CN105660674A - Use of insecticidal protein - Google Patents

Abstract

The invention relates to a use of an insecticidal protein; a method for controlling conogethes punctiferalis pests comprises the steps: allowing the conogethes punctiferalis pests at least to make contact with a Vip3A protein. The Vip3A protein which can kill the conogethes punctiferalis is generated in plants to control the conogethes punctiferalis pests; compared with an agriculture prevention and treatment method, a chemical prevention and treatment method and a physical prevention and treatment method used in the prior art, the method performs whole growth period and whole plant protection of the plants to prevent and treat infringement of the conogethes punctiferalis pests, has the advantages of no pollution, no residue, and stable and thorough effect, and is simple, convenient and economic.

Description

The purposes of insecticidal proteins

Technical field

The present invention relates to the purposes of a kind of insecticidal proteins, particularly relate to a kind of Vip3A protein and control dichocrocis punctiferalis cause harm the purposes of plant by expressing in plant.

Background technology

Dichocrocis punctiferalis Conogethespunctiferalis belongs to Lepidoptera Pyralidae, for polyphagous pest-insect, except harm Semen Maydis, Sorghum vulgare Pers. etc. make beyond the region of objective existence, also endanger the fruit trees such as Fructus Persicae, Fructus Kaki, Semen Castaneae, be distributed widely in China domestic, North gets Heilungkiang, the Inner Mongol, reach Taiwan, Hainan, Guangdong, Guangxi, south, Yunnan edge in the south, border, Dong Jie former Soviet Union east, border, Korea north, west from Shanxi, west, Shaanxi tiltedly to behind Ningxia, Gansu, folding into Sichuan, Yunnan, Tibet. During harm Semen Maydis, main moth eats female fringe, it is possible to moth stem, and strain rate of being injured reaches 30%-80%; During harm Sorghum vulgare Pers., newly hatched larvae is eaten in the Sorghum vulgare Pers. tender seed of children, with feces or food debris, mouth is sealed, within it eating into evil, eat empty one and turn again one until before three ages, weaving silk after three ages knots puts together and leaves tunnel in the middle of small ear, inside walking and gnaw seed, serious eats sorghum grain moth. Additionally can eat into stalk, the similar Pyrausta nubilalis (Hubern). of Harm.

Semen Maydis is the cereal crops that China is important, and along with the reinforcement of Global Greenhouse Effect, within nearly 2 years, temperature constantly rises, and insect pest species survey and quantity all increase. Dichocrocis punctiferalis gnaws or eats into food seed based on larva, and yield effect is bigger. In order to prevent and treat dichocrocis punctiferalis, the main prevention and controls that people generally adopt has: cultural control, chemical prevention and physical control.

Cultural control is that regulation and control crop, insect, environmental factors, creation one are conducive to plant growth to be unfavorable for the farmland ecological environment that dichocrocis punctiferalis occurs multifactorial for whole farmland ecosystem comprehensive coordination management. As Overwintering Larvae pupate with sprout wings before, combine and stop field, carry out intertillage and plough deeply and reduce pupa number, have certain effect to reducing generation radix of future generation; Or carry out the measure such as intercropping, crop rotation to reduce the dichocrocis punctiferalis fancy grade to host plant. But because cultural control must obey the requirement of crop allocation and volume increase, application has certain limitation, it is impossible to as emergency measure, just seem when dichocrocis punctiferalis is broken out helpless.

Chemical prevention and pesticide control, being utilize chemical insecticide to kill insect, be the important component part of dichocrocis punctiferalis comprehensive control, it has the feature of quick, convenient, easy and high economic benefit, particularly when the big generation of dichocrocis punctiferalis, it it is requisite emergency measure. Current chemical prevention and control method is mainly medicine liquid spray, and is before ovum incubates the Sheng phase to 2 ages to dichocrocis punctiferalis medication best period, and after 2 ages, along with polypide is more big, Drug resistance is more strong, and effect of chemical control is more poor, it will be difficult to reach the purpose of preventing and treating.Chemical prevention simultaneously also has its limitation, as improper use frequently can lead to crops generation poisoning, insect develops immunity to drugs, and reduce natural enemy, contaminated environment, make farmland ecosystem suffer to destroy with pesticide residues adverse consequencess such as the safety of people, animal constitute a threat to.

Physical control, mainly according to the insect reaction to physical factors various in environmental condition, utilizes various physical factor such as optical, electrical, color, humiture etc. and plant equipment to carry out trapping and killing, the method such as steriliation by irradiation carrys out pest control. Most widely used at present is frequency ventilating type insecticidal lamp trapping, and it utilizes the phototaxis of adult pest, closely uses up, and at a distance with ripple, lures insect close, the preventing and treating of dichocrocis punctiferalis adult is had certain effect; But frequency ventilating type insecticidal lamp needs clear up the dirt on high-voltage fence in time every day, insecticidal effect otherwise can be affected; And can not turn on light at thundery sky, the danger hurted sb.'s feelings of operationally also shocking by electricity; In addition the disposable input installing lamp is bigger.

In order to solve cultural control, chemical prevention and physical control limitation in actual applications, scientists finds to proceed in plant by the anti insect gene of the encoding insecticidal proteins coming from bacillus thuringiensis through research, can obtain some insect-resistant transgenic plants to prevent and treat insect pest of the plant. Vip3A insecticidal proteins is the one in numerous insecticidal proteins, is the specific protein produced by Bacillus cercus.

Vip3A albumen is by exciting the apoptosis of apoptosis type that sensitivity insecticide is had poisoning effect. Vip3A albumen is hydrolyzed to 4 kinds of major protein products in insect gut, the toxicity core texture that wherein only a kind of protein hydrolysate (33KD) is Vip3A albumen. The midgut epithelial cell of Vip3A protein binding sensitive insect, active cell programmed death, causes the dissolving of midgut epithelial cell to cause insect death. Non-sensitive insecticide is not produced any disease, is not result in apoptosis and the dissolving of midgut epithelial cell.

Have turned out the plant turning Vip3A gene and can resist the infringement of the Lepidoptera Lepidoptera insects such as the greedy noctuid in black cutworm, bollworm and meadow, but, there is no the transfer-gen plant about being expressed Vip3A albumen by generation so far and control the dichocrocis punctiferalis report to plant hazard.

Summary of the invention

It is an object of the invention to provide the purposes of a kind of insecticidal proteins, provide first and control the dichocrocis punctiferalis method to plant hazard by the transfer-gen plant of generation expression Vip3A albumen, and effectively overcome the technological deficiencies such as prior art cultural control, chemical prevention and physical control.

For achieving the above object, the invention provides a kind of method controlling dichocrocis punctiferalis insect, including by dichocrocis punctiferalis insect at least with Vip3A protein contact, wherein said dichocrocis punctiferalis insect not with Cry1Fa protein contact.

Further, described Vip3A albumen is present in the host cell at least producing described Vip3A albumen, described dichocrocis punctiferalis insect by ingest described host cell at least with described Vip3A protein contact.

Further, described Vip3A albumen is present in the antibacterial or transgenic plant at least producing described Vip3A albumen, described dichocrocis punctiferalis insect by ingest described antibacterial or described transgenic plant tissue at least with described Vip3A protein contact, after contact, the growth of described dichocrocis punctiferalis insect is suppressed and/or causes death, to realize dichocrocis punctiferalis is endangered the control of plant.

Described transgenic plant may be at any period of duration.

Described transgenic plant be organized as root, blade, stem stalk, fruit, tassel, female fringe, flower pesticide or filigree.

The described control that dichocrocis punctiferalis endangers plant does not change because of the change of plantation place and/or implantation time.

Described plant is Semen Maydis, Helianthi, Semen sojae atricolor, Sorghum vulgare Pers., Semen Castaneae, Fructus Persicae, Punica granatum L., Fructus Mali pumilae, Fructus Lycopersici esculenti, Fructus Solani melongenae, turfgrass, Cotton Gossypii, Brassica campestris L or Fructus Fragariae Ananssae.

Step before described contact procedure is the plantation plant containing the polynucleotide encoding described Vip3A albumen.

Preferably, the aminoacid sequence of described Vip3A albumen has the aminoacid sequence shown in SEQIDNO:1 or SEQIDNO:3 or SEQIDNO:5. The nucleotide sequence of described Vip3A albumen has the nucleotide sequence shown in SEQIDNO:2 or SEQIDNO:4 or SEQIDNO:6.

On the basis of technique scheme, described plant can also include the second nucleotide of at least one nucleotide being different from and encoding described Vip3A albumen, and described the second nucleotide does not encode Cry1Fa albumen.

Further, described the second nucleotide coding Cry class insect-killing protein, Vip class insect-killing protein, protease inhibitor, agglutinin, α-amylase or peroxidase.

Preferably, described the second nucleotide coding Cry1Ab albumen.

Further, the aminoacid sequence of described Cry1Ab albumen has the aminoacid sequence shown in SEQIDNO:7 or SEQIDNO:11. The nucleotide sequence of described Cry1Ab albumen have shown in SEQIDNO:8 or SEQIDNO:12 nucleotide sequence.

Selectively, described the second nucleotide is suppress the dsRNA of important gene in target insect pests.

For achieving the above object, present invention also offers a kind of Vip3A protein and control the purposes of dichocrocis punctiferalis insect.

For achieving the above object, present invention also offers a kind of method producing and controlling the plant of dichocrocis punctiferalis insect, including the polynucleotide sequence introducing coding Vip3A albumen in the genome to described plant, the described plant after introducing does not produce Cry1Fa albumen.

For achieving the above object, present invention also offers a kind of method producing to control the plant seed of dichocrocis punctiferalis insect, including the first plant that will be obtained by described method and the second plant hybridization, thus producing the seed containing the polynucleotide sequence encoding Vip3A albumen.

For achieving the above object, a kind of method that present invention also offers plant cultivated and control dichocrocis punctiferalis insect, including:

Planting at least one propagulum, the genome of described propagulum includes the polynucleotide sequence of coding Vip3A albumen;

Described propagulum is made to grow up to plant;

Make the growth when artificial vaccination dichocrocis punctiferalis insect and/or dichocrocis punctiferalis insect naturally-occurring endanger of described plant, results not there is the plant of the polynucleotide sequence of coding Vip3A albumen with other compared with there is the plant injury weakened and/or there is the plant of plant products of increase.

Heretofore described " propagulum " includes but not limited to plant tannins and plant vegetative propagule. Described plant tannins includes but not limited to plant seed; Described plant vegetative propagule refers to nutrition organs or certain particular tissues of plant, and it can produce new plant in vitro; Described nutrition organs or certain particular tissues include but not limited to root, stem and leaf, for instance: include Fructus Fragariae Ananssae and Rhizoma Dioscoreae esculentae etc. with the plant that root is vegetative propagule; Caulis Sacchari sinensis and Rhizoma Solani tuber osi (tuber) etc. is included with the plant that stem is vegetative propagule;Aloe and Flos Begoniae Evansianae etc. is included with the plant that leaf is vegetative propagule.

Heretofore described " contact ", refer to insecticide and/or insect touching, stop and/or feeding plant, plant organ, plant tissue or plant cell, described plant, plant organ, plant tissue or plant cell both can be its expression in vivo insecticidal proteins, it is also possible to be that the surface of described plant, plant organ, plant tissue or plant cell has insecticidal proteins and/or has the microorganism producing insecticidal proteins.

" control " of the present invention and/or " preventing and treating " refer to dichocrocis punctiferalis insect at least with Vip3A protein contact, after contact dichocrocis punctiferalis insect growth be suppressed and/or cause death. further, dichocrocis punctiferalis insect by feeding plant organize at least with Vip3A protein contact, after contact all or part of dichocrocis punctiferalis insect growth be suppressed and/or cause death. suppress to refer to sub-lethal, namely not yet lethal but certain effects of the aspects such as growth promoter, behavior, physiology, biochemistry and tissue can be caused, such as growth promoter slowly and/or stopping. meanwhile, plant should be morphologically normal, and can cultivate the consumption for product and/or generation under conventional approaches. in addition, the plant controlling dichocrocis punctiferalis insect of the polynucleotide sequence containing coding Vip3A albumen and/or plant seed, when artificial vaccination dichocrocis punctiferalis insect and/or dichocrocis punctiferalis insect naturally-occurring endanger, having the plant injury weakened compared with not genetically modified WT lines, concrete manifestation includes but not limited to the blade resistance and/or the kernel weight improved and/or the volume increase etc. that improve. " control " and/or " preventing and treating " of dichocrocis punctiferalis is acted on by Vip3A albumen is can be self-existent, not because of other can " control " and/or the existence of the material of " preventing and treating " dichocrocis punctiferalis insect and weaken and/or disappear. specifically, any tissue of transgenic plant (polynucleotide sequence containing coding Vip3A albumen) is simultaneously and/or asynchronously, exist and/or produce, Vip3A albumen and/or the another kind of material of dichocrocis punctiferalis insect can be controlled, then the existence of described another kind of material neither affects " control " and/or " preventing and treating " to dichocrocis punctiferalis of the Vip3A albumen and acts on, can not cause described " control " and/or " preventing and treating " effect completely and/or part is realized by described another kind of material, and unrelated with Vip3A albumen. under normal circumstances, in land for growing field crops, the process of dichocrocis punctiferalis insect feeding plant tissue is of short duration and is difficult to observe with the naked eye, therefore, when artificial vaccination dichocrocis punctiferalis insect and/or dichocrocis punctiferalis insect naturally-occurring endanger, there is dead dichocrocis punctiferalis insect in any tissue such as transgenic plant (polynucleotide sequence containing coding Vip3A albumen), and/or stop the dichocrocis punctiferalis insect that growth is suppressed thereon, and/or there is the plant injury weakened compared with not genetically modified WT lines, it is the method and/or purposes that achieve the present invention, namely by dichocrocis punctiferalis insect at least with Vip3A protein contact to realize the control method of dichocrocis punctiferalis insect and/or purposes.

In the present invention, the expression in a kind of transgenic plant of the Vip3A albumen can along with the expression of one or more Cry class insect-killing proteins and/or Vip class insect-killing protein. This kind of Pesticidal toxins co expression in same strain transgenic plant that exceedes can make plant comprise by genetic engineering and express required gene to realize. It addition, a kind of plant (the 1st parent) can pass through genetic engineering procedure expresses Vip3A protein, the second plant (the 2nd parent) can pass through genetic engineering procedure and express Cry class insect-killing protein and/or Vip class insect-killing protein.The progeny plants expressing all genes introducing the 1st parent and the 2nd parent is obtained by the 1st parent and the 2nd parents.

RNA interference (RNAinterference, RNAi) refers to phenomenon that be highly conserved during evolution, that brought out, the efficient selective degradation of homologous mRNA by double-stranded RNA (double-strandedRNA, dsRNA). Therefore can use RNAi technology specific depletion in the present invention or close the expression of specific gene in target insect pests.

In categorizing system, the morphological characteristics such as the general main type according to the nervuration of adult wing, linkage mode and feeler, are divided into Lepidoptera suborder, Superfamily, section etc., and Pyralidae are one of sections of most species in Lepidoptera, the whole world has been found that more than 10,000 kinds, and only China's record just has several thousand. Major part Pyralidae insecticide is the insect of crops, most causes harm eating into stem form, such as striped rice borer and Pyrausta nubilalis (Hubern).. Although dichocrocis punctiferalis and striped rice borer, Pyrausta nubilalis (Hubern). etc. belong to Lepidoptera Pyralidae, except there is similarity in criteria for classification, other morphosis then exists huge difference; Like the Fructus Fragariae Ananssae in plant the same with Fructus Mali pumilae (belonging to Rosales Rosaceae), they have the features such as colored both sexes, radiation symmetric, 5, petal, but its fruit and plant forms but vary. No matter dichocrocis punctiferalis is from Larva Morpho. Logy or adult form, all has the feature of its uniqueness. As dichocrocis punctiferalis is otherwise known as leopard stricture of vagina moth, being because on its adult wing has leopard stricture of vagina. And the Pyrausta nubilalis (Hubern). belonged to together with it, entirely without leopard stricture of vagina on wing, and there are some ripple glazes. Adult stage is the important stage that insecticide to exercise copulation breeding, and the decorative pattern on wing coordinates the sex pheromone of release, attracts companion, and then completes copulation and raise up seed. So apparent slight difference, what in fact embody is the fundamental difference in individual reproduction and colony's procreation.

Not only there is larger difference in the insecticide belonging to Pyralidae together, simultaneously on feeding habit, there is also difference in morphological characteristic. Such as it is all the Pyrausta nubilalis (Hubern). of Pyralidae mainly to cause harm Semen Maydis gramineous, other broad-leaved class crop of seldom causing harm, has especially never had been reported that Pyrausta nubilalis (Hubern). is caused harm the fruit tree crops such as Fructus Persicae, Punica granatum L., Fructus Mali pumilae. And dichocrocis punctiferalis is except Semen Maydis of causing harm, non-crop gramineous such as Helianthi, Semen sojae atricolor and Fructus Persicae, Punica granatum L. etc. of also causing harm in a large number. The difference of feeding habit, also imply that enzyme produced by internal digestive system is different with receptor protein. And the enzyme produced in digestive tract is the key point that Bt gene works, the enzyme that only can combine with specific b t gene or receptor protein, it is possible to, so that certain this insect of Bt gene pairs, there is insect resistant effect. Increasing research shows, the sensitivity of Bt albumen of the same race is showed difference by insecticide not of the same race not equal with order, even equal. The striped rice borer Chilosuppressalis and Ostrinia furnacalis Ostriniafurnacalis of such as Vip3Aa gene pairs Pyralidae shows anti-insect activity, but Indian meal moth Plodiainterpunctella and European corn borer Ostrinianubilalis for belonging to Pyralidae together but do not have insect resistant effect. Above-mentioned several insect belongs to Lepidoptera Pyralidae, but these several Pyralidae insects are shown different resistance effects by Bt albumen of the same race. Especially European corn borer and Ostrinia furnacalis even belong to Pyralidae Ostrinia genus (belonging to together with order is equal) in classification, but the reaction of Bt albumen of the same race is but distinct by it, more absolutely prove that Bt albumen is complicated with the interaction mode of insect bodies endoenzyme and receptor and is difficult to expect.

The genome of heretofore described plant, plant tissue or plant cell, refers to any hereditary material in plant, plant tissue or plant cell, and includes nucleus and plastid and mitochondrial genome.

Heretofore described polynucleotide and/or nucleotide form completely " gene ", coded protein or polypeptide in required host cell. Those skilled in the art are it is readily appreciated that under the regulating and controlling sequence that can the polynucleotide of the present invention and/or nucleotide be placed in purpose host controls.

Well-known to those skilled in the art, DNA typically exists with double chain form. In this arrangement, chain and another chain complementation, vice versa. Owing to DNA replicates other complementary strand creating DNA in plant. So, the present invention includes the use to the polynucleotide of example in sequence table and complementary strand thereof. " coding strand " that this area often uses refers to the chain being combined with antisense strand. For marking protein in vivo, DNA chain is transcribed into the complementary strand of a mRNA by typical case, and it translates protein as template. " antisense " chain that mRNA is actually from DNA is transcribed. " having justice " or " coding " chain has a series of codon (codon is three nucleotide, once reads three and can produce specific amino acids), it can be read as open reading frame (ORF) and form destination protein matter or peptide. Present invention additionally comprises the DNA with example and have the RNA of suitable function.

Nucleic acid molecule of the present invention or its fragment under strict conditions with Vip3A gene recombination of the present invention. The nucleic acid hybridization of any routine or amplification method may be used to identify the existence of Vip3A gene of the present invention. Nucleic acid molecules or its fragment can carry out specific hybrid with other nucleic acid molecules in any case. In the present invention, if two nucleic acid molecules can form antiparallel double-strandednucleic acid structure, it is possible to say that the two nucleic acid molecules can carry out specific hybrid to each other. If two nucleic acid molecules demonstrate complementary completely, then claiming one of them nucleic acid molecules is another nucleic acid molecules " complement ". In the present invention, when the corresponding nucleotide complementary of each nucleotide and another nucleic acid molecules of a nucleic acid molecules, then the two nucleic acid molecules is claimed to demonstrate " complete complementary ". If two nucleic acid molecules can with enough stability phase mutual crosses so that they be annealed and be bonded to each other under at least conventional " low strict " condition, then claiming the two nucleic acid molecules is " minimum level is complementary ". Similarly, if two nucleic acid molecules with enough stability phase mutual crosses so that they are annealed under conventional " highly strict " condition and are bonded to each other, then can claim the two nucleic acid molecules to have " complementarity ". Deviate from complete complementary and can allow, as long as this deviation not exclusively stops two molecules to form duplex structure. In order to enable a nucleic acid molecules as primer or probe, it is only necessary to ensure that it has sufficient complementarity in sequence, so that stable duplex structure can be formed under the specific solvent adopted and salinity.

In the present invention, the sequence of basic homology is one section of nucleic acid molecules, and this nucleic acid molecules can with the complementary strand generation specific hybrid of another section of nucleic acid molecules matched under high stringency. Promote the stringent condition being suitable for of DNA hybridization, for instance, it is approximately under 45 DEG C of conditions and processes by 6.0 × sodium chloride/sodium citrate (SSC), then wash with 2.0 × SSC under 50 DEG C of conditions, those skilled in the art are known by these conditions.Such as, the salinity in washing step can be selected from the about 2.0 × SSC of Low stringency conditions, 50 DEG C to the about 0.2 × SSC of high stringency, 50 DEG C. Additionally, the temperature conditions in washing step from the room temperature of Low stringency conditions about 22 DEG C, can be increased to about 65 DEG C of high stringency. Temperature conditions and salinity can all change, it is also possible to one of them remains unchanged and another variable changes. Preferably, stringent condition of the present invention can be in 6 × SSC, 0.5%SDS solution, with, SEQIDNO:4 and SEQIDNO:6, specific hybrid occurs, then respectively wash film 1 time with 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS at 65 DEG C.

Therefore, there is anti-insect activity and be included in the invention with the sequence of SEQIDNO:2, SEQIDNO:4 and SEQIDNO:6 of the present invention hybridization under strict conditions. These sequences and sequence of the present invention be 40%-50% homology at least about, about 60%, 65% or 70% homology, even at least about sequence homology of 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or bigger.

Heretofore described gene and protein not only include specific exemplary sequence, also include the part and/or fragment (including compared with full length protein and/or terminal deletion), variant, mutant, substituent (having the amino acid whose protein of replacement), chimera and the fusion protein that save the insecticidal activity feature of the protein of described particular example. Described " variant " or " variation " refer to that the same albumen of coding or coding have the nucleotide sequence of the equivalent protein of insecticidal activity. Described " equivalent protein " refers to that the albumen with claim has the identical or essentially identical bioactive albumen suppressing dichocrocis punctiferalis insect.

Original DNA that " fragment " or " truncate " of heretofore described DNA molecular or protein sequence refers to or a part for protein sequence (nucleotide or aminoacid) or its artificial reconstructed form (being such as suitable for the sequence of expression of plants), can there is change in the length of foregoing sequences, but length is enough to ensure that (coding) protein is insect toxins.

Use standard technique can build gene variant with easy by modifying gene. Such as, it is well known that the technology manufacturing point mutation. Again such as U.S. Patent number 5605793 describe after random fracture use DNA reassembly produce other molecular diversity method. Commercialization Cobra venom endonuclease can be used to manufacture the fragment of full-length gene, and exonuclease can be used according to standardization program. It is, for example possible to use enzyme such as Bal31 or direct mutagenesis excise nucleotide from the end system of these genes. Multiple restricted enzyme can also be used to obtain the gene of encoding active fragment. Protease can be used to directly obtain the active fragment of these toxin.

The present invention can derive equivalent protein from B.t. separator and/or DNA library and/or encode the gene of these equivalent protein. Multiple method is had to obtain the insecticidal proteins of the present invention. It is, for example possible to use the antibody of disclosure and claimed insecticidal proteins is identified and isolated from other albumen from protein mixture. Especially, antibody is probably what the most constant by albumen and the most different from other B.t. albumen protein part caused. May then pass through immunoprecipitation, enzyme-linked immunosorbent assay (ELISA) or western immunoblot method uses these antibody exclusively to identify the equivalent protein of activity characteristic.This area standardization program can be used to be easy to prepare the antibody of the fragment of albumen or equivalent protein or this albuminoid disclosed in the present invention. Then the gene encoding these albumen can be obtained from microorganism.

Due to the Feng Yuxing of genetic codon, multiple different DNA sequence can encode identical aminoacid sequence. Produce the alternative DNA sequence of the identical or essentially identical albumen of these codings just in the technical merit of those skilled in the art. These different DNA sequence are included within the scope of the invention. Described " substantially the same " sequence refers to aminoacid replacement, disappearance, interpolation or insertion but does not substantially affect the sequence of insecticidal activity, also includes the fragment retaining insecticidal activity.

In the present invention, the replacement of aminoacid sequence, disappearance or interpolation are the ordinary skill in the art, it is preferable that this seed amino acid is changed to: little characteristic changing, and namely folding the and/or active conserved amino acid of not appreciable impact albumen replaces; Little disappearance, normally about 1-30 amino acid whose disappearance; Little amino or c-terminus extend, for instance aminoterminal extends a methionine residues; Little connection peptides, for instance about 20-25 residue is long.

The conservative example replaced is the replacement occurred in following aminoacid group: basic amino acid (such as arginine, lysine and histidine), acidic amino acid (such as glutamic acid and aspartic acid), polar amino acid (such as glutamine, agedoite), hydrophobic amino acid (such as leucine, isoleucine and valine), ArAA (such as phenylalanine, tryptophan and tyrosine), and little molecule aminoacid (such as glycine, alanine, serine, threonine and methionine). Those aminoacid replacement generally not changing given activity are well-known in this area, and by, such as, N.Neurath and R.L.Hill was described in new york academic publishing house (AcademicPress) " Protein " that publish in 1979. Modal exchange has Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, and they contrary exchanges.

For a person skilled in the art it should be evident that this replacement can occur outside the region that molecular function is played an important role, and still produce active polypeptide. For by the polypeptide of the present invention, its activity is required and therefore selects the amino acid residue not being replaced, can according to methods known in the art, as direct mutagenesis or alanine scanning mutagenesis carry out identifying (as referring to, Cunningham and Wells, 1989, Science244:1081-1085). Latter technique is that each positively charged residue place introduces sudden change in the molecule, detects the anti-insect activity of gained mutating molecule, so that it is determined that the amino acid residue wanted that this molecular activity is overstated. Substrate-enzyme interacting site can also be measured by the analysis of its three dimensional structure, this three dimensional structure can by the technical measurements such as nuclear magnetic resonance spectroscopy, crystallography or photoaffinity labeling (referring to, such as deVos etc., 1992, Science255:306-312; Smith etc., 1992, J.Mol.Biol224:899-904; Wlodaver etc., 1992, FEBSLetters309:59-64).

In the present invention, Vip3A albumen includes but not limited to SEQIDNO:1, SEQIDNO:3 and SEQIDNO:5, and the aminoacid sequence with the aminoacid sequence shown in SEQIDNO:1, SEQIDNO:3 and SEQIDNO:5 with certain homology is also included within the present invention.These sequences and sequence similarities/homogeny of the present invention are typically larger than 60%, it is preferred that more than 75%, be more preferably greater than 80%, even more preferably from more than 90%, and can more than 95%. can also according to the preferred polynucleotide of homogeny particularly and/or the similarity scope definition present invention and protein. such as have 49% with the sequence of example of the present invention, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, the homogeny of 98% or 99% and/or similarity.

In the present invention, the transgenic plant producing described Vip3A albumen includes but not limited to COT102 transgenic cotton event and/or the vegetable material (as described by CN1004395507C) comprising COT102 transgenic cotton event, COT202 transgenic cotton event and/or comprise the vegetable material (as described by CN1886513A) of COT202 transgenic cotton event, or MIR162 transgenic corn events and/or comprise the vegetable material (as described by CN101548011A) of MIR162 transgenic corn events, it all can realize method and/or the purposes of the present invention, namely by dichocrocis punctiferalis insect at least with Vip3A protein contact to realize the control method of dichocrocis punctiferalis insect and/or purposes, more specifically, described Vip3A albumen is present in the transgenic plant at least producing described Vip3A albumen, described dichocrocis punctiferalis insect by ingest described transgenic plant tissue at least with described Vip3A protein contact, after contact, the growth of described dichocrocis punctiferalis insect is suppressed and/or causes death, to realize dichocrocis punctiferalis is endangered the control of plant.

Heretofore described regulating and controlling sequence include but not limited to promoter, transit peptides, terminator, enhancer, targeting sequencing, intron and other be operably connected to the adjustment sequence of described Vip3A albumen.

Described promoter is effable promoter in plant, and described " in plant effable promoter " refers to and guarantee that connected coded sequence carries out the promoter expressed in plant cell. In plant, effable promoter can be constitutive promoter. Instruct the example of the promoter of constitutive expression in plant to include but not limited to, derive from the promoter etc. of the 35S promoter of cauliflower mosaic virus, Semen Maydis Ubi promoter, Oryza sativa L. GOS2 gene. Alternatively, in plant, effable promoter can be tissue-specific promoter, namely this promoter as instructs the expression of coded sequence to be higher than its hetero-organization (can pass through conventional RNA test be measured) of plant in some tissues of plant in chlorenchyma, such as PEP carboxylase promoter. Alternatively, in plant, effable promoter can be wound-induced promoter. Wound-induced promoter or instruct the promoter of expression pattern of wound-induced to refer to when plant is stood machinery or gnawed, by insecticide, the wound caused, is significantly increased under the expression compared with normal growth conditions of the coded sequence under promoter regulation. The example of wound-induced promoter includes but not limited to, the protease suppressor gene (pin I and pin II) of Rhizoma Solani tuber osi and Fructus Lycopersici esculenti and the promoter of zein enzyme level gene (MPI).

Described transit peptides (also known as secretory signal sequence or targeting sequencing) is to instruct transgene product to arrive specific organelle or cellular compartment, for receptor protein, described transit peptides can be allos, such as, utilize encoding chloroplast transit peptide sequence targeting chloroplast, or utilize ' KDEL ' to retain sequence targeting endoplasmic reticulum, or utilize the CTPP targeting vacuole of barley plants agglutinin gene.

Described targeting sequencing including but not limited to, picornavirus targeting sequencing, such as EMCV targeting sequencing (encephalomyocarditis virus 5 ' noncoding region); Potyvirus leaders, such as MDMV (Maize Dwarf Mosaic Virus) targeting sequencing; Human immunoglobulin matter heavy-chain binding protein matter (BiP); The coat protein mRNA of alfalfa mosaic virus does not translate targeting sequencing (AMVRNA4); Tobacco mosaic virus (TMV) (TMV) targeting sequencing.

Described enhancer including but not limited to, cauliflower mosaic virus (CaMV) enhancer, figwort mosaic virus (FMV) enhancer, Dianthus carryophyllus air slaking circovirus virus (CERV) enhancer, cassava vein mosaic virus (CsVMV) enhancer, Mirabilis jalapa mosaic virus (MMV) enhancer, Castrum nocturum L tomato yellow leaf curl China virus (CmYLCV) enhancer, Cotton leaf curl Multan virus (CLCuMV), commelina yellow mottle virus (CoYMV) and Semen arachidis hypogaeae chlorisis streak mosaic virus (PCLSV) enhancer.

For monocotyledon apply for, described intron including but not limited to, Semen Maydis hsp70 intron, maize ubiquitin intron, Adh introne 1, crose synthase intron or Oryza sativa L. Act1 intron. For dicotyledon apply for, described intron including but not limited to, CAT-1 intron, pKANNIBAL intron, PIV2 intron and " super ubiquitin " intron.

Described terminator can be the applicable polyadenylation signal sequence worked in plant, include but not limited to, the polyadenylation signal sequence, the polyadenylation signal sequence deriving from protease-inhibitor Ⅱ (pin II) gene that derive from Agrobacterium (Agrobacteriumtumefaciens) rouge alkali synthetase (NOS) gene, derive from the polyadenylation signal sequence of Semen Pisi sativi ssRUBISCOE9 gene and derive from the polyadenylation signal sequence of alpha-tubulin (α-tubulin) gene.

Heretofore described " effectively connecting " represents the connection of nucleotide sequence, and described connection makes a sequence can provide the function that linked sequence is needed. " effectively connecting " described in the present invention can for be connected promoter with sequence interested so that transcribing of this sequence interested is subject to the control of this promoter and regulation and control. When sequential coding albumen interested and when going for the expression of this albumen " effectively connecting " represent: promoter is connected with described sequence, and connected mode makes the transcript efficient translation obtained. If the connection of promoter and coded sequence is the expression that transcript merges and want the albumen that realization encodes, manufacture such connection so that in the transcript obtained, the first translation initiation codon is the start codon of coded sequence. Alternatively, if the connection of promoter and coded sequence is the expression that the albumen that realization encodes is merged and wants in translation, manufacture such connection, the first translation initiation codon contained in 5 ' non-translated sequences and promoter are connected, and connected mode makes the translation product obtained and the relation of the translation opening code-reading frame encoding the albumen wanted is consistent with reading frame.The nucleotide sequence that can " effectively connect " includes but not limited to: provide sequence (the i.e. gene expression element of gene expression function, such as promoter, 5 ' untranslated regions, intron, protein encoding regions, 3 ' untranslated regions, poly-putative adenylylation site and/or transcription terminator), sequence (the i.e. T-DNA border sequence of DNA transfer and/or integration function is provided, site-specific recombinase recognition site, intergrase recognition site), sequence (the i.e. antibiotic resistance markers of selectivity function is provided, biosynthesis gene), offer can be scored the sequence of label function, sequence (the i.e. polylinker sequence of external or internal assistance series of operations, locus specificity recombination sequence) and provide copy function sequence (the i.e. origin of replication of antibacterial, autonomous replication sequence, centromeric sequence).

Heretofore described " parasite killing " or " pest-resistant " refers to crop pests it is poisonous, thus realizing " control " and/or " preventing and treating " crop pests. Preferably, described " parasite killing " or " pest-resistant " refers to and kills crop pests. More specifically, targeted insect is dichocrocis punctiferalis insect.

In the present invention, dichocrocis punctiferalis insect is had toxicity by Vip3A albumen. Plant in the present invention, particularly corn and soybean and Sorghum vulgare Pers., containing foreign DNA in its genome, described foreign DNA comprises the nucleotide sequence of coding Vip3A albumen, dichocrocis punctiferalis insect is by feeding plant tissue and this protein contact, and after contact, the growth of dichocrocis punctiferalis insect is suppressed and/or causes death. Suppression refers to lethal or sub-lethal. Meanwhile, plant should be morphologically normal, and can cultivate the consumption for product and/or generation under conventional approaches. Additionally, this plant can substantially eliminate the needs insecticide of the dichocrocis punctiferalis insect for Vip3A albumen institute targeting (described chemistry or the biological insecticides are) to chemistry or biological insecticides.

In vegetable material, the expression of insecticidal crystal protein (ICP) can be detected by multiple method described in this area, such as by application special primer, the mRNA of the coded insect-killing protein of generation in tissue is carried out quantitatively, or the amount of the insect-killing protein of direct specific detection generation.

The insecticidal effect of ICP in different test determination plants can be applied. In the present invention, targeted insect is mainly dichocrocis punctiferalis.

In the present invention, described Vip3A albumen can have the aminoacid sequence shown in SEQ ID NO:1, SEQIDNO:3 and SEQIDNO:5. Except comprising the coding region of Vip3A albumen, it is possible to comprise other elements, for instance the protein of encoding selection markers.

In addition, the expression cassette of the nucleotide sequence comprising code book invention Vip3A albumen can also be expressed in plant together with the protein of at least one encoding herbicide resistance gene, described herbicide resistance gene includes but not limited to, phosphine oxamate resistant gene is (such as bar gene, pat gene), phenmedipham resistant gene (such as pmph gene), Glyphosate resistance gene (such as EPSPS gene), Brominal (bromoxynil) resistant gene, sulfonylurea resistance gene, resistant gene to herbicide Dalapon, resistant gene to the resistant gene of cyanamide or glutamine synthetase inhibitor (such as PPT), thus obtaining, both there is high insecticidal activity, there is again the transgenic plant of Herbicid resistant.

In the present invention, by Exogenous DNA transfered plant, by the gene of described for coding Vip3A albumen or expression cassette or recombinant vector importing plant cell, conventional method for transformation includes but not limited to, Agrobacterium-medialed transformation, trace launch bombardment, the direct DNA that DNA takes in protoplast, electroporation or silicon whisker mediation imports.

The invention provides the purposes of a kind of insecticidal proteins, have the advantage that

1, endogenous cause of ill preventing and treating. Prior art controls the harm of dichocrocis punctiferalis insect mainly by external action and exopathogenic factor, such as cultural control, chemical prevention and physical control; And the present invention controls dichocrocis punctiferalis insect by producing in plant to kill the Vip3A albumen of dichocrocis punctiferalis, namely prevented and treated by endogenous cause of ill.

2, pollution-free, noresidue. Although the harm controlling dichocrocis punctiferalis insect is served certain effect by the chemical prevention and control method that prior art uses, but people, animal and farmland ecosystem also brings pollution, destroys and residual simultaneously; Use the method that the present invention controls dichocrocis punctiferalis insect, it is possible to eliminate above-mentioned adverse consequences.

3, preventing and treating in the time of infertility. The method controlling dichocrocis punctiferalis insect that prior art uses is all interim; and plant is carried out the protection in the time of infertility by the present invention; transgenic plant (Vip3A albumen) from germinate, growth, until bloom, result, can avoid suffering the infringement of dichocrocis punctiferalis.

4, whole plant preventing and treating. The method controlling dichocrocis punctiferalis insect that prior art uses is locality mostly, such as foliage-spray; And whole plant is protected by the present invention, as the root of transgenic plant (Vip3A albumen), blade, stem stalk, fruit, tassel, female fringe, flower pesticide or filigree etc. all can resist dichocrocis punctiferalis infringement.

5, effect stability. The frequency ventilating type insecticidal lamp that prior art uses not only needs every day and clears up the dirt of high-voltage fence in time, and can not use at thundery sky; The present invention makes described Vip3A albumen express in plant, effectively overcome the defect that the effect of frequency ventilating type insecticidal lamp is affected by extraneous factor, and the prevention effect of transgenic plant of the present invention (Vip3A albumen) in different location, different time, different genetic background be also all stable and consistent.

6, simple, convenient, economical. The disposable input of the frequency ventilating type insecticidal lamp that prior art uses is relatively big, and misoperation also shocks by electricity the danger hurted sb.'s feelings; The present invention only need to plant the transgenic plant that can express Vip3A albumen, without adopting other measure, thus saving a large amount of human and material resources and financial resources.

7, effect is thorough. The method controlling dichocrocis punctiferalis insect that prior art uses, its effect is halfway, only serves and alleviates effect; And the prevention effect of dichocrocis punctiferalis newly hatched larvae is almost absolutely by transgenic plant (Vip3A albumen) of the present invention, survival larva also substantially stasi extremely individually, after 3 days, larva is substantially still in just incubating state, it it is all obvious dysplasia, and stasi, field natural environment cannot be survived, and transgenic plant is generally limited only by slight damage.

Below by drawings and Examples, technical scheme is described in further detail.

Accompanying drawing explanation

The recombinant cloning vector DBN01-T containing Vip3A nucleotide sequence that Fig. 1 is the purposes of insecticidal proteins of the present invention builds flow chart;

The recombinant expression carrier DBN100002 containing Vip3A nucleotide sequence that Fig. 2 is the purposes of insecticidal proteins of the present invention builds flow chart;

Fig. 3 is the blade injury figure of the transgenic corn plant inoculation dichocrocis punctiferalis of the purposes of insecticidal proteins of the present invention;

Fig. 4 is the blade injury figure of the Transgenic soybean plants inoculation dichocrocis punctiferalis of the purposes of insecticidal proteins of the present invention.

Detailed description of the invention

The technical scheme of the purposes of insecticidal proteins of the present invention is further illustrated below by specific embodiment.

First embodiment, the acquisition of gene and synthesis

1, nucleotide sequence is obtained

The aminoacid sequence (789 aminoacid) of Vip3A-01 insect-killing protein, as shown in SEQ ID NO:1; Encode the Vip3A-01 nucleotide sequence (2370 nucleotide) of the aminoacid sequence corresponding to described Vip3A-01 insect-killing protein, as shown in SEQ ID NO:2.

The aminoacid sequence (789 aminoacid) of Vip3A-02 insect-killing protein, as shown in SEQ ID NO:3; Encode the Vip3A-02 nucleotide sequence (2370 nucleotide) of the aminoacid sequence corresponding to described Vip3A-02 insect-killing protein, as shown in SEQ ID NO:4.

The aminoacid sequence (1436 aminoacid) of Vip3A+Cry1Ab insect-killing protein, as shown in SEQ ID NO:9; Encode the Vip3A+Cry1Ab nucleotide sequence (4311 nucleotide) of the aminoacid sequence corresponding to described Vip3A+Cry1Ab insect-killing protein, as shown in SEQ ID NO:10; The wherein aminoacid sequence (788 aminoacid) of Vip3A insect-killing protein, as shown in SEQ ID NO:5; Encode the Vip3A nucleotide sequence (2364 nucleotide) of the aminoacid sequence corresponding to described Vip3A insect-killing protein, as shown in SEQ ID NO:6; The aminoacid sequence (648 aminoacid) of the effective fragment of Cry1Ab, as shown in SEQ ID NO:7; Encode the nucleotide sequence (1944 nucleotide) of the effective fragment of Cry1Ab of the aminoacid sequence corresponding to the effective fragment of described Cry1Ab, as shown in SEQ ID NO:8.

The aminoacid sequence (615 aminoacid) of Cry1Ab-01 insect-killing protein, as shown in SEQ ID NO:11; Encode the Cry1Ab-01 nucleotide sequence (1848 nucleotide) of the aminoacid sequence corresponding to described Cry1Ab-01 insect-killing protein, as shown in SEQ ID NO:12.

2, above-mentioned nucleotide sequence is synthesized

Described Vip3A-01 nucleotide sequence (shown in SEQ ID NO:2), as described in Vip3A-02 nucleotide sequence (shown in SEQ ID NO:4), as described in Vip3A+Cry1Ab nucleotide sequence (shown in SEQ ID NO:6) and as described in Cry1Ab-01 nucleotide sequence (as shown in SEQ ID NO:12), synthesized by Nanjing Genscript Biotechnology Co., Ltd.; 5 ' ends of the described Vip3A-01 nucleotide sequence (SEQIDNO:2) of synthesis are also associated with ScaI restriction enzyme site, and 3 ' ends of described Vip3A-01 nucleotide sequence (SEQIDNO:2) are also associated with SpeI restriction enzyme site; 5 ' ends of the described Vip3A-02 nucleotide sequence (SEQIDNO:4) of synthesis are also associated with ScaI restriction enzyme site, and 3 ' ends of described Vip3A-02 nucleotide sequence (SEQIDNO:4) are also associated with SpeI restriction enzyme site; 5 ' ends of the described Vip3A+Cry1Ab nucleotide sequence (SEQIDNO:9) of synthesis are also associated with SpeI restriction enzyme site, and 3 ' ends of described Vip3A+Cry1Ab nucleotide sequence (SEQIDNO:10) are also associated with KasI restriction enzyme site; 5 ' ends of the described Cry1Ab-01 nucleotide sequence (SEQIDNO:12) of synthesis are also associated with NcoI restriction enzyme site, and 3 ' ends of described Cry1Ab-01 nucleotide sequence (SEQIDNO:12) are also associated with BamHI restriction enzyme site.

Second embodiment, the structure of recombinant expression carrier and recombinant expression carrier convert Agrobacterium

1, the recombinant cloning vector containing Vip3A gene is built

The Vip3A-01 nucleotide sequence of synthesis is connected into cloning vehicle pGEM-T (Promega, Madison, USA, CAT:A3600) on, operating procedure is undertaken by Promega Products pGEM-T carrier description, obtaining recombinant cloning vector DBN01-T, it builds flow process, and (wherein, Amp represents ampicillin resistance gene as shown in Figure 1;F1 represents the origin of replication of phage f1; LacZ is LacZ start codon; SP6 is SP6RNA polymerase promoter; T7 is t7 rna polymerase promoter; Vip3A-01 is Vip3A-01 nucleotide sequence (SEQIDNO:2); MCS is multiple clone site).

Then recombinant cloning vector DBN01-T heat shock method is converted escherichia coli T1 competent cell (Transgen, Beijing, China, CAT:CD501), its hot shock condition is: 50 μ l escherichia coli T1 competent cells, 10 μ l plasmid DNA (recombinant cloning vector DBN01-T), 42 DEG C of water-baths 30 seconds; 37 DEG C of shaken cultivation 1 hour (under 100rpm rotating speed shaking table shake), LB flat board (the tryptone 10g/L of the ampicillin (100 mg/litre) of IPTG (isopropylthio-β-D-galactoside) and X-gal (the bromo-4-of 5-chloro-3-indole-β-D-galactoside) is scribbled on surface, yeast extract 5g/L, NaCl10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) upper growth is overnight. Picking white colony, LB fluid medium (tryptone 10g/L, yeast extract 5g/L, NaCl10g/L, ampicillin 100mg/L, with NaOH adjust pH to 7.5) under 37 DEG C of conditions of temperature overnight incubation. Its plasmid of alkalinity extraction: by bacterium solution centrifugal 1min under 12000rpm rotating speed, remove supernatant, precipitate thalline solution I (25mMTris-HCl, the 10mMEDTA (ethylenediaminetetraacetic acid) of 100 μ l ice pre-coolings, 50mM glucose, pH8.0) suspend; Add the 200 μ l solution II (0.2MNaOH, 1%SDS (sodium lauryl sulphate)) newly prepared, pipe is overturned 4 times, mixing, put 3-5min on ice; Add 150 solution III (3M potassium acetate, 5M acetic acid) ice-cold for μ l, fully mix immediately, place 5-10min on ice; Centrifugal 5min in temperature 4 DEG C, rotating speed 12000rpm when, adds 2 times of volume dehydrated alcohol in supernatant, and after mixing, room temperature places 5min; In temperature 4 DEG C, rotating speed 12000rpm when, centrifugal 5min, abandons supernatant, precipitation concentration (V/V) be 70% washing with alcohol after dry; Add 30 μ l TE (10mMTris-HCl, 1mMEDTA, the PH8.0) dissolution precipitation containing RNase (20 μ g/ml); Water-bath 30min at temperature 37 DEG C, digests RNA; Save backup in temperature-20 DEG C.

The plasmid extracted is after AhdI and XhoI enzyme action is identified, positive colony is carried out sequence verification, result shows that the described Vip3A-01 nucleotides sequence inserted in recombinant cloning vector DBN01-T is classified as the nucleotide sequence shown in SEQ ID NO:2, and namely Vip3A-01 nucleotide sequence is correctly inserted into.

Method according to above-mentioned structure recombinant cloning vector DBN01-T, the described Vip3A-02 nucleotide sequence of synthesis is connected on cloning vehicle pGEM-T, obtaining recombinant cloning vector DBN02-T, wherein, Vip3A-02 is Vip3A-02 nucleotide sequence (SEQIDNO:4). Vip3A-02 nucleotide sequence described in enzyme action and sequence verification recombinant cloning vector DBN02-T is correctly inserted into.

Method according to above-mentioned structure recombinant cloning vector DBN01-T, the described Vip3A+Cry1Ab nucleotide sequence of synthesis is connected on cloning vehicle pGEM-T, obtain recombinant cloning vector DBN03-T, wherein, Vip3A+Cry1Ab is Vip3A+Cry1Ab nucleotide sequence (SEQIDNO:10). Vip3A+Cry1Ab nucleotide sequence described in enzyme action and sequence verification recombinant cloning vector DBN03-T is correctly inserted into.

Method according to above-mentioned structure recombinant cloning vector DBN01-T, the described Cry1Ab-01 nucleotide sequence of synthesis is connected on cloning vehicle pGEM-T, obtaining recombinant cloning vector DBN04-T, wherein, Cry1Ab-01 is Cry1Ab-01 nucleotide sequence (SEQIDNO:12).Cry1Ab-01 nucleotide sequence described in enzyme action and sequence verification recombinant cloning vector DBN04-T is correctly inserted into.

2, the recombinant expression carrier containing Vip3A gene is built

With restricted enzyme ScaI and SpeI enzyme action recombinant cloning vector DBN01-T and expression vector DBNBC-01 (carrier framework: pCAMBIA2301 (CAMBIA mechanism can provide)) respectively, the Vip3A-01 nucleotide sequence fragment cut is inserted between ScaI and the SpeI site of expression vector DBNBC-01, it is well-known to those skilled in the art for utilizing conventional enzymatic cleavage methods carrier construction, being built into recombinant expression carrier DBN100002, it builds flow process (Kan: kanamycin gene as shown in Figure 2; RB: right margin; PrUbi: Semen Maydis Ubiquitin (ubiquitin) gene promoter (SEQIDNO:13); Vip3A-01:Vip3A-01 nucleotide sequence (SEQIDNO:2); TNos: the terminator (SEQIDNO:14) of rouge alkali synthetase gene; Hpt: hygromycin phosphotransferase gene (SEQIDNO:15); LB: left margin).

Recombinant expression carrier DBN100002 heat shock method is converted escherichia coli T1 competent cell, and its hot shock condition is: 50 μ l escherichia coli T1 competent cells, 10 μ l plasmid DNA (recombinant expression carrier DBN100002), 42 DEG C of water-baths 30 seconds; 37 DEG C of shaken cultivation 1 hour (under 100rpm rotating speed shaking table shake); Then at LB solid plate (the tryptone 10g/L containing 50mg/L kanamycin (Kanamycin), yeast extract 5g/L, NaCl10g/L, agar 15g/L, adjust pH to 7.5 with NaOH) upper cultivation 12 hours under 37 DEG C of conditions of temperature, picking white colony, at LB fluid medium (tryptone 10g/L, yeast extract 5g/L, NaCl10g/L, kanamycin 50mg/L, with NaOH adjust pH to 7.5) under 37 DEG C of conditions of temperature overnight incubation. Its plasmid of alkalinity extraction. The plasmid extracted is identified with after restricted enzyme ScaI and SpeI enzyme action, and positive colony is carried out order-checking qualification, result shows that recombinant expression carrier DBN100002 nucleotides sequence between ScaI and SpeI site is classified as nucleotide sequence shown in SEQ ID NO:2, i.e. Vip3A-01 nucleotide sequence.

According to the method for above-mentioned structure recombinant expression carrier DBN100002, ScaI and the SpeI enzyme action recombinant cloning vector DBN02-T described Vip3A-02 nucleotide sequence cut is inserted expression vector DBNBC-01, obtains recombinant expression carrier DBN100740. Nucleotide sequence in enzyme action and sequence verification recombinant expression carrier DBN100740 is containing nucleotide sequence shown in promising SEQ ID NO:4, i.e. Vip3A-02 nucleotide sequence, described Vip3A-02 nucleotide sequence can connect described prUbi promoter and tNos terminator.

According to the method for above-mentioned structure recombinant expression carrier DBN100002, SpeI and the KasI enzyme action recombinant cloning vector DBN03-T described Vip3A+Cry1Ab nucleotide sequence cut is inserted expression vector DBNBC-01, obtains recombinant expression carrier DBN100736. Nucleotide sequence in enzyme action and sequence verification recombinant expression carrier DBN100736 is containing nucleotide sequence shown in promising SEQ ID NO:10, i.e. Vip3A+Cry1Ab nucleotide sequence, described Vip3A+Cry1Ab nucleotide sequence can connect described prUbi promoter and tNos terminator.

Method according to above-mentioned structure recombinant expression carrier DBN100002, ScaI and SpeI, NcoI and BamHI enzyme action recombinant cloning vector DBN01-T and the DBN04-T described Vip3A-01 nucleotide sequence cut and Cry1Ab-01 nucleotide sequence are inserted expression vector DBNBC-01, obtains recombinant expression carrier DBN100003.Nucleotide sequence in enzyme action and sequence verification recombinant expression carrier DBN100003 is containing nucleotide sequence shown in promising SEQ ID NO:2 and SEQIDNO:12, i.e. Vip3A-01 nucleotide sequence and Cry1Ab-01 nucleotide sequence, described Vip3A-01 nucleotide sequence and described Cry1Ab-01 nucleotide sequence can connect described prUbi promoter and tNos terminator.

3, recombinant expression carrier converts Agrobacterium

Oneself is constructed correct recombinant expression carrier DBN100002, DBN100740, DBN100736 and DBN100003 liquid nitrogen method is transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT:18313-015) in, its conversion condition is: 100 μ L Agrobacterium LBA4404s, 3 μ L plasmid DNA (recombinant expression carrier), it is placed in liquid nitrogen 10 minutes, 37 DEG C of tepidarium 10 minutes, Agrobacterium LBA4404 after converting is inoculated in LB test tube in temperature 28 DEG C, cultivate 2 hours when rotating speed is 200rpm, be applied to the rifampicin containing 50mg/L (Rifampicin) and 100mg/L kanamycin (Kanamycin) LB flat board on until growing positive monoclonal, picking Colony Culture also extracts its plasmid, with restricted enzyme to recombinant expression carrier DBN100002, DBN100740, digestion verification is carried out after DBN100736 and DBN100003 enzyme action, result shows recombinant expression carrier DBN100002, DBN100740, DBN100736 and DBN100003 structure is completely correct.

3rd embodiment, transfer-gen plant acquisition

1, transgenic corn plant is obtained

The Agrobacterium infestation method conventionally adopted, the corn variety of aseptic culture is combined in the rataria of 31 (Z31) and the second embodiment the Agrobacterium described in 3 co-culture, with by the second embodiment 2 recombinant expression carrier DBN100002 built, DBN100740, the T-DNA of DBN100736 and DBN100003 (includes the promoter sequence of Semen Maydis Ubiquitin gene, Vip3A-01 nucleotide sequence, Vip3A-02 nucleotide sequence, Vip3A+Cry1Ab nucleotide sequence, Cry1Ab-01 nucleotide sequence, Hpt gene and Nos terminator sequence) it is transferred in maize chromosome group, obtain the milpa proceeding to Vip3A-01 nucleotide sequence, proceed to the milpa of Vip3A-02 nucleotide sequence, proceed to the milpa of Vip3A+Cry1Ab nucleotide sequence, proceed to the milpa of Vip3A-01-Cry1Ab-01 nucleotide sequence, simultaneously using wild-type corn plant as comparison.

For agriculture bacillus mediated corn transformation, briefly, immature rataria is separated from Semen Maydis, rataria is contacted with agrobacterium suspension, wherein Vip3A-01 nucleotide sequence, Vip3A-02 nucleotide sequence, Vip3A+Cry1Ab nucleotide sequence and Vip3A-01-Cry1Ab-01 nucleotide sequence can be transferred at least one cell (step 1: infect step) of one of rataria by Agrobacterium, in this step, rataria preferably immerses agrobacterium suspension (OD₆₆₀=0.4-0.6, infect culture medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 68.5g/L, glucose 36g/L, acetosyringone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH5.3)) in start inoculation. Rataria and Agrobacterium co-culture one period (3 days) (step 2: co-culture step). Preferably, rataria after infecting step solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 20g/L, glucose 10g/L, acetosyringone (AS) 100mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivate.After co-culturing the stage at this, it is possible to have selective " recovery " step. In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, plant gel 3g/L, pH5.8) at least exist in a kind of oneself know suppress Agrobacterium growth antibiotic (cephamycin), without the selective agent (step 3: recovering step) of vegetable transformant. Preferably, rataria does not have on the solid medium of selective agent cultivate there being antibiotic, to eliminate Agrobacterium and to provide convalescent period for infected cell. Then, the transformed calli (step 4: select step) that the rataria of inoculation is cultivated in the culture medium containing selective agent (hygromycin) and growth selection. Preferably, rataria have the screening solid medium of selective agent (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, hygromycin 50mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, plant gel 3g/L, pH5.8) upper cultivation, causes the cell selective growth converted. Then, callus regeneration becomes plant (step 5: regeneration step), it is preferable that in the culture medium containing selective agent, the callus of growth is above cultivated with aftergrowth at solid medium (MS division culture medium and MS root media).

The resistant calli that screening obtains transfers to described MS division culture medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, hygromycin 50mg/L, plant gel 3g/L, pH5.8), on, differentiation at 25 DEG C, is cultivated. Differentiation seedling out transfers to described MS root media (MS salt 2.15g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, plant gel g/L, pH5.8) on, it is cultured to about 10cm at 25 DEG C high, moves to hot-house culture to solid. In greenhouse, every day cultivates 16 hours at 28 DEG C, cultivates 8 hours at 20 DEG C.

2, Transgenic soybean plants is obtained

The Agrobacterium infestation method conventionally adopted, by in the soybean varieties of aseptic culture yellow 13 cotyledonary node tissue and the second embodiment in Agrobacterium described in 3 co-culture, with by the second embodiment 2 recombinant expression carrier DBN100002 built, DBN100740, the T-DNA of DBN100736 and DBN100003 (includes the promoter sequence of Semen Maydis Ubiquitin gene, Vip3A-01 nucleotide sequence, Vip3A-02 nucleotide sequence, Vip3A+Cry1Ab nucleotide sequence, Cry1Ab-01 nucleotide sequence, Hpt gene and Nos terminator sequence) it is transferred in Semen sojae atricolor chromosome set, obtain the soybean plant strain proceeding to Vip3A-01 nucleotide sequence, proceed to the soybean plant strain of Vip3A-02 nucleotide sequence, proceed to the soybean plant strain of Vip3A+Cry1Ab nucleotide sequence, proceed to the soybean plant strain of Vip3A-01-Cry1Ab-01 nucleotide sequence, simultaneously using Wild-type soy plant as comparison.

For agriculture bacillus mediated transformation of soybean, briefly, by ripe soybean seed at soybean germination culture medium (B5 salt 3.1g/L, B5 vitamin, sucrose 20g/L, agar 8g/L, pH5.6) in sprout, seed is inoculated on germination medium, by following CMC model: temperature 25 ± 1 DEG C; Photoperiod (light dark) is 16/8h. Taking the Semen sojae atricolor aseptic seedling that bud green cotyledonary node place expands after sprouting 4-6 days, under cotyledonary node, 3-4 millimeter place cuts hypocotyl, longitudinally slit cotyledon, removes terminal bud, lateral bud and seminal root.Wound is carried out at cotyledonary node place with the knife back of dissecting knife, the cotyledonary node tissue that wound is crossed is contacted with agrobacterium suspension, wherein Agrobacterium can by Vip3A-01 nucleotide sequence, Vip3A-02 nucleotide sequence, Vip3A+Cry1Ab nucleotide sequence and Vip3A-01-Cry1Ab-01 nucleotide sequence are transferred to cotyledonary node tissue (step 1: infect step) that wound crosses in this step, cotyledonary node tissue preferably immerses agrobacterium suspension (OD660=0.5-0.8, infect culture medium (MS salt 2.15g/L, B5 vitamin, sucrose 20g/L, glucose 10g/L, acetosyringone (AS) 40mg/L, MES (MES) 4g/L, zeatin (ZT) 2mg/L, pH5.3) to start inoculation in. cotyledonary node tissue and Agrobacterium co-culture one period (3 days) (step 2: co-culture step). preferably, cotyledonary node is organized in after infecting step and above cultivates at solid medium (MS salt 4.3g/L, B5 vitamin, sucrose 20g/L, glucose 10g/L, MES (MES) 4g/L, zeatin 2mg/L, agar 8g/L, pH5.6). after co-culturing the stage at this, it is possible to have selective " recovery " step. in " recovery " step, recovery media (B5 salt 3.1g/L, B5 vitamin, MES (MES) 1g/L, sucrose 30g/L, zeatin (ZT) 2mg/L, agar 8g/L, cephamycin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, pH5.6) at least exist in a kind of oneself know suppress Agrobacterium growth antibiotic (cephamycin), without the selective agent (step 3: recovering step) of vegetable transformant. preferably, the piece of tissue of cotyledon node regeneration does not have on the solid medium of selective agent cultivate there being antibiotic, to eliminate Agrobacterium and to provide convalescent period for infected cell. then, the transformed calli (step 4: select step) that the piece of tissue of cotyledon node regeneration is cultivated in the culture medium containing selective agent (hygromycin) and growth selection. preferably, the piece of tissue of cotyledon node regeneration is having the screening solid medium of selective agent (B5 salt 3.1g/L, B5 vitamin, MES (MES) 1g/L, sucrose 30g/L, 6-benzyladenine (6-BAP) 1mg/L, agar 8g/L, cephamycin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, hygromycin 50mg/L, pH5.6) upper cultivation, cause the cell selective growth converted. then, the cell regeneration converted becomes plant (step 5: regeneration step), preferably, in the culture medium containing selective agent, the piece of tissue of the cotyledon node regeneration of growth is above cultivated with aftergrowth at solid medium (B5 division culture medium and B5 root media).

The resistant tissues block that screening obtains transfers to described B5 division culture medium (B5 salt 3.1g/L, B5 vitamin, MES (MES) 1g/L, sucrose 30g/L, zeatin (ZT) 1mg/L, agar 8g/L, cephamycin 150mg/L, glutamic acid 50mg/L, aspartic acid 50mg/L, gibberellins 1mg/L, auxin 1mg/L, hygromycin 50mg/L, pH5.6), on, differentiation at 25 DEG C, is cultivated. Differentiation seedling out transfers to described B5 root media (B5 salt 3.1g/L, B5 vitamin, MES (MES) 1g/L, sucrose 30g/L, agar 8g/L, cephamycin 150mg/L, indole-3-butyric acid (IBA) 1mg/L), on root culture, it is cultured to about 10cm at 25 DEG C high, moves to hot-house culture to solid. In greenhouse, every day cultivates 16 hours at 26 DEG C, cultivates 8 hours at 20 DEG C.

3, Transgenic Sorghum plant is obtained

Sorghum vulgare Pers. method for transformation with reference to MolecularBiologyandGeneticEngineeringISSN2053-5767. Collect the seed of sorghum variety APKI, and rinse for several times with clear water; It is soaked in tween-20 infiltration liquid 5 minutes; Suspend with distilled water afterwards and clean, and dry in fume hood; The surface of the seed 70% (v/v) ethanol disinfection 30 seconds, and then with 0.1% (w/v) HgCl₂Sterilize 6 minutes; Clean 5-6 time with distilled water again; Seed is laid in the culture dish containing MS basis solid medium (pH5.8), culture dish is placed in temperature be 24 ± 2 DEG C, relative humidity be 70%, the photoperiod (light dark) is between the cultivation of 12:12; After 3-5 days, germination, take the outer implant of stem apex and be soaked in Agrobacterium 30 minutes; Take out the outer implant after soaking and be placed on sterilized filter paper; 72 hours are co-cultured under dark condition; The callus sterile water wash containing 500mg/L cephamycin 3-5 time; Callus after cleaning is transferred on inducing culture and cultivates 7 days; Transfer to 2-3 week in screening culture medium, repeat screening 3 times; Kanamycin-resistant callus tissue is transferred on regeneration culture medium; Regenerate blade etc., seedling is moved on root media, transplant to greenhouse after taking root. Culture medium prescription is with reference to MolecularBiologyandGeneticEngineeringISSN2053-5767, and wherein selective agent is used by transgene carrier in the present invention, is replaced by hygromycin. The sorghum plant thereby is achieved the sorghum plant proceeding to Vip3A-01 nucleotide sequence, proceeding to Vip3A-02 nucleotide sequence, the sorghum plant proceeding to Vip3A+Cry1Ab nucleotide sequence and proceed to the sorghum plant of Vip3A-01-Cry1Ab-01 nucleotide sequence; Simultaneously using wild type sorghum plant as comparison.

4th embodiment, verify transfer-gen plant with TaqMan

The blade of the milpa take the milpa proceeding to Vip3A-01 nucleotide sequence respectively, proceeding to Vip3A-02 nucleotide sequence, the milpa proceeding to Vip3A+Cry1Ab nucleotide sequence and the milpa that proceeds to Vip3A-01-Cry1Ab-01 nucleotide sequence is about 100mg as sample, extract its genomic DNA with the DNeasyPlantMaxiKit of Qiagen, detected the copy number of Vip3A gene and Cry1Ab gene by Taqman fluorescence probe quantitative PCR method. Simultaneously using wild-type corn plant as comparison, carry out detection according to the method described above and analyze. Experiment sets 3 repetitions, averages.

The concrete grammar of detection Vip3A gene and Cry1Ab gene copy number is as follows:

Step 11, take the milpa proceeding to Vip3A-01 nucleotide sequence respectively, the milpa proceeding to Vip3A-02 nucleotide sequence, the milpa proceeding to Vip3A+Cry1Ab nucleotide sequence, the milpa proceeding to Vip3A-01-Cry1Ab-01 nucleotide sequence and wild-type corn plant each 100mg of blade, being ground into homogenate with liquid nitrogen in mortar respectively, each sample takes 3 repetitions;

Step 12, use Qiagen DNeasyPlantMiniKit extract above-mentioned sample genomic DNA, concrete grammar is with reference to its product description;

Step 13, measure the genomic DNA concentration of above-mentioned sample with NanoDrop2000 (ThermoScientific);

Step 14, adjust the genomic DNA concentration of above-mentioned sample to same concentration value, described concentration value range for 80-100ng/ μ L;

Step 15, employing Taqman fluorescence probe quantitative PCR method identify the copy number of sample, using the sample through identifying known copy number as standard substance, using the sample of wild-type corn plant as comparison, and the repetition of 3, each sample, take its meansigma methods;Fluorescence quantification PCR primer and probe sequence be respectively:

Following primer and probe are used for detecting Vip3A-01 and Vip3A-02 nucleotide sequence:

Primer 1:ATTCTCGAAATCTCCCCTAGCG is such as shown in SEQ ID NO:16;

Primer 2: GCTGCCAGTGGATGTCCAG is such as shown in SEQ ID NO:17;

Probe 1:CTCCTGAGCCCCGAGCTGATTAACACC is such as shown in SEQ ID NO:18;

Following primer and probe are used for detecting Vip3A+Cry1Ab nucleotide sequence:

Primer 3:CCGAGCTTCATCGACTACTTCAAC is such as shown in SEQ ID NO:19;

Primer 4:CTCGTCCAGGGTCAGGTCG is such as shown in SEQ ID NO:20;

Probe 2:CCACCGGCATCAAGGACATCATGAAC is such as shown in SEQ ID NO:21;

Following primer and probe are used for detecting Cry1Ab-01 nucleotide sequence:

Primer 5:TGCGTATTCAATTCAACGACATG is such as shown in SEQ ID NO:22;

Primer 6:CTTGGTAGTTCTGGACTGCGAAC is such as shown in SEQ ID NO:23;

Probe 3:CAGCGCCTTGACCACAGCTATCCC is such as shown in SEQ ID NO:24;

PCR reaction system is:

Described 50 × primer/probe mixture comprises each 45 μ l of every kind of primer, the probe 50 μ l of 100 μMs of concentration and the 860 μ l1 × TE buffer of 1mM concentration, and at 4 DEG C, is housed in amber tube.

PCR reaction condition is:

Utilize SDS2.3 software (AppliedBiosystems) analytical data.

Test result indicate that, all oneself is incorporated in the chromosome set of the milpa detected for Vip3A-01 nucleotide sequence, Vip3A-02 nucleotide sequence, Vip3A+Cry1Ab nucleotide sequence and Vip3A-01-Cry1Ab-01 nucleotide sequence, and proceeds to the milpa of Vip3A-01 nucleotide sequence, proceeds to the milpa of Vip3A-02 nucleotide sequence, proceed to the milpa of Vip3A+Cry1Ab nucleotide sequence and proceed to the milpa of Vip3A-01-Cry1Ab-01 nucleotide sequence and all obtain the transgenic corn plant of single copy.

According to the above-mentioned TaqMan method verifying transgenic corn plant, Transgenic soybean plants and Transgenic Sorghum plant are carried out detection and analyzes. test result indicate that, Vip3A-01 nucleotide sequence, Vip3A-02 nucleotide sequence, all oneself is incorporated in the chromosome set of soybean plant strain and the sorghum plant detected respectively for Vip3A+Cry1Ab nucleotide sequence and Vip3A-01-Cry1Ab-01 nucleotide sequence, and proceed to the soybean plant strain of Vip3A-01 nucleotide sequence, proceed to the soybean plant strain of Vip3A-02 nucleotide sequence, proceed to the soybean plant strain of Vip3A+Cry1Ab nucleotide sequence, proceed to the soybean plant strain of Vip3A-01-Cry1Ab-01 nucleotide sequence, proceed to the sorghum plant of Vip3A-01 nucleotide sequence, proceed to the sorghum plant of Vip3A-02 nucleotide sequence, the sorghum plant proceeding to Vip3A+Cry1Ab nucleotide sequence and the sorghum plant proceeding to Vip3A-01-Cry1Ab-01 nucleotide sequence all obtain the transfer-gen plant of single copy.

5th embodiment, transfer-gen plant insect resistant effect detection

The milpa of Vip3A-01 nucleotide sequence will be proceeded to, proceed to the milpa of Vip3A-02 nucleotide sequence, proceed to the milpa of Vip3A+Cry1Ab nucleotide sequence, proceed to the milpa of Vip3A-01-Cry1Ab-01 nucleotide sequence; The soybean plant strain, the soybean plant strain proceeding to Vip3A-02 nucleotide sequence that proceed to Vip3A-01 nucleotide sequence, proceed to the soybean plant strain of Vip3A+Cry1Ab nucleotide sequence, proceed to the soybean plant strain of Vip3A-01-Cry1Ab-01 nucleotide sequence;The sorghum plant, the sorghum plant proceeding to Vip3A-02 nucleotide sequence that proceed to Vip3A-01 nucleotide sequence, proceed to the sorghum plant of Vip3A+Cry1Ab nucleotide sequence and proceed to the sorghum plant of Vip3A-01-Cry1Ab-01 nucleotide sequence; Corresponding wild-type corn plant, soybean plant strain and sorghum plant, and be accredited as not genetically modified milpa, soybean plant strain and sorghum plant through Taqman dichocrocis punctiferalis is carried out insect resistant effect detection.

1, the insect resistant effect detection of transgenic corn plant

Take the milpa proceeding to Vip3A-01 nucleotide sequence respectively, proceed to the milpa of Vip3A-02 nucleotide sequence, proceed to the milpa of Vip3A+Cry1Ab nucleotide sequence, proceed to the milpa of Vip3A-01-Cry1Ab-01 nucleotide sequence, wild-type corn plant and be accredited as the fresh blade of not genetically modified milpa (expansion tender leaf) through Taqman, totally and with gauze, the water on blade is blotted with aseptic water washing, then maize leaf is cut into the strip of about 1cm × 2cm, take 1 cut after strip blade put on the moisturizing filter paper bottom round plastic culture dish, add a cover after each culture dish is put 10 dichocrocis punctiferalis (newly hatched larvae), at temperature 22-26 DEG C, relative humidity 70%-80%, after placing 3 days when photoperiod (light dark) 16:8, according to dichocrocis punctiferalis larvae development progress, mortality rate and three indexs of blade injury rate, obtain resistance total score (full marks 300 points): resistance total score=100 × mortality rate+[100 × mortality rate+90 × (just incubate borer population/connect worm sum)+60 × (just incubate-negative control borer population/connect worm sum)+10 × (negative control borer population/connect worm sum)]+100 × (1-blade injury rate). proceed to totally 3 transformation event strains (S1, S2 and S3) of Vip3A-01 nucleotide sequence, proceed to totally 3 transformation event strains (S4, S5 and S6) of Vip3A-02 nucleotide sequence, proceed to totally 3 transformation event strains (S7, S8 and S9) of Vip3A+Cry1Ab nucleotide sequence, proceed to totally 3 transformation event strains (S10, S11 and S12) of Vip3A-01-Cry1Ab-01 nucleotide sequence, it is accredited as not genetically modified (NGM1) totally 1 strain, (CK1) of wild type totally 1 strain through Taqman, 3 strains are selected to test from each strain, multiple 6 times of every plant weight. shown in result such as table 1 and Fig. 3.

The pest-resistant experimental result of table 1, transgenic corn plant inoculation dichocrocis punctiferalis

The result of table 1 shows: the milpa proceeding to Vip3A-01 nucleotide sequence, the milpa proceeding to Vip3A-02 nucleotide sequence, proceeds to the milpa of Vip3A+Cry1Ab nucleotide sequence and proceeds to the milpa of Vip3A-01-Cry1Ab-01 nucleotide sequence dichocrocis punctiferalis is respectively provided with good insecticidal effect, the average mortality of dichocrocis punctiferalis is all more than 50%, and its resistance total score is also all more than 240 points; The insecticidal effect of dichocrocis punctiferalis is significantly higher than the milpa proceeding to Vip3A-01 nucleotide sequence and proceeds to the milpa of Vip3A-02 nucleotide sequence by the milpa simultaneously proceeding to Vip3A+Cry1Ab nucleotide sequence and the milpa proceeding to Vip3A-01-Cry1Ab-01 nucleotide sequence, and the average mortality of dichocrocis punctiferalis may be up to 100%; And be accredited as the resistance total score of not genetically modified milpa and wild-type corn plant through Taqman and be typically in about 30 points.

The result of Fig. 3 shows: compared with wild-type corn plant, the milpa proceeding to Vip3A-01 nucleotide sequence, the milpa proceeding to Vip3A-02 nucleotide sequence, proceed to the milpa of Vip3A+Cry1Ab nucleotide sequence and to proceed to the milpa of Vip3A-01-Cry1Ab-01 nucleotide sequence obvious to the prevention effect of dichocrocis punctiferalis newly hatched larvae, the larva of a small amount of survival is also affected by obvious suppression, larval growth is grown and is delayed, show extremely weak vitality simultaneously, generally cannot survive under natural environment;And proceed to the milpa of Vip3A-01 nucleotide sequence, proceed to the milpa of Vip3A-02 nucleotide sequence, proceed to the milpa of Vip3A+Cry1Ab nucleotide sequence and proceed to the milpa of Vip3A-01-Cry1Ab-01 nucleotide sequence and be limited only by slight damage, its blade injury rate is all below 5%.

The milpa, the milpa proceeding to Vip3A-02 nucleotide sequence that thus prove to proceed to Vip3A-01 nucleotide sequence, proceeding to the milpa of Vip3A+Cry1Ab nucleotide sequence and proceed to the milpa of Vip3A-01-Cry1Ab-01 nucleotide sequence and all demonstrate the activity suppressing dichocrocis punctiferalis, this activity is enough to the growth to dichocrocis punctiferalis and produces ill effect so that it is controlled in field.

2, the insect resistant effect detection of Transgenic soybean plants

Take the soybean plant strain proceeding to Vip3A-01 nucleotide sequence respectively, proceed to the soybean plant strain of Vip3A-02 nucleotide sequence, proceed to the soybean plant strain of Vip3A+Cry1Ab nucleotide sequence, proceed to the soybean plant strain of Vip3A-01-Cry1Ab-01 nucleotide sequence, Wild-type soy plant and be accredited as the fresh blade of not genetically modified soybean plant strain (expansion tender leaf) through Taqman, totally and with gauze, the water on blade is blotted with aseptic water washing, then soybean leaves is cut into the strip of about 1cm × 2cm, take 1 cut after strip blade put on the moisturizing filter paper bottom round plastic culture dish, add a cover after each culture dish is put 10 dichocrocis punctiferalis (newly hatched larvae), at temperature 22-26 DEG C, relative humidity 70%-80%, after placing 3 days when photoperiod (light dark) 16:8, according to dichocrocis punctiferalis larvae development progress, mortality rate and three indexs of blade injury rate, obtain resistance total score (full marks 300 points): resistance total score=100 × mortality rate+[100 × mortality rate+90 × (just incubate borer population/connect worm sum)+60 × (just incubate-negative control borer population/connect worm sum)+10 × (negative control borer population/connect worm sum)]+100 × (1-blade injury rate). proceed to totally 3 transformation event strains (S13, S14 and S15) of Vip3A-01 nucleotide sequence, proceed to totally 3 transformation event strains (S16, S17 and S18) of Vip3A-02 nucleotide sequence, proceed to totally 3 transformation event strains (S19, S20 and S21) of Vip3A+Cry1Ab nucleotide sequence, proceed to totally 3 transformation event strains (S22, S23 and S24) of Vip3A-01-Cry1Ab-01 nucleotide sequence, it is accredited as not genetically modified (NGM2) totally 1 strain, (CK2) of wild type totally 1 strain through Taqman, 3 strains are selected to test from each strain, multiple 6 times of every plant weight. shown in result such as table 2 and Fig. 4.

The pest-resistant experimental result of table 2, Transgenic soybean plants inoculation dichocrocis punctiferalis

The result of table 2 shows: the soybean plant strain proceeding to Vip3A-01 nucleotide sequence, the soybean plant strain proceeding to Vip3A-02 nucleotide sequence, proceeds to the soybean plant strain of Vip3A+Cry1Ab nucleotide sequence and proceeds to the soybean plant strain of Vip3A-01-Cry1Ab-01 nucleotide sequence dichocrocis punctiferalis is respectively provided with good insecticidal effect, the average mortality of dichocrocis punctiferalis is all more than 50%, and its resistance total score is also all more than 240 points; The insecticidal effect of dichocrocis punctiferalis is significantly higher than the soybean plant strain proceeding to Vip3A-01 nucleotide sequence and proceeds to the soybean plant strain of Vip3A-02 nucleotide sequence by the soybean plant strain simultaneously proceeding to Vip3A+Cry1Ab nucleotide sequence and the soybean plant strain proceeding to Vip3A-01-Cry1Ab-01 nucleotide sequence, and the average mortality of dichocrocis punctiferalis may be up to 100%;And be accredited as the resistance total score of not genetically modified soybean plant strain and Wild-type soy plant through Taqman and be typically in about 50 points.

The result of Fig. 4 shows: compared with Wild-type soy plant, the soybean plant strain proceeding to Vip3A-01 nucleotide sequence, the soybean plant strain proceeding to Vip3A-02 nucleotide sequence, proceed to the soybean plant strain of Vip3A+Cry1Ab nucleotide sequence and to proceed to the soybean plant strain of Vip3A-01-Cry1Ab-01 nucleotide sequence obvious to the prevention effect of dichocrocis punctiferalis newly hatched larvae, the larva of a small amount of survival is also affected by obvious suppression, larval growth is grown slowly, show extremely weak vitality simultaneously, generally cannot survive under natural environment; And proceed to the soybean plant strain of Vip3A-01 nucleotide sequence, proceed to the soybean plant strain of Vip3A-02 nucleotide sequence, proceed to the soybean plant strain of Vip3A+Cry1Ab nucleotide sequence and proceed to the soybean plant strain of Vip3A-01-Cry1Ab-01 nucleotide sequence and be generally limited only by slight damage, its blade injury rate is all below 5%.

The soybean plant strain, the soybean plant strain proceeding to Vip3A-02 nucleotide sequence that thus prove to proceed to Vip3A-01 nucleotide sequence, proceeding to the soybean plant strain of Vip3A+Cry1Ab nucleotide sequence and proceed to the soybean plant strain of Vip3A-01-Cry1Ab-01 nucleotide sequence and all demonstrate the activity suppressing dichocrocis punctiferalis, this activity is enough to the growth to dichocrocis punctiferalis and produces ill effect so that it is controlled in field.

3, the insect resistant effect detection of Transgenic Sorghum plant

Take the sorghum plant proceeding to Vip3A-01 nucleotide sequence respectively, proceed to the sorghum plant of Vip3A-02 nucleotide sequence, proceed to the sorghum plant of Vip3A+Cry1Ab nucleotide sequence, proceed to the sorghum plant of Vip3A-01-Cry1Ab-01 nucleotide sequence, wild type sorghum plant and be accredited as the fresh blade of not genetically modified sorghum plant (expansion tender leaf) through Taqman, totally and with gauze, the water on blade is blotted with aseptic water washing, then Sorghum Leaves is cut into the strip of about 1cm × 2cm, take 1 cut after strip blade put on the moisturizing filter paper bottom round plastic culture dish, each culture dish is put 10 dichocrocis punctiferalis (newly hatched larvae), after worm examination culture dish is added a cover, at temperature 22-26 DEG C, relative humidity 70%-80%, after placing 3 days when photoperiod (light dark) 16:8, according to dichocrocis punctiferalis larvae development progress, mortality rate and three indexs of blade injury rate, obtain resistance total score (full marks 300 points): resistance total score=100 × mortality rate+[100 × mortality rate+90 × (just incubate borer population/connect worm sum)+60 × (just incubate-negative control borer population/connect worm sum)+10 × (negative control borer population/connect worm sum)]+100 × (1-blade injury rate). proceed to totally 3 transformation event strains (S25, S26 and S27) of Vip3A-01 nucleotide sequence, proceed to totally 3 transformation event strains (S28, S29 and S30) of Vip3A-02 nucleotide sequence, proceed to totally 3 transformation event strains (S31, S32 and S33) of Vip3A+Cry1Ab nucleotide sequence, proceed to totally 3 transformation event strains (S34, S35 and S36) of Vip3A-01-Cry1Ab-01 nucleotide sequence, it is accredited as not genetically modified (NGM3) totally 1 strain, (CK3) of wild type totally 1 strain through Taqman, 3 strains are selected to test from each strain, multiple 6 times of every plant weight. result is as shown in table 3.

The pest-resistant experimental result of dichocrocis punctiferalis inoculated by table 3, Transgenic Sorghum plant

The result of table 3 shows: the sorghum plant proceeding to Vip3A-01 nucleotide sequence, the sorghum plant proceeding to Vip3A-02 nucleotide sequence, proceeds to the sorghum plant of Vip3A+Cry1Ab nucleotide sequence and proceeds to the sorghum plant of Vip3A-01-Cry1Ab-01 nucleotide sequence dichocrocis punctiferalis is respectively provided with good insecticidal effect, the average mortality of dichocrocis punctiferalis is all more than 50%, and its resistance total score is also all more than 240 points;The insecticidal effect of dichocrocis punctiferalis is significantly higher than the sorghum plant proceeding to Vip3A-01 nucleotide sequence and proceeds to the sorghum plant of Vip3A-02 nucleotide sequence by the sorghum plant simultaneously proceeding to Vip3A+Cry1Ab nucleotide sequence and the sorghum plant proceeding to Vip3A-01-Cry1Ab-01 nucleotide sequence, and the average mortality of dichocrocis punctiferalis may be up to 100%; And be accredited as the resistance total score of not genetically modified sorghum plant and wild type sorghum plant through Taqman and be typically in about 80 points.

Meanwhile, compared with wild type sorghum plant, the sorghum plant proceeding to Vip3A-01 nucleotide sequence, the sorghum plant proceeding to Vip3A-02 nucleotide sequence, proceed to the sorghum plant of Vip3A+Cry1Ab nucleotide sequence and to proceed to the sorghum plant of Vip3A-01-Cry1Ab-01 nucleotide sequence obvious to the prevention effect of dichocrocis punctiferalis newly hatched larvae, the larva of a small amount of survival is also affected by obvious suppression, larval growth is grown slowly, show extremely weak vitality simultaneously, generally cannot survive under natural environment; And proceed to the sorghum plant of Vip3A-01 nucleotide sequence, proceed to the sorghum plant of Vip3A-02 nucleotide sequence, proceed to the sorghum plant of Vip3A+Cry1Ab nucleotide sequence and proceed to the sorghum plant of Vip3A-01-Cry1Ab-01 nucleotide sequence and be generally limited only by slight damage, its blade injury rate is all below 10%.

The sorghum plant, the sorghum plant proceeding to Vip3A-02 nucleotide sequence that thus prove to proceed to Vip3A-01 nucleotide sequence, proceeding to the sorghum plant of Vip3A+Cry1Ab nucleotide sequence and proceed to the sorghum plant of Vip3A-01-Cry1Ab-01 nucleotide sequence and all demonstrate the activity suppressing dichocrocis punctiferalis, this activity is enough to the growth to dichocrocis punctiferalis and produces ill effect so that it is controlled in field.

Above-mentioned experimental result also shows to proceed to the milpa of Vip3A-01 nucleotide sequence, proceed to the milpa of Vip3A-02 nucleotide sequence, proceed to the milpa of Vip3A+Cry1Ab nucleotide sequence, proceed to the milpa of Vip3A-01-Cry1Ab-01 nucleotide sequence, proceed to the soybean plant strain of Vip3A-01 nucleotide sequence, proceed to the soybean plant strain of Vip3A-02 nucleotide sequence, proceed to the soybean plant strain of Vip3A+Cry1Ab nucleotide sequence, proceed to the soybean plant strain of Vip3A-01-Cry1Ab-01 nucleotide sequence, proceed to the sorghum plant of Vip3A-01 nucleotide sequence, proceed to the sorghum plant of Vip3A-02 nucleotide sequence, the sorghum plant proceeding to Vip3A+Cry1Ab nucleotide sequence and the sorghum plant that proceeds to Vip3A-01-Cry1Ab-01 nucleotide sequence to the control/preventing and treating of dichocrocis punctiferalis apparently because plant itself can produce Vip3A albumen, so, well known to those skilled in the art, according to the Vip3A albumen identical toxic action to dichocrocis punctiferalis, the transfer-gen plant that can produce similar expressed Vip3A albumen can be used in controlling/preventing and treating the harm of dichocrocis punctiferalis. in the present invention, Vip3A albumen includes but not limited to the Vip3A albumen of given aminoacid sequence in detailed description of the invention, transfer-gen plant can also produce at least one the second insect-killing protein being different from Vip3A albumen simultaneously, such as Vip albuminoid, Cry albuminoid.

In sum, the purposes of insecticidal proteins of the present invention controls dichocrocis punctiferalis insect by producing to kill the Vip3A albumen of dichocrocis punctiferalis in plant; Compared with the cultural control method that prior art uses, chemical prevention and control method and physical control method; the present invention plant is carried out the time of infertility, whole plant protect against the infringement controlling dichocrocis punctiferalis insect; and pollution-free, noresidue, effect stability, thoroughly, simple, convenient, economical.

It should be noted last that, above example is only in order to illustrate technical scheme and unrestricted, although the present invention being described in detail with reference to preferred embodiment, it will be understood by those within the art that, technical scheme can be modified or equivalent replacement, without deviating from the spirit and scope of technical solution of the present invention.

Claims (20)

1. the method controlling dichocrocis punctiferalis insect, it is characterised in that include by dichocrocis punctiferalis insect at least with Vip3A protein contact, wherein said dichocrocis punctiferalis insect not with Cry1Fa protein contact.

2. the method controlling dichocrocis punctiferalis insect according to claim 1, it is characterized in that, described Vip3A albumen is present in the host cell at least producing described Vip3A albumen, described dichocrocis punctiferalis insect by ingest described host cell at least with described Vip3A protein contact.

3. the method controlling dichocrocis punctiferalis insect according to claim 2, it is characterized in that, described Vip3A albumen is present in the antibacterial or transgenic plant at least producing described Vip3A albumen, described dichocrocis punctiferalis insect by ingest described antibacterial or described transgenic plant tissue at least with described Vip3A protein contact, after contact, the growth of described dichocrocis punctiferalis insect is suppressed and/or causes death, to realize dichocrocis punctiferalis is endangered the control of plant.

4. the method controlling dichocrocis punctiferalis insect according to claim 3, it is characterised in that described transgenic plant may be at any period of duration.

5. according to claim 3 control dichocrocis punctiferalis insect method, it is characterised in that described transgenic plant be organized as root, blade, stem stalk, fruit, tassel, female fringe, flower pesticide or filigree.

6. the method controlling dichocrocis punctiferalis insect according to claim 3, it is characterised in that the described control that dichocrocis punctiferalis endangers plant does not change because of the change of plantation place and/or implantation time.

7. the method controlling dichocrocis punctiferalis insect according to any one of claim 3 to 6, it is characterised in that described plant is Semen Maydis, Helianthi, Semen sojae atricolor, Sorghum vulgare Pers., Semen Castaneae, Fructus Persicae, Punica granatum L., Fructus Mali pumilae, Fructus Lycopersici esculenti, Fructus Solani melongenae, turfgrass, Cotton Gossypii, Brassica campestris L or Fructus Fragariae Ananssae.

8. the method controlling dichocrocis punctiferalis insect according to any one of claim 2 to 7, it is characterised in that the step before described contact procedure is the plantation plant containing the polynucleotide encoding described Vip3A albumen.

9. the method controlling dichocrocis punctiferalis insect according to any one of claim 1 to 8, it is characterised in that the aminoacid sequence of described Vip3A albumen has the aminoacid sequence shown in SEQIDNO:1 or SEQIDNO:3 or SEQIDNO:5.

10. the method controlling dichocrocis punctiferalis insect according to claim 9, it is characterised in that the nucleotide sequence of described Vip3A albumen has the nucleotide sequence shown in SEQIDNO:2 or SEQIDNO:4 or SEQIDNO:6.

11. the method controlling dichocrocis punctiferalis insect according to any one of claim 2 to 10, it is characterized in that, described plant can also include the second nucleotide of at least one nucleotide being different from and encoding described Vip3A albumen, and described the second nucleotide does not encode Cry1Fa albumen.

12. the method controlling dichocrocis punctiferalis insect according to claim 11, it is characterised in that described the second nucleotide coding Cry class insect-killing protein, Vip class insect-killing protein, protease inhibitor, agglutinin, α-amylase or peroxidase.

13. the method controlling dichocrocis punctiferalis insect according to claim 12, it is characterised in that described the second nucleotide coding Cry1Ab albumen.

14. the method controlling dichocrocis punctiferalis insect according to claim 13, it is characterised in that the aminoacid sequence of described Cry1Ab albumen has the aminoacid sequence shown in SEQIDNO:7 or SEQIDNO:11.

15. according to claim 14 control dichocrocis punctiferalis insect method, it is characterised in that the nucleotide sequence of described Cry1Ab albumen have shown in SEQIDNO:8 or SEQIDNO:12 nucleotide sequence.

16. the method controlling dichocrocis punctiferalis insect according to claim 11, it is characterised in that described the second nucleotide is suppress the dsRNA of important gene in target insect pests.

17. a Vip3A protein controls the purposes of dichocrocis punctiferalis insect.

18. the method producing to control the plant of dichocrocis punctiferalis insect, it is characterised in that including the polynucleotide sequence introducing coding Vip3A albumen in the genome of described plant, the described plant after introducing does not produce Cry1Fa albumen.

19. the method producing to control the plant seed of dichocrocis punctiferalis insect, it is characterised in that include the first plant and the second plant hybridization that method described in claim 18 are obtained, thus the seed of the polynucleotide sequence that generation is containing coding Vip3A albumen.

20. the method cultivating the plant controlling dichocrocis punctiferalis insect, it is characterised in that including:

Planting at least one propagulum, the genome of described propagulum includes the polynucleotide sequence of coding Vip3A albumen, and does not include the polynucleotide sequence of coding Cry1Fa albumen;

Described propagulum is made to grow up to plant;

Make the growth when artificial vaccination dichocrocis punctiferalis insect and/or dichocrocis punctiferalis insect naturally-occurring endanger of described plant, results not there is the plant of the polynucleotide sequence of coding Vip3A albumen with other compared with there is the plant injury weakened and/or there is the plant of plant products of increase.