic acid), polar amino acids (e.g., glutamine, asparagine), hydrophobic amino acids (e.g., leucine, isoleucine, and valine), aromatic amino acids (e.g., phenylalanine, tryptophan, and tyrosine), and small molecule amino acids (e.g., glycine, alanine, serine, threonine, and methionine). Those amino acid substitutions which do not normally alter a particular activity are well known in the art and have been described, for example, by N.Neurath and R.L.Hill in Protein, 1979, New York academic Press. The most common exchanges are Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, and vice versa.

It will be apparent to those skilled in the art that such substitutions may occur outside the region which plays an important role in the function of the molecule and still result in an active polypeptide. For polypeptides of the invention whose activity is essential and therefore the choice of unsubstituted amino acid residues can be identified according to methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (see, e.g., Cunningham and Wells, 1989, Science 244: 1081-1085). The latter technique involves introducing mutations at each positively charged residue in the molecule and testing the resulting mutant molecules for anti-insect activity to determine amino acid residues important for the activity of the molecule. The substrate-enzyme interaction site can also be determined by analysis of its three-dimensional structure as determined by techniques such as nuclear magnetic resonance analysis, crystallography, or photoaffinity labeling (see, e.g., deVos et al, 1992, Science 255: 306-.

In the present invention, there is a certain homology with the amino acid sequence shown in SEQ ID NO. 1, SEQ ID NO. 3 or SEQ ID NO. 5. These sequences typically have a similarity/identity of greater than 78%, preferably greater than 85%, more preferably greater than 90%, even more preferably greater than 95%, and may be greater than 99% to the sequences of the present invention. Preferred polynucleotides and proteins of the invention may also be defined according to more specific identity and/or similarity ranges. For example 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity and/or similarity to a sequence exemplified herein.

In the present invention, transgenic plants producing the Cry2Ab protein include, but are not limited to, the MON87751 transgenic soybean event and/or plant material comprising the MON87751 transgenic soybean event (as described in CN 105531376A), the MON89034 transgenic corn event and/or plant material comprising the MON89034 transgenic corn event (as described in CN 101495635B), or the MON15985 transgenic cotton event and/or plant material comprising the MON15985 transgenic cotton event (as described in CN 101413028B), which can all accomplish the methods and/or uses of the present invention, i.e., the methods and/or uses of controlling meadow borer pests by contacting the meadow borer with at least the Cry2Ab protein. It will be appreciated by those skilled in the art that the methods and/or uses of the present invention can also be achieved by expressing the Cry2Ab protein in the transgenic event described above in a different plant. More specifically, the Cry2Ab protein is present in a transgenic plant producing at least the Cry2Ab protein, the meadow moth pests are contacted with at least the Cry2Ab protein by feeding tissues of the transgenic plant, and the growth of the meadow moth pests is inhibited and/or caused to die after the contact, so as to realize the control of the meadow moth harmful plants.

The regulatory sequences of the present invention include, but are not limited to, promoters, transit peptides, terminators, enhancers, leader sequences, introns, and other regulatory sequences operably linked to the Cry2Ab protein.

The promoter is a promoter capable of being expressed in a plant, and the promoter capable of being expressed in the plant is a promoter which ensures that a coding sequence connected with the promoter is expressed in a plant cell. The promoter expressible in plants may be a constitutive promoter. Examples of promoters that direct constitutive expression in plants include, but are not limited to, 35S promoter derived from cauliflower mosaic virus, Arabidopsis Ubi10 promoter, maize Ubi promoter, promoter of rice GOS2 gene, and the like. Alternatively, the plant expressible promoter may be a tissue specific promoter, i.e. a promoter that directs expression of the coding sequence at a higher level in some tissues of the plant, e.g. in green tissues, than in other tissues of the plant (as can be determined by conventional RNA assays), e.g. the PEP carboxylase promoter. Alternatively, the promoter expressible in a plant may be a wound-inducible promoter. A wound-inducible promoter or a promoter that directs a wound-induced expression pattern means that when a plant is subjected to mechanical or insect feeding induced wounds, the expression of the coding sequence under the control of the promoter is significantly increased compared to under normal growth conditions. Examples of wound-inducible promoters include, but are not limited to, promoters of potato and tomato protease-inhibitory genes (pin I and pin II) and maize protease-inhibitory gene (MPI).

The transit peptide (also known as a secretion signal sequence or targeting sequence) is intended to direct the transgene product to a specific organelle or cellular compartment, and for the receptor protein, the transit peptide may be heterologous, e.g., targeting the chloroplast using a chloroplast transit peptide sequence, or targeting the endoplasmic reticulum using a 'KDEL' retention sequence, or targeting the vacuole using the CTPP of the barley lectin gene.

The leader sequence includes, but is not limited to, a small RNA virus leader sequence, such as an EMCV leader sequence (encephalomyocarditis virus 5' non-coding region); potyvirus leaders, such as the MDMV (maize dwarf mosaic virus) leader; human immunoglobulin heavy chain binding protein (BiP); untranslated leader sequences of envelope protein mRNA of alfalfa mosaic virus (AMV RNA 4); tobacco Mosaic Virus (TMV) leader sequence.

Such enhancers include, but are not limited to, cauliflower mosaic virus (CaMV) enhancer, Figwort Mosaic Virus (FMV) enhancer, carnation weathering Circovirus (CERV) enhancer, cassava vein mosaic virus (CsVMV) enhancer, Mirabilis Mosaic Virus (MMV) enhancer, midnight fragrant tree yellowing leaf curl virus (CmYLCV) enhancer, multan cotton leaf curl virus (CLCuMV), dayflower yellow mottle virus (CoYMV), and peanut chlorosis streak mosaic virus (PCLSV) enhancer.

For monocot applications, the intron includes, but is not limited to, the maize hsp70 intron, the maize ubiquitin intron, Adh intron 1, the sucrose synthase intron, or the rice Act1 intron. For dicot applications, the introns include, but are not limited to, the CAT-1 intron, the pKANNIBAL intron, the PIV2 intron, and the "superubiquitin" intron.

The terminator may be a suitable polyadenylation signal sequence that functions in plants, including, but not limited to, polyadenylation signal sequence derived from the Agrobacterium tumefaciens nopaline synthase (NOS) gene, polyadenylation signal sequence derived from the protease inhibitor II (PIN II) gene, polyadenylation signal sequence derived from the pea ssRUBISCO E9 gene, and polyadenylation signal sequence derived from the alpha-tubulin (alpha-tubulin) gene.

As used herein, "operably linked" refers to the linkage of nucleic acid sequences such that one provides the functionality required of the linked sequence. In the present invention, the "operative linkage" may be a linkage of a promoter to a sequence of interest such that transcription of the sequence of interest is controlled and regulated by the promoter. "operably linked" when the sequence of interest encodes a protein and expression of the protein is desired indicates that: the promoter is linked to the sequence in such a way that the resulting transcript is translated efficiently. If the linkage of the promoter to the coding sequence is a transcript fusion and expression of the encoded protein is desired, such a linkage is made such that the first translation initiation codon in the resulting transcript is the initiation codon of the coding sequence. Alternatively, if the linkage of the promoter to the coding sequence is a translational fusion and expression of the encoded protein is desired, the linkage is made such that the first translation initiation codon contained in the 5' untranslated sequence is linked to the promoter and is linked in such a way that the resulting translation product is in frame with the translational open reading frame encoding the desired protein. Nucleic acid sequences that may be "operably linked" include, but are not limited to: sequences that provide gene expression functions (i.e., gene expression elements such as promoters, 5 'untranslated regions, introns, protein coding regions, 3' untranslated regions, polyadenylation sites, and/or transcription terminators), sequences that provide DNA transfer and/or integration functions (i.e., T-DNA border sequences, site-specific recombinase recognition sites, integrase recognition sites), sequences that provide selective functions (i.e., antibiotic resistance markers, biosynthetic genes), sequences that provide scorable marker functions, sequences that facilitate sequence manipulation in vitro or in vivo (i.e., polylinker sequences, site-specific recombination sequences), and sequences that provide replication functions (i.e., bacterial origins of replication, autonomously replicating sequences, centromeric sequences).

"pesticidal" or "pest-resistant" as used herein means toxic to crop pests, thereby achieving "control" and/or "control" of the crop pests. Preferably, the term "pesticidal" or "pest-resistant" refers to killing of a crop pest. More specifically, the target insect is a meadow moth pest.

The Cry2Ab protein in the invention has toxicity to the grassland borers. The plants of the invention, in particular soybeans, contain in their genome exogenous DNA comprising a nucleotide sequence encoding a Cry2Ab protein with which the meadow moth pests are exposed by feeding plant tissue, upon which the growth of the meadow moth pests is inhibited and/or caused to die. Inhibition refers to lethal or sublethal. At the same time, the plant should be morphologically normal and can be cultured under conventional methods for consumption and/or production of the product. Furthermore, the plant may substantially eliminate the need for chemical or biological pesticides (which are pesticides against the meadow moth pest targeted by the Cry2Ab protein).

The expression level of Insecticidal Crystal Protein (ICP) in plant material can be detected by a variety of methods described in the art, for example by quantifying mRNA encoding an insecticidal protein produced in the tissue using specific primers, or by direct specific detection of the amount of insecticidal protein produced.

Different assays may be used to determine the pesticidal effect of ICP in plants. The target insects in the invention are mainly meadow moth.

In the invention, the Cry2Ab protein can have an amino acid sequence shown as SEQ ID NO. 1. In addition to comprising the coding region for the Cry2Ab protein, other elements may also be included, such as a protein encoding a selectable marker.

Furthermore, an expression cassette comprising a nucleotide sequence encoding a Cry2Ab protein of the invention can also be expressed in plants together with at least one protein encoding a herbicide resistance gene, including, but not limited to, a glufosinate resistance gene (e.g., bar gene, pat gene), a benfop resistance gene (e.g., pmph gene), a glyphosate resistance gene (e.g., EPSPS gene), a bromoxynil (bromoxynil) resistance gene, a sulfonylurea resistance gene, a resistance gene to herbicide dalapon, a resistance gene to cyanamide, or a resistance gene to a glutamine synthetase inhibitor (e.g., PPT), thereby obtaining transgenic plants having both high pesticidal activity and herbicide resistance.

In the present invention, an exogenous DNA is introduced into a plant, such as a gene or an expression cassette or a recombinant vector encoding the Cry2Ab protein into a plant cell, and conventional transformation methods include, but are not limited to, agrobacterium-mediated transformation, microprojectile bombardment, direct uptake of DNA into protoplasts, electroporation, or whisker silicon-mediated DNA introduction.

The invention provides an application of insecticidal protein, which has the following advantages:

1. preventing and treating internal cause. The prior art mainly controls the harm of the meadow moth pests by external action, namely exogenous factors, such as agricultural control, chemical control, physical control and biological control; the invention controls the pests of the meadow moth by generating Cry2Ab protein capable of killing the meadow moth in plants, namely by internal causes.

2. No pollution and no residue. Chemical prevention and control methods used in the prior art play a certain role in controlling the harm of meadow moth pests, but also bring pollution, damage and residue to human, livestock and farmland ecosystems; the above-mentioned adverse effects can be eliminated using the method for controlling meadow moth pests of the present invention.

3. Preventing and treating in the whole growth period. The methods for controlling the meadow moth pests in the prior art are all staged, but the invention protects the plants in the whole growth period, and the transgenic plants (Cry2Ab protein) can be prevented from being damaged by the meadow moth from germination, growth, flowering and fruiting.

4. And (4) whole plant prevention and control. The methods used in the prior art for controlling meadow moth pests are mostly local, such as foliar spray; the invention protects the whole plant, such as roots, leaves, stems, fruits, tassels, female ears, anthers or filaments of a transgenic plant (Cry2Ab protein) and the like, which can resist the invasion of the meadow moth.

5. The effect is stable. In the prior art, both agricultural control methods and physical control methods need to utilize environmental conditions to control pests, and have more variable factors; the Cry2Ab protein is expressed in the plant body, the defect of unstable environmental conditions is effectively overcome, and the control effect of the transgenic plant (Cry2Ab protein) is stable and consistent in different places, different time and different genetic backgrounds.

6. Simple, convenient and economical. The frequency oscillation type insecticidal lamp used in the prior art has large one-time investment and is in danger of hurting people by electric shock when not operated properly; the invention only needs to plant the transgenic plant capable of expressing the Cry2Ab protein without adopting other measures, thereby saving a great deal of manpower, material resources and financial resources.

7. The effect is thorough. The method for controlling the meadow moth pests in the prior art has incomplete effect and only plays a role in lightening; the transgenic plant (Cry2Ab protein) of the invention can cause the death of the larvae of the meadow moth which are hatched in a large amount, greatly inhibits the development progress of a small part of the living larvae, and is only slightly damaged in general.

The technical solution of the present invention is further described in detail by the accompanying drawings and embodiments.

Drawings

FIG. 1 is a flow chart of construction of a recombinant cloning vector DBN01-T containing Cry2Ab nucleotide sequence for use of the insecticidal protein of the invention;

FIG. 2 is a flow chart of the construction of a soybean recombinant expression vector DBN100033 containing Cry2Ab nucleotide sequence for the use of the insecticidal protein of the invention;

FIG. 3 is a flow chart of the construction of a corn recombinant expression vector DBN100034 containing Cry2Ab nucleotide sequence for the use of the insecticidal protein of the invention.

Detailed Description

The technical scheme of the application of the insecticidal protein of the invention is further illustrated by the specific examples.

First example, Gene acquisition and Synthesis

1. Obtaining nucleotide sequences

The amino acid sequence (634 amino acids) of Cry2Ab insecticidal protein is shown as SEQ ID NO:1 in the sequence table; a Cry2Ab nucleotide sequence (1905 nucleotides) which encodes an amino acid sequence corresponding to the Cry2Ab insecticidal protein and is shown as SEQ ID NO:2 in a sequence table.

The amino acid sequence (1178 amino acids) of Cry1Ac insecticidal protein is shown as SEQ ID NO. 3 in the sequence table; a Cry1Ac nucleotide sequence (3537 nucleotides) which encodes an amino acid sequence corresponding to the Cry1Ac insecticidal protein and is shown as SEQ ID NO:4 in a sequence table.

The amino acid sequence (1177 amino acids) of Cry1A.105 insecticidal protein is shown as SEQ ID NO. 5 in the sequence table; a Cry1A.105 nucleotide sequence (3534 nucleotides) which encodes an amino acid sequence corresponding to the Cry1A.105 insecticidal protein, and is shown as SEQ ID NO:6 in a sequence table.

An amino acid sequence (789 amino acids) of Vip3A insecticidal protein, which is shown as SEQ ID NO:7 in a sequence table; a Vip3A nucleotide sequence (2370 nucleotides) which encodes the amino acid sequence of the Vip3A insecticidal protein, as shown in SEQ ID NO:8 of the sequence Listing.

2. Synthesis of the above nucleotide sequence

Synthesizing the Cry2Ab nucleotide sequence (shown as SEQ ID NO:2 in the sequence table), the Cry1Ac nucleotide sequence (shown as SEQ ID NO:4 in the sequence table), the Cry1A.105 nucleotide sequence (shown as SEQ ID NO:6 in the sequence table) and the Vip3A nucleotide sequence (shown as SEQ ID NO:8 in the sequence table). The 5 'end of the synthesized Cry2Ab nucleotide sequence (SEQ ID NO:2) is also connected with an Nco I enzyme cutting site, and the 3' end of the Cry2Ab nucleotide sequence (SEQ ID NO:2) is also connected with a Spe I enzyme cutting site; the 5 'end of the synthesized Cry1Ac nucleotide sequence (SEQ ID NO:4) is also connected with a Sac I enzyme cutting site, and the 3' end of the Cry1Ac nucleotide sequence (SEQ ID NO:4) is also connected with a Kas I enzyme cutting site; the 5 'end of the synthesized Cry1A.105 nucleotide sequence (SEQ ID NO:6) is also connected with an Nco I enzyme cutting site, and the 3' end of the Cry1A.105 nucleotide sequence (SEQ ID NO:6) is also connected with a Hind III enzyme cutting site; the 5 'end of the synthesized Vip3A nucleotide sequence (SEQ ID NO:8) is also connected with an Asc I enzyme cutting site, and the 3' end of the Vip3A nucleotide sequence (SEQ ID NO:8) is also connected with a BamH I enzyme cutting site.

Second embodiment, construction of recombinant expression vector and Agrobacterium transformation with recombinant expression vector

1. Construction of recombinant cloning vector containing Cry2Ab gene

The synthetic Cry2Ab nucleotide sequence is connected to a cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600), the operation steps are carried out according to the pGEM-T vector instruction of Promega company, and a recombinant cloning vector DBN01-T is obtained, the construction process is shown in figure 1 (wherein Amp represents ampicillin resistance gene; f1 represents replication origin of phage f 1; LacZ is LacZ initiation codon; SP6 is SP6RNA polymerase promoter; T7 is T7RNA polymerase promoter; Cry2Ab is Cry2Ab nucleotide sequence (SEQ ID NO: 2); MCS is multiple cloning site).

The recombinant cloning vector DBN01-T was then used to transform E.coli T1 competent cells (Transgen, Beijing, China, CAT: CD501) by a heat shock method under the following heat shock conditions: 50 μ L of Escherichia coli T1 competent cells, 10 μ L of plasmid DNA (recombinant cloning vector DBN01-T), water bath at 42 ℃ for 30 s; the cells were cultured with shaking at 37 ℃ for 1h (shaking table at 100 rpm), and grown overnight on LB plates (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, pH adjusted to 7.5 with NaOH) coated with IPTG (isopropylthio-. beta. -D-galactoside) and X-gal (5-bromo-4-chloro-3-indol-. beta. -D-galactoside) ampicillin (100mg/L) on their surfaces. White colonies were picked and cultured overnight in LB liquid medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, ampicillin 100mg/L, pH 7.5 adjusted with NaOH) at 37 ℃. Extracting the plasmid by an alkaline method: centrifuging the bacterial solution at 12000rpm for 1min, removing supernatant, and suspending the precipitated bacterial solution with 100 μ L ice-precooled solution I (25mM Tris-HCl, 10mM EDTA (ethylene diamine tetraacetic acid), 50mM glucose, pH 8.0); add 200. mu.L of freshly prepared solution II (0.2M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the tube 4 times, mix, and place on ice for 3-5 min; adding 150 μ L ice-cold solution III (3M potassium acetate, 5M acetic acid), mixing well immediately, and standing on ice for 5-10 min; centrifuging at 4 deg.C and 12000rpm for 5min, adding 2 times volume of anhydrous ethanol into the supernatant, mixing, and standing at room temperature for 5 min; centrifuging at 4 deg.C and 12000rpm for 5min, removing supernatant, washing precipitate with 70% ethanol (V/V), and air drying; adding 30. mu.L of TE (10mM Tris-HCl, 1mM EDTA, pH8.0) containing RNase (20. mu.g/ml) to dissolve the precipitate; bathing in water at 37 deg.C for 30min to digest RNA; storing at-20 deg.C for use.

After the extracted plasmid is subjected to enzyme digestion identification by EcoR V and Xho I, sequencing verification is carried out on positive clones, and the result shows that the Cry2Ab nucleotide sequence inserted into the recombinant cloning vector DBN01-T is the nucleotide sequence shown by SEQ ID NO. 2 in the sequence table, namely the Cry2Ab nucleotide sequence is correctly inserted.

According to the method for constructing the recombinant cloning vector DBN01-T, the synthesized Cry1Ac nucleotide sequence is connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN02-T, wherein Cry1Ac is Cry1Ac nucleotide sequence (SEQ ID NO: 4). Enzyme cutting and sequencing verify that the Cry1Ac nucleotide sequence in the recombinant cloning vector DBN02-T is correctly inserted.

According to the method for constructing the recombinant cloning vector DBN01-T, the synthesized Cry1A.105 nucleotide sequence is connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN03-T, wherein the Cry1A.105 is the Cry1A.105 nucleotide sequence (SEQ ID NO: 6). The correct insertion of the Cry1A.105 nucleotide sequence in the recombinant cloning vector DBN03-T is verified by enzyme digestion and sequencing.

According to the method for constructing the recombinant cloning vector DBN01-T, the synthesized Vip3A nucleotide sequence is connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN04-T, wherein Vip3A is the Vip3A nucleotide sequence (SEQ ID NO: 8). The Vip3A nucleotide sequence in the recombinant cloning vector DBN04-T is correctly inserted through enzyme digestion and sequencing verification.

2. Construction of recombinant expression vector of soybean containing Cry2Ab gene

The construction of a recombinant expression vector DBN100033, which is well known to those skilled in the art, is constructed by inserting a cut-off Cry2Ab nucleotide sequence fragment between the Nco I and Spe I sites of an expression vector DBNBC-01, using restriction enzymes Nco I and Spe I, respectively, to cleave the recombinant cloning vector DBN01-T and the expression vector DBNBC-01 (vector backbone: pCAMBIA2301 (available from CAMBIA group)), using a conventional cleavage method to construct a vector, the construction procedure of which is shown in FIG. 2 (Kan: kanamycin gene; RB: right border; prAtUbi 10: Arabidopsis Ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:9), 2 Cry2 Ab: Cry2Ab nucleotide sequence (SEQ ID NO: 2); tNos: terminator of nopaline synthase gene (SEQ ID NO: 10); pr 35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 11); PAT grass phosphinothricin acetyl transferase gene (SEQ ID NO: 35T 6712); cauliflower mosaic virus 35S S terminator (SEQ ID NO: S) 13); LB: left border).

Transforming the recombinant expression vector DBN100033 into an Escherichia coli T1 competent cell by a heat shock method, wherein the heat shock condition is as follows: 50 μ L of Escherichia coli T1 competent cells, 10 μ L of plasmid DNA (recombinant expression vector DBN100033), water bath at 42 ℃ for 30 s; shaking at 37 deg.C for 1h (shaking table at 100 rpm); then, the cells were cultured for 12 hours at 37 ℃ on LB solid plates (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, pH adjusted to 7.5 with NaOH) containing 50mg/L Kanamycin (Kanamycin), white colonies were picked up, and the cells were cultured overnight at 37 ℃ in LB liquid medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, Kanamycin 50mg/L, pH adjusted to 7.5 with NaOH). The plasmid is extracted by an alkaline method. The extracted plasmid is cut by restriction enzymes Nco I and Spe I and then identified, and a positive clone is sequenced and identified, and the result shows that the nucleotide sequence of the recombinant expression vector DBN100033 between Nco I and Spe I sites is the nucleotide sequence shown by SEQ ID NO. 2 in the sequence table, namely Cry2Ab nucleotide sequence.

According to the above-mentioned method for constructing recombinant expression vector DBN100033, Sac I and Kas I, Nco I and Spe I are used to respectively enzyme-cut said Cry1Ac nucleotide sequence and Cry2Ab nucleotide sequence cut by recombinant cloning vector DBN01-T and DBN02-T to obtain recombinant expression vector DBN100175 (Kan: kanamycin gene; RB: right border; pratUbi 10: Arabidopsis Ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:9), Cry2 Ab: Cry2Ab nucleotide sequence (SEQ ID NO:2), terminator of tNos: nopaline synthase gene (SEQ ID NO:10), pratRbcS 4: Arabidopsis ribulose 1, 5-bisphosphate carboxylase small subunit gene promoter (SEQ ID NO:14), Cry1 Ac: Cry1Ac nucleotide sequence (SEQ ID NO:4), terminator of tNos: nopaline synthase gene (SEQ ID NO: 82910), cauliflower mosaic virus promoter (SEQ ID NO: 35: Acidonopaline mosaic virus) promoter (SEQ ID NO: 11: PSN-11) Enzyme gene (SEQ ID NO: 12); t 35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 13); LB: left border). The nucleotide sequence in the recombinant expression vector DBN100175 is verified to contain nucleotide sequences shown by SEQ ID NO:2 and SEQ ID NO:4 in the sequence table, namely Cry1Ac nucleotide sequence and Cry2Ab nucleotide sequence.

According to the above-mentioned method for constructing recombinant expression vector DBN100033, the nucleotide sequence of Cry1A.105 and nucleotide sequence of Cry2Ab cut by Nco I and Hind III, Nco I and Spe I respectively enzyme-digested recombinant cloning vector DBN01-T and DBN03-T are inserted into expression vector DBNBC-01 to obtain recombinant expression vector DBN100176 (Kan: kanamycin gene; RB: right border; praatUbi 10: Arabidopsis Ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:9), Cry2 Ab: Cry2Ab nucleotide sequence (SEQ ID NO:2), terminator of tNos: nopaline synthase gene (SEQ ID NO:10), prattRbcS 4: Arabidopsis thaliana ribulose 1, 5-bisphosphate carboxylase small subunit gene promoter (SEQ ID NO:14), Cry 1A.105: Cry1A.105 nucleotide sequence (SEQ ID NO:6), terminator of tpye synthase gene (SEQ ID NO: nopaline synthase gene: SEQ ID NO: PAT 35: nopaline transferred promoter (SEQ ID NO: 35S), and transgene cauliflower virus gene (SEQ ID NO: 35: PAT 11: 11) terminator of TPV 35 Enzyme gene (SEQ ID NO: 12); t 35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 13); LB: left border). The nucleotide sequence in the recombinant expression vector DBN100176 is verified by enzyme digestion and sequencing to contain nucleotide sequences shown by SEQ ID NO. 2 and SEQ ID NO. 6 in the sequence table, namely a Cry1A.105 nucleotide sequence and a Cry2Ab nucleotide sequence.

According to the method for constructing the recombinant expression vector DBN100033, the Vip3A nucleotide sequence cut by the Asc I and BamH I enzyme digestion recombinant cloning vector DBN04-T is inserted into the expression vector DBNBC-01 to obtain the recombinant expression vector DBN 100003. The nucleotide sequence in the recombinant expression vector DBN100003 is verified by enzyme digestion and sequencing to contain a nucleotide sequence shown as SEQ ID NO. 8 in the sequence table, namely a Vip3A nucleotide sequence. The Vip3A nucleotide sequence may be linked to the prAtUbi10 promoter and tNos terminator, respectively.

3. Construction of corn recombinant expression vector containing Cry2Ab gene

The recombinant cloning vector DBN01-T and the expression vector DBNBC-02 (vector backbone: pCAMBIA2301 (available from CAMBIA organization)) were digested with restriction enzymes Nco I and Spe I, respectively, and the excised Cry2Ab nucleotide sequence fragment was inserted between the Nco I and Spe I sites of the expression vector DBNBC-02, and the vectors constructed by conventional digestion methods are well known to those skilled in the art, to construct a recombinant expression vector DBN100034, whose construction procedure is shown in FIG. 3 (Kan: kanamycin gene; RB: right border; prUbi: maize Ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:15), Cry2 Ab: Cry2Ab nucleotide sequence (SEQ ID NO:2), tNos: nopaline synthase gene terminator (SEQ ID NO:10), PMI: phosphomannose isomerase gene (SEQ ID NO:16) LB: left border).

Transforming the recombinant expression vector DBN100034 into an Escherichia coli T1 competent cell by a heat shock method, wherein the heat shock condition is as follows: 50 μ L of Escherichia coli T1 competent cells, 10 μ L of plasmid DNA (recombinant expression vector DBN100034), water bath at 42 deg.C for 30 s; shaking at 37 deg.C for 1h (shaking table at 100 rpm); then, the cells were cultured for 12 hours at 37 ℃ on LB solid plates (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, pH adjusted to 7.5 with NaOH) containing 50mg/L Kanamycin (Kanamycin), white colonies were picked up, and the cells were cultured overnight at 37 ℃ in LB liquid medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, Kanamycin 50mg/L, pH adjusted to 7.5 with NaOH). The plasmid is extracted by an alkaline method. The extracted plasmid is cut by restriction enzymes Nco I and Spe I and then identified, and a positive clone is sequenced and identified, and the result shows that the nucleotide sequence of the recombinant expression vector DBN100034 between Nco I and Spe I sites is the nucleotide sequence shown by SEQ ID NO. 2 in the sequence table, namely Cry2Ab nucleotide sequence.

According to the method for constructing the recombinant expression vector DBN100034, the Cry1A.105 nucleotide sequence and the Cry2Ab nucleotide sequence cut by the restriction enzyme digestion of the recombinant cloning vector DBN01-T and the DBN03-T respectively by Nco I, Hind III, Nco I and Spe I are inserted into the expression vector DBNBC-02 to obtain the recombinant expression vector DBN 100076. The nucleotide sequence in the recombinant expression vector DBN100076 is verified by enzyme digestion and sequencing to contain nucleotide sequences shown by SEQ ID NO:2 and SEQ ID NO:6 in a sequence table, namely a Cry1A.105 nucleotide sequence and a Cry2Ab nucleotide sequence. The cry1a.105 nucleotide sequence and the Cry2Ab nucleotide sequence may be linked to the Ubi promoter and Nos terminator, respectively.

According to the method for constructing the recombinant expression vector DBN100034, the Vip3A nucleotide sequence cut by the Asc I and BamH I enzyme digestion recombinant cloning vector DBN04-T is inserted into the expression vector DBNBC-02 to obtain the recombinant expression vector DBN 100004. The nucleotide sequence in the recombinant expression vector DBN100004 is verified by enzyme digestion and sequencing to contain a nucleotide sequence shown as SEQ ID NO. 8 in the sequence table, namely a Vip3A nucleotide sequence. The Vip3A nucleotide sequence may be linked to the Ubi promoter and Nos terminator, respectively.

4. Recombinant expression vector transformation agrobacterium tumefaciens

The soybean recombinant expression vectors DBN100033, DBN100175, DBN100176 and DBN100003 and the corn recombinant expression vectors DBN100034, DBN100076 and DBN100004 which are constructed correctly are transformed into agrobacterium LBA4404 (Invitrogen, Chicago, USA, CAT: 18313-: 100. mu.L Agrobacterium LBA4404, 3. mu.L plasmid DNA (recombinant expression vector); placing in liquid nitrogen for 10min, and heating in 37 deg.C water bath for 10 min; inoculating the transformed Agrobacterium LBA4404 in LB test tube, culturing at 28 deg.C and 200rpm for 2h, spreading on LB plate containing 50mg/L Rifampicin (Rifampicin) and 100mg/L kanamycin until positive single clone grows out, picking out single clone, culturing and extracting plasmid, enzyme-cutting the soybean recombinant expression vectors DBN100033, DBN100175, DBN100176 and DBN100003, and the corn recombinant expression vectors DBN100034, DBN100076 and DBN100004 with restriction enzyme, and verifying enzyme-cutting, the result shows that the soybean recombinant expression vectors DBN100033, DBN100175, DBN100176 and DBN100003, and the corn recombinant expression vectors DBN100034, DBN100076 and DBN100004 have completely correct structures.

Third example, obtaining transgenic plants

1. Obtaining transgenic soybean plants

Cotyledon node tissues of yellow 13 in the aseptically cultured soybean variety were co-cultured with the agrobacterium described in the second example 4 according to the conventionally employed agrobacterium infection method to transfer T-DNAs (including Cry2Ab nucleotide sequence, Cry1Ac nucleotide sequence, cry1a.105 nucleotide sequence, Vip3A nucleotide sequence and PAT gene) of the soybean recombinant expression vectors DBN100033, DBN100175, DBN100176 and DBN100003 constructed in the second example 2 into the soybean genome, thereby obtaining a soybean plant transferred with a Cry2Ab nucleotide sequence, a soybean plant transferred with a Cry1Ac-Cry2Ab nucleotide sequence, a soybean plant transferred with a cry1a.105-Cry2Ab nucleotide sequence and a soybean plant transferred with a Vip3A nucleotide sequence, while using a wild-type soybean plant as a control.

For Agrobacterium-mediated transformation of soybean, briefly, mature soybean seeds were germinated in soybean germination medium (B5 salt 3.1g/L, B5 vitamins, sucrose 20g/L, agar 8g/L, pH5.6), the seeds were inoculated on germination medium and cultured under the following conditions: the temperature is 25 +/-1 ℃; the photoperiod (light/dark) was 16/8 h. Taking the soybean aseptic seedling expanded at the fresh green cotyledonary node after germinating for 4-6 days, cutting off hypocotyl at 3-4mm position below the cotyledonary node, longitudinally cutting cotyledon, and removing terminal bud, side bud and seed root. Wounding at the cotyledonary node with the back of a scalpel, contacting the wounded cotyledonary node tissue with an Agrobacterium suspension, wherein the Agrobacterium is capable of delivering the Cry2Ab nucleotide sequence to the wounded cotyledonary node tissue (step 1: infection step) in this step, the cotyledonary node tissue is preferably immersed in an Agrobacterium suspension (OD)₆₆₀0.5-0.8, infection medium (MS salt 2.15g/L, B5 vitamin, sucrose 20g/L, glucose 10g/L, acetyl cloveKetone (AS)40mg/L, 2-morpholinoethanesulfonic acid (MES)4g/L, Zeatin (ZT)2mg/L, pH5.3) to initiate inoculation. The cotyledonary node tissues were co-cultured with Agrobacterium for a period of time (3 days) (step 2: co-culture step). Preferably, the cotyledonary node tissue is cultured on solid medium (MS salts 4.3g/L, B5 vitamins, sucrose 20g/L, glucose 10g/L, MES 4g/L, ZT 2mg/L, agar 8g/L, pH5.6) after the infection step. After this co-cultivation phase, there may be an optional "recovery" step. In the "recovery" step, at least one antibiotic known to inhibit the growth of Agrobacterium (cephamycin) is present in the recovery medium (B5 salt 3.1g/L, B5 vitamins, MES 1g/L, sucrose 30g/L, ZT 2mg/L, agar 8g/L, cephamycin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, pH5.6) without the addition of a selection agent for plant transformants (step 3: recovery step). Preferably, the regenerated tissue mass of cotyledonary nodes is cultured on solid medium with antibiotics but without a selective agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Next, the regenerated tissue mass of cotyledonary node was cultured on a medium containing a selection agent (glufosinate) and the growing transformed callus was selected (step 4: selection step). Preferably, the regenerated tissue mass of cotyledonary node is cultured on selective solid medium (B5 salt 3.1g/L, B5 vitamins, MES 1g/L, sucrose 30g/L, 6-benzyladenine (6-BAP)1mg/L, agar 8g/L, cephamycin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, glufosinate 6mg/L, pH5.6) resulting in selective growth of transformed cells. Then, the transformed cells are regenerated into plants (step 5: regeneration step), and preferably, the cotyledonary node regenerated tissue pieces grown on a medium containing a selection agent are cultured on a solid medium (B5 differentiation medium and B5 rooting medium) to regenerate the plants.

The resistant tissue blocks obtained by screening are transferred to the B5 differentiation medium (B5 salt 3.1g/L, B5 vitamin, MES 1g/L, sucrose 30g/L, ZT 1mg/L, agar 8g/L, cefamycin 150mg/L, glutamic acid 50mg/L, aspartic acid 50mg/L, gibberellin 1mg/L, auxin 1mg/L, glufosinate 6mg/L, pH5.6), and cultured and differentiated at 25 ℃. The differentiated plantlets are transferred to the B5 rooting medium (B5 salt 3.1g/L, B5 vitamins, MES 1g/L, sucrose 30g/L, agar 8g/L, cephamycin 150mg/L and indole-3-butyric acid (IBA)1mg/L), cultured on the rooting medium at 25 ℃ to about 10cm high, and transferred to a greenhouse for culture until fructification occurs. In the greenhouse, the culture was carried out daily at 26 ℃ for 16h and at 20 ℃ for 8 h.

2. Obtaining transgenic maize plants

The immature embryos of the aseptically cultured maize variety heddle 31(Z31) were co-cultured with the agrobacterium described in the second example 4 according to the conventionally employed agrobacterium infection method to transfer the T-DNAs (including Cry2Ab nucleotide sequence, cry1a.105 nucleotide sequence, Vip3A nucleotide sequence and PMI gene) of the maize recombinant expression vectors DBN100034, DBN100076 and DBN100004 constructed in the second example 3 into the maize genome, and maize plants transferred with Cry2Ab nucleotide sequence, cry1a.105-Cry2Ab nucleotide sequence and Vip3A nucleotide sequence were obtained; wild type maize plants were also used as controls.

For Agrobacterium-mediated transformation of maize, briefly, immature embryos are isolated from maize and the embryos are contacted with an Agrobacterium suspension, wherein the Agrobacterium is capable of delivering a Cry2Ab nucleotide sequence to at least one cell of one of the immature embryos (step 1: the infection step), in which step the embryos are preferably immersed in an Agrobacterium suspension (OD)₆₆₀0.4-0.6, medium (MS salts 4.3g/L, MS vitamins, casein 300mg/L, sucrose 68.5g/L, glucose 36g/L, AS 40mg/L, 2, 4-dichlorophenoxyacetic acid (2,4-D)1mg/L, ph5.3)) was infected to initiate inoculation. The young embryos are co-cultured with Agrobacterium for a period of time (3 days) (step 2: co-culture step). Preferably, the immature embryos are cultured on solid medium (MS salts 4.3g/L, MS vitamins, casein 300mg/L, sucrose 20g/L, glucose 10g/L, AS 100mg/L, 2, 4-D1 mg/L, agar 8g/L, pH5.8) after the infection step. After this co-cultivation phase, there may be an optional "recovery" step. In the "recovery" step, at least one antibiotic known to inhibit the growth of Agrobacterium (cefamycin) is present in the recovery medium (MS salts 4.3g/L, MS vitamins, casein 300mg/L, sucrose 30g/L, 2, 4-D1 mg/L, phytogel 3g/L, pH5.8) without the addition of a selection agent for plant transformants (step 3: recovery step). Preferably, the immature embryo is present inAntibiotics but no selection agent on solid medium to eliminate Agrobacterium and provide a recovery period for infected cells. Next, the inoculated immature embryos are cultured on a medium containing a selection agent (mannose) and the growing transformed calli are selected (step 4: selection step). Preferably, the immature embryos are cultured on selective solid medium with selective agent (MS salts 4.3g/L, MS vitamins, casein 300mg/L, sucrose 30g/L, mannose 12.5g/L, 2, 4-D1 mg/L, plant gel 3g/L, pH5.8) resulting in selective growth of the transformed cells. Then, the callus is regenerated into a plant (step 5: regeneration step), and preferably, the callus grown on the medium containing the selection agent is cultured on a solid medium (MS differentiation medium and MS rooting medium) to regenerate the plant.

The resistant callus obtained by screening was transferred to the MS differentiation medium (MS salts 4.3g/L, MS vitamins, casein 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, mannose 5g/L, plant gel 3g/L, pH5.8) and cultured and differentiated at 25 ℃. The differentiated plantlets are transferred to the MS rooting medium (MS salt is 2.15g/L, MS, vitamin, casein is 300mg/L, cane sugar is 30g/L, indole-3-acetic acid is 1mg/L, plant gel is 3g/L, pH is 5.8), cultured at 25 ℃ to be about 10cm high, and transferred to a greenhouse for culture until fructification. In the greenhouse, the culture was carried out daily at 28 ℃ for 16h and at 20 ℃ for 8 h.

Fourth example, validation of transgenic plants Using TaqMan

About 100mg of each leaf of a soybean Plant with a Cry2Ab transferred nucleotide sequence, a soybean Plant with a Cry1Ac-Cry2Ab transferred nucleotide sequence, a soybean Plant with a Cry1A.105-Cry2Ab transferred nucleotide sequence and a soybean Plant with a Vip3A transferred nucleotide sequence are taken as samples, genomic DNA of the samples is extracted by a DNeasy Plant Maxi Kit of Qiagen, and the copy number of the PAT gene is detected by a Taqman probe fluorescence quantitative PCR method to determine the copy number of the Cry2Ab gene. Meanwhile, wild soybean plants are used as a control, and detection and analysis are carried out according to the method. The experiment was repeated 3 times and the average was taken.

The specific method for detecting the copy number of the PAT gene comprises the following steps:

step 11, respectively taking 100mg of leaves of a soybean plant with a transferred Cry2Ab nucleotide sequence, a soybean plant with a transferred Cry1Ac-Cry2Ab nucleotide sequence, a soybean plant with a transferred Cry1A.105-Cry2Ab nucleotide sequence, a soybean plant with a transferred Vip3A nucleotide sequence and a wild soybean plant, respectively grinding the leaves into homogenate by liquid nitrogen in a mortar, and taking 3 samples for each sample;

step 12, extracting the genomic DNA of the sample by using DNeasy Plant Mini Kit of Qiagen, and referring to the product specification of the specific method;

step 13, measuring the genomic DNA concentration of the sample by using NanoDrop 2000(Thermo Scientific);

step 14, adjusting the genomic DNA concentration of the sample to the same concentration value, wherein the concentration value range is 80-100 ng/mu L;

step 15, identifying the copy number of the sample by adopting a Taqman probe fluorescent quantitative PCR method, taking the sample with known copy number after identification as a standard substance, taking the sample of a wild soybean plant as a control, repeating each sample for 3 times, and taking the average value; the fluorescent quantitative PCR primer and the probe sequence are respectively as follows:

the following primers and probes were used to detect the PAT gene:

primer 1: gagggtgttgtggctggtattg is shown as SEQ ID NO:17 in the sequence list;

primer 2: tctcaactgtccaatcgtaagcg is shown as SEQ ID NO:18 in the sequence list;

1, probe 1: cttacgctgggccctggaaggctag is shown as SEQ ID NO:19 in the sequence list;

the PCR reaction system is as follows:

the 50 × primer/probe mixture contained 45 μ L of each primer at a concentration of 1mM, 50 μ L of probe at a concentration of 100 μ M and 860 μ L of 1 × TE buffer and was stored in amber tubes at 4 ℃.

The PCR reaction conditions are as follows:

data were analyzed using SDS2.3 software (Applied Biosystems).

The experimental result shows that Cry2Ab nucleotide sequence, Cry1Ac-Cry2Ab nucleotide sequence, Cry1A.105-Cry2Ab nucleotide sequence and Vip3A nucleotide sequence are all integrated into the chromosome group of the detected soybean plant, and the soybean plant transferred with Cry2Ab nucleotide sequence, the soybean plant transferred with Cry1Ac-Cry2Ab nucleotide sequence, the soybean plant transferred with Cry1A.105-Cry2Ab nucleotide sequence and the soybean plant transferred with Vip3A nucleotide sequence all obtain single-copy transgenic soybean plants.

Detection analysis (PMI gene) was performed on transgenic maize plants according to the method described above for validation of transgenic soybean plants using TaqMan. The experimental result shows that Cry2Ab nucleotide sequence, Cry1A.105-Cry2Ab nucleotide sequence and Vip3A nucleotide sequence are respectively integrated into the chromosome group of the detected corn plant, and the corn plant transferred with Cry2Ab nucleotide sequence, the corn plant transferred with Cry1A.105-Cry2Ab nucleotide sequence and the corn plant transferred with Vip3A nucleotide sequence all obtain single-copy transgenic plants.

Fifth example, detection of insect-resistant Effect of transgenic Soybean plants

The insect-resistant effect detection is carried out on the sod webworm by a soybean plant with a Cry2Ab nucleotide sequence, a soybean plant with a Cry1Ac-Cry2Ab nucleotide sequence, a soybean plant with a Cry1A.105-Cry2Ab nucleotide sequence, a soybean plant with a Vip3A nucleotide sequence, a wild type soybean plant and a soybean plant which is identified as non-transgenic by Taqman.

Respectively taking a soybean plant with a transferred Cry2Ab nucleotide sequence, a soybean plant with a transferred Cry1Ac-Cry2Ab nucleotide sequence, a soybean plant with a transferred Cry1A.105-Cry2Ab nucleotide sequence, a soybean plant with a transferred Vip3A nucleotide sequence, a wild type soybean plant and fresh leaves of the soybean plant identified as non-transgenic by Taqman (three-leaf period), washing the fresh leaves clean by sterile water, sucking water on the leaves by gauze, removing veins from the soybean leaves, simultaneously cutting the soybean leaves into long strips of 2cm multiplied by 3.5cm, taking 1 cut long strip-shaped leaf, putting the long strip-shaped leaf on a moisture-preserving filter paper at the bottom of a round plastic culture dish, putting 10 grasslands (initially hatched larvae) in each culture dish, covering the culture dish, placing the culture dish under the conditions of 25-28 ℃, 70-80% of relative humidity and 16:8 of light cycle (light/dark), and then according to three indexes of the development progress, mortality rate and leaf damage rate of the grassland borers, total score of resistance was obtained (300 points full): the total resistance score is 100 × mortality + [100 × mortality +90 × (number of first hatched insects/total number of inoculated insects) +60 × (number of first hatched-negative control insects/total number of inoculated insects) +10 × (number of negative control insects/total number of inoculated insects) ] +100 × (1-leaf damage rate). A total of 3 transformation event strains (S1, S2 and S3) transformed with a Cry2Ab nucleotide sequence, a total of 3 transformation event strains (S4, S5 and S6) transformed with a Cry1Ac-Cry2Ab nucleotide sequence, a total of 3 transformation event strains (S7, S8 and S9) transformed with a Cry1A.105-Cry2Ab nucleotide sequence, a total of 3 transformation event strains (S10, S11 and S12) transformed with a Vip3A nucleotide sequence, 1 strain (NGM1) identified as non-transgenic by Taqman and 1 strain (CK1) as a wild type; from each line, 3 plants were selected for testing, each replicated 1 time. The results are shown in Table 1.

TABLE 1 insect resistance test results of transgenic soybean plants inoculated with meadow moth

The results in table 1 show that: the soybean plant with the transferred Cry2Ab nucleotide sequence, the soybean plant with the transferred Cry1Ac-Cry2Ab nucleotide sequence and the soybean plant with the transferred Cry1A.105-Cry2Ab nucleotide sequence have better insecticidal effect on the meadow moth, the average death rate of the meadow moth is mostly 100 percent, and the total resistance score of the meadow moth is close to 300 scores; although the soybean plant with the Vip3A nucleotide sequence has insecticidal activity to the meadow moth, the lethality rate is only below 20%, the soybean plant identified as non-transgenic by Taqman and the wild soybean plant have no lethal or inhibiting effect to the meadow moth, and the total resistance score is generally about 80.

Compared with wild soybean plants, the soybean plants with the transferred Cry2Ab nucleotide sequence, the soybean plants with the transferred Cry1Ac-Cry2Ab nucleotide sequence and the soybean plants with the transferred Cry1A.105-Cry2Ab nucleotide sequence can cause a great amount of death of the larvae which are hatched first, and greatly inhibit the development progress of a small part of the living larvae, the larvae are basically still in the initially hatched state or between the initially hatched state and the negative control state after 3 days, and the pests with the inhibited development can not survive under natural conditions. The soybean plant transferred with the Cry2Ab nucleotide sequence, the soybean plant transferred with the Cry1Ac-Cry2Ab nucleotide sequence and the soybean plant transferred with the Cry1A.105-Cry2Ab nucleotide sequence are only slightly damaged on the whole, and the damage rate of leaves is below 10 percent; although the soybean plant with the Vip3A nucleotide sequence has insecticidal activity on the meadow moth, the control effect is not as obvious as that of Cry2Ab protein, most of larvae can survive, and the damage to leaves is obvious.

Therefore, the soybean plants with the Cry2Ab nucleotide sequence, the soybean plants with the Cry1Ac-Cry2Ab nucleotide sequence and the soybean plants with the Cry1A.105-Cry2Ab nucleotide sequence show high activity to resist the meadow moth, and the activity can generate adverse effect on the growth of the meadow moth so as to control the meadow moth in the field.

Sixth example, detection of insect-resistant Effect of transgenic maize plants

The corn plant with the Cry2Ab nucleotide sequence, the corn plant with the Cry1A.105-Cry2Ab nucleotide sequence, the corn plant with the Vip3A nucleotide sequence, the wild corn plant and the corn plant identified as non-transgenic by Taqman are subjected to insect-resistant effect detection on the meadow moth.

Respectively taking a corn plant with a Cry2Ab transferred nucleotide sequence, a corn plant with a Cry1A.105-Cry2Ab transferred nucleotide sequence, a corn plant with a Vip3A transferred nucleotide sequence, a wild corn plant and fresh leaves (heart leaves) of the corn plant identified as non-transgenic by Taqman (V3-V4), washing the fresh leaves with sterile water, sucking the water on the leaves with gauze, removing the leaf veins of the corn leaves, simultaneously cutting the corn leaves into long strips with the length of about 1cm multiplied by 4cm, putting 1 cut long strip leaf on a moisture-preserving filter paper at the bottom of a round plastic culture dish, putting 1 meadow moth (third-instar larva) in each culture dish, covering the culture dish, putting the culture dish for 3 days under the conditions of the temperature of 25-28 ℃, the relative humidity of 70-80% and the light cycle (light/dark) of 16:8, and then according to three indexes of development progress, mortality and leaf damage rate of the meadow moth larvae, total score of resistance was obtained (300 points full): the total resistance score is 100 × mortality + [100 × mortality +90 × (number of first hatched insects/total number of inoculated insects) +60 × (number of first hatched-negative control insects/total number of inoculated insects) +10 × (number of negative control insects/total number of inoculated insects) ] +100 × (1-leaf damage rate). A total of 3 transformation event strains (S13, S14 and S15) transformed with a Cry2Ab nucleotide sequence, a total of 3 transformation event strains (S16, S17 and S18) transformed with a Cry1A.105-Cry2Ab nucleotide sequence, a total of 3 transformation event strains (S19, S20 and S21) transformed with a Vip3A nucleotide sequence, 1 strain (NGM2) identified as non-transgenic by Taqman and 1 strain (CK2) of a wild type; from each line, 3 plants were selected for testing, each replicated 1 time. The results are shown in Table 2.

TABLE 2 insect resistance test results of transgenic maize plants inoculated with meadow moth

The results in table 2 show that: the corn plants with the Cry2Ab nucleotide sequence and the corn plants with the Cry1A.105-Cry2Ab nucleotide sequence have good insecticidal effect on the meadow moth, the average death rate of the meadow moth is over 60 percent, and the total resistance score is over 200; the maize plant transferred with the Vip3A nucleotide sequence has insecticidal activity to the meadow moth, but the lethality rate is only below 10%, the maize plant identified as non-transgenic by Taqman and the wild maize plant have no lethal or inhibiting effect to the meadow moth, and the total resistance score is about 50 generally.

Meanwhile, compared with wild corn plants, corn plants with the Cry2Ab nucleotide sequence and corn plants with the Cry1A.105-Cry2Ab nucleotide sequence can cause mass death of third-instar larvae of the meadow moth, and greatly inhibit the development progress of a small part of the survival larvae, so that the pests with the inhibited development can not survive in the natural environment of the field. The damage of the corn plant with the Cry2Ab nucleotide sequence and the corn plant with the Cry1A.105-Cry2Ab nucleotide sequence is obviously lighter than that of a control plant; the corn plant with the Vip3A nucleotide sequence has insecticidal activity on the meadow moth, but the control effect is not as obvious as that of Cry2Ab protein, most of larvae can survive, and the damage to leaves is obvious.

Thus, the corn plants with the Cry2Ab nucleotide sequence and the corn plants with the Cry1A.105-Cry2Ab nucleotide sequence show high activity against the meadow moth, and the activity is enough to generate adverse effect on the growth of the meadow moth, so that the meadow moth can be controlled in the field.

The above experimental results also show that: a soybean plant transferred with a Cry2Ab nucleotide sequence, a soybean plant transferred with a Cry1Ac-Cry2Ab nucleotide sequence and a soybean plant transferred with a Cry1A.105-Cry2Ab nucleotide sequence; the control of meadow moth by corn plants with Cry2Ab and Cry1A.105-Cry2Ab nucleotide sequences is obviously because the plants can produce Cry2Ab protein, so the technicians in this field are familiar with the fact that the plants with Cry2Ab protein can produce at least one second insecticidal protein different from Cry2Ab protein, such as Vip-type protein or Cry-type protein, according to the poisoning effect of Cry2Ab protein on meadow moth.

In conclusion, the application of the insecticidal protein disclosed by the invention is used for controlling the meadow moth pests by generating Cry2Ab protein capable of killing the meadow moth in plants; compared with the agricultural control method, the chemical control method, the physical control method and the biological control method used in the prior art, the invention protects the whole plant in the whole growth period to control the invasion of the meadow moth pests, and has the advantages of no pollution, no residue, stable and thorough effect, simplicity, convenience and economy.

Finally, it should be noted that the above embodiments are only for illustrating the technical solutions of the present invention and not for limiting, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

Sequence listing

<110> Beijing Dabei agricultural Biotechnology Co., Ltd

<120> use of insecticidal proteins

<130> DBNBC136

<160> 19

<170> SIPOSequenceListing 1.0

<210> 1

<211> 634

<212> PRT

<213> Artificial Sequence-Cry 2Ab amino acid Sequence (Artificial Sequence)

<400> 1

Met Asp Asn Ser Val Leu Asn Ser Gly Arg Thr Thr Ile Cys Asp Ala

1 5 10 15

Tyr Asn Val Ala Ala His Asp Pro Phe Ser Phe Gln His Lys Ser Leu

20 25 30

Asp Thr Val Gln Lys Glu Trp Thr Glu Trp Lys Lys Asn Asn His Ser

35 40 45

Leu Tyr Leu Asp Pro Ile Val Gly Thr Val Ala Ser Phe Leu Leu Lys

50 55 60

Lys Val Gly Ser Leu Val Gly Lys Arg Ile Leu Ser Glu Leu Arg Asn

65 70 75 80

Leu Ile Phe Pro Ser Gly Ser Thr Asn Leu Met Gln Asp Ile Leu Arg

85 90 95

Glu Thr Glu Lys Phe Leu Asn Gln Arg Leu Asn Thr Asp Thr Leu Ala

100 105 110

Arg Val Asn Ala Glu Leu Thr Gly Leu Gln Ala Asn Val Glu Glu Phe

115 120 125

Asn Arg Gln Val Asp Asn Phe Leu Asn Pro Asn Arg Asn Ala Val Pro

130 135 140

Leu Ser Ile Thr Ser Ser Val Asn Thr Met Gln Gln Leu Phe Leu Asn

145 150 155 160

Arg Leu Pro Gln Phe Gln Met Gln Gly Tyr Gln Leu Leu Leu Leu Pro

165 170 175

Leu Phe Ala Gln Ala Ala Asn Leu His Leu Ser Phe Ile Arg Asp Val

180 185 190

Ile Leu Asn Ala Asp Glu Trp Gly Ile Ser Ala Ala Thr Leu Arg Thr

195 200 205

Tyr Arg Asp Tyr Leu Lys Asn Tyr Thr Arg Asp Tyr Ser Asn Tyr Cys

210 215 220

Ile Asn Thr Tyr Gln Ser Ala Phe Lys Gly Leu Asn Thr Arg Leu His

225 230 235 240

Asp Met Leu Glu Phe Arg Thr Tyr Met Phe Leu Asn Val Phe Glu Tyr

245 250 255

Val Ser Ile Trp Ser Leu Phe Lys Tyr Gln Ser Leu Leu Val Ser Ser

260 265 270

Gly Ala Asn Leu Tyr Ala Ser Gly Ser Gly Pro Gln Gln Thr Gln Ser

275 280 285

Phe Thr Ser Gln Asp Trp Pro Phe Leu Tyr Ser Leu Phe Gln Val Asn

290 295 300

Ser Asn Tyr Val Leu Asn Gly Phe Ser Gly Ala Arg Leu Ser Asn Thr

305 310 315 320

Phe Pro Asn Ile Val Gly Leu Pro Gly Ser Thr Thr Thr His Ala Leu

325 330 335

Leu Ala Ala Arg Val Asn Tyr Ser Gly Gly Ile Ser Ser Gly Asp Ile

340 345 350

Gly Ala Ser Pro Phe Asn Gln Asn Phe Asn Cys Ser Thr Phe Leu Pro

355 360 365

Pro Leu Leu Thr Pro Phe Val Arg Ser Trp Leu Asp Ser Gly Ser Asp

370 375 380

Arg Glu Gly Val Ala Thr Val Thr Asn Trp Gln Thr Glu Ser Phe Glu

385 390 395 400

Thr Thr Leu Gly Leu Arg Ser Gly Ala Phe Thr Ala Arg Gly Asn Ser

405 410 415

Asn Tyr Phe Pro Asp Tyr Phe Ile Arg Asn Ile Ser Gly Val Pro Leu

420 425 430

Val Val Arg Asn Glu Asp Leu Arg Arg Pro Leu His Tyr Asn Glu Ile

435 440 445

Arg Asn Ile Ala Ser Pro Ser Gly Thr Pro Gly Gly Ala Arg Ala Tyr

450 455 460

Met Val Ser Val His Asn Arg Lys Asn Asn Ile His Ala Val His Glu

465 470 475 480

Asn Gly Ser Met Ile His Leu Ala Pro Asn Asp Tyr Thr Gly Phe Thr

485 490 495

Ile Ser Pro Ile His Ala Thr Gln Val Asn Asn Gln Thr Arg Thr Phe

500 505 510

Ile Ser Glu Lys Phe Gly Asn Gln Gly Asp Ser Leu Arg Phe Glu Gln

515 520 525

Asn Asn Thr Thr Ala Arg Tyr Thr Leu Arg Gly Asn Gly Asn Ser Tyr

530 535 540

Asn Leu Tyr Leu Arg Val Ser Ser Ile Gly Asn Ser Thr Ile Arg Val

545 550 555 560

Thr Ile Asn Gly Arg Val Tyr Thr Ala Thr Asn Val Asn Thr Thr Thr

565 570 575

Asn Asn Asp Gly Val Asn Asp Asn Gly Ala Arg Phe Ser Asp Ile Asn

580 585 590

Ile Gly Asn Val Val Ala Ser Ser Asn Ser Asp Val Pro Leu Asp Ile

595 600 605

Asn Val Thr Leu Asn Ser Gly Thr Gln Phe Asp Leu Met Asn Ile Met

610 615 620

Leu Val Pro Thr Asn Ile Ser Pro Leu Tyr

625 630

<210> 2

<211> 1905

<212> DNA

<213> Artificial Sequence-Cry 2Ab nucleotide Sequence (Artificial Sequence)

<400> 2

atggacaact ccgtcctgaa ctctggtcgc accaccatct gcgacgccta caacgtcgcg 60

gcgcatgatc cattcagctt ccagcacaag agcctcgaca ctgttcagaa ggagtggacg 120

gagtggaaga agaacaacca cagcctgtac ctggacccca tcgtcggcac ggtggccagc 180

ttccttctca agaaggtcgg ctctctcgtc gggaagcgca tcctctcgga actccgcaac 240

ctgatctttc catctggctc caccaacctc atgcaagaca tcctcaggga gaccgagaag 300

tttctcaacc agcgcctcaa cactgatacc cttgctcgcg tcaacgctga gctgacgggt 360

ctgcaagcaa acgtggagga gttcaaccgc caagtggaca acttcctcaa ccccaaccgc 420

aatgcggtgc ctctgtccat cacttcttcc gtgaacacca tgcaacaact gttcctcaac 480

cgcttgcctc agttccagat gcaaggctac cagctgctcc tgctgccact ctttgctcag 540

gctgccaacc tgcacctctc cttcattcgt gacgtgatcc tcaacgctga cgagtggggc 600

atctctgcag ccacgctgag gacctaccgc gactacctga agaactacac cagggactac 660

tccaactatt gcatcaacac ctaccagtcg gccttcaagg gcctcaatac gaggcttcac 720

gacatgctgg agttcaggac ctacatgttc ctgaacgtgt tcgagtacgt cagcatctgg 780

tcgctcttca agtaccagag cctgctggtg tccagcggcg ccaacctcta cgccagcggc 840

tctggtcccc aacaaactca gagcttcacc agccaggact ggccattcct gtattcgttg 900

ttccaagtca actccaacta cgtcctcaac ggcttctctg gtgctcgcct ctccaacacc 960

ttccccaaca ttgttggcct ccccggctcc accacaactc atgctctgct tgctgccaga 1020

gtgaactact ccggcggcat ctcgagcggc gacattggtg catcgccgtt caaccagaac 1080

ttcaactgct ccaccttcct gccgccgctg ctcaccccgt tcgtgaggtc ctggctcgac 1140

agcggctccg accgcgaggg cgtggccacc gtcaccaact ggcaaaccga gtccttcgag 1200

accacccttg gcctccggag cggcgccttc acggcgcgtg gaaattctaa ctacttcccc 1260

gactacttca tcaggaacat ctctggtgtt cctctcgtcg tccgcaacga ggacctccgc 1320

cgtccactgc actacaacga gatcaggaac atcgcctctc cgtccgggac gcccggaggt 1380

gcaagggcgt acatggtgag cgtccataac aggaagaaca acatccacgc tgtgcatgag 1440

aacggctcca tgatccacct ggcgcccaat gattacaccg gcttcaccat ctctccaatc 1500

cacgccaccc aagtgaacaa ccagacacgc accttcatct ccgagaagtt cggcaaccag 1560

ggcgactccc tgaggttcga gcagaacaac accaccgcca ggtacaccct gcgcggcaac 1620

ggcaacagct acaacctgta cctgcgcgtc agctccattg gcaactccac catcagggtc 1680

accatcaacg ggagggtgta cacagccacc aatgtgaaca cgacgaccaa caatgatggc 1740

gtcaacgaca acggcgcccg cttcagcgac atcaacattg gcaacgtggt ggccagcagc 1800

aactccgacg tcccgctgga catcaacgtg accctgaact ctggcaccca gttcgacctc 1860

atgaacatca tgctggtgcc aactaacatc tcgccgctgt actga 1905

<210> 3

<211> 1178

<212> PRT

<213> Artificial Sequence-Cry 1Ac amino acid Sequence (Artificial Sequence)

<400> 3

Met Asp Asn Asn Pro Asn Ile Asn Glu Cys Ile Pro Tyr Asn Cys Leu

1 5 10 15

Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu Thr Gly

20 25 30

Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser

35 40 45

Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile Ile

50 55 60

Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile

65 70 75 80

Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala

85 90 95

Ile Ser Arg Leu Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr Ala Glu

100 105 110

Ser Phe Arg Glu Trp Glu Ala Asp Pro Thr Asn Pro Ala Leu Arg Glu

115 120 125

Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser Ala Leu Thr Thr Ala

130 135 140

Ile Pro Leu Phe Ala Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val

145 150 155 160

Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser

165 170 175

Val Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser Arg

180 185 190

Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp His Ala Val

195 200 205

Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg

210 215 220

Asp Trp Ile Arg Tyr Asn Gln Phe Arg Arg Glu Leu Thr Leu Thr Val

225 230 235 240

Leu Asp Ile Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr Pro

245 250 255

Ile Arg Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val

260 265 270

Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu

275 280 285

Gly Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile Thr

290 295 300

Ile Tyr Thr Asp Ala His Arg Gly Glu Tyr Tyr Trp Ser Gly His Gln

305 310 315 320

Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro

325 330 335

Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln Arg Ile Val Ala

340 345 350

Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu Ser Ser Thr Leu Tyr Arg

355 360 365

Arg Pro Phe Asn Ile Gly Ile Asn Asn Gln Gln Leu Ser Val Leu Asp

370 375 380

Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Leu Pro Ser Ala Val

385 390 395 400

Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln

405 410 415

Asn Asn Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser His

420 425 430

Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile

435 440 445

Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn

450 455 460

Ile Ile Ala Ser Asp Ser Ile Thr Gln Ile Pro Ala Val Lys Gly Asn

465 470 475 480

Phe Leu Phe Asn Gly Ser Val Ile Ser Gly Pro Gly Phe Thr Gly Gly

485 490 495

Asp Leu Val Arg Leu Asn Ser Ser Gly Asn Asn Ile Gln Asn Arg Gly

500 505 510

Tyr Ile Glu Val Pro Ile His Phe Pro Ser Thr Ser Thr Arg Tyr Arg

515 520 525

Val Arg Val Arg Tyr Ala Ser Val Thr Pro Ile His Leu Asn Val Asn

530 535 540

Trp Gly Asn Ser Ser Ile Phe Ser Asn Thr Val Pro Ala Thr Ala Thr

545 550 555 560

Ser Leu Asp Asn Leu Gln Ser Ser Asp Phe Gly Tyr Phe Glu Ser Ala

565 570 575

Asn Ala Phe Thr Ser Ser Leu Gly Asn Ile Val Gly Val Arg Asn Phe

580 585 590

Ser Gly Thr Ala Gly Val Ile Ile Asp Arg Phe Glu Phe Ile Pro Val

595 600 605

Thr Ala Thr Leu Glu Ala Glu Tyr Asn Leu Glu Arg Ala Gln Lys Ala

610 615 620

Val Asn Ala Leu Phe Thr Ser Thr Asn Gln Leu Gly Leu Lys Thr Asn

625 630 635 640

Val Thr Asp Tyr His Ile Asp Gln Val Ser Asn Leu Val Thr Tyr Leu

645 650 655

Ser Asp Glu Phe Cys Leu Asp Glu Lys Arg Glu Leu Ser Glu Lys Val

660 665 670

Lys His Ala Lys Arg Leu Ser Asp Glu Arg Asn Leu Leu Gln Asp Ser

675 680 685

Asn Phe Lys Asp Ile Asn Arg Gln Pro Glu Arg Gly Trp Gly Gly Ser

690 695 700

Thr Gly Ile Thr Ile Gln Gly Gly Asp Asp Val Phe Lys Glu Asn Tyr

705 710 715 720

Val Thr Leu Ser Gly Thr Phe Asp Glu Cys Tyr Pro Thr Tyr Leu Tyr

725 730 735

Gln Lys Ile Asp Glu Ser Lys Leu Lys Ala Phe Thr Arg Tyr Gln Leu

740 745 750

Arg Gly Tyr Ile Glu Asp Ser Gln Asp Leu Glu Ile Tyr Ser Ile Arg

755 760 765

Tyr Asn Ala Lys His Glu Thr Val Asn Val Pro Gly Thr Gly Ser Leu

770 775 780

Trp Pro Leu Ser Ala Gln Ser Pro Ile Gly Lys Cys Gly Glu Pro Asn

785 790 795 800

Arg Cys Ala Pro His Leu Glu Trp Asn Pro Asp Leu Asp Cys Ser Cys

805 810 815

Arg Asp Gly Glu Lys Cys Ala His His Ser His His Phe Ser Leu Asp

820 825 830

Ile Asp Val Gly Cys Thr Asp Leu Asn Glu Asp Leu Gly Val Trp Val

835 840 845

Ile Phe Lys Ile Lys Thr Gln Asp Gly His Ala Arg Leu Gly Asn Leu

850 855 860

Glu Phe Leu Glu Glu Lys Pro Leu Val Gly Glu Ala Leu Ala Arg Val

865 870 875 880

Lys Arg Ala Glu Lys Lys Trp Arg Asp Lys Arg Glu Lys Leu Glu Trp

885 890 895

Glu Thr Asn Ile Val Tyr Lys Glu Ala Lys Glu Ser Val Asp Ala Leu

900 905 910

Phe Val Asn Ser Gln Tyr Asp Gln Leu Gln Ala Asp Thr Asn Ile Ala

915 920 925

Met Ile His Ala Ala Asp Lys Arg Val His Ser Ile Arg Glu Ala Tyr

930 935 940

Leu Pro Glu Leu Ser Val Ile Pro Gly Val Asn Ala Ala Ile Phe Glu

945 950 955 960

Glu Leu Glu Gly Arg Ile Phe Thr Ala Phe Ser Leu Tyr Asp Ala Arg

965 970 975

Asn Val Ile Lys Asn Gly Asp Phe Asn Asn Gly Leu Ser Cys Trp Asn

980 985 990

Val Lys Gly His Val Asp Val Glu Glu Gln Asn Asn Gln Arg Ser Val

995 1000 1005

Leu Val Val Pro Glu Trp Glu Ala Glu Val Ser Gln Glu Val Arg Val

1010 1015 1020

Cys Pro Gly Arg Gly Tyr Ile Leu Arg Val Thr Ala Tyr Lys Glu Gly

1025 1030 1035 1040

Tyr Gly Glu Gly Cys Val Thr Ile His Glu Ile Glu Asn Asn Thr Asp

1045 1050 1055

Glu Leu Lys Phe Ser Asn Cys Val Glu Glu Glu Ile Tyr Pro Asn Asn

1060 1065 1070

Thr Val Thr Cys Asn Asp Tyr Thr Val Asn Gln Glu Glu Tyr Gly Gly

1075 1080 1085

Ala Tyr Thr Ser Arg Asn Arg Gly Tyr Asn Glu Ala Pro Ser Val Pro

1090 1095 1100

Ala Asp Tyr Ala Ser Val Tyr Glu Glu Lys Ser Tyr Thr Asp Gly Arg

1105 1110 1115 1120

Arg Glu Asn Pro Cys Glu Phe Asn Arg Gly Tyr Arg Asp Tyr Thr Pro

1125 1130 1135

Leu Pro Val Gly Tyr Val Thr Lys Glu Leu Glu Tyr Phe Pro Glu Thr

1140 1145 1150

Asp Lys Val Trp Ile Glu Ile Gly Glu Thr Glu Gly Thr Phe Ile Val

1155 1160 1165

Asp Ser Val Glu Leu Leu Leu Met Glu Glu

1170 1175

<210> 4

<211> 3537

<212> DNA

<213> Artificial Sequence-Cry 1Ac nucleotide Sequence (Artificial Sequence)

<400> 4

atggacaaca acccaaacat caacgaatgc attccataca actgcttgag taacccagaa 60

gttgaagtac ttggtggaga acgcattgaa accggttaca ctcccatcga catctccttg 120

tccttgacac agtttctgct cagcgagttc gtgccaggtg ctgggttcgt tctcggacta 180

gttgacatca tctggggtat ctttggtcca tctcaatggg atgcattcct ggtgcaaatt 240

gagcagttga tcaaccagag gatcgaagag ttcgccagga accaggccat ctctaggttg 300

gaaggattga gcaatctcta ccaaatctat gcagagagct tcagagagtg ggaagccgat 360

cctactaacc cagctctccg cgaggaaatg cgtattcaat tcaacgacat gaacagcgcc 420

ttgaccacag ctatcccatt gttcgcagtc cagaactacc aagttcctct cttgtccgtg 480

tacgttcaag cagctaatct tcacctcagc gtgcttcgag acgttagcgt gtttgggcaa 540

aggtggggat tcgatgctgc aaccatcaat agccgttaca acgaccttac taggctgatt 600

ggaaactaca ccgaccacgc tgttcgttgg tacaacactg gcttggagcg tgtctggggt 660

cctgattcta gagattggat tagatacaac cagttcagga gagaattgac cctcacagtt 720

ttggacattg tgtctctctt cccgaactat gactccagaa cctaccctat ccgtacagtg 780

tcccaactta ccagagaaat ctatactaac ccagttcttg agaacttcga cggtagcttc 840

cgtggttctg cccaaggtat cgaaggctcc atcaggagcc cacacttgat ggacatcttg 900

aacagcataa ctatctacac cgatgctcac agaggagagt attactggtc tggacaccag 960

atcatggcct ctccagttgg attcagcggg cccgagttta cctttcctct ctatggaact 1020

atgggaaacg ccgctccaca acaacgtatc gttgctcaac taggtcaggg tgtctacaga 1080

accttgtctt ccaccttgta cagaagaccc ttcaatatcg gtatcaacaa ccagcaactt 1140

tccgttcttg acggaacaga gttcgcctat ggaacctctt ctaacttgcc atccgctgtt 1200

tacagaaaga gcggaaccgt tgattccttg gacgaaatcc caccacagaa caacaatgtg 1260

ccacccaggc aaggattctc ccacaggttg agccacgtgt ccatgttccg ttccggattc 1320

agcaacagtt ccgtgagcat catcagagct cctatgttct cttggataca tcgtagtgct 1380

gagttcaaca acatcatcgc atccgatagt attactcaaa tccctgcagt gaagggaaac 1440

tttctcttca acggttctgt catttcagga ccaggattca ctggtggaga cctcgttaga 1500

ctcaacagca gtggaaataa cattcagaat agagggtata ttgaagttcc aattcacttc 1560

ccatccacat ctaccagata tagagttcgt gtgaggtatg cttctgtgac ccctattcac 1620

ctcaacgtta attggggtaa ttcatccatc ttctccaata cagttccagc tacagctacc 1680

tccttggata atctccaatc cagcgatttc ggttactttg aaagtgccaa tgcttttaca 1740

tcttcactcg gtaacatcgt gggtgttaga aactttagtg ggactgcagg agtgattatc 1800

gacagattcg agttcattcc agttactgca acactcgagg ctgagtacaa ccttgagaga 1860

gcccagaagg ctgtgaacgc cctctttacc tccaccaatc agcttggctt gaaaactaac 1920

gttactgact atcacattga ccaagtgtcc aacttggtca cctaccttag cgatgagttc 1980

tgcctcgacg agaagcgtga actctccgag aaagttaaac acgccaagcg tctcagcgac 2040

gagaggaatc tcttgcaaga ctccaacttc aaagacatca acaggcagcc agaacgtggt 2100

tggggtggaa gcaccgggat caccatccaa ggaggcgacg atgtgttcaa ggagaactac 2160

gtcaccctct ccggaacttt cgacgagtgc taccctacct acttgtacca gaagatcgat 2220

gagtccaaac tcaaagcctt caccaggtat caacttagag gctacatcga agacagccaa 2280

gaccttgaaa tctactcgat caggtacaat gccaagcacg agaccgtgaa tgtcccaggt 2340

actggttccc tctggccact ttctgcccaa tctcccattg ggaagtgtgg agagcctaac 2400

agatgcgctc cacaccttga gtggaatcct gacttggact gctcctgcag ggatggcgag 2460

aagtgtgccc accattctca tcacttctcc ttggacatcg atgtgggatg tactgacctg 2520

aatgaggacc tcggagtctg ggtcatcttc aagatcaaga cccaagacgg acacgcaaga 2580

cttggcaacc ttgagtttct cgaagagaaa ccattggtcg gtgaagctct cgctcgtgtg 2640

aagagagcag agaagaagtg gagggacaaa cgtgagaaac tcgaatggga aactaacatc 2700

gtttacaagg aggccaaaga gtccgtggat gctttgttcg tgaactccca atatgatcag 2760

ttgcaagccg acaccaacat cgccatgatc cacgccgcag acaaacgtgt gcacagcatt 2820

cgtgaggctt acttgcctga gttgtccgtg atccctggtg tgaacgctgc catcttcgag 2880

gaacttgagg gacgtatctt taccgcattc tccttgtacg atgccagaaa cgtcatcaag 2940

aacggtgact tcaacaatgg cctcagctgc tggaatgtga aaggtcatgt ggacgtggag 3000

gaacagaaca atcagcgttc cgtcctggtt gtgcctgagt gggaagctga agtgtcccaa 3060

gaggttagag tctgtccagg tagaggctac attctccgtg tgaccgctta caaggaggga 3120

tacggtgagg gttgcgtgac catccacgag atcgagaaca acaccgacga gcttaagttc 3180

tccaactgcg tcgaggaaga aatctatccc aacaacaccg ttacttgcaa cgactacact 3240

gtgaatcagg aagagtacgg aggtgcctac actagccgta acagaggtta caacgaagct 3300

ccttccgttc ctgctgacta tgcctccgtg tacgaggaga aatcctacac agatggcaga 3360

cgtgagaacc cttgcgagtt caacagaggt tacagggact acacaccact tccagttggc 3420

tatgttacca aggagcttga gtactttcct gagaccgaca aagtgtggat cgagatcggt 3480

gaaaccgagg gaaccttcat cgtggacagc gtggagcttc tcttgatgga ggaataa 3537

<210> 5

<211> 1177

<212> PRT

<213> Artificial Sequence-Cry1A.105 amino acid Sequence (Artificial Sequence)

<400> 5

Met Asp Asn Asn Pro Asn Ile Asn Glu Cys Ile Pro Tyr Asn Cys Leu

1 5 10 15

Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu Thr Gly

20 25 30

Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser

35 40 45

Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile Ile

50 55 60

Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile

65 70 75 80

Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala

85 90 95

Ile Ser Arg Leu Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr Ala Glu

100 105 110

Ser Phe Arg Glu Trp Glu Ala Asp Pro Thr Asn Pro Ala Leu Arg Glu

115 120 125

Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser Ala Leu Thr Thr Ala

130 135 140

Ile Pro Leu Phe Ala Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val

145 150 155 160

Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser

165 170 175

Val Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser Arg

180 185 190

Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp His Ala Val

195 200 205

Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg

210 215 220

Asp Trp Ile Arg Tyr Asn Gln Phe Arg Arg Glu Leu Thr Leu Thr Val

225 230 235 240

Leu Asp Ile Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr Pro

245 250 255

Ile Arg Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val

260 265 270

Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu

275 280 285

Gly Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile Thr

290 295 300

Ile Tyr Thr Asp Ala His Arg Gly Glu Tyr Tyr Trp Ser Gly His Gln

305 310 315 320

Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro

325 330 335

Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln Arg Ile Val Ala

340 345 350

Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu Ser Ser Thr Leu Tyr Arg

355 360 365

Arg Pro Phe Asn Ile Gly Ile Asn Asn Gln Gln Leu Ser Val Leu Asp

370 375 380

Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Leu Pro Ser Ala Val

385 390 395 400

Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln

405 410 415

Asn Asn Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser His

420 425 430

Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile

435 440 445

Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn

450 455 460

Ile Ile Ala Ser Asp Ser Ile Thr Gln Ile Pro Leu Val Lys Ala His

465 470 475 480

Thr Leu Gln Ser Gly Thr Thr Val Val Arg Gly Pro Gly Phe Thr Gly

485 490 495

Gly Asp Ile Leu Arg Arg Thr Ser Gly Gly Pro Phe Ala Tyr Thr Ile

500 505 510

Val Asn Ile Asn Gly Gln Leu Pro Gln Arg Tyr Arg Ala Arg Ile Arg

515 520 525

Tyr Ala Ser Thr Thr Asn Leu Arg Ile Tyr Val Thr Val Ala Gly Glu

530 535 540

Arg Ile Phe Ala Gly Gln Phe Asn Lys Thr Met Asp Thr Gly Asp Pro

545 550 555 560

Leu Thr Phe Gln Ser Phe Ser Tyr Ala Thr Ile Asn Thr Ala Phe Thr

565 570 575

Phe Pro Met Ser Gln Ser Ser Phe Thr Val Gly Ala Asp Thr Phe Ser

580 585 590

Ser Gly Asn Glu Val Tyr Ile Asp Arg Phe Glu Leu Ile Pro Val Thr

595 600 605

Ala Thr Leu Glu Ala Glu Tyr Asn Leu Glu Arg Ala Gln Lys Ala Val

610 615 620

Asn Ala Leu Phe Thr Ser Thr Asn Gln Leu Gly Leu Lys Thr Asn Val

625 630 635 640

Thr Asp Tyr His Ile Asp Gln Val Ser Asn Leu Val Thr Tyr Leu Ser

645 650 655

Asp Glu Phe Cys Leu Asp Glu Lys Arg Glu Leu Ser Glu Lys Val Lys

660 665 670

His Ala Lys Arg Leu Ser Asp Glu Arg Asn Leu Leu Gln Asp Ser Asn

675 680 685

Phe Lys Asp Ile Asn Arg Gln Pro Glu Arg Gly Trp Gly Gly Ser Thr

690 695 700

Gly Ile Thr Ile Gln Gly Gly Asp Asp Val Phe Lys Glu Asn Tyr Val

705 710 715 720

Thr Leu Ser Gly Thr Phe Asp Glu Cys Tyr Pro Thr Tyr Leu Tyr Gln

725 730 735

Lys Ile Asp Glu Ser Lys Leu Lys Ala Phe Thr Arg Tyr Gln Leu Arg

740 745 750

Gly Tyr Ile Glu Asp Ser Gln Asp Leu Glu Ile Tyr Ser Ile Arg Tyr

755 760 765

Asn Ala Lys His Glu Thr Val Asn Val Pro Gly Thr Gly Ser Leu Trp

770 775 780

Pro Leu Ser Ala Gln Ser Pro Ile Gly Lys Cys Gly Glu Pro Asn Arg

785 790 795 800

Cys Ala Pro His Leu Glu Trp Asn Pro Asp Leu Asp Cys Ser Cys Arg

805 810 815

Asp Gly Glu Lys Cys Ala His His Ser His His Phe Ser Leu Asp Ile

820 825 830

Asp Val Gly Cys Thr Asp Leu Asn Glu Asp Leu Gly Val Trp Val Ile

835 840 845

Phe Lys Ile Lys Thr Gln Asp Gly His Ala Arg Leu Gly Asn Leu Glu

850 855 860

Phe Leu Glu Glu Lys Pro Leu Val Gly Glu Ala Leu Ala Arg Val Lys

865 870 875 880

Arg Ala Glu Lys Lys Trp Arg Asp Lys Arg Glu Lys Leu Glu Trp Glu

885 890 895

Thr Asn Ile Val Tyr Lys Glu Ala Lys Glu Ser Val Asp Ala Leu Phe

900 905 910

Val Asn Ser Gln Tyr Asp Gln Leu Gln Ala Asp Thr Asn Ile Ala Met

915 920 925

Ile His Ala Ala Asp Lys Arg Val His Ser Ile Arg Glu Ala Tyr Leu

930 935 940

Pro Glu Leu Ser Val Ile Pro Gly Val Asn Ala Ala Ile Phe Glu Glu

945 950 955 960

Leu Glu Gly Arg Ile Phe Thr Ala Phe Ser Leu Tyr Asp Ala Arg Asn

965 970 975

Val Ile Lys Asn Gly Asp Phe Asn Asn Gly Leu Ser Cys Trp Asn Val

980 985 990

Lys Gly His Val Asp Val Glu Glu Gln Asn Asn Gln Arg Ser Val Leu

995 1000 1005

Val Val Pro Glu Trp Glu Ala Glu Val Ser Gln Glu Val Arg Val Cys

1010 1015 1020

Pro Gly Arg Gly Tyr Ile Leu Arg Val Thr Ala Tyr Lys Glu Gly Tyr

1025 1030 1035 1040

Gly Glu Gly Cys Val Thr Ile His Glu Ile Glu Asn Asn Thr Asp Glu

1045 1050 1055

Leu Lys Phe Ser Asn Cys Val Glu Glu Glu Ile Tyr Pro Asn Asn Thr

1060 1065 1070

Val Thr Cys Asn Asp Tyr Thr Val Asn Gln Glu Glu Tyr Gly Gly Ala

1075 1080 1085

Tyr Thr Ser Arg Asn Arg Gly Tyr Asn Glu Ala Pro Ser Val Pro Ala

1090 1095 1100

Asp Tyr Ala Ser Val Tyr Glu Glu Lys Ser Tyr Thr Asp Gly Arg Arg

1105 1110 1115 1120

Glu Asn Pro Cys Glu Phe Asn Arg Gly Tyr Arg Asp Tyr Thr Pro Leu

1125 1130 1135

Pro Val Gly Tyr Val Thr Lys Glu Leu Glu Tyr Phe Pro Glu Thr Asp

1140 1145 1150

Lys Val Trp Ile Glu Ile Gly Glu Thr Glu Gly Thr Phe Ile Val Asp

1155 1160 1165

Ser Val Glu Leu Leu Leu Met Glu Glu

1170 1175

<210> 6

<211> 3534

<212> DNA

<213> Artificial Sequence-Cry1A.105 nucleotide Sequence (Artificial Sequence)

<400> 6

atggacaaca acccaaacat caacgagtgc atcccgtaca actgcctcag caaccctgag 60

gtcgaggtgc tcggcggtga gcgcatcgag accggttaca cccccatcga catctccctc 120

tccctcacgc agttcctgct cagcgagttc gtgccaggcg ctggcttcgt cctgggcctc 180

gtggacatca tctggggcat ctttggcccc tcccagtggg acgccttcct ggtgcaaatc 240

gagcagctca tcaaccagag gatcgaggag ttcgccagga accaggccat cagccgcctg 300

gagggcctca gcaacctcta ccaaatctac gctgagagct tccgcgagtg ggaggccgac 360

cccactaacc cagctctccg cgaggagatg cgcatccagt tcaacgacat gaacagcgcc 420

ctgaccaccg ccatcccact cttcgccgtc cagaactacc aagtcccgct cctgtccgtg 480

tacgtccagg ccgccaacct gcacctcagc gtgctgaggg acgtcagcgt gtttggccag 540

aggtggggct tcgacgccgc caccatcaac agccgctaca acgacctcac caggctgatc 600

ggcaactaca ccgaccacgc tgtccgctgg tacaacactg gcctggagcg cgtctggggc 660

cctgattcta gagactggat tcgctacaac cagttcaggc gcgagctgac cctcaccgtc 720

ctggacattg tgtccctctt cccgaactac gactcccgca cctacccgat ccgcaccgtg 780

tcccaactga cccgcgaaat ctacaccaac cccgtcctgg agaacttcga cggtagcttc 840

aggggcagcg cccagggcat cgagggctcc atcaggagcc cacacctgat ggacatcctc 900

aacagcatca ctatctacac cgatgcccac cgcggcgagt actactggtc cggccaccag 960

atcatggcct ccccggtcgg cttcagcggc cccgagttta cctttcctct ctacggcacg 1020

atgggcaacg ccgctccaca acaacgcatc gtcgctcagc tgggccaggg cgtctaccgc 1080

accctgagct ccaccctgta ccgcaggccc ttcaacatcg gtatcaacaa ccagcagctg 1140

tccgtcctgg atggcactga gttcgcctac ggcacctcct ccaacctgcc ctccgctgtc 1200

taccgcaaga gcggcacggt ggattccctg gacgagatcc caccacagaa caacaatgtg 1260

ccccccaggc agggtttttc ccacaggctc agccacgtgt ccatgttccg ctccggcttc 1320

agcaactcgt ccgtgagcat catcagagct cctatgttct cttggataca ccgtagtgct 1380

gagttcaaca acatcattgc atccgacagc attactcaaa tacccttggt gaaagcacat 1440

acacttcagt caggtactac tgttgtcaga ggtccagggt ttacaggagg agacattctt 1500

cgtcgcacaa gtggaggacc ctttgcttac actattgtta acatcaatgg ccaattgccc 1560

caaaggtatc gtgcaagaat ccgctatgcc tctactacaa atctcaggat ctacgtgact 1620

gttgcaggtg aaaggatctt tgctggtcag ttcaacaaga ctatggatac cggtgaccct 1680

ttgacattcc aatcttttag ctacgcaact atcaacacag cttttacatt cccaatgagc 1740

cagagtagct tcacagtagg tgctgacact ttcagctcag ggaatgaagt ttacatcgac 1800

aggtttgaat tgattccagt tactgcaacc ctcgaggctg agtacaacct tgagagagcc 1860

cagaaggctg tgaacgccct ctttacctcc accaatcagc ttggcttgaa aactaacgtt 1920

actgactatc acattgacca agtgtccaac ttggtcacct accttagcga tgagttctgc 1980

ctcgacgaga agcgtgaact ctccgagaaa gttaaacacg ccaagcgtct cagcgacgag 2040

aggaatctct tgcaagactc caacttcaaa gacatcaaca ggcagccaga acgtggttgg 2100

ggtggaagca ccgggatcac catccaagga ggcgacgatg tgttcaagga gaactacgtc 2160

accctctccg gaactttcga cgagtgctac cctacctact tgtaccagaa gatcgatgag 2220

tccaaactca aagccttcac caggtatcaa cttagaggct acatcgaaga cagccaagac 2280

cttgaaatct actcgatcag gtacaatgcc aagcacgaga ccgtgaatgt cccaggtact 2340

ggttccctct ggccactttc tgcccaatct cccattggga agtgtggaga gcctaacaga 2400

tgcgctccac accttgagtg gaatcctgac ttggactgct cctgcaggga tggcgagaag 2460

tgtgcccacc attctcatca cttctccttg gacatcgatg tgggatgtac tgacctgaat 2520

gaggacctcg gagtctgggt catcttcaag atcaagaccc aagacggaca cgcaagactt 2580

ggcaaccttg agtttctcga agagaaacca ttggtcggtg aagctctcgc tcgtgtgaag 2640

agagcagaga agaagtggag ggacaaacgt gagaaactcg aatgggaaac taacatcgtt 2700

tacaaggagg ccaaagagtc cgtggatgct ttgttcgtga actcccaata tgatcagttg 2760

caagccgaca ccaacatcgc catgatccac gccgcagaca aacgtgtgca cagcattcgt 2820

gaggcttact tgcctgagtt gtccgtgatc cctggtgtga acgctgccat cttcgaggaa 2880

cttgagggac gtatctttac cgcattctcc ttgtacgatg ccagaaacgt catcaagaac 2940

ggtgacttca acaatggcct cagctgctgg aatgtgaaag gtcatgtgga cgtggaggaa 3000

cagaacaatc agcgttccgt cctggttgtg cctgagtggg aagctgaagt gtcccaagag 3060

gttagagtct gtccaggtag aggctacatt ctccgtgtga ccgcttacaa ggagggatac 3120

ggtgagggtt gcgtgaccat ccacgagatc gagaacaaca ccgacgagct taagttctcc 3180

aactgcgtcg aggaagaaat ctatcccaac aacaccgtta cttgcaacga ctacactgtg 3240

aatcaggaag agtacggagg tgcctacact agccgtaaca gaggttacaa cgaagctcct 3300

tccgttcctg ctgactatgc ctccgtgtac gaggagaaat cctacacaga tggcagacgt 3360

gagaaccctt gcgagttcaa cagaggttac agggactaca caccacttcc agttggctat 3420

gttaccaagg agcttgagta ctttcctgag accgacaaag tgtggatcga gatcggtgaa 3480

accgagggaa ccttcatcgt ggacagcgtg gagcttctct tgatggagga ataa 3534

<210> 7

<211> 789

<212> PRT

<213> Artificial Sequence-Vip 3A amino acid Sequence (Artificial Sequence)

<400> 7

Met Asn Lys Asn Asn Thr Lys Leu Ser Thr Arg Ala Leu Pro Ser Phe

1 5 10 15

Ile Asp Tyr Phe Asn Gly Ile Tyr Gly Phe Ala Thr Gly Ile Lys Asp

20 25 30

Ile Met Asn Met Ile Phe Lys Thr Asp Thr Gly Gly Asp Leu Thr Leu

35 40 45

Asp Glu Ile Leu Lys Asn Gln Gln Leu Leu Asn Asp Ile Ser Gly Lys

50 55 60

Leu Asp Gly Val Asn Gly Ser Leu Asn Asp Leu Ile Ala Gln Gly Asn

65 70 75 80

Leu Asn Thr Glu Leu Ser Lys Glu Ile Leu Lys Ile Ala Asn Glu Gln

85 90 95

Asn Gln Val Leu Asn Asp Val Asn Asn Lys Leu Asp Ala Ile Asn Thr

100 105 110

Met Leu Arg Val Tyr Leu Pro Lys Ile Thr Ser Met Leu Ser Asp Val

115 120 125

Met Lys Gln Asn Tyr Ala Leu Ser Leu Gln Ile Glu Tyr Leu Ser Lys

130 135 140

Gln Leu Gln Glu Ile Ser Asp Lys Leu Asp Ile Ile Asn Val Asn Val

145 150 155 160

Leu Ile Asn Ser Thr Leu Thr Glu Ile Thr Pro Ala Tyr Gln Arg Ile

165 170 175

Lys Tyr Val Asn Glu Lys Phe Glu Glu Leu Thr Phe Ala Thr Glu Thr

180 185 190

Ser Ser Lys Val Lys Lys Asp Gly Ser Pro Ala Asp Ile Leu Asp Glu

195 200 205

Leu Thr Glu Leu Thr Glu Leu Ala Lys Ser Val Thr Lys Asn Asp Val

210 215 220

Asp Gly Phe Glu Phe Tyr Leu Asn Thr Phe His Asp Val Met Val Gly

225 230 235 240

Asn Asn Leu Phe Gly Arg Ser Ala Leu Lys Thr Ala Ser Glu Leu Ile

245 250 255

Thr Lys Glu Asn Val Lys Thr Ser Gly Ser Glu Val Gly Asn Val Tyr

260 265 270

Asn Phe Leu Ile Val Leu Thr Ala Leu Gln Ala Gln Ala Phe Leu Thr

275 280 285

Leu Thr Thr Cys Arg Lys Leu Leu Gly Leu Ala Asp Ile Asp Tyr Thr

290 295 300

Ser Ile Met Asn Glu His Leu Asn Lys Glu Lys Glu Glu Phe Arg Val

305 310 315 320

Asn Ile Leu Pro Thr Leu Ser Asn Thr Phe Ser Asn Pro Asn Tyr Ala

325 330 335

Lys Val Lys Gly Ser Asp Glu Asp Ala Lys Met Ile Val Glu Ala Lys

340 345 350

Pro Gly His Ala Leu Ile Gly Phe Glu Ile Ser Asn Asp Ser Ile Thr

355 360 365

Val Leu Lys Val Tyr Glu Ala Lys Leu Lys Gln Asn Tyr Gln Val Asp

370 375 380

Lys Asp Ser Leu Ser Glu Val Ile Tyr Gly Asp Met Asp Lys Leu Leu

385 390 395 400

Cys Pro Asp Gln Ser Glu Gln Ile Tyr Tyr Thr Asn Asn Ile Val Phe

405 410 415

Pro Asn Glu Tyr Val Ile Thr Lys Ile Asp Phe Thr Lys Lys Met Lys

420 425 430

Thr Leu Arg Tyr Glu Val Thr Ala Asn Phe Tyr Asp Ser Ser Thr Gly

435 440 445

Glu Ile Asp Leu Asn Lys Lys Lys Val Glu Ser Ser Glu Ala Glu Tyr

450 455 460

Arg Thr Leu Ser Ala Asn Asp Asp Gly Val Tyr Met Pro Leu Gly Val

465 470 475 480

Ile Ser Glu Thr Phe Leu Thr Pro Ile Asn Gly Phe Gly Leu Gln Ala

485 490 495

Asp Glu Asn Ser Arg Leu Ile Thr Leu Thr Cys Lys Ser Tyr Leu Arg

500 505 510

Glu Leu Leu Leu Ala Thr Asp Leu Ser Asn Lys Glu Thr Lys Leu Ile

515 520 525

Val Pro Pro Ser Gly Phe Ile Ser Asn Ile Val Glu Asn Gly Ser Ile

530 535 540

Glu Glu Asp Asn Leu Glu Pro Trp Lys Ala Asn Asn Lys Asn Ala Tyr

545 550 555 560

Val Asp His Thr Gly Gly Val Asn Gly Thr Lys Ala Leu Tyr Val His

565 570 575

Lys Asp Gly Gly Ile Ser Gln Phe Ile Gly Asp Lys Leu Lys Pro Lys

580 585 590

Thr Glu Tyr Val Ile Gln Tyr Thr Val Lys Gly Lys Pro Ser Ile His

595 600 605

Leu Lys Asp Glu Asn Thr Gly Tyr Ile His Tyr Glu Asp Thr Asn Asn

610 615 620

Asn Leu Glu Asp Tyr Gln Thr Ile Asn Lys Arg Phe Thr Thr Gly Thr

625 630 635 640

Asp Leu Lys Gly Val Tyr Leu Ile Leu Lys Ser Gln Asn Gly Asp Glu

645 650 655

Ala Trp Gly Asp Asn Phe Ile Ile Leu Glu Ile Ser Pro Ser Glu Lys

660 665 670

Leu Leu Ser Pro Glu Leu Ile Asn Thr Asn Asn Trp Thr Ser Thr Gly

675 680 685

Ser Thr Asn Ile Ser Gly Asn Thr Leu Thr Leu Tyr Gln Gly Gly Arg

690 695 700

Gly Ile Leu Lys Gln Asn Leu Gln Leu Asp Ser Phe Ser Thr Tyr Arg

705 710 715 720

Val Tyr Phe Ser Val Ser Gly Asp Ala Asn Val Arg Ile Arg Asn Ser

725 730 735

Arg Glu Val Leu Phe Glu Lys Arg Tyr Met Ser Gly Ala Lys Asp Val

740 745 750

Ser Glu Met Phe Thr Thr Lys Phe Glu Lys Asp Asn Phe Tyr Ile Glu

755 760 765

Leu Ser Gln Gly Asn Asn Leu Tyr Gly Gly Pro Ile Val His Phe Tyr

770 775 780

Asp Val Ser Ile Lys

785

<210> 8

<211> 2370

<212> DNA

<213> Artificial Sequence-Vip 3A nucleotide Sequence (Artificial Sequence)

<400> 8

atgaacaaga acaacaccaa gctctccaca cgggcacttc cctcctttat tgactacttt 60

aatggcatct atgggtttgc tacggggatc aaggacatta tgaacatgat cttcaagaca 120

gacactggcg gggatcttac gctcgacgag attcttaaga atcagcaact cctgaacgat 180

atctctggca agctggacgg cgtgaatggg tcacttaacg acctcatcgc tcaggggaat 240

ctcaacacag aactgtctaa ggagatcctc aagattgcaa atgagcagaa ccaagttctt 300

aatgatgtga acaataagct cgacgccatc aacacaatgc ttcgcgtgta cctcccaaag 360

attactagca tgctctcgga cgtcatgaag cagaactacg cgctgtccct tcaaattgag 420

tatctgagca agcagcttca agaaatctcg gacaagctgg atatcattaa tgtgaacgtc 480

ctcatcaaca gcaccctgac ggagattaca ccggcgtacc agaggatcaa gtatgtgaat 540

gagaagttcg aggaactcac ttttgctaca gaaacttcca gcaaggtcaa gaaggatggc 600

tcaccagccg acatcctgga tgagcttaca gaactcactg agctggcgaa gtccgtgacc 660

aagaatgacg tcgatggctt cgagttttac ctgaacacgt tccacgacgt tatggtgggc 720

aacaatcttt ttgggcggag cgctctcaag actgcatcgg aactgatcac caaggagaac 780

gttaagacga gcggctcgga ggtcgggaat gtttacaact tccttatcgt cctcaccgca 840

ctccaggccc aagcgtttct cacgctgacc acctgccgca agctcctcgg cctcgcagac 900

atcgattaca cctccatcat gaacgagcac ctgaacaagg agaaggagga gttccgcgtg 960

aatatccttc cgacactctc gaacactttt tctaatccaa actacgctaa ggtcaagggc 1020

tccgacgaag atgcaaagat gatcgttgag gccaagcctg gccatgcgct catcgggttc 1080

gagatttcta acgactcaat taccgtgctg aaggtctacg aggcgaagct caagcagaat 1140

tatcaagtgg acaaggattc tctgtcagag gttatctacg gcgacatgga taagctgctt 1200

tgccctgatc agtccgagca aatctactat acgaacaata ttgtcttccc caacgaatac 1260

gtgatcacca agattgactt tacgaagaag atgaagacac tccggtacga ggtgacggct 1320

aacttctatg attcgtctac gggcgagatc gacctcaaca agaagaaggt cgaatcatcc 1380

gaggccgaat acagaaccct gtcggcgaac gacgatggcg tgtatatgcc tcttggggtc 1440

atttctgaga ccttcctcac gcccatcaat ggctttgggc tccaggcaga tgagaactcc 1500

cgcctgatca cccttacgtg caagagctac ctcagggagc tgctgcttgc caccgacctc 1560

tctaacaagg aaacgaagct gatcgttccg ccatcaggct tcatctccaa tattgtggag 1620

aacgggtcaa ttgaggaaga taatctggaa ccgtggaagg ctaacaataa gaacgcatac 1680

gttgaccaca caggcggggt gaatggcact aaggcgctct atgtgcataa ggatggtggc 1740

atctcccagt tcattggcga caagctgaag ccgaagacag aatacgtgat tcaatatact 1800

gtgaagggca agccaagcat ccacctcaag gatgagaaca cagggtacat ccattacgaa 1860

gatactaaca acaacctgga ggactaccag acaatcaata agaggttcac aactggcact 1920

gacctgaagg gggtctatct tattctcaag tcccagaatg gcgatgaggc ctggggcgac 1980

aacttcatca ttctcgaaat ctcccctagc gagaagctcc tgagccccga gctgattaac 2040

accaataact ggacatccac tggcagcacg aatatctcgg ggaacaccct gacgctttac 2100

cagggcggga gaggcattct gaagcagaac ctccaactgg attcgttctc tacctacaga 2160

gtctattttt cagtttccgg cgacgcgaat gtgcgcatca ggaactcgcg ggaagtcctc 2220

ttcgagaaga gatacatgtc tggcgctaag gatgtgtcag aaatgttcac cacgaagttt 2280

gagaaggaca acttttatat cgaactgtcc caagggaata acctctacgg cggccccatt 2340

gttcattttt acgacgtgag catcaagtga 2370

<210> 9

<211> 1322

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 9

gtcgacctgc aggtcaacgg atcaggatat tcttgtttaa gatgttgaac tctatggagg 60

tttgtatgaa ctgatgatct aggaccggat aagttccctt cttcatagcg aacttattca 120

aagaatgttt tgtgtatcat tcttgttaca ttgttattaa tgaaaaaata ttattggtca 180

ttggactgaa cacgagtgtt aaatatggac caggccccaa ataagatcca ttgatatatg 240

aattaaataa caagaataaa tcgagtcacc aaaccacttg ccttttttaa cgagacttgt 300

tcaccaactt gatacaaaag tcattatcct atgcaaatca ataatcatac aaaaatatcc 360

aataacacta aaaaattaaa agaaatggat aatttcacaa tatgttatac gataaagaag 420

ttacttttcc aagaaattca ctgattttat aagcccactt gcattagata aatggcaaaa 480

aaaaacaaaa aggaaaagaa ataaagcacg aagaattcta gaaaatacga aatacgcttc 540

aatgcagtgg gacccacggt tcaattattg ccaattttca gctccaccgt atatttaaaa 600

aataaaacga taatgctaaa aaaatataaa tcgtaacgat cgttaaatct caacggctgg 660

atcttatgac gaccgttaga aattgtggtt gtcgacgagt cagtaataaa cggcgtcaaa 720

gtggttgcag ccggcacaca cgagtcgtgt ttatcaactc aaagcacaaa tacttttcct 780

caacctaaaa ataaggcaat tagccaaaaa caactttgcg tgtaaacaac gctcaataca 840

cgtgtcattt tattattagc tattgcttca ccgccttagc tttctcgtga cctagtcgtc 900

ctcgtctttt cttcttcttc ttctataaaa caatacccaa agcttcttct tcacaattca 960

gatttcaatt tctcaaaatc ttaaaaactt tctctcaatt ctctctaccg tgatcaaggt 1020

aaatttctgt gttccttatt ctctcaaaat cttcgatttt gttttcgttc gatcccaatt 1080

tcgtatatgt tctttggttt agattctgtt aatcttagat cgaagacgat tttctgggtt 1140

tgatcgttag atatcatctt aattctcgat tagggtttca taaatatcat ccgatttgtt 1200

caaataattt gagttttgtc gaataattac tcttcgattt gtgatttcta tctagatctg 1260

gtgttagttt ctagtttgtg cgatcgaatt tgtcgattaa tctgagtttt tctgattaac 1320

ag 1322

<210> 10

<211> 530

<212> DNA

<213> terminator (Agrobacterium tumefaciens)

<400> 10

ccatggagtc aaagattcaa atagaggacc taacagaact cgccgtaaag actggcgaac 60

agttcataca gagtctctta cgactcaatg acaagaagaa aatcttcgtc aacatggtgg 120

agcacgacac gcttgtctac tccaaaaata tcaaagatac agtctcagaa gaccaaaggg 180

caattgagac ttttcaacaa agggtaatat ccggaaacct cctcggattc cattgcccag 240

ctatctgtca ctttattgtg aagatagtgg aaaaggaagg tggctcctac aaatgccatc 300

attgcgataa aggaaaggcc atcgttgaag atgcctctgc cgacagtggt cccaaagatg 360

gacccccacc cacgaggagc atcgtggaaa aagaagacgt tccaaccacg tcttcaaagc 420

aagtggattg atgtgatatc tccactgacg taagggatga cgcacaatcc cactatcctt 480

cgcaagaccc ttcctctata taaggaagtt catttcattt ggagaggaca 530

<210> 11

<211> 529

<212> DNA

<213> promoter (Cauliflower mosaic virus)

<400> 11

gtcctctcca aatgaaatga acttccttat atagaggaag ggtcttgcga aggatagtgg 60

gattgtgcgt catcccttac gtcagtggag atatcacatc aatccacttg ctttgaagac 120

gtggttggaa cgtcttcttt ttccacgatg ctcctcgtgg gtgggggtcc atctttggga 180

ccactgtcgg cagaggcatc ttcaacgatg gcctttcctt tatcgcaatg atggcatttg 240

taggagccac cttccttttc cactatcttc acaataaagt gacagatagc tgggcaatgg 300

aatccgagga ggtttccgga tattaccctt tgttgaaaag tctcaattgc cctttggtct 360

tctgagactg tatctttgat atttttggag tagacaagcg tgtcgtgctc caccatgttg 420

acgaagattt tcttcttgtc attgagtcgt aagagactct gtatgaactg ttcgccagtc 480

tttacggcga gttctgttag gtcctctatt tgaatctttg actccatgg 529

<210> 12

<211> 552

<212> DNA

<213> Streptomyces viridochromogenes

<400> 12

atgtctccgg agaggagacc agttgagatt aggccagcta cagcagctga tatggccgcg 60

gtttgtgata tcgttaacca ttacattgag acgtctacag tgaactttag gacagagcca 120

caaacaccac aagagtggat tgatgatcta gagaggttgc aagatagata cccttggttg 180

gttgctgagg ttgagggtgt tgtggctggt attgcttacg ctgggccctg gaaggctagg 240

aacgcttacg attggacagt tgagagtact gtttacgtgt cacataggca tcaaaggttg 300

ggcctaggat ccacattgta cacacatttg cttaagtcta tggaggcgca aggttttaag 360

tctgtggttg ctgttatagg ccttccaaac gatccatctg ttaggttgca tgaggctttg 420

ggatacacag cccggggtac attgcgcgca gctggataca agcatggtgg atggcatgat 480

gttggttttt ggcaaaggga ttttgagttg ccagctcctc caaggccagt taggccagtt 540

acccagatct ga 552

<210> 13

<211> 195

<212> DNA

<213> terminator (Cauliflower mosaic virus)

<400> 13

ctgaaatcac cagtctctct ctacaaatct atctctctct ataataatgt gtgagtagtt 60

cccagataag ggaattaggg ttcttatagg gtttcgctca tgtgttgagc atataagaaa 120

cccttagtat gtatttgtat ttgtaaaata cttctatcaa taaaatttct aattcctaaa 180

accaaaatcc agtgg 195

<210> 14

<211> 1744

<212> DNA

<213> Arabidopsis promoter (Arabidopsis thaliana)

<400> 14

aattcaaatt tattatgtgt tttttttccg tggtcgagat tgtgtattat tctttagtta 60

ttacaagact tttagctaaa atttgaaaga atttacttta agaaaatctt aacatctgag 120

ataatttcag caatagatta tatttttcat tactctagca gtatttttgc agatcaatcg 180

caacatatat ggttgttaga aaaaatgcac tatatatata tatattattt tttcaattaa 240

aagtgcatga tatataatat atatatatat atatatgtgt gtgtgtatat ggtcaaagaa 300

attcttatac aaatatacac gaacacatat atttgacaaa atcaaagtat tacactaaac 360

aatgagttgg tgcatggcca aaacaaatat gtagattaaa aattccagcc tccaaaaaaa 420

aatccaagtg ttgtaaagca ttatatatat atagtagatc ccaaattttt gtacaattcc 480

acactgatcg aatttttaaa gttgaatatc tgacgtagga tttttttaat gtcttacctg 540

accatttact aataacattc atacgttttc atttgaaata tcctctataa ttatattgaa 600

tttggcacat aataagaaac ctaattggtg atttatttta ctagtaaatt tctggtgatg 660

ggctttctac tagaaagctc tcggaaaatc ttggaccaaa tccatattcc atgacttcga 720

ttgttaaccc tattagtttt cacaaacata ctatcaatat cattgcaacg gaaaaggtac 780

aagtaaaaca ttcaatccga tagggaagtg atgtaggagg ttgggaagac aggcccagaa 840

agagatttat ctgacttgtt ttgtgtatag ttttcaatgt tcataaagga agatggagac 900

ttgagaagtt ttttttggac tttgtttagc tttgttgggc gttttttttt ttgatcaata 960

actttgttgg gcttatgatt tgtaatattt tcgtggactc tttagtttat ttagacgtgc 1020

taactttgtt gggcttatga cttgttgtaa catattgtaa cagatgactt gatgtgcgac 1080

taatctttac acattaaaca tagttctgtt ttttgaaagt tcttattttc atttttattt 1140

gaatgttata tatttttcta tatttataat tctagtaaaa ggcaaatttt gcttttaaat 1200

gaaaaaaata tatattccac agtttcacct aatcttatgc atttagcagt acaaattcaa 1260

aaatttccca tttttattca tgaatcatac cattatatat taactaaatc caaggtaaaa 1320

aaaaggtatg aaagctctat agtaagtaaa atataaattc cccataagga aagggccaag 1380

tccaccaggc aagtaaaatg agcaagcacc actccaccat cacacaattt cactcataga 1440

taacgataag attcatggaa ttatcttcca cgtggcatta ttccagcggt tcaagccgat 1500

aagggtctca acacctctcc ttaggccttt gtggccgtta ccaagtaaaa ttaacctcac 1560

acatatccac actcaaaatc caacggtgta gatcctagtc cacttgaatc tcatgtatcc 1620

tagaccctcc gatcactcca aagcttgttc tcattgttgt tatcattata tatagatgac 1680

caaagcacta gaccaaacct cagtcacaca aagagtaaag aagaacaatg gcttcctcta 1740

tgct 1744

<210> 15

<211> 1992

<212> DNA

<213> promoter (Zea mays)

<400> 15

ctgcagtgca gcgtgacccg gtcgtgcccc tctctagaga taatgagcat tgcatgtcta 60

agttataaaa aattaccaca tatttttttt gtcacacttg tttgaagtgc agtttatcta 120

tctttataca tatatttaaa ctttactcta cgaataatat aatctatagt actacaataa 180

tatcagtgtt ttagagaatc atataaatga acagttagac atggtctaaa ggacaattga 240

gtattttgac aacaggactc tacagtttta tctttttagt gtgcatgtgt tctccttttt 300

ttttgcaaat agcttcacct atataatact tcatccattt tattagtaca tccatttagg 360

gtttagggtt aatggttttt atagactaat ttttttagta catctatttt attctatttt 420

agcctctaaa ttaagaaaac taaaactcta ttttagtttt tttatttaat aatttagata 480

taaaatagaa taaaataaag tgactaaaaa ttaaacaaat accctttaag aaattaaaaa 540

aactaaggaa acatttttct tgtttcgagt agataatgcc agcctgttaa acgccgtcga 600

cgagtctaac ggacaccaac cagcgaacca gcagcgtcgc gtcgggccaa gcgaagcaga 660

cggcacggca tctctgtcgc tgcctctgga cccctctcga gagttccgct ccaccgttgg 720

acttgctccg ctgtcggcat ccagaaattg cgtggcggag cggcagacgt gagccggcac 780

ggcaggcggc ctcctcctcc tctcacggca cggcagctac gggggattcc tttcccaccg 840

ctccttcgct ttcccttcct cgcccgccgt aataaataga caccccctcc acaccctctt 900

tccccaacct cgtgttgttc ggagcgcaca cacacacaac cagatctccc ccaaatccac 960

ccgtcggcac ctccgcttca aggtacgccg ctcgtcctcc cccccccccc ctctctacct 1020

tctctagatc ggcgttccgg tccatggtta gggcccggta gttctacttc tgttcatgtt 1080

tgtgttagat ccgtgtttgt gttagatccg tgctgctagc gttcgtacac ggatgcgacc 1140

tgtacgtcag acacgttctg attgctaact tgccagtgtt tctctttggg gaatcctggg 1200

atggctctag ccgttccgca gacgggatcg atttcatgat tttttttgtt tcgttgcata 1260

gggtttggtt tgcccttttc ctttatttca atatatgccg tgcacttgtt tgtcgggtca 1320

tcttttcatg cttttttttg tcttggttgt gatgatgtgg tctggttggg cggtcgttct 1380

agatcggagt agaattctgt ttcaaactac ctggtggatt tattaatttt ggatctgtat 1440

gtgtgtgcca tacatattca tagttacgaa ttgaagatga tggatggaaa tatcgatcta 1500

ggataggtat acatgttgat gcgggtttta ctgatgcata tacagagatg ctttttgttc 1560

gcttggttgt gatgatgtgg tgtggttggg cggtcgttca ttcgttctag atcggagtag 1620

aatactgttt caaactacct ggtgtattta ttaattttgg aactgtatgt gtgtgtcata 1680

catcttcata gttacgagtt taagatggat ggaaatatcg atctaggata ggtatacatg 1740

ttgatgtggg ttttactgat gcatatacat gatggcatat gcagcatcta ttcatatgct 1800

ctaaccttga gtacctatct attataataa acaagtatgt tttataatta ttttgatctt 1860

gatatacttg gatgatggca tatgcagcag ctatatgtgg atttttttag ccctgccttc 1920

atacgctatt tatttgcttg gtactgtttc ttttgtcgat gctcaccctg ttgtttggtg 1980

ttacttctgc ag 1992

<210> 16

<211> 1176

<212> DNA

<213> Escherichia coli

<400> 16

atgcaaaaac tcattaactc agtgcaaaac tatgcctggg gcagcaaaac ggcgttgact 60

gaactttatg gtatggaaaa tccgtccagc cagccgatgg ccgagctgtg gatgggcgca 120

catccgaaaa gcagttcacg agtgcagaat gccgccggag atatcgtttc actgcgtgat 180

gtgattgaga gtgataaatc gactctgctc ggagaggccg ttgccaaacg ctttggcgaa 240

ctgcctttcc tgttcaaagt attatgcgca gcacagccac tctccattca ggttcatcca 300

aacaaacaca attctgaaat cggttttgcc aaagaaaatg ccgcaggtat cccgatggat 360

gccgccgagc gtaactataa agatcctaac cacaagccgg agctggtttt tgcgctgacg 420

cctttccttg cgatgaacgc gtttcgtgaa ttttccgaga ttgtctccct actccagccg 480

gtcgcaggtg cacatccggc gattgctcac tttttacaac agcctgatgc cgaacgttta 540

agcgaactgt tcgccagcct gttgaatatg cagggtgaag aaaaatcccg cgcgctggcg 600

attttaaaat cggccctcga tagccagcag ggtgaaccgt ggcaaacgat tcgtttaatt 660

tctgaatttt acccggaaga cagcggtctg ttctccccgc tattgctgaa tgtggtgaaa 720

ttgaaccctg gcgaagcgat gttcctgttc gctgaaacac cgcacgctta cctgcaaggc 780

gtggcgctgg aagtgatggc aaactccgat aacgtgctgc gtgcgggtct gacgcctaaa 840

tacattgata ttccggaact ggttgccaat gtgaaattcg aagccaaacc ggctaaccag 900

ttgttgaccc agccggtgaa acaaggtgca gaactggact tcccgattcc agtggatgat 960

tttgccttct cgctgcatga ccttagtgat aaagaaacca ccattagcca gcagagtgcc 1020

gccattttgt tctgcgtcga aggcgatgca acgttgtgga aaggttctca gcagttacag 1080

cttaaaccgg gtgaatcagc gtttattgcc gccaacgaat caccggtgac tgtcaaaggc 1140

cacggccgtt tagcgcgtgt ttacaacaag ctgtaa 1176

<210> 17

<211> 22

<212> DNA

<213> Artificial Sequence-primer 1(Artificial Sequence)

<400> 17

gagggtgttg tggctggtat tg 22

<210> 18

<211> 23

<212> DNA

<213> Artificial Sequence-primer 2(Artificial Sequence)

<400> 18

tctcaactgt ccaatcgtaa gcg 23

<210> 19

<211> 25

<212> DNA

<213> Artificial Sequence-Probe 1(Artificial Sequence)

<400> 19

cttacgctgg gccctggaag gctag 25

Claims

1. A method for controlling meadow moth pests is characterized by comprising the step of contacting the meadow moth pests with at least Cry2Ab protein, wherein the amino acid sequence of the Cry2Ab protein is the amino acid sequence shown as SEQ ID NO. 1.

2. The method of controlling a meadow moth pest of claim 1 wherein said Cry2Ab protein is present in a host cell that produces at least said Cry2Ab protein, said meadow moth pest being in contact with at least said Cry2Ab protein by feeding said host cell.

3. The method of controlling meadow moth pests according to claim 2 wherein the Cry2Ab protein is present in a bacterium or transgenic plant that produces at least the Cry2Ab protein, said meadow moth pests are contacted with at least the Cry2Ab protein by ingestion of tissue of said bacterium or transgenic plant, upon which contact said meadow moth pests are inhibited from growing and/or caused to die, to effect control of meadow moth pest damage to plants.

4. The method of controlling meadow moth pests according to claim 3, wherein the tissue of the transgenic plant is a root, leaf, stem, fruit, tassel, ear, anther or filament.

5. The method of controlling meadow moth pests according to claim 3 or 4, wherein the plants are soybean, chenopodium album, sugar beet, sunflower, potato, hemp and corn.

6. The method for controlling meadow moth pests according to any one of claims 1 to 4, characterized in that the nucleotide sequence of the Cry2Ab protein is the nucleotide sequence shown as SEQ ID NO. 2.

7. The method for controlling meadow moth pests according to claim 5, characterized in that the nucleotide sequence of the Cry2Ab protein is the nucleotide sequence shown as SEQ ID NO. 2.

8. The method of controlling meadow moth pests according to any one of claims 3 to 4, 7, wherein said plant further comprises at least a second nucleotide different from the nucleotide encoding said Cry2Ab protein.

9. The method of controlling meadow moth pests according to claim 8, wherein the second nucleotide encodes a Cry-class insecticidal protein, a Vip-class insecticidal protein, a protease inhibitor, a lectin, an alpha-amylase or a peroxidase.

10. The method of controlling a meadow moth pest of claim 9 wherein said second nucleotide encodes a Vip3A protein, a Cry1A protein or a Cry1F protein.

11. The method of controlling meadow moth pests of claim 10, wherein said second nucleotide encodes the amino acid sequence set forth in SEQ ID No. 3 or SEQ ID No. 5.

12. The method of controlling meadow moth pests of claim 11, wherein said second nucleotide is the nucleotide sequence set forth in SEQ ID No. 4 or SEQ ID No. 6.

13. The method of controlling a meadow moth pest according to claim 6 wherein said plant further comprises at least a second nucleotide different from the nucleotide encoding said Cry2Ab protein.

14. The method of controlling meadow moth pests according to claim 13, wherein the second nucleotide encodes a Cry-class insecticidal protein, a Vip-class insecticidal protein, a protease inhibitor, a lectin, an alpha-amylase or a peroxidase.

15. The method of controlling a meadow moth pest of claim 14 wherein said second nucleotide encodes a Vip3A protein, a Cry1A protein or a Cry1F protein.

16. The method of controlling meadow moth pests of claim 15, wherein said second nucleotide encodes the amino acid sequence set forth in SEQ ID No. 3 or SEQ ID No. 5.

17. The method of controlling meadow moth pests of claim 16, wherein said second nucleotide is the nucleotide sequence set forth in SEQ ID No. 4 or SEQ ID No. 6.

18. The method of controlling a meadow moth pest according to claim 5 wherein said plant further comprises at least a second nucleotide different from the nucleotide encoding said Cry2Ab protein.

19. The method of controlling meadow moth pests according to claim 18, wherein said second nucleotide encodes a Cry-class insecticidal protein, a Vip-class insecticidal protein, a protease inhibitor, a lectin, an alpha-amylase or a peroxidase.

20. The method of controlling a meadow moth pest of claim 19 wherein said second nucleotide encodes a Vip3A protein, a Cry1A protein or a Cry1F protein.

21. The method of controlling meadow moth pests of claim 20, wherein said second nucleotide encodes the amino acid sequence set forth in SEQ ID No. 3 or SEQ ID No. 5.

22. The method of controlling meadow moth pests of claim 21, wherein said second nucleotide is the nucleotide sequence set forth in SEQ ID No. 4 or SEQ ID No. 6.

23. The method of controlling meadow moth pests according to claim 8, wherein the second nucleotide is a dsRNA that inhibits a gene of interest in the target insect pest.

24. The application of the Cry2Ab protein in controlling meadow moth pests is disclosed, wherein the amino acid sequence of the Cry2Ab protein is shown as SEQ ID NO. 1.