WO2016101612A1

WO2016101612A1 - Pest control method

Info

Publication number: WO2016101612A1
Application number: PCT/CN2015/085048
Authority: WO
Inventors: 张爱红; 陶青; 李建勇; 王利君
Original assignee: 北京大北农科技集团股份有限公司; 北京大北农科技集团股份有限公司生物技术中心
Priority date: 2014-12-22
Filing date: 2015-07-24
Publication date: 2016-06-30
Also published as: CN104488945A; CN104488945B

Abstract

The present invention relates to a use of an insecticidal protein, a method for controlling a chilo infuscatellus pest comprising a step of enabling the chilo infuscatellus pest to be at least in contact with a Vip3A protein. The present invention controls the chilo infuscatellus pest by enabling plants to generate the Vip3A protein capable of killing the chilo infuscatellus. Compared with an agricultural control method, a chemical control method and a physical control method used in the prior art, the present invention protects the entirety of a plant during the whole growing period from attacks of the chilo infuscatellus pest, has no pollution, no residue and a stable and thorough effect, and is simple, convenient and economic.

Description

Method of controlling pests

Cross-reference to related applications

Priority is claimed on Japanese Patent Application No. 201410806573.3, filed on Dec.

Technical field

The present invention relates to the use of a pesticidal protein, and in particular to the use of a Vip3A protein to control a plant of the millet ash by expressing it in a plant.

Background technique

Chilo infuscatellus, also known as sugarcane mites, belongs to the family Lepidoptera, widely distributed in Southeast Asia, South Asia and China. It is mainly used in China for grass crops such as corn, sorghum, millet and sugar cane. The ash mites are stalk pests, which can cause dead plants after the plants are damaged. Under normal circumstances, the spring valley area and the spring and summer valley mixed area are heavy, and the Xiagu area is light.

Corn is an important food crop in China. With the strengthening of the global warming effect, the temperature has been rising in the past two years, and the types and quantities of pests have increased. The ash ash was once the main pest in North China and South China, mainly affecting sorghum, millet and sugar cane. However, in recent years, there have been a large number of reports on the damage of corn from the ash, and the damage is on the rise. At present, the damage to the ash ash is mainly based on agricultural control, chemical control and physical control.

Agricultural control is a comprehensive and coordinated management of multiple factors in the entire farmland ecosystem, regulating crops, pests, environmental factors, and creating a farmland ecological environment that is conducive to crop growth and is not conducive to the occurrence of millet ash. Because the ash ash is generally overwinter in the 10 cm remnant under the soil surface, it is possible to eliminate the dead leaves of the corn, sorghum, millet and sugar cane in time to eliminate the source of the overwinter insect. At the same time, the feeding habits of the ash can be relatively simple, and the rotation method is adopted to reduce the density of the insect source, for example, it can be rotated with broad-leaved crops such as soybean, cotton and vegetables. However, the economic benefits of different crops are different, and rotation is likely to cause farmers to reduce their income, which is difficult to implement.

Chemical control, that is, pesticide control, is the use of chemical pesticides to kill pests. It is an important part of the comprehensive management of millet ash. It is characterized by rapid, convenient, simple and high economic benefits, especially the occurrence of ash. In the case, it is an essential emergency measure. As a stolon pest, the ash ash is very important for the control period. The best period of application is before the egg hatching period to the larvae of the larvae. Otherwise, it will be difficult to achieve the purpose of prevention and control after the young larva breaks into the stalk. At present, chemical control methods are mainly liquid spray and application of poisonous soil. However, chemical control also has its limitations. If improper use, it will lead to phytotoxicity of crops, resistance to pests, killing natural enemies, polluting the environment, and making farmland ecology. The system is damaged and the pesticide residues pose a threat to the safety of people and animals.

Physical control mainly relies on the response of pests to various physical factors in environmental conditions, and uses various physical factors such as light, electricity, color, temperature and humidity, and mechanical equipment to induce pests, radiation infertility and other methods to control pests. At present, the most widely used is the frequency-vibration insecticidal lamp trapping, which utilizes the phototaxis of pest adults, uses light at close range, uses waves at a long distance, attracts insects close to each other, and has certain effects on the prevention and control of adult worms; The insecticidal lamp needs to clean the dirt on the high-voltage power grid every day, otherwise it will affect the insecticidal effect; and it can't turn on the light in thunderstorm days, there is also the danger of electric shock in the operation; in addition, the one-time investment of installing the lamp is larger .

In order to solve the limitations of agricultural control, chemical control and physical control in practical applications, scientists have discovered that insect-resistant genes encoding insecticidal proteins from Bacillus thuringiensis can be transferred into plants to obtain some insect-resistant transgenic plants. To control plant pests. Vip3A insecticidal protein is one of many insecticidal proteins and is a specific protein produced by Bacillus cereus.

The Vip3A protein has a toxic effect on sensitive insects by activating apoptosis-type programmed cell death. The Vip3A protein is hydrolyzed into four major protein products in the insect gut, of which only one protein hydrolysate (33KD) is the toxic core structure of the Vip3A protein. The Vip3A protein binds to the midgut epithelial cells of sensitive insects, initiates programmed cell death, and causes the dissolution of midgut epithelial cells leading to insect death. It does not cause any symptoms to non-sensitive insects and does not cause apoptosis and dissolution of midgut epithelial cells.

Plants transfected with the Vip3A gene have been shown to be resistant to Lepidoptera pests such as the genus Lepidoptera, Spodoptera frugiperda, Euphorbia gracilis, and Spodoptera frugiperda. However, to date, no transgenic plants expressing the Vip3A protein have been produced. Report on the damage of plant ash to plants.

Summary of the invention

The object of the present invention is to provide a use of a pesticidal protein, for the first time, to provide a method for controlling the damage of a plant by using a transgenic plant expressing a Vip3A protein, and effectively overcoming the prior art agricultural control, chemical control and physical control And other technical defects.

To achieve the above object, the present invention provides the following technical solutions, specifically:

In one aspect, the invention provides a method of controlling a mites pest, comprising contacting a mites pest with at least a Vip3A protein;

Preferably, the Vip3A protein is present in a host cell that produces at least the Vip3A protein, and the millet worm is in contact with at least the Vip3A protein by ingesting the host cell;

More preferably, the Vip3A protein is present in a bacterium or a transgenic plant that produces at least the Vip3A protein, the mulberry pest is at least in contact with the Vip3A protein by ingesting the tissue of the bacterium or the transgenic plant, after contact The growth of the worms is inhibited and/or caused to death. To die, to achieve control of the plants that harm the ash.

Further, according to the method for controlling the pests of the mites, as described above, the transgenic plants may be in any growth period; and/or

The tissue of the transgenic plant is a leaf, a stalk, a fruit, a tassel, an ear, an anther or a filament; and/or

The control of the plants against the ash mites does not change due to changes in the location and/or planting time.

Further, the plant is corn, sorghum, millet, sugar cane, rice, wheat, barley or oats according to the method for controlling the pests of the ash.

Further, according to the method of controlling a mites pest as described above, the step before the contacting step is planting a plant containing a polynucleotide encoding the Vip3A protein.

Further, the amino acid sequence of the Vip3A protein has the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3 according to the method for controlling the pest of the worm;

Preferably, the nucleotide sequence of the Vip3A protein has the nucleotide sequence shown in SEQ ID NO: 2 or SEQ ID NO: 4.

Further, the plant may further comprise at least one second nucleotide different from the nucleotide encoding the Vip3A protein, according to the method for controlling the pest of the mites, as described above;

Preferably, the second nucleotide encodes a Cry-like insecticidal protein, a Vip-like insecticidal protein, a protease inhibitor, a lectin, an alpha-amylase or a peroxidase;

More preferably, the second nucleotide encodes a Cry1Ab protein;

Further preferably, the amino acid sequence of the Cry1Ab protein has the amino acid sequence shown in SEQ ID NO: 5;

Most preferably, the nucleotide sequence of the Cry1Ab protein has the nucleotide sequence set forth in SEQ ID NO: 6.

Further, according to the method for controlling a mites pest as described above, the second nucleotide is a dsRNA which inhibits an important gene in a target insect pest.

Further, according to the method of controlling a mites pest as described above, wherein the millet mites are in a crop field.

In another aspect, the invention provides the use of a Vip3A protein for controlling a pest of the mites.

In still another aspect, the invention provides the use of a plant cell, plant or plant part of the Vip3A gene to control a large pest.

In still another aspect, the present invention provides a method of producing a plant that controls a pest of a worm, including A polynucleotide sequence encoding a Vip3A protein is introduced into the genome of the plant.

In still another aspect, the present invention provides a method of producing a plant propagule for controlling a mites pest, comprising crossing a first plant obtained by the method as described above with a second plant, and/or removing as described above The fertile tissue on the plants obtained by the method is cultured to produce a plant propagule containing a polynucleotide sequence encoding a Vip3A protein.

In another aspect, the invention provides a plant propagule for controlling a mites pest, the plant propagule comprising a polynucleotide sequence encoding a Vip3A protein.

In still another aspect, the present invention provides a method of cultivating a plant for controlling a mites pest, comprising:

Planting at least one plant propagule comprising a polynucleotide sequence encoding a Vip3A protein in the genome of the plant propagule;

Causing the plant propagule into a plant;

The plants are grown under conditions in which the artificially inoculated pests of the mites and/or the mites are naturally at risk, and the plants are harvested with reduced plant damage and/or compared to other plants that do not have the polynucleotide sequence encoding the Vip3A protein. Or plants with increased plant yield.

In still another aspect, the present invention provides a plant for controlling the control of a mites pest according to the method described above.

In still another aspect, the present invention provides a plant cell, plant or plant part for controlling a mites pest, the genome of the plant cell, plant or plant part comprising a polynucleotide sequence encoding a Vip3A protein;

Further, according to the plant cell, plant or plant part as described above, wherein the plant is selected from the group consisting of corn, sorghum, millet, sugar cane, rice, wheat, barley and oats, and wherein the plant part For seeds, leaves, stems, fruits, tassels, ears, anthers, filaments, roots or any part thereof.

"Plant propagules" as used in the present invention include, but are not limited to, plant sexual propagules and plant asexual propagules. The plant sexual propagule includes, but is not limited to, a plant seed; the plant asexual propagule refers to a vegetative organ of a plant body or a special tissue which can produce a new plant under ex vivo conditions; the vegetative organ or a certain Specific tissues include, but are not limited to, roots, stems and leaves, for example: plants with roots as vegetative propagules including strawberries and sweet potatoes; plants with stems as vegetative propagules including sugar cane and potatoes (tubers), etc.; leaves as asexual Plants of the propagule include aloe vera and begonia.

"Contact" as used in the present invention means that insects and/or pests touch, stay and/or ingest plants, plant organs, plant tissues or plant cells, and the plants, plant organs, plant tissues or plant cells can It is a pesticidal protein expressed in the body, and may also be a microorganism having a pesticidal protein on the surface of the plant, plant organ, plant tissue or plant cell and/or having a pesticidal protein.

The term "control" and/or "control" in the present invention means that the mites are at least in contact with the Vip3A protein, and the growth of the larvae is inhibited and/or causes death after contact. Further, the larvae of the larvae are at least contacted with the Vip3A protein by ingesting the plant tissue, and all or part of the growth of the larvae are inhibited and/or cause death after the contact. Inhibition refers to sublethal death, that is, it has not been killed but can cause certain effects in growth, behavior, behavior, physiology, biochemistry and organization, such as slow growth and/or cessation. At the same time, the plants should be morphologically normal and can be cultured under conventional methods for consumption and/or production of the product. In addition, plants and/or plant seeds containing a polynucleotide sequence encoding a Vip3A protein that control the larvae of the larvae are inoculated with artificially inoculated pests of the mites and/or the mites, and non-transgenic Wild-type plants have reduced plant damage compared to specific manifestations including, but not limited to, improved stem resistance, and/or increased kernel weight, and/or increased yield, and the like. The "control" and / or "control" effects of the Vip3A protein on the ash can be independent and not attenuated and/or disappeared by other substances that can "control" and/or "control" the worms. . Specifically, any tissue of a transgenic plant (containing a polynucleotide sequence encoding a Vip3A protein) is present and/or asynchronously, present and/or produced, a Vip3A protein and/or another substance that can control the pest of the mites, The presence of the other substance neither affects the "control" and/or "control" effect of the Vip3A protein on the ash, nor does it result in complete and/or partial "control" and/or "control" effects. It is achieved by the other substance, but not by the Vip3A protein. In general, in the field, the process of feeding on plant tissues by the larvae is short-lived and difficult to observe with the naked eye. Therefore, under the conditions of artificial inoculation of the pests of the mites and/or the worms, such as genetically modified Any tissue of a plant (containing a polynucleotide sequence encoding a Vip3A protein) is present in a dead mites pest, and/or a sphagnum pest in which growth growth is inhibited, and/or with a non-transgenic wild-type plant The method and/or use of the present invention is achieved by having reduced plant damage, i.e., by contacting the Vip3A protein with at least the V. sinensis pest to achieve a method and/or use for controlling the mites.

In the present invention, expression of the Vip3A protein in a transgenic plant may be accompanied by expression of one or more Cry-like insecticidal proteins and/or Vip-like insecticidal proteins. Co-expression of such more than one insecticidal toxin in the same transgenic plant can be achieved by genetic engineering to allow the plant to contain and express the desired gene. In addition, one plant (the first parent) can express the Vip3A protein by genetic engineering, and the second plant (the second parent) can express the Cry-like insecticidal protein and/or the Vip-like insecticidal protein by genetic engineering operations. Progeny plants expressing all of the genes introduced into the first parent and the second parent are obtained by hybridization of the first parent and the second parent.

RNA interference (RNAi) is highly conserved during evolution. A phenomenon in which homologous mRNA is efficiently and specifically degraded by double-stranded RNA (dsRNA). Therefore, in the present invention, RNAi technology can be used to specifically knock out or shut down the expression of a specific gene in a target insect pest.

In the classification system, the lepidoptera is generally divided into suborders, superfamily, and family according to the morphological characteristics of the worm's veins, linkages, and types of antennae, while the genus Lepidoptera is the most diverse species of Lepidoptera. One of the departments has found more than 10,000 types in the world, and there are thousands of records in China alone. Most of the moths are pests of crops, most of which are in the form of stolons, such as stem borer and corn borer. Although the ash mites are similar to the mites and corn borers, they belong to the order Lepidoptera, and there are great differences in other morphological structures except for the similarity in the classification criteria; it is like the strawberry in the plant and the apple ( They belong to the genus Rosaceae, which have the characteristics of flower bisexuality, radiation symmetry, and 5 petals, but their fruits and plant morphology are very different. The ash ash has its unique characteristics in terms of larval morphology and adult morphology. For example, in the longitudinal line of the back, among the peasants, there is a rumored "high glutinous corn valley, the back line is three or four five", which means that the sorghum sorghum, corn stalk and ash scorpion belonging to the genus Mothidae have obvious numbers on the top line. difference. Under the longitudinal line of the back is the dorsal blood vessel. The dorsal blood vessel is an important part of the insect circulatory organ. The inside is filled with the hemolymph called the insect "blood". Therefore, the difference in the number of top lines on the surface of the body appears to reflect the difference in the back vessels, which is the difference in the insect circulation system.

Insects belonging to the genus Mothidae not only have large differences in morphological characteristics, but also have differences in feeding habits. For example, the stem borer of the same family is mainly harmful to rice, and rarely harms other grass crops. However, there have been no reports of damage to rice caused by millet ash, and more is caused by sugar cane in the south, sorghum, millet and corn in the north. The difference in feeding habits also suggests that the enzymes and receptor proteins produced by the digestive system in the body are different. The enzyme produced in the digestive tract is the key point of the Bt gene function. Only the enzyme or receptor protein that can bind to the specific Bt gene may make a certain Bt gene have an insect resistance effect on the pest. More and more studies have shown that insects of different families and even different families have different sensitivities to the same Bt protein. For example, the Vip3A gene showed anti-insect activity against Chilo suppressalis and Ostrinia furnacalis, but for Plodia interpunctella and European corn borer (of the same family) Ostrinia nubilalis has no insect resistance. The above four pests belong to the family Lepidoptera, but the same kind of Bt protein has different resistance effects to the four species of the moth. In particular, European corn borer and Asian corn borer are classified in the same species as the Ostrinia genus (the same genus), but their response to the same Bt protein is quite different, which further demonstrates the Bt protein and The way enzymes and receptors interact in insects is complex and unpredictable.

The genome of a plant, plant tissue or plant cell as referred to in the present invention refers to any genetic material within a plant, plant tissue or plant cell, and includes the nucleus and plastid and mitochondrial genomes.

The polynucleotides and/or nucleotides described in the present invention form a complete "gene", which is fine in the desired host The cell encodes a protein or polypeptide. One of skill in the art will readily recognize that the polynucleotides and/or nucleotides of the invention can be placed under the control of regulatory sequences in a host of interest.

As is well known to those skilled in the art, DNA typically exists in a double stranded form. In this arrangement, one chain is complementary to the other and vice versa. Since DNA is replicated in plants, other complementary strands of DNA are produced. Thus, the invention encompasses the use of the polynucleotides exemplified in the Sequence Listing and their complementary strands. A "coding strand" as commonly used in the art refers to a strand that binds to the antisense strand. To express a protein in vivo, one strand of DNA is typically transcribed into a complementary strand of mRNA that is used as a template to translate the protein. mRNA is actually transcribed from the "antisense" strand of DNA. A "sense" or "encoding" strand has a series of codons (codons are three nucleotides, three reads at a time to produce a particular amino acid), which can be read as an open reading frame (ORF) to form a protein or peptide of interest. The invention also includes RNA that is functionally equivalent to the exemplified DNA.

The nucleic acid molecule or fragment thereof of the present invention hybridizes to the Vip3A gene of the present invention under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of the Vip3A gene of the present invention. A nucleic acid molecule or fragment thereof is capable of specifically hybridizing to other nucleic acid molecules under certain circumstances. In the present invention, if two nucleic acid molecules can form an anti-parallel double-stranded nucleic acid structure, it can be said that the two nucleic acid molecules are capable of specifically hybridizing each other. If two nucleic acid molecules exhibit complete complementarity, one of the nucleic acid molecules is said to be the "complement" of the other nucleic acid molecule. In the present invention, when each nucleotide of one nucleic acid molecule is complementary to a corresponding nucleotide of another nucleic acid molecule, the two nucleic acid molecules are said to exhibit "complete complementarity". Two nucleic acid molecules are said to be "minimally complementary" if they are capable of hybridizing to one another with sufficient stability such that they anneal under at least conventional "low stringency" conditions and bind to each other. Similarly, two nucleic acid molecules are said to be "complementary" if they are capable of hybridizing to one another with sufficient stability such that they anneal under conventional "highly stringent" conditions and bind to each other. Deviation from complete complementarity is permissible as long as such deviation does not completely prevent the two molecules from forming a double-stranded structure. In order for a nucleic acid molecule to function as a primer or probe, it is only necessary to ensure that it is sufficiently complementary in sequence to allow for the formation of a stable double-stranded structure at the particular solvent and salt concentration employed.

In the present invention, a substantially homologous sequence is a nucleic acid molecule that is capable of specifically hybridizing to a complementary strand of another matched nucleic acid molecule under highly stringent conditions. Suitable stringent conditions for promoting DNA hybridization, for example, treatment with 6.0 x sodium chloride / sodium citrate (SSC) at about 45 ° C, followed by washing with 2.0 x SSC at 50 ° C, these conditions are known to those skilled in the art. It is well known. For example, the salt concentration in the washing step can be selected from about 2.0 x SSC under low stringency conditions, 50 ° C to about 0.2 x SSC, 50 ° C under highly stringent conditions. Further, the temperature conditions in the washing step can be raised from a low temperature strict room temperature of about 22 ° C to about 65 ° C under highly stringent conditions. Both the temperature conditions and the salt concentration can be changed, or one of them remains unchanged while the other variable changes. Preferably, the stringent conditions of the present invention may be in a 6 x SSC, 0.5% SDS solution. Specifically, specific hybridization with SEQ ID NO: 2 occurred at 65 ° C, and then the membrane was washed once with 2 x SSC, 0.1% SDS, and 1 x SSC, 0.1% SDS.

Therefore, a sequence having insect resistance and hybridizing to SEQ ID NO: 2 of the present invention under stringent conditions is included in the present invention. These sequences are at least about 40%-50% homologous to the sequences of the invention, about 60%, 65% or 70% homologous, even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93. Sequence homology of %, 94%, 95%, 96%, 97%, 98%, 99% or greater.

The genes and proteins described in the present invention include not only specific exemplary sequences, but also portions and/or fragments that retain the insecticidal activity characteristics of the proteins of the specific examples (including internal and/or end ratios compared to full length proteins). Deletions), variants, mutants, substitutions (proteins with alternative amino acids), chimeras and fusion proteins. By "variant" or "variant" is meant a nucleotide sequence that encodes the same protein or an equivalent protein encoded with insecticidal activity. The "equivalent protein" refers to a protein having the same or substantially the same biological activity as the anti-mite pest of the protein of the claims.

A "fragment" or "truncated" sequence of a DNA molecule or protein sequence as used in the present invention refers to a portion of the original DNA or protein sequence (nucleotide or amino acid) involved or an artificially engineered form thereof (eg, a sequence suitable for plant expression) The length of the aforementioned sequence may vary, but is of sufficient length to ensure that the (encoding) protein is an insect toxin.

Genes can be modified and gene variants can be easily constructed using standard techniques. For example, techniques for making point mutations are well known in the art. Further, for example, U.S. Patent No. 5,605,793 describes a method of using DNA reassembly to generate other molecular diversity after random fragmentation. Fragments of full-length genes can be made using commercial endonucleases, and exonucleases can be used according to standard procedures. For example, nucleotides can be systematically excised from the ends of these genes using enzymes such as Bal31 or site-directed mutagenesis. A gene encoding an active fragment can also be obtained using a variety of restriction enzymes. Active fragments of these toxins can be obtained directly using proteases.

The present invention may derive equivalent proteins and/or genes encoding these equivalent proteins from B.t. isolates and/or DNA libraries. There are various methods for obtaining the pesticidal protein of the present invention. For example, antibodies to the pesticidal proteins disclosed and claimed herein can be used to identify and isolate other proteins from protein mixtures. In particular, antibodies may be caused by protein portions that are most constant in protein and most different from other B.t. proteins. These antibodies can then be used to specifically identify a characteristically active equivalent protein by immunoprecipitation, enzyme-linked immunosorbent assay (ELISA) or western blotting. Antibodies of the proteins disclosed herein or equivalent proteins or fragments of such proteins can be readily prepared using standard procedures in the art. Genes encoding these proteins can then be obtained from microorganisms.

Due to the abundance of the genetic code, a variety of different DNA sequences can encode the same amino acid sequence. It is within the skill of the art to produce alternative DNA sequences that encode the same or substantially the same protein. These different DNA sequences are included within the scope of the invention. The "substantially identical" sequence refers to an amino acid substitution, deletion, addition or insertion but is not substantially Sequences that affect insecticidal activity also include fragments that retain insecticidal activity.

Substitution, deletion or addition of an amino acid sequence in the present invention is a conventional technique in the art, and it is preferred that such an amino acid change is: a small change in properties, that is, a conservative amino acid substitution that does not significantly affect the folding and/or activity of the protein; a small deletion, Typically a deletion of about 1-30 amino acids; a small amino or carboxy terminal extension, such as a methionine residue at the amino terminus; and a small linker peptide, for example about 20-25 residues in length.

Examples of conservative substitutions are substitutions occurring within the following amino acid groups: basic amino acids (such as arginine, lysine, and histidine), acidic amino acids (such as glutamic acid and aspartic acid), polar amino acids ( Such as glutamine, asparagine, hydrophobic amino acids (such as leucine, isoleucine and valine), aromatic amino acids (such as phenylalanine, tryptophan and tyrosine), and small molecules Amino acids (such as glycine, alanine, serine, threonine, and methionine). Those amino acid substitutions that generally do not alter a particular activity are well known in the art and have been described, for example, by N. Neurath and R. L. Hill, "Protein", published at the 1979 New York Academic Press. The most common interchanges are Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, and their opposite interchanges.

It will be apparent to those skilled in the art that such substitutions can occur outside of the regions that are important for molecular function and still produce active polypeptides. For amino acids from the polypeptides of the invention that are essential for their activity and are therefore selected for unsubstitution, they can be identified according to methods known in the art, such as site-directed mutagenesis or alanine scanning mutagenesis (see, for example, Cunningham and Wells). , 1989, Science 244: 1081-1085). The latter technique introduces a mutation at each positively charged residue in the molecule, and detects the insecticidal activity of the resulting mutant molecule, thereby determining an amino acid residue important for the activity of the molecule. The substrate-enzyme interaction site can also be determined by analysis of its three-dimensional structure, which can be determined by techniques such as nuclear magnetic resonance analysis, crystallography or photoaffinity labeling (see, eg, de Vos et al., 1992, Science 255). : 306-312; Smith et al, 1992, J. Mol. Biol 224: 899-904; Wlodaver et al, 1992, FEBS Letters 309: 59-64).

In the present invention, the Vip3A protein includes, but is not limited to, Sequence 1, and an amino acid sequence having a certain homology with the amino acid sequence shown in SEQ ID NO: 1 is also included in the present invention. These sequences are typically more than 60%, preferably greater than 75%, more preferably greater than 80%, even more preferably greater than 90%, and may be greater than 95%, similar to the sequences of the present invention. Preferred polynucleotides and proteins of the invention may also be defined according to a more specific range of identity and/or similarity. For example, the sequence of the example of the present invention is 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79% , 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity and/or similarity.

In the present invention, a transgenic plant producing the Vip3A protein includes, but is not limited to, a COT102 transgenic cotton event and/or a plant material comprising a COT102 transgenic cotton event (as described in CN1004395507C), a COT202 transgenic cotton event, and/or comprises a COT202 The plant material of the transgenic cotton event (as described in CN1886513A), or the MIR162 transgenic maize event and/or the plant material comprising the MIR162 transgenic cotton event (as described in CN101548011A), which can both implement the method of the invention and/or Or use, that is, by contacting at least a Vip3A protein with a larvae pest to achieve a method and/or use for controlling a mites pest, more specifically, the Vip3A protein is present in at least a transgenic plant producing the Vip3A protein, The seed of the ash worm is in contact with at least the Vip3A protein by ingesting the tissue of the transgenic plant, and the growth of the mites pest is inhibited and/or caused to death after the contact to achieve control of the plant against the ash mites.

Regulatory sequences of the invention include, but are not limited to, promoters, transit peptides, terminators, enhancers, leader sequences, introns, and other regulatory sequences operably linked to the Vip3A protein.

The promoter is a promoter expressible in a plant, and the "promoter expressible in a plant" refers to a promoter which ensures expression of a coding sequence linked thereto in a plant cell. A promoter expressible in a plant can be a constitutive promoter. Examples of promoters that direct constitutive expression in plants include, but are not limited to, the 35S promoter derived from cauliflower mosaic virus, the maize Ubi promoter, the promoter of the rice GOS2 gene, and the like. Alternatively, a promoter expressible in a plant may be a tissue-specific promoter, ie the promoter directs the expression level of the coding sequence in some tissues of the plant, such as in green tissue, to be higher than other tissues of the plant (through conventional The RNA assay is performed), such as the PEP carboxylase promoter. Alternatively, a promoter expressible in a plant can be a wound-inducible promoter. A wound-inducible promoter or a promoter that directs a wound-inducible expression pattern means that when the plant is subjected to mechanical or wounding by insect foraging, the expression of the coding sequence under the control of the promoter is significantly improved compared to normal growth conditions. Examples of wound-inducible promoters include, but are not limited to, promoters of protease inhibitory genes (pin I and pin II) and maize protease inhibitory genes (MPI) of potato and tomato.

The transit peptide (also known as a secretion signal sequence or targeting sequence) directs the transgene product to a particular organelle or cell compartment, and for the receptor protein, the transit peptide can be heterologous, for example, using a coding chloroplast transporter The peptide sequence targets the chloroplast, or targets the endoplasmic reticulum using the 'KDEL' retention sequence, or the CTPP-targeted vacuole using the barley plant lectin gene.

The leader sequence includes, but is not limited to, a picornavirus leader sequence, such as an EMCV leader sequence (5' non-coding region of encephalomyocarditis virus); a potato virus group leader sequence, such as a MDMV (maize dwarf mosaic virus) leader sequence; Human immunoglobulin protein heavy chain binding protein (BiP); untranslated leader sequence of the coat protein mRNA of alfalfa mosaic virus (AMV RNA4); tobacco mosaic virus (TMV) leader sequence.

The enhancer includes, but is not limited to, a cauliflower mosaic virus (CaMV) enhancer, a figwort mosaic virus (FMV) enhancer, a carnation weathering ring virus (CERV) enhancer, and a cassava vein mosaic virus (CsVMV) enhancer. , Purple Jasmine Mosaic Virus (MMV) enhancer, Night fragrant yellow leaf curl virus (CmYLCV) enhancer, Multan cotton leaf curl virus (CLCuMV), Acanthus yellow mottle virus (CoYMV) and peanut chlorotic line flower Leaf virus (PCLSV) enhancer.

For monocot applications, the introns include, but are not limited to, maize hsp70 introns, maize ubiquitin introns, Adh introns 1, sucrose synthase introns, or rice Actl introns. For dicotyledonous applications, the introns include, but are not limited to, the CAT-1 intron, the pKANNIBAL intron, the PIV2 intron, and the "super ubiquitin" intron.

The terminator may be a suitable polyadenylation signal sequence that functions in plants, including but not limited to, a polyadenylation signal sequence derived from the Agrobacterium tumefaciens nopaline synthase (NOS) gene. a polyadenylation signal sequence derived from the protease inhibitor II (pin II) gene, a polyadenylation signal sequence derived from the pea ssRUBISCO E9 gene, and a gene derived from the α-tubulin gene. Polyadenylation signal sequence.

As used herein, "operably linked" refers to the joining of nucleic acid sequences that allow one sequence to provide the function required for the linked sequence. The "operably linked" in the present invention may be such that the promoter is ligated to the sequence of interest such that transcription of the sequence of interest is controlled and regulated by the promoter. "Effective ligation" when a sequence of interest encodes a protein and is intended to obtain expression of the protein means that the promoter is ligated to the sequence in a manner that allows efficient translation of the resulting transcript. If the linker of the promoter to the coding sequence is a transcript fusion and it is desired to effect expression of the encoded protein, such ligation is made such that the first translation initiation codon in the resulting transcript is the start codon of the coding sequence. Alternatively, if the linkage of the promoter to the coding sequence is a translational fusion and it is desired to effect expression of the encoded protein, such linkage is made such that the first translation initiation codon and promoter contained in the 5' untranslated sequence Linked and linked such that the resulting translation product is in frame with the translational open reading frame encoding the desired protein. Nucleic acid sequences that may be "operably linked" include, but are not limited to, sequences that provide for gene expression functions (ie, gene expression elements such as promoters, 5' untranslated regions, introns, protein coding regions, 3' untranslated regions, poly Adenylation site and/or transcription terminator), sequences that provide DNA transfer and/or integration functions (ie, T-DNA border sequences, site-specific recombinase recognition sites, integrase recognition sites), provide options Sexually functional sequences (ie, antibiotic resistance markers, biosynthetic genes), sequences that provide for the function of scoring markers, sequences that facilitate sequence manipulation in vitro or in vivo (ie, polylinker sequences, site-specific recombination sequences) and provision The sequence of the replication function (ie, the origin of replication of the bacteria, the autonomously replicating sequence, the centromeric sequence).

"Insecticide" or "insect-resistant" as used in the present invention means toxic to crop pests, thereby achieving "control" and/or "control" of crop pests. Preferably, said "insecticide" or "insect-resistant" means killing crop pests. More specifically, the target insect is a mites pest.

In the present invention, the Vip3A protein is toxic to the mites. The plants of the present invention, particularly millet, sugar cane, sorghum and corn, contain exogenous DNA in their genome, the exogenous DNA comprising a nucleotide sequence encoding a Vip3A protein, which is fed by a plant tissue The protein is contacted and the growth of the insects is inhibited and/or causes death after exposure. Inhibition refers to death or sub-lethal death. At the same time, the plants should be morphologically normal and can be cultured under conventional methods for consumption and/or production of the product. In addition, the plant substantially eliminates the need for chemical or biological insecticides that are insecticides against the mites pests targeted by the Vip3A protein.

The expression level of insecticidal crystal protein (ICP) in plant material can be detected by various methods described in the art, for example, by using specific primers to quantify the mRNA encoding the insecticidal protein produced in the tissue, or directly specific The amount of insecticidal protein produced is detected.

Different tests can be applied to determine the insecticidal effect of ICP in plants. The target insects in the present invention are mainly milled ash.

In the present invention, the Vip3A protein may have the amino acid sequence shown by SEQ ID NO: 1 in the Sequence Listing. In addition to the coding region comprising the Vip3A protein, other elements may be included, such as a protein encoding a selectable marker.

Furthermore, an expression cassette comprising a nucleotide sequence encoding a Vip3A protein of the invention may also be expressed in a plant together with at least one protein encoding a herbicide resistance gene including, but not limited to, oxalic acid Phospho-resistant genes (such as bar gene, pat gene), benthamiana resistance genes (such as pmph gene), glyphosate resistance genes (such as EPSPS gene), bromoxynil resistance gene, sulfonylurea Resistance gene, resistance gene to herbicide tortoise, resistance gene to cyanamide or glutamine synthetase inhibitor (such as PPT), thereby obtaining high insecticidal activity and weeding Agent-resistant transgenic plants.

In the present invention, the foreign DNA is introduced into a plant, such as a gene encoding the Vip3Aa protein or an expression cassette or a recombinant vector, and the conventional transformation methods include, but are not limited to, Agrobacterium-mediated transformation, micro-launch bombardment, Direct DNA uptake into protoplast, electroporation or whisker silicon-mediated DNA introduction.

The present invention provides the use of a pesticidal protein with the following advantages:

1. Internal cause prevention. The prior art mainly controls the harm of the mites and pests through external action, ie, external factors, such as agricultural control, chemical control and physical control; and the present invention controls the ash by producing a Vip3A protein capable of killing the ash in the plant. The pests are controlled by internal factors.

2, no pollution, no residue. Although the chemical control method used in the prior art plays a certain role in controlling the damage of the mites and pests, it also brings pollution, damage and residue to the human, livestock and farmland ecosystems; using the present invention to control the worms The method can eliminate the above-mentioned adverse consequences.

3. Prevention and control during the whole growth period. The methods used in the prior art for controlling the pests of the worms are staged, and the present invention protects the plants during the whole growth period, and the transgenic plants (Vip3A protein) are Germination, growth, until the flowering, the result, can avoid the invasion of the ash.

4. Whole plant control. The methods used in the prior art to control the mites are mostly local, such as foliar application; while the present invention protects the entire plant, such as the leaves, stems, fruits, and males of the transgenic plants (Vip3A protein). Ears, ears, anthers or filaments are all resistant to the damage of the ash.

5, the effect is stable. The frequency-vibration insecticidal lamp used in the prior art not only needs to clean the dirt of the high-voltage power grid every day, but also cannot be used in thunderstorm days; the invention makes the Vip3A protein express in the plant body, effectively overcomes the frequency vibration type killing The effect of the insect lamp is affected by external factors, and the control effect of the transgenic plant (Vip3A protein) of the invention is stable and consistent at different locations, at different times, and in different genetic backgrounds.

6, simple, convenient and economical. The one-time input of the frequency-vibration insecticidal lamp used in the prior art is large, and the operation is improper and there is a danger of electric shock wounding; the invention only needs to plant a transgenic plant capable of expressing the Vip3A protein without using other measures. , which saves a lot of manpower, material resources and financial resources.

7, the effect is thorough. The method for controlling the mites and pests used in the prior art has the effect of being incomplete and only has a mitigating effect; while the transgenic plant of the present invention (Vip3A protein) has almost 100% control effect on the newly hatched larvae of the larvae. Individual surviving larvae also basically stopped development. After 3 days, the larvae were still in the initial hatching state, all of which were obviously dysplastic, and had stopped developing, and could not survive in the natural environment of the field, while the transgenic plants were generally only slightly damaged.

The technical solution of the present invention will be further described in detail below through the accompanying drawings and embodiments.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is a flow chart showing the construction of a recombinant cloning vector DBN01-T containing a Vip3A nucleotide sequence for use of the insecticidal protein of the present invention;

Figure 2 is a flow chart showing the construction of a recombinant expression vector DBN10002 containing a Vip3A nucleotide sequence for use of the insecticidal protein of the present invention;

Figure 3 is a diagram showing the damage of leaves of the transgenic corn plants inoculated with the ash mites according to the use of the insecticidal protein of the present invention;

Figure 4 is a diagram showing the damage of the leaves of the transgenic sugarcane plants inoculated with the worms of the present invention;

Figure 5 is a diagram showing the damage of the leaves of the transgenic sorghum plant inoculated with the ash sorghum of the present invention;

Figure 6 is a diagram showing the damage of leaves of transgenic millet plants inoculated with millet mites for the use of the insecticidal protein of the present invention.

The best way to implement the invention

The technical solution for the use of the insecticidal protein of the present invention is further illustrated by specific examples.

First embodiment, gene acquisition and synthesis

1. Obtain nucleotide sequence

The amino acid sequence of Vip3A-01 insecticidal protein (789 amino acids), as shown in SEQ ID NO: 1 in the Sequence Listing; Vip3A-01 encoding the amino acid sequence (789 amino acids) corresponding to the Vip3A-01 insecticidal protein Nucleotide sequence (2370 nucleotides) as shown in SEQ ID NO: 2 in the Sequence Listing. The amino acid sequence of Vip3A-02 insecticidal protein (789 amino acids), as shown in SEQ ID NO: 3 in the Sequence Listing; Vip3A-02 encoding the amino acid sequence (789 amino acids) corresponding to the Vip3A-02 insecticidal protein Nucleotide sequence (2370 nucleotides) as shown in SEQ ID NO: 4 of the Sequence Listing.

The amino acid sequence of Cry1Ab insecticidal protein (615 amino acids), as shown in SEQ ID NO: 5 in the Sequence Listing; the Cry1Ab nucleotide sequence encoding the amino acid sequence (615 amino acids) corresponding to the Cry1Ab insecticidal protein (1848) Nucleotides), as shown in SEQ ID NO: 6 in the Sequence Listing.

2. Synthesis of the above nucleotide sequence

The Vip3A-01 nucleotide sequence (as shown in SEQ ID NO: 2 in the Sequence Listing), the Vip3A-02 nucleotide sequence (as shown in SEQ ID NO: 4 in the Sequence Listing), the Cry1Ab core The nucleotide sequence (as shown in SEQ ID NO: 6 in the Sequence Listing) was synthesized by Nanjing Kingsray Biotechnology Co., Ltd.; the 5' end of the synthesized Vip3A-01 nucleotide sequence (SEQ ID NO: 2) was also The ScaI cleavage site is ligated, and the 3' end of the Vip3A-01 nucleotide sequence (SEQ ID NO: 2) is further ligated with a SpeI cleavage site; the synthesized Vip3A-02 nucleotide sequence (SEQ The 5' end of ID NO: 4) is also ligated with a ScaI cleavage site, and the 3' end of the Vip3A-02 nucleotide sequence (SEQ ID NO: 4) is also ligated with a SpeI cleavage site; The 5' end of the Cry1Ab nucleotide sequence (SEQ ID NO: 6) is also ligated with an NcoI cleavage site, and the 3' end of the Cry1Ab nucleotide sequence (SEQ ID NO: 6) is also ligated with BamHI. Site.

Second embodiment, construction of recombinant expression vector and recombinant expression vector for transformation of Agrobacterium

1. Construction of a recombinant cloning vector containing the Vip3A gene

The synthetic Vip3A-01 nucleotide sequence was ligated into the cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600), and the procedure was carried out according to the Promega product pGEM-T vector specification to obtain a recombinant cloning vector DBN01-T. The construction process is shown in Figure 1 (wherein Amp represents the ampicillin resistance gene; f1 represents the origin of replication of phage f1; LacZ is the LacZ start codon; SP6 is the SP6 RNA polymerase promoter; and T7 is initiated by T7 RNA polymerase). Vip3A-01 is the Vip3A-01 nucleotide sequence (SEQ ID NO: 2); MCS is the multiple cloning site).

The recombinant cloning vector DBN01-T was then transformed into E. coli T1 competent cells by heat shock method (Transgen, Beijing, China, CAT: CD501) under heat shock conditions: 50 μl E. coli T1 competent cells, 10 μl plasmid DNA (recombinant) Cloning vector DBN01-T), water bath at 42 ° C for 30 seconds; shaking culture at 37 ° C for 1 hour (shake at 100 rpm), coated with IPTG (isopropylthio-β-D-galactoside) and X -gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside) ampicillin (100 mg/L) in LB plate (tryptone 10 g/L, yeast extract 5 g/L, NaCl 10 g / L, agar 15 g / L, adjusted to pH 7.5 with NaOH) overnight growth. White colonies were picked and cultured in LB liquid medium (tryptone 10 g/L, yeast extract 5 g/L, NaCl 10 g/L, ampicillin 100 mg/L, pH adjusted to 7.5 with NaOH) at 37 °C. overnight. The plasmid was extracted by alkaline method: the bacterial solution was centrifuged at 12000 rpm for 1 min, the supernatant was removed, and the precipitated cells were pre-cooled with 100 μl of ice (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose. , pH 8.0) suspension; add 200 μl of freshly prepared solution II (0.2 M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the tube 4 times, mix, set on ice for 3-5 min; add 150 μl ice cold Solution III (3M potassium acetate, 5M acetic acid), mix well immediately, place on ice for 5-10 min; centrifuge at 5 ° C, 12000 rpm for 5 min, add 2 volumes of absolute ethanol to the supernatant, mix After homogenization, let it stand at room temperature for 5 min; centrifuge at 5 ° C, 12000 rpm for 5 min, discard the supernatant, and wash the precipitate with 70% ethanol (V/V) and dry it; add 30 μl of RNase (20 μg/ml). The TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) was dissolved in the precipitate; the RNA was digested in a water bath at 37 ° C for 30 min; and stored at -20 ° C until use.

After the extracted plasmid was identified by AhdI and XhoI digestion, the positive clone was verified by sequencing, and the result showed that the Vip3A-01 nucleotide sequence inserted in the recombinant cloning vector DBN01-T was represented by SEQ ID NO: 2 in the sequence listing. The nucleotide sequence, ie the Vip3A-01 nucleotide sequence, was correctly inserted.

According to the above method for constructing the recombinant cloning vector DBN01-T, the synthesized Vip3A-02 nucleotide sequence was ligated into the cloning vector pGEM-T to obtain a recombinant cloning vector DBN02-T, wherein Vip3A-02 was Vip3A-02. Nucleotide sequence (SEQ ID NO: 4). The correct insertion of the Vip3A-02 nucleotide sequence in the recombinant cloning vector DBN02-T was confirmed by restriction enzyme digestion and sequencing.

According to the above method for constructing the recombinant cloning vector DBN01-T, the synthesized Cry1Ab nucleotide sequence was ligated into the cloning vector pGEM-T to obtain a recombinant cloning vector DBN03-T, wherein the Cry1Ab was a Cry1Ab nucleotide sequence (SEQ ID NO: 6). The Cry1Ab nucleotide sequence in the recombinant cloning vector DBN03-T was correctly inserted by restriction enzyme digestion and sequencing.

2. Construction of a recombinant expression vector containing the Vip3A gene

Recombinant cloning vector DBN01-T and expression vector DBNBC-01 (vector backbone: pCAMBIA2301 (available from CAMBIA)) were digested with restriction endonucleases ScaI and SpeI, respectively, and the cut Vip3A-01 nucleotide sequence fragment was inserted. Between the ScaI and SpeI sites of the expression vector DBNBC-01, it is well known to those skilled in the art to construct vectors using conventional enzymatic cleavage methods. The recombinant expression vector DBN100002 was constructed as shown in Figure 2 (Kan: kanamycin gene; RB: right border; Ubi: maize Ubiquitin gene promoter (SEQ ID NO: 7); Vip3A-01 : Vip3A-01 nucleotide sequence (SEQ ID NO: 2); Nos: terminator of the nopaline synthase gene (SEQ ID NO: 8); Hpt: hygromycin phosphotransferase gene (SEQ ID NO: 9) ;LB: left border).

The recombinant expression vector DBN100002 was transformed into E. coli T1 competent cells by heat shock method. The heat shock conditions were: 50 μl E. coli T1 competent cells, 10 μl of plasmid DNA (recombinant expression vector DBN100002), water bath at 42 ° C for 30 seconds; 37 ° C oscillation Incubate for 1 hour (shake shake at 100 rpm); then LB solid plate containing 50 mg/L kanamycin (trypeptin 10 g/L, yeast extract 5 g/L, NaCl 10 g/L, agar 15 g) /L, adjust the pH to 7.5 with NaOH and incubate at 37 °C for 12 hours, pick white colonies, in LB liquid medium (tryptone 10g / L, yeast extract 5g / L, NaCl 10g / L, Kanamycin 50 mg/L was adjusted to pH 7.5 with NaOH and incubated overnight at 37 °C. The plasmid was extracted by an alkali method. The extracted plasmid was digested with restriction endonucleases ScaI and SpeI, and the positive clones were sequenced. The results showed that the nucleotide sequence between the ScaI and SpeI sites of the recombinant expression vector DBN10002 was SEQ ID in the sequence listing. NO: The nucleotide sequence shown in 2, that is, the Vip3A-01 nucleotide sequence.

According to the above method for constructing the recombinant expression vector DBN100002, the Vip3A-01 nucleotide sequence and the Cry1Ab nucleotide sequence excised by the ScaI and SpeI, NcoI and BamHI recombinant cloning vectors DBN01-T and DBN03-T were inserted and expressed. Vector DBNBC-01, recombinant expression vector DBN100003 was obtained. The nucleotide sequence in the recombinant expression vector DBN10003 was confirmed to be the nucleotide sequence shown by SEQ ID NO: 2 and SEQ ID NO: 6 in the sequence listing, namely the Vip3A-01 nucleotide sequence and the Cry1Ab nucleoside. The acid sequence, the Vip3A-01 nucleotide sequence and the Cry1Ab nucleotide sequence can be ligated to the Ubi promoter and the Nos terminator.

According to the above method for constructing the recombinant expression vector DBN100002, the Vip3A-02 nucleotide sequence excised from the ScaI and SpeI recombinant cloning vector DBN02-T was inserted into the expression vector DBNBC-01 to obtain a recombinant expression vector DBN100740. The nucleotide sequence in the recombinant expression vector DBN100740 was confirmed to be the nucleotide sequence shown by SEQ ID NO: 4 in the sequence listing, that is, the Vip3A-02 nucleotide sequence, and the Vip3A-02 nucleotide sequence was digested and sequenced. The Ubi promoter and the Nos terminator can be ligated.

3. Recombinant expression vector transforming Agrobacterium

The recombinant expression vectors DBN100002, DBN100003 and DBN100740, which have been constructed correctly, were transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT: 18313-015) by liquid nitrogen method, and the transformation conditions were: 100 μL Agrobacterium LBA4404, 3 μL of plasmid DNA. (recombinant expression vector); placed in liquid nitrogen for 10 minutes, 37 ° C warm water bath for 10 minutes; the transformed Agrobacterium LBA4404 was inoculated in LB test tube at a temperature of 28 ° C, 200 rpm After culturing for 2 hours, it was applied to LB plates containing 50 mg/L of rifampicin and 100 mg/L of kanamycin until a positive monoclonal was grown, and the monoclonal culture was picked and the plasmid was extracted. The recombinant expression vectors DBN100002, DBN100003 and DBN100740 were digested with restriction endonucleases StyI and AatII, and the results showed that the recombinant expression vectors DBN100002, DBN100003 and DBN100740 were completely correct.

Third embodiment, obtaining of transgenic plants

1. Obtaining genetically modified corn plants

The immature embryo of the aseptically cultured maize variety Heisei 31 (Z31) was co-cultured with the Agrobacterium described in the third embodiment in accordance with the conventional Agrobacterium infection method to construct the second embodiment. Recombinant expression vectors DBN100002, DBN100003 and DBN100740 T-DNA (including the promoter sequence of maize Ubiquitin gene, Vip3A-01 nucleotide sequence, Vip3A-02 nucleotide sequence, Cry1Ab nucleotide sequence, Hpt gene and Nos terminator) The sequence was transferred to the maize genome, and a maize plant transformed with the Vip3A-01 nucleotide sequence, a maize plant of the Vip3A-02 nucleotide sequence, and a maize plant transformed with the Cry1Ab+Vip3A-01 nucleotide sequence were obtained. At the same time, wild type corn plants were used as controls.

For Agrobacterium-mediated transformation of maize, briefly, immature immature embryos are isolated from maize, and the immature embryos are contacted with Agrobacterium suspension, wherein Agrobacterium can administer Vip3A-01 nucleotide sequence, Vip3A-02 nucleotide The sequence and the Cry1Ab+Vip3A-01 nucleotide sequence are delivered to at least one cell of one of the young embryos (step 1: infection step), in which the immature embryo is preferably immersed in an Agrobacterium suspension (OD ₆₆₀ =0.4-) 0.6, infecting medium (MS salt 4.3g / L, MS vitamin, casein 300mg / L, sucrose 68.5g / L, glucose 36g / L, acetosyringone (AS) 40mg / L, 2,4-dichloro Phenoxyacetic acid (2,4-D) 1 mg/L, pH 5.3)) was used to initiate inoculation. The immature embryo is co-cultured with Agrobacterium for a period of time (3 days) (step 2: co-cultivation step). Preferably, the immature embryo is in solid medium after the infection step (MS salt 4.3 g/L, MS vitamin, casein 300 mg/L, sucrose 20 g/L, glucose 10 g/L, acetosyringone (AS) 100 mg/L) It was cultured on 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg/L, agar 8 g/L, pH 5.8). After this co-cultivation phase, there can be an optional "recovery" step. In the "recovery" step, the medium was restored (MS salt 4.3 g / L, MS vitamin, casein 300 mg / L, sucrose 30 g / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / At least one antibiotic (cephalosporin) known to inhibit the growth of Agrobacterium is present in L, plant gel 3 g/L, pH 5.8), and no selection agent for plant transformants is added (step 3: recovery step). Preferably, the immature embryos are cultured on a solid medium with antibiotics but no selection agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Next, the inoculated immature embryos are cultured on a medium containing a selection agent (hygromycin) and the grown transformed callus is selected (step 4: selection step). Preferably, the immature embryo is screened in solid medium with selective agent (MS salt 4.3 g/L, MS vitamin, casein 300 mg/L, sucrose 30 g/L, hygromycin 50 mg/L, 2,4-dichlorobenzene) Incubation of oxyacetic acid (2,4-D) 1 mg/L, plant gel 3 g/L, pH 5.8) resulted in selective growth of transformed cells. Then, the callus regenerates the plant (step 5: regeneration step), preferably, the callus grown on the medium containing the selection agent is cultured on a solid medium (MS differentiation medium and MS rooting medium) Recycled plants.

The selected resistant callus was transferred to the MS differentiation medium (MS salt 4.3 g/L, MS vitamin, casein 300 mg/L, sucrose 30 g/L, 6-benzyl adenine 2 mg/L, M. 50 mg/L, vegetal gel 3 g/L, pH 5.8), cultured and differentiated at 25 °C. The differentiated seedlings were transferred to the MS rooting medium (MS salt 2.15 g/L, MS vitamin, casein 300 mg/L, sucrose 30 g/L, indole-3-acetic acid 1 mg/L, plant gel 3 g/L) , pH 5.8), cultured at 25 ° C to a height of about 10 cm, moved to a greenhouse to grow to firm. In the greenhouse, the cells were cultured at 28 ° C for 16 hours and then at 20 ° C for 8 hours.

2. Obtaining transgenic sorghum plants

Reference is made to the sorghum transformation method of Molecular Biology and Genetic Engineering ISSN 2053-5767. The seeds of sorghum variety APKI were collected and rinsed several times with water; soaked in tween-20 infusion for 5 minutes; then washed with double distilled water and dried in a fume hood; 70% (v/v) ethanol was used on the surface of the seeds. Sterilize for 30 seconds, then disinfect with 0.1 (w/v)% HgCl _{2 for} 6 minutes; then wash with 5-6 times with double distilled water; place the seeds in a Petri dish containing MS base solid medium (pH 5.8) Place the culture dish in a culture room with a temperature of 24 ± 2 ° C, a relative humidity of 70%, and a photoperiod (light/dark) of 12:12; after 3-5 days, the seeds are germinated and the shoot tip explants are taken. Soaked in Agrobacterium for 30 minutes; the explanted explants were placed on sterilized filter paper; co-cultured for 72 hours in the dark; the callus was washed with sterile water containing 500 mg/L cephalosporin 3 -5 times; the washed callus was transferred to the induction medium for 7 days; then transferred to the screening medium for 2-3 weeks, and the screening was repeated 3 times; the resistant callus was transferred to the regeneration medium; The leaves and the like are regenerated, and the seedlings are transferred to the rooting medium, and after being rooted, they are transplanted to the greenhouse. The medium formulation is referred to Molecular Biology and Genetic Engineering ISSN 2053-5767, wherein the screening agent is replaced with hygromycin according to the transgenic vector of the present invention. Thus, a sorghum plant transformed into the Vip3A-01 nucleotide sequence, a sorghum plant transformed into the Vip3A-02 nucleotide sequence, and a sorghum plant transformed into the Cry1Ab+Vip3A-01 nucleotide sequence were obtained; Plants served as controls.

3. Obtaining genetically modified sugarcane plants

The conversion method mainly refers to the 22nd to 24th pages of the 2012 Master's degree of Guangxi University. Take the fresh stem section of the cane top, remove the cane tip and leaf sheath, leaving the stem tip growth cone and the heart leaf stem segment. On the ultra-clean workbench, wipe the surface with a 75% (v/v) alcohol cotton ball, carefully peel off the outer layer of the heart leaf with the sterilized tweezers, and take the heart segment of the 5-7 cm length in the middle. A sheet cut into a thickness of about 3 mm was inoculated on an induction medium, and cultured in the dark at a temperature of 26 ° C for 20 days. The callus with good growth was selected and transferred to a new MS medium for 4 days, and then used for the transformation test; During transformation, the callus to be infested is clipped with sterilized tweezers in a clean bench and placed on a clean filter paper for 2 hours until the surface is completely dry and slightly shrunk; the dried sugar cane is more Soak the wound tissue in the invasive dye solution for 30 minutes, and shake it slowly on the shaker; remove the callus and transfer it to clean filter paper, and dry it completely in the clean bench until the callus surface is dry. No water film. The callus pieces were cut into small pieces of 0.6*0.6 cm, and then transferred to MR solid medium containing 100 μmol/L acetosyringone (AS), and cultured in a dark state at 23 ° C for 3 days; the callus after infection The tissue was clipped, placed on a filter paper and dried on a clean bench until the surface of the material was dry. Transfer the material to a differentiation medium containing 500 mg/L cephalosporin and hygromycin for screening; replace every 2 weeks. The culture medium was once removed, and the contaminated callus was removed. When the seedlings were about 3 cm long, they were transferred to a rooting medium containing hygromycin screening agent to induce rooting. Thus, a sugarcane plant transformed into the Vip3A-01 nucleotide sequence, a sugarcane plant transformed into the Vip3A-02 nucleotide sequence, and a sugarcane plant transformed into the Cry1Ab+Vip3A-01 nucleotide sequence were obtained; Plants served as controls.

4. Obtaining transgenic millet plants

The conversion method refers to the Hebei University of Agriculture 2012 Master Wang Hanyu's dissertation on pages 9 to 10. After soaking the mature seeds in 0.1% (v/v) Tween-20 solution, wash them with 70% (v/v) ethanol, then transfer to 0.1% (w/v) HgCl ₂ solution, and finally use sterile water. Wash 2-3 times. The sterilized seeds were transferred to MS medium and incubated at a temperature of 25 ° C for 2-3 days. When the stem tip of the seed grows to 4-6 mm, the shoot tip is transferred to the callus induction medium under aseptic conditions.

Induction of shoot tip callus: The induced shoot tip callus was immersed in the Agrobacterium suspension for 30 minutes, and the shoot tip callus was taken out on the sterilized filter paper, and the excess bacterial solution was aspirated and transferred to co-culture. The medium (MS + 100 mol / L AS + 2, 4-D) was co-cultured in the dark at a temperature of 28 ° C for 2-4 days. Then, the callus after co-cultivation was transferred to MS callus induction medium (2,4-D 4.5 μmol/L, 2.25 μmol/L Kn, cephalosporin 500 mg/L), and cultured at 25 ° C in dark. Two weeks of healing the callus. After the young ears were cultured on the callus induction medium for 5 weeks, the dense yellow-white callus was transferred to the differentiation medium for differentiation, and the screening medium hygromycin was added to the differentiation medium. After about five weeks, the callus formed a nodular structure, and the callus with the knot structure was transferred to the MS differentiation rooting medium (thiazolyl phenylurea (TDZ) 4.5 μmol/L, sucrose 120 μmol/L). Thus, a millet plant transformed into the Vip3A-01 nucleotide sequence, a millet plant transformed into the Vip3A-02 nucleotide sequence, and a millet plant transformed into the Cry1Ab+Vip3A-01 nucleotide sequence were obtained; Plants served as controls.

Fourth embodiment, verifying transgenic plants with TaqMan

The maize plants transformed with the Vip3A-01 nucleotide sequence, the maize plants transfected with the Vip3A-02 nucleotide sequence, and the maize plants transfected with the Cry1Ab+Vip3A-01 nucleotide sequence were used as samples, respectively. Qiagen's DNeasy Plant Maxi Kit extracts its genomic DNA, The copy number of the Vip3A gene and the Cry1Ab gene was detected by Taqman probe fluorescent quantitative PCR. At the same time, the wild type corn plants were used as a control, and the detection and analysis were carried out according to the above method. The experiment was set to repeat 3 times and averaged.

The specific methods for detecting the copy number of the Vip3A gene and the Cry1Ab gene are as follows:

Step 11. Take the maize plant transformed into the Vip3A-01 nucleotide sequence, the maize plant transformed into the Vip3A-02 nucleotide sequence, the maize plant transformed into the Cry1Ab+Vip3A-01 nucleotide sequence, and the wild-type maize plant. Each of the leaves was 100 mg, and the mixture was homogenized with liquid nitrogen in a mortar, and each sample was taken in 3 replicates;

Step 12. Extract the genomic DNA of the above sample using Qiagen's DNeasy Plant Mini Kit, and refer to the product manual for the specific method;

Step 13. Determine the genomic DNA concentration of the above sample using NanoDrop 2000 (Thermo Scientific);

Step 14, adjusting the genomic DNA concentration of the above sample to the same concentration value, the concentration value ranges from 80 to 100 ng / μL;

Step 15. The Taqman probe real-time PCR method is used to identify the copy number of the sample, and the sample with the known copy number is used as a standard, and the sample of the wild type corn plant is used as a control, and each sample has 3 replicates, and the average is taken. Value; the fluorescent PCR primers and probe sequences are:

The following primers and probes were used to detect the Vip3A-01 nucleotide sequence:

Primer 1: ATTCTCGAAATCTCCCCTAGCG is shown in SEQ ID NO: 10 in the Sequence Listing;

Primer 2: GCTGCCAGTGGATGTCCAG is shown in SEQ ID NO: 11 in the Sequence Listing;

Probe 1: CTCCTGAGCCCCGAGCTGATTAACACC as shown in SEQ ID NO: 12 in the Sequence Listing;

The following primers and probes were used to detect the Vip3A-02 nucleotide sequence:

Primer 3: ATTCTCGAAATCTCCCCTAGCG is shown in SEQ ID NO: 13 in the Sequence Listing;

Primer 4: GCTGCCAGTGGATGTCCAG is shown in SEQ ID NO: 14 in the Sequence Listing;

Probe 2: CTCCTGAGCCCCGAGCTGATTAACACC as shown in SEQ ID NO: 15 in the Sequence Listing;

The following primers and probes were used to detect the Cry1Ab nucleotide sequence:

Primer 5: TGCGTATTCAATTCAACGACATG is shown in SEQ ID NO: 16 in the Sequence Listing;

Primer 6: CTTGGTAGTTCTGGACTGCGAAC is shown in SEQ ID NO: 17 in the Sequence Listing;

Probe 3: CAGCGCCTTGACCACAGCTATCCC is shown in SEQ ID NO: 18 in the Sequence Listing;

The PCR reaction system is:

The 50× primer/probe mixture contained 45 μl of each primer at a concentration of 1 mM, 50 μl of a probe at a concentration of 100 μM, and 860 μl of 1×TE buffer, and stored at 4° C. in an amber tube.

The PCR reaction conditions are:

Data were analyzed using SDS2.3 software (Applied Biosystems).

The results showed that the Vip3A-01 nucleotide sequence, the Vip3A-02 nucleotide sequence, and the Cry1Ab+Vip3A-01 nucleotide sequence were integrated into the genome of the tested maize plants and transferred to the Vip3A-01 nucleus. A single copy of the transgenic maize plant was obtained from the maize plant of the nucleotide sequence, the maize plant transformed with the Vip3A-02 nucleotide sequence, and the maize plant transformed with the Cry1Ab+Vip3A-01 nucleotide sequence.

Transgenic sorghum plants, transgenic sugarcane plants and transgenic millet plants were tested and analyzed according to the above method for verifying transgenic maize plants with TaqMan. The results showed that the nucleotide sequences of Vip3A-01, Vip3A-02, and Cry1Ab+Vip3A-01 were integrated into the genomes of the tested sorghum, sugarcane and millet plants, respectively. Furthermore, the sorghum plant transformed into the Vip3A-01 nucleotide sequence, the sorghum plant transformed into the Vip3A-02 nucleotide sequence, the sorghum plant transformed into the Cry1Ab+Vip3A-01 nucleotide sequence, and the Vip3A-01 nucleotide was transferred. Sequence of sugarcane plants, sugarcane plants transformed into Vip3A-02 nucleotide sequence, sugarcane plants transformed into Cry1Ab+Vip3A-01 nucleotide sequence, millet plants transferred to Vip3A-01 nucleotide sequence, and transferred to Vip3A- A single copy of the transgenic plant was obtained from the millet plant of the nucleotide sequence of 02 and the millet plant transformed into the nucleotide sequence of Cry1Ab+Vip3A-01.

Fifth embodiment, detection of insect resistance of transgenic plants

A maize plant transformed into a Vip3A-01 nucleotide sequence, a maize plant transformed into a Vip3A-02 nucleotide sequence, a maize plant transformed into a Cry1Ab+Vip3A-01 nucleotide sequence, and a Vip3A-01 nucleotide Sequence of sorghum plants, sorghum plants transferred to the Vip3A-02 nucleotide sequence, transferred Sorghum plant with nucleotide sequence of Cry1Ab+Vip3A-01; sugarcane plant transformed into Vip3A-01 nucleotide sequence, sugarcane plant transformed into Vip3A-02 nucleotide sequence, and transferred into Cry1Ab+Vip3A-01 nucleotide sequence Sugarcane plant; millet plant transformed into Vip3A-01 nucleotide sequence, millet plant transformed into Vip3A-02 nucleotide sequence, millet plant transformed into Cry1Ab+Vip3A-01 nucleotide sequence; corresponding wild type corn Plants, sorghum plants, sugarcane plants and millet plants, as well as non-transgenic maize plants, sorghum plants, sugarcane plants and millet plants identified by Taqman were tested for insect resistance.

1. Detection of insect resistance of transgenic maize plants

Maize plants transfected with Vip3A-01 nucleotide sequence, maize plants transfected with Vip3A-02 nucleotide sequence, maize plants transfected with Cry1Ab+Vip3A-01 nucleotide sequence, wild-type maize plants and Taqman Fresh leaves identified as non-transgenic maize plants (expanded young leaves), rinsed with sterile water and blotted with water on the leaves, then the corn leaves are cut into strips of about 1 cm × 2 cm, one piece The cut long strips are placed on the moisturizing filter paper at the bottom of the round plastic petri dish. Ten ash larvae (initial hatching larvae) are placed in each dish, and the worms are covered with the temperature at 22-26. After 3 days of °C, relative humidity 70%-80%, photoperiod (light/dark) 0:24, the total score of resistance was obtained according to the three indicators of larval development, mortality and leaf damage rate. (out of 300): total score = 100 × mortality + [100 × mortality + 90 × (number of initial hatching / total number of insects) + 60 × (number of initial hatching - negative control insects / total number of insects) + 10 × (negative control number of insects / total number of insects)] + 100 × (1 - blade damage rate). A total of 3 transformation event lines (S1, S2 and S3) transfected into the Vip3A-01 nucleotide sequence, and 3 transformation event lines (S4, S5 and S6) into the Vip3A-02 nucleotide sequence, A total of 3 transformation event lines (S7, S8 and S9) transfected into the Cry1Ab+Vip3A-01 nucleotide sequence, identified by Taqman as a non-transgenic (NGM1) strain, and a wild-type (CK1) One strain was selected; 3 strains were selected from each strain, and each plant was repeated 6 times. The results are shown in Table 1 and Figure 3.

Table 1. Results of insect resistance test of inoculated corn ash in transgenic maize plants

The results in Table 1 indicate that maize plants transfected with the Vip3A-01 nucleotide sequence, maize plants transfected with the Vip3A-02 nucleotide sequence, and maize plants transfected with the Cry1Ab+Vip3A-01 nucleotide sequence against the ash They all have good insecticidal effects. The average mortality rate of millet ash is above 90%, and some even reach 100%. The total score of resistance is also around 290 points, and some even reach a maximum of 300 points. The total score of resistance identified as non-transgenic maize plants and wild-type maize plants is generally around 20 points.

The results in Figure 3 indicate that maize plants transfected with the Vip3A-01 nucleotide sequence, maize plants transfected with the Vip3A-02 nucleotide sequence, and transfected with Cry1Ab+Vip3A-01 nucleotides were compared to wild-type maize plants. The sequence of maize plants has almost 100% control effect on the newly hatched larvae of the larvae, and the very few surviving larvae basically stop developing. After 3 days, the larvae are still in the initial hatching state, and at the same time show extremely weak vitality and transfer to Vip3A. Maize plants with a -99 nucleotide sequence, maize plants transfected with the Vip3A-02 nucleotide sequence, and maize plants transfected with the Cry1Ab+Vip3A-01 nucleotide sequence were generally only slightly damaged, and were almost indistinguishable to the naked eye. The leaf damage rate of the ash ash is below 3%.

Thus, it was confirmed that maize plants transfected with the Vip3A-01 nucleotide sequence, maize plants transfected with the Vip3A-02 nucleotide sequence, and maize plants transfected with the Cry1Ab+Vip3A-01 nucleotide sequence showed high anti-milk mites. Activity, this activity is sufficient to have an adverse effect on the growth of the ash mites so that they are controlled in the field. At the same time, by controlling the drill collar of the ash, it is also possible to reduce the occurrence of diseases on the corn and greatly improve the yield and quality of the corn.

2. Detection of insect resistance of transgenic sugarcane plants

Sugarcane plants transfected with Vip3A-01 nucleotide sequence, sugarcane plants transfected with Vip3A-02 nucleotide sequence, sugarcane plants transfected with Cry1Ab+Vip3A-01 nucleotide sequence, wild-type sugarcane plants and Taqman Fresh leaves identified as non-transgenic sugarcane plants (expanded young leaves), rinsed with sterile water and blotted with water on the leaves, then the sugar cane leaves are cut into 1cm × 2cm long strips, take 1 piece of cut long strips of leaves into the moisturizing filter paper on the bottom of the round plastic culture dish, put 10 pieces of ash larvae (initial hatching larvae) in each dish, insect test After the culture dish is capped, it is placed at a temperature of 22-26 ° C, a relative humidity of 70%-80%, and a photoperiod (light/dark) of 0:24 for 3 days, according to the larval development progress, mortality, and leaves of the larvae. Three indicators of injury rate, total score of resistance (out of 300 points): total score = 100 × mortality + [100 × mortality + 90 × (number of initial hatching / total number of insects) + 60 × (initial hatching - Negative control number of insects/total number of insects) +10×(number of negative control insects/total number of insects)]+100×(1-blade damage rate). A total of 3 transformation event lines (S10, S11 and S12) transfected into the Vip3A-01 nucleotide sequence were transformed into a total of 3 transformation event lines (S13, S14 and S15) of the Vip3A-02 nucleotide sequence. A total of 3 transformation event lines (S16, S17 and S18) transfected into the Cry1Ab+Vip3A-01 nucleotide sequence, identified by Taqman as a non-transgenic (NGM2) strain, and a wild type (CK2) One strain was selected; 3 strains were selected from each strain, and each plant was repeated 6 times. The results are shown in Table 2 and Figure 4.

Table 2. Results of insect resistance test of inoculated corn ash from transgenic sugarcane plants

The results in Table 2 indicate that the sugarcane plants transferred into the Vip3A-01 nucleotide sequence were transferred to Vip3A-02. The sugarcane plant with nucleotide sequence and the sugarcane plant transformed into Cry1Ab+Vip3A-01 nucleotide sequence have good insecticidal effect on the millet, and the average mortality rate of the millet is more than 90%, and some even Up to 100%, the total score of resistance is about 290 points, and some even reach a maximum of 300 points; and the total score of resistance of non-transgenic sugarcane plants and wild-type sugarcane plants identified by Taqman is generally less than 20 points.

The results in Figure 4 indicate that sugarcane plants transfected with the Vip3A-01 nucleotide sequence, sugarcane plants transfected with the Vip3A-02 nucleotide sequence, and transfected into Cry1Ab+Vip3A-01 nucleotides compared to wild-type sugarcane plants The sequence of sugarcane plants has almost 100% control effect on the newly hatched larvae of the larvae, and some of the surviving larvae also basically stop developing. After 3 days, the larvae are still in the initial hatching state, showing very weak vitality and transferring to Vip3A. The sugarcane plant of the -01 nucleotide sequence, the sugarcane plant transformed into the Vip3A-02 nucleotide sequence, and the sugarcane plant transformed into the Cry1Ab+Vip3A-01 nucleotide sequence were only slightly damaged, and the naked eye was almost indistinguishable. The leaf damage rate of the ash ash is below 3%.

Thus, it was confirmed that the sugarcane plant transformed into the Vip3A-01 nucleotide sequence, the sugarcane plant transformed into the Vip3A-02 nucleotide sequence, and the sugarcane plant transformed into the Cry1Ab+Vip3A-01 nucleotide sequence all showed high anti-milk mites. Activity, this activity is sufficient to have an adverse effect on the growth of the ash mites so that they are controlled in the field. At the same time, by controlling the drill collar of the ash ash, it is also possible to reduce the occurrence of diseases on the sugar cane, and greatly improve the yield and quality of sugar cane.

3. Detection of insect resistance of transgenic sorghum plants

Sorghum plants transfected with Vip3A-01 nucleotide sequence, sorghum plants transfected with Vip3A-02 nucleotide sequence, sorghum plants transfected with Cry1Ab+Vip3A-01 nucleotide sequence, wild-type sorghum plants and Taqman Fresh leaves identified as non-transgenic sorghum plants (expanded young leaves), rinsed with sterile water and blotted the water on the leaves with gauze, then cut the sorghum leaves into strips of about 1 cm × 2 cm, take 1 piece The cut long strips are placed on the moisturizing filter paper at the bottom of the round plastic petri dish. Ten ash larvae (initial hatching larvae) are placed in each dish, and the worms are covered with the temperature at 22-26. After 3 days of °C, relative humidity 70%-80%, photoperiod (light/dark) 0:24, the total score of resistance was obtained according to the three indicators of larval development, mortality and leaf damage rate. (out of 300 points): total score = 100 × mortality + [100 × mortality + 90 × (number of initial hatching / total number of insects) + 60 × (number of initial hatching - negative control insects / total number of insects) + 10 × (negative control number of insects / total number of insects)] + 100 × (1 - blade damage rate). A total of 3 transformation event lines (S19, S20 and S21) transfected into the Vip3A-01 nucleotide sequence, and transferred to the Vip3A-02 nucleotide sequence for a total of 3 transformation event lines (S22, S23 and S24), A total of 3 transformation event lines (S25, S26 and S27) transfected into the Cry1Ab+Vip3A-01 nucleotide sequence, identified by Taqman as a non-transgenic (NGM3) strain, and a wild-type (CK3) One strain was selected; 3 strains were selected from each strain, and each plant was repeated 6 times. The results are shown in Table 3 and Figure 5.

Table 3. Results of insect resistance test of transgenic sorghum plants inoculated with millet

The results in Table 3 indicate that sorghum plants transfected with the Vip3A-01 nucleotide sequence, sorghum plants transfected with the Vip3A-02 nucleotide sequence, and sorghum plants transfected with the Cry1Ab+Vip3A-01 nucleotide sequence against the sorghum They all have good insecticidal effects. The average mortality rate of millet ash is above 90%, and some even reach 100%. The total score of resistance is above 290 points, and some even reach a maximum of 300 points; and it is identified by Taqman. The total resistance score for non-transgenic sorghum plants and wild-type sorghum plants is generally around 20 points.

The results in Figure 5 indicate that sorghum plants transfected with the Vip3A-01 nucleotide sequence, sorghum plants transfected with the Vip3A-02 nucleotide sequence, and transfected into Cry1Ab+Vip3A-01 nucleotides were compared to wild-type sorghum plants. The sequence of sorghum plants has almost 100% control effect on the newly hatched larvae of the larvae, and some of the surviving larvae basically stop developing. After 3 days, the larvae are still in the initial hatching state, and at the same time show extremely weak vitality and transfer to Vip3A. Sorghum plants with a nucleotide sequence of -01, sorghum plants transfected with the Vip3A-02 nucleotide sequence, and sorghum plants transfected with the Cry1Ab+Vip3A-01 nucleotide sequence were only slightly damaged, and were almost indistinguishable to the naked eye. The leaf damage rate of the ash ash is below 3%.

Thus, it was confirmed that the sorghum plant transformed into the Vip3A-01 nucleotide sequence, the sorghum plant transformed into the Vip3A-02 nucleotide sequence, and the sorghum plant transformed into the Cry1Ab+Vip3A-01 nucleotide sequence all showed high anti-milk mites. Activity, this activity is sufficient to have an adverse effect on the growth of the ash mites so that they are controlled in the field. At the same time, by controlling the drill collar of the ash mites, it is also possible to reduce the occurrence of diseases on sorghum and greatly improve the yield and quality of sorghum.

4. Detection of insect resistance of transgenic millet plants

Millet plants transfected with Vip3A-01 nucleotide sequence, millet plants transfected with Vip3A-02 nucleotide sequence, millet plants transfected with Cry1Ab+Vip3A-01 nucleotide sequence, wild-type millet plants and Taqman Fresh leaves identified as non-transgenic millet plants (expanded young leaves), rinsed with sterile water and blotted with water on the leaves, then the millet leaves are cut into strips of about 1 cm × 2 cm, one piece The cut long strips are placed on the moisturizing filter paper at the bottom of the round plastic petri dish. Ten ash larvae (initial hatching larvae) are placed in each dish, and the worms are covered with the temperature at 22-26. After 3 days of °C, relative humidity 70%-80%, photoperiod (light/dark) 24:24, the total score of resistance was obtained according to the three indicators of larval development, mortality and leaf damage rate. (out of 300 points): total score = 100 × mortality + [100 × mortality + 90 × (number of initial hatching / total number of insects) + 60 × (number of initial hatching - negative control insects / total number of insects) + 10 × (negative control number of insects / total number of insects)] + 100 × (1 - blade damage rate). A total of 3 transformation event lines (S28, S29 and S30) transfected into the Vip3A-01 nucleotide sequence were transferred to the Vip3A-02 nucleotide sequence for a total of 3 transformation event lines (S31, S32 and S33). A total of 3 transformation event lines (S34, S35 and S36) transfected into the Cry1Ab+Vip3A-01 nucleotide sequence, identified by Taqman as a non-transgenic (NGM4) line, and a wild type (CK4) One strain was selected; 3 strains were selected from each strain, and each plant was repeated 6 times. The results are shown in Table 4 and Figure 6.

Table 4: Results of insect resistance test of transgenic millet plants inoculated with millet

The results in Table 4 indicate that the millet plant into which the Vip3A-01 nucleotide sequence was transferred, the millet plant into which the Vip3A-02 nucleotide sequence was transferred, and the millet plant into which the Cry1Ab+Vip3A-01 nucleotide sequence was transferred to the millet They all have good insecticidal effects. The average mortality rate of millet ash is above 90%, and some even reach 100%. The total score of resistance is above 290 points, and some even reach a maximum of 300 points; and it is identified by Taqman. The total resistance score for non-transgenic millet plants and wild-type millet plants is generally around 20 minutes.

The results in Figure 6 indicate that the millet plant transferred to the Vip3A-01 nucleotide sequence, the millet plant transferred to the Vip3A-02 nucleotide sequence, and the Cry1Ab+Vip3A-01 nucleotide are transferred to the wild-type millet plant. The sequence of millet plants has almost 100% control effect on the newly hatched larvae of the larvae, and some of the surviving larvae basically stop developing. After 3 days, the larvae are still in the initial hatching state, and at the same time show extremely weak vitality and transfer to Vip3A. The millet plant of the -01 nucleotide sequence, the millet plant transformed into the Vip3A-02 nucleotide sequence, and the millet plant transformed into the Cry1Ab+Vip3A-01 nucleotide sequence are only slightly damaged, and the naked eye is almost indistinguishable. The leaf damage rate of the millet ash is less than 2%.

Thus, it was confirmed that the millet plant transformed into the Vip3A-01 nucleotide sequence, the millet plant transformed into the Vip3A-02 nucleotide sequence, and the millet plant transformed into the Cry1Ab+Vip3A-01 nucleotide sequence all showed high resistance to millet mites. Activity, this activity is sufficient to have an adverse effect on the growth of the ash mites so that they are controlled in the field. At the same time, by controlling the drill collar of the ash, it is also possible to reduce the occurrence of diseases on the millet and greatly improve the yield and quality of the millet.

The above experimental results also showed that the maize plant transformed into the Vip3A-01 nucleotide sequence, the maize plant transformed into the Vip3A-02 nucleotide sequence, the maize plant transformed into the Cry1Ab+Vip3A-01 nucleotide sequence, and transferred to Vip3A- a sugarcane plant having a nucleotide sequence of 01, a sugarcane plant transformed into a Vip3A-02 nucleotide sequence, a sugarcane plant transformed into a Cry1Ab+Vip3A-01 nucleotide sequence, a sorghum plant transformed into a Vip3A-01 nucleotide sequence, A sorghum plant transformed into the Vip3A-02 nucleotide sequence, a sorghum plant transformed into the Cry1Ab+Vip3A-01 nucleotide sequence, and a valley into the Vip3A-01 nucleotide sequence The control, control of the millet ash by the plant, the millet plant transferred to the Vip3A-02 nucleotide sequence, and the millet plant transferred to the Cry1Ab+Vip3A-01 nucleotide sequence is apparently because the plant itself can produce the Vip3A protein, so It is well known to those skilled in the art that according to the same toxic effect of the Vip3A protein on the mites, a similar transgenic plant expressing the Vip3A protein can be used to control/control the damage of the ash. The Vip3A protein of the present invention includes, but is not limited to, the Vip3A protein of the amino acid sequence given in the specific embodiment, and the transgenic plant can also produce at least one second insecticidal protein different from the Vip3A protein, such as a Vip-like protein or a Cry-like protein. protein.

It should be noted that the above embodiments are merely illustrative of the technical solutions of the present invention, and are not intended to be limiting, although the present invention will be described in detail with reference to the preferred embodiments. Modifications or equivalents may be made without departing from the spirit and scope of the invention.

Claims

A method for controlling a pest of a gray worm, characterized in that it comprises contacting at least a Vip3A protein with a pest of the larvae;

Preferably, the Vip3A protein is present in a host cell that produces at least the Vip3A protein, and the millet worm is in contact with at least the Vip3A protein by ingesting the host cell;

More preferably, the Vip3A protein is present in a bacterium or a transgenic plant that produces at least the Vip3A protein, the mulberry pest is at least in contact with the Vip3A protein by ingesting the tissue of the bacterium or the transgenic plant, after contact The growth of the worms is inhibited and/or caused to death, in order to achieve control of the plants that are harmful to the ash.
The method of controlling a mites pest according to claim 1, wherein the transgenic plant can be in any growth period; and/or

The tissue of the transgenic plant is a leaf, a stalk, a fruit, a tassel, an ear, an anther or a filament; and/or

The control of the plants against the ash mites does not change due to changes in the location and/or planting time.
A method of controlling a pest of a mulberry mites according to claim 1 or 2, wherein the plant is corn, sorghum, millet, sugar cane, rice, wheat, barley or oatmeal.
The method of controlling a mites pest according to any one of claims 1 to 3, wherein the step prior to the contacting step is planting a plant containing a polynucleotide encoding the Vip3A protein.
The method for controlling a pest of a mulberry mites according to any one of claims 1 to 4, wherein the amino acid sequence of the Vip3A protein has the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3;

Preferably, the nucleotide sequence of the Vip3A protein has the nucleotide sequence shown in SEQ ID NO: 2 or SEQ ID NO: 4.
A method of controlling a pest of a mulberry mites according to any one of claims 1 to 5, wherein the plant further comprises at least one second nucleoside different from a nucleotide encoding the Vip3A protein. acid;

Preferably, the second nucleotide encodes a Cry-like insecticidal protein, a Vip-like insecticidal protein, a protease inhibitor, a lectin, an alpha-amylase or a peroxidase;

More preferably, the second nucleotide encodes a Cry1Ab protein;

Further preferably, the amino acid sequence of the Cry1Ab protein has the sequence shown in SEQ ID NO: 5. Amino acid sequence;

Most preferably, the nucleotide sequence of the Cry1Ab protein has the nucleotide sequence set forth in SEQ ID NO: 6.
The method of controlling a pest of a mites according to claim 6, wherein the second nucleotide is a dsRNA which inhibits an important gene in a target insect pest.
A method according to any one of claims 1 to 7, wherein the millet mites are in a crop field.
A use of a Vip3A protein to control a mites pest.
A plant cell, plant or plant part that transfects the Vip3A gene controls the use of a large pest.
A method of producing a plant for controlling a mites pest, characterized by comprising introducing a polynucleotide sequence encoding a Vip3A protein into the genome of the plant.
A method of producing a plant propagule for controlling a mites pest, characterized by comprising hybridizing a first plant obtained by the method of claim 11 to a second plant, and/or removing the method of claim 11. The fertile tissue on the obtained plants is cultured to produce a plant propagule containing a polynucleotide sequence encoding a Vip3A protein.
A plant propagule for controlling a mites pest, characterized in that the plant propagule contains a polynucleotide sequence encoding a Vip3A protein.
A method for cultivating a plant for controlling a mites pest, characterized in that it comprises:

Planting at least one plant propagule comprising a polynucleotide sequence encoding a Vip3A protein in the genome of the plant propagule;

Causing the plant propagule into a plant;

The plants are grown under conditions in which the artificially inoculated pests of the mites and/or the mites are naturally at risk, and the plants are harvested with reduced plant damage and/or compared to other plants that do not have the polynucleotide sequence encoding the Vip3A protein. Or plants with increased plant yield.
The plant produced by controlling the millet mites pest according to the method of claim 14.
A plant cell, plant or plant part for controlling a mites pest, characterized in that the genome of the plant cell, plant or plant part comprises a polynucleotide sequence encoding a Vip3A protein.
The plant cell, plant or plant part according to claim 16, wherein the plant is selected from the group consisting of corn, sorghum, millet, sugar cane, rice, wheat, barley and oats, and wherein the plant part is a seed , leaves, stems, fruits, tassels, ears, anthers, filaments, roots or any part thereof.