CN109234307B

CN109234307B - Use of insecticidal proteins

Info

Publication number: CN109234307B
Application number: CN201811233434.0A
Authority: CN
Inventors: 韩超; 杨淑靖; 任振涛; 陶青
Original assignee: Beijing Dabeinong Biotechnology Co Ltd
Current assignee: Beijing Dabeinong Biotechnology Co Ltd
Priority date: 2018-10-23
Filing date: 2018-10-23
Publication date: 2022-04-15
Anticipated expiration: 2038-10-23
Also published as: CN109234307A

Abstract

The invention relates to an application of insecticidal protein, which comprises the following steps: the meadow borer is contacted with at least Cry1Fa protein. According to the invention, Cry1Fa protein capable of killing the meadow moth is generated in the plant body to control the meadow moth pests; compared with the agricultural control method, the chemical control method, the physical control method and the biological control method used in the prior art, the invention protects the whole plant in the whole growth period to control the invasion of the meadow moth pests, and has the advantages of no pollution, no residue, stable and thorough effect, simplicity, convenience and economy.

Description

Use of insecticidal proteins

Technical Field

The invention relates to application of an insecticidal protein, in particular to application of a Cry1Fa protein in controlling meadow moth-damaged plants through expression in the plants.

Background

The meadow moth Loxostege sticticalis belongs to the genus Chilo of the Lepidoptera Bombycidae family, and is mainly distributed in northeast, northwest and North China areas, namely Jilin, inner Mongolia, Heilongjiang, Ningxia, Gansu, Qinghai, Hebei, Shanxi, Shaanxi, Jiangsu and other provinces. The meadow moth is a big omnivorous pest, can eat over 200 plants of 35 families, and mainly comprises various crops such as beet, soybean, sunflower, potato, hemp, vegetables, medicinal materials and the like; in the case of large occurrence, cereal crops, trees and the like are all harmed by the plant growth promoter. The meadow moth outbreak generally occurs once in about 10 years, and is characterized in that: most of the larvae gather on the branch tips to form a net and hide, and the larvae eat mesophyll, leave epidermis and veins, and leave the veins or are eaten in serious cases, thus seriously affecting the yield.

Cultivated soybean (Glycine max (L.) Merri), an important commercial crop grown worldwide as a major source of vegetable oil and vegetable protein, is an important food crop in china. Soybean is one of the most favorite plants of the meadow moth, and the meadow moth can cause grain loss in different degrees every year, with the yield being reduced by 1-2 for light people and 3-4 for serious people. For controlling meadow moth, agricultural control, chemical control, physical control, and biological control are generally used as main methods.

The agricultural control is to comprehensively coordinate and manage multiple factors of the whole farmland ecosystem, regulate and control crop, pest and environmental factors and create a farmland ecological environment which is beneficial to crop growth and is not beneficial to emergence of the meadow moth. If the crop rotation is carried out on the seriously damaged field, the meadow moth loses the host; can be irrigated in autumn and winter for multiple times or in flowering period to kill larvae; in the place where the meadow moth overwinter is centralized, the method of turning over in autumn and ploughing in spring is adopted, and the overwinter larva is damaged by mechanical killing and soil block pressing, so that the death rate of the overwinter larva is increased; in a field with heavy grass waste, before larvae migrate as pests, an insect-preventing ditch can be dug, powder pesticide is sprayed in the ditch or a mulching film is erected in the middle of the ditch to prevent the larvae from migrating into the field and diffusing as pests; when the eggs are laid and most of the eggs are not hatched, weeding and killing the eggs by intertillage, and taking the removed weeds out of the field for composting or digging pits for burying; meanwhile, weeds on ridges beside the farmland are removed completely to prevent larvae from migrating into the farmland and damaging the farmland; in the field where the larvae are hatched, the pesticide is applied first and then the weeds are removed, so that the larvae are prevented from being transferred to crops quickly and the damage is increased.

The chemical control, namely the pesticide control, is to utilize chemical insecticide to kill pests, is an important component of the comprehensive control of the meadow moth, has the characteristics of rapidness, convenience, simplicity and high economic benefit, and is an essential emergency measure especially under the condition of large occurrence of the meadow moth. The existing chemical prevention and control method mainly adopts liquid medicine spraying, has better prevention and control effect during 1-3 instars of the larvae of the meadow moth, and can hardly achieve the purpose of prevention and control as the larger the larvae are, the stronger the drug resistance is and the poorer the prevention and control effect of the pesticide is. In fields with large concentrated damage of larvae in the instar period, when the pesticide control effect is poor, ditches can be dug around the fields or a pesticide spraying belt can be blocked to control diffusion damage. Meanwhile, chemical control also has limitations, such as pesticide damage to crops, drug resistance of pests, natural enemy killing and environmental pollution caused by improper use, damage to farmland ecosystems, threat to safety of pesticide residues to people and livestock and other adverse effects.

Physical control mainly utilizes various physical factors such as light, electricity, color, temperature and humidity and mechanical equipment for trapping, radiation sterilization and the like to control pests according to the reaction of the pests on various physical factors in environmental conditions. When the adult insects are sent out, the adult insects are trapped and killed by a net puff or light. The habit of migratory flight and phototaxis of the meadow moth is utilized, and a high-pressure mercury lamp, a frequency vibration type insecticidal lamp and the like are arranged to trap and kill the imagoes; however, the frequency vibration type insecticidal lamp needs to clean dirt on a high-voltage power grid every day in time, otherwise the insecticidal effect is influenced; the lamp can not be turned on in thunderstorm days, and the danger of hurting people by electric shock exists in operation; furthermore, the lamp is installed in a relatively large investment.

Biological control is to control the population quantity of pests by using some beneficial organisms or biological metabolites to achieve the purpose of reducing or eliminating the pests, such as trichogramma or beauveria bassiana to control the meadow moth. It is characterized by safety to human and livestock, little pollution to environment and long-term control of certain pests; but the effect is often unstable and the same investment is required to be made no matter the weight of the meadow moth is light.

In order to solve the limitation of agricultural control, chemical control, physical control and biological control in practical application, scientists find that some insect-resistant transgenic plants can be obtained to prevent and control plant pests by transferring insect-resistant genes for coding insecticidal proteins into plants through research.

The Cry1Fa insecticidal protein is one of a plurality of insecticidal proteins and is an insoluble parasporal crystal protein produced by Bacillus thuringiensis. The Cry1Fa protein is ingested by the insect into the midgut and the toxoprotein protoxin is solubilized in the alkaline pH environment of the insect midgut. The N-and C-termini of the protein are digested by alkaline protease to convert the protoxin to an active fragment; the active fragment is combined with a receptor on the upper surface of the insect midgut epithelial cell membrane and is inserted into the intestinal membrane, so that the cell membrane has perforation symptoms, osmotic pressure change, pH balance and the like inside and outside the cell membrane are damaged, the digestion process of the insect is disturbed, and the insect finally dies.

The transgenic Cry1Fa plant is proved to be capable of resisting the attack of Lepidoptera (Lepidoptera) pests such as black cutworms, however, no report on controlling the damage of the meadow moth to plants by generating transgenic plants expressing Cry1Fa protein exists so far.

Disclosure of Invention

The invention aims to provide the application of insecticidal protein, provides a method for controlling the damage of meadow moth to plants by generating transgenic plants expressing Cry1Fa protein for the first time, and effectively overcomes the technical defects of agricultural control, chemical control, physical control, biological control and the like in the prior art.

To achieve the above object, the present invention provides a method for controlling a meadow moth pest, comprising contacting the meadow moth pest with at least Cry1Fa protein.

Further, said Cry1Fa protein is present in a host cell that produces at least said Cry1Fa protein, and said meadow moth pest is contacted with at least said Cry1Fa protein by ingesting said host cell.

Still further, said Cry1Fa protein is present in a bacterium or transgenic plant that produces at least said Cry1Fa protein, said meadow moth pest is contacted with at least said Cry1Fa protein by ingestion of tissue of said bacterium or transgenic plant, upon contact said meadow moth pest growth is inhibited and/or caused to die, to achieve control of meadow moth pest damage to plants.

The tissue of the transgenic plant is root, leaf, stem, fruit, tassel, female ear, anther or filament.

The plant is soybean, herba Chenopodii Serotini, beet, sunflower, rhizoma Solani Tuber osi, hemp, and semen Maydis.

The transgenic plant may be at any stage of growth.

The control of the meadow moth hazard plants is not altered by changes in planting location and/or planting time.

The step preceding the contacting step is planting a plant comprising a polynucleotide encoding the Cry1Fa protein.

Preferably, the Cry1Fa protein has an amino acid sequence shown as SEQ ID NO. 1 or SEQ ID NO. 3.

More preferably, the Cry1Fa protein has a nucleotide sequence shown as SEQ ID NO. 2 or SEQ ID NO. 4.

On the basis of the above technical solution, said plant may also comprise at least one second nucleotide different from the nucleotide encoding said Cry1Fa protein.

Further, the second nucleotide encodes a Cry class insecticidal protein, a Vip class insecticidal protein, a protease inhibitor, a lectin, an alpha-amylase, or a peroxidase.

In the present invention, expression of a Cry1Fa protein in a transgenic plant can be accompanied by expression of one or more Cry-class insecticidal proteins and/or Vip-class insecticidal proteins. Co-expression of more than one insecticidal toxin in the same transgenic plant can be achieved by genetic engineering the plant to contain and express the desired genes. Alternatively, one plant (the 1 st parent) may be genetically engineered to express a Cry1Fa protein and a second plant (the 2 nd parent) may be genetically engineered to express a Cry-like insecticidal protein and/or a Vip-like insecticidal protein. Progeny plants expressing all the genes introduced into the 1 st and 2 nd parents are obtained by crossing the 1 st and 2 nd parents.

Preferably, the second nucleotide encodes a Vip3A protein or a Cry1A protein.

More preferably, the second nucleotide encodes an amino acid sequence having the amino acid sequence shown in SEQ ID NO. 5. The second nucleotide has a nucleotide sequence shown in SEQ ID NO. 6.

Alternatively, the second nucleotide is a dsRNA that inhibits an important gene in the target insect pest.

In order to achieve the purpose, the invention also provides application of the Cry1Fa protein in controlling meadow moth pests.

The invention also provides a method of producing a plant that controls a meadow moth pest comprising introducing into the genome of said plant a polynucleotide sequence encoding a Cry1Fa protein.

The invention also provides a method of producing a plant propagule for control of a meadow moth pest, comprising crossing a first plant obtained by the method with a second plant, and/or removing reproductive tissue from the plant obtained by the method for culture, thereby producing a plant propagule comprising a polynucleotide sequence encoding a Cry1Fa protein.

The present invention also provides a method of cultivating a plant for controlling a meadow moth pest, comprising:

planting at least one plant propagule comprising in its genome a polynucleotide sequence encoding a Cry1Fa protein;

growing the plant propagule into a plant;

growing said plants under conditions in which artificial inoculation by meadow moth pests and/or meadow moth pests naturally occur harm, harvesting plants having reduced plant damage and/or having increased plant yield as compared to other plants not having a polynucleotide sequence encoding a Cry1Fa protein.

"plant propagules" as used herein include, but are not limited to, vegetative propagules and vegetative propagules. The plant sexual propagules include, but are not limited to, plant seeds; the vegetative propagation body of the plant refers to a vegetative organ or a special tissue of the plant body, and can generate a new plant under the condition of in vitro; the vegetative organ or a specific tissue includes, but is not limited to, roots, stems and leaves, such as: plants with roots as vegetative propagules include strawberry, sweet potato, and the like; plants with stems as vegetative propagules include sugarcane and potato (tubers); the plant with leaves as asexual propagules includes aloe, begonia, etc.

The term "contact" as used herein means touching, staying and/or feeding, in particular, an insect and/or pest touching, staying and/or feeding, to a plant, plant organ, plant tissue or plant cell, which may be either a plant, plant organ, plant tissue or plant cell expressing an insecticidal protein in vivo, or a plant, plant organ, plant tissue or plant cell having an insecticidal protein on the surface and/or a microorganism producing an insecticidal protein.

The 'control' and/or 'control' of the invention means that the grassland borer is at least contacted with Cry1Fa protein, and the growth of the grassland borer is inhibited and/or the grassland borer dies after the contact. Further, the meadow moth pests are at least contacted with the Cry1Fa protein by feeding plant tissue, and after contact, all or part of the meadow moth pests are inhibited from growing and/or caused to die. Inhibition refers to sublethal, i.e., not yet lethal, but capable of causing some effect in growth, development, behavior, physiology, biochemistry and tissue, such as slow and/or stopped growth. At the same time, the plant should be morphologically normal and can be cultured under conventional methods for consumption and/or production of the product. Furthermore, plants and/or plant propagules for controlling meadow moth pests which contain a polynucleotide sequence encoding a Cry1Fa protein have reduced plant damage including, but not limited to, improved leaf resistance, and/or increased kernel weight, and/or yield increase, as compared to non-transgenic wild-type plants, under conditions in which artificial inoculation with meadow moth pests and/or meadow moth pests naturally occurs. The "controlling" and/or "controlling" effect of the Cry1Fa protein on meadow moth is that it can exist independently, in particular that any tissue of the transgenic plant (containing the polynucleotide sequence encoding the Cry1Fa protein) is present and/or produced simultaneously and/or asynchronously, the Cry1Fa protein and/or another substance that can control meadow moth pests, then the presence of said another substance neither affects the "controlling" and/or "controlling" effect of Cry1Fa on meadow moth, nor does it result in said "controlling" and/or "controlling" effect being achieved wholly and/or in part by said another substance, irrespective of the Cry1Fa protein. Generally, in the field, the process of feeding plant tissues by the meadow borers is short and difficult to observe by naked eyes, so that under the condition that the meadow borers and/or the meadow borers are naturally harmed, such as the meadow borers dead in any tissues of transgenic plants (containing a polynucleotide sequence for coding Cry1Fa protein), and/or the meadow borers with growth inhibition staying thereon, and/or the plant damage reduced compared with non-transgenic wild-type plants, is realized, namely, the method and/or the application of the invention are realized, namely, the method and/or the application of controlling the meadow borers by contacting the meadow borers with at least Cry1Fa protein are realized.

RNA interference (RNAi) refers to a highly conserved, double-stranded RNA (dsRNA) -induced, highly efficient and specific degradation of homologous mrnas during evolution. RNAi techniques can thus be used in the present invention to specifically knock out or turn off the expression of particular genes in target insect pests, particularly genes associated with the growth and development of the target insect pests.

The meadow moth imago is light brown, the body length is 8-10mm, the front wing is grey brown, the outer edge is provided with a light yellow stripe, the central near front edge of the wing is provided with a deep yellow spot, the front edge of the inner side of the vertex angle is provided with an unobvious triangular light yellow small spot, the back wing is light grey yellow, and the meadow moth is provided with two wavy stripes parallel to the outer edge. The ovum is elliptical, has a length of 0.8-1.2mm, and is 3, 5 or 7, 8 pieces of cluster-shaped ovum block adhered into complex tile shape. The larvae are 5 years old, the aged larvae are 16-25mm, the 1 st larvae are light green, and the body back has a plurality of dark brown lines; the 3 rd age is gray green, the body side has a light longitudinal band, and the whole body has burrs; the 5 th instar is mostly gray black, and bright yellow lines are arranged on two sides. Pupa length 14-20mm, back each node has 14 tawny small points, arranged on both sides, 8 thorns.

The meadow moth is distributed in northern areas of China, 2-4 generations occur in one year, adults are weak in flying ability and like to eat nectar, eggs are scattered on two sides of a leaf back main vein and are usually 3-4 grains together, and the number of the eggs is 2-8cm away from the ground. The newly hatched larvae mostly concentrate on the branch tips to form a net and hide, the larvae eat mesophyll, the food intake is increased sharply after 3 years, and the larvae are 5 years old. The meadow moth uses the aged larva to spin silk in soil to make it cocoon and overwinter. In the next spring, the overwintering larva begins pupating along with the increase of sunshine and the rise of air temperature, and generally enters the eclosion full period from the lower month of 5 to the upper month of 6. After eclosion, the adult insects migrate from the overwintering place to the emergence place, propagate for 1-2 generations in the emergence place, migrate to the overwintering place again, spawn and propagate until the mature larvae enter the soil and overwinter.

In the classification system, lepidoptera is generally classified into suborder, superfamily, and family according to morphological characteristics such as the pulse order, linkage pattern, and the type of an antennary. The borer moth family is one of the most varied families in lepidoptera, more than 1 ten thousand families are found in the world, and thousands of families are recorded in China. Most of the borer moth insects are pests of crops, most of which are in the form of stem borers, such as chilo suppressalis and corn borers. Although the corn borers and the meadow moth belong to the lepidoptera borer family, the corn borers and the meadow borers have great difference on other morphological structures except the similarity on classification standards; as compared with the strawberry and the apple in the plant (belonging to Rosaceae of Rosales), the strawberry and apple all have the characteristics of flower amphipathy, radiation symmetry, 5 petals and the like, but the fruit and plant forms are very different. However, people are considered to be largely different in insect morphology because people are less exposed to insects, especially agricultural pests, and have less concern about differences in insect morphology. In fact, meadow moth has its unique characteristics, both in terms of larval and adult morphology.

The insects belonging to the same family of the borer moth have great difference in morphological characteristics and also have difference in feeding habits. For example, the corn borer, which is the family of the borer moth, is mainly harmful to the corn of the family of the Gramineae, and rarely harmful to other broad-leaf crops. While the meadow moth prefers to eat vegetables such as grey vegetables, sugar beet and soybeans, and is harmful to cereal crops, forest trees and the like in the case of large emergence. Differences in feeding habits also suggest that the enzymes and receptor proteins produced by the digestive system in vivo are different. Enzymes produced in the digestive tract are the key points for the Bt genes to act, and only enzymes or receptor proteins which can be combined with specific Bt genes can make certain Bt genes have insect-resistant effects on the pests. More and more studies have shown that insects from different families of the same order, and even from different species of the same family, exhibit different sensitivities to the same species of Bt proteins. For example, the Vip3Aa gene shows insect-resistant activity against Chilo suppresalis, a Chilo suppressalis, and Ostrinia furnacalis, both of the family Cyclinae, but the Vip3Aa gene has no insect-resistant effect against Plodia interpunctella, a Plumba internella, and Ostrinia nubilalis, both of the family Ostrinia. The pests belong to the lepidoptera family of snout moth, but the same Bt protein shows different resistance effects on the pests of the lepidoptera family of snout moth. In particular, European corn borer and Asian corn borer belong to Ostrinia (congeneric genus) of the family Bombycidae in classification even, but the responses to the same Bt protein are quite different, and more fully indicate that the interaction mode of the Bt protein with insect in-vivo enzymes and receptors is complex and unpredictable.

The genome of a plant, plant tissue or plant cell as defined in the present invention refers to any genetic material within a plant, plant tissue or plant cell and includes the nuclear and plastid and mitochondrial genomes.

The polynucleotides and/or nucleotides described in the present invention form a complete "gene" encoding a protein or polypeptide in a desired host cell. One of skill in the art will readily recognize that the polynucleotides and/or nucleotides of the present invention may be placed under the control of regulatory sequences in the host of interest.

As is well known to those skilled in the art, DNA typically exists in a double stranded form. In this arrangement, one strand is complementary to the other strand, and vice versa. Other complementary strands of DNA are produced as the DNA replicates in plants. Thus, the present invention includes the use of the polynucleotides and their complementary strands exemplified in the sequence listing. The "coding strand" as commonly used in the art refers to the strand to which the antisense strand is joined. To express a protein in vivo, one strand of DNA is typically transcribed into the complementary strand of an mRNA, which serves as a template for translation of the protein. mRNA is actually transcribed from the "antisense" strand of DNA. The "sense" or "coding" strand has a series of codons (a codon is three nucleotides, three of which at a time can yield a particular amino acid) that can be read as an Open Reading Frame (ORF) to form a protein or peptide of interest. The present invention also includes RNAs that are functional equivalent to the exemplified DNA.

The nucleic acid molecule or fragment thereof of the invention hybridizes with the Cry1Fa gene of the invention under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of the Cry1Fa gene of the invention. Nucleic acid molecules or fragments thereof are capable of specifically hybridizing to other nucleic acid molecules under certain circumstances. In the present invention, two nucleic acid molecules can be said to be capable of specifically hybridizing to each other if they can form an antiparallel double-stranded nucleic acid structure. Two nucleic acid molecules are said to be "complements" of one another if they exhibit complete complementarity. In the present invention, two nucleic acid molecules are said to exhibit "perfect complementarity" when each nucleotide of the two nucleic acid molecules is complementary to the corresponding nucleotide of the other nucleic acid molecule. Two nucleic acid molecules are said to be "minimally complementary" if they are capable of hybridizing to each other with sufficient stability to allow them to anneal and bind to each other under at least conventional "low stringency" conditions. Similarly, two nucleic acid molecules are said to have "complementarity" if they are capable of hybridizing to each other with sufficient stability to allow them to anneal and bind to each other under conventional "highly stringent" conditions. Deviations from perfect complementarity may be tolerated as long as such deviations do not completely prevent the formation of a double-stranded structure by the two molecules. In order to allow a nucleic acid molecule to act as a primer or probe, it is only necessary to ensure sufficient complementarity in sequence to allow the formation of a stable double-stranded structure in the particular solvent and salt concentrations employed.

In the present invention, a substantially homologous sequence is a nucleic acid molecule that specifically hybridizes under highly stringent conditions to the complementary strand of a compatible nucleic acid molecule. Suitable stringency conditions for promoting DNA hybridization include, for example, treatment with 6.0 XSSC/sodium citrate (SSC) at about 45 ℃ followed by a wash with 2.0 XSSC at 50 ℃, as is well known to those skilled in the art. For example, the salt concentration in the washing step can be selected from the group consisting of about 2.0 XSSC for low stringency conditions, 50 ℃ to about 0.2 XSSC for high stringency conditions, 50 ℃. In addition, the temperature conditions in the washing step can be raised from about 22 ℃ at room temperature for low stringency conditions to about 65 ℃ for high stringency conditions. Both the temperature conditions and the salt concentration may be varied, or one may be held constant while the other is varied. Preferably, the stringent conditions of the present invention may be specifically hybridized with SEQ ID NO:2, SEQ ID NO:4 and SEQ ID NO:6 in a 6 XSSC, 0.5% SDS solution at 65 ℃ and then washed 1 time each with 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS.

Thus, sequences having anti-insect activity and hybridizing under stringent conditions to SEQ ID NO 2, SEQ ID NO 4 and SEQ ID NO 6 of the present invention are included in the present invention. These sequences are at least about 40% -50% homologous, about 60%, 65%, or 70% homologous, and even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence homology to the sequences of the present invention.

The genes and proteins described in the present invention include not only the specific exemplified sequences, but also portions and/or fragments (including internal and/or terminal deletions compared to the full-length protein), variants, mutants, substitutions (proteins with substituted amino acids), chimeras and fusion proteins that preserve the pesticidal activity characteristics of the specific exemplified proteins. The "variant" or "variation" refers to a nucleotide sequence that encodes the same protein or encodes an equivalent protein with pesticidal activity. The "equivalent protein" refers to a protein having the same or substantially the same biological activity against a meadow moth pest as the protein of claim.

"fragment" or "truncation" of a DNA molecule or protein sequence as described herein refers to a portion of the original DNA or protein sequence (nucleotide or amino acid) or an artificially modified form thereof (e.g., a sequence suitable for plant expression) that may vary in length but is long enough to ensure that the (encoded) protein is an insect toxin.

Modification of genes and easy construction of gene variants can be achieved using standard techniques. For example, techniques for making point mutations are well known in the art. Another example is U.S. patent No. 5605793, which describes methods for generating other molecular diversity using DNA reassembly after random fragmentation. Fragments of the full-length gene can be made using commercial endonucleases, and exonucleases can be used following standard procedures. For example, nucleotides can be systematically excised from the ends of these genes using enzymes such as Bal31 or site-directed mutagenesis. A variety of restriction enzymes can also be used to obtain a gene encoding an active fragment. Active fragments of these toxins can be obtained directly using proteases.

The invention can derive equivalent proteins and/or genes encoding the equivalent proteins from Bt isolates and/or DNA libraries. There are various methods for obtaining the pesticidal proteins of the present invention. For example, antibodies to the pesticidal proteins disclosed and claimed herein can be used to identify and isolate other proteins from a mixture of proteins. In particular, antibodies may be caused by the most constant and different protein portions of the protein than other Bt proteins. These antibodies can then be used to specifically identify the equivalent proteins with characteristic activities by immunoprecipitation, enzyme-linked immunosorbent assay (ELISA) or western blot methods. Antibodies to the proteins disclosed in the present invention or equivalent proteins or fragments of such proteins can be readily prepared using standard procedures in the art. The genes encoding these proteins can then be obtained from the microorganism.

Due to the redundancy of the genetic code, a plurality of different DNA sequences may encode the same amino acid sequence. It is well within the skill of the art to generate such alternative DNA sequences encoding the same or substantially the same protein. These different DNA sequences are included in the scope of the present invention. The "substantially identical" sequence refers to a sequence having amino acid substitutions, deletions, additions or insertions which do not substantially affect pesticidal activity, and also includes fragments which retain pesticidal activity.

The substitution, deletion or addition of the amino acid sequence in the present invention is a conventional technique in the art, and it is preferable that such amino acid change is: small changes in properties, i.e., conservative amino acid substitutions that do not significantly affect the folding and/or activity of the protein; small deletions, typically of about 1-30 amino acids; a small amino-or carboxy-terminal extension, e.g., one methionine residue to the amino terminus; small linker peptides, for example, about 20-25 residues in length.

Examples of conservative substitutions are those that occur within the following amino acid groups: basic amino acids (e.g., arginine, lysine, and histidine), acidic amino acids (e.g., glutamic acid and aspartic acid), polar amino acids (e.g., glutamine, asparagine), hydrophobic amino acids (e.g., leucine, isoleucine, and valine), aromatic amino acids (e.g., phenylalanine, tryptophan, and tyrosine), and small molecule amino acids (e.g., glycine, alanine, serine, threonine, and methionine). Those amino acid substitutions which do not normally alter a particular activity are well known in the art and have been described, for example, by N.Neurath and R.L.Hill in Protein, 1979, New York academic Press. The most common exchanges are Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, and vice versa.

It will be apparent to those skilled in the art that such substitutions may occur outside the region which plays an important role in the function of the molecule and still result in an active polypeptide. For polypeptides of the invention whose activity is essential and therefore the choice of unsubstituted amino acid residues can be identified according to methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (see, e.g., Cunningham and Wells, 1989, Science 244: 1081-1085). The latter technique involves introducing mutations at each positively charged residue in the molecule and testing the resulting mutant molecules for anti-insect activity to determine amino acid residues important for the activity of the molecule. The substrate-enzyme interaction site can also be determined by analysis of its three-dimensional structure as determined by techniques such as nuclear magnetic resonance analysis, crystallography, or photoaffinity labeling (see, e.g., deVos et al, 1992, Science 255: 306-.

In the present invention, there is a certain homology with the amino acid sequence shown in SEQ ID NO. 1, SEQ ID NO. 3 or SEQ ID NO. 5. These sequences typically have a similarity/identity of greater than 78%, preferably greater than 85%, more preferably greater than 90%, even more preferably greater than 95%, and may be greater than 99% to the sequences of the present invention. Preferred polynucleotides and proteins of the invention may also be defined according to more specific identity and/or similarity ranges. For example 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity and/or similarity to a sequence exemplified herein.

In the present invention, transgenic plants producing said Cry1Fa protein include, but are not limited to, DAS81419(9582.814.19.1) transgenic soybean event and/or plant material comprising DAS81419(9582.814.19.1) transgenic soybean event (as described in CN103826444A, CN103826445A and/or CN 103827132B), 9582.816.15.1 transgenic soybean event and/or plant material comprising 9582.816.15.1 transgenic soybean event (as described in CN104583404A and/or CN 104718293A), TC1507 transgenic corn event and/or plant material comprising TC1507 transgenic corn event (as described in US7288643B 2), DP-004114-3 transgenic corn event and/or plant material comprising DP-004114-3 transgenic corn event (as described in CN102892284B, CN104411828A and/or CN 106047918A), which may all achieve the methods and/or uses of the present invention, namely, the method and/or the use for controlling the pests of the meadow moth by contacting the meadow moth pests with at least Cry1Fa protein. It will be appreciated by those skilled in the art that the methods and/or uses of the present invention can also be achieved by expressing the Cry1Fa protein in the transgenic event described above in a different plant. More specifically, the Cry1Fa protein is present in a transgenic plant producing at least the Cry1Fa protein, the meadow moth pests are contacted with at least the Cry1Fa protein by feeding tissues of the transgenic plant, and the growth of the meadow moth pests is inhibited and/or caused to die after the contact, so as to realize the control on the meadow moth harmful plants.

The regulatory sequences of the present invention include, but are not limited to, promoters, transit peptides, terminators, enhancers, leader sequences, introns, and other regulatory sequences operably linked to the Cry1Fa protein.

The promoter is a promoter capable of being expressed in a plant, and the promoter capable of being expressed in the plant is a promoter which ensures that a coding sequence connected with the promoter is expressed in a plant cell. The promoter expressible in plants may be a constitutive promoter. Examples of promoters that direct constitutive expression in plants include, but are not limited to, 35S promoter derived from cauliflower mosaic virus, Arabidopsis Ubi10 promoter, maize Ubi promoter, promoter of rice GOS2 gene, and the like. Alternatively, the plant expressible promoter may be a tissue specific promoter, i.e. a promoter that directs expression of the coding sequence at a higher level in some tissues of the plant, e.g. in green tissues, than in other tissues of the plant (as can be determined by conventional RNA assays), e.g. the PEP carboxylase promoter. Alternatively, the promoter expressible in a plant may be a wound-inducible promoter. A wound-inducible promoter or a promoter that directs a wound-induced expression pattern means that when a plant is subjected to mechanical or insect feeding induced wounds, the expression of the coding sequence under the control of the promoter is significantly increased compared to under normal growth conditions. Examples of wound-inducible promoters include, but are not limited to, promoters of potato and tomato protease-inhibitory genes (pin I and pin II) and maize protease-inhibitory gene (MPI).

The transit peptide (also known as a secretion signal sequence or targeting sequence) is intended to direct the transgene product to a specific organelle or cellular compartment, and for the receptor protein, the transit peptide may be heterologous, e.g., targeting the chloroplast using a chloroplast transit peptide sequence, or targeting the endoplasmic reticulum using a 'KDEL' retention sequence, or targeting the vacuole using the CTPP of the barley lectin gene.

The leader sequence includes, but is not limited to, a small RNA virus leader sequence, such as an EMCV leader sequence (encephalomyocarditis virus 5' non-coding region); potyvirus leaders, such as the MDMV (maize dwarf mosaic virus) leader; human immunoglobulin heavy chain binding protein (BiP); untranslated leader sequences of envelope protein mRNA of alfalfa mosaic virus (AMV RNA 4); tobacco Mosaic Virus (TMV) leader sequence.

Such enhancers include, but are not limited to, cauliflower mosaic virus (CaMV) enhancer, Figwort Mosaic Virus (FMV) enhancer, carnation weathering Circovirus (CERV) enhancer, cassava vein mosaic virus (CsVMV) enhancer, Mirabilis Mosaic Virus (MMV) enhancer, midnight fragrant tree yellowing leaf curl virus (CmYLCV) enhancer, multan cotton leaf curl virus (CLCuMV), dayflower yellow mottle virus (CoYMV), and peanut chlorosis streak mosaic virus (PCLSV) enhancer.

For monocot applications, the intron includes, but is not limited to, the maize hsp70 intron, the maize ubiquitin intron, Adh intron 1, the sucrose synthase intron, or the rice Act1 intron. For dicot applications, the introns include, but are not limited to, the CAT-1 intron, the pKANNIBAL intron, the PIV2 intron, and the "superubiquitin" intron.

The terminator may be a suitable polyadenylation signal sequence that functions in plants, including, but not limited to, polyadenylation signal sequence derived from the Agrobacterium tumefaciens nopaline synthase (NOS) gene, polyadenylation signal sequence derived from the protease inhibitor II (PIN II) gene, polyadenylation signal sequence derived from the pea ssRUBISCO E9 gene, and polyadenylation signal sequence derived from the alpha-tubulin (alpha-tubulin) gene.

As used herein, "operably linked" refers to the linkage of nucleic acid sequences such that one provides the functionality required of the linked sequence. In the present invention, the "operative linkage" may be a linkage of a promoter to a sequence of interest such that transcription of the sequence of interest is controlled and regulated by the promoter. "operably linked" when the sequence of interest encodes a protein and expression of the protein is desired indicates that: the promoter is linked to the sequence in such a way that the resulting transcript is translated efficiently. If the linkage of the promoter to the coding sequence is a transcript fusion and expression of the encoded protein is desired, such a linkage is made such that the first translation initiation codon in the resulting transcript is the initiation codon of the coding sequence. Alternatively, if the linkage of the promoter to the coding sequence is a translational fusion and expression of the encoded protein is desired, the linkage is made such that the first translation initiation codon contained in the 5' untranslated sequence is linked to the promoter and is linked in such a way that the resulting translation product is in frame with the translational open reading frame encoding the desired protein. Nucleic acid sequences that may be "operably linked" include, but are not limited to: sequences that provide gene expression functions (i.e., gene expression elements such as promoters, 5 'untranslated regions, introns, protein coding regions, 3' untranslated regions, polyadenylation sites, and/or transcription terminators), sequences that provide DNA transfer and/or integration functions (i.e., T-DNA border sequences, site-specific recombinase recognition sites, integrase recognition sites), sequences that provide selective functions (i.e., antibiotic resistance markers, biosynthetic genes), sequences that provide scorable marker functions, sequences that facilitate sequence manipulation in vitro or in vivo (i.e., polylinker sequences, site-specific recombination sequences), and sequences that provide replication functions (i.e., bacterial origins of replication, autonomously replicating sequences, centromeric sequences).

"pesticidal" or "pest-resistant" as used herein means toxic to crop pests, thereby achieving "control" and/or "control" of the crop pests. Preferably, the term "pesticidal" or "pest-resistant" refers to killing of a crop pest. More specifically, the target insect is a meadow moth pest.

The Cry1Fa protein in the invention has toxicity to the grassland borer. The plants of the invention, in particular soybeans, contain in their genome exogenous DNA comprising a nucleotide sequence encoding a Cry1Fa protein with which the meadow moth pests are exposed by feeding plant tissue, upon which the growth of the meadow moth pests is inhibited and/or caused to die. Inhibition refers to lethal or sublethal. At the same time, the plant should be morphologically normal and can be cultured under conventional methods for consumption and/or production of the product. Furthermore, the plant may substantially eliminate the need for chemical or biological pesticides (which are pesticides against the meadow moth pest targeted by the Cry1Fa protein).

The expression level of Insecticidal Crystal Protein (ICP) in plant material can be detected by a variety of methods described in the art, for example by quantifying mRNA encoding an insecticidal protein produced in the tissue using specific primers, or by direct specific detection of the amount of insecticidal protein produced.

Different assays may be used to determine the pesticidal effect of ICP in plants. The target insects in the invention are mainly meadow moth.

In the invention, the Cry1Fa protein can have an amino acid sequence shown as SEQ ID NO. 1 or SEQ ID NO. 2. In addition to comprising the coding region for the Cry1Fa protein, other elements may also be included, such as a protein encoding a selectable marker.

Furthermore, an expression cassette comprising a nucleotide sequence encoding a Cry1Fa protein of the invention can also be expressed in plants together with at least one protein encoding a herbicide resistance gene, including, but not limited to, a glufosinate resistance gene (e.g., bar gene, pat gene), a benfop resistance gene (e.g., pmph gene), a glyphosate resistance gene (e.g., EPSPS gene), a bromoxynil (bromoxynil) resistance gene, a sulfonylurea resistance gene, a resistance gene to herbicide dalapon, a resistance gene to cyanamide, or a resistance gene to a glutamine synthetase inhibitor (e.g., PPT), thereby obtaining transgenic plants having both high pesticidal activity and herbicide resistance.

In the present invention, an exogenous DNA is introduced into a plant, such as a gene or an expression cassette or a recombinant vector encoding the Cry1Fa protein into a plant cell, and conventional transformation methods include, but are not limited to, Agrobacterium-mediated transformation, microprojectile bombardment, direct DNA uptake into protoplasts, electroporation, or whisker silicon-mediated DNA introduction.

The invention provides an application of insecticidal protein, which has the following advantages:

1. preventing and treating internal cause. The prior art mainly controls the harm of the meadow moth pests by external action, namely exogenous factors, such as agricultural control, chemical control, physical control and biological control; the invention controls the pests of the meadow moth by generating Cry1Fa protein capable of killing the meadow moth in plants, namely by internal causes.

2. No pollution and no residue. Chemical prevention and control methods used in the prior art play a certain role in controlling the harm of meadow moth pests, but also bring pollution, damage and residue to human, livestock and farmland ecosystems; the above-mentioned adverse effects can be eliminated using the method for controlling meadow moth pests of the present invention.

3. Preventing and treating in the whole growth period. The methods for controlling the meadow moth pests in the prior art are all staged, but the invention protects the plants in the whole growth period, and the transgenic plants (Cry1Fa protein) can be prevented from being damaged by the meadow moth from germination, growth, flowering and fruiting.

4. And (4) whole plant prevention and control. The methods used in the prior art for controlling meadow moth pests are mostly local, such as foliar spray; the invention protects the whole plant, such as roots, leaves, stems, fruits, tassels, female ears, anthers or filaments of a transgenic plant (Cry1Fa protein) and the like, which can resist the invasion of the meadow moth.

5. The effect is stable. In the prior art, both agricultural control methods and physical control methods need to utilize environmental conditions to control pests, and have more variable factors; the Cry1Fa protein is expressed in the plant body, the defect of unstable environmental conditions is effectively overcome, and the control effect of the transgenic plant (Cry1Fa protein) is stable and consistent in different places, different time and different genetic backgrounds.

6. Simple, convenient and economical. The frequency oscillation type insecticidal lamp used in the prior art has large one-time investment and is in danger of hurting people by electric shock when not operated properly; the invention only needs to plant the transgenic plant capable of expressing the Cry1Fa protein without adopting other measures, thereby saving a great deal of manpower, material resources and financial resources.

7. The effect is thorough. The method for controlling the meadow moth pests in the prior art has incomplete effect and only plays a role in lightening; the transgenic plant (Cry1Fa protein) of the invention can cause the death of the larvae of the meadow moth which are hatched in a large amount, greatly inhibits the development progress of a small part of the living larvae, and is only slightly damaged in general.

The technical solution of the present invention is further described in detail by the accompanying drawings and embodiments.

Drawings

FIG. 1 is a flow chart of construction of a recombinant cloning vector DBN01-T containing Cry1Fa-01 nucleotide sequence for use of the insecticidal protein of the invention;

FIG. 2 is a structural diagram of a soybean recombinant expression vector DBN100656 containing Cry1Ac-Cry1Fa-02 nucleotide sequences for use of the insecticidal protein of the invention;

FIG. 3 is a flow chart of the construction of a corn recombinant expression vector DBN100014 containing Cry1Fa-01 nucleotide sequence for the use of the insecticidal protein of the invention.

Detailed Description

The technical scheme of the application of the insecticidal protein of the invention is further illustrated by the specific examples.

First example, Gene acquisition and Synthesis

1. Obtaining nucleotide sequences

Cry1Fa-01 insecticidal protein amino acid sequence (605 amino acids) is shown as SEQ ID NO:1 in the sequence table; a Cry1Fa-01 nucleotide sequence (1818 nucleotides) which encodes an amino acid sequence corresponding to the Cry1Fa-01 insecticidal protein and is shown as SEQ ID NO. 2 in a sequence table; an amino acid sequence (1148 amino acids) of Cry1Fa-02 insecticidal protein is shown as SEQ ID NO. 3 in a sequence table; a Cry1Fa-02 nucleotide sequence (3447 nucleotides) which encodes an amino acid sequence corresponding to the Cry1Fa-02 insecticidal protein, and is shown as SEQ ID NO:4 in the sequence table.

The amino acid sequence (1156 amino acids) of the Cry1Ac insecticidal protein is shown as SEQ ID NO. 5 in the sequence table; a Cry1Ac nucleotide sequence (3471 nucleotides) which encodes the amino acid sequence of the Cry1Ac insecticidal protein, and is shown as SEQ ID NO:6 in the sequence table.

An amino acid sequence (789 amino acids) of Vip3A insecticidal protein, which is shown as SEQ ID NO:7 in a sequence table; a Vip3A nucleotide sequence (2370 nucleotides) which encodes the amino acid sequence of the Vip3A insecticidal protein, as shown in SEQ ID NO:8 of the sequence Listing.

2. Synthesis of the above nucleotide sequence

Synthesizing the Cry1Fa-01 nucleotide sequence (shown as SEQ ID NO:2 in the sequence table), the Cry1Fa-02 nucleotide sequence (shown as SEQ ID NO:4 in the sequence table), the Cry1Ac nucleotide sequence (shown as SEQ ID NO:6 in the sequence table) and the Vip3A nucleotide sequence (shown as SEQ ID NO:8 in the sequence table). The 5 'end of the synthesized Cry1Fa-01 nucleotide sequence (SEQ ID NO:2) is also connected with an Asc I enzyme cutting site, and the 3' end of the Cry1Fa-01 nucleotide sequence (SEQ ID NO:2) is also connected with a BamH I enzyme cutting site; the 5 'end of the synthesized Cry1Fa-02 nucleotide sequence (SEQ ID NO:4) is also connected with an Asc I enzyme cutting site, and the 3' end of the Cry1Fa-02 nucleotide sequence (SEQ ID NO:4) is also connected with a BamH I enzyme cutting site; the 5 'end of the synthesized Cry1Ac nucleotide sequence (SEQ ID NO:6) is also connected with a Sac I enzyme cutting site, and the 3' end of the Cry1Ac nucleotide sequence (SEQ ID NO:6) is also connected with a Kas I enzyme cutting site; the 5 'end of the synthesized Vip3A nucleotide sequence (SEQ ID NO:8) is also connected with an Asc I enzyme cutting site, and the 3' end of the Vip3A nucleotide sequence (SEQ ID NO:8) is also connected with a BamH I enzyme cutting site.

Second embodiment, construction of recombinant expression vector and Agrobacterium transformation with recombinant expression vector

1. Construction of recombinant cloning vector containing Cry1Fa Gene

The synthetic Cry1Fa-01 nucleotide sequence is connected to a cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600), the operation steps are carried out according to the pGEM-T vector instruction of Promega company, and a recombinant cloning vector DBN01-T is obtained, and the construction process is shown in figure 1 (wherein Amp represents ampicillin resistance gene, f1 represents replication origin of phage f1, LacZ is LacZ initiation codon, SP6 is SP6RNA polymerase promoter, T7 is T7RNA polymerase promoter, Cry1Fa-01 is Cry1Fa-01 nucleotide sequence (SEQ ID NO:2), and MCS is multiple cloning site).

The recombinant cloning vector DBN01-T was then used to transform E.coli T1 competent cells (Transgen, Beijing, China, CAT: CD501) by a heat shock method under the following heat shock conditions: 50 μ L of Escherichia coli T1 competent cells, 10 μ L of plasmid DNA (recombinant cloning vector DBN01-T), water bath at 42 ℃ for 30 s; the cells were cultured with shaking at 37 ℃ for 1h (shaking table at 100 rpm), and grown overnight on LB plates (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, pH adjusted to 7.5 with NaOH) coated with IPTG (isopropylthio-. beta. -D-galactoside) and X-gal (5-bromo-4-chloro-3-indol-. beta. -D-galactoside) ampicillin (100mg/L) on their surfaces. White colonies were picked and cultured overnight in LB liquid medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, ampicillin 100mg/L, pH 7.5 adjusted with NaOH) at 37 ℃. Extracting the plasmid by an alkaline method: centrifuging the bacterial solution at 12000rpm for 1min, removing supernatant, and suspending the precipitated bacterial solution with 100 μ L ice-precooled solution I (25mM Tris-HCl, 10mM EDTA (ethylene diamine tetraacetic acid), 50mM glucose, pH 8.0); add 200. mu.L of freshly prepared solution II (0.2M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the tube 4 times, mix, and place on ice for 3-5 min; adding 150 μ L ice-cold solution III (3M potassium acetate, 5M acetic acid), mixing well immediately, and standing on ice for 5-10 min; centrifuging at 4 deg.C and 12000rpm for 5min, adding 2 times volume of anhydrous ethanol into the supernatant, mixing, and standing at room temperature for 5 min; centrifuging at 4 deg.C and 12000rpm for 5min, removing supernatant, washing precipitate with 70% ethanol (V/V), and air drying; adding 30. mu.L of TE (10mM Tris-HCl, 1mM EDTA, pH8.0) containing RNase (20. mu.g/ml) to dissolve the precipitate; bathing in water at 37 deg.C for 30min to digest RNA; storing at-20 deg.C for use.

After the extracted plasmid is subjected to enzyme digestion identification by Asc I and BamH I, sequencing verification is carried out on positive clones, and the result shows that the Cry1Fa-01 nucleotide sequence inserted into the recombinant cloning vector DBN01-T is the nucleotide sequence shown by SEQ ID NO. 2 in the sequence table, namely the Cry1Fa-01 nucleotide sequence is correctly inserted.

According to the method for constructing the recombinant cloning vector DBN01-T, the synthesized Cry1Fa-02 nucleotide sequence is connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN02-T, wherein Cry1Fa-02 is Cry1Fa-02 nucleotide sequence (SEQ ID NO: 4). Enzyme cutting and sequencing verify that the Cry1Fa-02 nucleotide sequence in the recombinant cloning vector DBN02-T is correctly inserted.

According to the method for constructing the recombinant cloning vector DBN01-T, the synthesized Cry1Ac nucleotide sequence is connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN03-T, wherein Cry1Ac is Cry1Ac nucleotide sequence (SEQ ID NO: 6). Enzyme cutting and sequencing verify that the Cry1Ac nucleotide sequence in the recombinant cloning vector DBN03-T is correctly inserted.

According to the method for constructing the recombinant cloning vector DBN01-T, the synthesized Vip3A nucleotide sequence is connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN04-T, wherein Vip3A is the Vip3A nucleotide sequence (SEQ ID NO: 8). The Vip3A nucleotide sequence in the recombinant cloning vector DBN04-T is correctly inserted through enzyme digestion and sequencing verification.

2. Construction of recombinant expression vector of soybean containing Cry1Fa gene

Restriction enzymes Sac I and Kas I, Asc I and BamH I are used to respectively cut recombinant cloning vector DBN02-T, DBN03-T and expression vector DBNBC-01 (vector skeleton: pCAMBIA2301 (available from CAMBIA organization)), the cut Cry1Fa-02 nucleotide sequence and Cry1Ac nucleotide sequence are respectively inserted between Sac I and Kas I sites and between Asc I and BamH I sites of expression vector DBNBC-01, the construction of the vector by using the conventional cutting method is well known by those skilled in the art, and the vector structure is shown in FIG. 2 (Kan: kanamycin gene; RB right border; praUbi 10: Arabidopsis Ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:9), Cry1 Fa-02: Cry1Fa-02 nucleotide sequence (SEQ ID NO:4), terminator of nopaline synthase gene (SEQ ID: CstNov) promoter (SEQ ID NO:10), and cassava virus (VMID NO: 11: cassava virus NO: SEQ ID NO:10) ) (ii) a Cry1 Ac: cry1Ac nucleotide sequence (SEQ ID NO: 6); pr 35S: the cauliflower mosaic virus 35S promoter (SEQ ID NO: 12); PAT: phosphinothricin acetyltransferase gene (SEQ ID NO: 13); t 35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 14); LB: left border).

The recombinant expression vector DBN100656 was used to transform E.coli T1 competent cells by heat shock under the following conditions: 50 μ L of E.coli T1 competent cells, 10 μ L of plasmid DNA (recombinant expression vector DBN100656), water bath at 42 ℃ for 30 s; shaking at 37 deg.C for 1h (shaking table at 100 rpm); then, the cells were cultured for 12 hours at 37 ℃ on LB solid plates (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, pH adjusted to 7.5 with NaOH) containing 50mg/L Kanamycin (Kanamycin), white colonies were picked up, and the cells were cultured overnight at 37 ℃ in LB liquid medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, Kanamycin 50mg/L, pH adjusted to 7.5 with NaOH). The plasmid is extracted by an alkaline method. The extracted plasmid is cut by restriction enzymes Asc I and BamH I and then identified, and the positive clone is sequenced and identified, and the result shows that the nucleotide sequence of the recombinant expression vector DBN100656 between Asc I and BamH I sites is the nucleotide sequence shown by SEQ ID NO. 4 in the sequence table, namely Cry1Fa-02 nucleotide sequence.

According to the method for constructing the recombinant expression vector DBN100656, the Vip3A nucleotide sequence cut by Asc I and BamH I enzyme digestion recombinant cloning vector DBN04-T is inserted into the expression vector DBNBC-01 to obtain the recombinant expression vector DBN 100003. The nucleotide sequence in the recombinant expression vector DBN100003 is verified by enzyme digestion and sequencing to contain a nucleotide sequence shown as SEQ ID NO. 8 in the sequence table, namely a Vip3A nucleotide sequence. The Vip3A nucleotide sequence may be linked to the prAtUbi10 promoter and tNos terminator, respectively.

3. Construction of corn recombinant expression vector containing Cry1Fa gene

The recombinant cloning vector DBN01-T and the expression vector DBNBC-02 (vector backbone: pCAMBIA2301 (available from CAMBIA organization)) were digested with restriction enzymes Asc I and BamH I, respectively, and the excised Cry1Fa-01 nucleotide sequence fragment was inserted between Asc I and BamH I sites of the expression vector DBNBC-02, and the vector constructed by a conventional digestion method was well known to those skilled in the art to construct a recombinant expression vector DBN100014, whose construction flow is shown in FIG. 3 (Kan: kanamycin gene; RB: right border; prUbi: maize Ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:15), Cry1 Fa-01: 1Fa-01 nucleotide sequence (SEQ ID NO: 2); tNos: terminator of nopaline synthase gene (SEQ ID NO: 10); PMI phosphomannose isomerase gene (SEQ ID NO:16) LB: left border).

Transforming the recombinant expression vector DBN100014 into an Escherichia coli T1 competent cell by a heat shock method, wherein the heat shock condition is as follows: 50 μ L of Escherichia coli T1 competent cells, 10 μ L of plasmid DNA (recombinant expression vector DBN100014), water bath at 42 deg.C for 30 s; shaking at 37 deg.C for 1h (shaking table at 100 rpm); then, the cells were cultured for 12 hours at 37 ℃ on LB solid plates (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, pH adjusted to 7.5 with NaOH) containing 50mg/L Kanamycin (Kanamycin), white colonies were picked up, and the cells were cultured overnight at 37 ℃ in LB liquid medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, Kanamycin 50mg/L, pH adjusted to 7.5 with NaOH). The plasmid is extracted by an alkaline method. The extracted plasmid is cut by restriction enzymes Asc I and BamH I and then identified, and the positive clone is sequenced and identified, and the result shows that the nucleotide sequence of the recombinant expression vector DBN100014 between Asc I sites and BamH I sites is the nucleotide sequence shown by SEQ ID NO. 2 in the sequence table, namely Cry1Fa-01 nucleotide sequence.

According to the method for constructing the recombinant expression vector DBN100034, the Vip3A nucleotide sequence cut by the Asc I and BamH I enzyme digestion recombinant cloning vector DBN04-T is inserted into the expression vector DBNBC-02 to obtain the recombinant expression vector DBN 100004. The nucleotide sequence in the recombinant expression vector DBN100004 is verified by enzyme digestion and sequencing to contain a nucleotide sequence shown as SEQ ID NO. 8 in the sequence table, namely a Vip3A nucleotide sequence. The Vip3A nucleotide sequence may be linked to the Ubi promoter and Nos terminator, respectively.

4. Recombinant expression vector transformation agrobacterium tumefaciens

The correctly constructed soybean recombinant expression vectors DBN1006566 and DBN100003 and the corn recombinant expression vectors DBN100014 and DBN100004 were transformed into Agrobacterium LBA4404 (Invitron, Chicago, USA, CAT: 18313-one 015) by liquid nitrogen method under the following transformation conditions: 100. mu.L Agrobacterium LBA4404, 3. mu.L plasmid DNA (recombinant expression vector); placing in liquid nitrogen for 10min, and heating in 37 deg.C water bath for 10 min; inoculating transformed Agrobacterium LBA4404 in LB test tube, culturing at 28 deg.C and 200rpm for 2h, spreading on LB plate containing 50mg/L Rifampicin (Rifampicin) and 100mg/L kanamycin until positive single clone grows out, picking single clone, culturing and extracting plasmid, digesting soybean recombinant expression vectors DBN1006566 and DBN100003 and corn recombinant expression vectors DBN100014 and DBN100004 with restriction enzyme, and enzyme digestion verifying, the results show that the soybean recombinant expression vectors DBN1006566 and DBN100003 and the corn recombinant expression vectors DBN100014 and DBN100004 have completely correct structure.

Third example, obtaining transgenic plants

1. Obtaining transgenic soybean plants

Cotyledon node tissues of yellow 13 in the aseptically cultured soybean variety were co-cultured with the agrobacterium described in the second example 4 according to the conventionally employed agrobacterium infection method to transfer T-DNAs (including Cry1Fa-02 nucleotide sequence, Cry1Ac nucleotide sequence, Vip3A nucleotide sequence and PAT gene) of the soybean recombinant expression vectors DBN100656 and DBN100003 constructed in the second example 2 into the soybean genome, thereby obtaining a soybean plant transferred with a Cry1Ac-Cry1Fa-02 nucleotide sequence and a soybean plant transferred with a Vip3A nucleotide sequence, while taking a wild-type soybean plant as a control.

For Agrobacterium-mediated transformation of soybean, briefly, mature soybean seeds were germinated in soybean germination medium (B5 salt 3.1g/L, B5 vitamins, sucrose 20g/L, agar 8g/L, pH5.6), the seeds were inoculated on germination medium and cultured under the following conditions: the temperature is 25 +/-1 ℃; the photoperiod (light/dark) was 16/8 h. Taking the soybean aseptic seedling expanded at the fresh green cotyledonary node after germinating for 4-6 days, cutting off hypocotyl at 3-4mm position below the cotyledonary node, longitudinally cutting cotyledon, and removing terminal bud, side bud and seed root. Wounding at the cotyledonary node with the back of a scalpel, contacting the wounded cotyledonary node tissue with an Agrobacterium suspension, wherein the Agrobacterium is capable of delivering the Cry1Fa nucleotide sequence to the wounded cotyledonary node tissue (step 1: infection step) in this step, the cotyledonary node tissue is preferably immersed in an Agrobacterium suspension (OD)₆₆₀0.5-0.8, medium (MS salts 2.15g/L, B5 vitamins, sucrose 20g/L, glucose 10g/L, Acetosyringone (AS)40mg/L, 2-morpholinoethanesulfonic acid (MES)4g/L, Zeatin (ZT)2mg/L, pH5.3) was infected to initiate inoculation. The cotyledonary node tissues were co-cultured with Agrobacterium for a period of time (3 days) (step 2: co-culture step). Preferably, the cotyledonary node tissue is cultured on solid medium (MS salts 4.3g/L, B5 vitamins, sucrose 20g/L, glucose 10g/L, MES 4g/L, ZT 2mg/L, agar 8g/L, pH5.6) after the infection step. After this co-cultivation phase, there may be an optional "recovery" step. In the "recovery" step, the medium was recovered (B5 salt 3.1g/L, B5 vitamin, MES 1g/L, sucrose 30g/L, ZT 2mg/L, agar 8g/L, cephamycin 150mg/L, glutamic acid 100mg/L, aspartic acid 100 mg-L, ph5.6) in the presence of at least one antibiotic known to inhibit the growth of agrobacterium (cephamycin), without the addition of a selection agent for plant transformants (step 3: a recovery step). Preferably, the regenerated tissue mass of cotyledonary nodes is cultured on solid medium with antibiotics but without a selective agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Next, the regenerated tissue mass of cotyledonary node was cultured on a medium containing a selection agent (glufosinate) and the growing transformed callus was selected (step 4: selection step). Preferably, the regenerated tissue mass of cotyledonary node is cultured on selective solid medium (B5 salt 3.1g/L, B5 vitamins, MES 1g/L, sucrose 30g/L, 6-benzyladenine (6-BAP)1mg/L, agar 8g/L, cephamycin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, glufosinate 6mg/L, pH5.6) resulting in selective growth of transformed cells. Then, the transformed cells are regenerated into plants (step 5: regeneration step), and preferably, the cotyledonary node regenerated tissue pieces grown on a medium containing a selection agent are cultured on a solid medium (B5 differentiation medium and B5 rooting medium) to regenerate the plants.

The resistant tissue blocks obtained by screening are transferred to the B5 differentiation medium (B5 salt 3.1g/L, B5 vitamin, MES 1g/L, sucrose 30g/L, ZT 1mg/L, agar 8g/L, cefamycin 150mg/L, glutamic acid 50mg/L, aspartic acid 50mg/L, gibberellin 1mg/L, auxin 1mg/L, glufosinate 6mg/L, pH5.6), and cultured and differentiated at 25 ℃. The differentiated plantlets are transferred to the B5 rooting medium (B5 salt 3.1g/L, B5 vitamins, MES 1g/L, sucrose 30g/L, agar 8g/L, cephamycin 150mg/L and indole-3-butyric acid (IBA)1mg/L), cultured on the rooting medium at 25 ℃ to about 10cm high, and transferred to a greenhouse for culture until fructification occurs. In the greenhouse, the culture was carried out daily at 26 ℃ for 16h and at 20 ℃ for 8 h.

2. Obtaining transgenic maize plants

Co-culturing the immature embryos of the sterile-cultured corn variety heddle 31(Z31) with the agrobacterium of the second embodiment 4 according to a conventionally adopted agrobacterium infection method to transfer the T-DNAs (including Cry1Fa-01 nucleotide sequence, Vip3A nucleotide sequence and PMI gene) of the corn recombinant expression vectors DBN100014 and DBN100004 constructed in the second embodiment 3 into a corn chromosome group, so as to obtain a corn plant transferred with the Cry1Fa-01 nucleotide sequence and a corn plant transferred with the Vip3A nucleotide sequence; wild type maize plants were also used as controls.

For Agrobacterium-mediated transformation of maize, briefly, immature embryos are isolated from maize and the embryos are contacted with an Agrobacterium suspension, wherein the Agrobacterium is capable of delivering a Cry1Fa nucleotide sequence to at least one cell of one of the immature embryos (step 1: the infection step), in which step the embryos are preferably immersed in an Agrobacterium suspension (OD)₆₆₀0.4-0.6, medium (MS salts 4.3g/L, MS vitamins, casein 300mg/L, sucrose 68.5g/L, glucose 36g/L, AS 40mg/L, 2, 4-dichlorophenoxyacetic acid (2,4-D)1mg/L, ph5.3)) was infected to initiate inoculation. The young embryos are co-cultured with Agrobacterium for a period of time (3 days) (step 2: co-culture step). Preferably, the immature embryos are cultured on solid medium (MS salts 4.3g/L, MS vitamins, casein 300mg/L, sucrose 20g/L, glucose 10g/L, AS 100mg/L, 2, 4-D1 mg/L, agar 8g/L, pH5.8) after the infection step. After this co-cultivation phase, there may be an optional "recovery" step. In the "recovery" step, at least one antibiotic known to inhibit the growth of Agrobacterium (cefamycin) is present in the recovery medium (MS salts 4.3g/L, MS vitamins, casein 300mg/L, sucrose 30g/L, 2, 4-D1 mg/L, phytogel 3g/L, pH5.8) without the addition of a selection agent for plant transformants (step 3: recovery step). Preferably, the immature embryos are cultured on solid medium with antibiotics but without a selection agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Next, the inoculated immature embryos are cultured on a medium containing a selection agent (mannose) and the growing transformed calli are selected (step 4: selection step). Preferably, the immature embryos are cultured on selective solid medium with selective agent (MS salts 4.3g/L, MS vitamins, casein 300mg/L, sucrose 30g/L, mannose 12.5g/L, 2, 4-D1 mg/L, plant gel 3g/L, pH5.8) resulting in selective growth of the transformed cells. Then, the callus is regenerated into a plant (step 5: regeneration step), and preferably, the callus grown on the medium containing the selection agent is cultured on a solid medium (MS differentiation medium and MS rooting medium) to regenerate the plant.

The resistant callus obtained by screening was transferred to the MS differentiation medium (MS salts 4.3g/L, MS vitamins, casein 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, mannose 5g/L, plant gel 3g/L, pH5.8) and cultured and differentiated at 25 ℃. The differentiated plantlets are transferred to the MS rooting medium (MS salt is 2.15g/L, MS, vitamin, casein is 300mg/L, cane sugar is 30g/L, indole-3-acetic acid is 1mg/L, plant gel is 3g/L, pH is 5.8), cultured at 25 ℃ to be about 10cm high, and transferred to a greenhouse for culture until fructification. In the greenhouse, the culture was carried out daily at 28 ℃ for 16h and at 20 ℃ for 8 h.

Fourth example, validation of transgenic plants Using TaqMan

About 100mg of each leaf of a soybean Plant with transferred Cry1Ac-Cry1Fa-02 nucleotide sequence and a soybean Plant with transferred Vip3A nucleotide sequence are taken as samples, genomic DNA of the soybean Plant is extracted by using DNeasy Plant Maxi Kit of Qiagen, and the copy number of PAT gene is detected by a Taqman probe fluorescent quantitative PCR method to determine the copy number of Cry1Fa gene. Meanwhile, wild soybean plants are used as a control, and detection and analysis are carried out according to the method. The experiment was repeated 3 times and the average was taken.

The specific method for detecting the copy number of the PAT gene comprises the following steps:

step 11, respectively taking 100mg of leaves of a soybean plant with a transferred Cry1Ac-Cry1Fa-02 nucleotide sequence, a soybean plant with a transferred Vip3A nucleotide sequence and a wild soybean plant, respectively grinding the leaves into homogenate by liquid nitrogen in a mortar, and taking 3 samples for each time;

step 12, extracting the genomic DNA of the sample by using DNeasy Plant Mini Kit of Qiagen, and referring to the product specification of the specific method;

step 13, measuring the genomic DNA concentration of the sample by using NanoDrop 2000(Thermo Scientific);

step 14, adjusting the genomic DNA concentration of the sample to the same concentration value, wherein the concentration value range is 80-100 ng/mu L;

step 15, identifying the copy number of the sample by adopting a Taqman probe fluorescent quantitative PCR method, taking the sample with known copy number after identification as a standard substance, taking the sample of a wild soybean plant as a control, repeating each sample for 3 times, and taking the average value; the fluorescent quantitative PCR primer and the probe sequence are respectively as follows:

the following primers and probes were used to detect the PAT gene:

primer 1: gagggtgttgtggctggtattg is shown as SEQ ID NO:17 in the sequence list;

primer 2: tctcaactgtccaatcgtaagcg is shown as SEQ ID NO:18 in the sequence list;

1, probe 1: cttacgctgggccctggaaggctag is shown as SEQ ID NO:19 in the sequence list;

the PCR reaction system is as follows:

the 50 × primer/probe mixture contained 45 μ L of each primer at a concentration of 1mM, 50 μ L of probe at a concentration of 100 μ M and 860 μ L of 1 × TE buffer and was stored in amber tubes at 4 ℃.

The PCR reaction conditions are as follows:

data were analyzed using SDS2.3 software (Applied Biosystems).

The experimental result shows that Cry1Ac-Cry1Fa-02 nucleotide sequence and Vip3A nucleotide sequence are integrated into the chromosome group of the detected soybean plant, and the soybean plant transferred with Cry1Ac-Cry1Fa-02 nucleotide sequence and the soybean plant transferred with Vip3A nucleotide sequence both obtain single-copy transgenic soybean plants.

Detection analysis (PMI gene) was performed on transgenic maize plants according to the method described above for validation of transgenic soybean plants using TaqMan. The experimental result shows that Cry1Fa-01 nucleotide sequence and Vip3A nucleotide sequence are respectively integrated into the chromosome group of the detected corn plant, and the corn plant transferred with the Cry1Fa-01 nucleotide sequence and the corn plant transferred with the Vip3A nucleotide sequence obtain single-copy transgenic plants.

Fifth example, detection of insect-resistant Effect of transgenic Soybean plants

And (3) carrying out insect-resistant effect detection on the meadow moth by using the soybean plant with the transferred Cry1Ac-Cry1Fa-02 nucleotide sequence, the soybean plant with the transferred Vip3A nucleotide sequence, the wild type soybean plant and the soybean plant identified as non-transgenic by Taqman.

Respectively taking a soybean plant with a Cry1Ac-Cry1Fa-02 nucleotide sequence, a soybean plant with a Vip3A nucleotide sequence, a wild-type soybean plant and fresh leaves of the soybean plant identified as a non-transgenic plant (three-leaf stage) by Taqman, washing the fresh leaves with sterile water, sucking the water on the leaves with gauze, removing leaf veins of the soybean leaves, simultaneously cutting the soybean leaves into long strips with the length of about 2cm multiplied by 3.5cm, putting 1 cut long strip-shaped leaf on moisturizing filter paper at the bottom of a circular plastic culture dish, putting 10 sod borers (larvae which are hatched for the first time) in each culture dish, covering the culture dish, placing the culture dish for 3 days under the conditions of 25-28 ℃, 70-80% of relative humidity and 16:8 of light period, and then obtaining a total resistance score (300 points of the full score) according to three indexes of the developmental progress, the death rate and the damage rate of the sod borers): the total resistance score is 100 × mortality + [100 × mortality +90 × (number of first hatched insects/total number of inoculated insects) +60 × (number of first hatched-negative control insects/total number of inoculated insects) +10 × (number of negative control insects/total number of inoculated insects) ] +100 × (1-leaf damage rate). A total of 3 transformation event strains (S1, S2 and S3) transformed into Cry1Ac-Cry1Fa-02 nucleotide sequences, a total of 3 transformation event strains (S4, S5 and S6) transformed into Vip3A nucleotide sequences, 1 strain (NGM1) identified as non-transgenic by Taqman and 1 strain (CK1) in wild type; from each line, 3 plants were selected for testing, each replicated 1 time. The results are shown in Table 1.

TABLE 1 insect resistance test results of transgenic soybean plants inoculated with meadow moth

The results in table 1 show that: the soybean plant transferred with the Cry1Ac-Cry1Fa-02 nucleotide sequence has better insecticidal effect on the meadow moth, the average death rate of the meadow moth is basically 100%, and the total resistance score of the meadow moth is close to the full score of 300; although the soybean plant with the Vip3A nucleotide sequence has insecticidal activity to the meadow moth, the lethality rate is only below 20%, the soybean plant identified as non-transgenic by Taqman and the wild soybean plant have no lethal or inhibiting effect to the meadow moth, and the total resistance score is generally about 80.

Compared with wild soybean plants, the soybean plants transferred with the Cry1Ac-Cry1Fa-02 nucleotide sequence have almost one hundred percent of control effect on the larvae which are hatched initially by the meadow moth, the extremely individual survival larvae basically stop developing, the larvae are still basically in the initial hatching state after 3 days, the larvae are all obviously dysplastic and stop developing, and cannot survive in the natural environment of the field; and the soybean plants transferred with the Cry1Ac-Cry1Fa-02 nucleotide sequence are only slightly damaged, and the damage rate of leaves is about 1 percent; although the soybean plant with the Vip3A nucleotide sequence has insecticidal activity on the meadow moth, the control effect is not as obvious as that of Cry1Fa protein, most of larvae can survive, and the damage to leaves is obvious.

Thus, the soybean plants transferred with the Cry1Ac-Cry1Fa-02 nucleotide sequence show high activity against the meadow moth, and the activity is enough to generate adverse effect on the growth of the meadow moth so as to control the meadow moth in the field.

Sixth example, detection of insect-resistant Effect of transgenic maize plants

And (3) carrying out insect-resistant effect detection on the meadow moth by using the corn plant with the Cry1Fa-01 nucleotide sequence, the corn plant with the Vip3A nucleotide sequence, the wild corn plant and the corn plant identified as non-transgenic by Taqman.

Respectively taking fresh leaves (heart leaves) of a corn plant transferred with a Cry1Fa-01 nucleotide sequence, a corn plant transferred with a Vip3A nucleotide sequence, a wild corn plant and a corn plant identified as a non-transgenic corn plant by Taqman (in the V3-V4 period), washing the fresh leaves with sterile water, sucking the water on the leaves with gauze, then removing leaf veins of the corn leaves, simultaneously cutting the corn leaves into long strips with the length of about 1cm multiplied by 4cm, putting 1 cut long strip-shaped leaf into a piece of moisturizing filter paper at the bottom of a round plastic culture dish, putting 1 meadow moth (third instar larva) into each culture dish, then covering, placing for 3 days at 25-28 deg.C and relative humidity of 70% -80% under condition of photoperiod (light/dark) of 16:8, obtaining a total resistance score (300 points of full score) according to three indexes of the development progress, the mortality and the leaf damage rate of the meadow moth larvae: the total resistance score is 100 × mortality + [100 × mortality +90 × (number of first hatched insects/total number of inoculated insects) +60 × (number of first hatched-negative control insects/total number of inoculated insects) +10 × (number of negative control insects/total number of inoculated insects) ] +100 × (1-leaf damage rate). A total of 3 transformation event strains (S7, S8 and S9) transformed with Cry1Fa-01 nucleotide sequence, a total of 3 transformation event strains (S10, S11 and S12) transformed with Vip3A nucleotide sequence, 1 strain (NGM2) identified as non-transgenic by Taqman and 1 strain (CK2) in wild type; from each line, 3 plants were selected for testing, each replicated 1 time. The results are shown in Table 2.

TABLE 2 insect resistance test results of transgenic maize plants inoculated with meadow moth

The results in table 2 show that: the corn plant with the transferred Cry1Fa-01 nucleotide sequence has better insecticidal effect on the meadow moth, the average death rate of the meadow moth is over 60 percent, and the total resistance score is over 230; the maize plant transferred with the Vip3A nucleotide sequence has insecticidal activity to the meadow moth, but the lethality rate is only below 10%, the maize plant identified as non-transgenic by Taqman and the wild maize plant have no lethal or inhibiting effect to the meadow moth, and the total resistance score is about 50 generally.

Meanwhile, compared with wild corn plants, corn plants with the Cry1Fa-01 nucleotide sequence can cause a large number of larvae of the meadow moth to die, and greatly inhibit the development progress of a small part of the survival larvae, and the pests with the inhibited development can not survive in the natural environment of the field. And the corn plants transferred with the Cry1Fa-01 nucleotide sequence are only slightly damaged, and the leaf damage rate is below 10%; the corn plant with the Vip3A nucleotide sequence has insecticidal activity on the meadow moth, but the control effect is not as obvious as that of Cry1Fa protein, most of larvae can survive, and the damage to leaves is obvious.

Thus, the corn plants transferred with the Cry1Fa-01 nucleotide sequence show high activity against the meadow moth, and the activity is enough to generate adverse effect on the growth of the meadow moth so as to control the meadow moth in the field.

The above experimental results also show that: the control of the meadow moth by the soybean plant with the Cry1Ac-Cry1Fa-02 nucleotide sequence and the corn plant with the Cry1Fa-01 nucleotide sequence is obviously because the plants can generate Cry1Fa protein, so the technicians in the field are familiar with the technology, and the plant with the Cry1Fa protein can generate at least one second insecticidal protein different from the Cry1Fa protein, such as Vip-type protein or Cry-type protein and the like according to the poisoning effect of the Cry1Fa protein on the meadow moth.

In conclusion, the application of the insecticidal protein disclosed by the invention is used for controlling the meadow moth pests by generating the Cry1Fa protein capable of killing the meadow moth in plants; compared with the agricultural control method, the chemical control method, the physical control method and the biological control method used in the prior art, the invention protects the whole plant in the whole growth period to control the invasion of the meadow moth pests, and has the advantages of no pollution, no residue, stable and thorough effect, simplicity, convenience and economy.

Finally, it should be noted that the above embodiments are only for illustrating the technical solutions of the present invention and not for limiting, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

Sequence listing

<110> Beijing Dabei agricultural Biotechnology Co., Ltd

<120> use of insecticidal proteins

<130> DBNBC134

<160> 19

<170> SIPOSequenceListing 1.0

<210> 1

<211> 605

<212> PRT

<213> Artificial Sequence-Cry 1Fa01 amino acid Sequence (Artificial Sequence)

<400> 1

Met Glu Asn Asn Ile Gln Asn Gln Cys Val Pro Tyr Asn Cys Leu Asn

1 5 10 15

Asn Pro Glu Val Glu Ile Leu Asn Glu Glu Arg Ser Thr Gly Arg Leu

20 25 30

Pro Leu Asp Ile Ser Leu Ser Leu Thr Arg Phe Leu Leu Ser Glu Phe

35 40 45

Val Pro Gly Val Gly Val Ala Phe Gly Leu Phe Asp Leu Ile Trp Gly

50 55 60

Phe Ile Thr Pro Ser Asp Trp Ser Leu Phe Leu Leu Gln Ile Glu Gln

65 70 75 80

Leu Ile Glu Gln Arg Ile Glu Thr Leu Glu Arg Asn Arg Ala Ile Thr

85 90 95

Thr Leu Arg Gly Leu Ala Asp Ser Tyr Glu Ile Tyr Ile Glu Ala Leu

100 105 110

Arg Glu Trp Glu Ala Asn Pro Asn Asn Ala Gln Leu Arg Glu Asp Val

115 120 125

Arg Ile Arg Phe Ala Asn Thr Asp Asp Ala Leu Ile Thr Ala Ile Asn

130 135 140

Asn Phe Thr Leu Thr Ser Phe Glu Ile Pro Leu Leu Ser Val Tyr Val

145 150 155 160

Gln Ala Ala Asn Leu His Leu Ser Leu Leu Arg Asp Ala Val Ser Phe

165 170 175

Gly Gln Gly Trp Gly Leu Asp Ile Ala Thr Val Asn Asn His Tyr Asn

180 185 190

Arg Leu Ile Asn Leu Ile His Arg Tyr Thr Lys His Cys Leu Asp Thr

195 200 205

Tyr Asn Gln Gly Leu Glu Asn Leu Arg Gly Thr Asn Thr Arg Gln Trp

210 215 220

Ala Arg Phe Asn Gln Phe Arg Arg Asp Leu Thr Leu Thr Val Leu Asp

225 230 235 240

Ile Val Ala Leu Phe Pro Asn Tyr Asp Val Arg Thr Tyr Pro Ile Gln

245 250 255

Thr Ser Ser Gln Leu Thr Arg Glu Ile Tyr Thr Ser Ser Val Ile Glu

260 265 270

Asp Ser Pro Val Ser Ala Asn Ile Pro Asn Gly Phe Asn Arg Ala Glu

275 280 285

Phe Gly Val Arg Pro Pro His Leu Met Asp Phe Met Asn Ser Leu Phe

290 295 300

Val Thr Ala Glu Thr Val Arg Ser Gln Thr Val Trp Gly Gly His Leu

305 310 315 320

Val Ser Ser Arg Asn Thr Ala Gly Asn Arg Ile Asn Phe Pro Ser Tyr

325 330 335

Gly Val Phe Asn Pro Gly Gly Ala Ile Trp Ile Ala Asp Glu Asp Pro

340 345 350

Arg Pro Phe Tyr Arg Thr Leu Ser Asp Pro Val Phe Val Arg Gly Gly

355 360 365

Phe Gly Asn Pro His Tyr Val Leu Gly Leu Arg Gly Val Ala Phe Gln

370 375 380

Gln Thr Gly Thr Asn His Thr Arg Thr Phe Arg Asn Ser Gly Thr Ile

385 390 395 400

Asp Ser Leu Asp Glu Ile Pro Pro Gln Asp Asn Ser Gly Ala Pro Trp

405 410 415

Asn Asp Tyr Ser His Val Leu Asn His Val Thr Phe Val Arg Trp Pro

420 425 430

Gly Glu Ile Ser Gly Ser Asp Ser Trp Arg Ala Pro Met Phe Ser Trp

435 440 445

Thr His Arg Ser Ala Thr Pro Thr Asn Thr Ile Asp Pro Glu Arg Ile

450 455 460

Thr Gln Ile Pro Leu Val Lys Ala His Thr Leu Gln Ser Gly Thr Thr

465 470 475 480

Val Val Arg Gly Pro Gly Phe Thr Gly Gly Asp Ile Leu Arg Arg Thr

485 490 495

Ser Gly Gly Pro Phe Ala Tyr Thr Ile Val Asn Ile Asn Gly Gln Leu

500 505 510

Pro Gln Arg Tyr Arg Ala Arg Ile Arg Tyr Ala Ser Thr Thr Asn Leu

515 520 525

Arg Ile Tyr Val Thr Val Ala Gly Glu Arg Ile Phe Ala Gly Gln Phe

530 535 540

Asn Lys Thr Met Asp Thr Gly Asp Pro Leu Thr Phe Gln Ser Phe Ser

545 550 555 560

Tyr Ala Thr Ile Asn Thr Ala Phe Thr Phe Pro Met Ser Gln Ser Ser

565 570 575

Phe Thr Val Gly Ala Asp Thr Phe Ser Ser Gly Asn Glu Val Tyr Ile

580 585 590

Asp Arg Phe Glu Leu Ile Pro Val Thr Ala Thr Leu Glu

595 600 605

<210> 2

<211> 1818

<212> DNA

<213> Artificial Sequence-Cry 1Fa01 nucleotide Sequence (Artificial Sequence)

<400> 2

atggagaaca acatacagaa tcagtgcgtc ccctacaact gcctcaacaa tcctgaagta 60

gagattctca acgaagagag gtcgactggc agattgccgt tagacatctc cctgtccctt 120

acacgtttcc tgttgtctga gtttgttcca ggtgtgggag ttgcgtttgg cctcttcgac 180

ctcatctggg gcttcatcac tccatctgat tggagcctct ttcttctcca gattgaacag 240

ttgattgaac aaaggattga gaccttggaa aggaatcggg ccatcactac ccttcgtggc 300

ttagcagaca gctatgagat ctacattgaa gcactaagag agtgggaagc caatcctaac 360

aatgcccaac tgagagaaga tgtgcgtata cgctttgcta acacagatga tgctttgatc 420

acagccatca acaacttcac ccttaccagc ttcgagatcc ctcttctctc ggtctatgtt 480

caagctgcta acctgcactt gtcactactg cgcgacgctg tgtcgtttgg gcaaggttgg 540

ggactggaca tagctactgt caacaatcac tacaacagac tcatcaatct gattcatcga 600

tacacgaaac attgtttgga tacctacaat cagggattgg agaacctgag aggtactaac 660

actcgccaat gggccaggtt caatcagttc aggagagacc ttacacttac tgtgttagac 720

atagttgctc tctttccgaa ctacgatgtt cgtacctatc cgattcaaac gtcatcccaa 780

cttacaaggg agatctacac cagttcagtc attgaagact ctccagtttc tgcgaacata 840

cccaatggtt tcaacagggc tgagtttgga gtcagaccac cccatctcat ggacttcatg 900

aactctttgt ttgtgactgc agagactgtt agatcccaaa ctgtgtgggg aggacactta 960

gttagctcac gcaacacggc tggcaatcgt atcaactttc ctagttacgg ggtcttcaat 1020

cccgggggcg ccatctggat tgcagatgaa gatccacgtc ctttctatcg gaccttgtca 1080

gatcctgtct tcgtccgagg aggctttggc aatcctcact atgtactcgg tcttagggga 1140

gtggcctttc aacaaactgg tacgaatcac acccgcacat tcaggaactc cgggaccatt 1200

gactctctag atgagatacc acctcaagac aacagcggcg caccttggaa tgactactcc 1260

catgtgctga atcatgttac ctttgtgcgc tggccaggtg agatctcagg ttccgactca 1320

tggagagcac caatgttctc ttggacgcat cgtagcgcta cccccacaaa caccattgat 1380

ccagagagaa tcactcagat tcccttggtg aaggcacaca cacttcagtc aggaactaca 1440

gttgtaagag ggccggggtt cacgggagga gacattcttc gacgcactag tggaggacca 1500

ttcgcgtaca ccattgtcaa catcaatggg caacttcccc aaaggtatcg tgccaggata 1560

cgctatgcct ctactaccaa tctaagaatc tacgttacgg ttgcaggtga acggatcttt 1620

gctggtcagt tcaacaagac aatggatacc ggtgatccac ttacattcca atctttctcc 1680

tacgccacta tcaacaccgc gttcaccttt ccaatgagcc agagcagttt cacagtaggt 1740

gctgatacct tcagttcagg caacgaagtg tacattgaca ggtttgagtt gattccagtt 1800

actgccacac tcgagtaa 1818

<210> 3

<211> 1148

<212> PRT

<213> Artificial Sequence-Cry 1Fa02 amino acid Sequence (Artificial Sequence)

<400> 3

Met Glu Asn Asn Ile Gln Asn Gln Cys Val Pro Tyr Asn Cys Leu Asn

1 5 10 15

Asn Pro Glu Val Glu Ile Leu Asn Glu Glu Arg Ser Thr Gly Arg Leu

20 25 30

Pro Leu Asp Ile Ser Leu Ser Leu Thr Arg Leu Leu Leu Ser Glu Phe

35 40 45

Val Pro Gly Val Gly Val Ala Phe Gly Leu Phe Asp Leu Ile Trp Gly

50 55 60

Phe Ile Thr Pro Ser Asp Trp Ser Leu Phe Leu Leu Gln Ile Glu Gln

65 70 75 80

Leu Ile Glu Gln Arg Ile Glu Thr Leu Glu Arg Asn Arg Ala Ile Thr

85 90 95

Thr Leu Arg Gly Leu Ala Asp Ser Tyr Glu Ile Tyr Ile Glu Ala Leu

100 105 110

Arg Glu Trp Glu Ala Asn Pro Asn Asn Ala Gln Leu Arg Glu Asp Val

115 120 125

Arg Ile Arg Phe Ala Asn Thr Asp Asp Ala Leu Ile Thr Ala Ile Asn

130 135 140

Asn Phe Thr Leu Thr Ser Phe Glu Ile Pro Leu Leu Ser Val Tyr Val

145 150 155 160

Gln Ala Ala Asn Leu His Leu Ser Leu Leu Arg Asp Ala Val Ser Phe

165 170 175

Gly Gln Gly Trp Gly Leu Asp Ile Ala Thr Val Asn Asn His Tyr Asn

180 185 190

Arg Leu Ile Asn Leu Ile His Arg Tyr Thr Lys His Cys Leu Asp Thr

195 200 205

Tyr Asn Gln Gly Leu Glu Asn Leu Arg Gly Thr Asn Thr Arg Gln Trp

210 215 220

Ala Arg Phe Asn Gln Phe Arg Arg Asp Leu Thr Leu Thr Val Leu Asp

225 230 235 240

Ile Val Ala Leu Phe Pro Asn Tyr Asp Val Arg Thr Tyr Pro Ile Gln

245 250 255

Thr Ser Ser Gln Leu Thr Arg Glu Ile Tyr Thr Ser Ser Val Ile Glu

260 265 270

Asp Ser Pro Val Ser Ala Asn Ile Pro Asn Gly Phe Asn Arg Ala Glu

275 280 285

Phe Gly Val Arg Pro Pro His Leu Met Asp Phe Met Asn Ser Leu Phe

290 295 300

Val Thr Ala Glu Thr Val Arg Ser Gln Thr Val Trp Gly Gly His Leu

305 310 315 320

Val Ser Ser Arg Asn Thr Ala Gly Asn Arg Ile Asn Phe Pro Ser Tyr

325 330 335

Gly Val Phe Asn Pro Gly Gly Ala Ile Trp Ile Ala Asp Glu Asp Pro

340 345 350

Arg Pro Phe Tyr Arg Thr Leu Ser Asp Pro Val Phe Val Arg Gly Gly

355 360 365

Phe Gly Asn Pro His Tyr Val Leu Gly Leu Arg Gly Val Ala Phe Gln

370 375 380

Gln Thr Gly Thr Asn His Thr Arg Thr Phe Arg Asn Ser Gly Thr Ile

385 390 395 400

Asp Ser Leu Asp Glu Ile Pro Pro Gln Asp Asn Ser Gly Ala Pro Trp

405 410 415

Asn Asp Tyr Ser His Val Leu Asn His Val Thr Phe Val Arg Trp Pro

420 425 430

Gly Glu Ile Ser Gly Ser Asp Ser Trp Arg Ala Pro Met Phe Ser Trp

435 440 445

Thr His Arg Ser Ala Thr Pro Thr Asn Thr Ile Asp Pro Glu Arg Ile

450 455 460

Thr Gln Ile Pro Leu Val Lys Ala His Thr Leu Gln Ser Gly Thr Thr

465 470 475 480

Val Val Arg Gly Pro Gly Phe Thr Gly Gly Asp Ile Leu Arg Arg Thr

485 490 495

Ser Gly Gly Pro Phe Ala Tyr Thr Ile Val Asn Ile Asn Gly Gln Leu

500 505 510

Pro Gln Arg Tyr Arg Ala Arg Ile Arg Tyr Ala Ser Thr Thr Asn Leu

515 520 525

Arg Ile Tyr Val Thr Val Ala Gly Glu Arg Ile Phe Ala Gly Gln Phe

530 535 540

Asn Lys Thr Met Asp Thr Gly Asp Pro Leu Thr Phe Gln Ser Phe Ser

545 550 555 560

Tyr Ala Thr Ile Asn Thr Ala Phe Thr Phe Pro Met Ser Gln Ser Ser

565 570 575

Phe Thr Val Gly Ala Asp Thr Phe Ser Ser Gly Asn Glu Val Tyr Ile

580 585 590

Asp Arg Phe Glu Leu Ile Pro Val Thr Ala Thr Leu Glu Ala Glu Ser

595 600 605

Asp Leu Glu Arg Ala Gln Lys Ala Val Asn Ala Leu Phe Thr Ser Ser

610 615 620

Asn Gln Ile Gly Leu Lys Thr Asp Val Thr Asp Tyr His Ile Asp Arg

625 630 635 640

Val Ser Asn Leu Val Glu Cys Leu Ser Asp Glu Phe Cys Leu Asp Glu

645 650 655

Lys Lys Glu Leu Ser Glu Lys Val Lys His Ala Lys Arg Leu Ser Asp

660 665 670

Glu Arg Asn Leu Leu Gln Asp Pro Asn Phe Arg Gly Ile Asn Arg Gln

675 680 685

Leu Asp Arg Gly Trp Arg Gly Ser Thr Asp Ile Thr Ile Gln Gly Gly

690 695 700

Asp Asp Val Phe Lys Glu Asn Tyr Val Thr Leu Leu Gly Thr Phe Asp

705 710 715 720

Glu Cys Tyr Pro Thr Tyr Leu Tyr Gln Lys Ile Asp Glu Ser Lys Leu

725 730 735

Lys Ala Tyr Thr Arg Tyr Gln Leu Arg Gly Tyr Ile Glu Asp Ser Gln

740 745 750

Asp Leu Glu Ile Tyr Leu Ile Arg Tyr Asn Ala Lys His Glu Thr Val

755 760 765

Asn Val Pro Gly Thr Gly Ser Leu Trp Pro Leu Ser Ala Pro Ser Pro

770 775 780

Ile Gly Lys Cys Ala His His Ser His His Phe Ser Leu Asp Ile Asp

785 790 795 800

Val Gly Cys Thr Asp Leu Asn Glu Asp Leu Gly Val Trp Val Ile Phe

805 810 815

Lys Ile Lys Thr Gln Asp Gly His Ala Arg Leu Gly Asn Leu Glu Phe

820 825 830

Leu Glu Glu Lys Pro Leu Val Gly Glu Ala Leu Ala Arg Val Lys Arg

835 840 845

Ala Glu Lys Lys Trp Arg Asp Lys Arg Glu Lys Leu Glu Trp Glu Thr

850 855 860

Asn Ile Val Tyr Lys Glu Ala Lys Glu Ser Val Asp Ala Leu Phe Val

865 870 875 880

Asn Ser Gln Tyr Asp Arg Leu Gln Ala Asp Thr Asn Ile Ala Met Ile

885 890 895

His Ala Ala Asp Lys Arg Val His Ser Ile Arg Glu Ala Tyr Leu Pro

900 905 910

Glu Leu Ser Val Ile Pro Gly Val Asn Ala Ala Ile Phe Glu Glu Leu

915 920 925

Glu Gly Arg Ile Phe Thr Ala Phe Ser Leu Tyr Asp Ala Arg Asn Val

930 935 940

Ile Lys Asn Gly Asp Phe Asn Asn Gly Leu Ser Cys Trp Asn Val Lys

945 950 955 960

Gly His Val Asp Val Glu Glu Gln Asn Asn His Arg Ser Val Leu Val

965 970 975

Val Pro Glu Trp Glu Ala Glu Val Ser Gln Glu Val Arg Val Cys Pro

980 985 990

Gly Arg Gly Tyr Ile Leu Arg Val Thr Ala Tyr Lys Glu Gly Tyr Gly

995 1000 1005

Glu Gly Cys Val Thr Ile His Glu Ile Glu Asn Asn Thr Asp Glu Leu

1010 1015 1020

Lys Phe Ser Asn Cys Val Glu Glu Glu Val Tyr Pro Asn Asn Thr Val

1025 1030 1035 1040

Thr Cys Asn Asp Tyr Thr Ala Thr Gln Glu Glu Tyr Glu Gly Thr Tyr

1045 1050 1055

Thr Ser Arg Asn Arg Gly Tyr Asp Gly Ala Tyr Glu Ser Asn Ser Ser

1060 1065 1070

Val Pro Ala Asp Tyr Ala Ser Ala Tyr Glu Glu Lys Ala Tyr Thr Asp

1075 1080 1085

Gly Arg Arg Asp Asn Pro Cys Glu Ser Asn Arg Gly Tyr Gly Asp Tyr

1090 1095 1100

Thr Pro Leu Pro Ala Gly Tyr Val Thr Lys Glu Leu Glu Tyr Phe Pro

1105 1110 1115 1120

Glu Thr Asp Lys Val Trp Ile Glu Ile Gly Glu Thr Glu Gly Thr Phe

1125 1130 1135

Ile Val Asp Ser Val Glu Leu Leu Leu Met Glu Glu

1140 1145

<210> 4

<211> 3447

<212> DNA

<213> Artificial Sequence-Cry 1Fa02 nucleotide Sequence (Artificial Sequence)

<400> 4

atggagaaca acatacagaa tcagtgcgtc ccctacaact gcctcaacaa tcctgaagta 60

gagattctca acgaagagag gtcgactggc agattgccgt tagacatctc cctgtccctt 120

acacgtctcc tgttgtctga gtttgttcca ggtgtgggag ttgcgtttgg cctcttcgac 180

ctcatctggg gcttcatcac tccatctgat tggagcctct ttcttctcca gattgaacag 240

ttgattgaac aaaggattga gaccttggaa aggaatcggg ccatcactac ccttcgtggc 300

ttagcagaca gctatgagat ctacattgaa gcactaagag agtgggaagc caatcctaac 360

aatgcccaac tgagagaaga tgtgcgtata cgctttgcta acacagatga tgctttgatc 420

acagccatca acaacttcac ccttaccagc ttcgagatcc ctcttctctc ggtctatgtt 480

caagctgcta acctgcactt gtcactactg cgcgacgctg tgtcgtttgg gcaaggttgg 540

ggactggaca tagctactgt caacaatcac tacaacagac tcatcaatct gattcatcga 600

tacacgaaac attgtttgga tacctacaat cagggattgg agaacctgag aggtactaac 660

actcgccaat gggccaggtt caatcagttc aggagagacc ttacacttac tgtgttagac 720

atagttgctc tctttccgaa ctacgatgtt cgtacctatc cgattcaaac gtcatcccaa 780

cttacaaggg agatctacac cagttcagtc attgaagact ctccagtttc tgcgaacata 840

cccaatggtt tcaacagggc tgagtttgga gtcagaccac cccatctcat ggacttcatg 900

aactctttgt ttgtgactgc agagactgtt agatcccaaa ctgtgtgggg aggacactta 960

gttagctcac gcaacacggc tggcaatcgt atcaactttc ctagttacgg ggtcttcaat 1020

cccgggggcg ccatctggat tgcagatgaa gatccacgtc ctttctatcg gaccttgtca 1080

gatcctgtct tcgtccgagg aggctttggc aatcctcact atgtactcgg tcttagggga 1140

gtggcctttc aacaaactgg tacgaatcac acccgcacat tcaggaactc cgggaccatt 1200

gactctctag atgagatacc acctcaagac aacagcggcg caccttggaa tgactactcc 1260

catgtgctga atcatgttac ctttgtgcgc tggccaggtg agatctcagg ttccgactca 1320

tggagagcac caatgttctc ttggacgcat cgtagcgcta cccccacaaa caccattgat 1380

ccagagagaa tcactcagat tcccttggtg aaggcacaca cacttcagtc aggaactaca 1440

gttgtaagag ggccggggtt cacgggagga gacattcttc gacgcactag tggaggacca 1500

ttcgcgtaca ccattgtcaa catcaatggg caacttcccc aaaggtatcg tgccaggata 1560

cgctatgcct ctactaccaa tctaagaatc tacgttacgg ttgcaggtga acggatcttt 1620

gctggtcagt tcaacaagac aatggatacc ggtgatccac ttacattcca atctttctcc 1680

tacgccacta tcaacaccgc gttcaccttt ccaatgagcc agagcagttt cacagtaggt 1740

gctgatacct tcagttcagg caacgaagtg tacattgaca ggtttgagtt gattccagtt 1800

actgccacac tcgaggcaga gtctgacttg gaaagagcac agaaggcggt gaatgctctg 1860

ttcacttcgt ccaatcagat tgggctcaag acagatgtga ctgactatca catcgatcgc 1920

gtttccaacc ttgttgagtg cctctctgat gagttctgtt tggatgagaa gaaggagttg 1980

tccgagaagg tcaaacatgc taagcgactt agtgatgagc ggaacttgct tcaagatccc 2040

aactttcgcg ggatcaacag gcaactagat cgtggatgga ggggaagtac ggacatcacc 2100

attcaaggag gtgatgatgt gttcaaggag aactatgtta cgctcttggg tacctttgat 2160

gagtgctatc caacatacct gtaccagaag atagatgaat cgaaactcaa agcctacaca 2220

agataccagt tgagaggtta catcgaggac agtcaagacc ttgagatcta cctcatcaga 2280

tacaacgcca aacatgagac agtcaatgtg cctgggacgg gttcactctg gccactttca 2340

gccccaagtc ccatcggcaa gtgtgcccat cactcacacc acttctcctt ggacatagac 2400

gttggctgta ccgacctgaa cgaagacctc ggtgtgtggg tgatcttcaa gatcaagact 2460

caagatggcc atgccaggct aggcaatctg gagtttctag aagagaaacc acttgttgga 2520

gaagccctcg ctagagtgaa gagggctgag aagaagtgga gggacaagag agagaagttg 2580

gaatgggaaa caaacattgt gtacaaagaa gccaaagaaa gcgttgacgc tctgtttgtg 2640

aactctcagt atgataggct ccaagctgat accaacatag ctatgattca tgctgcagac 2700

aaacgcgttc atagcattcg ggaagcttac cttcctgaac ttagcgtgat tccgggtgtc 2760

aatgctgcta tctttgaaga gttagaaggg cgcatcttca ctgcattctc cttgtatgat 2820

gcgaggaatg tcatcaagaa tggtgacttc aacaatggcc tatcctgctg gaatgtgaaa 2880

gggcacgtag atgtagaaga acagaacaat caccgctctg tccttgttgt tcctgagtgg 2940

gaagcagaag tttcacaaga agttcgtgtc tgtcctggtc gtggctacat tcttcgtgtt 3000

accgcgtaca aagaaggata cggagaaggt tgcgtcacca tacacgagat tgagaacaac 3060

accgacgagc tgaagttcag caactgcgtc gaggaggaag tctacccaaa caacaccgta 3120

acttgcaatg actacactgc gactcaagag gagtatgagg gtacttacac ttctcgcaat 3180

cgaggatacg atggagccta tgagagcaac tcttctgtac ccgctgacta tgcatcagcc 3240

tatgaggaga aggcttacac cgatggacgt agggacaatc cttgcgaatc taacagaggc 3300

tatggggact acacaccgtt accagccggc tatgtcacca aagagttaga gtactttcca 3360

gaaaccgaca aggtttggat tgagattgga gaaacggaag gaacattcat tgttgatagc 3420

gtggagttac ttctgatgga ggaatga 3447

<210> 5

<211> 1156

<212> PRT

<213> Artificial Sequence-Cry 1Ac amino acid Sequence (Artificial Sequence)

<400> 5

Met Asp Asn Asn Pro Asn Ile Asn Glu Cys Ile Pro Tyr Asn Cys Leu

1 5 10 15

Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu Thr Gly

20 25 30

Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser

35 40 45

Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile Ile

50 55 60

Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile

65 70 75 80

Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala

85 90 95

Ile Ser Arg Leu Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr Ala Glu

100 105 110

Ser Phe Arg Glu Trp Glu Ala Asp Pro Thr Asn Pro Ala Leu Arg Glu

115 120 125

Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser Ala Leu Thr Thr Ala

130 135 140

Ile Pro Leu Phe Ala Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val

145 150 155 160

Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser

165 170 175

Val Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser Arg

180 185 190

Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp Tyr Ala Val

195 200 205

Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg

210 215 220

Asp Trp Val Arg Tyr Asn Gln Phe Arg Arg Glu Leu Thr Leu Thr Val

225 230 235 240

Leu Asp Ile Val Ala Leu Phe Pro Asn Tyr Asp Ser Arg Arg Tyr Pro

245 250 255

Ile Arg Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val

260 265 270

Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu

275 280 285

Arg Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile Thr

290 295 300

Ile Tyr Thr Asp Ala His Arg Gly Tyr Tyr Tyr Trp Ser Gly His Gln

305 310 315 320

Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro

325 330 335

Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln Arg Ile Val Ala

340 345 350

Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu Ser Ser Thr Leu Tyr Arg

355 360 365

Arg Pro Phe Asn Ile Gly Ile Asn Asn Gln Gln Leu Ser Val Leu Asp

370 375 380

Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Leu Pro Ser Ala Val

385 390 395 400

Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln

405 410 415

Asn Asn Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser His

420 425 430

Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile

435 440 445

Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn

450 455 460

Ile Ile Ala Ser Asp Ser Ile Thr Gln Ile Pro Ala Val Lys Gly Asn

465 470 475 480

Phe Leu Phe Asn Gly Ser Val Ile Ser Gly Pro Gly Phe Thr Gly Gly

485 490 495

Asp Leu Val Arg Leu Asn Ser Ser Gly Asn Asn Ile Gln Asn Arg Gly

500 505 510

Tyr Ile Glu Val Pro Ile His Phe Pro Ser Thr Ser Thr Arg Tyr Arg

515 520 525

Val Arg Val Arg Tyr Ala Ser Val Thr Pro Ile His Leu Asn Val Asn

530 535 540

Trp Gly Asn Ser Ser Ile Phe Ser Asn Thr Val Pro Ala Thr Ala Thr

545 550 555 560

Ser Leu Asp Asn Leu Gln Ser Ser Asp Phe Gly Tyr Phe Glu Ser Ala

565 570 575

Asn Ala Phe Thr Ser Ser Leu Gly Asn Ile Val Gly Val Arg Asn Phe

580 585 590

Ser Gly Thr Ala Gly Val Ile Ile Asp Arg Phe Glu Phe Ile Pro Val

595 600 605

Thr Ala Thr Leu Glu Ala Glu Ser Asp Leu Glu Arg Ala Gln Lys Ala

610 615 620

Val Asn Ala Leu Phe Thr Ser Ser Asn Gln Ile Gly Leu Lys Thr Asp

625 630 635 640

Val Thr Asp Tyr His Ile Asp Arg Val Ser Asn Leu Val Glu Cys Leu

645 650 655

Ser Asp Glu Phe Cys Leu Asp Glu Lys Lys Glu Leu Ser Glu Lys Val

660 665 670

Lys His Ala Lys Arg Leu Ser Asp Glu Arg Asn Leu Leu Gln Asp Pro

675 680 685

Asn Phe Arg Gly Ile Asn Arg Gln Leu Asp Arg Gly Trp Arg Gly Ser

690 695 700

Thr Asp Ile Thr Ile Gln Gly Gly Asp Asp Val Phe Lys Glu Asn Tyr

705 710 715 720

Val Thr Leu Leu Gly Thr Phe Asp Glu Cys Tyr Pro Thr Tyr Leu Tyr

725 730 735

Gln Lys Ile Asp Glu Ser Lys Leu Lys Ala Tyr Thr Arg Tyr Gln Leu

740 745 750

Arg Gly Tyr Ile Glu Asp Ser Gln Asp Leu Glu Ile Tyr Leu Ile Arg

755 760 765

Tyr Asn Ala Lys His Glu Thr Val Asn Val Pro Gly Thr Gly Ser Leu

770 775 780

Trp Pro Leu Ser Ala Pro Ser Pro Ile Gly Lys Cys Ala His His Ser

785 790 795 800

His His Phe Ser Leu Asp Ile Asp Val Gly Cys Thr Asp Leu Asn Glu

805 810 815

Asp Leu Gly Val Trp Val Ile Phe Lys Ile Lys Thr Gln Asp Gly His

820 825 830

Ala Arg Leu Gly Asn Leu Glu Phe Leu Glu Glu Lys Pro Leu Val Gly

835 840 845

Glu Ala Leu Ala Arg Val Lys Arg Ala Glu Lys Lys Trp Arg Asp Lys

850 855 860

Arg Glu Lys Leu Glu Trp Glu Thr Asn Ile Val Tyr Lys Glu Ala Lys

865 870 875 880

Glu Ser Val Asp Ala Leu Phe Val Asn Ser Gln Tyr Asp Arg Leu Gln

885 890 895

Ala Asp Thr Asn Ile Ala Met Ile His Ala Ala Asp Lys Arg Val His

900 905 910

Ser Ile Arg Glu Ala Tyr Leu Pro Glu Leu Ser Val Ile Pro Gly Val

915 920 925

Asn Ala Ala Ile Phe Glu Glu Leu Glu Gly Arg Ile Phe Thr Ala Phe

930 935 940

Ser Leu Tyr Asp Ala Arg Asn Val Ile Lys Asn Gly Asp Phe Asn Asn

945 950 955 960

Gly Leu Ser Cys Trp Asn Val Lys Gly His Val Asp Val Glu Glu Gln

965 970 975

Asn Asn His Arg Ser Val Leu Val Val Pro Glu Trp Glu Ala Glu Val

980 985 990

Ser Gln Glu Val Arg Val Cys Pro Gly Arg Gly Tyr Ile Leu Arg Val

995 1000 1005

Thr Ala Tyr Lys Glu Gly Tyr Gly Glu Gly Cys Val Thr Ile His Glu

1010 1015 1020

Ile Glu Asn Asn Thr Asp Glu Leu Lys Phe Ser Asn Cys Val Glu Glu

1025 1030 1035 1040

Glu Val Tyr Pro Asn Asn Thr Val Thr Cys Asn Asp Tyr Thr Ala Thr

1045 1050 1055

Gln Glu Glu Tyr Glu Gly Thr Tyr Thr Ser Arg Asn Arg Gly Tyr Asp

1060 1065 1070

Gly Ala Tyr Glu Ser Asn Ser Ser Val Pro Ala Asp Tyr Ala Ser Ala

1075 1080 1085

Tyr Glu Glu Lys Ala Tyr Thr Asp Gly Arg Arg Asp Asn Pro Cys Glu

1090 1095 1100

Ser Asn Arg Gly Tyr Gly Asp Tyr Thr Pro Leu Pro Ala Gly Tyr Val

1105 1110 1115 1120

Thr Lys Glu Leu Glu Tyr Phe Pro Glu Thr Asp Lys Val Trp Ile Glu

1125 1130 1135

Ile Gly Glu Thr Glu Gly Thr Phe Ile Val Asp Ser Val Glu Leu Leu

1140 1145 1150

Leu Met Glu Glu

1155

<210> 6

<211> 3471

<212> DNA

<213> Artificial Sequence-Cry 1Ac nucleotide Sequence (Artificial Sequence)

<400> 6

atggacaaca atcccaacat caacgagtgc attccttaca actgcctgag caaccctgag 60

gttgaggtgc tgggtggaga acggattgag actggttaca cacctatcga catctcgttg 120

tcacttaccc aattcctttt gtcagagttc gtgcccggtg ctggattcgt gcttggactt 180

gtcgatatca tttggggaat ctttggtccc tctcaatggg acgcctttct tgtacagata 240

gagcagttaa ttaaccaaag aatagaagaa ttcgctagga accaagccat ctcaaggtta 300

gaaggcctca gcaaccttta ccagatttac gcagaatctt ttcgagagtg ggaagcagac 360

ccgaccaatc ctgccttaag agaggagatg cgcattcaat tcaatgacat gaacagcgcg 420

ctgacgaccg caattccgct cttcgccgtt cagaattacc aagttcctct tttatccgtg 480

tacgtgcagg ctgccaacct gcacttgtcg gtgctccgcg atgtctccgt gttcggacaa 540

cggtggggct ttgatgccgc aactatcaat agtcgttata atgatctgac taggcttatt 600

ggcaactata ccgattatgc tgttcgctgg tacaacacgg gtctcgaacg tgtctgggga 660

ccggattcta gagattgggt caggtacaac cagttcaggc gagagttgac actaactgtc 720

ctagacattg tcgctctctt tcccaactac gactctaggc gctacccaat ccgtactgtg 780

tcacaattga cccgggaaat ctacacaaac ccagtcctcg agaacttcga cggtagcttt 840

cgaggctcgg ctcagggcat agagagaagc atcaggtctc cacacctgat ggacatattg 900

aacagtatca cgatctacac cgatgcgcac cgcggttatt actactggtc agggcatcag 960

atcatggcat cacccgttgg gttctctgga ccagaattca ctttcccact ttacgggact 1020

atgggcaatg cagctccaca acaacgtatt gttgctcaac tcggtcaggg cgtgtataga 1080

accttgtcca gcactctata taggagacct ttcaacatcg gcatcaacaa tcaacaattg 1140

tctgtgcttg acgggacaga atttgcctat ggaacctcct caaatctgcc atccgctgtc 1200

tacagaaaga gcggaacagt tgatagcttg gatgagatcc ctccacagaa caacaacgtt 1260

ccacctaggc aagggtttag ccatcgcctt agccatgtgt ccatgttccg ttcaggcttt 1320

agtaatagca gcgttagtat catcagagct ccgatgttct cttggataca tcgtagtgct 1380

gagtttaaca acataattgc atccgatagc attactcaga tcccagctgt caaggggaac 1440

tttctcttta atggttctgt catttcagga ccaggattca ctggaggcga cttggttagg 1500

ctgaattctt ccggcaacaa catccagaat agagggtata ttgaagtgcc cattcacttc 1560

ccatcgacat ctaccagata tcgtgttcgt gtaaggtatg cctctgttac ccctattcac 1620

ctcaacgtca attggggtaa ttcctccatc ttttccaata cagtaccagc gacagctaca 1680

tccttggata atctccaatc tagcgatttc ggttacttcg aaagtgccaa tgccttcacc 1740

tcttccctag gtaacatagt aggtgttaga aatttctccg gaaccgccgg agtgataatc 1800

gaccgcttcg aattcattcc cgttactgca acgctcgagg cagagtctga cttggaaaga 1860

gcacagaagg cggtgaatgc tctgttcact tcgtccaatc agattgggct caagacagat 1920

gtgactgact atcacatcga tcgcgtttcc aaccttgttg agtgcctctc tgatgagttc 1980

tgtttggatg agaagaagga gttgtccgag aaggtcaaac atgctaagcg acttagtgat 2040

gagcggaact tgcttcaaga tcccaacttt cgcgggatca acaggcaact agatcgtgga 2100

tggaggggaa gtacggacat caccattcaa ggaggtgatg atgtgttcaa ggagaactat 2160

gttacgctct tgggtacctt tgatgagtgc tatccaacat acctgtacca gaagatagat 2220

gaatcgaaac tcaaagccta cacaagatac cagttgagag gttacatcga ggacagtcaa 2280

gaccttgaga tctacctcat cagatacaac gccaaacatg agacagtcaa tgtgcctggg 2340

acgggttcac tctggccact ttcagcccca agtcccatcg gcaagtgtgc ccatcactca 2400

caccacttct ccttggacat agacgttggc tgtaccgacc tgaacgaaga cctcggtgtg 2460

tgggtgatct tcaagatcaa gactcaagat ggccatgcca ggctaggcaa tctggagttt 2520

ctagaagaga aaccacttgt tggagaagcc ctcgctagag tgaagagggc tgagaagaag 2580

tggagggaca agagagagaa gttggaatgg gaaacaaaca ttgtgtacaa agaagccaaa 2640

gaaagcgttg acgctctgtt tgtgaactct cagtatgata ggctccaagc tgataccaac 2700

atagctatga ttcatgctgc agacaaacgc gttcatagca ttcgggaagc ttaccttcct 2760

gaacttagcg tgattccggg tgtcaatgct gctatctttg aagagttaga agggcgcatc 2820

ttcactgcat tctccttgta tgatgcgagg aatgtcatca agaatggtga cttcaacaat 2880

ggcctatcct gctggaatgt gaaagggcac gtagatgtag aagaacagaa caatcaccgc 2940

tctgtccttg ttgttcctga gtgggaagca gaagtttcac aagaagttcg tgtctgtcct 3000

ggtcgtggct acattcttcg tgttaccgcg tacaaagaag gatacggaga aggttgcgtc 3060

accatacacg agattgagaa caacaccgac gagctgaagt tcagcaactg cgtcgaggag 3120

gaagtctacc caaacaacac cgtaacttgc aatgactaca ctgcgactca agaggagtat 3180

gagggtactt acacttctcg caatcgagga tacgatggag cctatgagag caactcttct 3240

gtacccgctg actatgcatc agcctatgag gagaaggctt acaccgatgg acgtagggac 3300

aatccttgcg aatctaacag aggctatggg gactacacac cgttaccagc cggctatgtc 3360

accaaagagt tagagtactt tccagaaacc gacaaggttt ggattgagat tggagaaacg 3420

gaaggaacat tcattgttga tagcgtggag ttacttctga tggaggaatg a 3471

<210> 7

<211> 789

<212> PRT

<213> Artificial Sequence-Vip 3A amino acid Sequence (Artificial Sequence)

<400> 7

Met Asn Lys Asn Asn Thr Lys Leu Ser Thr Arg Ala Leu Pro Ser Phe

1 5 10 15

Ile Asp Tyr Phe Asn Gly Ile Tyr Gly Phe Ala Thr Gly Ile Lys Asp

20 25 30

Ile Met Asn Met Ile Phe Lys Thr Asp Thr Gly Gly Asp Leu Thr Leu

35 40 45

Asp Glu Ile Leu Lys Asn Gln Gln Leu Leu Asn Asp Ile Ser Gly Lys

50 55 60

Leu Asp Gly Val Asn Gly Ser Leu Asn Asp Leu Ile Ala Gln Gly Asn

65 70 75 80

Leu Asn Thr Glu Leu Ser Lys Glu Ile Leu Lys Ile Ala Asn Glu Gln

85 90 95

Asn Gln Val Leu Asn Asp Val Asn Asn Lys Leu Asp Ala Ile Asn Thr

100 105 110

Met Leu Arg Val Tyr Leu Pro Lys Ile Thr Ser Met Leu Ser Asp Val

115 120 125

Met Lys Gln Asn Tyr Ala Leu Ser Leu Gln Ile Glu Tyr Leu Ser Lys

130 135 140

Gln Leu Gln Glu Ile Ser Asp Lys Leu Asp Ile Ile Asn Val Asn Val

145 150 155 160

Leu Ile Asn Ser Thr Leu Thr Glu Ile Thr Pro Ala Tyr Gln Arg Ile

165 170 175

Lys Tyr Val Asn Glu Lys Phe Glu Glu Leu Thr Phe Ala Thr Glu Thr

180 185 190

Ser Ser Lys Val Lys Lys Asp Gly Ser Pro Ala Asp Ile Leu Asp Glu

195 200 205

Leu Thr Glu Leu Thr Glu Leu Ala Lys Ser Val Thr Lys Asn Asp Val

210 215 220

Asp Gly Phe Glu Phe Tyr Leu Asn Thr Phe His Asp Val Met Val Gly

225 230 235 240

Asn Asn Leu Phe Gly Arg Ser Ala Leu Lys Thr Ala Ser Glu Leu Ile

245 250 255

Thr Lys Glu Asn Val Lys Thr Ser Gly Ser Glu Val Gly Asn Val Tyr

260 265 270

Asn Phe Leu Ile Val Leu Thr Ala Leu Gln Ala Gln Ala Phe Leu Thr

275 280 285

Leu Thr Thr Cys Arg Lys Leu Leu Gly Leu Ala Asp Ile Asp Tyr Thr

290 295 300

Ser Ile Met Asn Glu His Leu Asn Lys Glu Lys Glu Glu Phe Arg Val

305 310 315 320

Asn Ile Leu Pro Thr Leu Ser Asn Thr Phe Ser Asn Pro Asn Tyr Ala

325 330 335

Lys Val Lys Gly Ser Asp Glu Asp Ala Lys Met Ile Val Glu Ala Lys

340 345 350

Pro Gly His Ala Leu Ile Gly Phe Glu Ile Ser Asn Asp Ser Ile Thr

355 360 365

Val Leu Lys Val Tyr Glu Ala Lys Leu Lys Gln Asn Tyr Gln Val Asp

370 375 380

Lys Asp Ser Leu Ser Glu Val Ile Tyr Gly Asp Met Asp Lys Leu Leu

385 390 395 400

Cys Pro Asp Gln Ser Glu Gln Ile Tyr Tyr Thr Asn Asn Ile Val Phe

405 410 415

Pro Asn Glu Tyr Val Ile Thr Lys Ile Asp Phe Thr Lys Lys Met Lys

420 425 430

Thr Leu Arg Tyr Glu Val Thr Ala Asn Phe Tyr Asp Ser Ser Thr Gly

435 440 445

Glu Ile Asp Leu Asn Lys Lys Lys Val Glu Ser Ser Glu Ala Glu Tyr

450 455 460

Arg Thr Leu Ser Ala Asn Asp Asp Gly Val Tyr Met Pro Leu Gly Val

465 470 475 480

Ile Ser Glu Thr Phe Leu Thr Pro Ile Asn Gly Phe Gly Leu Gln Ala

485 490 495

Asp Glu Asn Ser Arg Leu Ile Thr Leu Thr Cys Lys Ser Tyr Leu Arg

500 505 510

Glu Leu Leu Leu Ala Thr Asp Leu Ser Asn Lys Glu Thr Lys Leu Ile

515 520 525

Val Pro Pro Ser Gly Phe Ile Ser Asn Ile Val Glu Asn Gly Ser Ile

530 535 540

Glu Glu Asp Asn Leu Glu Pro Trp Lys Ala Asn Asn Lys Asn Ala Tyr

545 550 555 560

Val Asp His Thr Gly Gly Val Asn Gly Thr Lys Ala Leu Tyr Val His

565 570 575

Lys Asp Gly Gly Ile Ser Gln Phe Ile Gly Asp Lys Leu Lys Pro Lys

580 585 590

Thr Glu Tyr Val Ile Gln Tyr Thr Val Lys Gly Lys Pro Ser Ile His

595 600 605

Leu Lys Asp Glu Asn Thr Gly Tyr Ile His Tyr Glu Asp Thr Asn Asn

610 615 620

Asn Leu Glu Asp Tyr Gln Thr Ile Asn Lys Arg Phe Thr Thr Gly Thr

625 630 635 640

Asp Leu Lys Gly Val Tyr Leu Ile Leu Lys Ser Gln Asn Gly Asp Glu

645 650 655

Ala Trp Gly Asp Asn Phe Ile Ile Leu Glu Ile Ser Pro Ser Glu Lys

660 665 670

Leu Leu Ser Pro Glu Leu Ile Asn Thr Asn Asn Trp Thr Ser Thr Gly

675 680 685

Ser Thr Asn Ile Ser Gly Asn Thr Leu Thr Leu Tyr Gln Gly Gly Arg

690 695 700

Gly Ile Leu Lys Gln Asn Leu Gln Leu Asp Ser Phe Ser Thr Tyr Arg

705 710 715 720

Val Tyr Phe Ser Val Ser Gly Asp Ala Asn Val Arg Ile Arg Asn Ser

725 730 735

Arg Glu Val Leu Phe Glu Lys Arg Tyr Met Ser Gly Ala Lys Asp Val

740 745 750

Ser Glu Met Phe Thr Thr Lys Phe Glu Lys Asp Asn Phe Tyr Ile Glu

755 760 765

Leu Ser Gln Gly Asn Asn Leu Tyr Gly Gly Pro Ile Val His Phe Tyr

770 775 780

Asp Val Ser Ile Lys

785

<210> 8

<211> 2370

<212> DNA

<213> Artificial Sequence-Vip 3A nucleotide Sequence (Artificial Sequence)

<400> 8

atgaacaaga acaacaccaa gctctccaca cgggcacttc cctcctttat tgactacttt 60

aatggcatct atgggtttgc tacggggatc aaggacatta tgaacatgat cttcaagaca 120

gacactggcg gggatcttac gctcgacgag attcttaaga atcagcaact cctgaacgat 180

atctctggca agctggacgg cgtgaatggg tcacttaacg acctcatcgc tcaggggaat 240

ctcaacacag aactgtctaa ggagatcctc aagattgcaa atgagcagaa ccaagttctt 300

aatgatgtga acaataagct cgacgccatc aacacaatgc ttcgcgtgta cctcccaaag 360

attactagca tgctctcgga cgtcatgaag cagaactacg cgctgtccct tcaaattgag 420

tatctgagca agcagcttca agaaatctcg gacaagctgg atatcattaa tgtgaacgtc 480

ctcatcaaca gcaccctgac ggagattaca ccggcgtacc agaggatcaa gtatgtgaat 540

gagaagttcg aggaactcac ttttgctaca gaaacttcca gcaaggtcaa gaaggatggc 600

tcaccagccg acatcctgga tgagcttaca gaactcactg agctggcgaa gtccgtgacc 660

aagaatgacg tcgatggctt cgagttttac ctgaacacgt tccacgacgt tatggtgggc 720

aacaatcttt ttgggcggag cgctctcaag actgcatcgg aactgatcac caaggagaac 780

gttaagacga gcggctcgga ggtcgggaat gtttacaact tccttatcgt cctcaccgca 840

ctccaggccc aagcgtttct cacgctgacc acctgccgca agctcctcgg cctcgcagac 900

atcgattaca cctccatcat gaacgagcac ctgaacaagg agaaggagga gttccgcgtg 960

aatatccttc cgacactctc gaacactttt tctaatccaa actacgctaa ggtcaagggc 1020

tccgacgaag atgcaaagat gatcgttgag gccaagcctg gccatgcgct catcgggttc 1080

gagatttcta acgactcaat taccgtgctg aaggtctacg aggcgaagct caagcagaat 1140

tatcaagtgg acaaggattc tctgtcagag gttatctacg gcgacatgga taagctgctt 1200

tgccctgatc agtccgagca aatctactat acgaacaata ttgtcttccc caacgaatac 1260

gtgatcacca agattgactt tacgaagaag atgaagacac tccggtacga ggtgacggct 1320

aacttctatg attcgtctac gggcgagatc gacctcaaca agaagaaggt cgaatcatcc 1380

gaggccgaat acagaaccct gtcggcgaac gacgatggcg tgtatatgcc tcttggggtc 1440

atttctgaga ccttcctcac gcccatcaat ggctttgggc tccaggcaga tgagaactcc 1500

cgcctgatca cccttacgtg caagagctac ctcagggagc tgctgcttgc caccgacctc 1560

tctaacaagg aaacgaagct gatcgttccg ccatcaggct tcatctccaa tattgtggag 1620

aacgggtcaa ttgaggaaga taatctggaa ccgtggaagg ctaacaataa gaacgcatac 1680

gttgaccaca caggcggggt gaatggcact aaggcgctct atgtgcataa ggatggtggc 1740

atctcccagt tcattggcga caagctgaag ccgaagacag aatacgtgat tcaatatact 1800

gtgaagggca agccaagcat ccacctcaag gatgagaaca cagggtacat ccattacgaa 1860

gatactaaca acaacctgga ggactaccag acaatcaata agaggttcac aactggcact 1920

gacctgaagg gggtctatct tattctcaag tcccagaatg gcgatgaggc ctggggcgac 1980

aacttcatca ttctcgaaat ctcccctagc gagaagctcc tgagccccga gctgattaac 2040

accaataact ggacatccac tggcagcacg aatatctcgg ggaacaccct gacgctttac 2100

cagggcggga gaggcattct gaagcagaac ctccaactgg attcgttctc tacctacaga 2160

gtctattttt cagtttccgg cgacgcgaat gtgcgcatca ggaactcgcg ggaagtcctc 2220

ttcgagaaga gatacatgtc tggcgctaag gatgtgtcag aaatgttcac cacgaagttt 2280

gagaaggaca acttttatat cgaactgtcc caagggaata acctctacgg cggccccatt 2340

gttcattttt acgacgtgag catcaagtga 2370

<210> 9

<211> 1322

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 9

gtcgacctgc aggtcaacgg atcaggatat tcttgtttaa gatgttgaac tctatggagg 60

tttgtatgaa ctgatgatct aggaccggat aagttccctt cttcatagcg aacttattca 120

aagaatgttt tgtgtatcat tcttgttaca ttgttattaa tgaaaaaata ttattggtca 180

ttggactgaa cacgagtgtt aaatatggac caggccccaa ataagatcca ttgatatatg 240

aattaaataa caagaataaa tcgagtcacc aaaccacttg ccttttttaa cgagacttgt 300

tcaccaactt gatacaaaag tcattatcct atgcaaatca ataatcatac aaaaatatcc 360

aataacacta aaaaattaaa agaaatggat aatttcacaa tatgttatac gataaagaag 420

ttacttttcc aagaaattca ctgattttat aagcccactt gcattagata aatggcaaaa 480

aaaaacaaaa aggaaaagaa ataaagcacg aagaattcta gaaaatacga aatacgcttc 540

aatgcagtgg gacccacggt tcaattattg ccaattttca gctccaccgt atatttaaaa 600

aataaaacga taatgctaaa aaaatataaa tcgtaacgat cgttaaatct caacggctgg 660

atcttatgac gaccgttaga aattgtggtt gtcgacgagt cagtaataaa cggcgtcaaa 720

gtggttgcag ccggcacaca cgagtcgtgt ttatcaactc aaagcacaaa tacttttcct 780

caacctaaaa ataaggcaat tagccaaaaa caactttgcg tgtaaacaac gctcaataca 840

cgtgtcattt tattattagc tattgcttca ccgccttagc tttctcgtga cctagtcgtc 900

ctcgtctttt cttcttcttc ttctataaaa caatacccaa agcttcttct tcacaattca 960

gatttcaatt tctcaaaatc ttaaaaactt tctctcaatt ctctctaccg tgatcaaggt 1020

aaatttctgt gttccttatt ctctcaaaat cttcgatttt gttttcgttc gatcccaatt 1080

tcgtatatgt tctttggttt agattctgtt aatcttagat cgaagacgat tttctgggtt 1140

tgatcgttag atatcatctt aattctcgat tagggtttca taaatatcat ccgatttgtt 1200

caaataattt gagttttgtc gaataattac tcttcgattt gtgatttcta tctagatctg 1260

gtgttagttt ctagtttgtg cgatcgaatt tgtcgattaa tctgagtttt tctgattaac 1320

ag 1322

<210> 10

<211> 530

<212> DNA

<213> Agrobacterium tumefaciens

<400> 10

ccatggagtc aaagattcaa atagaggacc taacagaact cgccgtaaag actggcgaac 60

agttcataca gagtctctta cgactcaatg acaagaagaa aatcttcgtc aacatggtgg 120

agcacgacac gcttgtctac tccaaaaata tcaaagatac agtctcagaa gaccaaaggg 180

caattgagac ttttcaacaa agggtaatat ccggaaacct cctcggattc cattgcccag 240

ctatctgtca ctttattgtg aagatagtgg aaaaggaagg tggctcctac aaatgccatc 300

attgcgataa aggaaaggcc atcgttgaag atgcctctgc cgacagtggt cccaaagatg 360

gacccccacc cacgaggagc atcgtggaaa aagaagacgt tccaaccacg tcttcaaagc 420

aagtggattg atgtgatatc tccactgacg taagggatga cgcacaatcc cactatcctt 480

cgcaagaccc ttcctctata taaggaagtt catttcattt ggagaggaca 530

<210> 11

<211> 515

<212> DNA

<213> cassava vein mosaic virus promoter (Manihot esculenta)

<400> 11

ccagaaggta attatccaag atgtagcatc aagaatccaa tgtttacggg aaaaactatg 60

gaagtattat gtgagctcag caagaagcag atcaatatgc ggcacatatg caacctatgt 120

tcaaaaatga agaatgtaca gatacaagat cctatactgc cagaatacga agaagaatac 180

gtagaaattg aaaaagaaga accaggcgaa gaaaagaatc ttgaagacgt aagcactgac 240

gacaacaatg aaaagaagaa gataaggtcg gtgattgtga aagagacata gaggacacat 300

gtaaggtgga aaatgtaagg gcggaaagta accttatcac aaaggaatct tatcccccac 360

tacttatcct tttatatttt tccgtgtcat ttttgccctt gagttttcct atataaggaa 420

ccaagttcgg catttgtgaa aacaagaaaa aatttggtgt aagctatttt ctttgaagta 480

ctgaggatac aagttcagag aaatttgtaa gtttg 515

<210> 12

<211> 529

<212> DNA

<213> promoter (Cauliflower mosaic virus)

<400> 12

gtcctctcca aatgaaatga acttccttat atagaggaag ggtcttgcga aggatagtgg 60

gattgtgcgt catcccttac gtcagtggag atatcacatc aatccacttg ctttgaagac 120

gtggttggaa cgtcttcttt ttccacgatg ctcctcgtgg gtgggggtcc atctttggga 180

ccactgtcgg cagaggcatc ttcaacgatg gcctttcctt tatcgcaatg atggcatttg 240

taggagccac cttccttttc cactatcttc acaataaagt gacagatagc tgggcaatgg 300

aatccgagga ggtttccgga tattaccctt tgttgaaaag tctcaattgc cctttggtct 360

tctgagactg tatctttgat atttttggag tagacaagcg tgtcgtgctc caccatgttg 420

acgaagattt tcttcttgtc attgagtcgt aagagactct gtatgaactg ttcgccagtc 480

tttacggcga gttctgttag gtcctctatt tgaatctttg actccatgg 529

<210> 13

<211> 552

<212> DNA

<213> Streptomyces viridochromogenes

<400> 13

atgtctccgg agaggagacc agttgagatt aggccagcta cagcagctga tatggccgcg 60

gtttgtgata tcgttaacca ttacattgag acgtctacag tgaactttag gacagagcca 120

caaacaccac aagagtggat tgatgatcta gagaggttgc aagatagata cccttggttg 180

gttgctgagg ttgagggtgt tgtggctggt attgcttacg ctgggccctg gaaggctagg 240

aacgcttacg attggacagt tgagagtact gtttacgtgt cacataggca tcaaaggttg 300

ggcctaggat ccacattgta cacacatttg cttaagtcta tggaggcgca aggttttaag 360

tctgtggttg ctgttatagg ccttccaaac gatccatctg ttaggttgca tgaggctttg 420

ggatacacag cccggggtac attgcgcgca gctggataca agcatggtgg atggcatgat 480

gttggttttt ggcaaaggga ttttgagttg ccagctcctc caaggccagt taggccagtt 540

acccagatct ga 552

<210> 14

<211> 195

<212> DNA

<213> terminator (Cauliflower mosaic virus)

<400> 14

ctgaaatcac cagtctctct ctacaaatct atctctctct ataataatgt gtgagtagtt 60

cccagataag ggaattaggg ttcttatagg gtttcgctca tgtgttgagc atataagaaa 120

cccttagtat gtatttgtat ttgtaaaata cttctatcaa taaaatttct aattcctaaa 180

accaaaatcc agtgg 195

<210> 15

<211> 1992

<212> DNA

<213> promoter (Zea mays)

<400> 15

ctgcagtgca gcgtgacccg gtcgtgcccc tctctagaga taatgagcat tgcatgtcta 60

agttataaaa aattaccaca tatttttttt gtcacacttg tttgaagtgc agtttatcta 120

tctttataca tatatttaaa ctttactcta cgaataatat aatctatagt actacaataa 180

tatcagtgtt ttagagaatc atataaatga acagttagac atggtctaaa ggacaattga 240

gtattttgac aacaggactc tacagtttta tctttttagt gtgcatgtgt tctccttttt 300

ttttgcaaat agcttcacct atataatact tcatccattt tattagtaca tccatttagg 360

gtttagggtt aatggttttt atagactaat ttttttagta catctatttt attctatttt 420

agcctctaaa ttaagaaaac taaaactcta ttttagtttt tttatttaat aatttagata 480

taaaatagaa taaaataaag tgactaaaaa ttaaacaaat accctttaag aaattaaaaa 540

aactaaggaa acatttttct tgtttcgagt agataatgcc agcctgttaa acgccgtcga 600

cgagtctaac ggacaccaac cagcgaacca gcagcgtcgc gtcgggccaa gcgaagcaga 660

cggcacggca tctctgtcgc tgcctctgga cccctctcga gagttccgct ccaccgttgg 720

acttgctccg ctgtcggcat ccagaaattg cgtggcggag cggcagacgt gagccggcac 780

ggcaggcggc ctcctcctcc tctcacggca cggcagctac gggggattcc tttcccaccg 840

ctccttcgct ttcccttcct cgcccgccgt aataaataga caccccctcc acaccctctt 900

tccccaacct cgtgttgttc ggagcgcaca cacacacaac cagatctccc ccaaatccac 960

ccgtcggcac ctccgcttca aggtacgccg ctcgtcctcc cccccccccc ctctctacct 1020

tctctagatc ggcgttccgg tccatggtta gggcccggta gttctacttc tgttcatgtt 1080

tgtgttagat ccgtgtttgt gttagatccg tgctgctagc gttcgtacac ggatgcgacc 1140

tgtacgtcag acacgttctg attgctaact tgccagtgtt tctctttggg gaatcctggg 1200

atggctctag ccgttccgca gacgggatcg atttcatgat tttttttgtt tcgttgcata 1260

gggtttggtt tgcccttttc ctttatttca atatatgccg tgcacttgtt tgtcgggtca 1320

tcttttcatg cttttttttg tcttggttgt gatgatgtgg tctggttggg cggtcgttct 1380

agatcggagt agaattctgt ttcaaactac ctggtggatt tattaatttt ggatctgtat 1440

gtgtgtgcca tacatattca tagttacgaa ttgaagatga tggatggaaa tatcgatcta 1500

ggataggtat acatgttgat gcgggtttta ctgatgcata tacagagatg ctttttgttc 1560

gcttggttgt gatgatgtgg tgtggttggg cggtcgttca ttcgttctag atcggagtag 1620

aatactgttt caaactacct ggtgtattta ttaattttgg aactgtatgt gtgtgtcata 1680

catcttcata gttacgagtt taagatggat ggaaatatcg atctaggata ggtatacatg 1740

ttgatgtggg ttttactgat gcatatacat gatggcatat gcagcatcta ttcatatgct 1800

ctaaccttga gtacctatct attataataa acaagtatgt tttataatta ttttgatctt 1860

gatatacttg gatgatggca tatgcagcag ctatatgtgg atttttttag ccctgccttc 1920

atacgctatt tatttgcttg gtactgtttc ttttgtcgat gctcaccctg ttgtttggtg 1980

ttacttctgc ag 1992

<210> 16

<211> 1176

<212> DNA

<213> Escherichia coli

<400> 16

atgcaaaaac tcattaactc agtgcaaaac tatgcctggg gcagcaaaac ggcgttgact 60

gaactttatg gtatggaaaa tccgtccagc cagccgatgg ccgagctgtg gatgggcgca 120

catccgaaaa gcagttcacg agtgcagaat gccgccggag atatcgtttc actgcgtgat 180

gtgattgaga gtgataaatc gactctgctc ggagaggccg ttgccaaacg ctttggcgaa 240

ctgcctttcc tgttcaaagt attatgcgca gcacagccac tctccattca ggttcatcca 300

aacaaacaca attctgaaat cggttttgcc aaagaaaatg ccgcaggtat cccgatggat 360

gccgccgagc gtaactataa agatcctaac cacaagccgg agctggtttt tgcgctgacg 420

cctttccttg cgatgaacgc gtttcgtgaa ttttccgaga ttgtctccct actccagccg 480

gtcgcaggtg cacatccggc gattgctcac tttttacaac agcctgatgc cgaacgttta 540

agcgaactgt tcgccagcct gttgaatatg cagggtgaag aaaaatcccg cgcgctggcg 600

attttaaaat cggccctcga tagccagcag ggtgaaccgt ggcaaacgat tcgtttaatt 660

tctgaatttt acccggaaga cagcggtctg ttctccccgc tattgctgaa tgtggtgaaa 720

ttgaaccctg gcgaagcgat gttcctgttc gctgaaacac cgcacgctta cctgcaaggc 780

gtggcgctgg aagtgatggc aaactccgat aacgtgctgc gtgcgggtct gacgcctaaa 840

tacattgata ttccggaact ggttgccaat gtgaaattcg aagccaaacc ggctaaccag 900

ttgttgaccc agccggtgaa acaaggtgca gaactggact tcccgattcc agtggatgat 960

tttgccttct cgctgcatga ccttagtgat aaagaaacca ccattagcca gcagagtgcc 1020

gccattttgt tctgcgtcga aggcgatgca acgttgtgga aaggttctca gcagttacag 1080

cttaaaccgg gtgaatcagc gtttattgcc gccaacgaat caccggtgac tgtcaaaggc 1140

cacggccgtt tagcgcgtgt ttacaacaag ctgtaa 1176

<210> 17

<211> 22

<212> DNA

<213> Artificial Sequence-primer 1(Artificial Sequence)

<400> 17

gagggtgttg tggctggtat tg 22

<210> 18

<211> 23

<212> DNA

<213> Artificial Sequence-primer 2(Artificial Sequence)

<400> 18

tctcaactgt ccaatcgtaa gcg 23

<210> 19

<211> 25

<212> DNA

<213> Artificial Sequence-Probe 1(Artificial Sequence)

<400> 19

cttacgctgg gccctggaag gctag 25

Claims

1. A method for controlling meadow moth pests is characterized by comprising the step of contacting the meadow moth pests with Cry1Fa protein at least, wherein the amino acid sequence of the Cry1Fa protein is shown as SEQ ID NO. 1 or SEQ ID NO. 3.

2. The method of controlling a meadow moth pest of claim 1 wherein said Cry1Fa protein is present in a host cell that produces at least said Cry1Fa protein, said meadow moth pest being in contact with at least said Cry1Fa protein by feeding said host cell.

3. The method of controlling meadow moth pests according to claim 2, characterized in that the Cry1Fa protein is present in a bacterium or transgenic plant that produces at least the Cry1Fa protein, said meadow moth pests are contacted with at least the Cry1Fa protein by feeding tissue of said bacterium or transgenic plant, upon contact said meadow moth pests are inhibited from growing and/or caused to die, to effect control of meadow moth pest endangered plants.

4. The method of controlling meadow moth pests according to claim 3, wherein the tissue of the transgenic plant is a root, leaf, stem, fruit, tassel, ear, anther or filament.

5. The method of controlling meadow moth pests according to claim 3 or 4, wherein the plants are soybean, chenopodium album, sugar beet, sunflower, potato, hemp and corn.

6. The method for controlling meadow moth pests according to any one of claims 1 to 4, characterized in that the nucleotide sequence of the Cry1Fa protein is the nucleotide sequence shown as SEQ ID NO. 2 or SEQ ID NO. 4.

7. The method for controlling meadow moth pests according to claim 5, characterized in that the nucleotide sequence of the Cry1Fa protein is the nucleotide sequence shown as SEQ ID NO. 2 or SEQ ID NO. 4.

8. The method of controlling meadow moth pests according to any one of claims 3 to 4, 7, wherein said plant further comprises at least a second nucleotide different from the nucleotide encoding said Cry1Fa protein.

9. The method of controlling meadow moth pests according to claim 8, wherein the second nucleotide encodes a Cry-class insecticidal protein, a Vip-class insecticidal protein, a protease inhibitor, a lectin, an alpha-amylase or a peroxidase.

10. The method of controlling meadow moth pests according to claim 9, wherein the second nucleotide encodes a Vip3A protein or a Cry1A protein.

11. The method of controlling meadow moth pests of claim 10, wherein said second nucleotide encodes the amino acid sequence set forth in SEQ ID No. 5.

12. The method of controlling meadow moth pests of claim 11, wherein said second nucleotide is the nucleotide sequence set forth in SEQ ID No. 6.

13. The method of controlling a meadow moth pest according to claim 6 wherein said plant further comprises at least a second nucleotide different from the nucleotide encoding said Cry1Fa protein.

14. The method of controlling meadow moth pests according to claim 13, wherein the second nucleotide encodes a Cry-class insecticidal protein, a Vip-class insecticidal protein, a protease inhibitor, a lectin, an alpha-amylase or a peroxidase.

15. The method of controlling a meadow moth pest of claim 14 wherein said second nucleotide encodes a Vip3A protein or a Cry1A protein.

16. The method of controlling meadow moth pests of claim 15, wherein said second nucleotide encodes the amino acid sequence set forth in SEQ ID No. 5.

17. The method of controlling meadow moth pests of claim 16, wherein said second nucleotide is the nucleotide sequence set forth in SEQ ID No. 6.

18. The method of controlling a meadow moth pest according to claim 5 wherein said plant further comprises at least a second nucleotide different from the nucleotide encoding said Cry1Fa protein.

19. The method of controlling meadow moth pests according to claim 18, wherein said second nucleotide encodes a Cry-class insecticidal protein, a Vip-class insecticidal protein, a protease inhibitor, a lectin, an alpha-amylase or a peroxidase.

20. The method of controlling a meadow moth pest of claim 19 wherein said second nucleotide encodes a Vip3A protein or a Cry1A protein.

21. The method of controlling meadow moth pests of claim 20 wherein said second nucleotide encodes the amino acid sequence set forth in SEQ ID No. 5.

22. The method of controlling meadow moth pests of claim 21, wherein said second nucleotide is the nucleotide sequence set forth in SEQ ID No. 6.

23. The method of controlling meadow moth pests according to claim 8, wherein the second nucleotide is a dsRNA that inhibits a gene of interest in the target insect pest.

24. The application of the Cry1Fa protein in controlling meadow moth pests is characterized in that the amino acid sequence of the Cry1Fa protein is shown as SEQ ID NO. 1 or SEQ ID NO. 3.